WO2004087871A2 - Method of determining gene expression: targeted expressed gene display - Google Patents

Abstract

The present invention provides a novel method to identify expression patterns of homologous genes, or groups of genes with homologous domains within genes or gene families. The invention is based upon a discovery of a novel method developed using i the Smad family of genes as a prototype, a method we call targeted expressed gene display (TEGD).

Description

METHOD OF DETERMINING GENE EXPRESSION: TARGETED EXPRESSED GENE DISPLAY

CROSS-REFERENCE TO RELATED APPLICATIONS [001] This application claims benefit under 35 U.S.C 119 (e) from U.S. provisional patent application Serial No. 60/457,472, filed March 25, 2003, the content of which is herewith incorporated by reference in its entirety.

GOVERNMENT SUPPORT

[002] This application was made with United States Government Support under Contract No. D AMD- 17-01-1-0160 awarded by the Army. The United States Government has certain rights in the invention.

BACKGROUND

[003] Methods such as RT-PCR, cDNA subtraction, differential display (DD), representational difference analysis (RDA), serial analysis of gene expression (SAGE) and microarrays are and have been widely used in the identification of novel transcripts as well as in the assessment ofthe level of gene expression in, for example, development and cancer. Despite their usefulness in the overall assessment of genes that are highly divergent at the DNA sequence level, the accurate and high throughput evaluation and. discovery of related and homologous members of a gene family and their gene products has remained a challenge. The currently available high throughput methods are unable to accurately discriminate between the redundancy among the DNA and RNA sequences of the unique members ofthe homologous gene family members and transcripts.

[004] Numerous proteins belong to a family of proteins having homologous domains and/or performing similar functions in the cell. The lack of methods to reliably and efficiently analyze in a single reaction using minute, for example nano gram quantities of test samples and follow-up the expression patterns ofthe homologous genes poses a problem in the diagnosis of numerous conditions including malignancies and diseases wherein alterations occur in the expression of genes encoding homologous proteins. [005] Therefore, it would be useful to discover a method capable of differentiating between the homologous proteins and providing a "snapshot" expression patterns of homologous genes or gene families with conserved domains.

SUMMARY

[006] The present invention provides a novel method to identify expression patterns of homologous genes, or groups of genes with homologous domains within genes or gene families. The invention is based upon a discovery of a novel method developed using the Smad family of genes as a prototype, a method we call targeted expressed gene display (TEGD). The method is universally applicable to other gene families, such as retinoblastoma (Rb) gene family, which share a high homology in the pocket region of the gene (see, e.g., Mayol X., et al., Oncogene. 1993 Sep;8(9):2561-6; for a review, see, e.g., Stiegler P. and Giordano A., Crit Rev Eukaryot Gene Expr. 2001;1 l(l-3):59-76, ), BRCA1 gene family with homologies in RING finger and/or BRCT domains (Wu et al., 1996 Nat. Genet. 14: 430-440); Saurin et al., 1996 Trends Biochem. Sci. 21: 208-214), BRCA2 gene family harboring BRC repeats (Bignell et al., 1997 Hum. Mol. Genet. 6 : 53- 58) or gene families encoding kinases, such as serine-threonine kinases, the type 1 family of growth factor receptors including epidermal growth factor receptor (EGFR), c- erb B- 2, c- erb B-3 and c- erb B-4, which have one or more conserved domains in common.

[007] The method ofthe present invention allows analysis of gene expression of genes containing homologous regions and thus gene families where related members contain at least two regions of homology separated by a divergent region of variable sequence. The sequence may vary either in length or sequence. The method also provides a tool for the discovery of novel members of a large family of related genes, genes encoding homologous domains such as homologous genes. In addition, the method ofthe present invention provides a tool to display differentially processed transcript variants ofthe same gene as well as to assess the level of expression of individual genes.

[008] Accordingly, the method ofthe present invention is useful in identifying individuals at risk of developing a disease or malignancy, diagnosing a disease or malignancy, providing prognosis to a disease or malignancy, monitoring effects of treatment of a disease or malignancy or developing therapeutic agents to treat a disease or malignancy.

[009] The term "disease or malignancy" as used herein refers to any disease or disorder, wherein an expression pattern of particular gene/genes is/are altered before of during the disease progression thereby providing a target gene family to monitor using the method ofthe present invention. Such families include, but are not limited to Smad gene family, Rb gene family and kinase gene family. The diseases include, for example, autoimmune diseases, connective tissue diseases, developmental disorders, infectious diseases and neurological diseases, while malignancies include cancers, lymphomas, and other abnormal cell growth and/or differentiation.

[010] The gene family members as referred to in the present invention include genes encoding closely related proteins to genes encoding at least two homologous nucleic acid domains encoding amino acid domains in different proteins. The phrase "gene family members" as referred to herein also include genes encoding different splice variants of the same gene. Additionally, gene families include different genetic defects such as one or more substitutions, deletions, insertions, or inversions in one gene. The gene family comprises any one or more nucleic acid sequences representing two or more transcripts, wherein the transcripts comprise at least one region encoding a homologous amino acid sequence flanked by a sequence encoding at least one non-homologous amino acid sequence.

[011] In one embodiment, the invention provides a method of screening for expression pattern alterations of gene family members and their variants in a test biological sample. The method comprises the steps of designing degenerate primers for amplifying the target gene family members, wherein the primers are designed in the homologous regions ofthe gene family wherein at least two regions of homology are separated by a divergent region of variable sequence, the sequence varying either in length or in sequence. Consequently, the PCR amplification reaction is performed with the primers using an mRNA obtained from a test biological sample and the amount of the PCR products corresponding to each member ofthe gene family is analyzed. Once a signature banding pattern (SBP) for each family of genes is established in a normal or appropriate test sample using a unique pair of PCR primers, repeat analysis can be performed and evaluations for the levels of expression or aberrant/ variant forms of transcripts can be conducted in an expeditious manner. Thus, a comparison ofthe amount ofthe PCR products of different size or sequence ofthe test biological sample to a control sample reflecting a normal gene expression pattern ofthe gene family members indicates changes on the test biological sample. The change in the gene expression can be either an increase or a decrease of expression of one or more members ofthe gene family. The changes may be caused by, for example, altered epigenetic modification, such as methylation or acetylation, or deletions, insertions or point mutations in the coding or non-coding region ofthe gene.

[012] The analysis ofthe amplified samples can be performed using techniques s^~Uch as denaturing gel electrophoresis or mass spectrometry, particularly if the difference ir the sequence between the homologous regions in gene family members are based on the length ofthe sequence. Alternatively, the analysis can be based on methods such as restriction fragment length polymorphism (RFLP), single strand conformation polymorphisms (SSCP), denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), chemical cleavage or any other method capable of differentiating between sequences with one or more sequence variations. Direct sequencing and hybridization to nucleic acid arrays are also contemplated means for detecting the different sequences after amplification. All these methods are presently well known to one skilled in the art.

[013] In another embodiment, the invention provides a method of identifying novel members of a homologous gene family. The method comprises the steps of designing two or more degenerate primers corresponding to one or more homologous regions of the known gene family members, amplifying nucleic acids from a biological sample and analyzing the amplification products wherein the novel genes can be identified using DNA sequence analysis as described above.

[014] The test biological sample may be obtained from a number of different sources including, but not limited to an individual suspected of being susceptible to a disease based upon a family history or other risk factors, such as smoking; an individual being affected with a disease; an individual being affected by a disease treated with a therapeutic agent; a tissue culture with normal or abnormal cells; and a tissue culture treated with test therapeutic agents.

[015] The biological sample may be obtained from the same individual at different times, for example, during routine check ups, so as to follow up the development of expression pattern of disease associated genes, such as Smad genes, Rb genes or kinase genes, expression of which is known to change in, for example, malignancies. Expression pattern may also be followed up during treatment of an individual by taking samples in various intervals during the course ofthe treatment and analyzing the response of an individual to any given treatment at the gene expression level. [016] The control biological sample can be obtained from normal cells representing the tissue at a normal state or alternatively from known abnormalities such as cells from

-A- different stages or types of cancer, different stages of an autoimmune disease, different types of connective tissue disorders or different types of neurological diseases. Control biological sample may also be a sample taken from the individual who is being followed up to compare the two samples taken from that individual at different time intervals ranging from a few days to years.

[017] The invention is furthermore useful in identifying predictive, diagnostic, prognostic and therapeutic target genes or proteins within a family of homologous genes by providing a tool to identify genes within a gene family that are over or under expressed in various disease conditions or as a response to various pharmacological interventions.

[018] In another embodiment, the invention provides a method of screening for individuals at risk of developing a disease based upon differences in the expression levels of homologous gene family members in a biological sample taken from an individual using the method described above.

[019] In one embodiment, the invention provides a method of diagnosing a disease based upon differences in the expression levels of homologous gene family members in a biological sample taken from an individual suspected of having a disease or malignancy.

[020] In another embodiment, the invention provides a method of providing prognostic information by analyzing the expression levels of homologous gene family members in a biological sample taken from an individual affected with a disease or malignancy.

[021] In yet another embodiment, the invention provides a method of monitoring therapeutic effects of treatment regimes by analyzing the expression levels of homologous gene family members in biological samples taken from an individual treated with therapeutic agents or other therapeutic methods wherein one or more biological samples are taken from the individual before administration of a treatment regime and consequently during and/or after treatment and comparing the expression levels ofthe homologous gene family members in the samples wherein normalization ofthe expression levels indicates that the treatment regime has had an effect.

[022] In one preferred embodiment, the invention provides a method of diagnosing specific cancers, preferably breast and colon cancer, comprising determining expression ofthe Smad family, Rb family or kinase family of proteins in a biological sample, wherein alteration in one or more Smad, Rb, or kinase gene expression compared to a control sample is indicative of cancer. In one preferred embodiment, the alteration is a decrease or loss of Smadδ gene expression. One can also use the method ofthe inveation to discover specific targets for drug screening assays.

BRIEF DESCRIPTION OF FIGURES

[023] Figures 1 A-1B demonstrate the principle ofthe present invention, a targeted expressed gene display (TEGD). Fig. 1 A is a schematic representation of TEGD for the Smad family of genes. MH1 and MH2 indicate highly homologous regions in the amino acid as^" well as DNA sequence among the various Smad gene family members. The forward and reverse primers for PCR amplification ofthe cDNA were designed in the conserved regions as indicated. The radiolabeled PCR products were analyzed by denaturing acrylamide gel electrophoresis. Fig. IB shows a TEGD analysis ofthe SMAD family of genes in various tissue types. PCR products for SMADs using degenerate primers were analyzed by TEGD. Lanes 1-17 correspond to PCR products generated using cDNA templates from the brain, lung, stomach, heart, liver, spleen, kidney, colon, bone marrow, small intestine, trachea, prostate, uterus, thymus, testis, skeletal muscle, and mammary gland, respectively. The arrows point to distinct PCR products. The approximate size of PCR products in base pairs (bp) is indicated on the left panel. The positions of various Smad genes and their variants as identified from sequence analysis are indicated on the right panel.

[024] Figure 2 shows tissue- wide expression of SMAD genes. Semi-quantitative RT-PCR analysis ofthe indicated SMAD genes was carried out as described under materials and methods shown in the Examples. The cDNA template was derived from total RNA from normal tissues ofthe brain, lung, heart, liver, bone marrow, kidney, spleen, thymus, prostate, testis, uterus, small intestine, mammary gland, skeletal muscle, stomach and colon, lanes 1-16, respectively.

[025] Figure 3 shows TEGD analysis of SMAD genes in various cancers. PCR products of SMADs generated using degenerate primers as described under Figure 1 were obtained from different cancers and analyzed by TEGD. The cDNA templates used in reactions analyzed on lanes CI, BI & SI are from normal cells from colon, breast and stomach tissues and C2-7, B2-8 and S2-5 are from colon, breast and gastric cancers, respectively. The arrows point to distinct PCR products that were abnormal compared to the normal control. The positions of various Smad genes and their variants as identified from sequence analysis are indicated on the right panel.

[026] Figure 4 shows SMAD8 expression in cancer cell lines and tumors. Total RNA was prepared using the Trizol method from the indicated colon cancer cell lines and analyzed by RT-PCR (Lanes 1-11). Smad3α and Smad3β are two ofthe major differentially spliced forms of Smad3, and Smad8α, Smad8β and Smad8γ are three of the major differentially spliced forms of Smad8, which correspond to the full-length SmadS, deletion of exon 2 of Smad8, and deletions of exons 2&3 of Smad8, respectively. Analysis ofthe β-Actin gene was used for normalization and quantitation ofthe expression ofthe different Smad genes and variants.

[027] Figures 5A-5B show the analysis of epigenetic gene silencing ofthe SMAL>8 gene by altered DNA methylation patterns. Fig. 5 A shows a bisulfite sequence analysis of the CpG islands of intron 1 ofthe Smad8 gene in the indicated cell lines that are either proficient or deficient in Smad8 expression. Fig. 5B shows an MSP analysis ofthe various cancers that have lost or retained Smad8 expression. The MSP (Methylation Specific PCR) products in lanes U and lanes M indicate the presence of unmethylated and methylated templates, respectively. Placental DNA (PDNA) and in vitro methylated DNA (IVM) serve as negative and positive controls.

[028] Figures 6A and 6B show the effects of DNA demethylation and inhibition of histone deacetylases on SMAD8 gene expression. Cells were treated with l-5mM 5-AZA- dC for 7 days or with 0.3 mM TSA for 24hrs. To assess the effect of both 5-AZA-dC and TSA simultaneously, cells were exposed sequentially for 7 days to 5-AZA-dC and subsequently to 0.3 mM TSA for an additional 24 hrs. Total RNA and genomic DNA were isolated and Smad8 expression and DNA hypermethylation were determined by RT- PCR (Fig. 6A) and MSP analysis (Fig. 6B), respectively. MDAMB231 cells were used as the positive control.

[029] Figure 7 shows a model for the Smad connection to cancer. TGFβ or BMP bind to the type-II receptor (RII), which phosphorylates a type I receptor (RI) kinase that, in turn, initiates signaling via the receptor regulated Smads (R-Smad) such as Smad2 or Smad3 down-stream of TGFβ or Smadl, Smad5 or Smad8 down-stream of BMP. The phosphorylated R-Smad forms a heteromeric complex with the common-mediator Smad (Co-Smad), Smad 4, and is translocated into the nucleus. In the nucleus, the R-SmaαV Co- Smad hetero-oligomer either by itself or by associating with a heterologous Smad interacting DNA binding protein (SIDBP) such as FAST-1 , and/or other cofactors could mediate specific transcriptional activation or repression responses. The inhibitory Smads (I-Smad) such as Smad6 and Smad7 are able to compete with the R-Smads by stably binding the RI kinase or by preventing association of R-Smads with the Co-Smad effectively blocking the signaling cascade of events. There are numerous other signaling pathways such as Ras-MEK that could modulate the end effects by establishing cross talk among the different pathways.

DETAILED DESCRIPTION

[030] The present invention provides a novel method to identify and analyze expression patterns and/or levels of expression of homologous genes, the genes containing homologous domains, or gene families. The invention is exemplified herein using the Smad family of genes as a prototype and is readily applicable to any family of genes that have two or more members with homologous sequences, such as the Rb-family or kinase family of genes.

[031 ] The method is based on the use of related gene family members that contain at least two regions of homology separated by a divergent region of variable sequence. The variable sequence is a sequence that is a substantially different nucleic acid sequence between the substantially homologous nucleic acid sequences. The variable sequence can vary in length or in sequence. The length variation must be at least one, preferably at least two, 5, 10, 15, 20, 30, 40, 50, 60, 70-90, 100, 500, or up to at least 1000-1500, or more nucleotides.

[032] The method ofthe present invention can in some embodiments be used to discover novel members of a large family of related genes.

[033] The method also permits one to display differentially processed transcript variants ofthe same gene as well as to assess the levels of expression of individual genes.

[034] The method ofthe present invention is useful in identifying individuals at risk of developing a disease or malignancy, diagnosing a disease or malignancy, providing prognostic information about a disease or malignancy, monitoring effects of treatment regimes of a disease or malignancy, including the effects of pharmaceuticals, and developing therapeutic agents to treat a disease or malignancy.

[035] The term "disease or malignancy" as used herein refers to any disease or disorder, in which an expression pattern of particular gene/genes is/are altered before or during the disease thereby providing a target gene family to monitor using the method of the present invention. A disease can be, for example, an autoimmune disease, a connective tissue disease, or a neurological disease. A malignancy can be a cancer, a leukemia, or other type of abnormal cell growth and/or differentiation.

[036] The terms "gene family" and "homologous genes" and "genes containing homologous domains" as used throughout the specification are used interchangeably and are meant to refer to any two or more nucleic acid sequences having at least one region of homologous nucleic acids sequence and one region which is different either in size or sequence. Examples of homologous gene families and sequences of genes belonging to these families can be found, for example, at the Mouse Genome Informatics database maintained by The Jackson Laboratories, at http://www.informatics.jax.org/mgihome/nomen/genefamilies/index.shtml and at Human Genome Nomenclature HUGC web page at http://www.gene.ucl.ac.uk/nomenclature/genefamily.shtml. These databases contain information on both human and mouse gene families with homologous sequences. Examples of such gene families include, but are not limited to: A Disintegrin-like and Metalloprotease with Thrombospondin Type 1 Motif Family; Adenylate Cyclase Family; Alpha Actinin Family; Annexin Family; Apolipoprotein C Family; Aquaporin Family; Calcium Channel, Voltage-dependent, Gamma Subunit Family; Calpain Family; Claudin Family; Collagen Family; Cyclic Nucleotide Phosphodiesterase Superfamily; Disheveled Associated Activator of Morphogenesis Family; E2f Transcription Factor Family; EH- domain Containing Family; Fatty Acid Coenzyme A Ligase Family; Gamma- Aminobutyric Acid Ionotropic Type A Receptor Family; Glutamate Receptor, Ionotropic Superfamily; Glycine Receptor, Alpha Family; Glypican Family; Golgi Associated, Gamma Adaptin Ear Containing, ARF Binding Protein Family; Iroquois Family; Leucine-rich Repeat LGI Family; Opsin Family; Phosphatidylinositol-4-phosphate 5- Kinase Family; Protocadherin Gamma Family; Secretory Carrier Membrane Protein Family; Synaptotagmin Family; Tripartite Motif Family; Cyp 450 Family; Cytokine Family; High Mobility Group (HMG) Chromosomal Proteins and Wnt Family: FRP/FrzB Genes; and TGF-B signaling protein family or SMAD.

[037] In one preferred embodiment, the method ofthe invention is directed to analyzing the expression pattern of Smad, Rb or kinase gene families. [038] Gene families, as referred to throughout the specification also include genes with different messenger RNA splice variants. Examples of such splice variants include but are not limited to Smad genes or the VEGF genes.

[039] Additionally, gene families include different genes with defects such as deletions, insertions, substitutions and inversions, as well as variable epigenetic differences, such as methylation or acetylation differences. The gene family comprises any two or more nucleic acid sequences representing two or more transcripts, wherein the transcripts comprise at least one region of divergent sequence flanked by at least two sequences that are homologous between at least two nucleic acids. As used herein and! throughout the specification, the regions of homology are preferably at least about 60V_o homologous, more preferably at least 70% homologous, still more preferably at least about 80%-85% homologous and even more preferably at least about 90%, 92%, 95%_s 98%, or 99%- 100% homologous.

[040] In one embodiment, the invention provides a method of screening for expression pattern alterations of gene family members and their variants in a test biological sample. The method comprises the steps of designing degenerate primers for amplifying the target gene family members, the primers corresponding to one or more conserved regions ofthe genes, amplifying the reaction with the primers using, as a template, an mRNA obtained from a test biological sample and analyzing the amount of PCR products corresponding to each member ofthe gene family. Comparison ofthe amount ofthe PCR products ofthe test biological sample to a control sample reflecting a normal gene expression pattern of the gene family members indicates changes on the test biological sample. The change can be either an increase or decrease of expression in one or more members ofthe gene family.

[041] Primers useful according to the present invention are designed using amino acid sequences ofthe protein families or nucleic acid sequences ofthe gene families as a guide. The primers are designed in the homologous regions ofthe gene family wherein at least two regions of homology are separated by a divergent region of variable sequence, the sequence being variable either in length or nucleic acid sequence.

[042] For example, the identical or highly, homologous, preferably at least 80%- 85% more preferably at least 90-99% homologous amino acid sequence of at least about 6, preferably at least 8-10 consecutive amino acids. Most preferably, the amino acid sequence is 100% identical. Forward and reverse primers are designed based upon the maintenance of codon degeneracy and the representation ofthe various amino acids at a given position among the known gene family members. Degree of homology as referred to herein is based upon analysis of an amino acid sequence using a standard sequence comparison software, such as protein-BLAST using the default settings (http://www.ncbi.nlm.nih.gov/BLAST/).

[043] Table 2 below represents the usage of degenerate codes and their standard symbols:

^"Y j C ^" f_ ^" A ;f~ G

[044] Preferably any 6-fold degenerate codons such as L, R and S are avoided since in practice they will introduce higher than 6-fold degeneracy. In the case of L, TTR and CTN are compromised YTN (8-fold degeneracy), in the case of R, CGN and AGR compromises at MGN (8-fold degeneracy), and finally S, TCN and AGY which can be compromised to WSN (16-fold degeneracy). In all three cases, 6 of these will match the target sequence. To avoid this loss of specificity, it is preferable to avoid these regions, or to make two populations, each with the alternative degenerate codon, e.g. for S include TCN in one pool, and AGY in the other.

[045] Primers may be designed using a number of available computer programs, including, but not limited to Oligo Analyzer3.0; Oligo Calculator; NetPrimer; Methprimer; Primer3; WebPrimer; PrimerFinder; Primer9; Oligo2002; Pride or GenomePride; Oligos; and Codehop. Detailed information about these programs can be obtained, for example, from www.molbiol.net.

[046] For example, CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide

Primers) uses common codon usage at the 5 -end, while including degeneracy at the V- end - though care should be taken to tailor the codon usage to the particular species fro»m which you are cloning. Primers may also be designed by hand and then checked for neon- specific binding to other targets in the nucleic acid databases, for example GenBank using, for example, FASTA. [047] Table 3 below lists the degree of degeneracy:

[048] For example, based upon the amino acid sequences of any protein family, preferably a human protein family, such as the human Smads 1 through 8, regions that are identical and conserved among the proteins are mapped out (1,2). The forward and reverse primers are designed based on the maintenance of codon degeneracy and the representation of the various amino acids at a given position among the known Smad family members. For example, in one preferred embodiment, degenerate Smad family specific primers useful in amplifying the Smad family of proteins are SmadXF2 5' primer-TNTKBMGVTGGCCNGAYYTBM (SEQ ID NO: 1) and SmadXRl 3' primer- CCAVCCYTTSRCRAARCTBAT (SEQ ID NO: 2).

[049] Alternatively, one may design primers capable of amplifying a conserved region in any other gene family having at least one region of homology.

[050] For example, the pocket region of retinoblastoma gene family shows several regions with a significant homology. One example of a homologous region is shown in the table below, wherein the consensus sequence is shown on the first line and is marked as "Cons". One can routinely identify such homologous regions, for example, using the National Institutes of Health web page for conserved domain homology, which can be found at http://www.ncbi.nlm.nih.gov/Structure/cdd. The homologous regions that can be used to design primers according to the present invention are exemplified in bold type in the consensus sequence for a part ofthe rb-gene family consensus sequence comprising the so called pocket region ofthe rb-genes. The GenBank identification (GI) numbers are provided on the left had column and the location of the amino acid sequences are provided in the beginning and end of each compared sequence.

130 140 150 160 170 180

....*.... |....*....|....*.... |....*....|....*.... |....*.... I

Cons 110 FHRSLLACCLELVLATYK DLSFPWILEVFGITAFDFYKVIESFIRH 155

(SEQ ID NO: 25) IGUX A 111 FH SLLACALEWMATYSrstsqnldsgtDLSFPWILNVLNLKAFDFYKVIESFIKA 167 (SEQ ID NO: 26) gi6671809 610 FLDSVFCFCVELILVSNGy DRPFPWSAELCGVHPF FHKVIDLMITH 656 (SEQ ID NO: 27) gi6225919 473 IviFNITLMACCVELVLEAYKt ELKFP VLDCFSISAFEFQKIIEIWRH 522

(SEQ ID NO: 28) gi3702121 522 FHRCMLACSAELVLATHKt vTMLFPAVLEKTGITAFDLSKVIESFIRH 569 (SEQ ID NO: 29) gi2352795 393 FHRC IACS DLVLATHKt vIMMFPAVLESTGLTAFDLSKIIENFVRH 440 (SEQ ID NO: 30) gil666661 462 FHESLLACSIEWMATYGsis retDLSFP ILEVFKIEPYDFYKVIESFIKD 513 (SEQ ID NO: 31) gi6686330 528 FHRSLLACCLEWTFSYKp pGNFPFITEIFDVPLYHFYKVIEVFIRA 574 (SEQ ID NO: 32) gi2498835 497 FHKSLMACCLEIVLFAYSs pRTFPWIIEVLDLQPFYFYKVIEWIRS 543

[051] The comparison was performed on the NIH conserved domain database at hJtPj//www.ncbi.nlm.nihlgov/Structure/cdd cddsrv.cgi?uid^:=pfam01858.

[052] Another example of homologous domains shared by a gene family is the type- 1 epidermal growth factor receptor family. A homology comparison between the consensus KOG1025 domain is shown below:

10 20 30 40 50 60 ....* ... I .... *....! ...*....!....*....!.... *....!....*....! consensus 1 PSGGAALAV-LGLLLVLAPTSAALWS QKVCSGTTNGLSVPGTGENHYRDLRKMY 53

(SEQ ID NO: 33) gi 3913590 1 MKPATGLWV-WVSLLVAAGTVQPSDS QSVCAGTENKLSSLSDLEQQYRALRKYY 53

(SEQ ID NO: 34) gi 2811086 3 PSGTAGAAL-LALLAALCPASRALEE KKVCQGTSNKLTQLGTFEDHFLSLQRMF 55

(SEQ ID NO: 35) gi 119534 1 MRANDALQV-LGLLFSLARGSEVGNS QAVCPGTLNGLSVTGDAENQYQTLYKLY 53

(SEQ ID NO: 36) gi 119533 1 -MELAALCR-WGLLLALLPPGAAS TQVCTGTDMKLRLPASPETHLDMLRHLY 50

(SEQ ID NO: 37)

[053] The comparison was performed on the NIH conserved domain database at http://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=KOG1025. [054] In this example the genes aligned with the consensus sequence are c-erb-B4 (gi 3913590). c-erb-Bl (gi 281 1086). c-erb-B3 (gi 119534). and c-erb-B2 (gi 1 19533). Amino acids shown in bold on the homology comparison table shown above are exemplary amino acids that can be used in designing the degenerate primers capable of amplifying all the members ofthe c-erb kinase family.

[055] Further examples of homologous domains that can be used to design primers to amplify gene family members are readily available to one skilled in the art. A non- limiting list of examples is provided below to illustrate the domain homology: [056] The superfamily of Tumor necrosis factor receptors contains a TNF-like receptor domain (TNFR-domain). When bound to TNF-like cytokines, TNFRs trigger multiple signal transduction pathways. They are involved in inflammation response, apoptosis, autoimmunity and organogenesis. Expression of several TNFR family members can be determined using the method ofthe present invention by designing primers in the homologous TNFR domains which are elongated with generally three tandem repeats of cysteine-rich domains (CRDs), that fit in the grooves between protomers within the ligand trimer. Such cysteine rich domains can be used as a template for primer design according to the present invention. [057] TNF-domain in the Tumor Necrosis Factor (TNF) superfamily. TNF superfamily members include the cytokines: TNF (TNF-alpha), LT (lymphotoxin-alpha, TNF-beta), CD40 ligand, Apo2L (TRAIL), Fas ligand, and osteoprotegerin (OPG) ligand. These proteins generally have an intracellular N-terminal domain, a short transmembrane segment, an extracellular stalk, and a globular TNF-like extracellular domain of about 150 residues. They initiate apoptosis by binding to related receptors, some of which have intracellular death domains. They generally form homo- or hetero- trimeric complexes. TNF cytokines bind one elongated receptor molecule along each of three clefts formed by neighboring monomers ofthe trimer with ligand trimerization a requiste for receptor binding.

[058] ARM domain in the armadillo/beta-catenin-like repeats (ARM). An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats have also been found in the mammalian armadillo homolog beta-catenin, the junctional plaque protein plakoglobin, the adenomatous polyposis coli (APC) tumor suppressor protein, and a number of other proteins. ARM has been implicated in mediating protein-protein interactions. The method ofthe present invention can be used to determine the gene expression pattern of genes comprising the ARM domain.

[059] TsglOl domains in the tumor susceptibility gene 101 protein (TSG101). This family consists ofthe eukaryotic tumor susceptibility gene 101 protein (TSG101). Altered transcripts of this gene have been detected in sporadic breast cancers and many other human malignancies. Therefore, the present method provides an ideal tool to follow the expression pattern of this tumor susceptibility gene transcripts in an individual either at the time of diagnosis of a malignancy or during routine check-ups, wherein alterations ofthe transcript level may provide an early diagnostic marker. [060] BRCT domains in the Breast Cancer Suppressor Protein (BRCA1), carboxy- terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo/hetero BRCT multimers, BRCT-non-BRCT interactions, and interactions within DNA strand breaks. Such homologies are also useful in the present invention to design primers.

[061 ] Accordingly, the present invention provides methods that are useful in analyzing changes in expression pattern or profile of several genes that all have homologous domains.

[062] Primers may be labeled using labels known to one skilled in the art. Such labels include, but are not limited to radioactive, fluorescent, dye, and enzymatic labels. [063] Analysis of amplification products can be performed using any method capable of separating the amplification products according to their size, including automated and manual gel electrophoresis, mass spectrometry, and the like. [064] Alternatively, the amplification products can be separated using sequence differences, using SSCP, DGGE, TGGE, chemical cleavage or restriction fragment polymorphisms as well as hybridization to, for example, nucleic acid arrays. [065] The methods of nucleic acid isolation, amplification and analysis are routine for one skilled in the art and examples of protocols can be found, for example, in the Molecular Cloning: A Laboratory Manual (3-Volume Set) Ed. Joseph Sambrook, David W. Russel, and Joe Sambrook, Cold Spring Harbor Laboratory; 3rd edition (January 15, 2001), ISBN: 0879695773. Particularly useful protocol source for methods used in PCR amplification is PCR (Basics: From Background to Bench) by M. J. McPherson, S. G- Møller, R. Beynon, C. Howe, Springer Verlag; 1st edition (October 15, 2000), ISBN: 0387916008.

[066] The template nucleic acids, preferably total RNA or messenger RNA (mRNA), that are amplified according to the method ofthe present invention are preferably isolated, purified and treated with a reverse transcriptase (RT) to obtain complementary DNA (cDNA) before amplification. However, a sample may also be used directly without significant amount of purification. Reverse-transcription can also be performed in the same reaction mixture with the PCR reaction (RT-PCT). [067] In another embodiment, the invention provides a method of identifying novel members of a homologous gene family. The method comprises the steps of designing two or more degenerate primers corresponding to one or more homologous regions ofthe known gene family members, amplifying nucleic acids from a biological sample and analyzing the amplification products wherein the novel genes can be identified using DNA sequence analysis. Methods for sequence analysis are known to one skilled in the art and particular protocols are available, for example, in the Molecular Cloning: A Laboratory Manual (3-Volume Set) Ed. Joseph Sambrook, David W. Russel, and Joe Sambrook, Cold Spring Harbor Laboratory; 3rd edition (January 15, 2001), ISBN: 0879695773.

[068] The test biological sample can be obtained from a number of different sources including, but not limited to, an individual suspected of being susceptible to a disease based upon a family history or other risk factors, such a smoking, obesity, exposure to chemicals, asbestos or the like; an individual being affected with a disease; an individual being affected by a disease and treated with a therapeutic agent; a tissue or cell culture with normal or abnormal cells; and a tissue or cell culture treated with test therapeutic agents, and an animal model of a disease; an animal model, such as drosophila, a mouse, a zebrafish, a rabbit, a dog or the like; eukaryotic as well as prokaryotic cells are both contemplated to contain targets for the methods ofthe present invention. Biological samples from healthy individuals, normal cells or healthy animals can be used as controls and are representative of normal expression pattern for genes of interest. [069] The target sequence may also be a viral sequence such as an human immuno deficiency virus (HIV) -sequence, wherein the method of the present invention provides a tool to, for example, detect novel virus variants within an individual affected with the virus, such as HIV.

-1 Q- [070] The control biological sample can be obtained from normal cells representing the tissue at its normal state or alternatively from known abnormalities such as cells fjfom different stages or types of cancer, different stages of autoimmune diseases, different types of connective tissue disorders, different developmental disorders or different types of neurological diseases.

[071 ] The method of the present invention is also useful in identifying predictive, diagnostic, prognostic and therapeutic target genes within a family of homologous genes by providing means to analyze the expression of all family members in one reaction. Cell cultures, tissue cultures, or animal models can be used. [072] First, a biological sample is taken from the desired cell, tissue or animal before treatment with a candidate agent and nucleic acids are amplified using the degenerate primers for a gene family and analyzed. The cell, tissue or animal is consequently treated with a candidate agent and a second sample is taken and analyzed after amplification ofthe transcripts ofthe second sample using the same degenerate primers and conditions as with the first sample before the treatment. Change in the expression pattern ofthe second sample compared to the first sample indicates a candidate agent capable of affecting the expression pattern. The candidate agents useful according to the present invention include small organic and inorganic molecules, and unmodified or modified nucleic acids, peptides and proteins.

[073] For example, the method was used to identify that methylation of SMAD8 results in silencing ofthe SMAD8 gene thereby predisposing an individual to malignancies and that demethylating agents can restore the normal unmethylated Smad8, leading to normalization in the expression of the SMAD8 gene. Thus, one can use the present method to discover diagnostics and theraputics. For example, with respect to the SMAD8 gene and gene product one can use antibodies to SMAD8 in an immunohistochemistry approach to determine if an individual is predisposed to malignancies.

[074] In another embodiment, the invention provides a method of screening for individuals at risk of developing a disease based upon differences in the expression levels of homologous gene family members, such as Smad, Rb, BRCA or kinase gene families in a biological sample taken from an individual using the method described above. For example, a decrease in expression of Smad family members in a tissue is indicative that the individual is susceptible to developing cancer as discussed in the Example below. Similarly, expression of Rb or kinase family of genes can be used int cancer diagnostics and prognostics.

[075] In one embodiment, the invention provides a method of diagnosing a disease based upon differences in the expression levels of homologous gene family members in a biological sample taken from an individual suspected of having a disease. In one preferred embodiment, the invention provides a method of diagnosing cancer based upon altered Smad8 expression, wherein reduction or loss of SMAD8 expression with corresponding DNA methylation in CpG islands localized to nucleotides 35292323 to 35292369 ofthe promoter region (Exonl ofthe untranslated hypothetical transcript MADH9-001 (Vega ranscript ID: OTTHUMT00013001062); chromosome 13ql2-14 on the reverse strand between RB and BRCA2) ofthe SMAD8 gene (UCSC genome browser: http://genome.ucsc.edu) is indicative of inactivation of Smad8 and wherein the inactivation is related to cancer, which is responsive to treatment with demethylating agents.

[076] The present invention therefore also provides predictive, diagnostic, and prognostic kits comprising degenerate primers to amplify a target gene family and instructions comprising amplification protocol and analysis ofthe results. The kit may alternatively also comprise buffers, enzymes, and containers for performing the amplification and analysis ofthe amplification products. The kit may also be a component of a screening, diagnostic or prognostic kit comprising other tools such as DNA micro arrays. Preferably, the kit also provides one or more control templates, such as nucleic acids isolated from normal tissue sample, and/or a series of samples representing different malignancies and/or diseases or different stages of one type of malignancy.

[077] In one embodiment, the kit provides two or more primer pairs, each pair capable of amplifying a different gene family thereby providing a kit for analysis of expression of several gene families in a biological sample in one reaction or several parallel reactions.

[078] Primers in the kits may be labeled, for example fluorescently labeled, to facilitate detection of the amplification products and consequent analysis ofthe expression patterns ofthe gene family members.

[079] In one embodiment, more than one gene family can be detected in one analysis. A combination kit will therefore comprise of primers capable of amplifying different gene families. The primers may be differentially labeled, for example using different fluorescent labels, so as to differentiate between the gene families. An exemplary combination of gene families for detection and prognosis of cancer can include primers designed to amplify, for example, Smad, Rb and kinase, for example, EGFR family of genes.

[080] In one embodiment, the invention provides alternatively spliced variants off SMAD2 with a deletion of exon3 (S E>2Δexon3; SMAD2 ), SMAD3 with deletions of both exons 3 and 7 (SM4.D Δexon3Δexon7; SMAD3 ), SMAD5 with a deletion of exon3 (S ΛZ 5Δexon3; SMAD 5 ) and SMAD8 with deletions of either exon3 (SMAD8Aexon3; SMAD8 ) or both exons 2 and 3 (SM4Zλ??Δexon2Δexon3; SMAD8y) in the analysis. [081 ] In one embodiment, the invention provides a method of providing prognostic information by analyzing the expression levels of homologous gene family members in a biological sample taken from an individual affected with a disease. [082] Precise mapping of DNA methylation patterns in CpG islands has become essential for understanding diverse biological processes such as the regulation of imprinted genes, X chromosome inactivation, and tumor suppressor gene silencing in human cancer. MSP (methylation-specific PCR) can rapidly assess the methylation status of virtually any group of CpG sites within a CpG island, independent ofthe use of methylation-sensitive restriction enzymes. Shortly, the MSP assay entails initial modification of DNA by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA The term "modifies" as used herein means the conversion of an unmethylated cytosine to another nucleotide which will distinguish the unmethylated from the methylated cytosine. Preferably, the agent modifies unmethylated cytosine to uracil. Preferably, the agent used for modifying unmethylated cytosine is sodium bisulfite, however, other agents that similarly modify unmethylated cytosine, but not methylated cytosine can also be used in the method ofthe invention. Sodiun bisulfite (NaHS0₃) reacts readily with the 5,6-double bond of cytosine, but poorly with methylated cytosine. Cytosine reacts with the bisulfite ion to form a sulfonated cytosine reaction intermediate which is susceptible to deamination, giving rise to a sulfonated uracil. The sulfonate group can be removed under alkaline conditions, resulting in the formation of uracil. Uracil is recognized as a thymine by Taq polymerase and therefore upon PCR, the resultant product contains cytosine only at the position where 5- methylcytosine occurs in the starting template DNA. [083] The primers used in the methods ofthe present invention for amplification- of the CpG-containing nucleic acid in the specimen, after bisulfite modification, specifically distinguish between untreated or unmodified DNA, methylated, and non- methylated DNA. MSP primers for the non-methylated DNA preferably have a T in the 3 ' CG pair to distinguish it from the C retained in methylated DNA, and the compliment is designed for the antisense primer. MSP primers usually contain relatively few Cs or Gs in the sequence since the Cs will be absent in the sense primer and the Gs absent in the antisense primer (C becomes modified to U(uracil) which is amplified as T(thymidine) in the amplification product). Primer design to the region responsible for SMAD8 gene silencing can be performed using, for example, Primo MSP 3.4, which is a PCR primer design program for methylation specific PCR (MSP) and bisulphite sequencing (at http://www.changbioscience.com/primo/primom.html). Details of the MSP method can be found at, e.g., Herman J.G. et al., Proc Natl Acad Sci U S A. Sep 3;93(18):9821-6, 1996 and U.S. Pat. Nos. 5,786,146; 6,017,704; 6,200,756; and 6,265,171, all of which are herein incorporated by reference in their entirety.

[084] Therefore, in one embodiment, the present invention provides a kit to evaluate methylation status from genomic DNA by methylation specific polymerase chain reaction comprising an agent that modifies unmethylated cytosine and primers specific for methylated and unmethylated regulatory region responsible for SMAD8 gene silencing The phrase "regulatory region responsible for SMAD8 gene silencing" as used herein and throughout the specification refers to a promoter region containing CpG islands ofthe SMAD8 which region resides before the coding sequence of SMAD8, also referred to as MADH6 (Watanabe et al., Genomics. 1997 Jun 15;42(3):446-51) or MADH9 (HUGO ID), in the genetic location EnsEMBL 35220321 to 35292902 bp on chromosome 13.

[085] In one embodiment, the kit comprises primers specific for unmethylated regulatory region responsible for SMAD8 gene silencing are S E⁾5-unmethylated- forward primer SEQ ID NO: 38 and S ΛDS-unmethylated-reverse primer SEQ ID NO: 39; and the primers specific for methylated regulatory region responsible for SMAD8 gene silencing are S 4Z)5-methylated- forward primer SEQ ID NO: 40 and SMAD8- methylated-reverse primer SEQ ID NO: 41.

[086] In another embodiment, the invention provides specific MSP (Methylation Specific PCR) primers. Sequences ofthe forward (F) and reverse (R) MSP primers to distinguish between the unmethylated (U) and methylated (M) genomic DNA respectively, used were as follows: 5'-GATGTGAGGTGATTTATGTAGT-3' (SMAD8U-Ε, SEQ ID NO: 38) and 5'-CACAACAACCTACAACTCAATTCCCT-3' (SMAD8O-R, SEQ ID NO: 39), and 5-GACGCGAGGCGATTTACG-3' (SMAD8M- , SEQ ID NO: 40) and 5'-CGACCACGTACGCGAAAACTCGCG-3' (SMAD8M-R, EQ ID NO: 41). These primers were used to evaluate the methylated and unmethylated status ofthe regulatory region responsible for SMAD8 gene silencing at the level of genome using genomic DNA rather than RNA as the test material. Therefore, these primers provide a high throughput tools to determining SMAD8 gene silencing in various diseases.

[087] In yet another embodiment, the invention provides a method of monitoring therapeutic effects of treatment regimes by analyzing the expression levels of homologous gene family members in biological samples taken from an individual treated with therapeutic agents or other therapeutic methods, wherein one or more biological samples are taken from the individual before administration of a treatment regime and consequently during and/or after treatment and comparing the expression levels ofthe homologous gene family members in the samples wherein normalization ofthe expression levels indicates that the treatment regime has had an effect. [088] In one preferred embodiment, the invention provides a method of diagnosing cancer, particularly breast and colon cancer comprising determining Smad8 expression in a biological sample, wherein decrease in Smad8 expression is indicative of cancer. [089] In one embodiment, the invention provides a method for determining the susceptibility of an individual affected with a malignancy to develop bone metastases, comprising an analysis of expression ofthe SMAD family of genes, wherein decrease in Smad8 expression is indicative ofthe individual being susceptible to bone metastases.

EXAMPLES [090] The analysis of Smad genes described herein is an illustrative example of how the method ofthe present invention can be used. Similar analysis may be performed using any number of other homologous gene families. [091] Major breakthroughs in understanding the molecular basis ofthe effects mediated by TGFβ and TGFβ-like cytokines in cancer came from genetic evidence showing inactivation ofthe various players in its signaling cascade. The vast majority of current evidence is derived from the identification of mutations causing structural defects in TGFβ receptors and the Smad4 gene, the central player among the downstream effectors ofthe TGFβ signaling pathway. To date, eight human homologues ofthe Stmad genes have been identified and are classified into three distinct classes based on their structure and biological function (1, 2). The first category consists of pathway-restricted or receptor regulated Smads (R-Smads): Smadl, Smad5 and Smadδ, which are involved in BMP signaling and Smad2 and Smad3 that are TGF β /activin pathway restricted. These Smads are directly phosphorylated by RI receptors upon activation by the RII receptors that are bound to the ligand. Phosphorylated R-Smads interact with the second class of Smads known as the common mediator Smad (Co-Smad) to form a heteromeric complex [3]. Smad4 is the only member of this class of Smads known in mammals. The third class of Smads includes Smad6 and Smad7 which were identified as anti-Smads or inhibitory Smads (I-Smad) due to their ability to act as inhibitors ofthe signaling pathway [4-6].

[092] Because the signaling pathways mediated by the members ofthe transforming growth factor-beta (TGF β) family are implicated in a number of biological processes including cell differentiation, proliferation, determination of cell fate during embryogenesis, cell adhesion, cell death, angiogenesis, metastasis and immunosuppression, it is conceivable that genetic alterations or anomalies in the expression patterns of various Smad molecules could contribute to different aspects of neoplastic progression [2, 7-10].

[093] Although there has been significant progress in elucidating the association between genetic alterations in the Smad4 gene and cancer, the nature of defects involving the other Smads has been elusive, potentially due to alternative mechanisms or targets that result in loss of or altered signaling end effects. The apparent lack of genetic alterations in the majority of Smad genes analyzed thus far in cancer support the epigenetic alterations that underlie these overall abnormalities in signaling could occur at the level of regulation of gene expression or processing ofthe transcripts (11-13). Our analyses ofthe Smad genes suggest that the novel TEGD method described in this article could be effectively exploited in the determination of its modes of inactivation in cancer. The efficient utilization ofthe method described here will find use not only for the discovery of novel members in a family of genes but could also lay the frame work for the analysis of individual genes for modes of altered functionality that originate at the level of transcription in various diseases and during development. [094] The SMAD family of genes has highly homologous amino acid sequences -at its N- and C- terminal regions (MH1 and MH2 respectively), which are separated by a highly divergent linker region rich in proline, serine and threonine (1,2). The examination ofthe MH domains from various Smad genes indicated that some ofthe amino acid residues are absolutely identical and others are conserved, which is consistent with critical structural features required for the functionality of these proteins. The sequence conservation at the amino acid level is also reflected to a larger extent at the DNA level. Despite their similarity at the level ofthe genetic blue print, the Smad proteins are involved in a wide array of cellular functions as they not only play roles as mediators, inhibitors and transcription factors of the Smad signaling pathway but also mediate signaling in response to diverse but related cytokines (TGFβ family). Thus the analysis of defects in any one of these players in this type of family of genes poses a formidable task to any one who would like to efficiently detect them for their role in various diseases with the goals of diagnosis and therapy. However, the fact that the SMAD genes in general contained two distinct highly conserved regions separated by a highly variable intervening liker region suggested to us a novel screening strategy to simultaneously analyze all the members of this family of genes (Figure 1 A). [095] We designed degenerate oligonucleotide primers (forward and reverse) corresponding to the conserved regions ofthe Smad family of genes based on the maintenance of codon degeneracy and the representation ofthe various amino acids at a given position among the known Smads for PCR amplification ofthe cDNA templates. PCR amplification in the presence of radiolabeled nucleotides in the reaction and the analysis ofthe products using a denaturing polyacrylamide gel revealed distinct bands on the gel (Figures 1A and IB).

[096] We recovered these distinct bands corresponding to the PCR products generated using Smad specific degenerate primers and sequenced them. The bands corresponding to the 1200, 960, 840, 680 and 570 base pairs (bp) PCR products were found to be identical to the cDNA sequences for Smad4, Smadl and Smad5, Smad2, Smad3 and Smad8, Smadό and Smad7 respectively, as predicted from their estimated sizes and sequences (Figure IB; 1, 2). These results indicated to us that once the signature pattern ofthe targeted expression gene display is optimized and established such as in this case with the Smad family of genes, repeat analysis of gene expression in tissues or other samples of unknown origin can be easily adapted to a high throughput routine analysis.

[097] First, we decided to confirm the presence or absence of Smad expression determined from TEGD using gene specific primers by semi quantitative RT-PCR (Figure 2). The expression patterns ofthe various Smads detected by TEGD remained. consistent with semi-quantitative PCR. Most ofthe Smads were expressed in all the tissue types that we have analyzed and Smad expression was lost in the liver and at barely detectable levels in the bone marrow and uterus (Figure 2). These results indicated to us that TEGD could be used as a tool for initial diagnostic high throughput evaluations to determine Smad gene expression patterns simultaneously and more efficiently and could be a highly improved alternate method that could substitute for the traditional multiplex PCR technique due to its increased level of sensitivity, ability to discriminate the genes that are closely related at their DNA sequence and the requirement of a low level of template/ starting material.

[098] The ability to simultaneously probe multiple members of a gene family using TEGD allowed us to apply this technique to analyze differential expression patterns of the various Smads in cancer to validate its utility for diagnostic screening of various diseases (Figure 3). We observed that Smad3 and Smad8 expression were consistently lost in significant fractions of colon and breast cancers, respectively. These initial observations were further validated by analyzing the expression patterns ofthe SmadS gene more carefully using gene specific primers by semi quantitative RT-PCR (Figure 4). These results provided the first clues to suggest that the Smad8 gene is a critical target for loss of function due to down regulation of gene expression in 31% of breast and colon cancers (Table 1). We have also established the significance of loss of Smad3 expression in cancer, primarily in colon cancer.

[099] The ability to simultaneously analyze multiple members ofthe Smad family of genes has thus enabled an efficient way to detect altered expression patterns of genes that are closely related at the level of their nucleotide sequence.

[0100] Loss of expression ofthe Smad8 gene was estimated to occur in nearly a third of both breast and colon cancers, which are the leading cause of cancer deaths in women and the second leading cause of cancer deaths in general, respectively. We investigated potential mechanisms for the loss of Smad8 gene expression due to the high level of significance of these alterations compared to known tumor markers. We examined whether genetic alterations such as chromosomal deletions affecting the Smad8 gene could lead to the loss of its expression by homozygous deletion analyses using microsatellite markers corresponding to the Smadδ gene from the genomic contig as well as by genomic PCR using primers that amplified the genomic region corresponding to the first and the last exons ofthe Smad8 gene. Since chromosomal deletions were not the major mechanism for loss of Smad8 expression in the affected cancers, epigenetic silencing of gene expression was examined. The genomic sequence ofthe Smad8 gene was inspected for the presence of CpG islands that may mediate DNA methylation and associated chromatin modification effects for their involvement in silencing of gene expression. Several CpG islands in the upstream promoter as well as the first intronic region ofthe Smad8 gene were tested as likely candidate regions that could be critical for differential DNA methylation patterns that could coincide with the loss of its expression (Figure 5). DNA sequence analysis ofthe bisulfite treated genomic DNA revealed that CpG islands localized to nucleotides 3541028 to 35410583 (chromosome 13) in the first intron ofthe Smad8 gene is only methylated in cancers that exhibited loss of expression (Figure 5A). Methylation specific PCR (MSP) was carried out using primers designed to these corresponding differentially methylated regions and the results further confirmed that the Smad8 gene is silenced in cancers due to DNA hypermethylation affecting CpG islands in the first intron ofthe Smad8 gene (Figure 5B).

Cancer Total # of samples Samples with loss of SMAD8 expression (%)

Breast 35 11/35 (31)

Colon 41 13/41 (31)

Esophagus 4 0/4 (0)

Head & Neck 4 2/4 (50)

Lung 19 1/19 (5)

Ovary 2 1/2 (50)

Pancreas 3 2/3 (65)

Prostate 4 3/4 (75)

Stomach 4 2/4 (50) Table 1 (above): Altered expression of Smad genes in cancers.

[0101] To directly examine the physiological significance of whether a modification to the nucleic acid sequence such as the apparent epigenetic DNA methylation by itself or in combination with histone acetylation deacetylation could be responsible for differential regulation of SMAD8 expression in cancers, we chose five cell lines (HTB129, HT29, CaCo2, CCL253 and MDAMB468) that exhibited Smad8 loss, and one cell line (MDAMB231) which retained SMAD8 expression as a control and examined the effects of 5'-aza-2'-deoxycytidine (5Aza-dC; a DNA demethylating agent) and/or trichostatin A (an inhibitor of histone deacetylases). A substantial increase in Smad8 expression was observed with 5Aza-dC treatment in all ofthe cell lines which were previously determined as exhibiting DNA hypermethylation mediated gene silencing of SMAD8 (Figure 6A). Trichostatin A by itself had little or no effect, however, there was slight up regulation of Smad8 expression in the presence of both drugs (Figure 6A). MSP analysis of SMAD8 regulatory regions with CpG islands that were differentially methylated in affected and control cell lines revealed that demethylation due to 5Aza-dC treatment accompanies a corresponding increase in SMAD8 gene expression (Figure 6B). These observations that strongly support the loss of Smad8 expression in cancers is primarily mediated by hypermethylation of cis-regulatory CpG islands ofthe gene. [0102] The analysis of closely related members of a family of genes to detect and establish differential gene expression patterns as well as the genetic alterations responsible for cancer and other diseases with limited amounts of clinical samples has remained a formidable task. Efficient methods to simultaneously analyze the closely related yet functionally divergent genes belonging to families would not only be important in accurate diagnosis and prognosis ofthe disease but also could be used to exploit pharmacogenetics to customize therapy.

[0103] TEGD technique according to the present invention can be effectively utilized to analyze families of genes that contain at least two stretches of conserved regions, which are separated by a divergent linker region of variable length. [0104] Once a signature pattern ofthe targeted expressed gene display is optimized and established with normal tissues, such as in this case with the Smad family of genes and an array of different tissue types, repeat analysis of gene expression in samples of unknown origin can be easily adapted to a high throughput routine analysis.

[0105] Therefore, we suggest that the TEGD technique can address the dilemma of efficient simultaneous expression pattern analysis of related genes with relatively minute amounts of samples in clinical and investigational research settings. Thus TEGD will advance the ability to probe gene families for genetic and epigenetic defects to the ne:xt level of sophistication and is useful in analyzing the expression patterns of homologous genes in a number of different situations. The exemplifying application ofthe TEGD technique to simultaneously analyze multiple members ofthe Smad family of genes h as not only validated the enormous advantage ofthe method as an initial diagnostic tool but also serves as a prototype to illustrate an efficient way to detect altered expression patterns of genes that are closely related at the level of their nucleotide sequence.

[0106] The signaling pathways mediated by the members ofthe TGFβ family are implicated in a number of biological processes including cell differentiation, proliferation, determination of cell fate during embryogenesis, cell adhesion, cell death, angiogenesis, metastasis and immunosuppression (Figure 7; 1,2). Due to the wide array of functional consequences mediated by its signaling events, TGFβ or TGFβ-like cytokines could impact tumorigenesis by affecting one or a combination ofthe processes affected by their signaling cascades. Major breakthroughs in understanding the molecular basis of the TGFβ-like cytokine mediated effects in cancer came from genetic evidence for inactivation ofthe various players in its signaling cascade (2). The vast majority of current evidence is derived from the identification of mutations causing structural defects in TGFβ receptors and the Smad4 gene in the TGFβ signaling pathway (2, 14-17). Because of the importance of Smad signaling in cancer and the inability to explain the molecular basis ofthe inactivation of Smad signaling events in the majority of cancers, we surveyed the various Smad genes using the novel TEGD technique described in this report (2,18,19). These experiments enabled us to obtain the first clues in identifying the Smad8 gene as an important target for loss of expression in nearly 31% of breast and colon cancers, a level of alteration even more frequent than that for the Smad4 gene, the most frequent target for genetic inactivation ofthe known Smad signaling genes in colon and pancreatic cancers and the HER/neu gene amplification, the most celebrated tumor marker for breast cancer, which occurs in about 20%-30% of breast cancer cases (20). [0107] During early stages of tumor development, loss of TGFβ signaling has been thought to result in the inability to suppress cell-cycle progression and inhibition of tumor growth (1 ,2). In advanced cancers, TGFβ and TGFβ-like cytokines adopt the role of enhancing metastatic spread (2). The Smads are the central players in TGFβ and TGFβ-like cytokine mediated signaling events. Understanding their functional integrity or bioavailability is critical not only for diagnosis and prognosis but also in designing therapeutic strategies for cancer treatment and management. [0108] The data presented in this report provides the first direct evidence that silencing of gene expression via DNA hypermethylation ofthe Smad8 gene appears to be an important event in tumori genesis of several cancers and occurs in one third of breast and colon cancers. It is interesting to note that Smad8 is apparently the major target for loss of function among the Smad genes in breast cancer and is a R-Smad which becomes phosphorylated during BMP signaling events and modulates BMP-responsive genes including those that may affect bone metabolism (21-25; Figure 7). Although metastasis to bone is often associated with advanced stage breast cancer, further studies would be required to understand whether Smad8 signaling defective metastic breast cancer cells could cause an imbalance in the normal bone homeostasis by enhancing osteoclastic activity and osteolytic lesions within the bone (26-29). Alternatively, although inactivation ofthe Smad2 and Smad4 genes due to intrageneic mutations and homozygous deletions has been reported in nearly 20% of colorectal cancers, evidence for genetic or epigenetic inactivation of other Smad gene targets at significant levels remained elusive until this report (30). The loss of expression of Smad8 in nearly 31% of colon cancers is more significant than any other Smad alterations known to date and would require further studies to determine whether the affected cells may play a critical role in tumorigenesis by a mechanism similar to or different from that in breast cancer. Germline mutations in the BMP recepter 1A in juvenile polyposis, which increases risk of developing gastrointestinal cancers also suggest that inactivation of BMP signaling may play a critical role in colon cancer (31 ,32). Despite the fact that the elucidation of BMP mediated signaling pathways in which Smad8 is a critical mediator is still in its infancy, these studies clearly provide the incentive for further investigations that may help gain a better understanding ofthe effects of Smadδ inactivation in cancer and its potential application in diagnosis, prognosis and in the design of therapeutic modalities. [0109] Methods. Cell culture, RNA isolation and cDNA synthesis. Cancef cell lines were purchased from ATCC and Coriell and culture conditions were performed s suggested by the provider. Tumor samples or nucleic acids isolated from the tumors used in this study were obtained from Carol Rosenberg (Boston University School of Medicine), Subra Kugathasan (Medical College of Wisconsin), Christian Weber (Boston University School of Medicine) and Kornelia Polyak (Dana Farber Cancer Institute). RNA isolation and cDNA synthesis from the cell lines and tumor samples were carried out using previously described procedures (30).

[0110] Smad genes degenerate RT-PCR: Based on the amino acid sequences ofthe human Smads 1-8, regions that are identical and conserved among the Smads were mapped out (1 ,2). The forward and reverse primers were designed based on the maintenance of codon degeneracy and the representation ofthe various amino acids at a given position among the known Smad family members.

[0111] All primers were obtained from Integrated DNA Technologies, Coralville, IA. The degenerate primers used for TEGD are as follows: [0112] Degenerate SMAD family specific primers: SmadXF2 5' primer- TNTKBMGVTGGCCNGAYYTBM (SEQ ID NO: 1) and SmadXRl 3' primer- CCAVCCYTTSRCRAARCTBAT (SEQ ID NO: 2)

[0113] A PCR 20 μl reaction mixture contained 67 mM Tris-HCl, pH 8.8, 16.6 mM ammonium sulfate, 6.7 mM magnesium chloride, 10 mM β-mercaptoethanol, 6% dimethyl sulphoxide, 100 μM each of dATP, dGTP, dCTP and dTTP, 0.02 mM (add 0.25 ul of α³²P-dCTP for labeling) each ofthe primers, lμl (50ng) of cDNA template and 0.5 μl of Platinum Taq (Invitrogen). An initial denaturation at 94°C for 2 minutes was followed by 30 cycles, each carried out at 94°C for 30 seconds, 55-60°C for 1 minute, and 70°C for 1 minute and 20 seconds, and one final extension cycle at 70°C for 10 minute.

[01 14] TEGD gel electrophoresis and recovery of DNA bands for further analysis. The smad genes degenerate RT-PCR sample was loaded onto a 4.5% denaturing polyacrylamide gel after a 2 minute denaturation step at 95°C. Electrophoresis was performed using a Genomyx LR machine (Beckman Coulter) for 4.5 hrs at 80 Watts. The gel was dried and autoradiography performed on the gel. DNA bands were cut out ofthe gel and isolated by conventional methods and the fragments were TA cloned (Invitrogen) for use in sequencing reactions. [01 15] DNA sequencing. DNA sequence analysis was performed using the GENOMYX LR machine. ³³P ddNTPs were used along with the ThermoSequanase kit. (USB, Cincinnati, OH).

[01 16] Genomic DNA Isolation. Genomic DNA from cell lines were isolated using the DNeasy Tissue Kit (QIAGEN) following the manufacturer's standard protocol. [01 17] LOH. Radiolabeled markers D13S927 and D13S928 that are closely associated to the Smad8 gene were used in LOH analysis. PCR products were analyzed on an 8% denaturing polyacrylamide gel.

[01 18] Analysis of gene expression using RT-PCR. The total RNA prepared from samples was used for cDNA synthesis and PCR amplification was essentially as described under the previous section. The primer pairs are as follows: Gene Primer sequence Anneal. Major

Temp. product size (bp) S 4Z⁾l F: 5'-CCACTGGAATGCTGTGAGTTTCC-3' 58°C 950

(SEQ ID NO: 3)

R: 5'-GTAAGCTCATAGACTGTCTCAAATCC-3' (SEQ ID NO: 4) SMAD2F: 5'-GGTAAGAACATGTCCATCTTGCC-3' (22) 58°C 950

(SEQ ID NO: 5)

R: 5'-CATGGGACTTGATTGGTGAAGC-3' (22) (SEQ ID NO: 6) S ΛD3 F: 5'-CGGGCCATGGAGCTGTGTGAGTTCG-3' 62°C 700

(SEQ ID NO: 7)

R: 5'-CGGGTCAACTGGTAGACAGCCTC-3' (SEQ ID NO: 8) SMADAF: 5'-GGACAATATGTCTATTACGAATAC-3' (22) 57°C 1720

(SEQ ID NO: 9)

R: 5'-TTTATAAACAGGATTGTATTTTGTAGTCC-3' (22) (SEQ ID NO: 10) S ΛD5F: 5'-GTATCAACCCATACCACTATAAGAG-3' 55°C 1010

(SEQ ID NO: 11)

R: 5'-CAGAGGGGAGCCCATCTGAGTAAG-3' (SEQ ID NO: 12) S 4 r5F: 5'-CGACTTTGGCGAAGTCGTGTG-3' 60°C 1130

(SEQ ID NO: 42)

R: 5'-GGATGCCGAAGCCGATCTTGC-3' (SEQ ID NO: 43) ΛD7F: 5'-GGTGCGAGGTGCCAAATGTCACC-3' 58°C 910

(SEQ ID NO: 13)

R: 5'-GATGAACTGGCGGGTGTAGCAC-3' (SEQ ID NO: 14) SMADSΕ: 5'-CTCTTATGCACTCCACCACCCCCATC-3' 58°C 980 (SEQ ID NO: 15)

R: 5'-CTTAAGACATGACTGTTAAGACACTG-3' (SEQ ID NO: 16) β-Actin F: 5'-ACACTGTGCCCATCTACGAGG-3' 60°C 600

(SEQ ID NO: 17) R: 5'-AGGGGCCGGACTCGTCATACT-3' (SEQ ID NO: 18)

[0119] Analysis of the Methylation Status of the Smad8 5'CpG Region. For the

MSP assay, genomic DNA was obtained from cell lines and primary tumors using the QIAGEN DNeasy Tissue Kit. Genomic DNA was modified with sodium bisulfite according to previously described methods (33). Denatured DNA was modified by treatment with 30μl of freshly prepared lOmM hydroquinone and 520μl of 3M sodium bisulfite, pH5.0 (Sigma- Aldrich Chemie GmbH), which converts unmethylated cytosines to uracil but does not change methylated cytosines. Each reaction was overlaid with mineral oil and incubated at 50° C for 16-20 hours. The modified DNA was purified using a Wizard DNA purification kit (Promega, Madison, Wisconsin), treated with 11 μl of 3M NaOH to desulfonate and precipitated with ethanol.

[0120] Bisulfite sequencing. Genomic sequencing of bisulfite modified DNA was accomplished using ³ P ddNTPs and the ThermoSequanase kit( USB, Cincinnati, OH). Bisulfite modified DNA (50-1 OOng) was amplified with the Smad8 gene specific primers: 5' primer-gaaatatgtgagg-aatagtagtttag (SEQ ID NO: 19) and 3' primer- ccactcatccctcccccacccaaatc (SEQ ID NO: 20)

[0121] Methylation-Specic PCR (MSP). The methylation status of the smad8 promoter region was also analyzed by MSP, with the use of primers designed for either unmethylated or methylated DNA sequences. Sequences of the forward (F) and reverse (R) MSP primers for methylated (M) and unmethylated (U) were as follows: 5_gatgtgaggtga-tttatgtagt-3_ (Smad8U-F, SEQ ID NO: 21)) and 5_- cacaacaacctacaactcaattccct-3_ (Smad8U-R, SEQ ID NO: 22), and 5_- gacgcgaggcgatttacg-3_ (Smad8M-F, SEQ ID NO: 23) and 5_-cgaccacgtacgcg- aaaactcgcg-3_ (Smad8M-R, SEQ ID NO: 24). PCR conditions were: 94°C for 2 min, 35 cycles of 94°C for 30 sec, 58°C for 30 sec, 70°C for 40 sec, followed by a final extension at 70°C for 10 min. A l OμL sample of each PCR product was mixed with 1 X loading buffer and loaded onto a nondenaturing 8% polyacrylamide gel and visualized by staining with ethidium bromide. [0122] 5'-Aza-2' deoxycytidine Treatment. HTB129, MDAMB468, MDAMB231, CaCo2, CCL253, CCL230, HT29 cells were incubated in culture medium with and without 5'-Aza-2' deoxycytidine (Sigma) at a concentration of 1-5 μm for 7 days or with 0.3 mM trichostatin A (TSA) for 24hrs.

[0123] To assess the effect of a combination of 5'-Aza-2' deoxycytidine and TSA, cells were exposed sequentially for 7 days to 5'-Aza-2' deoxycytidine and then to 0.3 mM TSA for an additional 24 hrs. Total RNA was isolated and Smad8 expression was determined by RT-PCR.

REFERENCES

[0124] The reference cited herein and throughout the specification are herein incorporated by reference in their entirety.

1. Massague J. TGF-beta signal transduction. Annu. Rev. Biochem 1998, 67,753-791.

2. Thiagalingam, S., K-h.Cheng, R. L. Foy, H. J. Lee, D. Chinnappan, and J. F. Ponte. 20O2. TGF-β and its Smad connection to cancer. Current Genomics 3: 449-476.

3. Abdollah S, Macias-Silva M, Tsukazaki T, Hayashi H, Attisano L, Wrana JL. TbetaRI phosphorylation of Smad2 on Ser465 and Ser467 is required for Smad2-Smad4 complex formation and signaling. J Biol Chem 1997, 272(44):27678-85.

4. Nakao A, Afrakhte M, Moren A, Nakayama T, Christian JL, Heuchel R, Itoh S, Kawabata M, Heldin NE, Heldin CH, ten Dijke P . 1997. Identification of Smad7, a TGFbeta- inducible antagonist of TGF-beta signalling. Nature 389, 631-635.

5. Imamura T, Takase M, Nishihara A, Oeda E, Hanai J, Kawabata M, Miyazono K. Smad6 inhibits signalling by the TGF-beta superfamily. Nature 1997, 389(6651):622-6.

6. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell BW, Richardson MA, Topper JN, Gimbrone MA Jr, Wrana JL, Falb D. The MAD-related protein Smad7 associates with the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 1997, 89(7): 1165-73.

7. Massague J, Wotton D. Transcriptional control by the TGF-beta/Smad signaling system. EMBO J 2000, 19(8):1745-54.

8. de Caestecker MP, Piek E, Roberts AB. Role of transforming growth factor-beta signaling in cancer. J Natl Cancer Inst 2000, 92(17): 1388-402.

9. Massague J, Blain SW, Lo RS. TGF-beta signaling in growth control, cancer, and heritable disorders. Cell 2000, 103(2):295-309.

10. Letterio JJ. Roberts AB. Regulation of immune responses by TGF-beta. Annu Rev Immunol. 1998, 16:137-61. 1 1. Thiagalingam, S., K-h.Cheng, H. J. Lee, N. Mineva, and J. F. Ponte. 2003. Histone deacetylases: Unique players in shaping the epigenetic histone code, Annal. New York Acad. Sci. 983: (In Press).

12. Baylin SB. 1997. Tying it all together: epigenetics, genetics, cell cycle, and cancer. Science 277:1948-1949.

13. Jones, P. A., and P. W. Laird. 1999. Cancer epigenetics comes of age. Nat. Genet. 21: 163- 167.

14. Markowitz, S., J. Wang, L. Myeroff, R. Parsons, L. Sun, J. Lutterbaugh, R. S. Fan, E. Zborowska, K.W. Kinzler. B. Vogestein and J.K.V. Wilson 1995. Inactivation of the type II TGF-β receptor in colon cancer cells with microsatellite instability. Science 268: 1336- 1338.

15. Thiagalingam, S., C. Lengauer, F. S. Leach, M. Schutte, S. A. Hahn, J. Overhauser, J. K. V. Willson, S. Markowitz, S. R. Hamilton, S. E. Kem, K. W. Kinzler and B. Vogelstein. 1996. Evaluation of candidate rumour suppressor genes on chromosome 18 in colorectal cancers. Nature Genet. 13: 343-346.

16. Eppert, K., S. W. Scherer , H. Ozcelik, R. Pirone, P.Hoodless, H. Kim, L.-C. Tsui, B. Bapat, S.Gallinger, I. L. Andrulis, G. H. Thomsen, J. L. Wrana, and L. Attisano.1996. MADR2 maps to 18q21 and encodes a TGF-β regulated MAD related protein that is mutated in colorectal carcinoma. Cell 86: 543-552.

17. Riggins, J. G., S. Thiagalingam, E. Rozenblum, C. L. Weinstein, S. E. Kern, S. R. Hamilton, J. K. V. Willson, S. Markowitz, K. W. Kinzler and B. Vogelstein. 1996. MAD- related genes in the human. Nature Genet. 13: 347-349.

18. Schutte M, Hruban RH, Hedrick L, Cho KR, Νadasdy GM, Weinstein CL, Bova GS, Isaacs WB, Cairns P, Νawroz H, Sidransky D, Casero RA. Jr, Meltzer PS, Hahn SA, Kern SE. 1996. DPC4 gene in various tumor types. Cancer Res. 56: 2527-2530.

19. Riggins, J. G., K. W. Kinzler, B. Vogelstein and S. Thiagalingam. 1997. Frequency of Smad gene mutations in human cancers. Cancer Res. 57: 2578-2580.

20. Zujewski, J.A. 2002. "Build Quality in"-HER2 Testing in the Real World. JNatl Cancer Inst. 94: 788-789.

21. Hogan, B.L.M. 1996. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10:1580-1594.

22. Hogan, B.L.M. 1999. Morphogenesis. Cell 96:225-233

23. Massague, J., and Y. G. Chen 2000. Controlling TGF-beta signaling. Genes Dev. 14:627- 644.

24. Attisano, L., and J. L. Wrana 2000. Smads as transcriptional co-modulators. Curr Opin Cell Biol. 12:235-243. 25. Miyazono K, Kusanagi K, Inoue H. 2001. Divergence and convergence of TGF-beta/BlMP signaling. J Cell Physiol. 187:265-76.

26. Coleman RE, Smith P, Rubens RD. 1998. Clinical course and prognostic factors following bone recurrence from breast cancer Br J Cancer. 77:336-340.

27. Coleman RE, Rubens RD. 1987. The clinical course of bone metastases from breast cancer. Br J Cancer. 55:61-66.

28. Reddi AH, Roodman D, Freeman C, Mohla S. 2003. Mechanisms of tumor metastasis to the bone: challenges and opportunities. J. Bone Miner Res. 18:190-194.

29. Reddi AH 1998. Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat. Biotechnol. 16:247-252.

30. Thiagalingam, S. 2001. Molecular detection of Smad4/Smad2 alterations in colorectal tumors: Colorectal Cancer Methods and Protocols. In Methods in Molecular Medicine. S. M. Powell (Ed) Humana Press Inc., New Jersey, 50: 149-165.

31. Howe JR, Bair JL, Sayed MG, Anderson ME, Mitros FA, Petersen GM, Velculescu VE, Traverso G, Vogelstein B. 2001. Germline mutations of the gene encoding bone morphogenetic protein receptor 1A in juvenile polyposis. Nat Genet. 28:184-187.

32. Sayed MG, Ahmed AF, Ringold JR, Anderson ME, Bair JL, Mitros FA, Lynch HT, Tinley ST, Petersen GM, Giardiello FM, Vogelstein B, Howe JR. 2002. Germline SMAD4 or BMPR1A mutations and phenotype of juvenile polyposis. Ann. Surg. Oncol. 9:901-906.

33. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin B. D., and S. B. Baylin.1996. Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826.

.17.

Claims

CLAIMS We claim:

1. A method of determining an expression pattern of gene family members and their variants in a test biological sample comprising the steps of a) amplifying the nucleic acids from a biological sample using at least one degenerate oligonucleotide primer pair, wherein the primers are capable of amplifying at least one fragment of a target gene family members, wherein the fragment contains two regions of homology between family members separated by a divergent region of variable sequence between family members, and wherein the primers are designed to anneal to at least two homologous nucleic acid regions encoding the homologous amino acid region among the target gene family members and wherein the two homologous regions are separated by the divergent region of variable sequence; and b) analyzing the amplified nucleic acids, wherein the amount and number of the amplification products represents a characteristic expression pattern ofthe target gene family members in the biological sample.

2. The method of claim 1, wherein the variable sequence varies in length and the analysis ofthe amplified nucleic acids in step b) is based on analysis ofthe length ofthe amplification products.

3. The method of claim 1, wherein the variable sequence varies in nucleic acid sequence and the analysis ofthe amplified nucleic acids in step b) is based on analysis of the sequence ofthe amplification products.

4. The method of claim 1 , wherein more than one degenerate oligonucleotide primer pair is designed each primer pair capable of amplifying a different gene family.

5. The method of claim 1 , wherein the target gene family is a Smad gene family.

6. The method of claim 5, wherein the primers are SEQ ID NO:l and SEQ ID NO:2.

7. A method of diagnosing a disease or condition and/or susceptibility to develop a disease or a condition comprising the steps of: a) amplifying and analyzing nucleic acids in a biological sample obtained from a subject wherein the amplification is performed using at least one pair of degenerate primers, wherein the degenerate primers are designed so that they are capable of amplifying all members of at least one target gene family associated with the disease or condition and/or susceptibility to develop the disease or condition, the primers conesponding to one or more conserved nucleic acid regions among the at least one target gene family thereby obtaining an expression pattern ofthe target gene family in the individual wherein the number and/or the amount ofthe amplified fragments indicates the presence and/or absence of gene family members and/or the amount of each gene family member expression in the biological sample; and b) comparing the expression pattern ofthe target gene family to a control biological sample, wherein alteration in the expression pattern in the biological sample from the individual compared to a control biological sample is indicative of a disease.

8. The method of claim 7, wherein the disease is cancer.

9. The method of claim 8, wherein the disease is bone metastasis resulting from cancer.

10. The method of claim 7 or 8, wherein the target gene family is human SMAD gene family.

11. The method of claim 10, wherein the alteration is a decrease in the SMAD8 gene expression.

12. The method of claim 7 or 8, wherein the target family is human type-1 epidermal growth factor receptor family.

13. The method of claim 7 or 8, wherein the target family is human retinoblastoma gene family.

14. A kit for producing an expression profile comprising at least two transcripts encoding homologous gene family members comprising at least one degenerate primer pair designed to anneal to nucleic acid regions in the gene families encoding homologous domains, wherein the homologous domains are separated by a variable sequence.

15. The kit of claim 12, wherein the kit comprises more than one primer pair, each pair designed to amplify a different homologous gene family.

16. The kit of claim 14, wherein the degenerate primer pair is designed to amplify human SMAD gene family.

17. The kit of claim 14, wherein the degenerate primer pair is designed to amplify human type-1 epidermal growth factor gene family.

18. The kit of claim 14, wherein the degenerate primer pair is designed to amplify human retinoblastoma gene family.

19. The kit of claim 12, wherein the degenerate primers are selected from the group consisting of human SMAD gene family, human type-1 epidermal growth factor gene family and human retinoblastoma gene family or a combination of thereof.

20. A kit to evaluate methylation status from genomic DNA by methylation specific polymerase chain reaction comprising an agent that modifies unmethylated cytosine and PCR-primers specific for methylated and unmethylated regulatory region responsible for SMAD gene silencing.

21. The kit of claim 20, wherein the SMAD gene is SMAD8.

22. The kit of claim 21 , wherein the PCR-primers specific for unmethylated regulatory region responsible for SMAD8 gene silencing are S 4Z)5-unmethylated- forward primer SEQ ID NO: 38 and SM DS-unmethylated-reverse primer SEQ ID NO: 39; and the primers specific for methylated regulatory region responsible for SMAD8 gene silencing are S rS-methylated-forward primer SEQ ID NO: 40 and SMAD8- methylated-reverse primer SEQ ID NO: 41.