WO2004087964A1

WO2004087964A1 - Method of detecting detecting mutations

Info

Publication number: WO2004087964A1
Application number: PCT/SE2004/000521
Authority: WO
Inventors: Anne Kihlgren; Catrin Molander; Björn ROSEN
Original assignee: Dynamic Code Ab
Priority date: 2003-04-02
Filing date: 2004-04-02
Publication date: 2004-10-14
Also published as: SE0300965D0

Abstract

Method of detecting mutations in a nucleic acid sequence which consists in determining at least part of that nucleic acid sequence, and in using LA-PCR to amplify at least one nucleic acid fragment from an isolated nucleic acid specimen in order to obtain a target DNA, forming oligonucleotide primers which are at least partially complementary to the target DNA, those with largely different sequences having different numbers of nucleotides, the oligonucleotide primers being hybridised with the target DNA and the oligonucleotide primers being extended with detectably labelled, terminating nucleotides and the extended oligonucleotide primers thereafter being separated according to size and the extended nucleotides being identified by means of the labelling of the terminating nucleotides. The invention further relates to a kit for performing the method comprising primer and nucleotide arrays according to the method.

Description

Method of detecting mutations

The present invention relates to a method of detecting mutations in a nucleic acid sequence according to the pre-characterising part of claim 1. The invention furthermore relates to a kit for performing the method.

The ability to detect mutations in a nucleic acid sequence is of great importance in many contexts. For example, some nucleic acid changes in human beings affect the breakdown of exogenous substances, such as pharmaceutical preparations and drugs. An example of such nucleic acid sequences are genes, so-called pharmaco-genes. These genes usually produce enzymes, the primary function of which is to handle toxic and harmful substances in food, but which also break down the exogenous substances. An example of such enzymes are Cytochrome P450 enzymes (CYP), which play a significant role in the metabolism of the exogenous substances. Great variations exist between different individuals with regard to the efficacious or toxic effect of a dose of exogenous substance. For example, with many CYPs there is a wide genetic variation that results in different individuals having different quantities of active enzyme. The different alleles have come about due to mutations during the individual's development. More than seventy different variants of the CYP2D6 gene are described, for example. There are individuals with the capacity to metabolise substances normally, slowly or rapidly.

US 6 448 010, for example, discloses a method of the aforementioned type. According to this method oligonucleotide primers are attached to a substrate, such as glass, following which a nucleic acid sequence is hybridised with the primers and the primers are extended by a labelled terminating base, such as a dideoxynucleotide labelled with a fluorescent dye, which can thereafter be detected. The method is expensive and to some extent difficult to perform, especially when analysing a large number of mutations, and in particular where the nucleic acid sequence derives from several genes. There is a desire to achieve a method which is inexpensive, easy to perform and is suitable for analysing a large number of mutations in a nucleic acid sequence.

An object of the present invention is to provide a method of analysing mutations that represents an improvement in the aforementioned respect. The object of the present invention is achieved by means of the features specified in the characterising part of claim 1.

A further object of the present invention is to provide a kit for performing the method, according to the features specified in the characterising part of claim 17.

According to the method it is possible in a reaction mix to analyse multiple mutations in the nucleic acid sequence, which makes the method easier to perform. In one embodiment at least three oligonucleotide primers are designed according to step b above and are then used to perform steps c-f above with the same reaction mix. A further special characteristic is the formation and use of at least five oligonucleotide primers as described above.

In one embodiment the method comprises a further step in which the number of gene copies in the DNA of cells is determined.

In the present invention the term gene comprises a region of a nucleic acid sequence in a DNA which is transcribed and the nucleic acid regions which affect the transcription.

The term terminating nucleotide comprises nucleotides which it is possible to attach to an oligonucleotide having a complementary bond to a nucleic acid sequence and one of which is attached to the 3 '-end of said oligonucleotide, the nucleotide in the extended position also being complementary to the nucleic acid sequence and it being impossible to attach any further nucleotide to the oligonucleotide extended by the terminating nucleotide.

The term detectably labelled nucleotide comprises nucleotides which incorporate any suitable group capable of detection, such as a fluorescent dye, chemiluminescent reagent or a radioactive group.

LA-PCR here relates to long and accurate PCR (polymerase chain reaction) amplification. Using LA-PCR it is possible to obtain a DNA product which is up to 100 kb.

The term mutation relates to changes in a nucleic acid sequence in which 1-6 bases have been substituted, added or deleted. The term oligonucleotide primers relates to polynucleotides comprising 1-150 nucleotides.

The invention will be described in more detail below.

A nucleic acid specimen is isolated from cells by methods that will be familiar to the person skilled in the art, as described in a handbook from Qiagen (Qiagen, 2001, Qiagen genomic DNA handbook, http://www.qiagen.com). Cells derived from blood, buccal specimens (oral cavity scraping) or hair roots are preferably used. The person skilled in the art will appreciate that it is possible to use cells from other biological tissue, such as cells from secretions. The isolated nucleic acid specimen comprises DNA or mRNA, but DNA is preferred, since it means that it is possible to analyse multiple mutations, even those in untranscribed DNA sequences.

Amplification of the nucleic acid sequence in one or more parts is performed with LA-PCR according to known methods, as are described, for example, in Cheng S, et al (Proceedings of the National Academy of Sciences, USA, 1994, 91 : 5695-5699). In order to perform the LA- PCR step, a pair of primers is first designed. Their sequence is determined by a known algorithm, such as one based on the nearest base neighbour (Nearest-neighbour algorithm, see, for example, Rozen S and Skaletsky HJ, Primer3 on the WWW for general users and for biologist programmers, In: Krawetz S, Misener S (eds), Bioinformatics Methods and Protocols: Methods in Molecular Biology, Humana Press, Totowa, NJ, 2000, p. 365-386). Primers used for hybridisation with the nucleic acid sequence will ideally have identical Tm values, but a difference of up to 20°C is tolerated. In the invention at least one pair of primers is designed in order to amplify at least one nucleic acid fragment in order obtain a target DNA. If more fragments are amplified it is possible to do this in the same reaction mix. It is often desirable to amplify long fragments, since this makes the method easier to perform. With LA-PCR it is possible to amplify fragments of a size in the order of 0.5 to 100 kb. The size is preferably 5- 100 kb and a size of 10-100 kb is especially preferred.

In one embodiment the target DNA derives from at least one gene, such as a pharmaco, onco or allergy-related gene. The target DNA is, with particular preference, derived from a pharmaco- gene. An example of one method of obtaining such target DNA is to first design two primers which are complementary to either side of a pharmaco-gene and which during the LA-PCR step amplify this pharmaco-gene, with the result that the target DNA is obtained. The amplified target DNA is then used in order to determine which mutations are present in the part of the nucleic acid that is to be amplified. As a first step, oligonucleotide primers are designed, which are at least partially complementary to the target DNA, so that it is possible for them to hybridise specifically with the target DNA at those points where the sequence is to be determined. The oligonucleotide primer is localised for each such point, so that in an extension it is extended by a detectably labelled terminating nucleotide that complements the target DNA. The design of the oligonucleotide primers is furthermore determined according to the aforementioned algorithm, for example. Oligonucleotide primers having largely different sequences are designed with different number of nucleotides. The term oligonucleotide primers having largely different sequences relates to oligonucleotides which do not hybridise at the same point on the target DNA. In order to adjust the number of constituent nucleotides in the oligonucleotide primers, it is also possible to extend the 5' ends with randomly constructed polynucleotides, which in the main does not affect the Tm values for hybridisation.

When analysing multiple mutations in one and the same step, it is advantageous if multiple different oligonucleotide primers are used and it is possible for the same reaction mix to contain all oligonucleotides for performing the hybridisation for the target DNA and the subsequent steps, which makes the method easier to perform. In one embodiment at least three oligonucleotide primers are used for analysing mutations in the nucleic acid sequence and in a further embodiment at least five oligonucleotide primers are used.

After hybridisation of the oligonucleotides with the target DNA they are extended with detectably labelled, terminating nucleotides. The nucleotides are either deoxynucleoside triphosphates (dNTPs), dideoxynucleoside triphosphates (ddNTPs) or any one of these, which are synthetically modified by a methyl group, for example. The detectable labels comprise fluorescent dyes, chemiluminescent reagents or radioactive groups, for example. In one embodiment ddNTPs labelled with known fluorescent dyes are used, the four ddNTPs being labelled with separable dyes. After hybridisation of the oligonucleotides with the target DNA, a reaction is carried out with polymerase and ddNTPs, the primers being extended with the ddNTPs. The extended oligonucleotide primers are then separated according to size by methods that will be familiar to the person skilled in the art, such as capillary electrophoresis. The extended ddNTPs of the separated primers are identified by means of the separable dyes. In one embodiment the number of copies of the genes analysed by the method is also determined in a further step. This is done in order to deduce the number of normal or mutant alleles. An example of this is where no mutation is detected but the gene occurs in multiple copies, which means that the active product of the gene is present in increased quantities. The number of copies is preferably determined by kinetic amplification, so-called real-time PCR (RT-PCR), which is described, for example, in Boulay, J L et al (Biotechniques, 1999, 27(2):228-232) and Wilke, K et al (Human Mutations, 2000, 16(5): 431-436). It is moreover advantageous to use an internal control, which is a gene that has not been found to be duplicated or replicated in a cell: a so-called single-copy gene. This gene is amplified in parallel with the pharmaco-gene and the number of DNA molecules of the pharmaco-gene is then quantified in relation to the internal control.

The invention further relates to a kit for detecting mutations in a nucleic acid sequence, the kit comprising at least the following components: - Primer array for amplification by means of LA-PCR in order to obtain the target DNA as described above.

- Oligonucleotide primer array for mutation analysis as described above.

- Detectably labelled, terminating nucleotides.

In one embodiment this kit also comprises a primer and probe array for determining the number of copies by means of the RT-PCR method described above.

According to the present invention it is possible to detect which pharmaco-gene type a cell specimen carries and thereby to individualise the choice of pharmaceutical substance, dosage interval and follow-up of a treatment. For example, from known data on pharmaco-gene types, it is possible to determine a suitably active pharmaceutical substance for an individual and at what dosage interval it is to be administered to the individual. This is suitably done by means of an algorithm intended for this purpose, which utilises known data.

In one embodiment the aforementioned kit may be used in order to determine a pharmaceutically suitable, therapeutically active substance for an individual and a suitable dosage interval for this substance. The invention will be explained below with reference to an example, which must not be regarded as limiting the invention in any way.

Example: Analysis of the pharmaco-gene CYP3A5 in a DNA isolated from an individual's blood

With regard to the isolation of DNA from cells which derive from blood, reference is made to known methods, such as that described in a handbook from Qiagen (Qiagen, 2001, Qiagen genomic DNA handbook, http://www.qiagen.com).

Once the DNA has been isolated, according to the invention the following steps are performed: 1) Determination of the number of gene copies, 2) LA amplification, 3) Analysis of mutations and 4) Evaluation of results. Each step is described in more detail below.

Step 1 : Determination of the number of gene copies

Reagents, buffers and solutions

- Universal PCR mix (TaqMan® Universal PCR master mix, Applied Biosystems, product number 4304437) - Internal control comprising primer and probe mix (the probe is labelled with a fluorescent dye, FAM), for a single-copy gene, in this case RNase P (included in kit with product number 4316831 from Applied Biosystems).

- Primer and probe mix for CYP3A5 (the probe is labelled with a fluorescent dye, ROX), which was ordered from Applied Biosystems, according to gene sequence in exon 4 and comprising: i) Forward primer: 5' gaagtttaatcagctccgttgtcc ii) Reverse primer: 5' tgggcgggacaggatga, iii) Probe: 5' ccgacgtgatgagaacagtgcta

- ddH₂0 Method a) 25 μl universal PCR mix, 2.5 μl primer and probe mix and 2.5 μl primer and probe mix for CYP3A5 and 19 μl ddH₂0 were mixed and 1 μl DNA (50 pg-50 ng) was then added. b) A PCR amplification was performed in a thermocycler (ABI PRISM ® 7700 sequence detector), which was set up in the following steps: i) 2 min at 50°C, ii) 10 min at 95°C and iii) 40 cycles comprising 15 sec at 95°C followed by 1 min at 60°C. c) The results were analysed by means of the instrument software according to the instruction manual for ABI PRISM ® 7700.

The result was that the pharmaco-gene CYP3 A5 occurs in the same number of copies as the internal control, which means that no allele had been removed or duplicated.

Step 2: LA amplification

In order to perform LA-PCR a so-called LA polymerase was used. In this example a kit

(GeneAmp® XL PCR Kit, PE Applied Biosystems, product number N808-0192) was used, which contains such a polymerase.

Reagents, buffers and solutions - rTth-DNA polymerase, XL 2 U/μl

- XL buffer (3.3x, XL Buffer II).

- 25 mN Mg(OAc)₂

- 10 mM d|NTP mix, which contains 2.5 mM each of dATP, dCTP, dTTP and dGTP.

- Wax (AmpliWax® PCR Gem 100, PE Applied Biosystems, product number N808-0100) - Primers 20 μM: i) Forward primer: 5' ctctttgtttccttggacttggggtgctaa ii) Reverse primer: 5' tgttaaatggatgtacctgtggtctgtgatgtg

Method a) The following were mixed: 6 μl XL buffer, 4 μl dNTPs, 1 μl each of the primers, 1.6 μl Mg(OAc)₂ and 6.4 μl ddH₂0, which gave a total volume of 20μl. b) A wax pellet was then added to the specimen and made to melt at 90°C before then solidifying at room temperature. c) The following were mixed on top of the wax layer: 9 μl 3.3x XL buffer, 0.5 μl rTth DNA polymerase, 1 μl DNA and 19.5 μl ddH₂0, which gave a total volume of 30μl. d) The following steps were performed in a thermocycler (Gen Amp® PCR 9700 Instrument System, Applied Biosystems): i) 1 min at 94°C, ii) 25 cycles comprising 15 sec at 94°C followed by 12 min at 66°C and iii) >10 min at 72°C.

The result was a PCR product of 36.9 kb.

Step 3: Analysis of mutations

Analysis of the mutations was performed using a kit containing, among other things, ddNTPs, which were labelled with different fluorescent dyes (SNP analysis; ABI PRISM® SNaP-shot ™ Multiplex Kit, Applied Biosystems product number 4323151 ).

Reagents, buffers and solutions

- PCR mix from kit (SNaPshot Multiplex Ready Reaction Mix)

- PCR product from step 2 (purified according to any of the methods that will be familiar to the person skilled in the art and in this example alkaline phosphatase and Exol treatment).

- Primers as follows (see above for design, italics indicate primer name, capitals indicate non-gene-specific part of the primer and lower case letters indicate gene-specific sequence and the abbreviation nt relates to nucleotides):

C27289 5'-atggtggtgaatgaaacact 20 nt

A69865'-GACTtaaacatataaaacattatg 24 nt

C31611 5'-GACTGACTttaactattgtagatcccct 28 nt

C3705 5 '-GACTGACTGACTacatattacctccctctctt 32 nt

InsG 37095 '-GACTGACTGACTGACTttacctccctctcttgacca 36 nt

A14665 5 '-GACTGACTGACTGACTGACTggtaagaggtgctgatttta 40 nt

T129525 '-GACTGACTGACTGACTGACTGACTactctagtctttaggcccag 44 nt

G146905'-GACTGACTGACTGACTGACTGACTGACTtccatatctttctccactca 48 nt InsT27131 5 '-GACTGACTGACTGACTGACTGACTGACTGACTttaccagtatgagttattct 52 nt Method a) The following were mixed in a tube on ice: 5 μl PCR mix from kit, 3 μl PCR product, 1 μl primer mix, which contained primers according to the above (final concentration: 0.2 μM) and 1 μl ddH₂0. b) The tube was placed in a thermocycler (GeneAmp® 9700) and the following were performed: 25 cycles comprising 10 sec at 96°C followed by 5 sec at 50°C and then 30 sec at 60°C. c) The specimens were incubated with 1 U alkaline phosphatase for an hour at 37°C and thereafter the phosphatase was inactivated for 15 min at 75°C. d) The PCR products were analysed on a genetic analysis instrument (ABI PRISM® 310 Genetic Analyzer) according to the instructions enclosed with the kit for the analysis of mutations and the handbook for the analysis instrument.

Step 4: Evaluation of results a) By using data obtained from the analysis with the genetic analysis instrument (ABI PRISM® 310 Genetic Analyzer), the size of the primers was determined relative to an internal size standard. b) The nucleotides used to extend the primers were determined. c) The result is shown in Table 1

Table 1

In this example two primers had been extended with two different nucleotides. This means that the individual carries one CYP2A5*1 allele, which is a wild type allele and one CYP2A5*3A allele, which is an allele which gives an inactive enzyme. The individual is a so-called intermediate metabolizer.

Claims

1. Method of detecting mutations in a nucleic acid sequence which consists in determining at, least part of that nucleic acid sequence, characterised in that the method comprises the following steps: a) LA-PCR is used to amplify at least one nucleic acid fragment from an isolated nucleic acid specimen in order to obtain a target DNA, b) oligonucleotide primers are designed which are at least partially complementary to the target DNA, those with largely different sequences having different numbers of nucleotides, c) the oligonucleotide primers are hybridised with the target DNA, d) the oligonucleotide primers are extended with detectably labelled, terminating nucleotides, e) the extended oligonucleotide primers are separated according to size, f) the labelling of the terminating nucleotides is used to identify the extended nucleotides.

2. Method according to Claim 1, characterised in that the nucleic acid specimen derives from blood, buccal specimens or hair roots.

3. Method according to Claim 1, characterised in that the isolated nucleic acid specimen comprises mRNA.

4. Method according to Claim 1 , characterised in that the isolated nucleic acid specimen comprises DNA.

5. Method according to Claim 1, characterised in that the target DNA obtained by LA-PCR comprises fragments of 0.5-100 kb.

6. Method according to Claim 1, characterised in that the target DNA obtained by LA-PCR comprises fragments of 5-100 kb.

7. Method according to Claim 1, characterised in that the target DNA obtained by LA-PCR comprises fragments of 10-100 kb.

8. Method according to Claim 1, characterised in that at least three oligonucleotide primers are designed according to step b and are then used to perform steps c-f with the same reaction mix.

9. Method according to Claim 1, characterised in that at least five oligonucleotide primers are designed according to step b and are then used to perform steps c-f with the same reaction mix.

10. Method according to Claim 1, characterised in that the target DNA derives from at least one gene.

11. Method according to Claim 1 , characterised in that the target DNA derives from at least one pharmaco-gene.

12. Method according to Claim 1, 10 or 11, characterised in that the method comprises a further step in which the number of gene copies in a DNA specimen is determined.

13. Method according to Claim 12, characterised in that the method comprises the use of RT- PCR to determine the number of gene copies in the DNA specimen, the number of copies of each gene being determined relative to a control, which is a gene that has not been found to be duplicated or replicated in a cell.

14. Method according to Claim 1, characterised in that the detectably labelled, terminating nucleotides are selected from the group comprising deoxynucleoside triphosphate and dideoxynucleoside triphosphate.

15. Method according to Claim 14, characterised in that the detectably labelled terminating nucleotides are synthetically modified.

16. Method according to Claim 1, 14 or 15, characterised in that the detectably labelled terminating nucleotides are labelled with fluorescent dyes, chemiluminescent reagents or radioactive groups.

17. Kit for performing the method according to any one of the preceding claims, characterised in that it comprises the following components a) oligonucleotide primer array for amplification by means of LA-PCR for performing step a according to Claim 1. b) oligonucleotide primer array for performing steps b to f according to Claim 1. c) detectably labelled terminating nucleotides

18. Kit according to Claim 17, characterised in that it also comprises a primer and probe array for determining the number of copies according to Claim 13.