WO2004089983A2 - Severe acute respiratory syndrome (sars) causing coronavirus - Google Patents
Severe acute respiratory syndrome (sars) causing coronavirus Download PDFInfo
- Publication number
- WO2004089983A2 WO2004089983A2 PCT/NL2004/000229 NL2004000229W WO2004089983A2 WO 2004089983 A2 WO2004089983 A2 WO 2004089983A2 NL 2004000229 W NL2004000229 W NL 2004000229W WO 2004089983 A2 WO2004089983 A2 WO 2004089983A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- sars
- interferon
- emc
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
Definitions
- the invention relates to the field of virology, more in particular to a new coronavirus.
- sequences encoding (parts of) viral proteins are provided.
- the invention relates to diagnostic means and methods, prophylactic means and methods and therapeutic means and methods to be employed in the diagnosis, prevention and/or treatment of disease, in particular of respiratory disease (atypical pneumonia), in particular of mammals, more in particular in humans.
- the invention relates to the use of interferon, preferably pegylated interferon for the prophylactic or therapeutic treatment of animals, preferably vertebrates, more preferably birds or mammals, especially human, apes or rodents, infected with a coronavirus, more specifically an animal, preferably human infected with a SAES associated coronavirus (SARS-CoV).
- animals preferably vertebrates, more preferably birds or mammals, especially human, apes or rodents, infected with a coronavirus, more specifically an animal, preferably human infected with a SAES associated coronavirus (SARS-CoV).
- SARS-CoV SAES associated coronavirus
- the virus has caused a global health risk because of its pathogenic effects in man combined with a relatively easy droplet transmission.
- the virus first was seen in the Chinese province Guangdong, was spread to Hong Kong in February 2003, and within two months it has been able to spread to several countries all over the world where it has caused 78 deaths out of 2300 people infected (New Engineer Online News 13:25 02 April 2003).
- the virus has been named SARS (Severe Acute Respiratory Syndrome) virus and causes a respiratory illness (atypical pneumonia) in man. This illness usually begins with a fever, sometimes associated with chills or other symptoms, including headache, rash, diarrhea, a general feeling of discomfort (malaise) and body aches. Some people also experience mild respiratory syndromes at the outset.
- SARS patients may develop a dry, nonproductive cough that might be accompanied or progress to the point where insuffiecient oxygen is getting to the blood, visible as shortness of breath.
- patients will require mechanical ventilation, and eventually the disease can lead to the death of the patient.
- Co-infection with other pathogens seems to occur frequently, especially with opportunistic pathogenic microorganisms such as human metapneumovirus (hMPV), Chlamydia, etcetera.
- hMPV human metapneumovirus
- the incubation time for the virus is typically 2-7 days and the disease is transmitted by people sich with SARS coughing or sneezing droplets in the air.
- the invention provides the nucleotide sequence of an isolated essentially mammalian positive-sense single stranded RNA virus belonging to the Coronaviruses, which is the causative factor for SARS. From a phylogenetic analysis of the sequences of the virus (Fig. 1) it appears that the virus is an intermediate between the group formed by TGEV (transmissable gastroenetritis virus), PEDV (porcine epidemic diarrhea virus) and 229E (human coronavirus 229E) at one side, the group formed by BoCo (bovine coronavirus) and MHN (murine hepatitis virus) at an other side, and the AIBV (avian infectious bronchitis virus) on yet another side .
- TGEV transmissable gastroenetritis virus
- PEDV porcine epidemic diarrhea virus
- 229E human coronavirus 229E
- BoCo bovine coronavirus
- MHN murine hepatitis virus
- AIBV avian infectious bronchitis virus
- bovine coronavirus seems to be the closest relative (at least for the viral replicase protein).
- phylogenetic analyses provide a convenient method of identifying a virus as a SARS virus several other possibly more straightforward albeit somewhat more coarse methods for identifying said virus or viral proteins or nucleic acids from said virus are herein also provided.
- a SARS virus can be identified by the percentages of homology of the virus, proteins or nucleic acids to be identified in comparison with viral proteins or nucleic acids identified herein by sequence. It is generally known that virus species, especially R ⁇ A virus species, often constitute a quasi species wherein a cluster of said viruses displays heterogeneity among its members.
- each isolate may have a somewhat different percentage relationship with the sequences of the isolate as provided herein.
- the invention provides an isolated essentially mammalian positive-sense single stranded RNA virus (SARS) belonging to the Coronaviruses and identifiable as phylogeneticaEy corresponding thereto by determining a nucleic acid sequence of said virus and determining that said nucleic acid sequence has a percentage nucleic acid identity to the sequences as listed higher than the percentages identified herein for the nucleic acids as identified herein below in comparison with BoCo, AIPV and PEDV.
- SARS single stranded RNA virus
- an isolated essentially mammalian positive-sense single stranded RNA virus belonging to the Coronaviruses and identifiable as phylogenetically corresponding thereto by determining an amino acid sequence of said virus and determining that said amino acid sequence has a percentage amino acid homology to the sequences as listed which is essentially higher than the percentages provided herein in comparison with BoCo, AIPV and PEDV.
- the invention provides diagnostic means and methods, prophylactic means and methods and therapeutic means and methods to be employed in the diagnosis, prevention and/or treatment of disease, in particular of respiratory disease (atypical pneumonia), in particular of mammals, more in particular in humans.
- respiratory disease typically pneumonia
- diagnosis, prophylaxis and/or treatment of a specific viral infection is performed with reagents that are most specific for said specific virus causing said infection.
- the invention for example provides a method for virologically diagnosing a SARS infection of an animal, in particular of a mammal, more in particular of a human being, comprising determining in a sample of said animal the presence of a viral isolate or component thereof by reacting said sample with a SARS specific nucleic acid or antibody according to the invention, and a method for serologically diagnosing a SARS infection of a mammal comprising determining in a sample of said mammal the presence of an antibody specifically directed against a SARS virus or component thereof by reacting said sample with a SARS virus-specific proteinaceous molecule or fragment thereof or an antigen according to the invention.
- the invention also provides a diagnostic kit for diagnosing a SARS infection comprising a SARS virus, a SARS virus-specific nucleic acid, proteinaceous molecule or fragment thereof, antigen and/or an antibody according to the invention, and preferably a means for detecting said SARS virus, SARS virus-specific nucleic acid, proteinaceous molecule or fragment thereof, antigen and/or an antibody, said means for example comprising an excitable group such as a fluorophore or enzymatic detection system used in the art (examples of suitable diagnostic kit format comprise IF, ELISA, neutralization assay, RT-PCR assay).
- an as yet unidentified virus component or synthetic analogue thereof such as nucleic acid, proteinaceous molecule or fragment thereof can be identified as SARS-virus-specific
- it suffices to analyse the nucleic acid or amino acid sequence of said component for example for a stretch of said nucleic acid or amino acid, preferably of at least 10, more preferably at least 25, more preferably at least 40 nucleotides or amino acids (respectively), by sequence homology comparison with the provided SARS viral sequences and with known non-SARS viral sequences (BoCo is preferably used) using for example phylogenetic analyses as provided herein.
- the component or synthetic analogue can be identified.
- the invention thus provides the nucleotide sequence of a novel etiological agent, an isolated essentially mammalian positive-sense single stranded RNA virus (herein also called SARS virus) belonging to the Coronaviridae family, and SARS virus-specific components or synthetic analogues thereof.
- SARS virus an isolated essentially mammalian positive-sense single stranded RNA virus
- Coronaviruses were first isolated from chickens in 1937, while the first human coronavirus was propagated in ⁇ itro by Tyrell and Bonoe in 1965. There are now about 13 species in this family, which infect cattle, pigs, rodents, cats, dogs, birds and man.
- Coronavirus particles are irregularly shaped, about 60-220 nm in diameter, with an outer envelope bearing distinctive, 'club-shaped' peplomers ( about 20 nm long and 10 nm wide at the distal end). This 'crown-like' appearance give the family its name.
- the envelope carries two glycoproteins: S, the spike glycoprotein which is involved in cell fusion and is a major antigen, and M, the membrane glycoprotein, which is involved in budding and envelope formation.
- S the spike glycoprotein which is involved in cell fusion and is a major antigen
- M the membrane glycoprotein, which is involved in budding and envelope formation.
- the genome is associated with a basic phosphoprotein, designated N.
- the genome of coronaviruses a single stranded positive-sense RNA strand, is typically 27-31 Kb long and contains a 5' methylated cap and a 3' poly-A tail, by which it can directly function as an mRNA in the infected cell.
- the 5' ORF 1 (about 20 Kb) is translated to produce a viral polymerase, which then produces a full length negative sense strand. This is used as a template to produce mRNA as a 'nested set' of transcripts, all with identical 5' non-translated leader sequence of 72 nucleotides and coincident 3' polyadenylated ends.
- Each mRNA thus produced is monocistronic, the genes at the 5' end being translated from the longest mRNA and so on. These unusual cytoplasmic structures are produced not by splicing, but by the polymerase during transcription. Between each of the genes there is a repeated intergenic sequence — AACUAAAC - which interacts with the transcriptase plus cellular factors to splice the leader sequence onto the start of each ORF. In some coronaviruses there are about 8 ORFs, coding for the proteins mentioned above, but also for a heamagglutenin esterase (HE), and several other non-structural proteins.
- HE heamagglutenin esterase
- Newly isolated viruses are phylogenetically corresponding to and thus taxonomically corresponding to SARS virus when comprising a gene order and/or amino acid sequence and/or nucleotide sequence sufficiently similar to our prototypic SARS virus.
- the highest amino acid sequence homology, between SARS virus and any of the known other viruses of the same family to date (BoCo or Mouse Hapatitis Virus) is for parts of the polymerase protein 18-61% (the % homology, and the virus to which the homology is depend on the region of the polymerase that is examined), as can be deduced when comparing the sequences given in figure 2 with sequences of other viruses, in particular of BoCo and Mouse Hapatitis Virus.
- the viral sequence of the SARS virus or an an isolated SARS virus gene as provided herein shows less than 95%, preferably less than 90%, more preferably less than 80%, more preferably less than 70% and most preferably less than 65% nucleotide sequence homology or less than 95%, preferably less than 90%, more preferably less than 80%, more preferably less than 70% and most preferably less than 65% amino acid sequence homology with the respective nucleotide or amino acid sequence of the bovine coronavirus or the murine hepatitis virus as for example can be found in Genbank (for example in accession number NC_002306 (BoCo) or NC_002645 (MHV)).
- Sequence divergence of SARS strains around the world may be somewhat higher, in analogy with other coronaviruses.
- a fair number of virus isolates have been isolated during the priority year of the present apphcation, and it has been found that these viruses share the homology indicated above.
- the sequences of these viruses can be found in GenBank accession no. AY274119 (see fig.
- nucleotide sequence homology denotes the presence of homology between two (poly)nucleotides.
- Polynucleotides have "homologous" sequences if the sequence of nucleotides in the two sequences is the same when aligned for maximum correspondence.
- Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity.
- the comparison window is generally from about 20 to 200 contiguous nucleotides.
- the "percentage of sequence homology" for polynucleotides may be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e. gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- the percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100 to yield the percentage of sequence homology.
- Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms, or by inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul, S.F. et al. 1990. J. Mol. Biol. 215:403; Altschul, S.F. et al. 1997. Nucleic Acid Res.
- BLAST Basic Local Alignment Search Tool
- substantially complementary means that two nucleic acid sequences have at least about 65%, preferably about 70%, more preferably about 80%, even more preferably 90%, and most preferably about 98%, sequence complementarity to each other. This means that the primers and probes must exhibit sufficient complementarity to their template and target nucleic acid, respectively, to hybridise under stringent conditions. Therefore, the primer sequences as disclosed in this specification need not reflect the exact sequence of the binding region on the template and degenerate primers can be used.
- a substantially complementary primer sequence is one that has sufficient sequence complementarity to the amplification template to result in primer binding and second-strand synthesis.
- hybrid refers to a double-stranded nucleic acid molecule, or duplex, formed by hydrogen bonding between complementary nucleotides.
- hybridise or “anneal” refer to the process by which single strands of nucleic acid sequences form double-helical segments through hydrogen bonding between complementary nucleotides.
- ohgonucleotide refers to a short sequence of nucleotide monomers (usually 6 to 100 nucleotides) joined by phosphorous linkages (e.g., phosphodiester, alkyl and aryl-phosphate, phosphorothioate), or non-phosphorous linkages (e.g., peptide, sulfamate and others).
- phosphorous linkages e.g., phosphodiester, alkyl and aryl-phosphate, phosphorothioate
- non-phosphorous linkages e.g., peptide, sulfamate and others.
- An ohgonucleotide may contain modified nucleotides having modified bases (e.g., 5-methyl cytosine) and modified sugar groups (e.g., 2'-0-methyl ribosyl, 2'-0-methoxyethyl ribosyl, 2'-fl.uoro ribosyl, 2'-amino ribosyl, and the like).
- Oligonucleotides may be naturally-occurring or synthetic molecules of double- and single-stranded DNA and double- and single-stranded RNA with circular, branched or linear shapes and optionally including domains capable of forming stable secondary structures (e.g., stem-and-loop and loop -stem-loop structures).
- primer refers to an ohgonucleotide which is capable of annealing to the ampHfication target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH.
- the (ampHfication) primer is preferably single stranded for maximum efficiency in amplification.
- the primer is an oligodeoxy ribonucleotide.
- primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer.
- a "pair of bi-directional primers" as used herein refers to one forward and one reverse primer as commonly used in the art of DNA ampHfication such as in PCR ampHfication.
- probe refers to a single-stranded ohgonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative.
- stringency or “stringent hybridization conditions” refer to hybridization conditions that affect the stabiHty of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence.
- the terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
- Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer.
- stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typicaUy about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g.
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary low stringent conditions or “conditions of reduced stringency” include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37°C and a wash in 2x SSC at 40°C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in O.lx SSC at 60°C. Hybridization procedures are well known in the art and are described in e.g.
- antibody includes reference to antigen binding forms of antibodies (e. g., Fab, F (ab) 2).
- antibody frequently refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobuHn genes, or fragments thereof which, specifically bind and recognize an analyte (antigen).
- analyte analyte
- antibody also includes antibody fragments such as single chain Fv, chimeric antibodies (i. e., comprising constant and variable regions from different species), humanized antibodies (i. e., comprising a complementarity determining region (CDR) from a non-human source) and heteroconjugate antibodies (e. g., bispecific antibodies).
- chimeric antibodies i. e., comprising constant and variable regions from different species
- humanized antibodies i. e., comprising a complementarity determining region (CDR) from a non-human source
- heteroconjugate antibodies e. g., bispecific antibodies.
- Interferon is a term genericaUy comprehending a group of vertebrate glycoproteins and proteins which are known to have various biological activities, such as antiviral, antiproliferative, and immunomodulatory activity at least in the species of animal from which such substances are derived. Interferon refers to a class of smaU protein and glycoprotein cytokines (15-28 kD) produced by T cells, fibroblasts, and other ceHs in response to viral infection and other biological and synthetic stimuH.
- Interferons bind to specific receptors on cell membranes; their effects include inducing enzymes, suppressing cell proliferation, inhibiting viral proHferation, enhancing the phagocytic activity of macrophages, and augmenting the cytotoxic activity of T lymphocytes.
- Interferons are divided into five major classes (alpha, beta, gamma, tau, and omega) and several subclasses (indicated by Arabic numerals and letters) on the basis of physicochemical properties, ceHs of origin, mode of induction, and antibody reactions.
- the invention provides an isolated essentiaUy mammaHan positive- sense single stranded RNA virus (SARS) belonging to the Coronaviruses and identifiable as phylogenetically corresponding thereto by determining a nucleic acid sequence of a suitable fragment of the genome of said virus and testing it in phylogenetic tree analyses wherein maximum HkeHhood trees are generated using 100 bootstraps and 3 jumbles and finding it to be more closely phylogeneticaUy corresponding to a virus isolate having the sequences as depicted in figure 2 than it is corresponding to a virus isolate of BoCo (bovine coronavirus, e.g. ace. no.
- BoCo bovine coronavirus
- NC_002306 in Genbank MHN (murine hepatitis virus, e.g. ace. no. ⁇ C_002645), AIBV (avian infectious bronchitis virus, e.g. ace. no. NC_001451), PEDV (porcine epidemic diarrhea virus), TGEN (transmissible gastroenteritis virus, e.g. ace. no. ⁇ C_003436) or 229E (human coronavirus 229E, e.g. ace. no. NC_003045).
- the viral sequences with the GenBank accession numbers mentioned above are beHeved to be phylogentically cooresponding viruses to the virus of which the sequences are depicted in fig. 2.
- Suitable nucleic acid genome fragments each useful for such phylogenetic tree analyses are for example any of the RAP-PCR fragments EMC-1 to -14 and RDG-1 as disclosed in figure 2, leading to the phylogenetic tree analysis as disclosed in figure 1.
- a suitable open reading frame (ORF) comprises the ORF encoding the viral polymerase (ORF la).
- the analysed virus isolate comprises a SARS virus isolate according to the invention.
- ORF open reading frame
- Another suitable open reading frame (ORF) useful in phylogenetic analyses comprises the ORF encoding the N protein.
- the analysed virus isolate comprises a SARS isolate according to the invention.
- ORF open reading frame
- Another suitable open reading frame (ORF) useful in phylogenetic analyses comprises the ORF encoding the spike protein S.
- ORF open reading frame
- an overaH amino acid identity of at least 60%, more preferably of at least 70%, more preferably of at least 80%, more preferably of at least 90%, most preferably of at least 95%of the analysed S-protein encoded by a sequence comprising the sequence of translation 2 of EMC7 and translation 1 of the RDG 1 sequence of the S-protein as depicted in figure 2 is found, the analysed virus isolate comprises a SARS virus isolate according to the invention.
- the S ORF of the SARS virus seems to be located adjacent to the ORF lab (coding for the viral polymerase), which would discriminate SARS viruses from the bovine coronavirus and the murine hepatitis virus, which have a so-caUed 2a gene and an HE-gene between the S protein and the viral polymerase.
- the invention provides among others an isolated or recombinant nucleic acid or virus-specific functional fragment thereof obtainable from a virus according to the invention.
- the isolated or recombinant nucleic acids comprises the sequences as given in figure 2 or sequences of homologues which are able to hybridise with those under stringent conditions.
- the invention provides primers and or probes suitable for identifying a SARS virus nucleic acid.
- the invention provides a vector comprising a nucleic acid according to the invention.
- vectors such as plasmid vectors containing (parts of) the genome of SARS virus, virus vectors containing (parts of) the genome of SARS (for example, but not limited thereto, vaccinia virus, retroviruses, baculovirus), or SARS virus containing (parts of) the genome of other viruse or other pathogens are provided.
- the invention provides a host cell comprising a nucleic acid or a vector according to the invention.
- Plasmid or viral vectors containing the polymerase components of SARS virus are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic ceUs). Plasmid or viral vectors containing full-length or partial copies of the SARS virus genome will be generated in prokaryotic cells for the expression of viral nucleic acids in- ⁇ itro or in- ⁇ i ⁇ o.
- the latter vectors may contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, may lack parts of the viral genome for the generation of repHcation defective virus, and may contain mutations, deletions or insertions for the generation of attenuated viruses.
- Infectious copies of SARS virus (being wild type, attenuated, repHcation-defective or chimeric) can be produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.
- ceHs transiently or stably expressing one or more fuH-length or partial SARS virus proteins
- Such ceHs can be made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and may be useful for complementation of mentioned wild type, attenuated, repHcation-defective or chimeric viruses.
- a chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more viruses.
- a SARS virus vector expressing one or more proteins of a human metapneumovirus or a human metapneumovirus vector expressing one or more proteins of SARS virus will protect individuals vaccinated with such vector against both virus infections.
- Such a specific chimeric virus is particularly useful in the invention because it is suspected that co-infection of, for instance, human metapneumovirus frequently occurs in SARS virus infected patients.
- Attenuated and replication-defective viruses may be of use for vaccination purposes with Hve vaccines as has been suggested for other viruses. Recently, Subbarao, K. et al., J. Virol.
- the invention provides a proteinaceous molecule or coronavirus-specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention.
- useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from a virus according to the invention.
- Such molecules, or antigenic fragments thereof, as provided herein, are for example useful in diagnostic methods or kits and in pharmaceutical compositions such as sub-unit vaccines and inhibitory peptides.
- Particularly useful are the viral polymerase protein, the spike protein, the nucleocapsid or antigenic fragments thereof for inclusion as antigen or subunit immunogen, but inactivated whole virus can also be used.
- Particulary useful are also those proteinaceous substances that are encoded by recombinant nucleic acid fragments that are identified for phylogenetic analyses, of course preferred are those that are within the preferred bounds and metes of ORFs useful in phylogenetic analyses, in particular for eHciting SARS virus specific antibodies, whether in vivo (e.g. for protective puposes or for providing diagnostic antibodies) or in vitro (e.g. by phage display technology or another technique useful for generating synthetic antibodies).
- antibodies be it natural polyclonal or monoclonal, or synthetic (e.g. (phage) Hbrary-derived binding molecules) antibodies that specifically react with an antigen comprising a proteinaceous molecule or SARS virus-specific functional fragment thereof according to the invention.
- phage e.g. (phage) Hbrary-derived binding molecules
- a person skuled in the art will be able to develop (monoclonal) antibodies using isolated virus material and/or recombinantly expressed viral proteins.
- Sui et al. Proc. Natl. Acad. Sci. 101(8), 2536- 2541, 2004
- Such antibodies are also useful in a method for identifying a viral isolate as a SARS virus comprising reacting said viral isolate or a component thereof with an antibody as provided herein. This can for example be achieved by using purified or non-purified SARS virus or parts thereof (proteins, peptides) using ELISA, RIA,
- infected cells or cell cultures may be used to identify viral antigens using classical immunofluorescence or immunohistochemical techniques.
- SpecificaUy useful in this respect are antibodies raised against SARS virus proteins which are encoded by a nucleotide sequence comprising one or more of the fragments disclosed in figure 2.
- Other methods for identifying a viral isolate as a SARS virus comprise reacting said viral isolate or a component thereof with a virus specific nucleic acid according to the invention.
- the invention provides a viral isolate identifiable with a method according to the invention as a mammalian virus taxonomicaUy corresponding to a positive- sense single stranded RNA virus identifiable as likely belonging to the SARS virus genus within the family of Coronaviruses.
- the method is useful in a method for virologically diagnosing a SARS virus infection of a mammal, said method for example comprising determining in a sample of said mammal the presence of a viral isolate or component thereof by reacting said sample with a nucleic acid or an antibody according to the invention.
- Methods of the invention can in principle be performed by using any nucleic acid ampHfication method, such as the . Polymerase Chain Reaction (PCR; MulHs 1987, U.S. Pat. No. 4,683,195, 4,683,202, en 4,800,159) or by using ampHfication reactions such as Ligase Chain Reaction (LCR; Barany 1991, Proc. Natl. Acad. Sci. USA 88:189-193; EP Appl.
- PCR Polymerase Chain Reaction
- LCR Ligase Chain Reaction
- an amplification reaction may be performed under conditions of reduced stringency (e.g. a PCR amplification using an anneaHng temperature of 38°C, or the presence of 3.5 mM MgCl2).
- reduced stringency e.g. a PCR amplification using an anneaHng temperature of 38°C, or the presence of 3.5 mM MgCl2.
- the person skilled in the art will be able to select conditions of suitable stringency.
- primers herein are selected to be “substantially” complementary (i.e. at least 65%, more preferably at least 80% perfectly complementary) to their target regions present on the different strands of each specific sequence to be ampHfied. It is possible to use primer sequences containing e.g. inositol residues or ambiguous bases or even primers that contain one or more mismatches when compared to the target sequence. In general, sequences that exhibit at least 65%, more preferably at least 80% homology with the target DNA or RNA ohgonucleotide sequences, are considered suitable for use in a method of the present invention. Sequence mismatches are also not critical when using low stringency hybridization conditions.
- the detection of the ampHfication products can in principle be accompHshed by any suitable method known in the art.
- the detection fragments may be directly stained or labelled with radioactive labels, antibodies, luminescent dyes, fluorescent dyes, or enzyme reagents.
- Direct DNA stains include for example intercalating dyes such as acridine orange, ethidium bromide, ethidium monoazide or Hoechst dyes.
- the DNA or RNA fragments may be detected by incorporation of labeUed dNTP bases into the synthesized fragments.
- Detection labels which may be associated with nucleotide bases include e.g. fluorescein, cyanine dye or BrdUrd.
- a suitable detection procedure for use in the present invention may for example comprise an enzyme immunoassay (EIA) format (Jacobs et al., 1997, J. Clin. Microbiol. 35, 791-795).
- either the forward or the reverse primer used in the ampHfication reaction may comprise a capturing group, such as a biotin group for immobiHzation of target DNA PCR ampHcons on e.g. a streptavidin coated microtiter plate weUs for subsequent EIA detection of target DNA -ampHcons (see below).
- a capturing group such as a biotin group for immobiHzation of target DNA PCR ampHcons on e.g. a streptavidin coated microtiter plate weUs for subsequent EIA detection of target DNA -ampHcons (see below).
- a capturing group such as a biotin group for immobiHzation of target DNA PCR ampHcons on e.g. a streptavidin coated microtiter plate weUs for subsequent EIA detection of target DNA -ampHcons (see below).
- Probes useful for the detection of the target DNA as disclosed herein preferably bind only to at least a part of the DNA sequence region as amp
- Suitable probes for detection based on the nucleotide sequence of the target DNA without undue experimentation as set out herein.
- the complementary nucleotide sequences, whether DNA or RNA or chemicaHy synthesized analogs, of the target DNA may suitably be used as type-specific detection probes in a method of the invention, provided that such a complementary strand is ampHfied in the ampHfication reaction employed.
- Suitable detection procedures for use herein may for example comprise immobilization of the ampHcons and probing the DNA sequences thereof by e.g. southern blotting.
- Other formats may comprise an EIA format as described above.
- the specific ampHcon detection probes may comprise a label moiety such as a fluorophore, a chromophore, an enzyme or a radio- label, so as to facifitate monitoring of binding of the probes to the reaction product of the amplification reaction.
- Such labels are well-known to those skilled in the art and include, for example, fluorescein isothiocyanate (FITC), ⁇ -galactosidase, horseradish peroxidase, streptavidin, biotin, digoxigenin, 35S or 1251. Other examples will be apparent to those skilled in the art.
- Detection may also be performed by a so called reverse Hne blot (RLB) assay, such as for instance described by Van den Brule et al. (2002, J. CHn. Microbiol. 40, 779-787).
- RLB probes are preferably synthesized with a 5' amino group for subsequent immobiHzation on e.g. carboxyl-coated nylon membranes.
- the advantage of an RLB format is the ease of the system and its speed, thus aUowing for high throughput sample processing.
- the use of nucleic acid probes for the detection of RNA or DNA fragments is weU known in the art.
- Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1 °C for each 1 % of mismatching; thus, the hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with > 90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5 °C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH.
- the invention provides ohgonucleotide probes for the generic detection of target RNA or DNA.
- the detection probes herein are selected to be "substantially" complementary to one of the strands of the double stranded nucleic acids generated by an amplification reaction of the invention.
- the probes are substantiaHy complementary to the immobilizable, e.g. biotin labeUed, antisense strands of the ampHcons generated from the target RNA or DNA.
- detection probes of the present invention it is aUowable for detection probes of the present invention to contain one or more mismatches to their target sequence.
- sequences that exhibit at least 65%, more preferably at least 80% homology with the target ohgonucleotide sequences are considered suitable for use in a method of the present invention.
- Antibodies, both monoclonal and polyclonal, can also be used for detection purpose in the present invention, for example, in immunoassays in which they can be utilized in liquid phase or bound to a sohd phase carrier.
- the monoclonal antibodies in these immunoassays can be detectably labeled in various ways.
- immunoassay formats may be used to select antibodies specificaUy reactive with a particular protein (or other analyte).
- soHd-phase ELISA immunoassays are routinely used to select monoclonal antibodies specificaUy immunoreactive with a protein. See Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor
- immunoassay formats and conditions that can be used to determine selective binding.
- types of immunoassays that can utilize antibodies of the invention are competitive and non- competitive immunoassays in either a direct or indirect format.
- examples of such immunoassays are the radioim unoassay (RIA) and the sandwich (immunometric) assay.
- RIA radioim unoassay
- sandwich immunometric assay.
- Detection of the antigens using the antibodies of the invention can be done utilizing immunoassays that are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples.
- Those of skill in the art wiU know, or can readily discern, other immunoassay formats without undue experimentation.
- Antibodies can be bound to many different carriers and used to detect the presence of the target molecules.
- Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified ceUuloses, polyacrylamides, agaroses and magnetite.
- the nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or wiH be able to ascertain such using routine experimentation.
- the invention also provides a method for serologicaHy diagnosing a SARS virus infection of a mammal comprising determining in a sample of said mammal the presence of an antibody specificaUy directed against a SARS virus or component thereof by reacting said sample with a proteinaceous molecule or fragment thereof or an antigen according to the invention
- Methods and means provided herein are particularly useful in a diagnostic kit for diagnosing a SARS virus infection, be it by virological or serological diagnosis.
- kits or assays may for example comprise a virus, a nucleic acid, a proteinaceous molecule or fragment thereof, an antigen and/or an antibody according to the invention.
- a virus, a nucleic acid, a proteinaceous molecule or fragment thereof, an antigen and/or an antibody according to the invention is also provided for the production of a pharmaceutical composition, for example for the treatment or prevention of SARS virus infections and/or for the treatment or prevention of atypical pneumonia, in particular in humans.
- a peptide comprising part of the amino acid sequence of the spike protein as depicted in translation 2 with the sequence EMC7 and translation 1 of the RDG seq of figure 2, is used for the preparation of a therapeutic or prophylactic peptide.
- a protein comprising the amino acid sequence of the spike protein as depicted in translation 2 with the sequence EMC7 translation 1 of the RDG seqof figure 2, is used for the preparation of a sub-unit vaccine.
- the nucleocapsid of Cornoviruses as depicted in the translation of EMC8, in figure 2, is known to be particularly useful for eHciting ceU-mediated immunity against Coronaviruses and can be used for the preparation of a sub-unit vaccine.
- Attenuation of the virus can be achieved by estabHshed methods developed for this purpose, including but not Hmited to the use of related viruses of other species, serial passages through laboratory animals or/and tissue/ceU cultures, serial passages through ceU cultures at temparutes below 37C (cold-adaption), site directed mutagenesis of molecular clones and exchange of genes or gene fragments between related viruses.
- estabHshed methods developed for this purpose, including but not Hmited to the use of related viruses of other species, serial passages through laboratory animals or/and tissue/ceU cultures, serial passages through ceU cultures at temparutes below 37C (cold-adaption), site directed mutagenesis of molecular clones and exchange of genes or gene fragments between related viruses.
- Sui et al. seepra
- humanised neutrahsing antibodies have been prepared which have shown to be reactive with the N-terminal 261-672 amino acids of the spike protein of the SARS virus.
- a pharmaceutical composition comprising a virus, a nucleic acid, a proteinaceous molecule or fragment thereof, an antigen and/or an antibody according to the invention can for example be used in a method for the treatment or prevention of a SARS virus infection and/or a respiratory illness comprising providing an individual with a pharmaceutical composition according to the invention. This is most useful when said individual comprises a human.
- Antibodies against SARS virus proteins, especiaUy against the spike protein of SARS virus, preferably against the amino acid sequence as depicted in translation 2 of EMC7 and translation 1 of the RDG seq in figure 2 are also useful for prophylactic or therapeutic purposes, as passive vaccines.
- the spike protein is a very strong antigen and that antibodies against spike protein can be used in prophylactic and therapeutic vaccination.
- the invention also provides method to obtain an antiviral agent useful in the treatment of atypical pneumonia comprising estabHshing a ceU culture or experimental animal comprising a virus according to the invention, treating said culture or animal with an candidate antiviral agent, and determining the effect of said agent on said virus or its infection of said culture or animal.
- An example of such an antiviral agent comprises a SARS virus-neutralising antibody, or functional component thereof, as provided herein, but antiviral agents of other nature are obtained as well.
- the invention also provides use of an antiviral agent according to the invention for the preparation of a pharmaceutical composition, in particular for the preparation of a pharmaceutical composition for the treatment of atypical pneumonia, especificaUy when caused by a SARS virus infection, and provides a pharmaceutical composition comprising an antiviral agent according to the invention, useful in a method for the treatment or prevention of a SARS virus infection or atypical pneumonia, said method comprising providing an individual with such a pharmaceutical composition.
- the invention provides a pharmaceutical composition comprising interferon, especially pegylated interferon.
- aU interferon forms would be useful in the present invention, since it is known that aU the interferon forms have at least some activity in aUeviating (symptoms of) viral infection.
- preferentiaUy the interferon is used which is derived from the host which is infected with, or which runs the risk of being infected with the virus.
- interferon- alpha, and especiaUy for coronavirus infections that affect humans, like SARS — human interferon-alpha.
- Alpha interferon is a natural protein produced by the human body in response to infection. It is also known as interferon alpha-2b.
- alpha interferon alpha family consists of small proteins that have cHnicaUy important anti-infective and anti-tumor activity. It is understood that alpha interferon may be administered alone or in combination with beta interferon or gamma interferon. Genetic engineering techniques have allowed several companies to mass- produce alpha interferon, which is known as recombinant human alpha interferon, or by abbreviations such as rhIFN or rIFN-alpha. This is marketed under tradenames such as Viraferon (made by Schering-Plough), Roferon-A (by Roche) and Wellferon (by Glaxo SmithKHne). Interferon-alpha N3, or Alferon N, is another form of interferon alpha, derived from human leukocytes and containing multiple species of interferon- alpha.
- Pegylated IFN alfa-2b has a prolonged serum half-Hfe (40 hours) relative to standard IFN alfa-2b (7-9 hours).
- the greater size of pegylated IFN alfa-2a acts to reduce glomerular filtration, markedly prolonging its serum half- Hfe (72-96 hours) compared with standard IFN alfa-2a (6-9 hours) (Bruce A. Luxon MD Clinical Therapeutics, Volume 24, Issue 9, September 2002, Pages 1363-1383).
- Pegylation of proteins is a standard technique avaUable to a person skUled in the art, and standard pegylated iiiterferons are avaUable commerciaUy from Roche (PEGASYS® (interferon alfa 2a) and Schering-Plough ( PEG-Intron A) or in development Hke PEG-Alfacon, the PEGylated version of Infergen(R) (Interferon alfacon-1) a bio-engineered type I interferon alpha.
- Schering-Plough has developed a semi-synthetic form of Intron® A by attaching a 12- kDa mono-methoxy polyethylene glycol to the protein (PEG Intron) which fulfils the requirements of a long-acting interferon alpha protein whUe providing significant cHnical benefits.
- Pegylation decreases the specific activity of the interferon alpha-2b protein, whilst the potency of PEG Intron, independent of protein concentration, is comparable to the Intron® A standard at both the molecular and ceUular level.
- PEG Intron has enhanced pharmacokinetic profile in both animal and human studies [see Yu-Sen Wang et al., 2002: Advanced Drug Delivery Reviews, Volume 54, Issue 4 , 17, Pages 547-570].
- a 40 ltilodalton branched, mobUe PEG is covalently bound to the interferon alfa-2a molecule and provides a selectively protective barrier without significantly reducing binding site receptivity.
- the present invention encompasses all types of pegylated interferons or future interferons with yet undisclosed molecule attachments which provide a selectively protective barrier, to shield the interferon from being degraded, without significantly reducing binding site receptivity.
- interferon as a prophylactic treatment for the prevention of coronavirus infection.
- Subjecting apes to a prophylactic or therapeutic treatment either before or during infection with the cornoavirus has a good and useful predictionary value for apphcation of such a prophylaxis or therapy in human subjects.
- a prophylactic treatment would be especially welcome for people who run a risk of being infected, such as, in the case of SARS virus, hospital personnel, children, elderly and people having an underlying condition such as diabetes or heart disease, or a weakened immune system.
- SARS-CoV infection might be asymptomatic in some people, or cause nonrespiratory symptoms in others.
- a prophylactic treatment for the prevention of coronavirus infection like SARS-CoV is indeed essential.
- interferon is also apphcable for therapy of coronaviruses, i.e. at the time when virus infection is already estabHshed.
- Our in vivo data show that pathologic effects are at least delayed upon administration of interferon. Interferon of human and murine origins has been quantified in the art in terms of International Units ("IU").
- a "unit” of interferon shall mean the reciprocal of a dilution of interferon- containing material that, as determined by assay, inhibits one-half the number of plaques of a chaUenge virus, the chaUenge virus being the vesicular stomatitis virus ("VSV"). So quantified a "unit” of interferon is routinely found to be about one-tenth the quantity of interferon represented by one "IU. " Alternatively, interferon can be quamtitated in ⁇ g/kgof body weight.
- Interferon is given in doses ranging from l ⁇ g/kg to 3 ⁇ g/kg. When the interferon is pegylated doses can be delivered less frequently.
- Treatment of a coronavirus disease in accordance with the present invention comprises administering pegylated interferon at a dosage of 0.01-6 ⁇ g/kg per day in a dosage form adapted to promote contact of said dosage of interferon with the oral and pharyngeal mucosa of said animal.
- the dosage of interferon is from 0.1- 4 ⁇ g/kg per day, more preferably 0.3-3 ⁇ g/kg per day.
- Interferon may be administered by any available means, including but not limited to, oral, intravenous, intramuscular, pulmonary and nasal routes, and wherein said composition is present as a solution, a suspension or an aerosol spray, especiaUy of fine particles.
- the pegylated interferon be administered in a dosage form adapted to assure maximum contact of the interferon in said dosage form with the oral and pharyngeal mucosa of the human or animal, undergoing treatment.
- Contact of interferon with the mucosa can be enhanced by maximizing residence time of the treatment solution in the oral or pharyngeal cavity.
- best results seem to be achieved in human patients when the patient is requested to hold said solution of interferon in the mouth for a period of time.
- Contact of interferon with the oral and pharyngeal mucosa and thereafter with the lymphatic system of the treated human or animal avian, rodent is unquestionably the most efficient method administering immunotherapeutic amounts of pegylated interferon.
- interferon can be administered in either a Hquid (solution) or solid dosage form.
- interferon can be administered dissolved in a buffered aqueous solution typicaUy containing a stabiHzing amount (1-5% by weight) of blood serums.
- a buffered solution suitable as a carrier of interferon administered in accordance with this invention is phosphate buffered saHne prepared by standard techniques.
- interferon in a sohd dosage form such as a lozenge adapted to be dissolved upon contact with saHva in the mouth with or without the assistance of chewing.
- a unitary dosage form is formulated to release about 1 to about 1500 IU of interferon upon dissolution in the mouth for contact with the oral and pharyngeal mucosa.
- a unitary dosage form of interferon in accordance with this invention can be prepared by art-recognized techniques for forming compressed tablets such as chewable vitamins. SimUarly, interferon can be incorporated into starch-based gel formulations to form a lozenge which will dissolve and release interferon for contact with the oral mucosa when held in the mouth.
- SoHd unitary dosage forms of interferon for use in accordance with the present invention can be prepared utUizing art recognized dosage formulation techniques.
- the pH of such formulations can range from about 4 to about 8.5.
- a pre- dosage form formulation after addition of interferon, above about 50°C.
- a solid dosage form for animal use is a molasses block containing effective amounts of interferon.
- interferon can be formulated into flavoured or unflavoured solutions or syrups using a buffered aqueous solution of interferon as a base with added caloric or non-caloric sweeteners, flavour oils and pharmaceuticaUy acceptable surfactant/dispersants.
- Another preferred embodiment is administration of interferon together with another treatment which is directed to prevent or treat infection with coronaviruses.
- Such other treatment can for instance be a vaccine, antibody and/or anti-viral agent selected from the group consisting of whole inactivated virus vaccines, attenuated vaccines, sub-unit vaccines, recombinant vaccines, antibody for passive immunization, nucleoside analogs such as ribavirin, RNA-dependent RNA polymerase inhibitors and protease inhibitors.
- Treatment to prevent and/or treat infection with coronaviruses can also comprise combination treatments with other antiviral compounds, such as, for instance, nucleoside-based compounds such as ribavirin (e.g. Rebetol® (ribavirin, USP). These compounds act through interfering with the viral repHcation by presenting nucleosides which are built in during viral repHcation, but which either prevent formation of viral proteins or which do not yield functional proteins. Co- administration of interferon wiU even more slow down viral repHcation. Combinations of ribavirin and forms of interferon can help to reduce viral load.
- Another disease condition responding to treatment in accordance with the present invention is neoplastic disease.
- interferon in accordance with the above description can, alone or in combination with other drugs or therapy, help effect remission of cancers such as maHgnant lymphoma, melanoma, mesothelioma, Burkitt lymphoma and nasopharyngeal carcinoma and other neoplastic diseases, especially those of known or suspected viral etiology and diseases such as Hodgkin's Disease and leukemia.
- cancers such as maHgnant lymphoma, melanoma, mesothelioma, Burkitt lymphoma and nasopharyngeal carcinoma and other neoplastic diseases, especially those of known or suspected viral etiology and diseases such as Hodgkin's Disease and leukemia.
- Other disease conditions responding to treatment in accordance with the present invention are infectious diseases of coronaviral origin in human, avian, porcine, canine and fehne species.
- Human coronavirises are coronivirus 229E and the newly discovered coronavirus HcoV-NL (see European patent apphcation 03078772.5.
- coronaviruses can cause fatal systemic diseases in animals, including fehne infectious peritonitis virus (FIPV), hemagglutinating encephalomyeHtis virus (HEV) of swine, and some strains of avian infectious bronchitis virus (IBV) and mouse hepatitis virus (MHV).
- FIPV fehne infectious peritonitis virus
- HEV hemagglutinating encephalomyeHtis virus
- IBV avian infectious bronchitis virus
- MHV mouse hepatitis virus
- coronaviruses can repHcate in Hver, lung, kidney, gut, spleen, brain, spinal cord, retina, and other tissues.
- Immunopathology plays a role in tissue damage in MHV and FIPV, and cytokines are responsible for some signs of disease.
- cytokines are responsible for some signs of disease.
- virulent virus mutants can arise and cause fatal infectious peritonitis, a systemic disease.
- the invention also comprises an animal model usable for testing of prophylactic and/or therapeutic methods and/or preparations. It has appeared that apes can be infected with the SARS virus, thereby showing chnical symptoms, and more importantly, simUar tissue morphology as found in humans suffering from atypical pneumonia caused by the SARS virus. Subjecting apes to a prophylactic or therapeutic treatment either before or during infection with the virus will have a good and useful predictionary value for application of such a prophylaxis or therapy in human subjects.
- Fig. 1 Phylogenetic relationship for the nucleotide sequences of isolate HK39849 with its closest relatives geneticaUy. Phylogenetic trees were generated by maximum HkeHhood analyses using 100 bootstraps and 3 jumbles. The scale representing the number of nucleotide changes is shown for each tree.
- Fig. 2 Nucleotide sequences from 13 clones of parts of the SARS virus. Also included are the putative polypeptide sequences of polypeptides and ahgnments of the putative polypeptides with that of another member of the Coronoviridae family, where possible.
- Fig. 3 Schematic map of the SARS virus genome, indicating the position of the nucleotide sequences of figure 2 relative to the genome and a putative indication of the open reading frames of the genome based on analogy with other coronaviruses.
- the gene structure for the region between the SpUce and Nucleocapsid is uncertain.
- EMC1-EMC14 and RDG 1 sequences as provided in figure 2.
- CDC and BINl-2 sequences were provided through personal communication from the CDC (Dr. W.
- Fig. 4 Amino acid comparison of the N-terminus of the S-protein of the SARS virus and closely related coronaviruses.
- HCV OC43 human coronavirus isolate OC43;
- Fig. 5 Negative contrast EM photograph of SARS virus obtained from concentrated supernatant of infected ceU cultures.
- Fig. 6 Infection with SARS -coronavirus causes pulmonary and renal lesions in cynomolgus macaques.
- FormaHn-fixed, paraffin-embedded tissues were stained with haematoxyhn and eosin and examined by light microscopy.
- There is diffuse alveolar damage of the lung (a) and the alveolar lumina (b) are flooded with highly proteinaceous exudate admixed with inflammatory ceUs and ceUular debris.
- a bronchiole c
- in the surrounding lung parenchyma are several multinucleated syncytial ceUs (arrowheads).
- the renal coUecting tubules (d) contain simUar multinucleated syncytial ceUs.
- Original magnifications a x 12.5; b x 50; c x 100; d x 250.
- Fig 7 Infection of domestic cats and ferrets with SCV.
- Four animals per group were euthanised at day 4 whUe the other two were analysed tUl day 28.
- Real time PCR results are shown relative to a titrated SCV standard and shown as TCID ⁇ o/ml (N.D. not done).
- Fig. 8 Detection of SCV in postmortem tissues of experimentaUy SCV infected cats and ferrets
- Fig. 9 Effect of pegylated IFN- ⁇ on SARS Coronavirus (SCV) replication in macaques.
- Virus isolation (VI) results are indicated in the lower part of the panel whereas real time PCR results are shown in the upper part of the panels (n.a., not available).
- Fig. 12 Effect of pegylated IFN- ⁇ on SCV excretion in cynomolgus macaques.
- Data are expressed as mean ⁇ s.d.; *, P ⁇ 0.05 versus control group at 2 d.p.i., **, P. ⁇ 0.01 versus control group at 2 d.p.i..
- Isolation Isolate HK39849 was isolated from a hospitahsed SARS patient by throat swab and inoculated into a culture of Vero-E6 ceUs. A sample of the supernatant from these infected ceUs provided by Dr. M. Peiris (Queeen Mary Hospital Faculty of
- RNA arbitrarUy primed PCR RAP-PCR
- RNA arbitrarUy primed PCR essentiaUy as described by Welsh & McClelland (NAR 18:7213; PNAS USA 90:10710, 1993).
- Virus in the culture supernatants was purified on continuous 20-60% sucrose gradients. The gradient fractions were inspected for virus-Hke particles by EM, and RNA was isolated from the fraction containing , in which the most nucleocapsids were observed. Equivalent amounts of RNA isolated from virus fractions were used for RAP-PCR, after which samples were run side by side on a 3% NuSieve agarose gel.
- Differentially displayed bands ranging in size from 200-1500 base pairs specific for the unidentified virus were subsequently purified from the gel, cloned in plasmid pCR2.1 (Invitrogen) and sequenced with vector-specific primers. When we used these sequences to search for homologies against sequences in the Genbank database using the BLAST software (www.ncbi.nlm.nih.gov/BLAST/) which yielded resemblance to virus sequences of the coronaviruses displayed in the phylogenetic tree of figure 1.
- EMC 1-6, 13 and 14 Eight of these fragments (EMC 1-6, 13 and 14) were located in the ORF coding for the viral polymerase (ORF lab), one (EMC-7) spanned the 3' end of ORFlab and reached into the 5' end of spike protein region; EMC- 10 overlapped the 3' end of EMC-7 and therefore also codes part of the S protein region and EMC 9 encodes a region downstream of EMC- 10; by use of primers to sequences within EMC10 and EMC9 (see below), the region between these two sequences was amplified by PCR and sequenced. The fuU contiguous region has been incoporated into EMC7 in firgure 2;a further sequence (RDG1 in figure 2) encodes the 3' end of the Spike protein.
- EMC8 A further sequence (EMC8) spanned part of the Nucleocapsid coding sequence.
- the remaining three sequences (EMC9, 11 and 12) have in the meantime been found to be regions of the orf lab/replicase, where emc 9 is incorporated in emc 11. This has not yet been reflected in figure 3.
- Virus was coUected from SARS patients using throat swabs and from experimentally infected monkeys (throat and nasal swabs, serum, plasma and faeces)
- Throat swabs were dipped into a culture of Vero-E6 ceUs and incubated for 1-4 days. CeU culture supernatant was clarified by centrifugation and filtered through a 0.45 micrometre filter, before beings stored frozen. The virus was subsequently propagated in Vero-118 ceUs.
- Tissue culture supernatant from infected Vero cells were pelleted through 20% sucrose onto a 60% sucrose cushion. The virus was then peUeted through 20% sucrose and resuspended in PBS/1% NP40.
- the virus was The conjugated to horseradish peroxidase by standard techniques was tested in 3 concentrations (diluted in dilution buffer 9000- 03, 1:100, 1:400 and 1:1600), both on polyvalent anti-IgM code MCB0201 (cross- reactive with monkey) and monoclonal anti-IgM, code 9000-62 (non-crossreactive with monkey).
- Sera were diluted 1:200 in serum diluent (code 9000-03), monkey 775 was dUuted 1: 100, 1:200 and 1:400.
- virus was concentrated from infected ceU culture supernatants in a micro-centrifuge at 4 °C at 17000 x g, after which the peUet was resuspended in PBS and inspected by negative contrast EM
- a one-step RT-PCR was performed in 50 ⁇ l reactions containing 50 mM Tris.HCl pH 8.5, 50 mM NaCl, 4 mM MgC12, 2 mM dithiotreitol, 200 ⁇ M each dNTP, 10 units recombinant RNAsin (Promega, Leiden, the Netherlands), 10 units AMV RT (Promega, Leiden, The Netherlands), 5 units Amplitaq Gold DNA polymerase (PE Biosystems, Nieuwerkerk aan de Ijssel, The Netherlands) and 5 ⁇ l RNA. Cycling conditions were 45 min. at 42 °C and 7 min. at 95 °C once, 1 min at 95 °C, 2 min. at 42 °C and 3 min. at 72 °C repeated 40 times and 10 min. at 72 °C once.
- AAGCTCGTCACCTAAGTCATAAGAC from EMC11 sequence
- RAP-PCR was performed essentiaUy as described by Welsh & McCleUand (Nuc. Acid Res. 18:7213, 1990; Proc. Natl. Acad. Sci. USA 90:10710 1993) .
- the ohgonucleotide sequences are described in addenda 2.
- 2 ⁇ l RNA was used in a 10 ⁇ l reaction containing 10 ng/ ⁇ l ohgonucleotide, 10 mM dithiotreitol, 500 ⁇ m each dNTP, 25 mM Tris-HCl pH 8.3, 75 mM KC1 and 3 mM MgC12. The reaction mixture was incubated for 5 min. at 70 °C and 5 min.
- RAP-PCR products cloned in vector pCR2.1 were sequenced with M13- specific ohgonucleotides.
- DNA fragments obtained by RT-PCR were purified from agarose gels using Qiaquick Gel Extraction kit (Qiagen, Leusden, The Netherlands), and sequenced directly with the same oligonucleotides used for PCR. Sequence analyses were performed using a Dyenamic ET terminator sequencing kit (Amersham Pharmacia Biotech, Roosendaal, The Netherlands) and an ABI 373 automatic DNA sequencer (PE Biosystem). All techniques were performed according to the instructions of the manufacturer.
- SARS rev2 agcctgtgttgtagattgcgg
- primers ampHfy a 149bp fragment of the polymerase gene (orf lab)
- primers ampHfy a 149bp fragment of the polymerase gene (orf lab) RT-PCR, gel purification and direct sequencing were performed as described above.
- Example 2 Methods to identify SARS virus Specimen collection
- nasopharyngeal aspirates, throat and nasal swabs, broncheo alveolar lavages, serum and plasma samples, and stools preferably from mammals such as humans, carnivores (dogs, cats, musteUits, seals etc.), horses, ruminants (cattle, sheep, goats etc.), pigs, rabbits, birds (poultry, ostriches, etc) should be examined. From birds cloaca swabs and droppings can be examined as weU. Sera should be coUected for immunological assays, such as ELISA, molecular-based assays, such as RT-PCR and virus neutralisation assays.
- immunological assays such as ELISA, molecular-based assays, such as RT-PCR and virus neutralisation assays.
- Virus isolation Collected virus specimens were diluted with 5 ml Dulbecco MEM medium (BioWhittaker, WalkersvUle, MD) and thoroughly mixed on a vortex mixer for one minute. The suspension was thus centrifuged for ten minutes at 840 x g. The sediment was spread on a multispot slide ( ⁇ utacon, Leimuiden, The Netherlands) for immunofluorescence techniques, and the supernatant was used for virus isolation.
- Dulbecco MEM medium BioWhittaker, WalkersvUle, MD
- Vero-118 ceUs or tMK ceUs were cultured in 24 weU plates containing glass sHdes (Costar, Cambridge, UK), with the medium described below supplemented with 10% fetal bovine serum
- the plates were inoculated with supernatant of the patient samples, 0,2 ml per well in triphcate, followed by centrifuging at 840x g for one hour. After inoculation the plates were incubated at 37 °C for a maximum of 1-3 days and cultures were checked daUy for CPE. Extensive CPE was generaUy observed within 24hours. and included detachment of cells from the monolayer..
- virus characterisation For EM analyses, virus was concentrated from infected ceU culture supernatants in a micro-centrifuge at 4 °C at 17000 x g, after which the peUet was resuspended in PBS and inspected by negative contrast EM. Antigen detection by indirect IFA
- Virus was cultured on Vero-118 cells in 24 well slides containing glass sHdes. These glass slides were washed with PBS and fixed in aceton for 1 minute at room temperature.
- the sHdes were incubated for 30 minutes at 37 °C with SARS patient serum.
- SARS patient serum We used patient serum, but antibodies can be raised in various animals, such as ferrets, goats and rabbits (for polyclonal antibodies) and mice and hamsters (for monoclonal antibodies), and the working dilution of the antibody can vary for each immunisation.
- the sHdes were incubated at 37°C for 30 minutes with FITC labeled goat-anti- human antibodies.
- the sHdes were included in a glycerol/PBS solution (Citifluor, UKC, Canterbury, UK) and covered. The sHdes were analysed using an Axioscop fluorescence microscope (Carl Zeiss B.V., Weesp, the Netherlands).
- SARS virus-infected Vero ceUs were fixed with acetone on covershps (as described above), washed with PBS and incubated 30 minutes at 37°C with serum samples at a 1 to 16 dUution. After two washes with PBS and one with tap water, the slides were incubated 30 minutes at 37°C with FITC-labeUed secondary antibodies to human antibodies (Dako). SHdes were processed as described above.
- Antibodies can be labeUed directly with a fluorescent dye, which wiU result in a direct immuno fluorescence assay.
- FITC can be replaced with any fluorescent dye. This technique can be apphed to antibodies in other animals such as mammals, ruminants, birds or other species, assuming the secondary antibody to the appropriate species is used.
- the Conjugate The conjugate was tested at a number of concentrations, both on polyvalent anti-IgM (cross-reactive with monkey) and monoclonal anti-IgM, (non-crossreactive with monkey). Sera were diluted 1:200 in serum chluent and the monkey serum was diluted 1: 100, 1:200 and 1:400.
- the reaction was stopped with sulphuric acid (0.5M).
- Results were interpreted by eye. Three of the four SARS-IgM positive sera (as detected by IF on infected ceUs) had a higher score than negative control sera. One serum had a score which was also reached by some of the negative controls. The 9 day old monkey sera did not react, but the 12 day old did. Thus, this study shows that with direct conjugation of nucleocapsids the developemnt of an IgM capture method is fe as able.
- this type of assay can be performed in a number of formats by those trained in the art.
- the assay can be extended to the detection of IgA and IgG antibodies from humans and animals and can make use of different capture antigens, such as, but not limited to, purified recombinant N protein.
- Cynomologous macaque specific antisera for the newly discovered virus were generated by experimental intratrachael installation of cultured virus of
- Cynomologous macaques One to two weeks later the animals were bled. The sera were tested for reactivity to SARS virus by indirect IFA as described above; uninfected control cells were used to ensure the specificity of the serum. Other animal species are also suitable for the generation of specific antibody preparations and other antigen preparations may be used.
- a one-step RT-PCR was performed in 50 ⁇ l reactions containing 50 mM Tris.HCl pH 8.5, 50 mM NaCl, 4 mM MgCl 2 , 2 mM dithiotreitol, 200 ⁇ M each dNTP, 10 units recombinant RNAsin (Promega, Leiden, the Netherlands), 10 units AMV RT (Promega, Leiden, The Netherlands), 5 unit ' s AmpHtaq Gold DNA polymerase (PE Biosystems, Nieuwerkerk aan de Ijssel, The Netherlands) and 5 ⁇ l RNA. CycHng conditions were 45 min. at 42 °C and 7 min. at 95 °C once, 1 min at 95 °C, 2 min. at 42 °C and 3 min. at 72 °C repeated 40 times and 10 min. at 72 °C once. Primers used for diagnostic PCR:
- SARS fwd2 ggtggaacatcatccggtgat
- SARS rev2 agcctgtgttgtagattgcgg
- primers amplify a 149bp fragment of the polymerase gene (orf lab) RT-PCR, gel purification and direct sequencing were performed as described above.
- PCR fragments were sequenced directly with the same oligonucleotides used for PCR, or the fragments were purified from the gel with Qiaquick Gel Extraction kit (Qiagen, Leusden, The Netherlands) and cloned in pCR2.1 vector (Invitrogen, Groningen, The Netherlands) according to instructions from the manufacturer and subsequently sequenced with M13-specific oligonucleotides.
- a recombinant protein derived from the SARS virus is preferred as the antigen.
- purified nucleocapsids may also be used.
- Antigens suitable for antibody detection include any SARS protein that combines with any SARS-specific antibody of a patient exposed to or infected with SARS virus.
- Preferred antigens of the invention include those that predominantly engender the immune response in patients exposed to SARS, which therefore, typicaUy are recognised most readily by antibodies of a patient.
- Particularly preferred antigens include the N, and S proteins of SARS.
- Antigens used for immunological techniques can be native antigens or can be modified versions thereof. WeU known techniques of molecular biology can be used to alter the amino acid sequence of a SARS antigen to produce modified versions of the antigen that may be used in immunologic techniques.
- Methods for cloning genes, for manipulating the genes to and from expression vectors, and for expressing the protein encoded by the gene in a heterologous host are well-known, and these techniques can be used to provide the expression vectors, host cells, and the for expressing cloned genes encoding antigens in a host to produce recombinant antigens for use in diagnostic assays. See for instance: Molecular cloning, A laboratory manual and Current Protocols in Molecular Biology.
- a variety of expression systems may be used to produce SARS antigens.
- a variety of expression vectors suitable to produce proteins in E.Coli may be used to produce proteins in E.Coli.
- B.subtilis, yeast, insect cells and mammalian cells have been described, any of which might be used to produce a SARS antigen suitable to detect anti- SARS antibodies in exposed patients.
- the baculovirus expression system has the advantage of providing necessary processing of proteins, and is therefor preferred.
- the system utiHzes the polyhedrin promoter to direct expression of SARS antigens. (Matsuura et al. 1987, J. Gen. Virol. 68: 1233-1250).
- Antigens produced by recombinant baculo-viruses can be used in a variety of immunological assays to detect anti- SARS antibodies in a patient. It is weU established, that recombinant antigens can be used in place of natural virus in practically any immunological assay for detection of virus specific antibodies.
- the assays include direct and indirect assays, sandwich assays, soHd phase assays such as those using plates or beads among others, and liquid phase assays. Assays suitable include those that use primary and secondary antibodies, and those that use antibody binding reagents such as protein A.
- detection methods can be used in the invention, including colorimetric, fluorescent, phosphorescent, chemUuminescent, luminescent and radioactive methods.
- Example 3 Animal models
- the monkeys had the foUowing chnical symptoms o Lethargy o
- One of four monkeys had severe pneumonia o ' MUd to severe rash in the inguinal region and the axUar region • Watery stools
- Virus was detected using RT-PCR on tissue samples and by culturing samples foUowed by electron microscopy from
- Cynomologous Macaques may be used as animal models to tests the efficacy of pharmaceutical preparations for therapeutic or prophylactic purposes Cats and ferrets
- Table 1 SARS -associated coronavirus excretion by cynomolgus macaques treated with pegylated interferon.
- Control animals (M001, 002) Pharyngeal swabs on days 2 and 4 were aU positive
- Necropsies were done according to a standard protocol; one lung of each monkey was inflated with 10% neutral-buffered formahn by intrabronchial intubation and suspended in 10% neutral-buffered formahn overnight. Samples were collected in a standard manner (one from the cranial part of the lung, one from the medial and two from the caudal part), embedded in paraffin, cut at 5 ⁇ m and used for immunohistochemistry (see below) or stained with haematoxyhn and eosin (HE). For semiquantitative assessment of SCV-infection-associated inflammation in the lung, each HE-stained section was examined for inflammatory foci by Hght microscopy using a 10x objective.
- Each focus was scored for size (1: smaller than or equal to area of 10x objective, 2: larger than area of 10x objective and smaUer than or equal to area of 2.5x objective, 3: larger than area of 2.5x objective) and severity of inflammation (1: mUd, 2: moderate, 3: marked).
- the cumulative scores for the inflammatory foci provided the total score per animal. Sections were examined without knowledge of the identity of the macaques. The lung sections of one monkey in the post exposure group were not assessed because of the presence of inflammation from pre-mortem aspiration of food remains. Lung samples from a control group macaque were used for transmission electron microscopy as described by Kuiken, T. et al. (Lancet 362. 263- 270, 2003).
- SCV RT-PCR An RT-PCR with primers and probe specific for the nucleoprotein (NP) gene of SCV was used to quantificate SCV in swabs as described by Kuiken et al. (supra). Serial dUutions of the SCV stock were used as a standard and the results were expressed as SCV eq/ml swab medium.
- the control macaques showed multifocal acute DAD (diffuse alveolar damage), characterized by flooding of alveoH with protein-rich oedema fluid mixed with neutrophils and rare syncytia, extensive loss of alveolar and bronchiolar epithehum and occasional type 2 pneumocyte ' hyperplasia.
- DAD diffuse alveolar damage
- squamous ceUs fining the alveolar walls. They were indicated as type 1 pneumocytes by their location, morphology, and expression of keratin in serial sections.
- coronavirus-like particles measuring about 70 nm in diameter with typical internal nucleocapsid-like structure were found in alveolar ceUs.
- type 1 pneumocytes were identified as type 1 pneumocytes because they lined the alveolar lumen, were closely apposed to the basement membrane, were squamous, contained abundant pinocytotic vesicles, and — in contrast to type 2 pneumocytes — had neither lamellar bodies nor microvUH. As found previously in experimentaUy infected macaques at 6 d.p.i., less extensive SCV antigen expression also was detected in hyperplastic type 2 pneumocytes within inflammatory foci. The combination of these histopathologic and immunohistochemical findings show that type 1 pneumocytes are the main target of SCV in early infection, and are associated with DAD.
- pegylated IFN- ⁇ As an antiviral agent post-exposure, we injected pegylated IFN- ⁇ intramuscularly into a post-exposure group of four macaques 1 and 3 days after experimental SCV infection, and evaluated them in the same way as the prophylactic group. Excretion of SCV from the pharynx was found only on 2 d.p.i. at a significantly reduced level compared to the control group (Fig. 12). Moreover, the virus titre in the lungs at 4 d.p.i. was significantly decreased, whereas the remaining parameters were less reduced (Fig. 13a-c). These results show that use of pegylated IFN- ⁇ one day post-exposure protects type 1 pneumocytes of experimentaUy infected macaques from SCV infection but is less effective than prophylactic use.
- type 1 pneumocytes are the main target ceU for SCV infection of cynomolgus macaques early in the disease, and that pegylated IFN- ⁇ protects type 1 pneumocytes from SCV infection.
- the temporal sequence of lung lesions that emerges when the pathological studies in humans and macaques are viewed together is: viral infection and subsequent loss of type 1 pneumocytes; acute DAD, characterized by flooding of alveolar lumina with highly proteinaceous oedema fluid; chronic DAD, characterized by type 2 pneumocyte hyperplasia; and, in severe cases, extensive pulmonary fibrosis.
- This sequence of events corresponds to the stereotypic alveolar reaction to acute lung injury from a variety of causes (Ware, L.B. and Matthay, M.A., N. Eng. J. Med. 342, 1334-1349, 2000).
- pegylated IFN- ⁇ therapy In addition to potential disease mitigation, reduced viral excretion through pegylated IFN- ⁇ therapy also has an epidemiological effect by reducing the spread of SCV in the human population. Whether the mechanism of pegylated IFN- ⁇ protection is by direct antiviral activity or immunostimulatory effects remains to be determined.
- the time interval during which effective post-exposure treatment with pegylated IFN- ⁇ can be initiated may be longer in humans than in the experimentaUy infected macaques. This is because the peak of SCV infection in the lungs is at about 16 d.p.i. in humans — based on an average incubation period of 6 days (Booth, CM. et al, JAMA 289, 2801-2809, 2003) and a peak in viral excretion at 10 days after onset of symptoms (peiris, J.S.M. et al, Lancet 361, 1767-1772, 2003) — compared to 2 d.p.i. in these macaques (Fig. 12).
- type 1 pneumocytes are the main target cell for SCV infection of macaques early in the disease, and that pegylated IFN- ⁇ , a commercially available antiviral drug, protects these ceUs from SCV infection.
- Prophylactic or early post-exposure treatment with pegylated IFN- ⁇ will help to reduce the impact of SCV infection on healthcare workers and others possibly exposed to SCV and to Hmit the spread of the virus in the human population.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Biotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2006507863A JP2007528700A (en) | 2003-04-08 | 2004-04-08 | SARS |
| CA002521856A CA2521856A1 (en) | 2003-04-08 | 2004-04-08 | Severe acute respiratory syndrome (sars) causing coronavirus |
| US10/552,755 US20070053878A1 (en) | 2003-04-08 | 2004-04-08 | Sars |
| EP04726682A EP1613650A2 (en) | 2003-04-08 | 2004-04-08 | Severe acute respiratory syndrome (sars) causing coronavirus |
| AU2004228584A AU2004228584A1 (en) | 2003-04-08 | 2004-04-08 | Severe acute respiratory syndrome (SARS) causing coronavirus |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03076037 | 2003-04-08 | ||
| EP03076037.5 | 2003-04-08 | ||
| EP03076110.0 | 2003-04-14 | ||
| EP03076110 | 2003-04-14 | ||
| EP03077307 | 2003-07-18 | ||
| EP03077307.1 | 2003-07-18 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004089983A2 true WO2004089983A2 (en) | 2004-10-21 |
| WO2004089983A3 WO2004089983A3 (en) | 2005-01-20 |
Family
ID=33162638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/NL2004/000229 Ceased WO2004089983A2 (en) | 2003-04-08 | 2004-04-08 | Severe acute respiratory syndrome (sars) causing coronavirus |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20070053878A1 (en) |
| EP (1) | EP1613650A2 (en) |
| JP (1) | JP2007528700A (en) |
| KR (1) | KR20060020610A (en) |
| AU (1) | AU2004228584A1 (en) |
| CA (1) | CA2521856A1 (en) |
| TW (1) | TW200508247A (en) |
| WO (1) | WO2004089983A2 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004092360A2 (en) | 2003-04-10 | 2004-10-28 | Chiron Corporation | The severe acute respiratory syndrome coronavirus |
| WO2006008654A3 (en) * | 2004-07-23 | 2006-05-04 | Univ Aix Marseille Ii | Rna dependent rna polymerases/primases from coronavirus and their use in molecular biology and drug screening |
| EP1651271A4 (en) * | 2003-04-01 | 2006-11-08 | Intermune Inc | COMPOSITIONS AND METHODS FOR TREATING CORONAVIRUS INFECTION AND SARS |
| WO2006076007A3 (en) * | 2004-04-22 | 2007-04-05 | Univ Vanderbilt | Methods of detecting coronavirus infections |
| EP1620061A4 (en) * | 2003-04-28 | 2007-09-12 | Sequoia Pharmaceuticals | Antiviral agents for the treatment, control and prevention of infections by coronaviruses |
| EP1706506A4 (en) * | 2003-12-17 | 2007-10-31 | Agency Science Tech & Res | SPECIFIC AND SENSITIVE TEST FOR DETECTION OF SARS CORONAVIRUS |
| CN103394097A (en) * | 2013-06-09 | 2013-11-20 | 东北农业大学 | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method |
| US11168128B2 (en) | 2020-02-26 | 2021-11-09 | Vir Biotechnology, Inc. | Antibodies against SARS-CoV-2 and methods of using the same |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG149684A1 (en) | 2001-01-19 | 2009-02-27 | Vironovative Bv | A virus causing respiratory tract illness in susceptible animals |
| KR101076102B1 (en) | 2002-02-21 | 2011-10-21 | 비로노바티브 비.브이. | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| US9044486B2 (en) * | 2008-04-02 | 2015-06-02 | Cornell University | Method for prophylaxis or treatment of feline infectious peritonitis |
| CN107033250B (en) * | 2017-05-23 | 2020-01-21 | 山东省农业科学院奶牛研究中心 | Bovine coronavirus recombinant multi-epitope antigen and application thereof |
| KR102646366B1 (en) * | 2020-02-27 | 2024-03-12 | 충남대학교산학협력단 | Porcine epidemic diarrhea virus vaccine using virus-like particles and the method for producing the same |
| WO2022025029A1 (en) * | 2020-07-27 | 2022-02-03 | 国立大学法人滋賀医科大学 | Method for in vitro proliferating virus belonging to family coronaviridae, method for producing neutralizing antibody to virus belonging to family coronaviridae, and method for producing infection model of severe acute respiratory syndrome coronavirus 2 |
| US12274700B1 (en) * | 2020-10-30 | 2025-04-15 | Accencio LLC | Methods of treating symptoms of coronavirus infection with RNA polymerase inhibitors |
| US11175293B1 (en) | 2021-01-04 | 2021-11-16 | University Of Utah Research Foundation | Rapid assay for detection of SARS-CoV-2 antibodies |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| HUT45559A (en) * | 1987-01-16 | 1988-07-28 | Duphar Int Res | Process for producing new proteines and peptides of antigene activity and vaccines against virus of infective gastritis-enteritis |
| FR2828405B1 (en) * | 2001-08-09 | 2005-06-24 | Virbac Sa | ANTI-CORONAVIRUS VACCINE |
| NZ543467A (en) * | 2003-04-10 | 2008-07-31 | Novartis Vaccines & Diagnostic | The severe acute respiratory syndrome coronavirus |
-
2004
- 2004-04-08 TW TW093109694A patent/TW200508247A/en unknown
- 2004-04-08 WO PCT/NL2004/000229 patent/WO2004089983A2/en not_active Ceased
- 2004-04-08 KR KR1020057019199A patent/KR20060020610A/en not_active Withdrawn
- 2004-04-08 US US10/552,755 patent/US20070053878A1/en not_active Abandoned
- 2004-04-08 CA CA002521856A patent/CA2521856A1/en not_active Abandoned
- 2004-04-08 JP JP2006507863A patent/JP2007528700A/en active Pending
- 2004-04-08 EP EP04726682A patent/EP1613650A2/en not_active Withdrawn
- 2004-04-08 AU AU2004228584A patent/AU2004228584A1/en not_active Abandoned
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1651271A4 (en) * | 2003-04-01 | 2006-11-08 | Intermune Inc | COMPOSITIONS AND METHODS FOR TREATING CORONAVIRUS INFECTION AND SARS |
| WO2004092360A2 (en) | 2003-04-10 | 2004-10-28 | Chiron Corporation | The severe acute respiratory syndrome coronavirus |
| EP1618127B1 (en) * | 2003-04-10 | 2014-12-10 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic composition comprising a spike protein of the SARS coronavirus |
| EP1620061A4 (en) * | 2003-04-28 | 2007-09-12 | Sequoia Pharmaceuticals | Antiviral agents for the treatment, control and prevention of infections by coronaviruses |
| EP1706506A4 (en) * | 2003-12-17 | 2007-10-31 | Agency Science Tech & Res | SPECIFIC AND SENSITIVE TEST FOR DETECTION OF SARS CORONAVIRUS |
| WO2006076007A3 (en) * | 2004-04-22 | 2007-04-05 | Univ Vanderbilt | Methods of detecting coronavirus infections |
| WO2006008654A3 (en) * | 2004-07-23 | 2006-05-04 | Univ Aix Marseille Ii | Rna dependent rna polymerases/primases from coronavirus and their use in molecular biology and drug screening |
| CN103394097A (en) * | 2013-06-09 | 2013-11-20 | 东北农业大学 | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method |
| US11168128B2 (en) | 2020-02-26 | 2021-11-09 | Vir Biotechnology, Inc. | Antibodies against SARS-CoV-2 and methods of using the same |
| US11479599B2 (en) | 2020-02-26 | 2022-10-25 | Vir Biotechnology, Inc. | Antibodies against SARS-CoV-2 and methods of using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| US20070053878A1 (en) | 2007-03-08 |
| JP2007528700A (en) | 2007-10-18 |
| AU2004228584A1 (en) | 2004-10-21 |
| WO2004089983A3 (en) | 2005-01-20 |
| EP1613650A2 (en) | 2006-01-11 |
| CA2521856A1 (en) | 2004-10-21 |
| TW200508247A (en) | 2005-03-01 |
| KR20060020610A (en) | 2006-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8092994B2 (en) | Human virus causing respiratory tract infection and uses thereof | |
| EP1613650A2 (en) | Severe acute respiratory syndrome (sars) causing coronavirus | |
| AU2003244822B2 (en) | Canine respiratory coronavirus (CRCV) spike protein, polymerase and hemagglutinin/esterase | |
| US20080286756A1 (en) | Compositions and methods for diagnosing and treating severe acute respiratory syndrome (sars) | |
| WO2015143335A1 (en) | Methods and compositions for chimeric coronavirus spike proteins | |
| IL226253A (en) | Canine / Miami / 05/05 influenza virus capable of infecting canine animals and methods used | |
| US7129223B2 (en) | Inhibition of SARS-associated coronavirus (SCoV) infection and replication by RNA interference | |
| US9878030B2 (en) | BVDV vaccine | |
| SK18232000A3 (en) | Attenuated pestiviruses | |
| US7371837B2 (en) | Human virus causing respiratory tract infection and uses thereof | |
| Lee et al. | Nephropathogenesis of chickens experimentally infected with various strains of infectious bronchitis virus | |
| WO2005049814A2 (en) | Novel atypical pneumonia-causing virus | |
| EP1508615A1 (en) | Coronavirus, nucleic acid, protein, and methods for the generation of vaccine, medicaments and diagnostics | |
| Kwon et al. | Construction of an infectious cDNA clone of avian hepatitis E virus (avian HEV) recovered from a clinically healthy chicken in the United States and characterization of its pathogenicity in specific-pathogen-free chickens | |
| AU2013205112B2 (en) | Influenza viruses able to infect canids, uses thereof | |
| Sasseville et al. | Biological and molecular characteristics of an HEV isolate associated with recent acute outbreaks of encephalomyelitis in Quebec pig farms | |
| WO2001068819A1 (en) | Improved methods to isolate, identify, quantify, and propagate chicken infectious anemia virus and high titer vaccine | |
| Cusi et al. | Evaluation of rubella virus E2 and C proteins in protection against rubella virus in a mouse model | |
| US11865172B2 (en) | Materials and methods for respiratory disease control in canines | |
| EP2818182B1 (en) | Novel pneumovirus compositions and methods for using the same | |
| CN115992099A (en) | A strain of porcine parvovirus and its application | |
| EP1505153A1 (en) | Nucleic acid sequence comprising the rna packaging signal of a group 1 coronavirus and the applications thereof | |
| Leroith et al. | Construction of an infectious cDNA clone of avian hepatitis E virus (avian HEV) recovered from a clinically healthy... |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2521856 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020057019199 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006507863 Country of ref document: JP Ref document number: 2004228584 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2004228584 Country of ref document: AU Date of ref document: 20040408 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004228584 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004726682 Country of ref document: EP Ref document number: 20048124691 Country of ref document: CN Ref document number: 2913/CHENP/2005 Country of ref document: IN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004726682 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020057019199 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007053878 Country of ref document: US Ref document number: 10552755 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10552755 Country of ref document: US |