WO2004087753A1 - Mutein of human interferon-beta and its preparation method - Google Patents

Abstract

The present invention provides a mutein of human interferon-beta of which one or two sugar chain is added according to the artificial mutagenesis of 110, 117 and/or 137 amino acid of natural human interferon-beta. More particularly, the present invention provides a mutein of human interferon-beta having enhanced antiviral activity and half-life, which is expressed through animal cell according to the artificial replacement of 110, 117 and/or 137 amino acid into asparagine to add one or two sugar chain; a gene for encoding such mutein of interferon-beta; and a preparation method thereof.

Description

MUTEIN OF HUMAN INTERFERON-BETA AND ITS PREPARATION

METHOD

TECHNICAL FIELD

The present invention provides a mutein of human interferon-beta in which one or two sugar chain is added according to the artificial mutagenesis of 110, 117 and/ or 137 amino acid of natural human interferon-beta. More particularly, the present invention provides a mutein of human interferon-beta having enhanced antiviral activity and half-life, which is expressed through animal cell to have additional one or two sugar chain according to the artificial replacement of 110, 117 and/ or 137 amino acid into asparagine; a gene for encoding such mutein of interferon-beta; and a preparation method thereof.

BACKGROUND ART

Interferons are one of major cytokines which show the antiviral activity, the suppression of cell growth and the modulation of immune response (Baron et al. JAMA 266: p 1375, 1991). Among them, interferon-beta (IFN-β) is a globular protein consisting of 5 alpha helixes with its molecular weight of 25 kD, which reduces to 20 kD without sugar chains (Arduini et al. Protein Science 8: pp 1867-1877, 1999).

The double strand RNA which won't be created in normal cells will be produced if the cells are infected by virus, which is a signal inducing the synthesis of IFN-β (Jane way et al. Immunobiolo y : The immune system in health and disease. 4th ed. New York: Elsevier Science/ Garland Publishing, pp 385-386, 1999). The signal transduction pathway of IFN-β is initiated as the IFN-β combines with its receptor, which exists in the heterodimer made up of two polypeptides with their sizes of 550 amino acids and 487 amino acids (Russell-Harde et al. Biochemical and Biophysical Research Communications 255: pp 539-544, 1999). Then, phosphorylated receptor is combined with STAT2, and STAT2 forms dimer to activate the transcription of various genes at the nucleus (Arduini et al. Protein Science 8: pp 1867-1877, 1999).

IFN-β can facilitate recognition of the virus infected cell by CD7 cell, which increases the apoptosis of virus infected cell (Janeway et al Immunobiology: The immune system in health and disease. 4th ed. New York: Elsevier Science/ Garland Publishing. pp 385-386, 1999). Especially, in the presence of double strand RNA induced by virus infection, elF2 is inactivated by dsRNA dependent kinase and the synthesis of protein is suppressed (Biron et al. Seminars in Immunology 10: pp 383-390, 1998).

Recently, the research for clinical application of IFN-β is actively carried out. Particularly, IFN-β has been applied for relieving or treating the multiple sclerosis, which occurs in central nervous system, especially, brain or spine, as auto-immune disease caused by the mechanism that T cells attack the neuron cells of central nervous system as exogenous cells (Goodkin et al. Multiple sclerosis: Treatment options for patients with relapsing-remitting and secondary progressive multiple sclerosis, 1999).

Even though the suppression mechanism of multiple sclerosis has not been disclosed precisely, this auto-immune disease can be relieved by recovery of suppressive T cells (Dayal et al. All- trans retinoic acid potentiates the ability of interferon beta-lb, 1998). On the other hand, this disease can be relieved by suppression of enzyme formation related to the synthesis of nitiric oxide, as one of major factors for causing multiple sclerosis (Hua et al. Beta inteferon prevents nitric oxide/ peroxynitrate from damaging the central nervous system, 1998.) IFN-β is the first treatment for multiple sclerosis, which was approved by FDA on 1993 (Revelle M 1993 07 Sept. FDA licenses interferon beta-lb).

The approved IFN-β lb has been produced in E. coli by recombinant DNA technology to have no sugar chains (Arduini et al. Protein Science 8: pp 1867-1877, 1999). This product has been commercially marketed as trade name 'Betaseron' which is the unique drug for treating multiple sclerosis.

The second drug approved by FDA on 1996 for treating multiple sclerosis is IFN-β la produced and expressed from Chinese Hamster Ovary Cell, which is very similar to the natural human interferon-beta (HnlFN-β) due to its sugar chains. This drug has been marketed as trade name 'Avonex' by Biogen (Goodkin et al. Multiple sclerosis: Treatment options for patients with relapsing-remitting and secondary progressive multiple sclerosis, 1999).

The latest approved product by FDA is trade name 'Rebif manufactured by Serono Co. Even though this drug 'Rebif has the same IFN-β gene as 'Avonex', 'Rebif could be approved as a new drug due to the differences of preparation form, dosage, frequency and the efficacy for relieving disease (J. Biotechnol. 87: pp 279-284, 2001). Interferon-beta can be applied for the treatment of cancer, auto-immune disease and virus infection as well as multiple sclerosis, because it has antiviral activity, cell growth inhibiting and proliferative activity and also can boost the immune system's anticancer function by stimulating NK cells, cytotoxic T cells, and macrophages(Cirelli et al. 1995 Major therapeutic uses of interferons. Clin Immunother 3: pp 27-87). Further, recent researches show that IFN-β is effective to treatment of HIV, hepatitis C infection (Pilling et al. European Journal of Immunology 29: pp 1041-1050, 1999) as well as rheumatoid arthritis, one of auto-immune diseases (Young et al. Neurology 51: pp 682-689, 1998).

The present invention relates to a mutein of IFN-β having enhanced in vivo activity for treating multiple sclerosis. More particularly, this invention relates to a mutein of IFN-β having longer half-life by adding one or two sugar chain to the polypeptide of IFN-β.

In vivo activity of IFN-β depends on the in vivo half -life. It has been known that in vivo half-life of glycoprotein is related to the contents of sialic acid located at the terminus of sugar chain. Therefore, in vivo activity of IFN-β is influenced by the existence of sugar chain. Because the addition and structure of sugar chain depends on the host cell, specific host cell will be required to the specific formation of sugar chain to the glycoprotein.

Bacteria, for example, £. coli, has been disclosed that sugar chain can not be added to polypeptide. Even though FN-β expressed from E. coli which doesn't have sugar chain shows in vitro activity excellent, it shall be eliminated rapidly in the human body due to the absence of sugar chain. Therefore, the existence of sugar chain has a key role of IFN-β activity by extending the half -life of IFN-β.

To enhance the activity of natural IFN-β, following 4 approaches have been researched.

Major approach can be accomplished by replacing some amino acids of natural IFN-β gene by mutagenesis. . For example, immune response corresponding to peptide stretch of recombinant human IFN-β having C17S has been examined (Redlich et al., Proc. Natl. Acad. Sci., USA, Vol.88, pp.4040-4044, 1991). The increase of sugar contents of erythropoietin (EPO) by mutagenesis has been disclosed to enhance the half-life (PCT pamphlet No. W095/ 005465).

Amgen Co. has developed hTPO analogues by deleting the C-terminus amino acids to the natural hTPO; hTP0151 (amino acid 1-151) or by adding new amino acids after deleting C-terminus amino acid; hTP0174 (amino acid 1-174). On the other hand, new analogue has been developed by adding methionine-lysine to N- terminus of hTP0163. However, these analogues showed lower in vivo activity compared to natural hTPO, while these analogues maintain in vitro activity (PCT pamphlet No. W095/ 026746).

The second approach is to develop an analogue by adding polyethylene glycol (hereinafter 'PEG') to hTPO like Amgen's hTP0163-PEG (PCT pamphlet No. W095/ 026746, Compositions and methods for stimulating magakaryocyte growth and differentiation, U.S. Pat. No. 5,795,569 Mono-pegylated proteins that megakaryocyte growth and differentiation). However, such analogues showed the decline of stability in the body, because C-terminus having a key role for hTPO stability is deleted. Further, these analogues can be easily exposed from immune response system in the human body due to the change of protein folding. Therefore, these analogues have drawbacks of the decline of stability and the problem of expression. Moreover, the quality problem can occur because PEG cannot be combined in a constant ratio when it is added to hTPO fraction. On the other hand, the specific glycosylation pattern of IFN-β and its preparation method have been reported (European Patent Publication No. 287075 Al, Process for the construction of an animal cell line for the production of human beta-interferon).

Many references disclosed the configuration change of polypeptide by polymer conjugation or glycosylation. U.S. Pat. No. 4,904,584

'Site-specific homogeneous modification of polypeptides' disclosed the polypeptide in which at least one of lysine is deleted or replaced by other amino acid with addition of PEG. PCT pamphlet No. W099/ 067291 'Site specific protein modification by mutagenesis' disclosed the method of conjugating protein with PEG, wherein PEG is contacted with protein in the appropriate condition for conjugation. PCT pamphlet No.

W099/ 003887 'Derivatives of growth hormone and related proteins' disclosed the PEG analogue of growth hormone, wherein cysteine residue is replaced by non-essential amino acid in the polypeptide. In this disclosure, IFN-β is regarded as one of related proteins belonged to growth hormone superfamily.

PCT pamphlet No. WO00/ 023114 'Polymer conjugates of interferon beta-lA and their uses' disclosed the IFN-β glycosylated and PEG-lated. U.S. Pat. No. 5,218,092 'Modified granulocyte-colony stimulating factor polypeptide with added carbohydrate chains' disclosed the modification of granulocyte-colony stimulating factor by introducing carbohydrate chain to enhance the activity. In this disclosure, IFN-β was indicated as one of polypeptides, which can be modified by the method disclosed in U.S. Pat. No. 5,218,092.

The third approach is to enhance IFN-β activity by introducing sugar chain to the protein. Generally, most of proteins are present in the form of glycoprotein. This sugar chains is linked to the specific site of amino acid sequence and the kinds of sugar chains can be classified into two groups. O-linked sugar chains are added to oxygen sites of serine or threonine and N-linked sugar chains are added to amide of asparagine sites having the sequence asparagine-X-serine/theronine (X is any amino acid except proline) in the polypeptide. It has been known that sugar chains of glycoprotein influence the physical, chemical and/ or biological properties of protein, especially, in vivo biological and pharmaco-kinetic properties (Jenkins et al., Nature Biotechnological., 14: pp 975-981, 1996); Liu et al., Act. TIBTECK, 10: pp 114-120 , 1992). As an example, in the case of human interferon-Y and glucose transport protein, it was reported that the biological activity of this protein declines obviously, unless sugar chains are introduced by replacing asparagine into other amino acid not to add sugar chain (Sareneva et al, Biochemical 303: pp 831-840, 1994; Asano et al, FEBS, 324: pp 258-261, 1993). Using this method, Amgen Co. developed hTPO analogue having enhanced activity by introducing at least one additional N-linked sugar chain. For the production of this hTPO analogue, the specific base of cDNA for expressing hTPO was mutated to have the amino acid sequence of asparagine-X-serine/theronine (X is any amino acid except proline) in 174 amino acids to introduce sugar chain (PCT pamphlet No. WO96/025498, MPL ligand analogs). However, the introduction of additional sugar chain does not always enhance the biological activity of protein. This fact was confirmed by Amgen's reference and Korea Research Institute of Bioscience and Biotechnology's reference (PCT pamphlet No. W096/ 25498; Park et al., T. Biol. Chem., 273: pp 256-261, 1998). In these references, it was reported that the biological activity of analogue where sugar chain is added to protein declined compared to that of natural type protein. Therefore, in order to enhance the biological activity, what is important is not a number of additional sugar chains to the protein, but a site where sugar chain is added. In U.S. Pat. No. 5,618,698 'Production of erythropoietin', it has been disclosed that at least one additional sugar chain to EPO enhances the in vivo biological activity due to the increased half-life.

The fourth approach is to develop a fusion protein. As an example, it was reported that formation of the dimer of EPO had been tried to enhance the half-life in the body (A.J. Sytkowski et al, J. Biol. Chem. vol. 274, No. 35, pp 24773-24778). In other report, in order to increase the contents of sugar, especially, sialic acid, new amino acid, peptide or protein fragment was fused with EPO molecule to enhance the in vivo activity. However, the use of amino acid, peptide or protein fragment for fusion protein can be applied in a limited manner, because this modification through fusion causes the decline of original activity as well as the increase of antigenicity. Fusion protein or chimeric protein has been researched for other proteins except IFN-β. As an example of well known fusion protein, follicle stimulating hormone, as one of female hormones has been disclosed (Furuhashi et al, 1995, Mol. Endocrinol.).

Various methods have been disclosed for analysing the IFN-β activity. Examples of useful methods can be described as follows. i ) Antiviral analysis method, for example, CPE (U.S. Pat. No. 5,545,723 'Muteins of interferon-beta' and U.S. Pat. No. 4,914,033 'Structure and properties of modified interferons'); ϋ ) binding with receptor (U.S. Pat. No. 5,545,723; ST AT activation); in) activation of IFN-β2 responsive gene (activation of interferon-stimulating response element (ISRE) linked with reporter gene such as lucif erase); iv) phosphorlyation of receptor type I ; v ) anti-proliferation (U.S. Pat. No. 4,914,033, evaluation of suppression by IFN-β2 as to replication of cell lines); vi) immune-regulation (U.S. Pat. No. 4,914,033, cytotoxicity, Noronha et al., T. Neuroimmunol., 46: pp 145-154, 1993); vii) suppression of IFN-Y by T-lymphocyte; viii) experimental allergic encephalomyelitis (Louboutin et al., Acta Neurol. Scand., 88: pp 97-99, 1993, Rott et al., Eur. T. Immunol., 23: pp 1745-1751, 1993).

Among above techniques, the present invention uses the method for introducing additional sugar chain to the specific site of protein to enhance the activity, according to the teaching of U.S. Pat. No. 5,618,698, in which at least one sugar chain is introduced to EPO.

DISCLOSURE OF INVENTION

The object of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said mutein of human interferon-beta is prepared by the steps comprising i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ϋ ) expressing said artificially mutated cDNA in animal cell; and iϋ) obtaining said mutein of human interferon-beta having additional one or two sugar chain.

The preferred embodiment of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to replace 110th site of aspartate (DUO) and/ or 137th site of glutamate (E137) by asparagine (D110N, E137N, D110N-E137N) in 166 natural human interferon-beta.

Another embodiment of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to have one further replacement of amino acid selected from the group consisting of 72th site of glutamine (Q72), 73th site of aspartate (D73), 75th site of serine (S75) and 116th site of leucine (L116) by asparagine (N).

The further object of the present invention is to provide a mutated cDNA clone expressing a mutein of human interferon-beta, wherein said cDNA clone is artificially mutated to have one or two AAT sequence at asparagine (N) transcription sites, where natural transcription sites are selected from group consisting of 110th site of aspartate (GAT), 117th site of methionine (ATG) and 137th site of glutamate (GAG) in natural human interferon-beta cDNA sequence of SEQ ID NO: 2. Further, the present invention also provides a method for preparing a mutein of human interferon-beta in which additional one or two sugar chain is added, comprising the steps of: i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ii ) expressing said artificially mutated cDNA in animal cell such as CHO cell; and iii) obtaining said mutein of human interferon-beta having additional one or two sugar chain.

The present invention also provides a pharmaceutical composition comprising a mutein of human interferon-beta as active ingredient and other diluent, adjuvant, and carrier.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG 1 shows the cDNA sequence and amino acid sequence of human interferon-beta. The parts indicated by '*' (6,10,11,16,56,67,

74,88,98,155,159,160 amino acid) show the helix turn of three-dimensional structure of interferon-beta. The parts indicated by '**' (27,39,92,142 amino acid) show the important sites for receptor binding and activity. The sites indicated by '!' (72,73 amino acid) show the antiviral activity sites.

FIG 2 shows a process for introducing Asn-X-Ser/Thr (N-X-S/T) sequence at desired place using site-directed mutagenesis method. The first step shows the synthesis of substituted gene by PCR using specific primer set. The second step shows the transformation of E. coli using methylated interferon-beta gene as template and digesting with Dpn I in the PCR reacting solution containing synthesized interferon-beta gene.

FIG 3 shows the cloning process of expression vector pcDNA3.1-IFN~β in order to express mutein of interferon-beta.

FIG 4 shows the co-transfection process of expression vector pcDNA3.1-IFN~β and vector ρSP72-DHFR in order to insert it into animal cell.

FIG 5 shows the Western Blot picture after electrophoresis of mutein of interferon-beta expressed by COS cell. An anti-human IFN-β monoclonal antibody is used as the primary antibody and a rabbit anti-mouse IgG antibody conjugated HRP (Zymed) is used as the secondary antibody.

FIG 6 shows the Western Blot picture after cleavage with N-glycanase and electrophoresis of mutein of interferon-beta expressed by COS cell. An anti-human IFN-β monoclonal antibody is used as the primary antibody and a rabbit anti-mouse IgG antibody conjugated HRP (Zymed) is used as the secondary antibody.

FIG 7 shows the Western Blot picture indicating the degree of cleavage (at the time of cleavage, 10 minutes after cleavage, 30 minute after cleavage, 3 hours after cleavage, 8 hours after cleavage, 16 hours after cleavage) with N-glycanase to mutein of interferon-beta (N-2) expressed by CHO cell. FIG 8 shows SDS-PAGE and Western Blot picture of mutein of interferon-beta purified from CHO cell culture soup.

FIG 9 shows the Isoelectric focusing gel electrophoresis according to Western Blot as to mutein of interferon-beta expressed by CHO cell and natural type interferon-beta to identify the distribution of isoform of protein.

FIG 10 shows HPLC data, which is prepared by the steps of i ) cleaving a mutein of interferon-beta expressed by CHO cell and natural interferon-beta with Lysyl endoproteinase; ii ) reducing them with DTT; iii) alkylation of obtained material with Iodoacetamide (Sigma); and iv) cleaving the sugar chain with PNGase F and analyzing them with Reverse phase C18 column. A) the natural interferon-beta B) a mutein of interferon-beta (N-2), C) a mutein of interferon-beta (N-20).

FIG 11 shows the comparison of antiviral activity by muteins of interferon-beta expressed by CHO cell and natural interferon-beta.

FIG 12 shows the anti-proliferation effect by muteins of interferon-beta expressed by CHO cell and natural interferon-beta.

FIG 13 shows the immune-enhanced property by muteins of interferon-beta expressed by CHO cell and natural interferon-beta by measuring the activation of MHC class I in A549 cell.

FIG 14 shows the plasma concentration of interferon-beta (muteins of interferon-beta expressed by CHO cell and natural interferon-beta) in rats at time interval. BEST MODE FOR CARRYING OUT THE INVENTION

We would explain the mutein of human interferon-beta as follows.

1. Isolation of mutated gene for coding the mutein of interferon-beta

The gene for mutein of interferon-beta is prepared by site-directed mutagenesis in order to introduce Asn-X-Ser/Thr (N-X-S/T) sequence in natural interferon-beta amino acid sequence, so that additional sugar chain can be added. One or two site selected from the group consisting of Q72, D73, S75, DUO, L116, M117, and E137 of human interferon-beta amino acid sequence (SEQ ID NO: 1)(FIG 1) is artificially replaced by asparagine. To obtain mutated gene, primer set is prepared for overlapping PCR as to the mutated site. As shown in FIG 2, overlapping PCR is carried out using overlapping primer set and Pfu-turbo DNA polymerase with plasmid pGEM-T Easy vector (Promega, USA) containing interferon-beta gene as template. Followings are primer sets for overlapping PCR obtaining interferon-beta mutated gene. Only one overlapping PCR is required for replacing one nucleotide in interferon-beta gene. However, two overlapping PCRs are required for replacing two nucleotides in interferon-beta gene.

i ) Primer-set for preparing mutated interferon-beta gene (Q72N) 1st sense primer :

CTTTGCTATTTTCAGAAAAGATTCATCTAGCACTG (SEQ ID NO: 3) 1st antisense priemr :

CAGTGCTAGATGAATCTTTTCTGAAAATAGCAAAG (SEQ ID NO: 4) 2nd sense primer : CTTTGCTATTTTCAGAAATGATTCATCTAGCACTG (SEQ ID NO: 5)

2nd antisense primer :

CAGTGCTAGATGAATCATTTCTGAAAATAGCAAAG (SEQ ID NO: 6) ii ) Primer-set for preparing mutated interferon-beta gene (D73N) sense primer :

GCTATTTTCAGACAAAATTCATCTAGCACTGGC (SEQ ID NO: 7) antisense primer :

GCCAGTGCTAGAGAATTTTGTCTGAAAATAGC (SEQ ID NO: 8) iii) Primer-set for preparing mutated interferon-beta gene (S75N)

1st sense primer :

GCTATTTTCAGACAAAATTCATCTAGCACTGGC (SEQ ID NO: 9)

1st antisense primer :

GCCAGTGCTAGATGAATTTTGTCTGAAAATAGC (SEQ ID NO: 10)

2nd sense primer :

CAGACAAGATTCAACTAGCACTGGCTGGAAT (SEQ ID NO: 11)

2nd antisense primer :

ATTCCAGCCAGTGCTAGTTGAATCTTGTCTG (SEQ ID NO: 12) iv) Primer-set for preparing mutated interferon-beta gene (DllON) sense primer :

CAGACAAGATTCAAATAGCACTGGCTGGAAT (SEQ ID NO: 13) antisense primer :

ATTCCAGCCAGTGCTATTTGAATCTTGTCTG (SEQ ID NO: 14) v ) Primer-set for preparing mutated interferon-beta gene (L116N)

1st sense primer :

ACCAGGGGAAAACACATGAGCAGTCTGCACC (SEQ ID NO: 15)

1st antisense primer :

GGTGCAGACTGCTCATGTGTTTTCCCCTGGT (SEQ ID NO: 16)

2nd sense primer :

ACCAGGGGAAAAAACATGAGCAGTCTGCACC (SEQ ID NO: 17)

2nd antisense primer : GGTGCAGACTGCTCATGTTTTTTCCCCTGGT (SEQ ID NO: 18) vi) Primer-set for preparing mutated interferon-beta gene (M117N)

1st sense primer :

ACCAGGGGAAAACTCAAGAGCAGTCTGCACC (SEQ ID NO: 19)

1st antisense primer :

GGTGCAGACTGCTCTTGAGTTTTCCCCTGGT (SEQ ID NO: 20)

2nd sense primer :

ACCAGGGGAAAACTCAATAGCAGTCTGCACC (SEQ ID NO: 21)

2nd antisense primer :

GGTGCAGACTGCTATTGAGTTTTCCCCTGGT (SEQ ID NO: 22) vii) Primer-set for preparing mutated interferon-beta gene (E137N)

1st sense primer :

CCTGAAGGCCAAGGATTACAGTCACTGTGCC (SEQ ID NO: 23)

1st antisense primer :

CGCACAGTGACTGTAATCCTTGGCCTTCAGG (SEQ ID NO: 24)

2nd sense primer :

CCTGAAGGCCAAGAATTACAGTCACTGTGCC (SEQ ID NO: 25)

2nd antisense primer :

GGCACAGTGACTGTAATTCTTGGCCTTCAGG (SEQ ID NO: 26)

As a result, using site-directed mutagenesis, the codon encoding above 7 amino acids is replaced by the codon encoding asparagine. This plasmid is called 'pGEMT-IFN-β-X'. Then, using said plasmid as template, the gene for a mutein of interferon-beta is obtained by carrying out PCR using two primers PI (CCGGAATTCGCCACCATGACCAACAA GTGTCTCCTCCAAA, SEQ ID NO: 27) and P2 (CCGCTCGAGGTCACT TAAACAGCATCTGCTGGTTGA, SEQ ID NO: 28).

In the present invention, 22 kinds of mutated gene for mutein of interferon-beta are manufactured. Table 1 shows the replacing amino acid site and replacing nucleotide site of 22 kinds of mutated gene.

(Table 1)

2. Expression of mutein of interferon-beta by the cultivation of transformed cell After cloning expression vector containing mutated gene, COS cell is transfected by this vector. Expression vector, pcDNA3.1-IFN~β is prepared as shown in FIG 3 with following steps. i ) Digesting pcDNA3.1 (Invitrogen) and amplified IFN-β gene with restriction enzyme, EcoR I and Xho I; ii ) eluting of linear pcDNA3.1 and IFN-β gene in agarose gel using Qiagen elution kit; iii) transforming E. coli DH5α after ligation of said gene; and iv) selecting and obtaining the transformed plasmid.

As shown in FIG 4, expression vector pcDNA3.1-IFN— β and pSP72-DHFR are co-transfected in order to insert them to animal cell. After reacting DNA isolated from expression vector and Lipofectin (Gibco BRL) in the serum-free DMEM medium, Lipofectin-DNA complex is obtained. After adding serum-free DMEM to said Lipofectin-DNA complex, this complex is overlaid on COS cell. Said COS cell is transfected and incubated in 5% C0₂ incubator at 37 TJ . Then, transfected COS cell is cultivated. Finally, transfected cell is selected in the medium containing G418. Selection medium has been exchanged in 4 days interval and the concentration of medium for apoptosis is determined. Then, transfected cell is selected by replacing medium to alpha-MEM minimal medium deficient of deoxyribonucleoside and ribonucleoside containing G418.

The expression capability for mutein of interferon-beta by CHO cell is measured by Western Blot with following method. After electrophoresis, developed protein is transferred into nitrocellulose filter using transfer blotter. After washing, nitrocellulose filter is reacted with anti-human IFN-β monoclonal antibody as first antibody. After washing, said filter is reacted with rabbit anti-mouse IgG antibody conjugated HRP. After completion of reaction, electrogenerated chemiluminescence (ECL) is added to detect positive band of a mutein of interferon-beta in X-ray film.

3. Activity test of mutein of interferon-beta

As shown in FIG 5, it is confirmed that the molecular weight of mutein of interferon-beta expressed by transformed COS cell increases compared to that of natural interferon-beta. Further, as shown in FIG 6, it is also confirmed that the molecular weight of mutein of interferon-beta decreases due to the removal of sugar chain when it is treated with N-glycanase.

i ) Antiviral activity test

To compared the antiviral activities of mutein of interferon-beta and natural interferon-beta, the interferon-beta protein is quantified by EIA. Then, the potencies of mutein of interferon-beta and natural interferon-beta are measured by antiviral activity test.

Enzyme-Immuno-Assay is employed for measuring antiviral activity. In the cultivation suspension containing various muteins of interferon-beta expressed by COS cell, potency of antiviral activity is measured by EIA. Table 2 shows the ratio of potency of antiviral activity/ EIA. From this experiment, the antiviral activities of N-2 mutein (DllON), N-19 mutein (DllON M117N), N-20 mutein (DllON E137N), N-22 mutein (M117N E137N) are measured to be enhanced.

(Table 2) The increase of M.W. of mutein of interferon-beta and the ratio of potency of antiviral activity/ EIA

+ M.W. of mutein of interferon-beta is 24 kDa, where one sugar chain is additionally added. ++ M.W. of mutein of interferon-beta is 26 kDa, where two sugar chains are additionally added.

ii ) Half-life test

Half-life test is carried out by measuring the concentration of interferon-beta muteins in the plasma after injecting it into rats. After injecting natural and mutein of interferon-beta into rats using cathete, the bloods are collected at the same time of injection, 1 min, 5 min, 15 min, 30 min, 1 hr 15 min, 3 hr, 5 hr, 8 hr. Collected bloods are prevented to be coagulated by treating anti-coagulant solution. The amounts of interferon-beta in the plasma of rats are measured by antiviral test method. The increase of half-life can be detected by pharmacokinetics. Table 3 shows the results.

(Table 3)

Half-life of natural and mutein of interferon-beta in rats

* AUC (Area under curve), ** MRT (Mean residence time), *** Vss (Steady state volume)

Various vectors can be used to express cDNA for preparing mutein of interferon-beta of the present invention. Preferred vectors are adaptable to eukaryotic host cell in order to add sugar chain in mutein of interferon-beta. Vectors useful to eukaryotic host cell have expression sequences derived from SV40, Bovine Papilloma Virus, Adenovirus or Cytomegalo virus. Preferred example of vector can be pCDNA3.1(+)/Hyg (Invitrogen, Carlsbad, Calif., USA) and pCI-neo (Stratagen, La Jolla, Calif., USA).

Generally, the host cell to be used has to show high introduction of DNA and high expression of introduced DNA. Of course, eukaryotic host cell has to be employed for this invention. The example of mammalian host cell contains CHO cell, COS cell such as COS 1, COS 7, BHK cell and mouse cell. The host cells are cultivated in nutrient medium adaptable to produce polypeptide. For example, host cells can be cultivated in shake flask, fermenter in laboratory scale or fermenter in industrial scale in order to express and produce polypeptide.

The present invention also provides a pharmaceutical composition containing mutein of interferon-beta as active ingredient. The therapeutic composition for mutein of interferon-beta can be a formulation of freeze-dried cake or solution containing pharmaceutically acceptable carrier, diluent and/ or stabilizer. As non-oral formulation, solution, suspension or emulsion can be prepared with pharmaceutically acceptable carrier and/ or diluent.

The present invention can be explained by following examples. However, the scope of present invention cannot be limited by following examples.

EXAMPLES

(Exmaple 1) Isolation of mutein of interferon-beta gene by mutagenesis for expressing one or two Asn-X-Ser/Thr sequence

The gene for mutein of interferon-beta is prepared by site-directed mutagenesis in order to introduce Asn-X-Ser/Thr (N-X-S/T) sequence in natural interferon-beta amino acid sequence, so that additional sugar chain can be attached. One or two site selected from the group consisting of Q72, D73, S75, DUO, L116, M117, and E137 of human interferon-beta amino acid sequence (SEQ ID NO: 1) is artificially replaced by asparagine. To obtain mutated gene, primer sets (SEQ ID NO: 3 ~ SEQ ID NO: 26) are prepared for overlapping PCR as to the mutated site as described above. As shown in FIG 2, overlapping PCR is carried out using overlapping primer set and Pfu-turbo DNA polymerase with plasmid pGEM-T Easy vector (Promega, USA) containing interferon-beta gene as template.

5 — 50 ng of template gene, 125 ng of primer set and 1 μl of dNTP mixture are added to 5 μi of 10 x buffer solution. Then, highly purified water (50 μi) and 1 μi of Pfu Turbo DNA polymerase (2.5 U/ μi) are added. Template gene is denatured by thermo-cycle of at 95 °C for 30 sec; at 55 Jfor 60 sec; at 68 °C for 480 sec as one cycle. This thermo-cycle is repeated 12 times. Methylated template gene is removed after treating obtained PCR product with 1 μi of Dpnl (10 U/μi) at 37 °C for 4 hours. 1 μi of Dpnl treating reaction solution is treated with E. coli XLl-blue and heated at 42 TJ for 45 sec. Then, E. coli is cooled by ice. E. coli is cultivated in 500 μi of cultivation medium at 37 TJ for 1 hour. After cultivation, cells are collected by centrifuge. Collected cells are spread in LB agar medium and cultivated at 37 TJ for 16 hours. Then, colonies are formed. After isolating plasmid DNA of cells in the colony, the sequence of DNA for mutein of interferon-beta is confirmed by DNA sequencer. As a result, 7 codons are replaced by the codon for encoding asparagine. Namely, the sequence of interferon-beta is mutated into Q72N, D73N, S75N, DllON, L116N, M117N, E137N. Finally, one or two mutated nucleotide sequences selected from the group consisting of Q72N, D73N, S75N, DllON, L116N, M117N, E137N are obtained. This plasmid is called as 'pGEMT-IFN-β-X' (X is number of mutein of interferon-beta). Above Table 1 shows the 22 kinds of mutated gene for mutein of interferon-beta prepared in the present invention.

(Exmaple 2) Preparation of expression vector, transfection with COS cell and cell culture

PCR is carried out with primer PI (SEQ ID NO: 27) and primer P2 (SEQ ID NO: 28) using pGEMT-IFN-β-X containing gene of mutein of interferon-beta as template. Then, gene for coding mutein of interferon-beta containing additional one or two Asn-X-Ser/Thr (N-X-S/T) sequence is obtained (FIG 3). DNA polymerase (Stratagene) is used for this PCR and the terminus of gene coding mutein of interferon-beta has restriction enzyme sites of EcoRI and Xhol. Then, pcDNA3.1

(Invitrogen) and amplified gene of mutein of IFN-β are treated with EcoRI and Xhol. Linearized pcDNA3.1 and gene of mutein of IFN-β are eluted using Qiagen elution kit from agarose gel. After ligation, this gene is used for transforming E. coli DH5α. After cultivating transformed E. coli in LB-ampicillin medium, plasmid is isolated from the growing colony. Then, obtained plasmid is treated with restriction enzymes EcoRI and Xhol and electrophoresis in 1% agarose gel is carried out for selecting the plasmid containing gene of mutein of interferon-beta. The sequence of selected plasmid DNA is confirmed. This selected plasmid is called as pcDNA3.1-IFN-β-X (X is a number of mutein of interferon-beta).

After selecting expression vectors for natural interferon-beta, muteins of interferon-beta N-2, N-5, N-19, N-20, N-22, COS cells (ATCC No. CRL-1650) are transfected by these expression vectors. For transfection, COS cells is pre-cultivated like this. They are seeded into 60 mm tissue culture plate in a concentration of 2 * 10 cells/ mi to be cultured for 24 hours. 2 μg of expression vector DNA and 7 μi of Lipofectin™ (Gibco BRL) are added and reacted to 100 μi of serum-free DMEM medium for 15 min at room temperature. The mixture is again reacted for 15 min at room temperature to form Lipofectin-DNA complex. After adding serum-free DMEM to obtained Lipofectin-DNA complex, this complex is overlaid on COS cells. Said COS cells are transfected and incubated in 5% C0₂ incubator at 37 TJ for 6 hours. COS cells transfected by expression vectors are cultured in DMEM medium containing 10% fetal bovine serum (JRH), 50 μg/mi of penicillin and 50 μg/ mi of streptomycin in 5% C0₂ condition at 37 TJ for 48 hours. After 3 to 5 days culture, transfected COS cell suspension is collected.

(Example 3) Test for confirming the characteristics of interferon-beta

A. Confirmation of additional sugar chain

From the COS cell suspension obtained in Example 2, 1-2 μg of supernatant containing mutein of interferon-beta has been immuno-precipitated overnight using anti-IFN-β rabbit polyclonal antibody. 20-80 μi of protein A sepharose resin suspended with PBS (phosphate buffered saline) (1:1 weight ratio) is added to supernatant and reacted for 1 hour at room temperature. The precipitate is obtained by centrifuge and washed with PBS. N-glycanase is treated with a part of precipitate for cleaving the N-linked sugar chain. Electrophoresis for both precipitate treated with N-glycanase and precipitate without treatment are carried out using 15% SDS-polyacrylamide gel. Then, obtained material is transferred into nitrocellulose membrane. Western Blot analysis is carried out using anti-IFN-β mouse monoclonal antibody according to the method of Runkel et al. (Runkel et al., Pharaceutical Research 15: pp 641-649, 1998).

After analyzing the cultivation supernatant of COS transformed cell suspension containing mutein of interferon-beta, the molecular weight of mutein of interferon-beta increases compared to that of natural interferon-beta (FIG 5). On the other hand, the molecular weight of mutein of interferon-beta decreases by the treatment of N-glycanase because additinal sugar chain is removed (FIG 6).

To confirm the number of N-linked sugar chain, partial cleavage test is carried out according to the method of Elliott et al. (Elliott et al., Nature Biotech 21: pp 414-421, 2003). Mutein of interferon-beta (N-20) expressed from COS cell is collected in serum-free cultivation medium. 1 μg of mutein of interferon-beta is laid on tube and distilled water is added to be 15 μi as final volume. After adding 10 μi of 0.5% SDS, the test material is boiled for 3 min. Then, 10.8 μi of 0.5M NaP0₄ (pH 8.6), 5 μi of 7.5% nonidet P40 and 1.5 μi of 250 unit/i N-glycanase (Genzyme) are added. The mixture is reacted at 37 TJ . After adding SDS-PAGE sample buffer, the reaction is stopped. Then, SDS-PAGE Western Blot is carried out. Anti-IFN-β polyclonal antibody is adsorbed as first antibody and anti-rabbit antibody conjugated HRP is adsorbed as second antibody. Then, the result is detected by ECL detection kit. According to the treatment of N-glycanase, the sugar chain is removed from interferon-beta. After 10 minutes of treatment, 24 kDa band containing additional one sugar chain is detected. After 30 minutes of treatment, only 20 kDa band without additional sugar chain is remained (FIG 9). According to this experiment, it is confirmed that the increase of molecular weight of mutein of interferon-beta is based upon the additional two N-linked sugar chains.

B. Activities of mutein of interferon-beta

To compare the activities between natural interferon-beta and mutein of interferon-beta, the protein amounts of each interferon-beta are determined by EIA. Further, the potencies of both mutein of interferon-beta and natural interferon-beta are measured by antiviral activity test.

EIA is carried out using PBL EIA kit. Each 100 μi of diluent solution is added to each designated well of the antibody conjugated plate in EIA kit. Also, 100 μi of diluted international standard solution and experimental solution are mixed and reacted for 1 hour at room temperature. The international standard solution is prepared by following steps; i ) dissolving one ample of international standard of human interferon-beta (NIBSC, England) with 1 mi of buffer; ii ) distributing 100 μi of standard solution to each vial; iii) storing this vial at -70 TJ; and iv) melting and diluting this vial at the time of using. After reaction, remaining reacting solution in the well is removed and washed with 250 μi of washing solution 3 times. Then, 100 μi of enzyme antibody conjugated solution is added and reacted for 1 hour at room temperature. After removing reacting solution, the well is washed with 200 μi of washing solution 3 times. After removing remaining solution completely, 100 μi of substrate-coloring solution is added and reacted for 30 min at room temperature. After completion of reaction, 100 μi of reaction stopping solution is added to each well. Then, absorbance is measured at 450 nm. For preparing standard curve, the concentration of standard solution is adopted as horizontal line and absorbance (A450 run) is adopted as vertical line. The value of IFN-β concentration according to each absorbance of international standard and test material is measured using standard curve. The value of interferon-beta concentration is calculated from the mean value of 3 different dilution samples. The antiviral activity test is carried out according to the same manner of described above. Above Table 2 shows the increase of M.W. of mutein of interferon-beta and the ratio of potency of antiviral activity/ EIA. According to this experiment, it is confirmed that the molecular weight of mutein of interferon-beta increases based upon the additional sugar chain, and that the antiviral activity of mutein of interferon-beta expressed from COS cell is same or better than that of natural interferon-beta.

(Example 4) Transfection and cell culture (CHO cell)

In 60 mm cultivation flask, CHO cell (DG44) is cultured to be 4 0-80% (1-4 X 10⁵ cell/60mm dish). After mixing 3 μi of

LipofectAmoine reagent (Gibco) and 97 μi of cell cultivation medium (α -MEM with media, serum-free, antibiotics-free), plasmid pcDNA3.1-IFN-β -X DNA (0.1 μg/μi, 2 g) and plasmid pSP72-DHFR (0.2 μg) are added to cultured CHO cells. One day after, the medium is exchanged by alpha-MEM medium containing 10% FBS and 500 μg/ mi of G418. The transfected cells are selected after cultivating for 7 to 10 days in the minimal alpha-MEM medium deficient of deoxyribonucleoside and ribonucleoside. Then, transfected cells (CHO DHFR+) are secondarily selected. Secondarily selected CHO DHFR+ transfected cells are cloned by limiting dilution method in 96 well plate. After cultivating in the selection medium, the concentration of MTX (methotrexate, Sigma, USA) increases from 20 nM to 1000 nM in 10% serum-minimal medium. Finally, MTX resistant clone is thirdly selected by collecting the cells growing in MTX selection medium.

The cell line growing at 1 μM of MTX medium more than 1 month is selected and isolated with following steps. i ) Culturing the cell line in 96 well-multi plate; ii ) selecting some cell line expressing a large amount of interferon-beta are selected by EIA; in) transferring said cell line into 24 well plate; and iv) subsequently transferring said cell line into 6 well plate. Finally, single cell line expressing interferon-beta among transfected CHO cells is selected and established by EIA. The amount of mutein of interferon-beta expressed by selected CHO-137 cell line reaches 8.6 μg/mi/ 24. hr, whereas the amount of interferon-beta expressed by normal CHO cell is only 1.8 μg/ mi/ 24. hr. Therefore, selected cell line has productivity twice more than that of natural cell line.

(Example 5) Purification of mutein of interferon-beta having additional one or two sugar chain expressed from CHO cell

Cell line obtained from Example 4 containing one or two mutated interferon-beta gene is cultured in cell factory (Nunc, Cat No. 170069). Expression cell line is transferred and cultured in a-MEM medium containing 10% FBS in a concentration of 5X10 cell/ m#. The cell line is grown on 5% C0₂ condition at 37 TJ for 72 hours. Grown cell line is washed with PBS 3 times to remove the serum component and the medium is exchanged by serum-free medium (Sigma C8730). The cultivated suspension is collected in every 24 hours interval by replacing serum-free medium. After collecting cultivated suspension 4 times, obtained suspension is purified. 200 mi of blue sepharose resin (Amersham-Pharmacia) is filled in XK50/20 column (Amersham- Pharmacia). Then, buffer A (20 mM sodium phosphate, 1 M NaCl, pH 7.4) is flowed in 10 C.V. (column volume) to be equilibrium. Sterilized filtered cultivation suspension is flowed through this column in a velocity of 20 ιτj£/^mm- UV detector in 280 ran is connected to monitor the flow. Non-adsorbed material is washed by flowing buffer B (20 mM sodium phosphate, 1 M NaCl, 30% Ethylen Glycol, pH 7.4) and the protein adsorbed in resin is eluted by buffer C (20 mM sodium phosphate, 1 M NaCl, 60% Ethylen Glycol, pH 7.4). Eluent solution is dialyzed by PBS (Phosphate Buffered Saline) and it is concentrated by concentrator (Centricon, Cut off 10,000). Finally, it is dialyzed by PBS.

(Exaplem 6) Physio-chemical analysis of interferon-beta having one or two additional sugar chain expressed from CHO cell

A. SDS-PAGE and Western Blot

Purified material obtained in Example 5 and 5X sample buffer solution (125 mM Tris-HCl, 5% SDS, 50% glycerol, 0.1% β -mercapto-ethanol, 1 mg/mi bromophenol blue) are mixed in a ratio of 1 : 4. After pretreatment at 95 TJ for 5 min, each 20 μi of testing material and molecular weight marker are developed in 15% polyacrylamide gel after loading them. After electrophoresis, it is stained with Coomassie Brilliant Blue and decolorized. About 20.0 kDa band for natural interferon-beta without sugar chain, about 22.0 kDa band for natural interferon-beta having sugar chain, about 24.0 kDa band for mutein of interferon-beta having one additional sugar chain and about 26.0 kDa band for mutein of interferon-beta having two additional sugar chain are detected (FIG 8). After electrophoresis, developed proteins are transferred into nitrocellulose membrane (Schleicher & Schuell) using transfer blotter (Hoefer). Said nitrocellulose membrane is laid on stopping solution (TBS solution containing 5% skim milk and 0.1% Tween 20) and it is stirred for 1 hour at room temperature. Then, it is washed with washing solution for 5 min 3 times. After washing, nitrocellulose membrane is reacted with anti-human IFN-β monoclonal antibody (R&D System) as first antibody for 1 hour at room temperature. After washing with TBS solution containing 0.1% Tween-20, it is reacted with rabbit anti-mouse IgG antibody conjugated HRP (Zymed) as second antibody for 1 hour at room temperature. After completion of reaction, it is washed 3 times and emitting solution (ECL, Amersham) is added to detect the positive band of mutein of interferon-beta. Then, it is photo-printed in X-ray film (Hyperfilm, Amersham) for detection. As a result, about 20.0 kDa band for natural interferon-beta without sugar chain, about 22.0 kDa band for natural interferon-beta having sugar chain, about 24.0 kDa band for mutein of interferon-beta having one additional sugar chain and about 26.0 kDa band for mutein of interferon-beta having two additional sugar chain are detected as same as SDS-PAGE (FIG 9).

B. Confirmation test for addition of sialic acid at the terminus of sugar chain

The amount of interferon-beta in purified protein is detected using Human IFN-β ELISA kit (PBL). The amount of sialic acid is measured according to the method of Masaki Ito et al. (Masaki Ito et al., Anal. Biochem. 300, 260 (2002)). Sialic acid is isolated from glycoprotein after treating 0.1 N HC1 for 1 hour at 80 TJ . Isolated sialic acid is labeled using sialic acid fluorescent label kit (Takara) and the amount of sialic acid is measured using HPLC. Table 4 shows the percentage of weight sialic acid/ weight IFN-β. Mutein of interferon-beta shows about twice sialic acid amount compared to natural interferon-beta.

(Table 4)

C. Test for confirming the change of isoelectric point of protein

The amount of interferon-beta from purified protein is measured using human IFN-β ELISA kit (PBL) and isoelectric point of protein is measured. The test is carried out according to the method and kit No vex IEF Gels kit (Invitrogen). After carrying out IEF, the pattern of interferon-beta is confirmed by Western Blot. According to increase of amount of sialic acid at the terminus of sugar chain, the pattern of isoelectric point becomes to be declined (FIG 9).

D. Analysis of peptide mapping of protein

To confirm the interferon-beta of each muteins, peptide mapping is carried out. Peptide mapping is carried out according to the method of Jun Utsumi et al. (Jun Utsumi et al., Eur. J. Biochem. 181, 545 (1989)). Each mutein of interferon-beta is cleaved by Lysyl endoproteinase from Achromobacter (WAKO). Then, it is reduced by DTT (Sigma) and alkylated by lodoacetamide (Sigma). Finally, it is cleaved by PNGase F enzyme (Sigma) to be same pattern of interferon-beta. Then, it is analyzed by HPLC using Reverse phase C18 column. It is confirmed that natural type and mutein of interferon-beta have same pattern (FIG 10).

(Exmaple 7) Biological activity of mutein of interferon-beta expressed from CHO cell

A. Antiviral activity of mutein of interferon-beta N-2, N-5, and N-20

The antiviral activity is measured as to mutein of interferon-beta N-2, N-5, and N-20 and interferon-beta without sugar chain (IFN-β-lb) using natural interferon-beta as standard.

A549 cells are cultured in MEM medium supplemented with 10% FBS, 5 mi of MEM nonessential amino acid 100X solution, 100 mM of sodium pyruvate. At the same day of analysis, cell are laid in fresh medium and the density of cell is adjusted into 300000 cell/m#. Interferons-beta in experimental group and control group are diluted. Dilution is carried out in the 96- well microtiter plate after delivering 100 β/well. All samples are tested in duplicate. Control well contains only 100 μi of medium (without IFN-β). After delivering 100 μi of cells per each well, plate is incubated in 5% C0₂ condition at 37 TJ for 20 hours. After removing the medium from the plate, 100 μi of EMCV (1000 TCID50/m£) diluted by said medium is added in each well. After incubation of plate in 5% C0₂ condition at 37 TJ for 22 hours, the plate is removed and it is dyed with crystal violet. After removing dye, 100 μi of 2-methoxyethanol is added and dyeing solution is extracted. Antiviral activity is measured by the absorbance of 450 nm.

Antiviral activity of IFN-β-lb without sugar chain shows low antiviral activity, whereas muteins of interferon-beta N-2, N-5, and N-20 show high antiviral activities compared to that of natural type. Mutein of interferon-beta N-20 having additional two sugar chain shows the best antiviral activity and muteins of interferon-beta N-2 and N-5 show similar antiviral activity (FIG 11).

B. Anti-proliferation effect

The anti-proliferation effect by mutein of interferon-beta is measured. This effect is measured compared to that of natural interferon-beta using Daudi cell. Daudi cells are cultured RPMI 1640 medium supplemented with 100 U/mi of penicillin, 100 mg/ mi of streptomycin, 2 mM of glutamine and 10% FBS. Interferons-beta in experimental group and control group are diluted using RPMI 1640 medium containing 10% FBS. Dilution is carried out in the 96-well microtiter plate after delivering 100 μi/wel\. All samples are tested in duplicate. Cells are distributed in a concentration of 10000 cell/ well in 96-well plate and incubated in 5% C0₂ condition at 37 TJ for 40 -48 hours. Then, 50 μi of medium containing 3[H] thymidine lμCi is added into well and cells are incubated for 6 hours. After collecting cells, radioactive amount is measured.

Mutein of interferon-beta has a anti-proliferation effect as to Daudi cell and the activity depends on the amount of interferon-beta. IFN-β -lb shows low anti-proliferation effect, whereas muteins of interferon-beta N-2, N-5 and N-20 show high anti-proliferation effect compared to that of natural interferon-beta. Therefore, it is confirmed that anti-proliferation effect increases according to the increase of number of additional sugar chain in mutein of interferon-beta (FIG 12).

C. Immuno-regulation function

The immno-regulation function of natural and muteins of interferon-beta are measured by the activation of MHC class I in A549 cell.

A549 cells are cultured in DMEM medium containing 10% FBS and 2 mM glutamine. After diluting cells, cells are delivered to the medium containing diluted natural interferon-beta, muteins of interferon-beta and IFN-β-lb in a concentration of 100000 cell/m£. Then, cells are incubated in 5% C0₂ condition at 37 TJ for 48 hours. After treating cells with Hank's buffered salt solution containing 5 mM EDTA, cells are collected by centrifugation. Cells are diluted to the concentration of 2 x 10 cell/ mi with FACS buffer and the expression of MHC class I is measured by FACS analysis. Anti-HLA ABC antibody coupled with biotin and streptavidin coupled with fluorescence are used for detection. All samples are tested in duplicate.

Mutein of interferon-beta shows slightly better immune-enhanced effect compared to that of IFN-β-la. It is also confirmed that immune-enhanced effect increases according to the increase of number of additional sugar chain in interferon-beta, and that IFN-β-lb without additional sugar chain shows low immune-enhanced effect (FIG 13).

D. Pharmacokinetics In vivo activity was measured as the change of plasma concentration in rats administered with mutein of interferon-beta expressed from CHO cell. Female Hsd:Sprague-Dawley rat having 246. 3 — 258.1 g weight is employed as experimental animal for in vivo activity test. These rats are adapted in animal feeding room under constant temperature (24 ± 1 TJ), constant moisture (55%) and 12 hours of lumination for 1 week.

1 group consists of random sampling 4 animals under same weight range. Experiment is carried out under three groups i ) administered with natural interferon-beta, ii ) administered with mutein of interferon-beta, and iii) without administering any drug. Catheter is inserted two days before experiment and the average weight of rats is 253.5 g.

Natural interferon-beta and mutein of interferon-beta are injected in vein of rats. The blood is collected from the catheter at the times of 1, 5, 15, 30 min, 1 hr 15 min, 3 hr, 5 hr, 8 hr after injection. Before collecting blood, the tube is washed with normal saline and the amount of each collected blood is 0.3 mL. After collecting blood, the catheter is filled with heparin saline (50 IU/mL). Collected blood is treated with anti coagulant (sodium citrate 4%) and it is centrifuged to collect plasma after removing blood cells. Then, it is frozen at -70 TJ and the amount of interferon-beta in the plasma is measured by antiviral test method. FIG 14 shows the plasma concentration of interferon-beta (muteins of interferon-beta expressed by CHO cell and natural interferon-beta) in rats at time interval. Pharmacokinetics is calculated by above plasma concentration in rats. The results are shown in Table 3.

Claims

WHAT IS CLAIMED IS :

1. A mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said mutein of human interferon-beta is prepared by the steps comprising i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ii ) expressing said artificially mutated cDNA in animal cell; and iii) obtaining said mutein of human interferon-beta having additional one or two sugar chain.

2. The mutein of human interferon-beta according to claim 1, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to replace 110th site of aspartate (DUO) and/ or 137th site of glutamate (E137) by asparagine (DllON, E137N, D110N-E137N) in 166 natural human interferon-beta.

3. The mutein of human interferon-beta according to claim 1, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to have one further replacement of amino acid selected from the group consisting of 72th site of glutamine (Q72), 73th site of aspartate (D73), 75th site of serine (S75) and 116th site of leucine (L116) by asparagine (N).

4. A mutated cDNA clone expressing a mutein of human interferon-beta, wherein said cDNA clone is artificially mutated to have one or two AAT sequence at asparagine (N) transcription sites, where natural transcription sites are selected from group consisting of 110th site of aspartate (GAT), 117th site of methionine (ATG) and 137th site of glutamate (GAG) in natural human interferon-beta cDNA sequence of SEQ ID NO: 2.

5. A method for preparing a mutein of human interferon-beta in which additional one or two sugar chain is added, comprising the steps of: i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ii ) expressing said artificially mutated cDNA in animal cell such as CHO cell; and iii) obtaining said mutein of human interferon-beta having additional one or two sugar chain.

6. A pharmaceutical composition comprising a mutein of human interferon-beta as active ingredient and other diluent, adjuvant, and carrier.