WO2004090101A2 - Epoxyde hydrolases, acides nucleiques les codant et procedes de production et d'utilisation correspondants - Google Patents

Epoxyde hydrolases, acides nucleiques les codant et procedes de production et d'utilisation correspondants Download PDF

Info

Publication number
WO2004090101A2
WO2004090101A2 PCT/US2004/010312 US2004010312W WO2004090101A2 WO 2004090101 A2 WO2004090101 A2 WO 2004090101A2 US 2004010312 W US2004010312 W US 2004010312W WO 2004090101 A2 WO2004090101 A2 WO 2004090101A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sequence
polypeptide
epoxide hydrolase
isolated
Prior art date
Application number
PCT/US2004/010312
Other languages
English (en)
Other versions
WO2004090101A3 (fr
Inventor
Lishan Zhao
Bin Han
David Weiner
Original Assignee
Diversa Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Diversa Corporation filed Critical Diversa Corporation
Publication of WO2004090101A2 publication Critical patent/WO2004090101A2/fr
Publication of WO2004090101A3 publication Critical patent/WO2004090101A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • TECHNICAL FIELD This invention relates to molecular and cellular biology and biochemistry.
  • the invention is directed to polypeptides having epoxide hydrolase activity, polynucleotides encoding the polypeptides, and methods for making and using these polynucleotides and polypeptides.
  • the polypeptides ofthe invention can be used as epoxide hydrolases to catalyze the hydrolysis of epoxides and arene oxides to their corresponding diols.
  • Epoxide hydrolases catalyze the hydrolysis of epoxides and arene oxides to their corresponding diols.
  • Epoxide hydrolases from microbial sources are highly versatile biocatalysts for the asymmetric hydrolysis of epoxides on a preparative scale. Besides kinetic resolution, which furnishes the corresponding vicinal diol and remaining non-hydrolyzed epoxide in nonracemic form, enantioconvergent processes are possible. These are highly attractive as they lead to the formation of a single enantiomeric diol from a racemic oxirane, see, e.g., Steinreiber (2001) Curr. Opin. Biotechnol. 12:552-558.
  • Microsomal epoxide hydrolases are biotransformation enzymes that catalyze the conversion of a broad array of xenobiotic epoxide substrates to more polar diol metabolites, see, e.g., Omiecinski (2000) Toxicol. Lett. 112-113:365-370.
  • Microsomal epoxide hydrolases catalyze the addition of water to epoxides in a two-step reaction involving initial attack of an active site carboxylate on the oxirane to give an ester intermediate followed by hydrolysis ofthe ester.
  • Soluble epoxide hydrolase play a role in the biosynthesis of inflammation mediators, see, e.g., Morisseau (1999) Proc. Natl. Acad. Sci. USA 96:8849-8854.
  • Chiral molecules including alcohols, a-hydroxy acids and epoxides, are important for the synthesis of pharmaceuticals, agrochemicals, as well as many fine chemicals.
  • a major challenge in modern organic chemistry is to generate such compounds in high yields, with high stereo- and regioselectivities.
  • Enantiopure epoxides are versatile synthons for the synthesis of numerous pharmaceuticals, agrochemicals and other high value compounds.
  • EHs epoxide hydrolases
  • epoxide hydrolases have shown promise as biocatalysts for the preparation of chiral epoxides and vicinal diols. They exhibit high enantioselectivities for their substrates, and can be effectively used in the resolution of racemic epoxides prepared by chemical means.
  • the selective hydrolysis of a racemic epoxide can generate both the corresponding diols and the unreacted epoxides with high enantiomeric excess (ee) values.
  • the following significant limitations urgently need to be overcome: (1) the number of enzymes available is small; and (2) the scope of substrates is limited.
  • Enzyme-based processes have been gradually replacing many conventional chemical-based methods.
  • a current limitation to more widespread industrial use is primarily due to the relatively small number of commercially available enzymes. Only approximately 300 enzymes (excluding DNA modifying enzymes) are at present commercially available from the greater than 3000 non-DNA-modifying enzyme activities thus far described.
  • Enzymes have evolved by selective pressure to perform very specific biological functions within the milieu of a living organism, under conditions of temperature, pH and salt concentration. For the most part, the non-DNA modifying enzyme activities thus far identified have been isolated from mesophilic organisms, which represent a very small fraction ofthe available phylogenetic diversity. The dynamic field of biocatalysis takes on a new dimension with the help of enzymes isolated from microorganisms that thrive in extreme environments.
  • such enzymes must function at temperatures above 100°C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0°C in arctic waters, in the saturated salt environment ofthe Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge.
  • the invention provides not only a source of materials for the development of biologies, therapeutics, and enzymes for industrial applications, but also provides a new materials for further processing by, for example, directed evolution and mutagenesis to develop molecules or polypeptides modified for particular activity, specificity or conditions.
  • new enzymes for industrial use there has been a dramatic increase in the need for bioactive compounds with novel activities. This demand has arisen largely from changes in worldwide demographics coupled with the clear and increasing trend in the number of pathogenic organisms that are resistant to currently available antibiotics.
  • the invention can be used to obtain and identify polynucleotides and related sequence specific information from, for example, infectious microorganisms present in the environment such as, for example, in the gut of various macroorganisms.
  • Identifying novel enzymes in an environmental sample is one solution to this problem.
  • the invention provides methods, compositions and sources for the development of biologies, diagnostics, therapeutics, and compositions for industrial applications.
  • Chiral epoxides and diols are key building blocks for the synthesis of pharmaceuticals.
  • the epoxide group is readily transformed into a wide range of derivatives by acid or base-catalyzed ring opening reactions, while the diols similarly can be converted into a diverse range of structures.
  • chiral epoxides and diols are an important part ofthe chiral intermediate market. Unfortunately there are no generally effective commercial methods to access these important chiral molecules.
  • Several elegant chemical methods have been developed to prepare chiral epoxides and diols from alkenes by asymmetric epoxidation or dihydroxylation.
  • EHs are ubiquitous in nature. EHs have been found in all mammalian species tested, with the mammalian liver microsomal epoxide hydrolase ( EH) being the best studied (see, e.g., Armstrong, R. N. Drug Metab. Rev. 1999, 31, 71-86.) Most mammalian EHs are involved in the detoxification of epoxides, while a few are engaged in the biosynthesis of hormones. Although mammalian EHs have been known for decades, most studies were focused on their biological role and mechanism.
  • EHs have been found from various bacteria, yeast, and fungi (see, e.g., Svaving (1998) Enz. Microbiol. Technol. 22:19-26).
  • bacterial EHs include those isolated from Agrob ⁇ cterium r ⁇ diob ⁇ cter, Rhodococcus sp., Cot ⁇ neb ⁇ cterium sp., Mycob ⁇ cterium p ⁇ r ⁇ ffinicum, Noc ⁇ rdi ⁇ sp., Pseudomon ⁇ s NRRL B-2994, and some Streptomyces strains.
  • Fungal EHs were also found in Aspergillus niger, Helminihosporum s ⁇ tivum, Diploid ⁇ gossypin ⁇ , Be ⁇ uveri ⁇ sulfurescens, and some Furs ⁇ rium strains.
  • the best-known yeast EH is Rhodotorul ⁇ glutinis enzyme. Almost all of these enzymes were discovered during the screening of available strains with various epoxide substrates, and only a handful of them were further investigated at the genetic level. Some of these enzymes showing good enantioselectivity and potentially being readily available through fermentation.
  • the scope of substrates recognized by microbial epoxide hydrolases need to be expanded and discovery of novel EHs should offer a viable solution.
  • EHs are cofactor-free, 'easy-to-use 5 catalysts. Biochemical studies have shown that EHs, like other well-recognized hydro lytic enzymes such as Upases and esterases, require neither prosthetic groups nor metal ions for activity. Current proposed mechanism by which EHs operate also bears similarity to that of esterases in that a covalent adduct is formed between the enzyme active site and the substrate during the catalytic cycle. Site-directed mutagenesis studies and structural data of a bacterial enzyme (A. radiobacter) suggested an active site Asp as the nucleophile.
  • the invention provides isolated or recombinant nucleic acids comprising a nucleic acid sequence having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary nucleic acid ofthe invention, e.g., SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO:85, over a region of at least about 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500,
  • nucleic acids ofthe invention include isolated or recombinant nucleic acids comprising a nucleic acid sequence as set forth in, SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO:85, and subsequences thereof, e.g., at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, or more.
  • Exemplary nucleic acids ofthe invention also include isolated or recombinant nucleic acids encoding a polypeptide having a sequence as set forth in SEQ ID NO:82, SEQ ID NO: 84, or SEQ ID NO:86, and subsequences thereof and variants thereof.
  • the polypeptide has an epoxide hydrolase activity.
  • the invention also provides epoxide hydrolase-encoding nucleic acids with a common novelty in that they are derived from mixed cultures.
  • the invention provides epoxide hydrolase-encoding nucleic acids isolated from mixed cultures comprising a nucleic acid ofthe invention, e.g., a sequence having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary nucleic acid ofthe invention, e.g.
  • the invention provides epoxide hydrolase-encoding nucleic acids isolated from mixed cultures comprising a nucleic acid ofthe invention, e.g., a sequence having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 61%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary nucleic acid ofthe invention, e.g., SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO:85, over a region of at least
  • the invention also provides epoxide hydrolase-encoding nucleic acids with a common novelty in that they are derived from environmental sources, e.g., mixed environmental sources.
  • the invention provides epoxide hydrolase-encoding nucleic acids isolated from environmental sources, e.g., mixed environmental sources, comprising a nucleic acid ofthe invention, e.g., a sequence having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or
  • the invention provides epoxide hydrolase-encoding nucleic acids isolated from environmental sources, e.g., mixed environmental sources, comprising a nucleic acid sequence as set forth in , e.g., SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO: 85, over a region of at least about 50, 75, 100, 150, 200, 250, 300, 350, 400, 450. 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or more residues (e.g., 1164 residues, the length of the SEQ ID NO:83).
  • the sequence comparison algorithm is a BLAST version 2.2.2 algorithm where a filtering setting is set to blastall -p blastp -d "nr pataa" -F F, and all other options are set to default.
  • Another aspect ofthe invention is an isolated or recombinant nucleic acid including at least 10 consecutive bases of a nucleic acid sequence of the invention, sequences substantially identical thereto, and the sequences complementary thereto.
  • epoxide hydrolase (EH) activity comprises the hydrolysis of epoxides, including asymmetric hydrolysis of epoxides on a preparative scale, to generate the corresponding vicinal diol.
  • the epoxide hydrolase activity comprises enantioconvergent processes for the generation of a single enantiomeric diol from a racemic oxirane.
  • the epoxide hydrolase activity comprises hydrolysis of highly substituted epoxides, e.g., highly substituted 2,2- and 2,3-disubstituted epoxides.
  • the epoxide hydrolase activity comprises use as a hydrolase in Sharpless epoxidation, Katsuki-Jacobsen reactions, Shi Epoxidation and Jacobsen hydrolytic kinetic resolution reactions. In one aspect, the epoxide hydrolase activity comprises desymmetrization of meso-epoxides.
  • the isolated or recombinant nucleic acid encodes a polypeptide having an epoxide hydrolase activity which is thermostable.
  • the polypeptide can retain an epoxide hydrolase activity under conditions comprising a temperature range of between about 37°C to about 95°C; between about 55°C to about 85°C, between about 70°C to about 95°C, or, between about 90°C to about 95°C.
  • the isolated or recombinant nucleic acid encodes a polypeptide having an epoxide hydrolase activity which is thermotolerant.
  • the polypeptide can retain an epoxide hydrolase activity after exposure to a temperature in the range from greater than 37°C to about 95°C or anywhere in the range from greater than 55°C to about 85°C.
  • the polypeptide retains an epoxide hydrolase activity after exposure to a temperature in the range from greater than 90°C to about 95°C at pH 4.5.
  • the invention provides isolated or recombinant nucleic acids comprising a sequence that hybridizes under stringent conditions to a nucleic acid ofthe invention, e.g., an exemplary sequence as set forth in SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, or fragments or subsequences thereof.
  • the nucleic acid encodes a polypeptide having an epoxide hydiOlase activity.
  • the nucleic acid can be at least about 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200 or more residues in length or the full length ofthe gene or transcript.
  • the stringent conditions include a wash step comprising a wash in 0.2X SSC at a temperature of about 65°C for about 15 minutes.
  • the invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide having an epoxide hydrolase activity, wherein the probe comprises at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 or more, consecutive bases of a sequence comprising a sequence of the invention, or fragments or subsequences thereof, wherein the probe identifies the nucleic acid by binding or hybridization.
  • the probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a sequence comprising a sequence of the invention, or fragments or subsequences thereof.
  • the invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide having an epoxide hydrolase activity, wherein the probe comprises a nucleic acid comprising a sequence at least about 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 or more residues having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 9
  • the probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a nucleic acid sequence ofthe invention, or a subsequence thereof.
  • the invention' provides an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide having an epoxide hydrolase activity, wherein the primer pah is capable of amplifying a nucleic acid comprising a sequence of the invention, or fragments or subsequences thereof.
  • One or each member ofthe amplification primer sequence pair can comprise an oligonucleotide comprismg at least about 10 to 50 consecutive bases ofthe sequence.
  • the invention provides methods of amplifying a nucleic acid encoding a polypeptide having an epoxide hydrolase activity comprising amplification of a template nucleic acid with an amplification primer sequence pair capable of amplifying a nucleic acid sequence of the invention, or fragments or subsequences thereof.
  • the invention provides expression cassettes comprising a nucleic acid of the invention or a subsequence thereof.
  • the expression cassette can comprise the nucleic acid that is operably linked to a promoter.
  • the promoter can be a viral, bacterial, mammalian or plant promoter.
  • the plant promoter can be a potato, rice, corn, wheat, tobacco or barley promoter.
  • the promoter can be a constitutive promoter.
  • the constitutive promoter can comprise CaMV35S.
  • the promoter can be an inducible promoter.
  • the promoter can be a tissue- specific promoter or an environmentally regulated or a developmentally regulated promoter.
  • the promoter can be, e.g., a seed-specific, a leaf-specific, a root-specific, a stem-specific or an abscission-induced promoter.
  • the expression cassette can further comprise a plant or plant virus expression vector.
  • the mvention provides cloning vehicles comprising an expression cassette (e.g., a vector) ofthe invention or a nucleic acid ofthe invention.
  • the cloning vehicle can be a viral vector, a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage or an artificial chromosome.
  • the viral vector can comprise an adenovirus vector, a retroviral vector or an adeno-associated viral vector.
  • the cloning vehicle can comprise a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage PI -derived vector (PAC), a yeast artificial chromosome (YAC), or a mammalian artificial chromosome (MAC).
  • the invention provides transformed cell comprising a nucleic acid of the invention or an expression cassette (e.g., a vector) ofthe invention, or a cloning vehicle of the invention.
  • the transformed cell can be a bacterial cell, a mammalian cell, a fungal cell, a yeast cell, an insect cell or a plant cell.
  • the plant cell can be a potato, wheat, rice, corn, tobacco or barley cell.
  • the invention provides transgenic non-human animals comprising a nucleic acid ofthe invention or an expression cassette (e.g., a vector) ofthe invention.
  • the animal is a mouse.
  • the invention provides transgenic plants comprising a nucleic acid ofthe invention or an expression cassette (e.g., a vector) of the invention.
  • the transgenic plant can be a com plant, a potato plant, a tomato plant, a wheat plant, an oilseed plant, a rapeseed plant, a soybean plant, a rice plant, a barley plant or a tobacco plant.
  • the mvention provides transgenic seeds comprising a nucleic acid ofthe invention or an expression cassette (e.g., a vector) ofthe invention.
  • the transgenic seed can be a com seed, a wheat kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower seed, a sesame seed, a peanut or a tobacco plant seed.
  • the invention provides an antisense oligonucleotide comprising a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid ofthe invention.
  • the invention provides methods of inhibiting the translation of an epoxide hydrolase message in a cell comprising administering to the cell or expressing in the cell an antisense oligonucleotide comprising a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid of the invention.
  • the invention provides double-stranded inhibitory RNA (RNAi) molecules comprising a subsequence of a nucleic acid ofthe invention.
  • RNAi double-stranded inhibitory RNA
  • the RNAi is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.
  • the invention provides methods of inhibitmg the expression of an epoxide hydrolase in a cell comprising administering to the cell or expressing in the cell a double- stranded inhibitory RNA (iRNA), wherein the RNA comprises a subsequence of a nucleic acid ofthe invention.
  • iRNA double- stranded inhibitory RNA
  • the invention provides an isolated or recombinant polypeptide comprising an amino acid sequence having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary polypeptide or peptide ofthe mvention over a region of at least about 50, 75, 100, 150, 200, 250, 300, 350 or more residues, or over the full length ofthe polypeptide, and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual
  • Exemplary polypeptide or peptide sequences ofthe invention include SEQ ID NO: 82, SEQ ID NO:84, SEQ ID NO:86, and subsequences thereof and variants thereof.
  • Exemplary polypeptides also include fragments of at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600 or more residues in length, or over the full length of an enzyme (e.g., the 387 residues of SEQ ID NO:82, or the 379 residues of SEQ ID NO:84).
  • the peptide can be, e.g., an immunogenic fragment, a motif (e.g., a binding site), a signal sequence, a prepro sequence or an active site.
  • the isolated or recombinant polypeptide ofthe invention (with or without a signal sequence) has an epoxide hydrolase activity.
  • Exemplary polypeptide or peptide sequences of the invention include sequence encoded by a nucleic acid ofthe invention.
  • Exemplary polypeptide or peptide sequences ofthe invention include polypeptides or peptides specifically bound by an antibody ofthe invention.
  • a polypeptide ofthe invention has at least one epoxide hydrolase activity.
  • Another aspect of the invention is an isolated or recombinant polypeptide or peptide including at least 10 consecutive bases of a polypeptide or peptide sequence of the invention, sequences substantially identical thereto, and the sequences complementary thereto.
  • epoxide hydrolase (EH) activity comprises the hydrolysis of epoxides, including asymmetric hydrolysis of epoxides on a preparative scale, to generate the corresponding vicinal diol.
  • the epoxide hydrolase activity comprises enantioconvergent processes for the generation of a single enantiomeric diol from a racemic oxirane.
  • the epoxide hydrolase activity comprises hydrolysis of highly substituted epoxides, e.g., highly substituted 2,2- and 2,3-disubstituted epoxides.
  • the epoxide hydrolase activity comprises use as a hydrolase in Sha ⁇ less epoxidation, Katsuki-Jacobsen reactions, Shi Epoxidation and Jacobsen hydrolytic kinetic resolution reactions. In one aspect, the epoxide hydrolase activity comprises desymmetrization of meso-epoxides.
  • the epoxide hydrolase activity is thermostable.
  • the polypeptide can retain an epoxide hydrolase activity under conditions comprising a temperature range of between about 37°C to about 95°C, between about 55°C to about 85°C, between about 70°C to about 95°C, or between about 90°C to about 95°C.
  • the epoxide hydrolase activity can be thermotolerant.
  • the polypeptide can retain an epoxide hydrolase activity after exposure to a temperature in the range from greater than 37°C to about 95°C, or in the range from greater than 55°C to about 85°C.
  • the polypeptide can retain an epoxide hydrolase activity after exposure to a temperature in the range from greater than 90°C to about 95°C at pH 4.5.
  • the isolated or recombinant polypeptide can comprise the polypeptide ofthe invention that lacks a signal sequence.
  • the isolated or recombinant polypeptide can comprise the polypeptide ofthe invention comprising a heterologous signal sequence, such as a heterologous epoxide hydrolase or non-epoxide hydrolase signal sequence.
  • the invention provides chimeric proteins comprising a first domain comprising a signal sequence ofthe invention and at least a second domain.
  • the protein can be a fusion protein.
  • the second domain can comprise an enzyme.
  • the enzyme can be an epoxide hydrolase (e.g., an epoxide hydrolase ofthe invention, or, another epoxide hydrolase).
  • the epoxide hydrolase activity comprises a specific activity at about 37°C i the range from about 100 to about 1000 units per milligram of protein. In another aspect, the epoxide hydrolase activity comprises a specific activity from about 500 to about 750 units per milligram of protein. Alternatively, the epoxide hydrolase activity comprises a specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein. In one aspect, the epoxide hydrolase activity comprises a specific activity at 37°C in the range from about 750 to about 1000 units per milligram of protein.
  • thermotolerance comprises retention of at least half of the specific activity ofthe epoxide hydrolase at 37°C after being heated to the elevated temperature.
  • thermotolerance can comprise retention of specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein after being heated to the elevated temperature.
  • the invention provides the isolated or recombinant polypeptide ofthe invention, wherein the polypeptide comprises at least one glycosylation site.
  • glycosylation can be an N-linked glycosylation.
  • the polypeptide can be glycosylated after being expressed in a P. pastoris or a S. pombe.
  • the polypeptide can retain an epoxide hydiOlase activity under conditions comprising about pH 6.5, pH 6, pH 5.5, pH 5, pH 4.5 or pH 4.
  • the polypeptide can retain an epoxide hydrolase activity under conditions comprising about pH 7, pH 7.5 pH 8.0, pH 8.5, pH 9, pH 9.5, pH 10, pH 10.5 or pH 11.
  • the isolated or recombinant polypeptide can comprise the polypeptide ofthe invention that lacks a signal sequence and/or a prepro domain. In one aspect, the isolated or recombinant polypeptide can comprise the polypeptide ofthe invention comprising a heterologous signal sequence and/or prepro domain, such as a heterologous epoxide hydrolase signal sequence.
  • the invention provides a signal sequence comprising a peptide comprising/ consisting of a sequence as set forth in residues 1 to 15, 1 to 16, 1 to 17, 1 to 18, 1 to 19, 1 to 20, 1 to 21, 1 to 22, 1 to 23, 1 to 24, 1 to 25, 1 to 26, 1 to 27, 1 to 28, 1 to 28, 1 to 30, 1 to 31, 1 to 32, 1 to 33, 1 to 34, 1 to 35, 1 to 36, 1 to 37, 1 to 38, 1 to 39, 1 to 40, 1 to 41, 1 to 42, 1 to 43, 1 to 44 of a polypeptide ofthe invention.
  • the invention provides chimeric proteins comprising a first domain comprising a signal sequence ofthe invention and at least a second domain.
  • the protein can be a fusion protein.
  • the second domain can comprise an enzyme.
  • the enzyme can be an epoxide hydrolase, e.g., an enzyme ofthe invention.
  • the mvention provides chimeric polypeptides comprising at least a first domain comprising signal peptide (SP), a prepro domain, a catalytic domain (CD), or an active site of an epoxide hydrolase ofthe invention and at least a second domain comprising a heterologous polypeptide or peptide, wherein the heterologous polypeptide or peptide is not naturally associated with the signal peptide (SP), prepro domain or catalytic domain (CD).
  • the heterologous polypeptide or peptide is not an epoxide hydrolase.
  • the heterologous polypeptide or peptide can be amino terminal to, carboxy terminal to or on both ends ofthe signal peptide (SP), prepro domain or catalytic domam (CD).
  • the invention provides protein preparations comprising a polypeptide of the invention, wherein the protein preparation comprises a liquid, a solid or a gel.
  • the mvention provides heterodimers comprising a polypeptide ofthe invention and a second domain.
  • the second domain can be a polypeptide and the heterodimer can be a fusion protein.
  • the second domain can be an epitope or a tag.
  • the invention provides homodimers comprising a polypeptide of the invention.
  • the invention provides immobilized polypeptides having an epoxide hydrolase activity, wherein the polypeptide comprises a polypeptide ofthe invention, a polypeptide encoded by a nucleic acid ofthe invention, or a polypeptide comprising a polypeptide ofthe invention and a second domain.
  • the polypeptide can be immobilized on a cell, a metal, a resin, a polymer, a ceramic, a glass, a microelectrode, a graphitic particle, a bead, a gel, a plate, an array or a capillary tube.
  • the invention provides arrays comprismg an immobilized nucleic acid of the invention.
  • the invention provides arrays comprising an antibody ofthe invention.
  • the invention provides isolated or recombinant antibodies that specifically bind to a polypeptide of the invention or to a polypeptide encoded by a nucleic acid ofthe invention.
  • the antibody can be a monoclonal or a polyclonal antibody.
  • the invention provides hybridomas comprising an antibody of the invention, e.g., an antibody that specifically binds to a polypeptide ofthe invention or to a polypeptide encoded by a nucleic acid of the invention.
  • the invention provides food supplements for an animal comprising a polypeptide ofthe invention, e.g., a polypeptide encoded by the nucleic acid ofthe invention.
  • the polypeptide in the food supplement can be glycosylated.
  • the invention provides edible enzyme delivery matrices comprising a polypeptide ofthe invention, e.g., a polypeptide encoded by the nucleic acid of the invention.
  • the delivery matrix comprises a pellet.
  • the polypeptide can be glycosylated.
  • the epoxide hydrolase activity is thermotolerant.
  • the epoxide hydrolase activity is thermostable.
  • the invention provides method of isolating or identifying a polypeptide having an epoxide hydrolase activity comprising the steps of: (a) providing an antibody of the invention; (b) providing a sample comprising polypeptides; and (c) contacting the sample of step (b) with the antibody of step (a) under conditions wherein the antibody can specifically bind to the polypeptide, thereby isolating or identifying a polypeptide having an epoxide hydrolase activity.
  • the invention provides methods of making an anti-epoxide hydrolase antibody comprising administering to a non-human animal a nucleic acid ofthe invention or a polypeptide ofthe invention or subsequences thereof in an amount sufficient to generate a humoral immune response, thereby making an anti-epoxide hydrolase antibody.
  • the invention provides methods of making an anti-epoxide hydrolase immune comprising administering to a non-human animal a nucleic acid ofthe invention or a polypeptide of the invention or subsequences thereof in an amount sufficient to generate an immune response.
  • the invention provides methods of producing a recombinant polypeptide comprising the steps of: (a) providing a nucleic acid ofthe invention operably linked to a promoter; and (b) expressing the nucleic acid of step (a) under conditions that allow expression ofthe polypeptide, thereby producing a recombinant polypeptide.
  • the method can further comprise transfonning a host cell with the nucleic acid of step (a) followed by expressing the nucleic acid of step (a), thereby producing a recombinant polypeptide in a transformed cell.
  • the invention provides methods for identifying a polypeptide having an epoxide hydrolase activity comprising the following steps: (a) providing a polypeptide of the invention; or a polypeptide encoded by a nucleic acid of the invention; (b) providing an epoxide hydrolase substrate; and (c) contacting the polypeptide or a fragment or variant thereof of step (a) with the subsfrate of step (b) and detecting a decrease in the amount of substrate or an increase in the amount of a reaction product, wherein a decrease in the amount ofthe substrate or an increase in the amount of the reaction product detects a polypeptide having an epoxide hydrolase activity.
  • the mvention provides methods for identifying an epoxide hydrolase substrate comprising the following steps: (a) providing a polypeptide ofthe invention; or a polypeptide encoded by a nucleic acid ofthe invention; (b) providing a test substrate; and (c) contacting the polypeptide of step (a) with the test substrate of step (b) and detecting a decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount ofthe substrate or an increase in the amount of a reaction product identifies the test substrate as an epoxide hydrolase substrate.
  • the invention provides methods of determining whether a test compound specifically binds to a polypeptide comprising the following steps: (a) expressing a nucleic acid or a vector comprising the nucleic acid under conditions permissive for translation of the nucleic acid to a polypeptide, wherein the nucleic acid comprises a nucleic acid ofthe invention, or, providing a polypeptide ofthe invention; (b) providmg a test compound; (c) contacting the polypeptide with the test compound; and (d) determining whether the test compound of step (b) specifically binds to the polypeptide.
  • the invention provides methods for identifying a modulator of an epoxide hydrolase activity comprising the following steps: (a) providing a polypeptide ofthe invention or a polypeptide encoded by a nucleic acid of the hivention; (b) providing a test compound; (c) contacting the polypeptide of step (a) with the test compound of step (b) and measuring an activity ofthe epoxide hydrolase, wherein a change hi the epoxide hydrolase activity measured in the presence ofthe test compound compared to the activity in the absence ofthe test compound provides a determination that the test compound modulates the epoxide hydrolase activity.
  • the epoxide hydrolase activity can be measured by providing an epoxide hydrolase substrate and detecting a decrease in the amount ofthe substrate or an increase in the amount of a reaction product, or, an increase in the amount ofthe substrate or a decrease in the amount of a reaction product.
  • a decrease in the amount ofthe substrate or an increase in the amount ofthe reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compotmd as an activator of epoxide hydrolase activity.
  • An increase in the amount ofthe subsfrate or a decrease in the amount ofthe reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an inhibitor of epoxide hydrolase activity.
  • the invention provides computer systems comprising a processor and a data storage device wherein said data storage device has stored thereon a polypeptide sequence or a nucleic acid sequence ofthe invention (e.g., a polypeptide encoded by a nucleic acid ofthe invention).
  • the computer system can further comprise a sequence comparison algorithm and a data storage device having at least one reference sequence stored thereon.
  • the sequence comparison algorithm comprises a computer program that indicates polymo ⁇ hisms.
  • the computer system can further comprise an identifier that identifies one or more features in said sequence.
  • the invention provides computer readable media having stored thereon a polypeptide sequence or a nucleic acid sequence ofthe invention.
  • the invention provides methods for identifying a feature in a sequence comprising the steps of: (a) reading the sequence using a computer program which identifies one or more features in a sequence, wherein the sequence comprises a polypeptide sequence or a nucleic acid sequence ofthe invention; and (b) identifying one or more features in the sequence with the computer program.
  • the invention provides methods for comparing a first sequence to a second sequence comprising the steps of: (a) reading the first sequence and the second sequence through use of a computer program which compares sequences, wherein the first sequence comprises a polypeptide sequence or a nucleic acid sequence ofthe invention; and (b) determining differences between the first sequence and the second sequence with the computer program.
  • the step of determining differences between the first sequence and the second sequence can further comprise the step of identifying polymo ⁇ hisms.
  • the method can further comprise an identifier that identifies one or more features in a sequence.
  • the method can comprise reading the first sequence using a computer program and identifying one or more features in the sequence.
  • the hivention provides methods for isolating or recovering a nucleic acid encoding a polypeptide having an epoxide hydrolase activity from an environmental sample comprismg the steps of: (a) providing an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide having an epoxide hydrolase activity, wherein the primer pair is capable of amplifying a nucleic acid ofthe mvention; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to the amplification primer pair; and, (c) combining the nucleic acid of step (b) with the amplification primer pah of step (a) and amplifying nucleic acid from the environmental sample, thereby isolating or recovering a nucleic acid encoding a polypeptide having an epoxide hydrolase activity from an environmental sample.
  • One or each member ofthe amplification primer sequence pair can comprise an oligon
  • the invention provides methods for isolating or recovering a nucleic acid encoding a polypeptide having an epoxide hydrolase activity from an environmental sample comprismg the steps of: (a) providing a polynucleotide probe comprising a nucleic acid ofthe invention or a subsequence thereof; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to a polynucleotide probe of step (a); (c) combining the isolated nucleic acid or the treated environmental sample of step (b) with the polynucleotide probe of step (a); and (d) isolating a nucleic acid that specifically hybridizes with the polynucleotide probe of step (a), thereby isolating or recovering a nucleic acid encoding a polypeptide having an epoxide hydrolase activity from an environmental sample.
  • the environmental sample can comprise a water sample, a liquid sample, a soil sample, an ah sample or a biological sample.
  • the biological sample can be derived from a bacterial cell, a protozoan cell, an insect cell, a yeast cell, a plant cell, a fungal cell or a mammalian cell.
  • the invention provides methods of generating a variant of a nucleic acid encoding a polypeptide having an epoxide hydrolase activity comprising the steps of: (a) providing a template nucleic acid comprising a nucleic acid ofthe invention; and (b) modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to generate a variant of the template nucleic acid.
  • the method can further comprise expressing the variant nucleic acid to generate a variant epoxide hydrolase polypeptide.
  • the modifications, additions or deletions can be introduced by a method comprising error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site- specific mutagenesis, gene reassembly, gene site saturation mutagenesis (GSSMTM), synthetic ligation reassembly (SLR) or a combination thereof.
  • the modifications, additions or deletions are introduced by a method comprising recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restiiction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
  • the method can be iteratively repeated until an epoxide hydrolase having an altered or different activity or an altered or different stability from that of a polypeptide encoded by the template nucleic acid is produced.
  • the variant epoxide hydrolase polypeptide is thermotolerant, and retains some activity after being exposed to an elevated temperature.
  • the variant epoxide hydrolase polypeptide has increased glycosylation as compared to the epoxide hydrolase encoded by a template nucleic acid.
  • the variant epoxide hydrolase polypeptide has an epoxide hydrolase activity under a high temperature, wherein the epoxide hydrolase encoded by the template nucleic acid is not active under the high temperature.
  • the method can be iteratively repeated until an epoxide hydrolase coding sequence having an altered codon usage from that of the template nucleic acid is produced. In another aspect, the method can be iteratively repeated until an epoxide hydrolase gene having higher or lower level of message expression or stability from that ofthe template nucleic acid is produced.
  • the invention provides methods for modifying codons in a nucleic acid encoding a polypeptide having an epoxide hydrolase activity to increase its expression in a host cell, the method comprising the following steps: (a) providing a nucleic acid of the invention encoding a polypeptide having an epoxide hydrolase activity; and, (b) identifying a non-preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented hi coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell.
  • the invention provides methods for modifying codons in a nucleic acid encoding a polypeptide havmg an epoxide hydrolase activity; the method comprising the following steps: (a) providing a nucleic acid ofthe invention; and, (b) identifying a codon in the nucleic acid of step (a) and replacing it with a different codon encoding the same amino acid as the replaced codon, thereby modifying codons in a nucleic acid encoding an epoxide hydrolase.
  • the invention provides methods for modifying codons in a nucleic acid encoding a polypeptide having an epoxide hydrolase activity to increase its expression in a host cell, the method comprising the following steps: (a) providing a nucleic acid ofthe invention encoding an epoxide hydrolase polypeptide; and, (b) identifying a non- preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell.
  • the mvention provides methods for modifying a codon in a nucleic acid encoding a polypeptide having an epoxide hydrolase activity to decrease its expression in a host cell, the method comprising the following steps: (a) providing a nucleic acid ofthe invention; and (b) identifying at least one preferred codon in the nucleic acid of step (a) and replacing it with a non-preferred or less preferred codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in a host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to decrease its expression in a host cell, hi one aspect, the host cell can be a bacterial cell, a fungal cell, an insect cell, a yeast cell, a plant cell or a mammalian cell.
  • the invention provides methods for producing a library of nucleic acids encoding a plurality of modified epoxide hydrolase active sites or substrate binding sites, wherein the modified active sites or substrate binding sites are derived from a first nucleic acid comprising a sequence encoding a first active site or a first substrate binding site the method comprismg the following steps: (a) providing a first nucleic acid encoding a first active site or first substrate binding site, wherein the first nucleic acid sequence comprises a sequence that hybridizes under stringent conditions to a nucleic acid ofthe invention, and the nucleic acid encodes an epoxide hydrolase active site or an epoxide hydrolase substrate binding site; (b) providing a set of mutagenic oligonucleotides that encode naturally-occurring amino acid variants at a plurality of targeted codons in the first nucleic acid; and, (c) using the set of mutagenic oligonucleotides to generate a set of active site-
  • the method comprises mutagenizing the first nucleic acid of step (a) by a method comprising an optimized directed evolution system, gene site-saturation mutagenesis (GSSM), synthetic ligation reassembly (SLR), error-prone PCR, shuffling, oligonucleotide-dhected mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturation mutagenesis (GSSMTM), synthetic ligation reassembly (SLR) and a combination thereof.
  • GSSM gene site-saturation mutagenesis
  • SLR synthetic ligation reassembly
  • SLR synthetic ligation reassembly
  • the method comprises mutagenizing the first nucleic acid of step (a) or variants by a method comprising recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil- containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction- purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
  • the invention provides methods for making a small molecule comprising the following steps: (a) providing a plurality of biosynthetic enzymes capable of synthesizing or modifying a small molecule, wherein one ofthe enzymes comprises an epoxide hydrolase enzyme encoded by a nucleic acid ofthe invention; (b) providing a substrate for at least one ofthe enzymes of step (a); and (c) reacting the substrate of step (b) with the enzymes under conditions that facilitate a plurality of biocatalytic reactions to generate a small molecule by a series of biocatalytic reactions.
  • the invention provides methods for modifying a small molecule comprising the following steps: (a) providing an epoxide hydrolase enzyme, wherein the enzyme comprises a polypeptide ofthe invention, or, a polypeptide encoded by a nucleic acid ofthe invention, or a subsequence thereof; (b) providing a small molecule; and (c) reacting the enzyme of step (a) with the small molecule of step (b) under conditions that facilitate an enzymatic reaction catalyzed by the epoxide hydrolase enzyme, thereby modifying a small molecule by an epoxide hydrolase enzymatic reaction.
  • the method can comprise a plurality of small molecule substrates for the enzyme of step (a), thereby generating a library of modified small molecules produced by at least one enzymatic reaction catalyzed by the epoxide hydrolase enzyme.
  • the method can comprise a plurality of additional enzymes under conditions that facihtate a plurality of biocatalytic reactions by the enzymes to form a library of modified small molecules produced by the plurality of enzymatic reactions.
  • the method can further comprise the step of testing the library to determine if a particular modified small molecule which exhibits a desired activity is present within the library.
  • the step of testing the library can further comprise the steps of systematically eliminating all but one of the biocatalytic reactions used to produce a portion ofthe plurality ofthe modified small molecules within the library by testing the portion ofthe modified small molecule for the presence or absence of the particular modified small molecule with a desired activity, and identifying at least one specific biocatalytic reaction that produces the particular modified small molecule of desired activity.
  • the invention provides methods for determining a functional fragment of an epoxide hydrolase enzyme comprismg the steps of: (a) providing an epoxide hydrolase enzyme, wherein the enzyme comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid ofthe invention, or a subsequence thereof; and (b) deleting a plurality of amino acid residues from the sequence of step (a) and testing the remaining subsequence for an epoxide hydrolase activity, thereby determining a functional fragment of an epoxide hydrolase enzyme.
  • the epoxide hydrolase activity is measured by providing an epoxide hydrolase substrate and detecting a decrease in the amount ofthe substrate or an increase in the amount of a reaction product.
  • the hivention provides methods for whole cell engineering of new or modified phenotypes by using real-thne metabolic flux analysis, the method comprising the following steps: (a) making a modified cell by modifying the genetic composition of a cell, wherein the genetic composition is modified by addition to the cell of a nucleic acid ofthe invention; (b) culturing the modified cell to generate a plurality of modified cells; (c) measuring at least one metabolic parameter ofthe cell by monitoring the cell culture of step (b) in real time; and, (d) analyzing the data of step (c) to determine if the measured parameter differs from a comparable measurement in an unmodified cell under similar conditions, thereby identifying an engineered phenotype in the cell using real-time metabolic flux analysis.
  • the genetic composition ofthe cell can be modified by a method comprising deletion of a sequence or modification of a sequence in the cell, or, knocking out the expression of a gene.
  • the method can further comprise selecting a cell comprismg a newly engineered phenotype.
  • the method can comprise culturing the selected cell, thereby generating a new cell strain comprising a newly engineered phenotype.
  • the invention provides methods of increasing thermotolerance or thermos-ability of an epoxide hydrolase polypeptide, the method comprising glycosylating an epoxide hydrolase polypeptide, wherein the polypeptide comprises at least thirty contiguous amino acids of a polypeptide ofthe invention; or a polypeptide encoded by a nucleic acid sequence ofthe invention, thereby increasing the thermotolerance or thermostability of the epoxide hydrolase polypeptide.
  • the epoxide hydrolase specific activity can be thermostable or thermotolerant at a temperature in the range from greater than about 37°C to about 95°C.
  • the invention provides methods for overexpressing a recombinant epoxide hydrolase polypeptide hi a cell comprising expressing a vector comprising a nucleic acid comprising a nucleic acid ofthe invention or a nucleic acid sequence ofthe invention, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, wherein overexpression is effected by use of a high activity promoter, a dicistronic vector or by gene amplification ofthe vector.
  • the invention provides methods of making a transgenic plant comprising the following steps: (a) introducing a heterologous nucleic acid sequence into the cell, wherein the heterologous nucleic sequence comprises a nucleic acid sequence ofthe invention, thereby producing a transformed plant cell; and (b) producing a transgenic plant from the transformed cell.
  • the step (a) can further comprise introducing the heterologous nucleic acid sequence by electroporation or microinjection of plant cell protoplasts.
  • the step (a) can further comprise introducing the heterologous nucleic acid sequence directly to plant tissue by DNA particle bombardment.
  • the step (a) can further comprise introducing the heterologous nucleic acid sequence into the plant cell DNA using an Agrobacterium tumefaciens host.
  • the plant cell can be a potato, corn, rice, wheat, tobacco, or barley cell.
  • the invention provides methods of expressing a heterologous nucleic acid sequence in a plant cell comprismg the following steps: (a) fransforming the plant cell with a heterologous nucleic acid sequence operably linked to a promoter, wherein the heterologous nucleic sequence comprises a nucleic acid ofthe invention; (b) growing the plant under conditions wherein the heterologous nucleic acids sequence is expressed in the plant cell.
  • Figure 1 is a block diagram of a computer system.
  • Figure 2 is a flow diagram illustrating one aspect of a process for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
  • Figure 3 is a flow diagram illustrating one aspect of a process in a computer for determining whether two sequences are homologous.
  • Figure 4 is a flow diagram illustrating one aspect of an identifier process 300 for detecting the presence of a feature in a sequence.
  • Figure 5 is a chart summary of exemplary reactions that can be used with the epoxide hydrolases of the invention.
  • Figure 6 is a schematic of an exemplary reaction where an epoxide hydrolase of the invention is used in the desymmetrization of meso-epoxides.
  • Figure 7 is a schematic of an exemplary high-throughput screen for novel epoxide hydrolases.
  • Figure 8 is a schematic of an exemplary high-throughput sequence-based screen for epoxide hydrolases.
  • Figure 9 illustrates DhectEvolution® (Diversa Co ⁇ oration, San Diego,
  • Figure 10 illustrates HIV protease inhibitors that share a common core chiral C-4 unit in their structures.
  • Figure 11 is an illustration ofthe mechanism of A. radiobacter epoxide hydrolase.
  • Figure 12 is an illustration ofthe types of epoxide substrates.
  • Figure 13 is an illustration ofthe enantioconvergent hydrolysis of cis-2,3- epoxyheptane to 2R,3R-2,3-dihydroxyheptane catalyzed by Norcardia EH1.
  • Figure 14 is an illustration of a high-throughput screening method based on a periodate-coupled fluorogenic assay for an epoxide hydrolase.
  • Figure 15 is an illustration of the synthesis ofthe substrates for a periodate-coupled fluorogenic assay for an epoxide hydrolase.
  • FIG 16 is an illustration of Fluorescence Activated Cell Sorting (FACS) for ultra high throughput single cell activity and sequence screening.
  • Figure 17 is an illustration of environmental library biopanning for sequence-based discovery.
  • FACS Fluorescence Activated Cell Sorting
  • the invention provides polypeptides having epoxide hydrolase activity, polynucleotides encoding die polypeptides, and methods for making and using these polynucleotides and polypeptides.
  • the polypeptides ofthe hivention can be used as epoxide hydrolases to catalyze the hydrolysis of epoxides and arene oxides to their corresponding diols.
  • Epoxide hydrolases ofthe invention can be used as tools for the synthesis of enantiopure epoxides via the hydrolytic kinetic resolution of racemic epoxides.
  • the epoxide hydrolases ofthe invention can be highly versatile biocatalysts for the asymmetiic hydrolysis of epoxides on a preparative scale. Besides kinetic resolution, which furnishes the corresponding vicinal diol and remaining non-hydrolyzed epoxide in nonracemic form, the epoxide hydrolases ofthe invention are used in enantioconvergent processes for the generation of a single enantiomeric diol from a racemic oxirane.
  • the epoxide hydrolases ofthe invention can be used in the hydrolysis of highly substituted epoxides, e.g., highly substituted 2,2- and 2,3-disubstituted epoxides.
  • the epoxide hydrolases ofthe invention can be used in any method known in the art, see, e.g., Orru (1999) Curr. Opin. Chem. Biol. 3:16-21.
  • polypeptides ofthe invention can be used as epoxide hydrolases in Sha ⁇ less epoxidation, Katsuki-Jacobsen reactions, Shi Epoxidation and Jacobsen hydrolytic kinetic resolution reactions (see Figure 5.)
  • polypeptides of the invention can be used in the desymmetrization of meso-epoxides.
  • the conversion of substrate to either R,R or S,S-product was with greater than 97%ee, and, in one aspect, 99% conversion.
  • Figure 6 is a schematic of an exemplary reaction where an epoxide hydrolase ofthe invention is used in the desymmetrization of meso-epoxides.
  • the mvention provides biocatalytic processes for large-scale production of chiral epoxides and vicinal diols.
  • the invention provides epoxide hydro lase-based biocatalytic processes for preparing the following three exemplary targets: Table 1. Chiral diol/epoxide targets for epoxide hydrolases in Phase II
  • the first target is 1,4-disubstituted 2R,3R-butanediol.
  • the substituents at the terminal positions are either chlorine (la) or tosyl groups (lb). They can be prepared by EH-mediated desymmetrization of theh corresponding meso-epoxides 4a or 4b. Such desymmetrization processes can ideally reach 100% yield at 100% ee.
  • the other two targets, R-3-chlorostyrene oxide (2) and S-oxhanylmethyl acetamide (3) can be prepared using EHs-catalyzed kinetic resolution of theh respective racemic epoxides.
  • R-3-Chlorostyrene oxide is an important chiral synthon for a number of ⁇ 3 -adrenergic receptor agonists that show anti-obesity and antidiabetic activities (Scheme 2).
  • S-oxhanylmethyl acetamide (3) is a key chiral synthon for serotonergic receptor agonists that are effective against psychotic disorder.
  • 3 can also be used in the synthesis of oxazolidinone antibiotics, a novel class of antibiotics effective against drug-resistant pathogenic strains (Scheme 3).
  • an epoxide hydrolase homAgrobacterium radiobacter was evaluated in the HKR of 3. However, it is selective for the wrong enantiomer.
  • the invention provides epoxide hydrolases that selectively hydrolyze the correct (S-) enantiomer.
  • the invention provides assay methods for determining if a polypeptide is within the scope ofthe invention and for obtaining epoxide hydrolases (EHs).
  • Assay methods ofthe invention include growth-based assays, direct activity-based assays and sequence-based assays. In one aspect, to successfully obtain a range of EHs with desirable characteristics, all three of these assay methods may be used complementarity.
  • Figure 16 is an illustration of Fluorescence Activated Cell Sorting (FACS) for use with any assay ofthe invention, including an ultra high throughput single cell activity and sequence screening assay, and, including the growth-based assays, dhect activity-based assays and sequence-based assays ofthe mvention.
  • FACS Fluorescence Activated Cell Sorting
  • the invention provides high throughput growth-based selection methods for determining if a polypeptide is witliin the scope of the invention and for obtaining epoxide hydrolases (EHs).
  • high throughput growth-based selection methods are the most dhect method for identifying enzymes within the scope of the invention or enzymes that are capable of catalyzing the modification of epoxides.
  • EHs are identified or discovered if they convert an epoxide substrate to a diol that can be utilized by host bacteria as a carbon source.
  • E. coli fucA-disrupted mutant that can use propane diol as carbon source is required for propylene oxide selection, as described, e.g., by hacking (1976) J. Bacteriol. 126:1166-1172.
  • These hosts can be generated via targeted mutation of certain genes or transposon (Tn) mutagenesis in a random fashion. In some aspects, the latter strategy is more attractive because it is more convenient and extremely powerful.
  • Tn is introduced into E. coli hosts through electroporation, where in vivo transposition leads to random Tn insertion in genomic DNA. This results in an E.
  • coli insertion library suitable for screening for desired mutants, such as those that can utilize propane diol as carbon source.
  • desired mutants such as those that can utilize propane diol as carbon source.
  • propane diol as carbon source.
  • the library cells are plated out on agar plates containing minimal medium with propane diol as the sole carbon source. Upon incubation, propane diol-utilizi g clones can be identified because only they will grow and form colonies on the plates.
  • EHs simple epoxides
  • a variety of EHs with opthnal specificities on more complex epoxides can be identified or discovered if they have weak activity on glycidol or propylene oxide.
  • the generality of this identification/ discovery technique will depend on the sensitivity ofthe selection.
  • Additional epoxide substrates for selection may also be identified if E. coli mutants capable of growing on other vicinal diols are discovered from the Tn insertion libraries. Screening for these diol-utilizing mutants can be carried out using protocols described above.
  • Epoxides are known to be toxic to microbes due to alkylation of proteins and nucleic acids.
  • the effect of different concentrations of glycidol on the growth of an E. coli host was evaluated. The results showed that E. coli can tolerate up to 0.05% of glycidol (v/v). This concentration may be high enough for selection as the cells were able to grow with 0.025% glycerol provided extracellularly in the media as the sole carbon source. If necessary, however, E. coli mutants bearing higher glycidol tolerance may be discovered by screening libraries of mutagenized hosts including the Tn insertion libraries mentioned above. Also, a positive control clone has been developed that has epoxide hydrolase activity.
  • An epoxide hydrolase from A. radiobacter whose nucleotide sequence was reported, can be readily cloned and expressed in E. coli., as described, e.g., by Arand (1999) Biochem. J. 344:273- 280. Primers have been designed and synthesized for the amplification and cloning of this gene. In addition, as described below, an active epoxide hydrolase that may be used as the positive control has been identified.
  • Sequence based Assays The invention provides sequence-based assays for determining if a polypeptide is witliin the scope ofthe invention and for obtaining epoxide hydrolases (EHs).
  • EHs epoxide hydrolases
  • a complementary approach to the activity-based identification/ discovery of epoxide hydrolases is sequence-based identification/ discovery of epoxide hydrolases, followed by assessment of theh substrate specificities in secondary assays.
  • sequence-based methods is a valuable strategy for discovering particular classes of enzymes. Considerable amounts of sequence and structural information are available on EHs, rendering the development of sequenced-based discovery possible.
  • Primers will be designed based on these regions. These primers will be used to generate PCR products from DNA libraries. The products will be gel- separated, purified, and subjected for sequence analysis. The full-length sequences of positive hits can be retrieved by southern blotting. The activities of these hits will then be investigated using fluorogenic or chromogenic assays.
  • One limitation of the sequence- based approach compared to activity-based metliods is that it is limited to the discovery of genes that share homology to existing genes. However, as new EH genes are discovered and a sequence database of EHs is built up, the sequence-based approach becomes increasingly powerful as more sequences can be used in probe design.
  • Bioinfoimatic analysis of a DNA database resulted in a total of 6 putative epoxide hydrolase genes as well as 3 partial open reading frame (ORFs) that bear homology to A. radiobacter and other epoxide hydrolases.
  • ORFs partial open reading frame
  • degenerate primers have been designed and used for screening a gene library known to contain one of these genes. This screening did result in the finding ofthe known gene as was expected.
  • Another PCR product (-200 bp) was also obtained and upon sequencing, the partial ORF showed strong sequence homology to other known EHs. This unexpected result thus indicates that the sequence-based strategy is capable of discovering novel EHs.
  • the invention provides fluorogenic and chromogenic assays for determining if a polypeptide is within the scope ofthe invention and for obtaining epoxide hydrolases (EHs).
  • Figure 14 is an illustration of an exemplary high-throughput screening method based on a periodate-coupled fluorogenic assay for an epoxide hydrolase.
  • fluorogenic and chromogenic assays are used in high-throughput screening for enzyme characterization and identification/ discovery. Fluorogenic assays have been commonly used for many hydrolytic enzymes in which the substrates release a fluorescent signal upon the hydrolysis reaction. These assays are activity-based like the selection method, but they can be used for more diverse substrates than the selection experiments. The lhnitation, however, is that they have lower throughput than the selection assays.
  • the epoxide substrate (13) used in this assay contains a masked fluorophore that can generate strong fluorescence when released.
  • periodate is added to oxidize the vicinal diol product (14) to generate a carbonyl-containing intermediate (15).
  • 15 can undergo a beta-elimination reaction catalyzed by bovine serum albumin (BSA) to release a fluorescent product (16) such as umbelliferone.
  • BSA bovine serum albumin
  • the assay is carried out in a multi-well format, e.g., a 1536- well format.
  • clones from gene libraries are distributed into individual wells, e.g., 5 clones per well for the primary screening.
  • these clones are allowed to grow for 24 to 48 hrs before substrate 19 is added.
  • sodium periodate and BSA are added to promote the beta-elimination reaction.
  • the fluorescence level in each well is measured to identify preliminary hits. These hits can be reconfirmed by ranning a second round of assays.
  • robotic systems are used to automate all the liquid handling and fluorescence measurement processes.
  • the first substrate for this assay development 19, has been synthesized by coupling of umbelliferone with 4-bromo-l-butene in the presence of potassium carbonate at 50°C to yield olefin, which was subjected to an epoxidation reaction using meta-chloroperbenzoic acid (mCPBA).
  • Figure 15 is an illustration ofthe synthesis ofthe substrates for this periodate-coupled fluorogenic assay for an epoxide hydrolase. The resulting epoxide was used to detect epoxide hydrolase activity ofthe 6 clones mentioned above. These clones contain putative epoxide hydrolase genes. One of them was found to be active for. This showed that the assay is useful.
  • Colorimetric Assay The invention provides colorimetric assays for determining if a polypeptide is within the scope ofthe invention and for obtaining epoxide hydrolases (EHs).
  • a colorimetric assay can be extremely useful in high throughput screening if a sensitive color change is involved and the assay can be performed in solid agar format. Screening on solid agar offers extremely high throughput, while a color change allows easy identification of hits.
  • a colorimetric assay that uses 4-(p-mtrobenzyl)-pyridine to detect epoxide substrates can be employed.
  • Hydrolyzed epoxides e.g., diols
  • epoxides are not reactive with the compound, and thus observation of a decrease in absorbance at 560 nm is indicative of epoxide hydrolysis.
  • colonies grown on agar plates were transferred to filter paper preincubated with epoxides. Epoxide hydrolase activity was detected by the formation of colorless halos on the blue filter paper. This assay has the potential to be converted to a HTP screen.
  • This assay detects the disappearance ofthe substrate instead of the appearance ofthe products.
  • the advantage is that it targets substrates directly, not theh derivatives. Therefore, even if its relative low sensitivity proves to be a problem for HTP screening, it may be used for secondary screening of primary hits detected from other discovery methods.
  • the colorimetric assay was tested on the positive epoxide hydrolase clone mentioned above using three epoxides: styrene oxide, epichlorohydrin, and glycidol. All three epoxides were found to be substrates, with epichlorohydrin showing the highest activity.
  • the assays ofthe invention are applied to screen environmental gene libraries for the presence of microbial enzymes with the necessary activities and subsfrate specificities. Positive hits from these screens may then be sequenced and the genes subcloned into expression vectors. The expressed recombinant enzymes can then be characterized with respect to activity and substrate selectivities. Should Hie identified enzymes require enhancement of one or more of theh properties (e.g. pH and temperature optima, thermostability, thermotolerance, substrate specificity etc.) they can be optimized using GSSMTM (Gene Site Saturation Mutagenesis), Gene ReassemblyTM and other technologies discussed below.
  • GSSMTM Gene Site Saturation Mutagenesis
  • epoxide hydrolases may be used in the chemo-enzymatic synthesis of specific fine chemicals and high value precursors to pharmaceuticals and agrochemicals.
  • the optimized enzymes developed using a method of the present invention may be applied in the development of a commercially viable synthesis route to one or more target compounds.
  • the epoxide hydrolases can be used as key intermediates in the synthesis of fine chemicals and enantiomeric pharmaceuticals having the desired purities.
  • the environmental gene libraries are constructed using DNA isolated from a wide variety of micro-environments around the world.
  • Application of an appropriate discovery method then allows enzymes to be extracted from these libraries according to function, enzyme class or a specific combination ofthe two.
  • the preferred discovery method ensures capture of genes from uncultivated microbes and facilitates screening in well-defined, domesticated laboratory hosts. This expression cloning method results in simultaneous capture of enzyme activities and the corresponding genetic information.
  • the invention provides high throughput fluorogenic assays for determining if a polypeptide is within the scope of the invention and for obtaining epoxide hydrolases (EHs).
  • EHs epoxide hydrolases
  • a high throughput fluorogenic discovery screening for epoxide hydrolases was developed based on a periodate-coupled activity assay for epoxide hydrolase activity described by Badalassi (2000) Angew Chem. Int Ed 39:4067-4070. This assay utilizes an epoxide substrate containing a masked umbelliferone fluorophore that can generate strong fluorescence when released.
  • the umbelliferone moiety is unmasked when the vicinal diol product ofthe enzymatic reaction is oxidatively cleaved by periodate to generate a carbonyl-containing intermediate, which can undergo a ⁇ -elimination reaction under basic conditions.
  • the ⁇ -elimination step is accelerated by bovine serum albumin (BSA).
  • the epoxide (Ebum, epoxybutoxyumbelliferone), a derivative of 1- hydroxycoumarin with an epoxy side chain, was chosen for use as the substrate in the assay development and subsequent screening.
  • the 7-O-alkylated coumarin is a much weaker fluorescent compound than 7-hydroxyco__narin.
  • the leaving group places niinimal steric restrictions on the epoxide ring and therefore is ideally suited for general discovery.
  • the substrate was synthesized in two steps from 7-hydroxycoumarin: coupling of 7-hydroxycoumarin with 4-bromo-l-butene in the presence of potassium carbonate at 50°C followed by an epoxidation reaction using meta-chloroperbenzoic acid (mCPBA).
  • a previously identified epoxide hydrolase gene was cloned into pSE420 (Invitrogen) and expressed in E. coli.
  • This enzyme, SEQ ID NO:l, SEQ ID NO:2 was found to be active on Ebum and was utilized as a positive control to optimize the assay conditions. Fresh overnight cultures of whole cells were found to be suitable for use in assays directly. The optimal substrate concentration, pH, temperature and incubation time were determined for the assay.
  • a robotic screen was developed whereby all the liquid handling and fluorescence measurement processes were automated, as shown in Figure 7.
  • Clones from gene libraries were distributed into individual wells, preferably 5 clones per well for the primary screening. These clones were allowed to grow before Ebum and other reagents were added. After several hours of incubation, the fluorescence level in each well was measured to identify preliminary hits. These hits were reconfirmed through a secondary assay. The screen was performed on 384- well plates but it can also be hnplemented on the 1536-well plates.
  • a sequence-based high throughput assay has also been successfully developed. Both the prokaryotic and eukaryotic EHs belong to the ⁇ , ⁇ -hydrolase fold superfamily and share low, but significant sequence homology.
  • Bacterial EHs have higher sequence similarity. Alignments ofthe nucleotide sequences of bacterial EHs have allowed the identification of conserved sequences. Primers were designed based on these regions. These primers were used to generate PCR products from Diversa's DNA libraries that were used to make multiple biotinylated hybridization probes known as hooks. Novel epoxide hydrolase genes were retrieved by either Diversa's Biopanning TM (Diversa Co ⁇ oration, San Diego, CA) or hybridization technologies, see, e.g., U.S. Patent No. 6,455,254. The sequence-based approach serves as a complementary method to the activity-based discovery.
  • FIG. 17 is an illustration of environmental library biopanning assay of the mvention (in one aspect, using an enzyme of the invention) for sequence-based discovery.
  • Epoxides are known to be toxic to microbes due to alkylation of proteins and nucleic acids. Therefore it is critical that selection hosts can tolerate epoxide levels suitable for selections.
  • concentrations of glycidol and propylene oxide were investigated. The results showed that E. coli could tolerate up to 10 mM of glycidol and propylene oxide. This concentration may be high enough for selections as it was found that the cells were able to grow with 5 mM glycerol provided exfracellularly in the media as the sole carbon source.
  • Glycerol utilization in E. coli is suppressed via feedback inhibition on glycerol kinase (GlpK) by fructose 1,6-bisphosphate as well as a repressor encoded by glpR.
  • GlpK glycerol kinase
  • FBP fructose 1,6-bisphosphate
  • glpR glycerol kinase
  • An E. coli mutant with mutations in the glpK gene that abolished the feedback inhibition by FBP, and a deactivated glpR gene was obtained and further engineered to be a suitable host for selections. It was shown that this mutant could utilize glycerol more efficiently. It has been shown that an E.
  • coli mutant with a constitutively expressed oxidoreductase can utilize propane diol as the sole carbon source (Hacking (1976) J. Bacteriol. 126: 1166- 1172).
  • the enzyme FucO converts propane diol to lactaldehyde that is further metabolized.
  • Such a mutant was also obtained and engineered to be suitable for selections.
  • Chhal GC methods have been developed for the quantitative analysis for epicMorohydrin, methyl glycidate, cyclohexene oxide, cyclopentene oxide and theh respective diols.
  • Chhal HPLC methods have also been developed for the quantitative analysis for cis- stilbene oxide, 3-chlorostyrene oxide and their respective diols.
  • Epoxide hydrolase genes were subcloned into pSE420 and expressed in various E. coli hosts. C-terminal His-tags were used to facilitate protein purification. The total expressed protein was examined on SDS-PAGE. Further purification using NTA resin-containing spin columns at small scale was also carried out to determine the solubility and expression level ofthe deshed proteins. When there was no detectable expression or low levels of expression, E. coli hosts that stabilize mRNA or contain tRNA synthetases for rare codons were used to improve the expression. When the expressed proteins were insoluble, different induction conditions such as lower IPTG concentrations, lower induction temperature were employed. Overall, over 90% of the subclones achieved good expression.
  • the enantioselectivity ofthe enzyme-catalyzed reactions was also determined.
  • E value enantiomeric ratio
  • enzymes exhibit diverse enantioselectivities.
  • enzymes were found that are selective for either enantiomers ofthe racemic epoxides in kinetic resolution reactions or either enantiomers ofthe diols in desymmetrization reactions. This offers a significant advantage over the existing microbial EHs that were often found to be selective for only one enantiomer.
  • epoxide hydrolases ofthe invention hydrolyze cis-stilbene oxide at over 96% ee.
  • epoxide hydrolases ofthe invention also exhibited good selectivity toward short-chain aliphatic epoxides such as epichlorohydrin. Previously reported resolution with other enzymes had very poor selectivity (E ⁇ 2) (see, e.g., Spelberg (1999) Tetrahedron: Asymmetry 10:2863-2870).
  • the invention provides two complementary high throughput screens for epoxide hydrolases: an activity-based fluorogenic assay and a sequence-based assay.
  • the invention provides a chiral analytic assays for several epoxides and theh corresponding diols.
  • a biocatalytic process usually is an integral part of an overall process for 20 the preparation of active pharmaceutical ingredients (APIs) that also consists of other chemical steps. It is therefore very important to place the development of biocatalytic processes within the context ofthe overall process development. When introducing a new biocatalytic step, one must consider whether it can be readily integrated with the rest of chemical steps and how the downstream chemistry may be optimized. Described below is how the three biocatalytic steps of the invention may be integrated into theh respective overall processes.
  • a key intermediate 10 can be prepared from la in four steps (see, e.g., U.S. Patent No. 5,705,647,).
  • the thiophenyl functionality can be introduced by the nucleophilic azhidine ring opening to afford 11a, from which nelfinavh can be synthesized using established chemistry.
  • a process for the preparation of nelfinavh, the top selling antiviral drug among all the HIV protease inhibitors, can also be developed using lb. As shown in Scheme 6, this process introduces the thiophenyl group via an oxazoline intermediate 12 (see, e.g., Kim (2001) Org Lett. 3:2349-2351).
  • lb can be readily converted to la by using metal halides such as LiCl. It is also conceivable that the aziridine 10 may also be prepared from lb directly. Therefore, both la and lb will be used in the initial screening of EHs. This strategy offers flexibility in the biocatalyst selection and the subsequent process development. The integration of 3-R-chlorostyrene oxide is rather straightforward.
  • S-oxiranylmethyl acetamide 3 is also readily integrated into the overall synthesis of oxazolidinone antibiotics such as linezolid (see, e.g., Schaus (1996)
  • Epoxide 3 can also be used to make aminomethyl benzodioxanes 13, the key intermediates for the preparation of serotonergic agonists, in two steps (Scheme 8).
  • Epoxides 4 can be readily synthesized from l,4-dihydroxy-2-butene as shown in Scheme 9. Chlorination or tosylation ofthe olefin followed by epoxidation generates 4a and 4b, respectively.
  • Racemic 3-chlorostyrene oxide (5) was synthesized in Phase I from 3- chlorostyrene through m-chloroperbenzoic acid (MCPBA)-mediated oxidation. Small quantities of R-isomer were obtained from Aldrich. The diols were obtained from alkaline hydrolysis ofthe epoxides.
  • MCPBA m-chloroperbenzoic acid
  • Epoxide 6 may be synthesized from either allylarnine or epichlorohydrin as shown in Scheme 11.
  • Analytical amount ofthe pure enantiomer 3 can be prepared from S-epichlorohydrin. It is worth pointing out that this is not a viable route commercially to compete with the biocatalytic process due to the high cost of S- epichlorohydrin as the starting material.
  • the diols may be synthesized by alkaline hydrolysis of theh respective epoxides.
  • the invention provides analytical methods for identification of epoxide hydrolases (EHs) with the desired activity and enantioselectivity from enzyme libraries. Chromatography on chiral GC and/or HPLC columns provides quantitative analysis of both the conversion (yield) and the enantioselectivity (enantiomeric access (ee)). A number of chhal GC and HPLC methods (e.g. a chiral HPLC method for analyzing 3- chlorostryene oxide and its diol products) have been developed for the quantitative analysis of epoxides and diols in Phase I of this project. The invention also provides HPLC methods for the analysis of epoxides 4b and lb, epoxide 6 and its diols will be developed, and a GC method for 4a and la. Screening of EHs
  • the previously produced enzymes can be reconstituted by the addition of water and the reactions are carried out hi 96-well plates.
  • a final subsfrate concentration of 2 mg/ml and an enzyme concenfration of 0.5 mg/ml can be used in the initial screemng.
  • the substrates are normally prepared hi more concentrated form in organic solvents such as acetonitrile or ethanol so that 5% of organic co-solvent is present in the reactions. Aliquots can be withdrawn at various time points to monitor the progress ofthe reactions on GC/HPLC.
  • the enantioselectivity ofthe enzymes is measured by ee % of the diol products, which can be calculated from the GC/HPLC analysis.
  • the enantioselectivity ofthe enzymes is measured by the E value, which can be calculated from the reaction conversion and the ee % ofthe remaining subsfrates based on HPLC analysis.
  • reaction conditions There are two goals for optimization of reaction conditions. One is to find the conditions under which the enantioselectivity of epoxide hydrolases can be improved to the deshed level. For a desymmetrization reaction, it is desirable to have an ee value of over 98%. For a kinetic resolution reaction, an E value of over 100 is generally considered to be practical. Many reaction parameters, in particular, organic solvents and other additives, have been known to affect the enzyme enantioselectivity. Significantly higher ee and E values may be obtained with the use of a particular organic co-solvent or with the subsfrate as the co-solvent.
  • the second goal is to find the optimal conditions that can give the highest volumetric productivity, which is defined as the mass of product synthesized in a defined volume in certain amount of time.
  • the volumetric productivity is determined by a combination ofthe enzyme stability, activity and the substrate concentration. Both the enzyme activity and stability may also be affected by the reaction parameters including pH, temperature and organic solvents. Higher subsfrate concentrations are necessary for efficient large-scale production. Therefore, the highest possible subsfrate concentration needs to be determined for the identified candidates under the established optimal conditions.
  • Subsfrate inhibition has been reported in some epoxide hydrolase-catalyzed reactions (see, e.g., Genzel (2001) J. Org. Chem. 66:538-543). Two sfrategies can be taken to solve this problem if it occurs: bioreactor engineering (such as batch feed of subsfrates) and enzyme engineering via directed evolution.
  • solvents and theh content e.g. methanol, ethanol, dimethyl sulfi.de, acetone, acetonitrile, etc.
  • other additives e.g. detergents
  • lead enzymes may already possess the required performance criteria and no iixrther improvement may be needed.
  • lead enzymes for targets 1-3 may not have all the deshed characteristics for ultimate industrial use. For example, higher enantioselectivity and/or activity as well as optimal stability may be required. Additionally, enzyme inactivation by epoxide subsfrates may pose problems at high concenfration reactions, necessitating further enzyme engineering. These improvements of enzyme characteristics may be addressed by rapid laboratory evolution. Diversa has utilized its directed evolution technologies for improving enzyme enantioselectivity and many other characteristics, and these technologies have successfully provided highly robust enzymes with improved selectiviti.es and turnover rates.
  • GSSMTM Gene Site Saturation Mutagenesis
  • Figure 9 GeneReassemblyTM
  • GSSMTM technology is used to create a family of related sequences which all differ from a parent sequence by a single amino acid change at a defined position. The technology creates a comprehensive library of all possible single amino acid substitutions in a given protein. Using an assay specific to the targeted phenotypic characteristic, this family of variants can be screened for improved variants in the mutated population. Following the identification of improved variants, the changes, many of which may exhibit additive or synergistic effects, can be recombined into a single highly improved version ofthe enzyme.
  • GSSMTM technology overcomes deficiencies inherent in traditional site-directed mutagenesis methods.
  • GeneReassemblyTM technologies use various methods for blending remote gene homologues (see, e.g., U.S. Patent No. 6,489,145).
  • the technologies enable both stochastic and non-stochastic homologue blending resulting in evolution libraries containing up to 10,000,000 variants.
  • the approaches enable the reassembly of genes with as little as 20% DNA:DNA homology.
  • GSSMTM Gene Site Saturation Mutagenesis
  • GeneReassemblyTM methods numerous enzymes have been optimized for process performance.
  • enantioselectivity and activity have also been improved in these processes.
  • Figure 9 illustrates DhectEvolution® (Diversa Co ⁇ oration, San Diego, CA) technology, which allows enzyme optimization through ulfra-high- throughput (UHTP) screening of combined point mutations and the blending of genes with favorable characteristics.
  • UHTP ulfra-high- throughput
  • GSSMTM Gene Site Saturation Mutagenesis
  • GeneReassemblyTM methods technologies can be used to create clone variant libraries for those lead enzymes that need to be further modified ("improved”).
  • the key to these dhected evolution experiments is the development of a high throughput assay that allows the screening of mutant libraries rapidly. Such an assay should be able to monitor both the enantioselectivity and the activity ofthe reactions.
  • MS-based assay offers both the necessary throughput and the capability of determirting enantioselectivity and activity parameters.
  • MS Mass Spectrometry
  • a single enantiomeric epoxide e.g. the S-isomer
  • its deuterated pseudo enantiomer are mixed in a 1:1 ratio to simulate a racemate.
  • the hydrolysis ofthe two subsfrates can generate a pair of pseudo enantiomeric diol products.
  • these two pahs of pseudo enantiomers can be differentiated by MS.
  • the enantioselectivity and the conversion can be obtained.
  • the enantiomeric ratio E can thus be calculated to allow the identification ofthe mutants with higher selectivity.
  • the specific activity ofthe mutants can also be obtained from the conversion.
  • a deuterated enantiomer of R-3-chlorastyrene oxide may be synthesized according to Scheme 13.
  • a deuterated enantiomer of 3 can be synthesized using a method similar to the synthesis of 3 but with inexpensive d 6 -acetic anhydride in the acetylation step (Scheme 14).
  • MS-based screens may be best utilized to identify a small number of up- mutants quickly from the variant library. These up-mutants may be further characterized in detail with HPLC or GC methods so that the best evolved enzyme(s) can be unambiguously identified.
  • MS-based screens prove to be problematic, chiral chromatographic methods may also be used for the screening.
  • these methods including HPLC, GC or capillary electrophoresis (CE), offer the separation of enantiomers and simple quantification.
  • the challenge is that the throughput may not be as high as that of MS.
  • recent development in multi-channel HPLC and CE technologies has made it possible to screen up to 1,000 samples per day using these instruments (See, e.g., Reetz (2001) Angew Chem, Int. Ed. 40:284-310; Reetz (2000) Angew Chem, Int. Ed. 39:3891-3893).
  • the evolved enzyme(s) can be utilized in subsequent process development. Reaction parameters can again be optimized. Reactions can be run in mini-bioreactors at several hundred milliliter-scale. Gram quantities of products can be prepared. Methods to isolate products can be evaluated and downstream chemistry can be validated. Definitions
  • epoxide hydrolase includes all polypeptides having an epoxide hydrolase (EH) activity, including the hydrolysis of epoxides, including asymmetric hydrolysis of epoxides on a preparative scale, to generate the corresponding vicinal diol.
  • the epoxide hydrolase activity comprises enantioconvergent processes for the generation of a single enantiomeric diol from a racemic oxirane.
  • the epoxide hydrolase activity comprises hydrolysis of highly substituted epoxides, e.g., highly substituted 2,2- and 2,3-disubstituted epoxides.
  • the epoxide hydrolase activity comprises use as a hydrolase in Sha ⁇ less epoxidation, Katsuki-Jacobsen reactions, Shi Epoxidation and Jacobsen hydrolytic kinetic resolution
  • the epoxide hydrolase activity comprises desymmetrization of meso-epoxides.
  • antibody 55 includes a peptide or polypeptide derived from, modeled after or substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, capable of specifically binding an antigen or epitope, see, e.g. Fundamental Immunology, Third Edition, W.E. Paul, ed., Raven Press, N.Y. (1993); Wilson (1994) J. Immunol. Methods 175:267-273; Yarmush (1992) J. Biochem. Biophys. Methods 25:85-97.
  • the teim antibody includes antigen-binding portions, i.e., "antigen binding sites,” (e.g., fragments, subsequences, complementarity determining regions (CDRs)) that retain capacity to bind antigen, including (i) a Fab fragment, a monovalent fragment consisting ofthe VL, NH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting ofthe NH and CHI domains; (iv) a Fv fragment consisting ofthe NL and NH domains of a single ann of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a NH domain; and (vi) an isolated complementarity determining region (CDR).
  • Single chain antibodies are also included by reference in
  • array or “microarray” or “biochip” or “chip” as used herein is a plurality of target elements, each target element comprismg a defined amount of one or more polypeptides (including antibodies) or nucleic acids immobilized onto a defined area of a substrate surface, as discussed in further detail, below.
  • a “coding sequence of or a “sequence encodes” a particular polypeptide or protein is a nucleic acid sequence which is transcribed and translated into a polypeptide or protem when placed under the confrol of appropriate regulatory sequences.
  • expression cassette refers to a nucleotide sequence which is capable of affecting expression of a structural gene (i.e., a protem coding sequence, such as an epoxide hydrolase ofthe invention) in a host compatible with such sequences.
  • Expression cassettes include at least a promoter operably linked with the polypeptide coding sequence; and, optionally, with other sequences, e.g., transcription termination signals. Additional factors necessary or helpful in effecting expression may also be used, e.g., enhancers.
  • expression cassettes also include plasmids, expression vectors, recombinant viruses, any form of recombinant "naked DNA" vector, and the like.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory sequence to a transcribed sequence.
  • a promoter is operably linked to a coding sequence, such as a nucleic acid ofthe invention, if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are czs-acting.
  • some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • a "vector” comprises a nucleic acid which can infect, transfect, transiently or permanently fransduce a cell. It will be recogmzed that a vector can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid.
  • the vector optionally comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a vhal lipid envelope, etc.).
  • Nectors include, but are not limited to replicons (e.g., R A replicons, bacteriophages) to which fragments of D ⁇ A may be attached and become replicated.
  • Nectors thus include, but are not limited to R ⁇ A, autonomous self-replicating circular or linear D ⁇ A or R ⁇ A (e.g., plasmids, viruses, and the like, see, e.g., U.S. Patent No. 5,217,879), and include both the expression and non-expression plasmids.
  • a recombinant microorganism or cell culture is described as hosting an "expression vector” this includes both extra-chromosomal circular and linear DNA and DNA that has been inco ⁇ orated into the host chromosome(s).
  • the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is inco ⁇ orated within the host's genome.
  • promoter includes all sequences capable of driving transcription of a coding sequence in a cell, e.g., a plant cell.
  • promoters used hi the constructs ofthe invention include cw-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene.
  • a promoter can be a c ⁇ -acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an infronic sequence, which are involved in transcriptional regulation.
  • cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate;, etc.) transcription.
  • Constutive promoters are those that drive expression continuously under most envhonmental conditions and states of development or cell differentiation.
  • Inducible or “regulatable” promoters direct expression ofthe nucleic acid ofthe invention under the influence of envhonmental conditions or developmental conditions. Examples of envhonmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, or the presence of light.
  • tissue-specific promoters are transcriptional control elements that are only active in particular cells or tissues or organs, e.g., in plants or animals.
  • Tissue-specific regulation may be achieved by certain intrinsic factors which ensure that genes encoding proteins specific to a given tissue are expressed. Such factors are known to exist in mammals and plants so as to allow for specific tissues to develop.
  • plant includes whole plants, plant parts (e.g., leaves, stems, flowers, roots, etc.), plant protoplasts, seeds and plant cells and progeny of same.
  • the class of plants which can be used in the method ofthe invention is generally as broad as the class of higher plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), as well as gymnosperms. It includes plants of a variety of ploidy levels, including polyploid, diploid, haploid and hemizygous states.
  • transgenic plant includes plants or plant cells into which a heterologous nucleic acid sequence has been inserted, e.g., the nucleic acids and various recombinant constructs (e.g., expression cassettes) of the invention.
  • Plasmids can be commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. Equivalent plasmids to those described herein are known in the art and will be apparent to the ordinarily skilled artisan.
  • gene includes a nucleic acid sequence comprising a segment of DNA involved in producing a franscription product (e.g., a message), which in rum is franslated to produce a polypeptide chain, or regulates gene franscription, reproduction or stability.
  • Genes can include regions preceding and following the coding region, such as leader and trailer, promoters and enhancers, as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).
  • nucleic acid 55 or “nucleic acid sequence” includes oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA (e.g., mRNA, rRNA, tRNA) of genomic or synthetic origin which may be single- stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin, including, e.g., iRNA, ribonucleoproteins (e.g., iRNPs).
  • DNA or RNA e.g., mRNA, rRNA, tRNA
  • PNA peptide nucleic acid
  • DNA-like or RNA-like material natural or synthetic in origin, including, e.g., iRNA, ribonucleoproteins (e.g., iRNPs).
  • nucleic acids i.e., oligonucleotides, containing known analogues of natural nucleotides.
  • the term also encompasses nucleic-acid-like structures with synthetic backbones, see e.g., Mata (1997) Toxicol. Appl. Pharmacol. 144:189-197; Sfrauss-Soukup (1997) Biochemistry 36:8692-8698; Strain (1996) Antisense Nucleic Acid Drag Dev 6:153- 156.
  • amino acid or amino acid sequence include an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules.
  • polypeptide and protem include amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids.
  • polypeptide also includes peptides and polypeptide fragments, motifs and the like. The term also includes glycosylated polypeptides.
  • the peptides and polypeptides ofthe invention also include all "mimetic 55 and "peptidomimetic 55 forms, as described in further detail, below.
  • isolated 55 includes a material removed from its original environment, e.g., the natural environment if it is naturally occurring.
  • a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all ofthe coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural envh Otiment.
  • an isolated material or composition can also be a "purified 55 composition, i.e., it does not requhe absolute purity; rather, it is intended as a relative definition.
  • Individual nucleic acids obtained from a library can be conventionally purified to electrophoretic homogeneity.
  • the invention provides nucleic acids which have been purified from genomic DNA or from other sequences in a library or other environment by at least one, two, three, four, five or more orders of magnitude.
  • the term "recombmanf 5 can include nucleic acids adjacent to a "backbone 55 nucleic acid to which it is not adjacent in its natural environment.
  • nucleic acids represent 5% or more ofthe number of nucleic acid inserts in a population of nucleic acid "backbone molecules.
  • Backbone molecules 55 include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest.
  • the enriched nucleic acids represent 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or more ofthe number of nucleic acid inserts in the population of recombinant backbone molecules.
  • Recombinant 55 polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; e.g., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein.
  • Synthetic 55 polypeptides or protein are those prepared by chemical synthesis, as described in further detail, below.
  • a promoter sequence can be "operably linked to 5 ' a coding sequence when
  • RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA, as discussed further, below.
  • Oligonucleotide includes either a single sfranded polydeoxynucleoti.de or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another ohgonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide can ligate to a fragment that has not been dephosphorylated.
  • substantially identical in the context of two nucleic acids or polypeptides, can refer to two or more sequences that have, e.g., at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 61%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more nucleotide or amino acid residue (sequence) identity, when compared and aligned for maximum correspondence, as measured using one any known sequence comparison algorithm, as discussed in detail below, or by visual inspection.
  • nucleotide or amino acid residue (sequence) identity when
  • the invention provides nucleic acid and polypeptide sequences having substantial identity to an exemplary sequence ofthe invention, e.g., SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO:85 (nucleic acids) SEQ ID NO:82, SEQ ID NO:84, or SEQ ID NO:86 (polypeptides), over a region of at least about 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 or more residues, or a region ranging from between about 50 residues to the full length of the nucleic acid or polypeptide.
  • Nucleic acid sequences ofthe invention can be substantially identical over the enthe length of a polypeptide coding region.
  • a "substantially identical" amino acid sequence also can include a sequence that differs from a reference sequence by one or more conse ⁇ -ttive or non- conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site ofthe molecule, and provided that the polypeptide essentially retains its functional properties.
  • a conservative amino acid substitution for example, substitutes one amino acid for another ofthe same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine).
  • One or more amino acids can be deleted, for example, from an epoxide hydrolase, resulting in modification ofthe structure ofthe polypeptide, without significantly altering its biological activity.
  • amino- or carboxyl-terminal amino acids that are not required for epoxide hydrolase activity can be removed.
  • Hybridization 55 includes the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art. For example, stringency can be increased by reducing the concenfration of salt, increasing the concentration of formamide, or raising the hybridization temperature, altering the time of hybridization, as described in detail, below.
  • nucleic acids ofthe invention are defined by theh ability to hybridize under various stringency conditions (e.g., high, medium, and low), as set forth herein.
  • "Variant 55 includes polynucleotides or polypeptides of the hivention modified at one or more base pahs, codons, infrons, exons, or amino acid residues (respectively) yet still retain the biological activity of an epoxide hydrolase of the invention.
  • Variants can be produced by any number of means included methods such as, for example, error-prone PCR, shuffling, oligonucleotide-dhected mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, GSSM and any combination thereof.
  • Techniques for producing variant epoxide hydrolase having activity at a pH or temperature, for example, that is different from a wild-type epoxide hydrolase, are included herein.
  • GSSM 55 saturated mutagenesis or "GSSM 55 includes a method that uses degenerate oligonucleotide primers to infroduce point mutations hito a polynucleotide, as described in detail, below.
  • optical directed evolution system 55 includes a method for reassembling fragments of related nucleic acid sequences, e.g., related genes, and explained in detail, below.
  • SLR synthetic ligation reassembly 55
  • the invention provides nucleic acids, e.g., SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85; nucleic acids encoding polypeptides as set forth in SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, including expression cassettes such as expression vectors, encoding the polypeptides ofthe invention.
  • the invention also includes methods for discovering new epoxide hydrolase sequences using the nucleic acids ofthe invention.
  • the invention also includes methods for inhibiting the expression of epoxide hydrolase genes, transcripts and polypeptides using the nucleic acids ofthe invention. Also provided are methods for modifying the nucleic acids ofthe invention by, e.g., synthetic ligation reassembly, optimized directed evolution system and/or saturation mutagenesis.
  • SEQ ID NO: 81 is atggccgcac aggcgaaccc cgagatccga ccattccgca tcgacgtacc gcaggcagac 60 ctggacgacc tgcgggaccg gctggcgcaa agccgctggc ccgagctggt ctcaccggc 120 tgggagcggg gcgtcccggt cgcctacctc aaggacctgg ccgactactg ggccaactcg 180 tacgactggc gggcgcacga ggccgcgctc aacgaatacc cccagtttac gaccgacatc 240 gatgggcaga ccatccacttt cccccgagcggacgcgcgcgagcggacgcgcg
  • SEQ ID NO:83 is atgagcgaca tcaccccgtt tcagatccag attcccgaca gtgaactcga cgacctgcgc 60 cgtcgcctgg cgagcacgcg atggcccaac cctgagccgg tctcggattg gtcgcagggc 120 atccctctcg ggtatctcca ggaagtctgc gcgtattggg caaaagacta cgactggcgg 180 gcgcgcgagg cccatctcaa ccagtttccc cagttcaaga ccgaaatcga tggcctgggc 240 atccacttca tccacgtcaa gtcggcggag ccgaacgcccc tc
  • SEQ ID NO: 85 is atgccagcga tccagcacac ctccatcgaa gcccgcggct tcagcactca tgtcgcgcag 60 tgcggaaacg gtccgccact gctcctgctg cacggctggc ccgagttctg ggcgacctgg 120 gagcccatgt tcgagcgcct cgaccga taccggctga tcgccccga cttccgcggc 180 ttcggcgaga gcggcaatcc gacgcggaa cggtccgacc agacgggcccc cgacgtgctg 240 gccgacgaca tcgcggccgt catggatgcg ctcgggcggg
  • nucleic acids ofthe invention can be made, isolated and/or mampulated by, e.g., cloning and expression of cDNA libraries, amplification of message or genomic DNA by PCR, and the like.
  • homologous genes can be modified by manipulating a template nucleic acid, as described herein.
  • the invention can be practiced in conjunction with any method or protocol or device known in the art, which are well described in the scientific and patent literature.
  • RNA, iRNA, antisense nucleic acid, cDNA, genomic DNA, vectors, viruses or hybrids thereof may be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/ generated recombinantly. Recombinant polypeptides generated from these nucleic acids can be individually isolated or cloned and tested for a deshed activity. Any recombinant expression system can be used, including bacterial, mammalian, yeast, insect or plant cell expression systems.
  • these nucleic acids can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Fren el (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Patent No. 4,458,066.
  • nucleic acids such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook, ed., MOLECULAR CLONING: A LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, ed.
  • Sources of nucleic acid used in the methods ofthe invention include genomic or cDNA libraries contained in, e.g., mammalian artificial chromosomes (MACs), see, e.g., U.S. Patent Nos. 5,721,118; 6,025,155; human artificial chromosomes, see, e.g.,
  • a nucleic acid encoding a polypeptide ofthe invention is assembled in appropriate phase with a leader sequence capable of dfrecting secretion of the franslated polypeptide or fragment thereof.
  • the invention provides fusion proteins and nucleic acids encoding them.
  • a polypeptide of the invention can be fused to a heterologous peptide or polypeptide, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification.
  • Peptides and polypeptides ofthe invention can also be synthesized and expressed as fusion proteins with one or more additional domains linked thereto for, e.g., producing a more immunogenic peptide, to more readily isolate a recombinantly synthesized peptide, to identify and isolate antibodies and antibody-expressing B cells, and the like.
  • Detection and purification facilitating domains include, e.g., metal chelating peptides such as polyhistidine tracts and histidine- tryptophan modules that allow purification on immobilized metals, protem A domains that allow purification on immobilized immunoglobulin, and the domain utilized in tlie FLAGS extensior- affinity purification system (Immunex Co ⁇ , Seattle WA).
  • metal chelating peptides such as polyhistidine tracts and histidine- tryptophan modules that allow purification on immobilized metals
  • protem A domains that allow purification on immobilized immunoglobulin
  • domain utilized in tlie FLAGS extensior- affinity purification system Immunex Co ⁇ , Seattle WA.
  • the inclusion of a eleavable linker sequences such as Factor Xa or enterokinase (Invitrogen, San Diego CA) between a purification domain and the motif-comprising peptide or polypeptide to facilitate purification.
  • an expression vector can include an epitope-encoding nucleic acid sequence linked to six histidine residues followed by a thioredoxin and an enterokinase cleavage site (see e.g., Williams (1995) Biochemistry 34:1787-1797; Dobeli (1998) Protein Expr. Purif. 12:404-414).
  • the histidine residues facilitate detection and purification while the enterokinase cleavage site provides a means for purifying the epitope from the remainder ofthe fusion protein.
  • Technology pertaining to vectors encoding fusion proteins and application of fusion proteins are well described in the scientific and patent literature, see e.g., KroII (1993) DNA Cell. Biol., 12:441-53.
  • the invention provides nucleic acid (e.g., DNA) sequences ofthe invention operatively linked to expression (e.g., transcriptional or translational) control sequence(s), e.g., promoters or enhancers, to dhect or modulate RNA synthesis/ expression.
  • expression control sequence can be in an expression vector.
  • Exemplary bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and tip.
  • Exemplary eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from refrovirus, and mouse metallothionein I. Promoters suitable for expressing a polypeptide in bacteria include the E.
  • Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter.
  • Transcriptional and translational regulatory sequences used in the expression cassettes and vectors ofthe invention include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.
  • the regulatory sequences include a promoter and transcriptional start and stop sequences.
  • Promoter sequences encode either constitutive or inducible promoters.
  • the promoters may be either naturally occurring promoters or hybrid promoters.
  • Hybrid promoters which combine elements of more than one promoter, are also known in the art, and are useful in the present invention.
  • the promoters are strong promoters, allowing high expression in cells, particularly mammalian cells, such as the CMV promoter, particularly in combination with a Tet regulatory element.
  • the invention provides expression cassettes that can be expressed in a tissue-specific manner, e.g., that can express an epoxide hydrolase ofthe invention in a tissue-specific manner.
  • the invention also provides plants or seeds that express an epoxide hydrolase ofthe invention in a tissue-specific manner.
  • the tissue-specificity can be seed specific, stem specific, leaf specific, root specific, fruit specific and the like.
  • a constitutive promoter such as the CaMN 35S promoter can be used for expression in specific parts ofthe plant or seed or throughout the plant.
  • a plant promoter fragment can be employed which will dhect expression of a nucleic acid in some or all tissues of a plant, e.g., a regenerated plant.
  • Such promoters are referred to herein as "constitutive" promoters and are active under most envhonmental conditions and states of development or cell differentiation.
  • constitutive promoters include the cauliflower mosaic virus (CaMN) 35S transcription initiation region, the 1'- or 2'- promoter derived from T-D ⁇ A of Agrobacterium tumefaciens, and other franscription initiation regions from various plant genes known to those of skill. Such genes include, e.g., ACT11 from Arabidopsis (Huang
  • tissue-specific or constitutive promoters derived from viruses which can include, e.g., the tobamovirus subgenomic promoter (Kumagai (1995) Proc. Natl. Acad. Sci. USA 92:1679-1683; the rice tungro bacilliform virus (RTBV), which replicates only in phloem cells in infected rice plants, with its promoter which drives strong phloem-specific reporter gene expression; the cassava vein mosaic virus (CVMN) promoter, with highest activity in vascular elements, in leaf mesophyll cells, and in root tips (Verdaguer (1996) Plant Mol. Biol. 31:1129-1139).
  • viruses which can include, e.g., the tobamovirus subgenomic promoter (Kumagai (1995) Proc. Natl. Acad. Sci. USA 92:1679-1683; the rice tungro bacilliform virus (RTBV), which replicates only in phloem
  • the plant promoter may direct expression of epoxide hydrolase-expressing nucleic acid in a specific tissue, organ or cell type (i.e. tissue- specific promoters) or may be otherwise under more precise envhonmental or developmental control or under the control of an inducible promoter.
  • tissue-specific promoters i.e. tissue-specific promoters
  • envhonmental conditions include anaerobic conditions, elevated temperature, the presence of light, or sprayed with chemicals/hormones.
  • the invention inco ⁇ orates the drought-inducible promoter of maize (Busk
  • Tissue-specific promoters can promote transcription only within a certain time frame of developmental stage within that tissue. See, e.g., Blazquez (1998) Plant Cell 10:791-800, characterizing the Arabidopsis LEAFY gene promoter. See also Cardon (1997) Plant J 12:367-77, describing the franscription factor SPL3, which recognizes a conserved sequence motif in the promoter region of the A. thaliana floral meristem identity gene API; and Mandel (1995) Plant Molecular Biology, Vol. 29, pp 995-1004, describing the meristem promoter eIF4. Tissue specific promoters which are active throughout the life cycle of a particular tissue can be used.
  • the nucleic acids ofthe invention are operably linked to a promoter active primarily only in cotton fiber cells. In one aspect, the nucleic acids ofthe invention are operably linked to a promoter active primarily during the stages of cotton fiber cell elongation, e.g., as described by Rinehart (1996) supra.
  • the nucleic acids can be operably linked to the Fbl2A gene promoter to be preferentially expressed in cotton fiber cells (Ibid) . See also, John (1997) Proc. Natl. Acad. Sci. USA 89:5769-5773; John, et al., U.S. Patent Nos. 5,608,148 and 5,602,321, describing cotton fiber-specific promoters and methods for the construction of transgenic cotton plants.
  • Root-specific promoters may also be used to express the nucleic acids ofthe invention.
  • Examples of root-specific promoters include the promoter from the alcohol dehydrogenase gene (DeLisle (1990) Int. Rev. Cytol. 123:39-60).
  • Other promoters that can be used to express the nucleic acids of the invention include, e.g., ovule-specific, embryo-specific, endospenn-specific, integument- specific, seed coat-specific promoters, or some combination thereof; a leaf-specific promoter (see, e.g., Busk (1997) Plant J.
  • the Blec4 gene from pea which is active in epidermal tissue of vegetative and floral shoot apices of transgenic alfalfa making it a useful tool to target the expression of foreign genes to the epidermal layer of actively growing shoots or fibers
  • the ovule- specific BEL1 gene see, e.g., Reiser (1995) Cell 83:735-742, GenBank No. U39944)
  • the promoter in Klee, U.S. Patent No. 5,589,583, describing a plant promoter region is capable of conferring high levels of transcription in meristematic tissue and/or rapidly dividing cells.
  • plant promoters which are inducible upon exposure to plant hormones, such as auxins, are used to express the nucleic acids ofthe invention.
  • the invention can use the auxin-response elements El promoter fragment (AuxREs) in the soybean (Glycine max L.) (Liu (1997) Plant Physiol. 115:397-407); the auxin-responsive Arabidopsis GST6 promoter (also responsive to salicylic acid and hydrogen peroxide) (Chen (1996) Plant J. 10: 955-966); the auxin-inducible parC promoter from tobacco (Sakai (1996) 37:906-913); a plant biotin response element (Streit (1997) Mol. Plant Microbe Interact. 10:933-937); and, the promoter responsive to the stress hormone abscisic acid (Sheen (1996) Science 274:1900-1902).
  • auxin-response elements El promoter fragment AuxREs
  • the auxin-responsive Arabidopsis GST6 promoter also
  • the nucleic acids of the invention can also be operably linked to plant promoters which are inducible upon exposure to chemicals reagents which can be applied to the plant, such as herbicides or antibiotics.
  • plant promoters which are inducible upon exposure to chemicals reagents which can be applied to the plant, such as herbicides or antibiotics.
  • the maize In2-2 promoter activated by benzenesulfonamide herbicide safeners, can be used (De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem.
  • Coding sequence can be under the confrol of, e.g., a tefracycline-inducible promoter, e.g.
  • transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11:465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11:1315-1324).
  • chemically- (e.g., hormone- or pesticide-) induced promoters t.e., promoter responsive to a chemical which can be applied to the transgenic plant in the field
  • expression of a polypeptide ofthe invention can be induced at a particular stage of development of the plant.
  • the invention also provides for transgenic plants containing an inducible gene encoding for polypeptides ofthe invention whose host range is limited to target plant species, such as corn, rice, barley, wheat, potato or other crops, inducible at any stage of development ofthe crop.
  • target plant species such as corn, rice, barley, wheat, potato or other crops
  • a tissue-specific plant promoter may drive expression of operably linked sequences in tissues other than the target tissue.
  • a tissue-specific promoter is one that drives expression preferentially in the target tissue or cell type, but may also lead to some expression in other tissues as well.
  • the nucleic acids ofthe invention can also be operably linked to plant promoters which are inducible upon exposure to chemicals reagents.
  • These reagents include, e.g., herbicides, synthetic auxins, or antibiotics which can be applied, e.g., sprayed, onto transgenic plants.
  • Inducible expression ofthe epoxide hydrolase-producing nucleic acids ofthe invention will allow the grower to select plants with the optimal epoxide hydrolase expression and/or activity. The development of plant parts can thus controlled. In this way the invention provides the means to facilitate the harvesting of plants and plant parts.
  • the maize In2-2 promoter activated by benzenesulfonamide herbicide safeners
  • De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem.
  • Coding sequences ofthe invention are also under the confrol of a tetracycline-inducible promoter, e.g., as described with transgenic tobacco plants containing the Avena saliva L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11:465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11:1315-1324).
  • polyadenylation region at the 3'-end ofthe coding region should be included.
  • the polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from genes in the Agrobacterial T-DNA. Expression vectors and cloning vehicles
  • the mvention provides expression vectors and cloning vehicles comprising nucleic acids ofthe invention, e.g., sequences encoding the epoxide hydrolases of the invention.
  • Expression vectors and cloning vehicles of the invention can comprise viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g., vaccima, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), PI -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, Aspergillus and yeast).
  • Vectors ofthe invention can include chromosomal, non-chromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. Exemplary vectors are include: bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid or other vector may be used so long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention.
  • the expression vector can comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • Mammalian expression vectors can comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • the expression vectors contain one or more selectable marker genes to permit selection of host cells containing the vector.
  • Expression vectors ofthe invention may also include a selectable marker gene to allow for the selection of bacterial strains that have been transformed, e.g., genes which render the bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin and tefracycline.
  • Selectable markers can also include biosynthetic genes, such as those in the histidine, tryptophan and leucine biosynthetic pathways.
  • selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tefracycline or ampicillin resistance in E. coli, and the S. cerevisiae TRPl gene.
  • Promoter regions can be selected from any deshed gene using chloramphenicol transferase (CAT) vectors or other vectors with selectable markers.
  • CAT chloramphenicol transferase
  • Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its franscription. Examples include the SV40 enhancer on the late side ofthe replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side ofthe replication origin, and the adenovirus enhancers.
  • a nucleic acid sequence can be inserted into a vector by a variety of procedures. In general, the sequence is ligated to the deshed position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases.
  • blunt ends in both the insert and the vector may be ligated.
  • a variety of cloning techniques are known in the art, e.g., as described in Ausubel and Sambrook. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the vector can be in the form of a plasmid, a vhal particle, or a phage.
  • Other vectors include chromosomal, non-chromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • a variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by, e.g., Sambrook.
  • Particular bacterial vectors which can be used include the commercially available plasmids comprising genetic elements ofthe well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pDIO, ⁇ siX174 pBluescript II KS, pNH8A, pNH16a, ⁇ NH18A, ⁇ NH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, DR540, pRIT5 (Pharmacia), pKK232-8 and pCM7.
  • Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3 .
  • pBPV, pMSG, and pSVL Pharmacia
  • any other vector may be used as long as it is replicable and viable in the host cell.
  • the nucleic acids ofthe invention can be expressed in expression cassettes, vectors or viruses and transiently or stably expressed in plant cells and seeds.
  • One exemplary transient expression system uses episomal expression systems, e.g., cauliflower mosaic viras (CaMV) vhal RNA generated in the nucleus by franscription of an episomal mini-chromosome containing supercoiled DNA, see, e.g., Covey (1990) Proc. Natl. Acad. Sci. USA 87:1633-1637.
  • coding sequences, i.e., all or sub-fragments of sequences ofthe invention can be inserted into a plant host cell genome becoming an integral part ofthe host chromosomal DNA.
  • a vector comprising the sequences (e.g., promoters or coding regions) from nucleic acids ofthe invention can comprise a marker gene that confers a selectable phenotype on a plant cell or a seed.
  • the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosulfuron or Basta.
  • Expression vectors capable of expressing nucleic acids and proteins in plants are well known in the art, and can include, e.g., vectors from Agrobacterium spp., potato viras X (see, e.g., Angell (1997) EMBO J. 16:3675-3684), tobacco mosaic virus (see, e.g., Casper (1996) Gene 173:69-73), tomato bushy stunt virus (see, e.g., Hillman (1989) Vhology 169:42-50), tobacco etch viras (see, e.g., Dolja (1997) Virology
  • the expression vector can have two replication systems to allow it to be maintained in two organisms, for example in mammalian or insect cells for expression and in a prokaryotic host for cloning and amplification.
  • the expression vector can contain at least one sequence homologous to the host cell genome. It can contain two homologous sequences which flank the expression construct.
  • the integrating vector can be directed to a specific locus in the host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are well known in the art.
  • Expression vectors ofthe invention may also include a selectable marker gene to allow for the selection of bacterial strains that have been transformed, e.g., genes which render the bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin and tefracycline.
  • selectable markers can also include biosynthetic genes, such as those in the histidine, tryptophan and leucine biosynthetic pathways.
  • the mvention also provides a transformed cell comprising a nucleic acid sequence of the invention, e.g., a sequence encoding an epoxide hydrolase ofthe hivention, or a vector ofthe invention.
  • the host cell may be any ofthe host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells.
  • Exemplary bacterial cells include E. coli, Streptomyces, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium and various species within the genera Bacillus, Streptomyces, and Staphylococcus .
  • Exemplary insect cells include Drosophila S2 and Spodoptera S ⁇ >.
  • Exemplary animal cells include CHO, COS or Bowes melanoma or any mouse or human cell line.
  • the selection of an appropriate host is within the abilities of those skilled in the art. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising (1988) Ann. Rev. Genet. 22:421-477, U.S. Patent No. 5,750,870.
  • the vector can be introduced into the host cells using any of a variety of techniques, including transformation, fransfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate fransfection, DEAE-Dexfran mediated fransfection, lipofection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
  • the nucleic acids or vectors of the invention are introduced into the cells for screening, thus, the nucleic acids enter the cells in a manner suitable for subsequent expression of the nucleic acid.
  • the method of introduction is largely dictated by the targeted cell type. Exemplary methods include CaP0 4 precipitation, liposome fusion, lipofection (e.g., LIPOFECTINTM), electroporation, viral infection, etc.
  • the candidate nucleic acids may stably integrate into the genome ofthe host cell (for example, with retroviral introduction) or may exist either transiently or stably in the cytoplasm (i.e. through the use of traditional plasmids, utilizing standard regulatory sequences, selection markers, etc.). As many pharmaceutically important screens requhe human or model mammalian cell targets, retroviral vectors capable of fransfecting such targets are preferred.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes ofthe invention.
  • the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
  • Cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
  • Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • the expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulo se chromatography, hydrophobic mteraction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protem refolding steps can be used, as necessary, in completing configuration of the polypeptide. If deshed, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • mammalian cell culture systems can also be employed to express recombhiant protem.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.
  • the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated.
  • Polypeptides ofthe invention may or may not also include an initial methionine amino acid residue.
  • Cell-free translation systems can also be employed to produce a polypeptide of the invention.
  • Cell-free translation systems can use mRNAs transcribed from a DNA constract comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof.
  • the DNA construct may be linearized prior to conducting an in vitro franscription reaction.
  • the transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulo cyte extract, to produce the deshed polypeptide or fragment thereof.
  • the expression vectors can contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tefracycline or ampicillin resistance in E. coli.
  • nucleic acids ofthe invention and nucleic acids encoding the polypeptides ofthe invention, or modified nucleic acids ofthe invention can be reproduced by amplification.
  • Amplification can also be used to clone or modify the nucleic acids ofthe invention.
  • the invention provides amplification primer sequence pahs for amplifying nucleic acids ofthe invention.
  • One of skill in the art can design amplification primer sequence pairs for any part of or the full length of these sequences.
  • the invention provides a nucleic acid amplified by a primer pair ofthe invention, e.g., a primer pair as set forth by about the first (the 5 5 ) 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more residues of S ⁇ Q ID NO: l or S ⁇ Q ID NO:7, and about the first (the 5') 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more residues ofthe complementary sfrand (of S ⁇ Q ID NO:81, S ⁇ Q ID NO:83, or S ⁇ Q ID NO: 85).
  • a primer pair ofthe invention e.g., a primer pair as set forth by about the first (the 5 5 ) 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more residues of S ⁇ Q ID NO: l or S ⁇ Q ID NO:7, and about the first (the 5') 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more residues ofthe complementary sfrand (of S ⁇ Q ID NO
  • Amplification reactions can also be used to quantify the amount of nucleic acid in a sample (such as the amount of message in a cell sample), label the nucleic acid (e.g., to apply it to an array or a blot), detect the nucleic acid, or quantify the amount of a specific nucleic acid in a sample.
  • message isolated from a cell or a cDNA library are amplified.
  • Amplification methods are also well known in the art, and include, e.g., polymerase chain reaction, PCR (see, e.g., PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. ---mis, Academic Press, NY. (1990) and PCR STRATEGIES (1995), ed. Innis .
  • LCR ligase chain reaction
  • transcription amplification see, e.g., Kwoh (1989) Proc. Natl. Acad. Sci. USA 86:1173
  • self-sustained sequence replication see, e.g., Guatelli (1990) Proc. Natl. Acad. Sci. USA 87:1874)
  • Q Beta replicase amplification see, e.g., Smith (1997) J. Clin. Microbiol.
  • the invention provides nucleic acids comprising sequences having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary nucleic acid ofthe invention (e.g., SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, and nucleic acids encoding SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86) over a region of at least about 50, 75, 100, 150,
  • polypeptides comprising sequences having at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity to an exemplary polypeptide ofthe invention, e.g., SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86.
  • sequence identity may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2. or FASTA version 3.0-78, with the default
  • Table 2 is a chart describing selected characteristics of exemplary polypeptide SEQ ID NO:82, encoded by, e.g., SEQ ID NO:81, and exemplary polypeptide SEQ ID NO:84, encoded by, e.g., SEQ ID NO:83, including sequence identity comparison ofthe exemplary sequences to public databases.
  • Selected characteristics of polypeptide SEQ ID NO:86, encoded by, e.g., SEQ ID NO:85, include: NR Description: bh0418 [Bradyrhizobium japonicum] dbj
  • NR organism Bradyrhizobium japonicum Geneseq Protein Description: Residues 362 to 391 of rat epoxide hydrolase
  • NR refers to the Non-Redundant nucleotide database maintained by NCBI. This database is a composite of GenBank, GenBank updates, and EMBL updates.
  • the entries in the column "NR Description” refer to the definition line in any given NCBI record, which includes a description ofthe sequence, such as the source organism, gene name/protein name, or some description ofthe function of the sequence.
  • the entries in the column "NR Accession Code 55 refer to the unique identifier given to a sequence record.
  • the entries in the column “NR Evalue” refer to the Expect value (Evalue), which represents the probability that an alignment score as good as the one found between the query sequence (the sequences ofthe invention) and a database sequence would be found in the same number of comparisons between random sequences as was done in the present BLAST search.
  • the entries in the column “NR Organism” refer to the source organism of the sequence identified as the closest BLAST hit.
  • the second set of databases is collectively known as the GeneseqTM database, which is available through Thomson Derwent (Philadelphia, PA).
  • An EC number is the number assigned to a type of enzyme according to a scheme of standardized enzyme nomenclature developed by the Enzyme Commission ofthe Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUBMB).
  • the results in the "Predicted EC No.” column are determined by a BLAST search against the Kegg (Kyoto Encyclopedia of Genes and Genomes) database. If the top BLAST match has an Evalue equal to or less than e "6 , the EC number assigned to the top match is entered into the table. The EC number of the top hit is used as a guide to what the EC number ofthe sequence of the hivention might be.
  • the columns “Query DNA Length” and “Query Protein Length” refer to the number of nucleotides or the number amino acids, respectively, in the sequence ofthe invention that was searched or queried against either the NCBI or Geneseq databases.
  • the columns “Geneseq or NR DNA Length 55 and “Geneseq or NR Protein Length” refer to the number of nucleotides or the number amino acids, respectively, in the sequence ofthe top match from the BLAST search. The results provided in these columns are from the search that returned the lower Evalue, either from the NCBI databases or the Geneseq database.
  • Homologous sequences also include RNA sequences in which uridines replace the thymines in the nucleic acid sequences.
  • the homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth herein can be represented in the traditional single character format (see, e.g., Stryer, Lubert. Biochemistry, 3rd Ed., W. H Freeman & Co., New York) or in any other format which records the identity ofthe nucleotides in a sequence.
  • Various sequence comparison programs identified herein are used in this aspect ofthe invention.
  • Protein and/or nucleic acid sequence identities may be evaluated using any ofthe variety of sequence comparison algorithms and programs known in the art.
  • sequence comparison algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol. 215(3):403- 410, 1990; Thompson et al., Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol. 266:383-402, 1996; Altschul et al, J. Mol. Biol. 215(3):403-410, 1990; Altschul et al, Nature Genetics 3:266-272, 1993).
  • homology or identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package ofthe Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications.
  • sequence analysis software e.g., Sequence Analysis Software Package ofthe Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705
  • one sequence can act as a reference sequence, e.g., a sequence ofthe mvention, to which test sequences are compared.
  • a sequence comparison algorithm test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a "comparison window 55 includes reference to a segment of any one of the numbers of contiguous residues.
  • contiguous residues ranging anywhere from 20 to the full length of an exemplary polypeptide or nucleic acid sequence ofthe invention are compared to a reference sequence ofthe same number of contiguous positions after the two sequences are optimally aligned.
  • the reference sequence has the requisite sequence identity to an exemplary polypeptide or nucleic acid sequence of the mvention, e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to a sequence ofthe hivention, that sequence is within the scope ofthe mvention.
  • subsequences ranging from about 20 to 600, about 50 to 200, and about 100 to 150 are compared to a reference sequence ofthe same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequence for comparison are well known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of person & Lipman, Proc. Nat'l. Acad. Sci.
  • Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences.
  • a number of genome databases are available, for example, a substantial portion ofthe human genome is available as part ofthe Human Genome Sequencing Project (Gibbs, 1995).
  • Several genomes have been sequenced, e.g., M. genitalium (Fraser et al., 1995), M. jannaschii (Bult et al., 1996), H. influenzae (Fleischmann et al, 1995), E. coli (Blattner et al., 1997), and yeast (S. cerevisiae) (Mewes et al., 1997), andD.
  • BLAST, BLAST 2.0 and BLAST 2.2.2 algorithms are also used to practice the mvention. They are described, e.g., in Altschul (1977) Nuc. Acids Res. 25:3389- 3402; Altschul (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Bioteclmology Information. This algorithm involves first identifying high scoring sequence pahs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy- some positive-valued threshold score T when aligned with a word ofthe same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul (1990) supra).
  • HSPs high scoring sequence pahs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension ofthe word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation, of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed ofthe alignment.
  • W wordlength
  • E expectation
  • B BLOSUM62 scoring matrix
  • BLAST Basic Local Alignment Search Tool
  • five specific BLAST programs can be used to perform the following task: (1) BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database; (2) BLASTN compares a nucleotide query sequence against a nucleotide sequence database; (3) BLASTX compares the six- frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database; (4) TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and, (5) TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
  • the BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pahs, 55 between a query amino or nucleic acid sequence and a test sequence which is preferably obtained from a protein or nucleic acid sequence database.
  • High-scoring segment pahs are preferably identified (i.e., aligned) by means of a scoring matrix, many of which are known in the art.
  • the scoring matrix used is the BLOSUM62 matrix (Gonnet et al., Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993).
  • the PAM or PAM250 matrices may also be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation).
  • the NCBI BLAST 2.2.2 programs is used, default options to blastp. There are about 38 setting options in the BLAST 2.2.2 program. In this exemplary aspect ofthe invention, all default values are used except for the default filtering setting (i.e., all parameters set to default except filtering which is set to OFF); in its place a "-F F" setting is used, which disables filtering. Use of default filtering often results in Karlin- Altschul violations due to short length of sequence.
  • Word Size 3 Matrix: Blosum62 Gap Costs: Existence: 11 Extension: 1"
  • Other default settings can be: filter for low complexity OFF, word size of 3 for protein, BLOSUM62 matrix, gap existence penalty of -11 and a gap extension penalty of -1.
  • An exemplary NCBI BLAST 2.2.2 program setting has the "-W" option default to 0. This means that, if not set, the word size defaults to 3 for proteins and 11 for nucleotides.
  • the sequence ofthe invention can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer. Accordingly, the invention provides computers, computer systems, computer readable mediums, computer programs products and the like recorded or stored thereon the nucleic acid and polypeptide sequences ofthe invention.
  • the words "recorded” and “stored” refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any known methods for recording information on a computer readable medium to generate manufactures comprising one or more ofthe nucleic acid and/or polypeptide sequences ofthe hivention.
  • Computer readable media include magnetically readable media, optically readable media, elecfronically readable media and magnetic/optical media.
  • the computer readable media may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital Versatile Disk (DVD), Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of other media known to those skilled in the art.
  • aspects of the invention include systems (e.g., internet based systems), particularly computer systems, which store and manipulate the sequences and sequence information described herein.
  • a computer system 100 is illustrated in block diagram form in Figure 1.
  • a computer system refers to the hardware components, software components, and data storage components used to analyze a nucleotide or polypeptide sequence ofthe invention.
  • the computer system 100 can include a processor for processing, accessing and manipulating the sequence data.
  • the processor 105 can be any well-known type of central processing unit, such as, for example, the Pentium III from Intel Co ⁇ oration, or similar processor from Sun, Motorola, Compaq, AMD or International Business Machines.
  • the computer system 100 is a general p pose system that comprises the processor 105 and one or more internal data storage components 110 for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components.
  • a skilled artisan can readily appreciate that any one ofthe currently available computer systems are suitable.
  • the computer system 100 includes a processor 105 connected to a bus which is connected to a main memory 115 (preferably implemented as RAM) and one or more internal data storage devices 110, such as a hard drive and/or other computer readable media having data recorded thereon.
  • the computer system 100 can further include one or more data retrieving device 118 for reading the data stored on the internal data storage devices 110.
  • the data retrieving device 118 may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, or a modem capable of connection to a remote data storage system (e.g., via the internet) etc.
  • the internal data storage device 110 is a removable computer readable medium such as a floppy disk, a compact disk, a magnetic tape, etc. containing confrol logic and/or data recorded thereon.
  • the computer system 100 may advantageously include or be programmed by appropriate software for reading the control logic and/or the data from the data storage component once inserted in the data retrieving device.
  • the computer system 100 includes a display 120 which is used to display output to a computer user. It should also be noted that the computer system 100 can be linked to other computer systems 125a-c in a network or wide area network to provide cenfralized access to the computer system 100.
  • Software for accessing and processing the nucleotide or amino acid sequences ofthe invention can reside in main memory 115 during execution.
  • the computer system 100 may further comprise a sequence comparison algorithm for comparing a nucleic acid sequence ofthe invention.
  • the algorithm and sequence(s) can be stored on a computer readable medium.
  • a "sequence comparison algorithm 55 refers to one or more programs which are implemented (locally or remotely) on the computer system 100 to compare a nucleotide sequence with other nucleotide sequences and/or compounds stored within a data storage means.
  • the sequence comparison algorithm may compare the nucleotide sequences of the mvention stored on a computer readable medium to reference sequences stored on a computer readable medium to identify homologies or structural motifs.
  • FIG. 2 is a flow diagram illustrating one aspect of a process 200 for comparing a new nucleotide or protem sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
  • the database of sequences can be a private database stored within the computer system 100, or a public database such as GENBANK that is available through the Internet.
  • the process 200 begins at a start state 201 and then moves to a state 202 wherein the new sequence to be compared is stored to a memory in a computer system 100.
  • the memory could be any type of memory, including RAM or an internal storage device.
  • the process 200 then moves to a state 204 wherein a database of sequences is opened for analysis and comparison.
  • the process 200 then moves to a state 206 wherein the first sequence stored in the database is read into a memory on the computer.
  • a comparison is then performed at a state 210 to determine if the first sequence is the same as the second sequence. It is important to note that this step is not limited to performing an exact comparison between the new sequence and the first sequence in the database.
  • Well-known methods are known to those of skill in the art for comparing two nucleotide or protein sequences, even if they are not identical. For example, gaps can be introduced into one sequence in order to raise the homology level between the two tested sequences.
  • the parameters that control whether gaps or other features are introduced into a sequence during comparison are normally entered by the user of the computer system.
  • a determination is made at a decision state 210 whether the two sequences are the same.
  • the term "same 55 is not limited to sequences that are absolutely identical. Sequences that are within the homology parameters entered by the user will be marked as "same 55 in the process 200. If a determination is made that the two sequences are the same, the process 200 moves to a state 214 wherein the name ofthe sequence from the database is displayed to the user. This state notifies the user that the sequence with the displayed name fulfills the homology constraints that were entered.
  • the process 200 moves to a decision state 218 wherein a determination is made whether more sequences exist in the database. If no more sequences exist in the database, then the process 200 terminates at an end state 220. However, if more sequences do exist in the database, then the process 200 moves to a state 224 wherein a pointer is moved to the next sequence in the database so that it can be compared to the new sequence. In this manner, the new sequence is aligned and compared with every sequence in the database.
  • one aspect ofthe invention is a computer system comprising a processor, a data storage device having stored thereon a nucleic acid sequence ofthe invention and a sequence comparer for conducting the comparison.
  • the sequence comparer may indicate a homology level between the sequences compared or identify structural motifs, or it may identify structural motifs in sequences which are compared to these nucleic acid codes and polypeptide codes.
  • Figure 3 is a flow diagram illustrating one embodiment of a process 250 in a computer for determining whether two sequences are homologous.
  • the process 250 begins at a start state 252 and then moves to a state 254 wherein a first sequence to be compared is stored to a memory.
  • the second sequence to be compared is then stored to a memory at a state 256.
  • the process 250 then moves to a state 260 wherein the first character in the first sequence is read and then to a state 262 wherem the first character ofthe second sequence is read.
  • the sequence is a nucleotide sequence, then the character would normally be either A, T, C, G or U.
  • the sequence is a protein sequence, then it can be a single letter amino acid code so that the first and sequence sequences can be easily compared.
  • a determhiatioii is then made at a decision state 264 whether the two characters are the same. If they are the same, then the process 250 moves to a state 268 wherein the next characters in the first and second sequences are read. A determination is then made whether the next characters are the same. If they are, then the process 250 continues this loop until two characters are not the same. If a determination is made that the next two characters are not the same, the process 250 moves to a decision state 274 to determine whether there are any more characters either sequence to read. If there are not any more characters to read, then the process 250 moves to a state 276 wherein the level of homology between the first and second sequences is displayed to the user.
  • the level of homology is determined by calculating the proportion of characters between the sequences that were the same out of the total number of sequences in the first sequence. Thus, if every character in a first 100 nucleotide sequence aligned with an every character in a second sequence, the homology level would be 100%.
  • the computer program can compare a reference sequence to a sequence ofthe mvention to determine whether the sequences differ at one or more positions.
  • the program can record the length and identity of inserted, deleted or substituted nucleotides or amino acid residues with respect to the sequence of either the reference or the invention.
  • the computer program may be a program which determines whether a reference sequence contains a single nucleotide polymo ⁇ hism (SNP) with respect to a sequence ofthe invention, or, whether a sequence ofthe invention comprises a SNP of a known sequence.
  • the computer program is a program which identifies SNPs.
  • the method may be implemented by the computer systems described above and the method illusfrated hi Figure 3. The method can be performed by reading a sequence ofthe invention and the reference sequences through the use ofthe computer program and identifying differences with the computer program.
  • the computer based system comprises an identifier for identifying features within a nucleic acid or polypeptide ofthe invention.
  • An "identifier 55 refers to one or more programs which identifies certain features within a nucleic acid sequence.
  • an identifier may comprise a program which identifies an open reading frame (ORF) in a nucleic acid sequence.
  • Figure 4 is a flow diagram illustrating one aspect of an identifier process 300 for detecting the presence of a feature in a sequence. The process 300 begins at a start state 302 and then moves to a state 304 wherein a first sequence that is to be checked for features is stored to a memory 115 in the computer system 100.
  • a database of sequence features is opened.
  • a database would include a list of each feature's attributes along with the name ofthe feature.
  • a feature name could be "Initiation Codon 55 and the attribute would be "ATG 55 .
  • Another example would be the feature name "TAATAA Box” and the feature attribute would be "TAATAA”.
  • An example of such a database is produced by the University of Wisconsin Genetics Computer Group.
  • the features may be structural polypeptide motifs such as alpha helices, beta sheets, or functional polypeptide motifs such as enzymatic active sites, helix-turn-helix motifs or other motifs known to those skilled in the art.
  • the process 300 moves to a state 308 wherein the first feature is read from the database.
  • a comparison ofthe attribute ofthe first feature with the first sequence is then made at a state 310.
  • a determination is then made at a decision state 316 whether the attribute of the feature was found in the first sequence. If the attribute was found, then the process 300 moves to a state 318 wherein the name ofthe found feature is displayed to the user.
  • the process 300 then moves to a decision state 320 wherein a determination is made whether move features exist in the database. If no more features do exist, then the process 300 terminates at an end state 324.
  • the process 300 reads the next sequence feature at a state 326 and loops back to the state 310 wherein the attribute ofthe next feature is compared against the first sequence. If the feature attribute is not found in the first sequence at the decision state 316, the process 300 moves directly to the decision state 320 in order to determine if any more features exist in the database.
  • the invention provides a computer program that identifies open reading frames (ORFs).
  • a polypeptide or nucleic acid sequence ofthe invention can be stored and manipulated in a variety of data processor programs in a variety of formats.
  • a sequence can be stored as text in a word processing file, such as MicrosoftWORD or WORDPERFECT or as an ASCII file in a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE.
  • many computer programs and databases may be used as sequence comparison algorithms, identifiers, or sources of reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence ofthe invention.
  • the programs and databases used to practice the invention include, but are not limited to: MacPattem (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine (Molecular Applications Group), Look (Molecular Applications Group), MacLook (Molecular Applications Group), BLAST and BLAST2 (NCBI), BLASTN and BLASTX (Altschul et al, J. Mol. Biol. 215: 403, 1990), FASTA (Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85: 2444, 1988), FASTDB (Bratlag et al. Comp. App. Biosci.
  • Motifs which may be detected using the above programs include sequences encoding leucine zippers, helix-turn-helix motifs, glycosylation sites, ubiquitination sites, alpha helices, and beta sheets, signal sequences encoding signal peptides which direct the secretion ofthe encoded proteins, sequences implicated in franscription regulation such as homeoboxes, acidic stretches, enzymatic active sites, substrate binding sites, and enzymatic cleavage sites.
  • the invention provides isolated or recombinant nucleic acids that hybridize under stringent conditions to an exemplary sequence of the invention (SEQ ID NO:81, SEQ ID NO:83, or SEQ ID NO:85), or a nucleic acid that encodes a polypeptide of the invention (SEQ ID NO: 82, SEQ ID NO: 84, or SEQ ID NO: 86).
  • the stringent conditions can be highly stringent conditions, medium stringent conditions, low stringent conditions, including the high and reduced stringency conditions described herein. In one aspect, it is the stringency ofthe wash conditions that set forth the conditions which determine whether a nucleic acid is within the scope ofthe invention, as discussed below.
  • nucleic acids ofthe invention as defined by theh ability to hybridize under stringent conditions can be between about five residues and the full length of nucleic acid ofthe invention; e.g., they can be at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, or more, residues in length. Nucleic acids shorter than full length are also included.
  • nucleic acids ofthe invention can be useful as, e.g., hybridization probes, labeling probes, PCR oligonucleotide probes, iRNA, antisense or sequences encoding antibody binding peptides (epitopes), motifs, active sites and the like.
  • nucleic acids ofthe invention are defined by their ability to hybridize under high stringency comprises conditions of about 50% formamide at about 37°C to 42°C.
  • nucleic acids ofthe invention are defined by their ability to hybridize under reduced stringency comprising conditions in about 35% to 25%> formamide at about 30°C to 35°C.
  • nucleic acids ofthe invention are defined by their ability to hybridize under high stringency comprismg conditions at 42°C in 50% formamide, 5X SSPE, 0.3% SDS, and a repetitive sequence blocking nucleic acid, such as cot-1 or salmon sperm DNA (e.g., 200 n/ml sheared and denatured salmon sperm DNA).
  • nucleic acids ofthe invention are defined by their ability to hybridize under reduced stringency conditions comprising 35% formamide at a reduced temperature of 35°C.
  • the filter may be washed with 6X SSC, 0.5% SDS at 50°C. These conditions are considered to be “moderate 55 conditions above 25% fonnamide and "low 55 conditions below 25%> fonnamide.
  • moderate is when the above hybridization is conducted at 30% formamide.
  • low stringency is when the above hybridization is conducted at 10% formamide.
  • the temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly.
  • Nucleic acids ofthe invention are also defined by theh ability to hybridize under high, medium, and low stringency conditions as set forth in Ausubel and Sambrook. Variations on the above ranges and conditions are well known in the art. Hybridization conditions are discussed further, below.
  • the above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used.
  • the hybridization temperature may be decreased in increments of 5°C from 68°C to 42°C in a hybridization buffer having a Na concenfration of approximately IM.
  • the filter may be washed with 2X SSC, 0.5% SDS at the temperature of hybridization.
  • These conditions are considered to be "moderate 55 conditions above 50°C and "low” conditions below 50°C.
  • a specific example of “moderate” hybridization conditions is when the above hybridization is conducted at 55°C.
  • a specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 45°C.
  • the hybridization may be carried out in buffers, such as 6X SSC, containing formamide at a temperature of 42°C.
  • the concenfration of formamide in the hybridization buffer may be reduced in 5% increments from 50% to 0% to identify clones having decreasing levels of homology to the probe.
  • the filter may be washed with 6X SSC, 0.5% SDS at 50°C. These conditions are considered to be “moderate 55 conditions above 25% formamide and "low 55 conditions below 25% formamide.
  • a specific example of "moderate” hybridization conditions is when the above hybridization is conducted at 30% formamide.
  • a specific example of "low stringency 55 hybridization conditions is when the above hybridization is conducted at 10% formamide.
  • wash conditions used to identify nucleic acids within the scope ofthe invention include, e.g.: a salt concentration of about 0.02 molar at pH 7 and a temperature of at least about 50°C or about 55°C to about 60°C; or, a salt concenfration of about 0.15 M NaCl at 72°C for about 15 minutes; or, a salt concenfration of about 0.2X SSC at a temperature of at least about 50°C or about 55°C to about 60°C for about 15 to about 20 minutes; or, the hybridization complex is washed twice with a solution with a salt concenfration of about 2X SSC containing 0.1 % SDS at room temperature for 15 minutes and then washed twice by 0.1X SSC containing 0.1% SDS at 68oC for 15 minutes; or, equivalent conditions. See
  • the invention also provides nucleic acid probes that can be used, e.g., for identifying nucleic acids encoding a polypeptide with an epoxide hydiOlase activity or fragments thereof or for identifying epoxide hydrolase genes.
  • the probe comprises at least 10 consecutive bases of a nucleic acid ofthe invention.
  • a probe ofthe invention can be at least about 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150 or about 10 to 50, about 20 to 60 about 30 to 70, consecutive bases of a sequence as set forth in a nucleic acid of the hivention.
  • the probes identify a nucleic acid by binding and/or hybridization.
  • the probes can be used in arrays ofthe invention, see discussion below, including, e.g., capillary arrays.
  • the probes ofthe invention can also be used to isolate other nucleic acids or polypeptides.
  • the probes ofthe invention can be used to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence ofthe invention or an organism from which the nucleic acid was obtained.
  • a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample.
  • the nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences present in the sample.
  • conditions which permit the probe to specifically hybridize to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence, as well as control sequences which do not contain the complementary sequence.
  • Hybridization conditions such as the salt concenfration ofthe hybridization buffer, the formamide concenfration ofthe hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids (see discussion on specific hybridization conditions).
  • Hybridization may be detected by labeling the probe with a detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product.
  • detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product.
  • Many methods for using the labeled probes to detect the presence of complementary nucleic acids in a sample are familiar to those skilled in the art. These include Southern Blots, Northern Blots, colony hybridization procedures, and dot blots. Protocols for each of these procedures are provided in Ausubel and Sambrook.
  • more than one probe may be used in an amplification reaction to determine whether the sample contains an organism containing a nucleic acid sequence ofthe invention (e.g., an organism from which the nucleic acid was isolated).
  • the probes comprise oligonucleotides.
  • the amplification reaction may comprise a PCR reaction. PCR protocols are described in Ausubel and Sambrook (see discussion on amplification reactions). In such procedures, the nucleic acids in the sample are contacted with the probes, the amplification reaction is performed, and any resulting amplification product is detected.
  • the amplification product may be detected by performing gel electrophoresis on the reaction products and staining the gel with an intercalator such as ethidium bromide.
  • an intercalator such as ethidium bromide.
  • one or more ofthe probes may be labeled with a radioactive isotope and the presence of a radioactive amplification product may be detected by autoradiography after gel elecfrophoresis.
  • Probes derived from sequences near the 3 5 or 5 5 ends of a nucleic acid sequence of the invention can also be used in chromosome walking procedures to identify clones containing additional, e.g., genomic sequences. Such methods allow the isolation of genes which encode additional proteins of interest from the host organism.
  • nucleic acid sequences ofthe invention are used as probes to identify and isolate related nucleic acids.
  • the so-identified related nucleic acids may be cDNAs or genomic DNAs from organisms other than the one from which the nucleic acid ofthe invention was first isolated.
  • a nucleic acid sample is contacted with the probe under conditions which permit the probe to specifically hybridize to related sequences.
  • Hybridization ofthe probe to nucleic acids from the related organism is then detected using any of the methods described above.
  • the conditions used to achieve a particular level of stringency can vary, depending on the nature ofthe nucleic acids being hybridized.
  • the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) ofthe hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions.
  • An additional consideration is whether one ofthe nucleic acids is immobilized, for example, on a filter. Hybridization can be carried out under conditions of low stringency, moderate stringency or high stringency.
  • a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45°C in a solution consisting of 0.9 M NaCl, 50 mM NaH 2 P04, pH 7.0, 5.0 M Na 2 EDTA, 0.5% SDS, 10X Denhardt's, and 0.5 mg/ml polyriboadenylic acid.
  • Approximately 2 X IO 7 cpm (specific activity 4-9 X 10 8 cpm ug) of 32 P end-labeled oligonucleotide probe can then added to the solution.
  • the membrane is washed for 30 minutes at room temperature (RT) in IX SET (150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na 2 EDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh IX SET at Tm-10°C for the oligonucleotide probe.
  • IX SET 150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na 2 EDTA
  • the membrane is then exposed to auto-radiographic film for detection of hybridization signals. o
  • nucleic acids having different levels of homology to the probe can be identified and isolated.
  • Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures ofthe probes.
  • the melting temperature 5 Tm, is the temperature (under defined ionic sfrength and pH) at which 50% ofthe target sequence hybridizes to a perfectly complementary probe.
  • Very stringent conditions are selected to be equal to or about 5°C lower than the Tm for a particular probe.
  • Prehybridization may be carried out in 6X SSC, 5X 5 Denhardt's reagent, 0.5% SDS, lOO ⁇ g denatured fragmented salmon sperm DNA or 6X SSC, 5X Denhardt's reagent, 0.5% SDS, lOO ⁇ g denatured fragmented salmon sperm DNA, 50% formamide.
  • Formulas for SSC and Denhardt's and other solutions are listed, e.g., in Sambrook.
  • Hybridization is conducted by addmg the detectable probe to the 0 prehybridization solutions listed above. Where the probe comprises double stranded
  • hybridization For probes over 200 nucleotides in length, the hybridization may be carried out at 15-25°C below the Tm. For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10°C below the Tm. In one aspect, hybridizations in 6X SSC are conducted at approxhnately 68°C. In one aspect, hybridizations in 50% formamide containing solutions are conducted at approximately 42°C. All ofthe foregoing hybridizations would be considered to be under conditions of high stringency.
  • the filter is washed to remove any non- specifically bound detectable probe.
  • the stringency used to wash the filters can also be varied depending on the nature ofthe nucleic acids being hybridized, the length ofthe nucleic acids being hybridized, the degree of complementarity, the nucleotide sequence composition (e.g., GC v. AT content), and the nucleic acid type (e.g., RNA v. DNA).
  • Examples of progressively higher stringency condition washes are as follows: 2X SSC, 0.1% SDS at room temperature for 15 minutes (low stringency); 0.1X SSC, 0.5%> SDS at room temperature for 30 minutes to 1 hour (moderate stringency); 0.1X SSC, 0.5% SDS for 15 to 30 minutes at between the hybridization temperature and 68°C (high stringency); and 0.15M NaCl for 15 minutes at 72°C (very high stringency).
  • a final low stringency wash can be conducted in 0. IX SSC at room temperature.
  • the examples above are merely illustrative of one set of conditions that can be used to wash filters.
  • One of skill in the art would know that there are numerous recipes for different stringency washes.
  • Nucleic acids which have hybridized to the probe can be identified by autoradiography or other conventional techniques. The above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used. For example, the hybridization temperature may be decreased in increments of 5°C from 68°C to 42°C in a hybridization buffer having a Na + concenfration of approximately IM. Following hybridization, the filter may be washed with 2X SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be “moderate 55 conditions above 50°C and "low” conditions below 50°C. An example of “moderate 55 hybridization conditions is when the above hybridization is conducted at 55°C. An example of "low stringency 55 hybridization conditions is when the above hybridization is conducted at 45°C.
  • the hybridization may be carried out in buffers, such as 6X SSC, containing formamide at a temperature of 42°C.
  • the concenfration of formamide in the hybridization buffer may be reduced in 5% increments from 50%> to 0%> to identify clones having decreasing levels of homology to the probe.
  • the filter may be washed with 6X SSC, 0.5% SDS at 50°C.
  • 6X SSC 0.5% SDS at 50°C.
  • probes and methods ofthe invention can be used to isolate nucleic acids having a sequence with at least about 99%, 98%, 97%, at least 95%>, at least 90%>, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, or at least 50% homology to a nucleic acid sequence ofthe invention comprising at least about 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, or more consecutive bases thereof, and the sequences complementary thereto. Homology may be measured using an alignment algorithm, as discussed herein.
  • the homologous polynucleotides may have a coding sequence which is a naturally occurring allelic variant of one ofthe coding sequences described herein.
  • allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to a nucleic acid ofthe invention.
  • probes and methods ofthe invention can be used to isolate nucleic acids which encode polypeptides having at least about 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, or at least 50% sequence identity (homology) to a polypeptide ofthe invention comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids, as determined using a sequence alignment algorithm (e.g., such as the
  • the invention provides nucleic acids complementary to (e.g., antisense sequences to) the nucleic acid sequences ofthe invention.
  • Antisense sequences are capable of inhibiting the transport, splicing or transcription of epoxide hydrolase- encoding genes.
  • the inhibition can be effected through the targeting of genomic DNA or messenger RNA.
  • the franscription or function of targeted nucleic acid can be inhibited, for example, by hybridization and/or cleavage.
  • One particularly useful set of inhibitors provided by the present invention includes oligonucleotides which are able to either bind epoxide hydrolase gene or message, in either case preventing or inhibiting the production or function of epoxide hydrolase.
  • the association can be through sequence specific hybridization.
  • Another useful class of inhibitors includes oligonucleotides which cause inactivation or cleavage of epoxide hydrolase message.
  • the oligonucleotide can have enzyme activity which causes such cleavage, such as ribozymes.
  • the oligonucleotide can be chemically modified or conjugated to an enzyme or composition capable of cleaving the complementary nucleic acid. A pool of many different such oligonucleotides can be screened for those with the deshed activity.
  • Antisense Oligonucleotides can be screened for those with the deshed activity.
  • the invention provides antisense oligonucleotides capable of binding epoxide hydrolase message which can inhibit proteolytic activity by targeting mRNA.
  • Strategies for designing antisense oligonucleotides are well described in the scientific and patent literature, and the skilled artisan can design such epoxide hydrolase oligonucleotides using the novel reagents ofthe invention.
  • gene walking/ RNA mapping protocols to screen for effective antisense oligonucleotides are well known in the art, see, e.g., Ho (2000) Methods Enzymol. 314:168-183, describing an RNA mapping assay, which is based on standard molecular techniques to provide an easy and reliable method for potent antisense sequence selection. See also Smith (2000) Eur. J. Pharm. Sci. 11:191-198.
  • Naturally occurring nucleic acids are used as antisense oligonucleotides.
  • the antisense oligonucleotides can be of any length; for example, in alternative aspects, the antisense oligonucleotides are between about 5 to 100, about 10 to 80, about 15 to 60, about 18 to 40. The optimal length can be determined by routine screening.
  • the antisense oligonucleotides can be present at any concentration. The optimal concenfration can be determined by routine screening.
  • a wide variety of synthetic, non- naturally occurring nucleotide and nucleic acid analogues are known which can address this potential problem.
  • peptide nucleic acids containing non-ionic backbones, such as N-(2-aminoethyl) glycine units can be used.
  • Antisense ohgonucleotides having phosphorothioate linkages can also be used, as described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol Appl Pharmacol 144:189-197; Antisense Therapeutics, ed. Agrawal (Humana Press, Totowa, N.J., 1996).
  • Antisense oligonucleotides having synthetic DNA backbone analogues provided by the invention can also include phosphoro-ditbioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, and mo ⁇ holino carbamate nucleic acids, as described above.
  • Combinatorial chemistry methodology can be used to create vast numbers of oligonucleotides that can be rapidly screened for specific oligonucleotides that have appropriate binding affinities and specificities toward any target, such as the sense and antisense epoxide hydrolase sequences ofthe invention (see, e.g., Gold (1995) J. of Biol. Chem. 270:13581-13584).
  • the invention provides ribozymes capable of binding epoxide hydrolase message. These ribozymes can inhibit epoxide hydrolase activity by, e.g., targeting mRNA. Sfrategies for designing ribozymes and selecting the epoxide hydro lase-specif ⁇ c antisense sequence for targeting are well described in the scientific and patent literature, and the skilled artisan can design such ribozymes using the novel reagents ofthe invention. Ribozymes act by binding to a target RNA through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA that cleaves the target RNA.
  • the ribozyme recognizes and binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cleave and inactivate the target RNA. Cleavage of a target RNA in such a manner will destroy its ability to dhect synthesis of an encoded protein if the cleavage occurs in the coding sequence. After a ribozyme has bound and cleaved its RNA target, it can be released from that RNA to bind and cleave new targets repeatedly.
  • a ribozyme can be advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its franscription, translation or association with another molecule) as the effective concentration of ribozyme necessary to effect a therapeutic treatment can be lower than that of an antisense oligonucleotide.
  • antisense technology where a nucleic acid molecule simply binds to a nucleic acid target to block its franscription, translation or association with another molecule
  • This potential advantage reflects the ability ofthe ribozyme to act enzymatically.
  • a single ribozyme molecule is able to cleave many molecules of target RNA.
  • a ribozyme is typically a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechamsm of binding, but also on the mechanism by which the molecule inhibits the expression ofthe RNA to which it binds. That is, the inhibition is caused by cleavage ofthe RNA target and so specificity is defined as the ratio ofthe rate of cleavage ofthe targeted RNA over the rate of cleavage of non-targeted RNA. This cleavage mechamsm is dependent upon factors additional to those involved in base pairing. Thus, the specificity of action of a ribozyme can be greater than that of antisense oligonucleotide binding the same RNA site.
  • the ribozyme ofthe invention e.g., an enzymatic ribozyme RNA molecule
  • hammerhead motifs are described by, e.g., Rossi (1992) Aids Research and Human Refroviruses 8: 183; hahpin motifs by Hampel (1989) Biochemistry 28:4929, and Hampel (1990) Nuc. Acids Res.
  • a ribozyme ofthe invention e.g., an enzymatic RNA molecule of this invention, can have a specific substrate binding site complementary to one or more of the target gene RNA regions.
  • a ribozyme ofthe invention can have a nucleotide sequence within or surrounding that subsfrate binding site which imparts an RNA cleaving activity to the molecule.
  • RNA interference RNA interference
  • the invention provides an RNA inhibitory molecule, a so- called "RNAi 55 molecule, comprising an epoxide hydrolase sequence ofthe invention.
  • the RNAi molecule comprises a double-stranded RNA (dsRNA) molecule.
  • the RNAi can inhibit expression of an epoxide hydrolase gene.
  • the RNAi is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length. While the invention is not limited by any particular mechanism of action, the RNAi can enter a cell and cause the degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs.
  • ssRNA single-stranded RNA
  • RNA interference RNA interference
  • dsRNA double-sfranded RNA
  • RNAi' s of the invention are used in gene- silencing therapeutics, see, e.g., Shuey (2002) Drug Discov. Today 7:1040-1046.
  • the invention provides methods to selectively degrade RNA using the RNAi's of the invention.
  • RNAi molecules ofthe invention can be used to generate a loss-of-function mutation in a cell, an organ or an animal.
  • Methods for making and using RNAi molecules for selectively degrade RNA are well known in the art, see, e.g., U.S. Patent No. 6,506,559; 6,511,824; 6,515,109; 6,489,127.
  • the invention provides methods of generating variants of the nucleic acids ofthe invention, e.g., those encoding an epoxide hydrolase. These methods can be repeated or used in various combinations to generate epoxide hydrolases having an altered or different activity or an altered or different stability from that of an epoxide hydrolase encoded by the template nucleic acid. These methods also can be repeated or used in various combinations, e.g., to generate variations in gene/ message expression, message translation or message stability.
  • the genetic composition of a cell is altered by, e.g., modification of a homologous gene ex vivo, followed by its reinsertion into the cell.
  • a nucleic acid ofthe invention can be altered by any means. For example, random or stochastic methods, or, non-stochastic, or "directed evolution, 55 methods, see, e.g., U.S. Patent No. 6,361,974. Methods for random mutation of genes are well known in the art, see, e.g., U.S. Patent No. 5,830,696. For example, mutagens can be used to randomly mutate a gene.
  • Mutagens include, e.g., ultraviolet light or gamma irradiation, or a chemical mutagen, e.g., mitomycin, nitrous acid, photoactivated psoralens, alone or in combination, to induce DNA breaks amenable to repair by recombination.
  • Other chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid.
  • Other mutagens are analogues of nucleotide precursors, e.g., nitrosoguanidine, 5-bromouracil, 2-aminopurine, or acridine. These agents can be added to a PCR reaction in place ofthe nucleotide precursor thereby mutating the sequence. Intercalating agents such as proflavine, acriflavine, quinacrine and the like can also be used.
  • nucleic acids e.g., genes
  • Stochastic fragmentation
  • modifications, additions or deletions are introduced by error-prone PCR, shuffling, oligonucleotide-dhected mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturation mutagenesis (GSSMTM), synthetic ligation reassembly (SLR), recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, urach-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repah mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis,
  • Mutational methods of generating diversity include, for example, site- directed mutagenesis (Ling et al. (1997) "Approaches to DNA mutagenesis: an overview” Anal Biochem. 254(2): 157-178; Dale et al. (1996) "Oligonucleotide-dhected random mutagenesis using the phosphorothioate method” Methods Mol. Biol. 57:369-374; Smith
  • Additional protocols that can be used to practice the invention include point mismatch repair (Kramer (1984) "Point Mismatch Repair” Cell 38:879-887), mutagenesis using repair-deficient host strains (Carter et al. (1985) "Improved oligonucleotide site-directed mutagenesis using Ml 3 vectors" Nucl. Acids Res. 13: 4431- 4443; and Carter (1987) "Improved oligonucleotide-dhected mutagenesis using M13 vectors” Methods in Enzymol. 154: 382-403), deletion mutagenesis (Eghtedarzadeh (1986) "Use of oligonucleotides to generate large deletions" Nucl.
  • Non-stochastic, or "directed evolution, 5 ' methods include, e.g., saturation mutagenesis (GSSM), synthetic ligation reassembly (SLR), or a combination thereof are used to modify the nucleic acids ofthe hivention to generate epoxide hydrolases with new or altered properties (e.g., activity under highly acidic or alkaline conditions, high temperatures, and the like).
  • Polypeptides encoded by the modified nucleic acids can be screened for an activity before testing for proteolytic or other activity. Any testing modality or protocol can be used, e.g., using a capUlary array platform. See, e.g., U.S. Patent Nos. 6,361,974; 6,280,926; 5,939,250.
  • codon primers containing a degenerate N,N,G/T sequence are used to introduce point mutations into a polynucleotide, e.g., an epoxide hydrolase or an antibody ofthe invention, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position, e.g., an amino acid residue in an enzyme active site or ligand binding site targeted to be modified.
  • oligonucleotides can comprise a contiguous first homologous sequence, a degenerate N,N,G/T sequence, and, optionally, a second homologous sequence.
  • the downstream progeny translational products from the use of such oligonucleotides include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy ofthe N,N,G/T sequence includes codons for all 20 amino acids.
  • one such degenerate oligonucleotide (comprised of, e.g., one degenerate N,N,G/T cassette) is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions.
  • At least two degenerate cassettes are used - either in the same oligonucleotide or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions.
  • more than one N,N,G/T sequence can be contained in one oligonucleotide to introduce amino acid mutations at more than one site.
  • This plurality of N,N,G/T sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s).
  • oligonucleotides serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,G/T sequence, to infroduce any combination or permutation of amino acid additions, deletions, and/or substitutions.
  • simultaneous mutagenesis of two or more contiguous amino acid positions is done using an oligonucleotide that contains contiguous N,N,G/T triplets, i.e. a degenerate (N,N,G/T)n sequence.
  • degenerate cassettes having less degeneracy than the N,N,G/T sequence are used.
  • it may be deshable in some instances to use (e.g. in an oligonucleotide) a degenerate triplet sequence comprised of only one N, where said N can be in the first second or third position of the triplet. Any other bases including any combinations and permutations thereof can be used in the remaining two positions ofthe triplet.
  • degenerate N,N,N triplet sequence it may be deshable hi some instances to use (e.g. in an oligo) a degenerate N,N,N triplet sequence.
  • use of degenerate triplets allows for systematic and easy generation of a full range of possible natural amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide (in alternative aspects, the methods also include generation of less than all possible substitutions per amino acid residue, or codon, position). For example, for a 100 amino acid polypeptide, 2000 distinct species (i.e. 20 possible amino acids per position X 100 amino acid positions) can be generated.
  • oligonucleotide or set of oligonucleotides containing a degenerate N,N,G/T triplet 32 individual sequences can code for aU 20 possible natural amino acids.
  • a reaction vessel in which a parental polynucleotide sequence is subjected to saturation mutagenesis using at least one such oligonucleotide there are generated 32 distinct progeny polynucleotides encoding 20 distinct polypeptides.
  • the use of a non-degenerate oligonucleotide in site- directed mutagenesis leads to only one progeny polypeptide product per reaction vessel.
  • Nondegenerate oligonucleotides can optionally be used in combination with degenerate primers disclosed; for example, nondegenerate oligonucleotides can be used to generate specific point mutations in a working polynucleotide. This provides one means to generate specific silent point mutations, point mutations leading to corresponding amino acid changes, and point mutations that cause the generation of stop codons and the corresponding expression of polypeptide fragments.
  • each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide (e.g., epoxide hydrolases) molecules such that all 20 natural amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the parental polynucleotide (other aspects use less than all 20 natural combinations).
  • the 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g. cloned into a suitable host, e.g., E. coli host, using, e.g., an expression vector) and subjected to expression screemng.
  • an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to the parental polypeptide, such as increased proteolytic activity under alkaline or acidic conditions), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein.
  • favorable amino acid changes may be identified at more than one amino acid position.
  • One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions. For example, if 2 specific favorable amino acid changes are identified in each of 3 amino acid positions in a polypeptide, the permutations include 3 possibilities at each position (no change from the original amino acid, and each of two favorable changes) and 3 positions. Thus, there are 3 x 3 x 3 or 27 total possibilities, including 7 that were previously examined - 6 single point mutations (i.e. 2 at each of three positions) and no change at any position.
  • site-saturation mutagenesis can be used together with another stochastic or non-stochastic means to vary sequence, e.g., synthetic ligation reassembly (see below), shuffling, chimerization, recombination and other mutagenizing processes and mutagenizing agents.
  • This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner.
  • the invention provides a non-stochastic gene modification system termed "synthetic ligation reassembly,” or simply “SLR,” a “dhected evolution process,” to generate polypeptides, e.g., epoxide hydrolases or antibodies ofthe invention, with new or altered properties.
  • SLR is a method of ligating oligonucleotide fragments together non-stochastically. This method differs from stochastic oligonucleotide shuffling in that the nucleic acid building blocks are not shuffled, concatenated or chimerized randomly, but rather are assembled non-stochastically. See, e.g., U.S. Patent Application Serial No.
  • SLR comprises the following steps: (a) providing a template polynucleotide, wherein the template polynucleotide comprises sequence encoding a homologous gene; (b) providing a plurality of building block polynucleotides, wherein the building block polynucleotides are designed to cross-over reassemble with the template polynucleotide at a predetermined sequence, and a building block polynucleotide comprises a sequence that is a variant ofthe homologous gene and a sequence homologous to the template polynucleotide flanking the variant sequence; (c) combining a building block polynucleotide with a template polynucleotide such that the building block polynucleotide cross-over reassembles with the template polynucle
  • SLR does not depend on the presence of high levels of homology between polynucleotides to be rearranged.
  • this method can be used to non-stochastically generate libraries (or sets) of progeny molecules comprised of over 10100 different chimeras.
  • SLR can be used to generate libraries comprised of over 101000 different progeny chimeras.
  • aspects of the present invention include non-stochastic methods of producing a set of finalized chimeric nucleic acid molecule shaving an overall assembly order that is chosen by design. This method includes the steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved.
  • the mutually compatible ligatable ends ofthe nucleic acid building blocks to be assembled are considered to be "serviceable 5 ' for this type of ordered assembly if they enable the building blocks to be coupled in predetermined orders.
  • the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design ofthe ligatable ends. If more than one assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order ofthe assembly step(s).
  • the annealed building pieces are treated with an enzyme, such as a ligase (e.g. T4 DNA ligase), to achieve covalent bonding of the building pieces.
  • a ligase e.g. T4 DNA ligase
  • the design ofthe oligonucleotide building blocks is obtained by analyzing a set of progenitor nucleic acid sequence templates that serve as a basis for producing a progeny set of finalized chimeric polynucleotides.
  • These parental oligonucleotide templates thus serve as a source of sequence information that aids in the design ofthe nucleic acid building blocks that are to be mutagenized, e.g., chhnerized or shuffled.
  • the sequences of a plurality of parental nucleic acid templates are aligned in order to select one or more demarcation points.
  • the demarcation points can be located at an area of homology, and are comprised of one or more nucleotides.
  • demarcation points are preferably shared by at least two of the progenitor templates.
  • the demarcation points can thereby be used to delineate the boundaries of oligonucleotide building blocks to be generated in order to rearrange the parental polynucleotides.
  • the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly of the final chimeric progeny molecules.
  • a demarcation point can be an area of homology (comprised of at least one homologous nucleotide base) shared by at least two parental polynucleotide sequences.
  • a demarcation point can be an area of homology that is shared by at least half of the parental polynucleotide sequences, or, it can be an area of homology that is shared by at least two thirds of the parental polynucleotide sequences.
  • a serviceable demarcation points is an area of homology that is shared by at least three fourths ofthe parental polynucleotide sequences, or, it can be shared by at almost all ofthe parental polynucleotide sequences.
  • a demarcation point is an area of homology that is shared by all of the parental polynucleotide sequences.
  • a ligation reassembly process is performed exhaustively in order to generate an exhaustive library of progeny chimeric polynucleotides.
  • all possible ordered combinations ofthe nucleic acid building blocks are represented in the set of finalized chimeric nucleic acid molecules.
  • the assembly order i.e. the order of assembly of each building block in the 5' to 3 sequence of each finalized chimeric nucleic acid
  • the assembly order is by design (or non-stochastic) as described above. Because ofthe non-stochastic nature of this invention, the possibility of unwanted side products is greatly reduced.
  • the ligation reassembly method is performed systematically.
  • the method is performed in order to generate a systematically compartmentalized library of progeny molecules, with compartments that can be screened systematically, e.g. one by one.
  • this invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, a design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, these methods allow a potentially very large number of progeny molecules to be examined systematically in smaller groups.
  • the progeny molecules generated preferably comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design.
  • the saturation mutagenesis and optimized directed evolution methods also can be used to generate different progeny molecular species.
  • the invention provides freedom of choice and confrol regarding the selection of demarcation points, the size and number of the nucleic acid building blocks, and the size and design ofthe couplings. It is appreciated, furthermore, that the requirement for intermolecular homology is highly relaxed for the operability of this invention. In fact, demarcation points can even be chosen in areas of little or no intermolecular homology. For example, because of codon wobble, i.e. the degeneracy of codons, nucleotide substitutions can be introduced into nucleic acid building blocks without altering the amino acid originally encoded in the corresponding progenitor template. Alternatively, a codon can be altered such that the coding for an originally amino acid is altered.
  • This invention provides that such substitutions can be introduced into the nucleic acid building block in order to increase the incidence of intermolecular homologous demarcation points and thus to allow an increased number of couplings to be achieved among the building blocks, which in turn allows a greater number of progeny chimeric molecules to be generated.
  • the synthetic nature ofthe step in which the building blocks are generated allows the design and introduction of nucleotides (e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vifro process (e.g. by mutagenesis) or in an in vivo process (e.g. by utilizing the gene splicing ability of a host organism).
  • nucleotides e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences
  • a nucleic acid building block is used to introduce an intron.
  • functional introns are introduced into a man-made gene manufactured according to the methods described herein.
  • the artificially introduced intron(s) can be functional in a host cells for gene splicing much in the way that naturally-occurring introns serve functionally in gene splicing.
  • the invention provides a non-stochastic gene modification system termed "optimized dhected evolution system" to generate polypeptides, e.g., epoxide hydrolases or antibodies ofthe invention, with new or altered properties.
  • Optimized dhected evolution is directed to the use of repeated cycles of reductive reassortment, recombination and selection that allow for the directed molecular evolution of nucleic acids through recombination.
  • Optimized dhected evolution allows generation of a large population of evolved chimeric sequences, wherein the generated population is significantly enriched for sequences that have a predetermined number of crossover events.
  • a crossover event is a point in a chimeric sequence where a shift in sequence occurs from one parental variant to another parental variant. Such a point is normally at the juncture of where oligonucleotides from two parents are ligated together to form a single sequence.
  • This method allows calculation ofthe correct concentrations of oligonucleotide sequences so that the final chimeric population of sequences is enriched for the chosen number of crossover events. This provides more confrol over choosing chimeric variants having a predetermined number of crossover events.
  • this method provides a convenient means for exploring a tremendous amount ofthe possible protein variant space in comparison to other systems.
  • One method for creating a chimeric progeny polynucleotide sequence is to create oligonucleotides corresponding to fragments or portions of each parental sequence. Each oligonucleotide preferably includes a unique region of overlap so that mixing the oligonucleotides together results in a new variant that has each oligonucleotide fragment assembled in the correct order. Additional information can also be found, e.g., in USSN 09/332,835; U.S. Patent No. 6,361,974.
  • the number of oligonucleotides generated for each parental variant bears a relationship to the total number of resulting crossovers in the chimeric molecule that is ultimately created.
  • three parental nucleotide sequence variants might be provided to undergo a ligation reaction in order to find a chimeric variant having, for example, greater activity at high temperature.
  • a set of 50 oligonucleotide sequences can be generated corresponding to each portions of each parental variant. Accordingly, during the ligation reassembly process there could be up to 50 crossover events within each of the chimeric sequences. The probability that each of the generated chimeric polynucleotides will contain oligonucleotides from each parental variant in alternating order is very low.
  • each oligonucleotide fragment is present in the ligation reaction in the same molar quantity it is likely that in some positions oligonucleotides from the same parental polynucleotide will ligate next to one another and thus not result in a crossover event. If the concentration of each oligonucleotide from each parent is kept constant during any ligation step in this example, there is a 1/3 chance (assuming 3 parents) that an oligonucleotide from the same parental variant will ligate within the chimeric sequence and produce no crossover.
  • a probability density function can be detemiined to predict the population of crossover events that are likely to occur during each step in a ligation reaction given a set number of parental variants, a number of oligonucleotides corresponding to each variant, and the concentrations of each variant during each step in the ligation reaction.
  • PDF probability density function
  • a target number of crossover events can be predetermined, and the system then programmed to calculate the starting quantities of each parental oligonucleotide during each step in the ligation reaction to result in a probability density function that centers on the predetermined number of crossover events.
  • These methods are directed to the use of repeated cycles of reductive reassortment, recombination and selection that allow for the directed molecular evolution of a nucleic acid encoding a polypeptide through recombination.
  • This system allows generation of a large population of evolved chimeric sequences, wherem the generated population is significantly enriched for sequences that have a predetermined number of crossover events.
  • a crossover event is a point in a chimeric sequence where a shift in sequence occurs from one parental variant to another parental variant. Such a point is normally at the juncture of where oligonucleotides from two parents are ligated together to form a single sequence.
  • the method allows calculation ofthe correct concentrations of oligonucleotide sequences so that the final chimeric population of sequences is enriched for the chosen number of crossover events. This provides more confrol over choosing chimeric variants having a predetermined number of crossover events.
  • the population of chimerics molecules can be enriched for those variants that have a particular number of crossover events.
  • each ofthe molecules chosen for further analysis most likely has, for example, only three crossover events.
  • the resulting progeny population can be skewed to have a predetermined number of crossover events, the boundaries on the functional variety between the chimeric molecules is reduced. This provides a more manageable number of variables when calculating which oligonucleotide from the original parental polynucleotides might be responsible for affecting a particular trait.
  • the method creates a chimeric progeny polynucleotide sequence by creating oligonucleotides corresponding to fragments or portions of each parental sequence.
  • Each oligonucleotide preferably includes a unique region of overlap so that mixing the oligonucleotides together results in a new variant that has each oligonucleotide fragment assembled in the correct order. See also USSN 09/332,835.
  • aspects of the invention include a system and software that receive a desired crossover probability density function (PDF), the number of parent genes to be reassembled, and the number of fragments in the reassembly as inputs.
  • PDF crossover probability density function
  • the output of this program is a "fragment PDF" that can be used to determine a recipe for producing reassembled genes, and the estimated crossover PDF of those genes.
  • the processing described herein is preferably performed in MATLABTM (The Mathworks, Natick, Massachusetts) a programming language and development environment for technical computing.
  • these processes can be iteratively repeated.
  • a nucleic acid or, the nucleic acid
  • This process can be iteratively repeated until a desired phenotype is engineered.
  • an entire biochemical anabolic or catabolic pathway can be engineered into a cell, including, e.g., epoxide hydrolysis activity.
  • a particular oligonucleotide has no affect at all on the desired trait (e.g., a new epoxide hydrolase phenotype)
  • it can be removed as a variable by synthesizing larger parental oligonucleotides that include the sequence to be removed. Since inco ⁇ orating the sequence within a larger sequence prevents any crossover events, there will no longer be any variation of this sequence in the progeny polynucleotides.
  • This iterative practice of determining which oligonucleotides are most related to the desired trait, and which are unrelated allows more efficient exploration all of the possible protein variants that might be provide a particular trait or activity. In vivo shuffling
  • In vivo shuffling of molecules is use in methods ofthe hivention that provide variants of polypeptides ofthe invention, e.g., antibodies, epoxide hydrolases, and the like.
  • In vivo shuffling can be performed utilizing the natural property of cells to recombine multimers. While recombination in vivo has provided the major natural route to molecular diversity, genetic recombination remains a relatively complex process that involves 1) the recognition of homologies; 2) strand cleavage, strand invasion, and metabolic steps leading to the production of recombinant chiasma; and finally 3) the resolution of chiasma into discrete recombined molecules.
  • the invention provides a method for producing a hybrid polynucleotide from at least a first polynucleotide (e.g., an epoxide hydrolase ofthe invention) and a second polynucleotide (e.g., an enzyme, such as an epoxide hydrolase of the invention or any other epoxide hydrolase, or, a tag or an epitope).
  • a first polynucleotide e.g., an epoxide hydrolase ofthe invention
  • a second polynucleotide e.g., an enzyme, such as an epoxide hydrolase of the invention or any other epoxide hydrolase, or, a tag or an epitope.
  • the invention can be used to produce a hybrid polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell.
  • hybrid polynucleotide 55 is any nucleotide sequence which results from the method ofthe present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes which utilize repeated sequences to alter a nucleotide sequence within a DNA molecule. Producing sequence variants
  • the invention also provides additional methods for making sequence variants ofthe nucleic acid (e.g., epoxide hydrolase) sequences ofthe invention.
  • the invention also provides additional methods for isolating epoxide hydrolases using the nucleic acids and polypeptides ofthe invention.
  • the invention provides for variants of an epoxide hydrolase coding sequence (e.g., a gene, cDNA or message) ofthe invention, which can be altered by any means, including, e.g., random or stochastic methods, or, non-stochastic, or "dhected evolution," methods, as described above.
  • the isolated variants may be naturally occurring. Variant can also be created in vitro.
  • Variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures. Other methods of making variants are also familiar to those skilled in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids which encode polypeptides having characteristics which enhance theh value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. These nucleotide differences can result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
  • variants may be created using error prone PCR.
  • error prone PCR PCR is performed under conditions where the copying fidelity ofthe DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product.
  • Error prone PCR is described, e.g., in Leung, D.W., et al., Technique, 1:11-15, 1989) and Caldwell, R. C. & Joyce G.F., PCR Methods Applic, 2:28-33, 1992.
  • nucleic acids to be mutagenized are mixed with PCR primers, reaction buffer, MgCl 2 , MhCl 2 , Taq polymerase and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product.
  • the reaction may be performed using 20 frnoles of nucleic acid to be mutagenized, 30 pmole of each PCR primer, a reaction buffer comprismg 50mM KC1, lOmM Tris HCI (pH 8.3) and 0.01% gelatin, 7mM MgC12, 0.5mM MnCl 2 , 5 units of Taq polymerase, 0.2mM dGTP, 0.2mM dATP, ImM dCTP, and ImM dTTP.
  • PCR may be performed for 30 cycles of 94°C for 1 min, 45°C for 1 min, and 72°C for 1 min. However, it will be appreciated that these parameters may be varied as appropriate.
  • the mutagenized nucleic acids are cloned into an appropriate vector and the activities ofthe polypeptides encoded by the mutagenized nucleic acids is evaluated. Variants may also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest. Oligonucleotide mutagenesis is described, e.g., in Reidhaar-Olson (1988) Science 241:53-57. Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized. Clones containing the mutagenized DNA are recovered and the activities ofthe polypeptides they encode are assessed.
  • Assembly PCR involves the assembly of a PCR product from a mixture of s aU DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in, e.g., U.S. Patent No. 5,965,408.
  • StiU another method of generating variants is sexual PCR mutagenesis.
  • sexual PCR mutagenesis forced homologous recombination occurs between DNA molecules of different but highly related DNA sequence in vitro, as a result of random fragmentation ofthe DNA molecule based on sequence homology, followed by fixation ofthe crossover by primer extension in a PCR reaction.
  • Sexual PCR mutagenesis is described, e.g., in Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751. Briefly, in such procedures a plurality of nucleic acids to be recombined are digested with DNase to generate fragments having an average size of 50-200 nucleotides.
  • Fragments of the desired average size are purified and resuspended in a PCR mixture.
  • PCR is conducted under conditions which facilitate recombination between the nucleic acid fragments.
  • PCR may be performed by resuspending the purified fragments at a concenfration of 10-30ng/:l in a solution of 0.2mM of each dNTP, 2.2mM MgCl 2 , 50mM KCL, lOmM Tris HCI, pH 9.0, and 0.1% Triton X-100.
  • PCR 2.5 units of Taq polymerase per 100:1 of reaction mixture is added and PCR is performed using the following regime: 94°C for 60 seconds, 94°C for 30 seconds, 50-55°C for 30 seconds, 72°C for 30 seconds (30-45 times) and 72°C for 5 minutes.
  • oligonucleotides may be included in the PCR reactions.
  • the Klenow fragment of DNA polymerase I may be used in a first set of PCR reactions and Taq polymerase may be used in a subsequent set of PCR reactions. Recombinant sequences are isolated and the activities ofthe polypeptides they encode are assessed.
  • Il l Variants may also be created by in vivo mutagenesis.
  • random mutations in a sequence of interest are generated by propagating the sequence of interest in a bacterial strain, such as an E. coli strain, which carries mutations hi one or more ofthe DNA repair pathways.
  • a bacterial strain such as an E. coli strain
  • Such "mutator" strains have a higher random mutation rate than that of a wild-type parent. Propagating the DNA in one of these strains will eventually generate random mutations within the DNA.
  • Mutator strains suitable for use for in vivo mutagenesis are described, e.g., in PCT Publication No. WO 91/16427. Variants may also be generated using cassette mutagenesis.
  • cassette mutagenesis a smaU region of a double sfranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence.
  • the oligonucleotide often contains completely and/or partially randomized native sequence.
  • Recursive ensemble mutagenesis may also be used to generate variants.
  • Recursive ensemble mutagenesis is an algorithm for protein engineering (protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis.
  • Recursive ensemble mutagenesis is described, e.g., in Arkin (1992) Proc. Natl. Acad. Sci. USA 89:7811-7815.
  • variants are created using exponential ensemble mutagenesis.
  • Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins.
  • Exponential ensemble mutagenesis is described, e.g., in Delegrave (1993) Biotechnology Res. 11:1548-1552. Random and site-directed mutagenesis are described, e.g., in Arnold (1993) Current Opinion in Biotechnology 4:450-455.
  • the variants are created using shuffling procedures wherein portions of a plurality of nucleic acids which encode distinct polypeptides are fused together to create chimeric nucleic acid sequences which encode chimeric polypeptides as described in, e.g., U.S. Patent Nos. 5,965,408; 5,939,250 (see also discussion, above).
  • the invention also provides variants of polypeptides ofthe hivention (e.g., epoxide hydrolases) comprising sequences in which one or more ofthe amino acid residues (e.g., of an exemplary polypeptide ofthe invention) are substituted with a conserved or non-conserved amino acid residue (e.g., a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
  • Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics.
  • polypeptides ofthe invention include those with conservative substitutions of sequences ofthe invention, e.g., the exemplary polypeptides ofthe invention, including but not limited to the following replacements: replacements of an aliphatic amino acid such as Alanine, Valine, Leucine and Isoleucine with another aliphatic amino acid; replacement of a Serine with a Threonine or vice versa; replacement of an acidic residue such as Aspartic acid and Glutamic acid with another acidic residue; replacement of a residue bearing an amide group, such as Asparagine and Glutamine, with another residue bearing an amide group; exchange of a basic residue such as Lysine and Arginine with another basic residue; and replacement of an aromatic residue such as Phenylalanine, Tyrosine with another aromatic residue.
  • replacements of an aliphatic amino acid such as Alanine, Valine, Leucine and Isoleucine with another aliphatic amino acid
  • replacement of a Serine with a Threonine or vice versa
  • variants are those in which one or more ofthe amino acid residues ofthe polypeptides ofthe invention includes a substituent group.
  • variants within the scope ofthe hivention are those in which the polypeptide is associated with another compound, such as a compound to increase the half-life ofthe polypeptide, for example, polyethylene glycol.
  • Additional variants within the scope ofthe invention are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence or a sequence which facilitates purification, enrichment, or stabilization ofthe polypeptide.
  • the variants, fragments, derivatives and analogs ofthe polypeptides ofthe invention retain the same biological function or activity as the exemplary polypeptides, e.g., epoxide hydrolase activity, as described herein.
  • the variant, fragment, derivative, or analog includes a proprotein, such that the variant, fragment, derivative, or analog can be activated by cleavage ofthe proprotein portion to produce an active polypeptide.
  • the invention provides methods for modifying epoxide hydro lase- encoding nucleic acids to modify codon usage.
  • the mvention provides methods for modifying codons in a nucleic acid encoding an epoxide hydrolase to increase or decrease its expression in a host cell.
  • the invention also provides nucleic acids encoding an epoxide hydrolase modified to increase its expression in a host ceU, epoxide hydrolase so modified, and methods of making the modified epoxide hydrolases.
  • the method comprises identifying a "non-preferred” or a "less preferred” codon in epoxide hydrolase-encoding nucleic acid and replacing one or more of these non- prefened or less preferred codons with a "preferred codon” encoding the same amino acid as the replaced codon and at least one non-preferred or less preferred codon in the nucleic acid has been replaced by a prefen-ed codon encoding the same amino acid.
  • a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell.
  • Host cells for expressing the nucleic acids, expression cassettes and vectors ofthe hivention include bacteria, yeast, fungi, plant cells, insect cells and mammalian ceUs.
  • the hivention provides methods for optimizing codon usage in all of these cells, codon-altered nucleic acids and polypeptides made by the codon-altered nucleic acids.
  • Enzymes ofthe invention can be expressed in any host ceU, e.g., any bacterial cell, e.g., any species within the genera Bacillus, Streptomyces or Staphylococcus, or any yeast cell, e.g., Pichia pastoris, Saccharomyces cerevisiae or
  • Exemplary host cells include gram negative bacteria, such as Escherichia coli; gram positive bacteria, such as Streptomyces, Lactobacillus gasseri, Lactococcus lactis, Lactococcus cremoris, Bacillus cereus, Bacillus subtilis.
  • Exemplary host cells also include eukaryotic organisms, e.g., various insect cells, animal cells, mammalian ceUs, yeast cells, such as Saccharomyces sp., includhig Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and Kluyveromyces lactis, Hansenula polymorpha, Aspergillus niger; and cell lines.
  • Exemplary animal cells include CHO, COS or Bowes melanoma or any mouse or human cell line. The selection of an appropriate host is within the abilities of those skilled in the art. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific hterature. See, e.g., Weising (1988) Ann. Rev. Genet. 22:421- 477, U.S. Patent No. 5,750,870.
  • the invention also includes nucleic acids and polypeptides optimized for expression in these organisms and species.
  • the codons of a nucleic acid encoding an epoxide hydrolase isolated from a bacterial cell are modified such that the nucleic acid is optimally expressed in a bacterial cell different from the bacteria from which the epoxide hydrolase was derived, a yeast, a fungi, a plant cell, an insect cell or a mammalian cell.
  • Methods for optimizing codons are well known in the art, see, e.g., U.S. Patent No. 5,795,737; Baca (2000) Int. J. Parasitol. 30:113-118; Hale (1998) Protein Expr. Purif. 12:185-188; Narum
  • the mvention provides transgenic non-human animals comprising a nucleic acid, a polypeptide (e.g., an epoxide hydrolase), an expression cassette or vector or a transfected or transformed cell ofthe invention.
  • the hivention also provides methods of making and using these transgenic non-human animals.
  • the transgenic non-human animals can be, e.g., goats, rabbits, sheep, pigs, cows, rats and mice, comprising the nucleic acids ofthe invention. These animals can be used, e.g., as in vivo models to study epoxide hydrolase activity, or, as models to screen for agents that change the epoxide hydrolase activity in vivo.
  • the coding sequences for the polypeptides to be expressed in the fransgenic non-human animals can be designed to be constitutive, or, under the control of tissue-specific, developmental-specific or inducible transcriptional regulatory factors.
  • Transgenic non-human animals can be designed and generated using any method known in the art; see, e.g., U.S. Patent Nos.
  • U.S. Patent No. 6,211,4208 describes making and using fransgenic non-human mammals which express in theh brains a nucleic acid construct comprising a DNA sequence.
  • U.S. Patent No. 5,387,742 describes injecting cloned recombinant or synthetic DNA sequences into fertilized mouse eggs, implanting the injected eggs in pseudopregnant females, and growing to term transgenic mice whose cells express proteins related to the pathology of Alzheimer's disease.
  • U.S. Patent No. 6,187,992 describes making and using a fransgenic mouse whose genome comprises a disruption ofthe gene encoding amyloid precursor protein (APP).
  • APP amyloid precursor protein
  • the transgenic or modified animals ofthe invention comprise a "knockout animal, 5 ' e.g., a "knockout mouse,” engineered not to express an endogenous gene, which is replaced with a gene expressing an epoxide hydrolase ofthe invention, or, a fusion protein comprismg an epoxide hydrolase ofthe invention.
  • the invention provides fransgenic plants and seeds comprising a nucleic acid, a polypeptide (e.g., an epoxide hydrolase), an expression cassette or vector or a fransfected or transformed ceU ofthe invention.
  • the invention also provides plant products, e.g., oils, seeds, leaves, extracts and the like, comprising a nucleic acid and/or a polypeptide (e.g., an epoxide hydrolase) ofthe invention.
  • the transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot).
  • the invention also provides methods of making and using these transgenic plants and seeds.
  • the fransgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with any method known in the art. See, for example, U.S. Patent No. 6,309,872.
  • Nucleic acids and expression constructs ofthe invention can be introduced into a plant ceU by any means.
  • nucleic acids or expression constructs can be introduced into the genome of a desired plant host, or, the nucleic acids or expression constructs can be episomes.
  • Introduction into the genome of a deshed plant can be such that the host's epoxide hydrolase production is regulated by endogenous transcriptional or translational confrol elements.
  • the hivention also provides "knockout plants” where insertion of gene sequence by, e.g., homologous recombination, has disrupted the expression ofthe endogenous gene. Means to generate "knockout" plants are well-known in the art, see, e.g., Sfrepp (1998) Proc Natl. Acad. Sci. USA 95:4368-4373; Miao (1995) Plant J 7:359-365. See discussion on fransgenic plants, below.
  • nucleic acids ofthe invention can be used to confer desired traits on essentially any plant, e.g., on starch-producing plants, such as potato, wheat, rice, barley, and the like.
  • Nucleic acids of the hivention can be used to manipulate metabolic pathways of a plant in order to optimize or alter host's expression of epoxide hydrolase. The can change epoxide hydrolase activity in a plant.
  • an epoxide hydrolase ofthe invention can be used in production of a fransgenic plant to produce a compound not naturaUy produced by that plant. This can lower production costs or create a novel product.
  • the first step in production of a transgenic plant involves making an expression construct for expression in a plant cell.
  • These techniques are well known in the art. They can include selecting and cloning a promoter, a coding sequence for facilitating efficient binding of ribosomes to mRNA and selecting the appropriate gene terminator sequences.
  • a constitutive promoter is CaMV35S, from the cauliflower mosaic virus, which generally results in a high degree of expression in plants.
  • Other promoters are more specific and respond to cues in the plant's internal or external envhonment.
  • An exemplary light-inducible promoter is the promoter from the cab gene, encoding the major chlorophyll a/b binding protein.
  • the nucleic acid is modified to achieve greater expression in a plant cell.
  • a sequence ofthe invention is likely to have a higher percentage of A-T nucleotide pahs compared to that seen in a plant, some of which prefer G-C nucleotide pahs. Therefore, A-T nucleotides in the coding sequence can be substituted with G-C nucleotides without significantly changing the amino acid sequence to enhance production ofthe gene product in plant cells.
  • Selectable marker gene can be added to the gene construct in order to identify plant cells or tissues that have successfully integrated the transgene. This may be necessary because achieving inco ⁇ oration and expression of genes in plant cells is a rare event, occurring in just a few percent ofthe targeted tissues or cells.
  • Selectable marker genes encode proteins that provide resistance to agents that are normally toxic to plants, such as antibiotics or herbicides. Only plant cells that have integrated the selectable marker gene will survive when grown on a medium containing the appropriate antibiotic or herbicide. As for other inserted genes, marker genes also requhe promoter and termination sequences for proper function.
  • making fransgenic plants or seeds comprises inco ⁇ orating sequences ofthe invention and, optionally, marker genes into a target expression construct (e.g., a plasmid), along with positioning ofthe promoter and the tem inator sequences.
  • a target expression construct e.g., a plasmid
  • This can involve transferring the modified gene into the plant through a suitable method.
  • a construct may be introduced directly into the genomic DNA ofthe plant ceU using techniques such as electroporation and microinjection of plant cell protoplasts, or the constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. For example, see, e.g., Christou (1997) Plant Mol. Biol. 35:197-203; Pawlowski (1996) Mol. Biotechnol.
  • protoplasts can be immobilized and injected with a nucleic acids, e.g., an expression construct.
  • a nucleic acids e.g., an expression construct.
  • plant regeneration from protoplasts is not easy with cereals, plant regeneration is possible in legumes using somatic embryogenesis from protoplast derived callus.
  • Organized tissues can be transformed with naked DNA using gene gun technique, where DNA is coated on tungsten microprojectiles, shot 1/lOOth the size of cells, which carry the DNA deep into ceUs and organelles.
  • Transformed tissue is then induced to regenerate, usually by somatic embryogenesis. This technique has been successful in several cereal species including maize and rice.
  • Nucleic acids can also be introduced in to plant cells using recombinant viruses.
  • Plant cells can be transformed using viral vectors, such as, e.g., tobacco mosaic virus derived vectors (Rouwendal (1997) Plant Mol. Biol. 33:989-999), see Porta (1996) "Use of vhal replicons for the expression of genes in plants," Mol. Biotechnol. 5:209-221.
  • nucleic acids e.g., an expression construct
  • suitable T-DNA flanking regions can be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector.
  • the virulence functions ofthe Agrobacterium tumefaciens host will dhect the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
  • Agrobacterium tumefaciens-mediated transformation techniques including disarming and use of binary vectors, are well described in the scientific literature. See, e.g., Horsch (1984) Science 233:496-498; Fraley (1983) Proc. N ⁇ tl. Ac ⁇ d. Sci.
  • the DNA in an A. tumefaciens cell is contained in the bacterial chromosome as well as in another structure known as a Ti (tumor-inducing) plasmid.
  • the Ti plasmid contains a stretch of DNA termed T-DNA ( ⁇ 20 kb long) that is transferred to the plant ceU in the infection process and a series of vir (virulence) genes that dhect the infection process. __.
  • tumefaciens can only infect a plant through wounds: when a plant root or stem is wounded it gives off certain chemical signals, in response to which, the vh genes of A. tumefaciens become activated and dhect a series of events necessary for the transfer ofthe T-DNA from the Ti plasmid to the plant's chromosome. The T-DNA then enters the plant cell through the wound.
  • One speculation is that the T-DNA waits until the plant DNA is being replicated or transcribed, then inserts itself into the exposed plant DNA. In order to use A.
  • the tumor-inducing section of T-DNA have to be removed, while retaining the T-DNA border regions and the vh genes.
  • the transgene is then inserted between the T-DNA border regions, where it is transferred to the plant cell and becomes integrated into the plant's chromosomes.
  • the invention provides for the transformation of monocotyledonous plants using the nucleic acids ofthe hivention, including important cereals, see Hiei (1997) Plant Mol. Biol. 35:205-218. See also, e.g., Horsch, Science (1984) 233:496; Fraley (1983) Proc. Natl Acad. Sci USA 80:4803; Thykjaer (1997) supra; Park (1996) Plant Mol. Biol. 32: 1135-1148, discussing T-DNA integration into genomic DNA. See also D ⁇ alluin, U.S. Patent No. 5,712,135, describing a process for the stable integration of a DNA comprising a gene that is functional in a cell of a cereal, or other monocotyledonous plant.
  • the third step can involve selection and regeneration of whole plants capable of transmitting the inco ⁇ orated target gene to the next generation.
  • regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker that has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture,
  • Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee (1987) Ann. Rev. of Plant Phys. 38:467-486.
  • tissue culture a process known as tissue culture. Once whole plants are generated and produce seed, evaluation ofthe progeny begins.
  • the expression cassette After the expression cassette is stably inco ⁇ orated in fransgenic plants, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. Since fransgenic expression ofthe nucleic acids ofthe invention leads to phenotypic changes, plants comprising the recombinant nucleic acids ofthe invention can be sexually crossed with a second plant to obtain a final product. Thus, the seed of the invention can be derived from a cross between two transgenic plants ofthe invention, or a cross between a plant of the invention and another plant.
  • the deshed effects e.g., expression ofthe polypeptides ofthe invention to produce a plant in which flowering behavior is altered
  • both parental plants express the polypeptides (e.g., an epoxide hydrolase) of the invention.
  • the desired effects can be passed to future plant generations by standard propagation means.
  • Transgenic plants ofthe invention can be dicotyledonous or monocotyledonous.
  • monocot transgenic plants ofthe invention are grasses, such as meadow grass (blue grass, Pod), forage grass such as festuca, lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (com).
  • dicot fransgenic plants ofthe invention are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
  • the fransgenic plants and seeds ofthe invention include a broad range of plants, including, but not limited to, species from the genera Anacardium, Arachis, Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lupinus,
  • Lycopersicon Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannisetum, Persea, Phaseolus, Pistachio, Pisum, Pyrus, Primus, Raphanus, Ricinus, Secale, Senecio, Sinapis, Solanum, Sorghum, Theobromus, Trigonella, Triticum, Vicia, Vitis, Vigna, and Zea .
  • the nucleic acids of the invention are expressed in plants which contain fiber cells, including, e.g., cotton, silk cotton free (Kapok, Ceiba pentandra), desert willow, creosote bush, winterfat, balsa, ramie, kenaf, hemp, roselle, jute, sisal abaca and flax.
  • the fransgenic plants ofthe invention can be members of the genus Gossypium, including members of any Gossypium species, such as G. arbor eum;. G. herbacewn, G. barbadense, and G. hirsutum.
  • the invention also provides for fransgenic plants to be used for producing large amounts ofthe polypeptides (e.g., an epoxide hydrolase or antibody) ofthe invention.
  • the polypeptides e.g., an epoxide hydrolase or antibody
  • the polypeptides e.g., an epoxide hydrolase or antibody
  • Palmgren (1997) Trends Genet. 13:348; Chong (1997) Transgenic Res. 6:289-296 (producing human milk protein beta-casein in transgenic potato plants using an auxin-inducibl ⁇ , bidhectional maunopine synthase (masl',2') promoter with Agrobacterium tumefaciens-mediate ⁇ leaf disc transformation methods).
  • the invention provides isolated or recombinant polypeptides having a sequence identity (e.g., at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, or complete (100%) sequence identity) to an exemplary sequence of the invention, e.g., SEQ ID NO:82, SEQ ID NO:84, or SEQ ID NO:86.
  • the polypeptide has an epoxide hydrolase activity.
  • the identity can be over the full length ofthe polypeptide, or, the identity can be over a region of at least about 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700 or more residues.
  • Polypeptides of the invention can also be shorter than the full length of exemplary polypeptides.
  • the invention provides polypeptides (peptides, fragments) ranging in size between about 5 and the fuU length of a polypeptide, e.g., an enzyme, such as an epoxide hydrolase; exemplary sizes being of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more residues, e.g., contiguous residues of an exemplary epoxide hydrolase ofthe invention.
  • an enzyme such as an epoxide hydrolase
  • exemplary sizes being of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more residues, e.g., contig
  • Peptides ofthe invention can be useful as, e.g., labeling probes, antigens, toleragens, motifs, epoxide hydrolase active sites.
  • Polypeptides ofthe invention also include antibodies capable of binding to an enzyme ofthe hivention.
  • SEQ ID NO:82 is
  • SEQ ID NO:84 is N-(SEQ ID NO:84).
  • SEQ ID NO: 86 is
  • polypeptides ofthe invention include epoxide hydrolases in an active or inactive form.
  • the polypeptides ofthe invention include proproteins before "maturation 55 or processing of prepro sequences, e.g., by a proprotein-processing enzyme, such as a proprotein convertase to generate an "active 55 mature protein.
  • the polypeptides ofthe invention include epoxide hydrolases inactive for other reasons, e.g., before "activation 55 by a post-franslational processing event, e.g., an endo- or exo- peptidase or proteinase action, a phosphorylation event, an amidation, a glycosylation or a sulfation, a dimerization event, and the like.
  • a post-franslational processing event e.g., an endo- or exo- peptidase or proteinase action, a phosphorylation event, an amidation, a glycosylation or a sulfation, a dimerization event, and the like.
  • Methods for identifying "prepro" domain sequences and signal sequences are well known in the art, see, e.g., Van de Ven (1993) Crit. Rev. Oncog. 4(2): 115-136.
  • the protein is purified from the extracellular space and
  • the polypeptides ofthe invention include aU active forms, including active subsequences, e.g., catalytic domains or active sites, of an enzyme ofthe hivention.
  • the invention provides catalytic domains or active sites as set forth below.
  • the invention provides a peptide or polypeptide comprising or consisting of an active site domain as predicted through use of a database such as Pfam (which is a large collection of multiple sequence alignments and hidden Markov models covering many common protein famhies, The Pfam protein families database, A. Bateman, E. Bimey, L. Cerruti, R. Durbin, L. Etwiller, S.R. Eddy, S. Griffiths- Jones, K.L.
  • Pfam which is a large collection of multiple sequence alignments and hidden Markov models covering many common protein famhies
  • the invention includes polypeptides with or without a signal sequence and/or a prepro sequence.
  • the invention includes polypeptides with heterologous signal sequences and/or prepro sequences.
  • the prepro sequence (including a sequence ofthe invention used as a heterologous prepro domain) can be located on the amino terminal or the carboxy terminal end ofthe protein.
  • the invention also includes isolated or recombinant signal sequences, prepro sequences and catalytic domains (e.g., "active sites 55 ) comprising sequences ofthe invention.
  • Polypeptides and peptides ofthe invention can be isolated from natural sources, be synthetic, or be recombinantly generated polypeptides. Peptides and proteins can be recombinantly expressed in vitro or in vivo.
  • the peptides and polypeptides ofthe invention can be made and isolated using any method known in the art. Polypeptide and peptides ofthe invention can also be synthesized, whole or in part, using chemical methods well known in the art. See e.g., Caruthers (1980) Nucleic Acids Res. Symp. Ser. 215-223; Horn (1980) Nucleic Acids Res. Symp. Ser.
  • peptide synthesis can be performed using various solid-phase techniques (see e.g., Roberge (1995) Science 269:202; Merrifield (1997) Methods Enzymol. 289:3-13) and automated synthesis may be achieved, e.g., using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
  • the peptides and polypeptides ofthe invention can also be glycosylated.
  • the glycosylation can be added post-franslationally either chemicaUy or by cellular biosynthetic mechanisms, wherein the later inco ⁇ orates the use of known glycosylation motifs, which can be native to the sequence or can be added as a peptide or added in the nucleic acid coding sequence.
  • the glycosylation can be O-linked or N-linked.
  • the peptides and polypeptides ofthe invention include all "mimetic 55 and "peptidomimetic 55 forms.
  • the terms "mimetic 55 and "peptidomimetic 55 refer to a synthetic chemical compound which has substantially the same structural and/or functional characteristics ofthe polypeptides ofthe invention.
  • the mimetic can be either enthely composed of synthetic, non-natural analogues of amino acids, or, is a chimeric molecule of partly natural peptide amino acids and partly non-natural analogs of amino acids.
  • the mimetic can also inco ⁇ orate any amount of natural amino acid conservative substitutions as long as such substitutions also do not substantially alter the mimetic 5 s structure and/or activity.
  • a mimetic composition is within the scope ofthe hivention if it has an epoxide hydrolase activity.
  • Polypeptide mimetic compositions ofthe invention can contain any combination of non-natural structural components.
  • mimetic compositions ofthe invention include one or all ofthe following three structural groups: a) residue linkage groups other than the natural amide bond ("peptide bond 55 ) linkages; b) non-natural residues in place of naturally occurring amino acid residues; or c) residues which induce secondary structural mimicry, i.e., to induce or stabilize a secondary structure, e.g., a beta turn, gamma turn, beta sheet, alpha helix conformation, and the like.
  • a polypeptide ofthe hivention can be characterized as a mimetic when all or some of its residues are joined by chemical means other than natural peptide bonds.
  • Individual peptidomimetic residues can be joined by peptide bonds, other chemical bonds or coupling means, such as, e.g., glutaraldehyde, N-hydroxysuccinhnide esters, bifunctional malehnides, N,N 5 -dicyclohexylcarbodiimide (DCC) or N,N'- diisopropylcarbodiimide (DIC).
  • glutaraldehyde N-hydroxysuccinhnide esters
  • bifunctional malehnides N,N 5 -dicyclohexylcarbodiimide (DCC) or N,N'- diisopropylcarbodiimide (DIC).
  • aminomethylene CH 2 -NH
  • ethylene olefin
  • a polypeptide ofthe invention can also be characterized as a mimetic by containing all or some non-natural residues in place of naturally occurring amino acid residues.
  • Non-natural residues are well described in the scientific and patent literature; a few exemplary non-natural compositions useful as mimetics of natural amino acid residues and guidelines are described below.
  • Mimetics of aromatic amino acids can be generated by replacing by, e.g., D- or L- naphylalanhie; D- or L- phenylglycine; D- or L- 2 thieneylalanine; D- or L-1, -2, 3-, or 4- pyreneylalanine; D- or L-3 thieneylalanine; D- or L-(2-pyridinyl)-alanine; D- or L-(3-pyridmyl)-alanine; D- or L-(2-pyrazinyl)-alanine; D- or L-(4-isopropyl)-phenylglycine; D-(trifluoromethyl)-phenylglycine; D- (trifluoromethyl)-phenylalanh ⁇ e; D-p-fluoro-phenylalanine; D- or L-p- biphenylphenylalanine; D- or L-p-methoxy-bipheny
  • Aromatic rings of a non-natural amino acid include, e.g., thiazolyl, thiophenyl, pyrazolyl, benzimidazolyl, naphthyl, furanyl, pyrrolyl, and pyridyl aromatic rings.
  • Mimetics of acidic amino acids can be generated by substitution by, e.g., non-carboxylate amino acids while maintaining a negative charge; (phosphono)alanine; sulfated threonine.
  • Carboxyl side groups e.g., aspartyl or glutamyl
  • Carboxyl side groups can also be selectively modified by reaction with carbodiimides (R'-N-C-N-R 5 ) such as, e.g., 1- cyclohexyl-3(2-mo ⁇ holinyl-(4-ethyl) carbodifmide or l-ethyl-3(4-azonia- 4,4- dimetholpentyl) carbodiimide.
  • Aspartyl or glutamyl can also be converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • Mimetics of basic amino acids can be generated by substitution with, e.g., (in addition to lysine and arginine) the amino acids ornithine, citrulline, or (guanidino)-acetic acid, or (guanidino)alkyl-acetic acid, where alkyl is defined above.
  • Nitrile derivative e.g., containing the CN-moiety in place of COOH
  • Asparaginyl and glutaminyl residues can be deaminated to the conesponding aspartyl or glutamyl residues.
  • Arginine , residue mimetics can be generated by reacting arginyl with, e.g., one or more conventional reagents, including, e.g., phenylglyoxal, 2,3-butanedione, 1,2-cyclo- hexanedione, or ninhydrin, preferably under alkaline conditions.
  • Tyrosine residue mimetics can be generated by reacting tyrosyl with, e.g., aromatic diazonium compounds or tefranifromethane.
  • N-acetylimidizol and tefranitromethane can be used to form O- acetyl tyrosyl species and 3 -nitro derivatives, respectively.
  • Cysteine residue mimetics can be generated by reacting cysteinyl residues with, e.g., alpha-haloacetates such as 2- chloroacetic acid or chloroacetamide and corresponding amines; to give carboxymethyl or carboxyamidomethyl derivatives.
  • Cysteine residue mimetics can also be generated by reacting cysteinyl residues with, e.g., bromo-trifluoroacetone, alpha-bromo-beta-(5- imidozoyl) propionic acid; chloroacetyl phosphate, N-alkylmaleimides, 3- ⁇ ifro-2-pyridyl disulfide; methyl 2-pyridyl disulfide; p-chloromercuribenzoate; 2-chloromercuri-4 nitrophenol; or, chloro-7-nifrobenzo-oxa-l,3-diazole.
  • cysteinyl residues e.g., bromo-trifluoroacetone, alpha-bromo-beta-(5- imidozoyl) propionic acid
  • chloroacetyl phosphate N-alkylmaleimides
  • 3- ⁇ ifro-2-pyridyl disulfide methyl 2-pyridyl disul
  • Lysine mimetics can be generated (and amino terminal residues can be altered) by reacting lysinyl with, e.g., succinic or other carboxylic acid anhydrides. Lysine and other alpha-ammo-containing residue mimetics can also be generated by reaction with imidoesters, such as methyl picolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitro- benzenesulfonic acid, O-methylisourea, 2,4, pentanedione, and fransamidase-catalyzed reactions with glyoxylate. Mimetics of methionine can be generated by reaction with, e.g., methionine sulfoxide.
  • Mimetics of proline include, e.g., pipecolic acid, thiazolidine carboxylic acid, 3- or 4- hydroxy proline, dehydroproline, 3- or 4-methylproline, or 3,3,- dhnethylprolhie.
  • Histidine residue mimetics can be generated by reacting histidyl with, e.g., diethylprocarbonate or para-bromophenacyl bromide.
  • mimetics include, e.g., those generated by hydroxylation of proline and lysine; phosphorylation ofthe hydroxyl groups of seryl or threonyl residues; methylation ofthe alpha-amino groups of lysine, arginine and histidine; acetylation ofthe N-terminal amine; methylation of main chain amide residues or substitution with N-methyl amino acids; or amidation of C-terminal carboxyl groups.
  • a residue, e.g., an amino acid, of a polypeptide ofthe mvention can also be replaced by an amino acid (or peptidomimetic residue) ofthe opposite chirality.
  • any amino acid naturally occurring hi the L-configuration (which can also be referred to as the R or S, depending upon the stracture ofthe chemical entity) can be replaced with the amino acid ofthe same chemical structural type or a peptidomimetic, but ofthe opposite chirality, referred to as the D- amino acid, but also can be referred to as the R- or S- form.
  • the invention also provides methods for modifying the polypeptides ofthe invention by either natural processes, such as post-franslational processing (e.g., phosphorylation, acylation, etc), or by chemical modification techniques, and the resulting modified polypeptides. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphatidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma- carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation.
  • Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments ofthe hivention. Such method have been known in the art since the early 1960's (Merrifield, R. B., J. Am. Chem. Soc, 85:2149-2154, 1963) (See also Stewart, J. M. and Young, J.
  • a plate of rods or pins is inverted and inserted into a second plate of corresponding wells or reservoirs, which contain solutions for attaching or anchoring an appropriate amino acid to the pin's or rod's tips.
  • a process step i.e., inverting and inserting the rod's and pin's tips into appropriate solutions, amino acids are built into deshed peptides.
  • FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an
  • the invention includes epoxide hydrolases ofthe invention with and without signal.
  • the polypeptide comprising a signal sequence ofthe hivention can be an epoxide hydrolase ofthe invention or another epoxide hydrolase or another enzyme or other polypeptide.
  • the invention includes immobilized epoxide hydrolases, anti-epoxide hydrolase antibodies and fragments thereof.
  • the invention provides methods for inhibiting epoxide hydrolase activity, e.g, using dominant negative mutants or anti- epoxide hydrolase antibodies ofthe hivention.
  • the invention includes heterocomplexes, e.g., fusion proteins, heterodhners, etc., comprising the epoxide hydrolases ofthe invention.
  • Polypeptides ofthe invention can have an epoxide hydrolase activity under various conditions, e.g., extremes in pH and/or temperature, oxidizing agents, and the like.
  • the invention provides methods leading to alternative epoxide hydrolase preparations with different catalytic efficiencies and stabilities., e.g., towards temperature, oxidizing agents and changing wash conditions.
  • epoxide hydrolase variants can be produced using techniques of site-dhected mutagenesis and/or random mutagenesis.
  • directed evolution can be used to produce a great variety of epoxide hydrolase variants with alternative specificities and stability.
  • the proteins ofthe invention are also useful as research reagents to identify epoxide hydrolase modulators, e.g., activators or inhibitors of epoxide hydrolase activity. Briefly, test samples (compounds, broths, extracts, and the like) are added to epoxide hydrolase assays to determine theh ability to inhibit substrate cleavage. Inhibitors identified in this way can be used in industry and research to reduce or prevent undesired proteolysis. As with epoxide hydrolases, inhibitors can be combined to increase the spectrum of activity.
  • the invention also provides methods of discovering new epoxide hydrolases using the nucleic acids, polypeptides and antibodies ofthe hivention.
  • lambda phage libraries are screened for expression-based discovery of epoxide hydrolases.
  • the invention uses lambda phage libraries in screening to allow detection of toxic clones; unproved access to subsfrate; reduced need for engineering a host, by-passing the potential for any bias resulting from mass excision ofthe library; and, faster growth at low clone densities. Screening of lambda phage libraries can be in liquid phase or in solid phase. In one aspect, the invention provides screening in liquid phase.
  • the invention provides screening methods using the proteins and nucleic acids ofthe invention and robotic automation to enable the execution of many thousands of biocatalytic reactions and screening assays in a short period of time, e.g., per day, as well as ensuring a high level of accuracy and reproducibility (see discussion of arrays, below). As a result, a library of derivative compounds can be produced in a matter of weeks. For further teachings on modification of molecules, including small molecules, see PCT/US94/09174.
  • the present invention includes epoxide hydrolase enzymes which are non- naturaUy occurring carbonyl hydrolase variants (e.g., epoxide hydrolase variants) having a different proteolytic activity, stability, subsfrate specificity, pH profile and/or performance characteristic as compared to the precursor carbonyl hydrolase from which the amino acid sequence of the variant is derived.
  • epoxide hydrolase variants have an amino acid sequence not found hi nature, which is derived by substitution of a plurality of amino acid residues of a precursor epoxide hydrolase with different amino acids.
  • the precursor epoxide hydrolase may be a naturally-occurring epoxide hydrolase or a recombinant epoxide hydrolase.
  • the useful epoxide hydrolase variants encompass the substitution of any ofthe naruraUy occurring L-amino acids at the designated amino acid residue positions.
  • the invention provides signal sequences (e.g., signal peptides (SPs)), prepro domains and catalytic domains (CDs).
  • SPs signal peptides
  • CDs catalytic domains
  • the SPs, prepro domains and/or CDs ofthe invention can be isolated or recombinant peptides or can be part of a fusion protein, e.g., as a heterologous domain in a chimeric protein.
  • the invention provides nucleic acids encoding these catalytic domains (CDs), prepro domains and signal sequences (SPs, e.g., a peptide having a sequence comprising/ consisting of amino terminal residues of a polypeptide ofthe invention).
  • the invention provides a signal sequence comprising a peptide comprising/ consisting of a sequence as set forth in residues 1 to 12, 1 to 13, 1 to 14, 1 to 15, 1 to 16, 1 to 17, 1 to 18, 1 to 19, 1 to 20, 1 to 21, 1 to 22, 1 to 23, 1 to 24, 1 to 25, 1 to 26, 1 to 27, 1 to 28, 1 to 28, 1 to 30, 1 to 31, 1 to 32, 1 to 33, 1 to 34, 1 to 35, 1 to 36, 1 to 37, 1 to 38, 1 to 39, 1 to 40, 1 to 41, 1 to 42, 1 to 43, 1 to 44 (or a longer peptide) of a polypeptide ofthe invention.
  • the epoxide hydrolase signal sequences (SPs), CDs, and/or prepro sequences ofthe invention can be isolated peptides, or, sequences joined to another hydrolase or a non- epoxide hydrolase polypeptide, e.g., as a fusion (chimeric) protein.
  • the invention provides polypeptides comprising epoxide hydrolase signal sequences ofthe invention.
  • polypeptides comprising epoxide hydrolase signal sequences SPs, CDs, and/or prepro ofthe mvention comprise sequences heterologous to epoxide hydrolases ofthe invention (e.g., a fusion protem comprising an SP, CD, and/or prepro of the invention and sequences from another epoxide hydrolase or a non-epoxide hydrolase protein).
  • the invention provides epoxide hydrolases ofthe invention with heterologous SPs, CDs, and/or prepro sequences, e.g., sequences with a yeast signal sequence.
  • An epoxide hydrolase ofthe invention can comprise a heterologous SP and or prepro in a vector, e.g., a pPIC series vector (Invitrogen, Carlsbad, CA).
  • SPs, CDs, and or prepro sequences ofthe invention are identified following identification of novel epoxide hydrolase polypeptides.
  • the pathways by which proteins are sorted and fransported to theh proper cellular location are often refened to as protein targeting pathways.
  • One ofthe most important elements in all of these targeting systems is a short amino acid sequence at the amino terminus of a newly synthesized polypeptide called the signal sequence. This signal sequence directs a protein to its appropriate location in the cell and is removed during fransport or when the protein reaches its final destination.
  • Most lysosomal, membrane, or secreted proteins have an amino-terminal signal sequence that marks them for translocation into the lumen ofthe endoplasmic reticulum.
  • the signal sequences can vary in length from 13 to 45 or more amino acid residues.
  • Various methods of recognition of signal sequences are known to those of skill in the art.
  • SignalP uses a combined neural network which recognizes both signal peptides and theh cleavage sites. (Nielsen, et al., "Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.” Protein Engineering, vol. 10, no. 1, p. 1-6 (1997).
  • epoxide hydrolases ofthe invention do not have SPs and/or prepro sequences, and/or catalytic domains (CDs).
  • the invention provides polypeptides (e.g., epoxide hydrolases) lacking all or part of an SP, a CD and/or a prepro domain.
  • the invention provides a nucleic acid sequence encoding a signal sequence (SP), a CD, and/or prepro from one epoxide hydrolase operably linked to a nucleic acid sequence of a different epoxide hydrolase or, optionally, a signal sequence (SPs) and/or prepro domain from a non-epoxide hydrolase protein may be deshed.
  • the invention also provides isolated or recombinant polypeptides comprising signal sequences (SPs), prepro domain and/or catalytic domains (CDs) ofthe invention and heterologous sequences.
  • the heterologous sequences are sequences not naturally associated (e.g., to an epoxide hydrolase) with an SP, prepro domain and/or CD.
  • the sequence to which the SP, prepro domain and/or CD are not naturally associated can be on die SP's, prepro domain and/or CD's amino terminal end, carboxy terminal end, and/or on both ends ofthe SP and/or CD.
  • the invention provides an isolated or recombinant polypeptide comprising (or consisting of) a polypeptide comprising a signal sequence (SP), prepro domain and/or catalytic domain (CD) ofthe invention with the proviso that it is not associated with any sequence to which it is naturally associated (e.g., epoxide hydrolase sequence).
  • SP signal sequence
  • CD catalytic domain
  • the invention provides isolated or recombinant nucleic acids encoding these polypeptides.
  • the isolated or recombinant nucleic acid ofthe invention comprises coding sequence for a signal sequence (SP), prepro domain and/or catalytic domain (CD) ofthe invention and a heterologous sequence (i.e., a sequence not naturally associated with the a signal sequence (SP), prepro domain and/or catalytic domain (CD) ofthe invention).
  • the heterologous sequence can be on the 3 ' terminal end, 5 5 terminal end, and/or on both ends of the SP, prepro domain and/or CD coding sequence.
  • the invention provides fusion of N-terminal or C-terminal subsequences of enzymes ofthe invention (e.g., signal sequences, prepro sequences) with other polypeptides, active proteins or protein fragments.
  • enzymes ofthe invention e.g., signal sequences, prepro sequences
  • the production of an enzyme ofthe invention may also be accomplished by expressing the enzyme as an inactive fusion protein that is later activated by a proteolytic cleavage event (using either an endogenous or exogenous protease activity, e.g. trypsin) that results in the separation ofthe fusion protein partner and the mature enzyme, e.g., epoxide hydrolase ofthe invention.
  • the fusion protein ofthe invention is expressed from a hybrid nucleotide construct that encodes a single open reading frame containing the following elements: the nucleotide sequence for the fusion protein, a Unker sequence (defined as a nucleotide sequence that encodes a flexible amino acid sequence that joins two less flexible protein domains), protease cleavage recognition site, and the mature enzyme (e.g., epoxide hydrolase) sequence.
  • a hybrid nucleotide construct that encodes a single open reading frame containing the following elements: the nucleotide sequence for the fusion protein, a Unker sequence (defined as a nucleotide sequence that encodes a flexible amino acid sequence that joins two less flexible protein domains), protease cleavage recognition site, and the mature enzyme (e.g., epoxide hydrolase) sequence.
  • the fusion protein can comprise a pectate lyase sequence, a xylanase sequence, a phosphatidic acid phosphatase sequence, or another sequence, e.g., a sequence that has previously been shown to be over-expressed in a host system of interest.
  • Any host system can be used (see discussion, above), for example, E. coli or Pichia pastoris.
  • the arrangement ofthe nucleotide sequences in the chimeric nucleotide construction can be determined based on the protein expression levels achieved with each fusion constract.
  • the nucleotide sequences is assembled as follows: Signal sequence/fusion protein/linker sequence/protease cleavage recognition site/ mature enzyme (e.g., any enzyme ofthe hivention, e.g., a hydrolase) or signal sequence/pro sequence/mature enzyme/linker sequence/fusion protein.
  • the expression of enzyme e.g., epoxide hydrolase as an inactive fusion protein may improve the overall expression ofthe enzyme's sequence, may reduce any potential toxicity associated with the ove ⁇ roduction of active enzyme and/or may increase the shelf life of enzyme prior to use because enzyme would be inactive until the fusion protein is processed.
  • the invention provides specific formulations for the activation of an epoxide hydrolase ofthe invention expressed as a fusion protein.
  • the activation ofthe epoxide hydrolase activity initially expressed as an inactive fusion protein is accomplished using a proteolytic activity or potentially a proteolytic activity in combination with an amino-terminal or carboxyl-terminal peptidase. This activation event may be accomplished in a variety of ways and at variety of points in the manufacturing/storage process prior to applications.
  • Exemplary processes ofthe invention include: cleavage by an endogenous activity expressed by the manufacturing host upon secretion ofthe fusion constract into the fermentation media; cleavage by an endogenous protease activity that is activated or comes in contact with intracellularly expressed fusion construct upon rapture of the host cells; passage of the crude or purified fusion construct over a column of immobilized protease activity to accomplish cleavage and enzyme (e.g., epoxide hydrolase ofthe invention) activation prior to enzyme formulation; freatment ofthe crude or purified fusion constract with a soluble source of proteolytic activity; and/or, activation ofthe epoxide hydrolase activity by continuously circulating the fusion construct formulation through a column of immobilized protease activity at reduced temperature (for example, any temperature between about 4°C and 20°C).
  • enzyme e.g., epoxide hydrolase ofthe invention
  • the peptides and polypeptides ofthe invention can also be glycosylated, for example, in one aspect, comprismg at least one glycosylation site, e.g., an N-linked or O-linked glycosylation.
  • the polypeptide can be glycosylated after being expressed in a P. pastoris or a S. pombe.
  • the glycosylation can be added post-translationally either chemically or by cellular biosynthetic mechanisms, wherein the later inco ⁇ orates the use of known glycosylation motifs, which can be native to the sequence or can be added as a peptide or added in the nucleic acid coding sequence.
  • an epoxide hydrolase (EH) enzyme ofthe invention has an activity analogous to the mechanism of an A. radiobacter epoxide hydrolase, as illusfrated in Figure 11. While the invention is not limited by any particular mechanism of action, this exemplary catalytic mechanism involves two distinct steps.
  • the first step (a) is an SN2 nucleophilic attack by an Asp 107 carboxylate oxygen on the least hindered carbon atom ofthe epoxide, resulting in a covalent ester intermediate.
  • the ester intermediate is hydrolyzed by a water molecule that is activated by the Asp246- His275 pair.
  • EHs ofthe invention can exhibit high enantioselectivity and/or high activity toward certain categories of epoxide subsfrates.
  • epoxide subsfrates for various EHs ofthe mvention can be divided into five types: mono- substituted, 2,2-disubstituted, 2,3-disubstituted, trisubstituted, and styrene-oxides, as illusfrated in Figure 12.
  • EHs ofthe invention can have different stereoselectivities to different types of subsfrates, including these five types.
  • an enzyme ofthe invention has selectivity for R-epoxides as their subsfrates.
  • an enzyme ofthe invention has good enantioselectivity for sterically more bulky 2,2-disubstituted subsfrates, e.g., analogous to Rhodococcus (strains NCIMB 11216, DSM 43338) or Nocardia sp. (strains H8, TB1, EH1).
  • the regioselectivity can be absolute, i.e., attack can occur exclusively at the less hindered unsubstituted oxhane carbon atom.
  • an enzyme ofthe invention has good enantioselectivity for S-enantiomers.
  • an enzyme ofthe invention has mixed regioselectivities, e.g., for the hydrolysis of 2,3-disubstituted subsfrates, in which ring-opening occurs at both positions ofthe oxhane ring at various ratios. Noting the invention is not limited by any particular mechanism of action, this can be due to the fact that both reaction centers have similar steric effects. Significant applications may be found in two scenarios. In the cases where Rl and R2 are identical, the subsfrates are meso compounds. Epoxide hydrolases ofthe invention can catalyze desymmetrization, which leads to a single enantiomeric diol product with 100% yield.
  • EHs ofthe hivention can catalyze hydrolysis in an enantioconvergent manner leading to only one stereoisomeric diol as the sole product. This can be useful for the synthesis of enantiopure vicinal diols.
  • an EH ofthe invention can catalyze the enantioconvergent hydrolysis of cis-2,3-e ⁇ oxyheptane to 2R,3R-2,3-dihydroxyheptane with good yield and enantiomeric excess, as illusfrated in Figure 13, with exemplary protocols that can be used with enzymes ofthe invention described, e.g., in Rroutil (1996) Tetrahedron Lett. 37:8379-8382.
  • the 2S,3R-enantiomer reacts 10-fold faster than the 2R,3S-enantiomer, but hydrolysis of both enantiomers can occur via attack at the S-centers, leading exclusively to the 2R,3R-diol product.
  • an enzyme ofthe invention can hydrolyze trisubstituted epoxides.
  • an EH ofthe invention has good enantioselectivity for bulky substrates, e.g., trisubstituted epoxides.
  • Exemplary protocols that can be used with enzy es ofthe invention, e.g., to hydrolyze trisubstituted epoxides, are described, e.g., in Weijers (1997) Tetrahedron: Asymmetry 8:639-647; Archer (1996) Tetrahedron Lett. 37:8819-8822.
  • an enzyme ofthe invention can hydrolyze styrene-oxides. These can be viewed as a special group of substrates because the benzylic carbon of these subsfrates provides stability to the carbocation nature ofthe transition state ofthe reaction. As a result, this group of substrates usually exhibits poor regioselectivity if the benzylic carbon is also sterically hhidered.
  • an enzyme ofthe invention has excellent enantioselectivity for styrene-oxides, e.g., analogous to that observed in reactions catalyzed by enzymes from red yeasts such as Rhodotorula glutinis strain CIMW 147, or fungal epoxide hydrolases, such as the enzyme from Aspergillus niger.
  • red yeasts such as Rhodotorula glutinis strain CIMW 147
  • fungal epoxide hydrolases such as the enzyme from Aspergillus niger.
  • Exemplary protocols that can be used with enzymes ofthe invention are described, e.g., by Weijers (1997) Tetrahedron: Asymmetry 8:639-647; Archelas (2001) Curr. Opin. Chem. Biol. 5:112-119.
  • an enzyme ofthe invention has very good regioselectivity hi the synthesis of diols, or, in other aspects, EHs ofthe invention can have high stereoselectivity for any type of epoxides.
  • an enzyme of the invention has activity similar or analogous to that of yeast EHs with mono-substituted oxiranes, or fungal EHs with styrene-oxide substrates, or bacterial enzymes with 2,2- and 2,3- disubstituted epoxides.
  • enzymes ofthe invention are used as tools for chemists to prepare enantiopure epoxides and vicinal diols.
  • the enzymes ofthe invention are used to synthesize chiral epoxides and diols for use in anti-cancer, antivirals, antifungals, antibacterials, and other pharmaceuticals .
  • the enzymes ofthe invention are used in conjunction with current chemical asymmetric epoxidation processes.
  • industrial applications of epoxide hydrolases ofthe invention comprise: replacing chemical methods as "cleaner" catalysts in certain transformations; to be the choice of catalysts where the chemical methods are limited; preparing certain diols in an enantioconvergent manner where the yields are not limited to 50%; use in combination with other asymmetric epoxidation methods to improve overall ee value by hydrolyzing a minor epoxide enantiomer.
  • an enzyme ofthe invention is used as a catalyst for the modification of epoxides.
  • the invention provides sensitive, high throughput methods for the discovery of catalysts for the modification of epoxides using, e.g., EHs of the invention.
  • High throughput methods can be used to determine if an enzyme is an EH within the scope ofthe invention.
  • a combination of optimized assays and screening hosts are applied to demonstrate that biocatalysts can be obtained from environmental gene libraries.
  • the host strain libraries and envhonmental gene libraries can be built using the technologies described in U.S. Patent No. 5,958,672, U.S. Patent No. 6,001,574 and U.S. Patent No. 5,763,239.
  • the invention provides polypeptides having epoxide hydrolase activity, polynucleotides encoding the polypeptides, and methods for making and using these polynucleotides and polypeptides.
  • the polypeptides ofthe invention can be used as epoxide hydrolases to catalyze the hydrolysis of epoxides and arene oxides to their corresponding diols.
  • Epoxide hydrolases ofthe invention can be hydrolytic enzymes to catalyze the opening of an epoxide ring to convert a subsfrate to a conesponding diol.
  • Epoxide hydrolases ofthe mvention can be highly regio- and enantioselective, allowing the preparation of pure enantiomers.
  • the polypeptides ofthe hivention can be used to hydrolyze hazardous epoxide compounds generated through peroxidation in living organisms, and, to eliminate the high chemical reactivity of epoxide compounds.
  • the invention provides epoxide hydrolases (EHs) from wide varieties of biodiversity sources such as enzyme or gene libraries.
  • EHs epoxide hydrolases
  • the invention provides methods to rapidly select or screen enzymes and genes to obtain suitable EHs.
  • the invention provides methods to access untapped biodiversity and to rapidly screen for sequences and activities of interest utilizing recombinant DNA technology. This invention combines the benefits associated with the ability to rapidly screen natural compounds with the flexibility and reproducibility afforded with working with the genetic material of organisms.
  • the invention provides method to synthesize useful chiral epoxides using the enzymes of the present invention.
  • the invention provides useful chiral epoxides and theh derivatives produced using the EHs ofthe present invention.
  • the epoxide hydrolases ofthe invention are highly versatile biocatalysts for the asymmetric hydrolysis of epoxides on a preparative scale. Besides kinetic resolution, which furnishes the corresponding vicinal diol and remaining non-hydrolyzed epoxide in nonracemic form, the epoxide hydrolases ofthe invention are used in enantioconvergent processes for the generation of a single enantiomeric diol from a racemic oxirane.
  • the epoxide hydrolases ofthe invention can be used in the hydrolysis of highly substituted epoxides, e.g., highly substituted 2,2- and 2,3-disubstituted epoxides.
  • the epoxide hydrolases of the invention can be used in any method known in the art, see, e.g., Orru (1999) Curr. Opin. Chem. Biol. 3:16-21.
  • polypeptides ofthe invention can be used as epoxide hydrolases in Sha ⁇ less epoxidation, Katsuki-Jacobsen reactions, Shi Epoxidation and Jacobsen hydrolytic kinetic resolution reactions.
  • the invention provides methods for using epoxide hydrolases ofthe invention to provide stereospecific reaction products.
  • the polypeptides ofthe invention can be used in the desymmetrization of meso-epoxides.
  • the conversion of subsfrate to either R,R or SS-product was with greater than 97%ee, and, in one aspect, 99% conversion.
  • Figure 6 is a schematic of an exemplary reaction where an epoxide hydrolase ofthe invention is used in the desymmetrization of meso-epoxides.
  • the invention provides epoxide hydrolases to produce styrene glycol, and corresponding methods.
  • the epoxide hydrolases are reacted with styrene oxide to produce styrene glycols.
  • the invention provides methods for enzymatic separation of epoxide- enantiomer mixtures.
  • the invention provides methods for protecting a cell against oxidants, e.g., in an immunotoxic reaction, comprising introducing around or into the cell an antioxidizing agent comprising an epoxide hy rolase.
  • the invention provides epoxide hydrolase inhibitors (e.g., an antisense or ribozyme nucleic acid, or an antibody, ofthe invention) to ameliorate an immunological disorder, e.g., a T ceU mediated disorder, and corresponding methods of ameliorating an immunological disorder, e.g., a T cell mediated disorder.
  • the invention provides epoxide hydrolases to freat peroxisomal disorders, and conesponding methods of ameliorating a peroxisomal disorder.
  • the invention provides epoxide hydrolases to freat dysfunction, damage or diseases ofthe respiratory system and corc ⁇ sponding methods of ameliorating dysfunction, damage or diseases ofthe respiratory system.
  • the invention provides reagents for forensic analyses, e.g., as chromosome markers or tissue or organ specific markers, comprising epoxide hydrolases ofthe hivention.
  • the invention provides epoxide hydrolases to develop novel pest confrol, e.g., insect, agents, and, compositions comprising epoxide hydrolase inhibitors (e.g., an antisense or ribozyme nucleic acid, or an antibody, ofthe invention) for use in pest confrol.
  • the invention provides epoxide hydrolases to hydrolyze leukotrienes, and corresponding methods, e.g., theh use as anti-inflammatory reagents.
  • the invention provides pharmaceutical compositions comprising one or more epoxide hydrolases of the invention to act as anti-mflammatory reagents by hydrolyzing leukotrienes and other inflammation-causing compositions.
  • inflammation can be treated by inhibition of epoxide hydrolases using compositions comprising epoxide hydrolase inhibitors (e.g., an antisense or ribozyme nucleic acid, or an antibody, ofthe invention) to inhibit inflammation mediates by poly-unsaturated lipid metabolites.
  • the invention provides epoxide hydrolases and methods to evaluate the cyto toxicity of a compound by measuring the expression of epoxide hydrolase in a cell.
  • polypeptides ofthe invention can be made or used as epoxide hydrolases in any known method, protocol or industrial use, as described, e.g., in U.S. Patent Nos. 6,387,668; 6,379,938; 6,372,469; 6,372,469; 5,635,369; 6,174,695, describing use of epoxide hydrolase inhibitors to inhibit inflammation mediated by poly- unsaturated lipid metabolites; 5,759,765, describing epoxide hydrolases and methods to evaluate the cytotoxicity of a compound by measuring the expression of epoxide hydrolase in a ceU; and, WO 01/46476, describing use of epoxide hydrolases to provide stereospecific reaction products; WO 01/07623, WO 00/68394, WO 00/37619, describing methods for enzymatic separation of epoxide-enantiomer mixtures; WO 99/06059, describing a method for protecting a cell
  • Patent No. 6,153,397, 6,143,542, 6,037,160, and WO 99/32153 describing use of epoxide hydrolase inhibitors in pest control
  • JP 20217597 describing use of epoxide hydrolases to produce styrene glycol by reaction with styrene oxides
  • WO 00/50577 describing the use of epoxide hydrolases to hydrolyze leukotrienes and to act as anti-inflammatory reagents.
  • the hivention provides hybrid epoxide hydrolases and fusion proteins, including peptide libraries, comprising sequences ofthe mvention.
  • the peptide libraries ofthe invention can be used to isolate peptide modulators (e.g., activators or inhibitors) of targets, such as epoxide hydrolase subsfrates, receptors, enzymes.
  • the peptide libraries of the invention can be used to identify formal binding partners of targets, such as ligands, e.g., cytokines, hormones and the like.
  • the invention provides methods for biomolecule screening for biologically and therapeutically relevant compounds using enzymes ofthe invention.
  • the screening methods ofthe invention can be used to identify relevant biomolecules, e.g., from chemical libraries, nucleic acid libraries and peptide libraries, that can inhibit or augment the biological activity of a target molecule (e.g., enzymes ofthe invention).
  • the screening methods ofthe invention can be used to identify and isolate peptide inhibitors of targets and or for the identification of formal binding partners of targets.
  • the invention provides methods for screening of combinatorial libraries of potential drags using enzymes ofthe invention.
  • the invention provides methods for screening of combinatorial libraries on therapeutically relevant target cells expressing a recombinant enzyme ofthe invention.
  • the invention provides screening methods of peptide libraries using fusion proteins (e.g., the peptide moiety) with an enzyme ofthe invention.
  • the peptides can be conformationally stabilized (relative to linear peptides) to allow a higher binding affinity for targets.
  • the invention provides fusions of epoxide hydrolases of the invention and other peptides, including known and random peptides. They can be fused in such a manner that the stracture ofthe epoxide hydrolases is not significantly perturbed and the peptide is metabolically or structurally conformationally stabilized. This allows the creation of a peptide library that is easily monitored both for its presence within cells and its quantity.
  • the invention provides ammo acid sequence variants of enzymes of the invention, and methods of making them.
  • EH variants can be characterized by a predetermined nature ofthe variation, a feature that sets them apart from a naturally occurring form, e.g, an allelic or interspecies variation of an epoxide hydrolase sequence.
  • the variants ofthe invention exhibit the same qualitative biological activity as the naturally occurring analogue.
  • the variants can be selected for having modified characteristics.
  • the site or region for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined.
  • random mutagenesis may be conducted at the target codon or region and the expressed epoxide hydrolase variants screened for the optimal combination of desired activity.
  • Techniques for malting substitution mutations at predetermined sites in DNA having a known sequence are well known, as discussed herein for example, Ml 3 primer mutagenesis and PCR mutagenesis. Screening of the mutants can be done using assays of proteolytic activities.
  • amino acid substitutions can be single residues; insertions can be on the order of from about 1 to 20 amino acids, although considerably larger insertions can be done.
  • Deletions can range from about 1 to about 20, 30, 40, 50, 60, 70 residues or more.
  • substitutions, deletions, insertions or any combination thereof may be used. Generally, these changes are done on a few amino acids to minimize the alteration ofthe molecule. However, larger changes may be tolerated in certain circumstances.
  • the invention provides epoxide hydrolases where the structure ofthe polypeptide backbone, the secondary or the tertiary structure, e.g., an alpha-helical or beta-sheet stracture, has been modified.
  • the charge or hydrophobicity has been modified.
  • the bulk of a side chain has been modified.
  • Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative. For example, substitutions can be made which more significantly affect: the structure ofthe polypeptide backbone in the area ofthe alteration, for example a alpha-helical or a beta-sheet stracture; a charge or a hydrophobic site ofthe molecule, which can be at an active site; or a side chain.
  • the invention provides substitutions in polypeptide ofthe invention where (a) a hydrophilic residues, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g. lysyl, arginyl, or histidyl . is substituted for (or by) an electronegative residue, e.g.
  • variants can exhibit the same qualitative biological activity (i.e. epoxide hydrolase activity) although variants can be selected to modify the characteristics ofthe epoxide hydrolases as needed.
  • epoxide hydrolases ofthe invention comprise epitopes or purification tags, signal sequences or other fusion sequences, etc.
  • the epoxide hydrolases ofthe invention can be fused to a random peptide to form a fusion polypeptide.
  • fused or “operably linked” herein is meant that the random peptide and the epoxide hydrolase are linked together, in such a manner as to minimize the disruption to the stability ofthe epoxide hydrolase structure, e.g., it retains epoxide hydrolase activity.
  • the fusion polypeptide (or fusion polynucleotide encoding the fusion polypeptide) can comprise further components as well, including multiple peptides at multiple loops.
  • the peptides and nucleic acids encoding them are randomized, either fully randomized or they are biased in their randomization, e.g. in nucleotide/residue frequency generally or per position.
  • Randomized means that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively.
  • the nucleic acids which give rise to the peptides can be chemically synthesized, and thus may inco ⁇ orate any nucleotide at any position. Thus, when the nucleic acids are expressed to form peptides, any amino acid residue may be inco ⁇ orated at any position.
  • the synthetic process can be designed to generate randomized nucleic acids, to allow the formation of all or most of the possible combinations over the length ofthe nucleic acid, thus forming a library of randomized nucleic acids.
  • the library can provide a sufficiently structurally diverse population of randomized expression products to affect a probabilistically sufficient range of cellular responses to provide one or more cells exhibiting a deshed response.
  • the invention provides an interaction library large enough so that at least one of its members will have a stracture that gives it affinity for some molecule, protein, or other factor.
  • a peptide library ofthe invention is fully randomized, with no sequence preferences or constants at any position.
  • the library is biased, that is, some positions within the sequence are either held constant, or are selected from a limited number of possibilities.
  • the nucleotides or amino acid residues are randomized within a defined class, for example, of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • individual residues may be fixed in the random peptide sequence ofthe insert to create a structural bias.
  • the random libraries can be biased to a particular secondary stracture by including an appropriate number of residues (beyond the glycine linkers) which prefer the particular secondary stracture.
  • the bias is towards peptides that interact with known classes of molecules. For example, it is known that much of intracellular signaling is carried out via short regions of polypeptides interacting with other polypeptides through small peptide domains. For instance, a short region from the FflV-1 envelope cytoplasmic domain has been previously shown to block the action of cellular calmodulin.
  • Regions of the Fas cytoplasmic domain which shows homology to the mastoparan toxin from wasps, can be limited to a short peptide region with death-inducing apoptotic or G protein inducing functions.
  • a number of molecules or protein domains are suitable as starting points for the generation of biased randomized peptides.
  • a large number of small molecule domains are known, that confer a common function, stracture or affinity.
  • areas of weak amino acid homology may have strong structural homology.
  • Exemplary molecules, domains, and or conesponding consensus sequences used in the invention include SH-2 domains, SH-3 domains, Pleckstrin, death domains, epoxide hydrolase cleavage/recognition sites, enzyme inhibitors, enzyme subsfrates, Traf, etc.
  • there are a number of known nucleic acid binding proteins containing domains suitable for use in the invention e.g., leucine zipper consensus sequences.
  • a variety of apparatus and methodologies can be used to in conjunction with the polypeptides and nucleic acids of the invention, e.g., to screen polypeptides for epoxide hydrolase activity, to screen compounds as potential modulators, e.g., activators or inhibitors, of an epoxide hydrolase activity, for antibodies that bind to a polypeptide ofthe invention, for nucleic acids that hybridize to a nucleic acid ofthe invention, to screen for cells expressing a polypeptide of the invention and the like.
  • Capillary Arrays e.g., to screen polypeptides for epoxide hydrolase activity, to screen compounds as potential modulators, e.g., activators or inhibitors, of an epoxide hydrolase activity, for antibodies that bind to a polypeptide ofthe invention, for nucleic acids that hybridize to a nucleic acid ofthe invention, to screen for cells expressing a polypeptide of the invention and the like.
  • CapUlary anays such as the GIGAMATRIXTM, Diversa Co ⁇ oration, San Diego, CA, can be used to in the methods ofthe invention.
  • Nucleic acids or polypeptides ofthe invention can be immobilized to or applied to an an-ty, including capillary arrays.
  • Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for theh ability to bind to or modulate the activity of a nucleic acid or a polypeptide ofthe invention.
  • Capillary anays provide another system for holding and screening samples.
  • a sample screening apparatus can include a plurality of capiUaries formed into an anay of adjacent capUlaries, wherein each capUlary comprises at least one wall defining a lumen for retaining a sample.
  • the apparatus can further include interstitial material disposed between adjacent capillaries in the anay, and one or more reference indicia formed within ofthe interstitial material.
  • a capillary for screening a sample wherein the capillary is adapted for being bound in an array of capillaries, can include a first wall defining a lumen for retaining the sample, and a second wall formed of a filtering material, for filtering excitation energy provided to the lumen to excite the sample.
  • a polypeptide or nucleic acid e.g., a ligand
  • a first component into at least a portion of a capillary of a capillary array.
  • Each capillary of the capillary anay can comprise at least one wall defining a lumen for retaining the first component.
  • An ah bubble can be introduced into the capillary behind the first component.
  • a second component can be introduced into the capillary, wherein the second component is separated from the first component by the air bubble.
  • a sample of interest can be introduced as a first liquid labeled with a detectable particle into a capillary of a capillary array, wherein each capillary ofthe capillary array comprises at least one wall defining a lumen for retaining the first liquid and the detectable particle, and wherein the at least one wall is coated with a binding material for binding the detectable particle to the at least one wall.
  • the method can further include removing the first liquid from the capillary tube, wherein the bound detectable particle is maintained within the capillary, and introducing a second liquid into the capUlary tube.
  • the capillary array can include a plurality of individual capillaries comprising at least one outer wall defining a lumen.
  • the outer wall ofthe capUlary can be one or more walls fused together. Similarly, the wall can define a lumen that is cylindrical, square, hexagonal or any other geometric shape so long as the walls form a lumen for retention of a liquid or sample.
  • the capillaries ofthe capUlary array can be held together in close proximity to form a planar stracture.
  • the capillaries can be bound together, by being fused (e.g., where the capillaries are made of glass), glued, bonded, or clamped side-by- side.
  • the capillary array can be formed of any number of individual capillaries, for example, a range from 100 to 4,000,000 capillaries.
  • a capillary anay can form a micro titer plate having about 100,000 or more individual capillaries bound together.
  • Nucleic acids or polypeptides of the invention can be immobilized to or applied to an array.
  • Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for theh ability to bind to or modulate the activity of a nucleic acid or a polypeptide ofthe invention.
  • a monitored parameter is transcript expression of an epoxide hydrolase gene.
  • One or more, or, all the transcripts of a cell can be measured by hybridization of a sample comprising transcripts ofthe cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an anay, or "biochip.
  • an “anay 55 of nucleic acids on a microchip” some or all ofthe transcripts of a cell can be simultaneously quantified.
  • anays comprising genomic nucleic acid can also be used to determine the genotype of a newly engineered strain made by the methods ofthe invention.
  • Polypeptide arrays can also be used to simultaneously quantify a plurality of proteins.
  • the present invention can be practiced with any known “array,” also referred to as a "microarray” or “nucleic acid anay” or “polypeptide array” or “antibody array” or “biochip, 55 or variation thereof.
  • Arrays are genetically a plurality of "spots 5 ' or "target elements," each target element comprising a defined amount of one or more biological molecules, e.g., oligonucleotides, immobilized onto a defined area of a substrate surface for specific binding to a sample molecule, e.g., mRNA transcripts.
  • biological molecules e.g., oligonucleotides
  • any known anay and/or method of making and using anays can be inco ⁇ orated in whole or in part, or variations thereof, as described, for example, in U.S. Patent Nos. 6,277,628; 6,277,489; 6,261,776; 6,258,606; 6,054,270; 6,048,695; 6,045,996; 6,022,963; 6,013,440; 5,965,452; 5,959,098; 5,856,174; 5,830,645; 5,770,456; 5,632,957; 5,556,752; 5,143,854; 5,807,522; 5,800,992; 5,744,305; 5,700,637; 5,556,752; 5,434,049; see also, e.g., WO 99/51773; WO 99/09217; WO 97/46313; WO 96/17958; see also, e.g., Johnston (1998) Curr.
  • the invention provides isolated or recombinant antibodies that specifically bind to an epoxide hydrolase ofthe invention. These antibodies can be used to isolate, identify or quantify the epoxide hydrolases ofthe invention or related polypeptides. These antibodies can be used to isolate other polypeptides within the scope the invention or other related epoxide hydrolases. The antibodies can be designed to bind to an active site of an epoxide hydrolase. Thus, the invention provides methods of inhibiting epoxide hydrolases using the antibodies ofthe invention.
  • the invention provides fragments ofthe enzymes ofthe invention, including immunogenic fragments of a polypeptide ofthe invention, e.g., SEQ ID NO:82, SEQ ID NO:84, or SEQ ID NO:86.
  • the immunogenic peptides ofthe invention e.g., the immunogemc fragments of SEQ ID NO:82, SEQ ID NO:84, or SEQ ID NO:86
  • the antibodies can be used in immunoprecipitation, staining, hnmunoaffinity columns, and the like.
  • nucleic acid sequences encoding for specific antigens can be generated by immunization followed by isolation of polypeptide or nucleic acid, amplification or cloning and immobilization of polypeptide onto an array ofthe invention.
  • the methods ofthe invention can be used to modify the structure of an antibody produced by a cell to be modified, e.g., an antibody's affinity can be increased or decreased.
  • the ability to make or modify antibodies can be a phenotype engineered into a cell by the methods ofthe invention.
  • Antibodies also can be generated in vitro, e.g., using recombinant antibody binding site expressing phage display libraries, in addition to the traditional in vivo methods using animals. See, e.g., Hoogenboom (1997) Trends Biotechnol. 15:62-70; Katz (1997) Annu. Rev. Biophys. Biomol. Struct. 26:27-45.
  • Polypeptides or peptides can be used to generate antibodies which bind specifically to the polypeptides, e.g., the epoxide hydrolases, ofthe invention.
  • the resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample.
  • a protein preparation such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of the polypeptides ofthe invention.
  • the antibody is attached to a solid support, such as a bead or other column matrix.
  • the protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one ofthe polypeptides ofthe invention.
  • binding may be detennined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope.
  • binding ofthe antibody to the sample may be detected using a secondary antibody having such a detectable label thereon.
  • detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope.
  • binding ofthe antibody to the sample may be detected using a secondary antibody having such a detectable label thereon.
  • Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
  • Polyclonal antibodies generated against the polypeptides ofthe invention can be obtained by dhect injection ofthe polypeptides into an animal or by administering the polypeptides to a non-human animal. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique, the trioma technique, the human B-cell hybridoma technique, and the EBN-hybridoma technique (see, e.g., Cole (1985) in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques described for the production of single chain antibodies (see, e.g., U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies to the polypeptides ofthe invention. Alternatively, transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
  • Antibodies generated against the polypeptides of the invention may be used in screening for similar polypeptides (e.g., epoxide hydrolases) from other organisms and samples. In such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any ofthe procedures described above may be used to detect antibody binding.
  • similar polypeptides e.g., epoxide hydrolases
  • kits comprising the compositions, e.g., nucleic acids, expression cassettes, vectors, cells, fransgenic seeds or plants or plant parts, polypeptides (e.g., epoxide hydrolases) and/or antibodies ofthe invention.
  • the kits also can contain instructional material teaching the methodologies and industrial uses ofthe invention, as described herein.
  • the metliods ofthe invention provide whole cell evolution, or whole ceU engineering, of a cell to develop a new cell strain having a new phenotype, e.g., a new or modified epoxide hydrolase activity, by modifying the genetic composition ofthe cell.
  • the genetic composition can be modified by addition to the cell of a nucleic acid ofthe invention.
  • To detect the new phenotype at least one metabolic parameter of a modified cell is monitored in the cell in a "real time" or "on-line” time frame.
  • a plurality of cells such as a cell culture, is monitored in "real time” or “on-line.”
  • a plurality of metabolic parameters is monitored in "real time” or “on-line.” Metabolic parameters can be monitored using the epoxide hydrolases ofthe invention.
  • Metabolic flux analysis is based on a known biochemistry framework.
  • a linearly independent metabolic matrix is constructed based on the law of mass conservation and on the pseudo-steady state hypothesis (PSSH) on the intracellular metabolites.
  • PSSH pseudo-steady state hypothesis
  • Metabolic phenotype relies on the change of pathway utilization with respect to environmental conditions, genetic regulation, developmental state and the genotype, etc.
  • the dynamic behavior ofthe cells, theh phenotype and other properties are analyzed by investigating the pathway utilization. For example, if the glucose supply is increased and the oxygen decreased during the yeast fermentation, the utilization of respiratory pathways will be reduced and/or stopped, and the utilization of the fermentative pathways will dominate. Confrol of physiological state of cell cultures will become possible after the pathway analysis.
  • the methods ofthe invention can help determine how to manipulate the fermentation by determining how to change the substrate supply, temperature, use of inducers, etc. to confrol the physiological state of cells to move along deshable direction.
  • the MFA results can also be compared with franscriptome and proteome data to design experiments and protocols for metabolic engineering or gene shuffling, etc.
  • any modified or new phenotype can be conferred and detected, including new or unproved characteristics in the cell. Any aspect of metabolism or growth can be monitored. Monitoring expression of an mRNA transcript
  • the engineered phenotype comprises increasing or decreashig the expression of an mRNA transcript (e.g., an epoxide hydrolase message) or generating new (e.g., epoxide hydrolase) transcripts in a cell.
  • This increased or decreased expression can be traced by testing for the presence of an epoxide hydrolase ofthe invention or by epoxide hydrolase activity assays.
  • mRNA transcripts, or messages also can be detected and quantified by any method known in the art, including, e.g., Northern blots, quantitative amplification reactions, hybridization to anays, and the like.
  • Quantitative amplification reactions include, e.g., quantitative PCR, including, e.g., quantitative reverse franscription polymerase chain reaction, or RT-PCR; quantitative real time RT-PCR, or "real-time kinetic RT-PCR” (see, e.g., Kreuzer (2001) Br. J. Haematol. 114:313-318; Xia (2001) Transplantation 72:907-914).
  • the engineered phenotype is generated by l nocking out expression of a homologous gene.
  • the gene's coding sequence or one or . more transcriptional control elements can be knocked out, e.g., promoters or enhancers.
  • promoters or enhancers e.g., promoters or enhancers.
  • the engineered phenotype comprises increasing the expression of a homologous gene. This can be effected by knocking out of a negative control element, including a transcriptional regulatory element acting in cis- or trans- , or, mutagenizing a positive confrol element.
  • a negative control element including a transcriptional regulatory element acting in cis- or trans- , or, mutagenizing a positive confrol element.
  • One or more, or, all the transcripts of a cell can be measured by hybridization of a sample comprising transcripts of the cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an anay.
  • the engineered phenotype comprises increasing or decreasing the expression of a polypeptide (e.g., an epoxide hydrolase) or generating new polypeptides in a cell.
  • a polypeptide e.g., an epoxide hydrolase
  • This increased or decreased expression can be fraced by determining the amount of epoxide hydrolase present or by epoxide hydrolase activity assays.
  • Polypeptides, peptides and amino acids also can be detected and quantified by any method known in the art, including, e.g., nuclear magnetic resonance (NMR), specfrophotometry, radiography (protein radiolabeling), electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, various immunological methods, e.g.
  • Plates ofthe tibrary prepared as described in Example 1 are used to multiply inoculate a single plate containing 200 ⁇ l of LB Amp/Meth, glycerol in each well. This step is performed using the High Density Replicating Tool (HDRT) ofthe Beckman BIOMEK.RTM. with a 1% bleach, water, isopropanol, air-dry sterilization cycle between each inoculation.
  • HDRT High Density Replicating Tool
  • the single plate is grown for 2h at 37°C and is then used to inoculate two white 96-well Dynatech microtiter daughter plates containing 250 ⁇ l of LB Amp/Meth, glycerol in each weU.
  • the original single plate is incubated at 37°C for 18h, then stored at -80°C
  • the two condensed daughter plates are incubated at 37°C also for 18 h.
  • the condensed daughter plates are then heated at 70°C for 45 min. to kill the cells and inactivate the host E. coli enzymes.
  • a stock solution of 5 mg/mL mo ⁇ hourea phenylalanyl-7-ammo-4-trifluorome_ ⁇ yl coumarin (MuPheAFC, the "substrate”) in DMSO is diluted to 600 ⁇ M with 50 mM pH 7.5 Hepes buffer containing 0.6 mg/mL of the detergent dodecyl maltoside.
  • MuPheAFC The data will indicate whether one ofthe clones in a particular well is hydrolyzing the subsfrate.
  • the source library plates are thawed and the individual clones are used to singly inoculate a new plate containing LB Amp/Meth, glycerol. As above, the plate is incubated at 37°C to grow the cells, heated at 70°C to inactivate the host enzymes, and 50 ⁇ l of 600 ⁇ M MuPheAFC is added using the Biomek.
  • chhal high performance liquid chromatography HPLC
  • CE chhal capillary elecfrophoresis
  • the foUowhig is an exemplary assay that can be used to identify EHs or to determine if a polypeptide is an epoxide hydrolase with the scope ofthe invention.
  • SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, encoded, e.g., by SEQ ID NO:81, SEQ ID NO:83 and SEQ ID NO:85, respectively, are highly specific epoxide hydrolases i different stereo-specific epoxide-hydrolyzing reactions.
  • SEQ ID NO:81, SEQ ID NO:83 and SEQ ID NO:85 are highly specific epoxide hydrolases i different stereo-specific epoxide-hydrolyzing reactions.
  • Several epoxide hydrolases were overexpressed in heterologous hosts and stored as lyophilized cell lysates that were used to evaluate biocatalytic functions. Enzymes were screened for the desymmetrization of cyclic me_ _ -epoxides.
  • Epoxide (X ) Epoxide Hydrolase Spec. Act.” TOF c % ee"
  • enzymes were found to be capable of selectively hydrolyzing a wide range of meso-epoxides, including cyclic as well as acyclic alkyl- and aryl-substituted subsfrates.
  • the conesponding chiral lR,2R-diols were furnished with high ee's and yields.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des polypeptides présentant une activité époxyde hydrolase, des polynucléotides codant ces polypeptides ainsi que des procédés de production et d'utilisation de ces polynucléotides et polypeptides. Les polypeptides de cette invention peuvent être utilisés comme époxyde hydrolases pour catalyser l'hydrolyse d'époxydes et d'oxydes aréniques en leurs diols correspondants.
PCT/US2004/010312 2003-04-01 2004-04-01 Epoxyde hydrolases, acides nucleiques les codant et procedes de production et d'utilisation correspondants WO2004090101A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US45993203P 2003-04-01 2003-04-01
US60/459,932 2003-04-01

Publications (2)

Publication Number Publication Date
WO2004090101A2 true WO2004090101A2 (fr) 2004-10-21
WO2004090101A3 WO2004090101A3 (fr) 2008-07-24

Family

ID=33159712

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/010312 WO2004090101A2 (fr) 2003-04-01 2004-04-01 Epoxyde hydrolases, acides nucleiques les codant et procedes de production et d'utilisation correspondants

Country Status (1)

Country Link
WO (1) WO2004090101A2 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] 06 March 2001 SHEN ET AL. Database accession no. (AAB13568) *

Also Published As

Publication number Publication date
WO2004090101A3 (fr) 2008-07-24

Similar Documents

Publication Publication Date Title
EP1869174B1 (fr) Lyases, acides nucleiques codant pour celles-ci et methodes de fabrication et d'utilisation
EP2468853B1 (fr) Procédé de décoloration enzymatique de la phéophytine
US8148324B2 (en) Chemoenzymatic methods for the synthesis of statins and statin intermediates
DK2238242T3 (en) -Transferases and oxidoreductases, nucleic acids encoding FOR THEM, AND PROCESSES FOR THE STILL LING AND USE THEREOF
CA2643416A1 (fr) Aldolases, acides nucleiques les codant et procedes de fabrication et d'utilisation de celles-ci
US9017990B2 (en) Methods for enzymatic decolorization of chlorophyll
US20060281908A1 (en) Xylose isomerases, nucleic acids encoding them and methods for making and using them
US20060259993A1 (en) Amidases, nucleic acids encoding them and methods for making and using them
US20110027346A1 (en) Lyase Enzymes, Nucleic Acids Encoding Them and Methods for Making and Using Them
WO2004085624A2 (fr) Transaminases, desaminases et aminomutases, compositions et methodes de detoxification enzymatique
AU2004223394A1 (en) Glucosidases, nucleic acids encoding them and methods for making and using them
WO2004069848A2 (fr) Amidases, acides nucleiques codant pour elles et leurs procedes d'obtention et d'utilisation
WO2004007750A2 (fr) Mono-oxygenases, acides nucleiques codant pour celles-ci et procedes de fabrication et d'utilisation de celles-ci
WO2004090101A2 (fr) Epoxyde hydrolases, acides nucleiques les codant et procedes de production et d'utilisation correspondants
AU2003216125A1 (en) Amidases, nucleic acids encoding them and methods for making and using them
AU2012200864A1 (en) Compositions and method for enzymatic decolorization of chlorophyll

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase