WO2004083432A1 - Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure - Google Patents

Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure Download PDF

Info

Publication number
WO2004083432A1
WO2004083432A1 PCT/NL2003/000214 NL0300214W WO2004083432A1 WO 2004083432 A1 WO2004083432 A1 WO 2004083432A1 NL 0300214 W NL0300214 W NL 0300214W WO 2004083432 A1 WO2004083432 A1 WO 2004083432A1
Authority
WO
WIPO (PCT)
Prior art keywords
exon
oligonucleotide
mrna
exons
gene
Prior art date
Application number
PCT/NL2003/000214
Other languages
French (fr)
Inventor
Garrit-Jan Boudewijn Van Ommen
Judith Christina Theodora Van Deutekom
Johannes Theodorus Den Dunnen
Annemieke Aartsma-Rus
Original Assignee
Academisch Ziekenhuis Leiden
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=33028995&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2004083432(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Academisch Ziekenhuis Leiden filed Critical Academisch Ziekenhuis Leiden
Priority to PCT/NL2003/000214 priority Critical patent/WO2004083432A1/en
Priority to AU2003225410A priority patent/AU2003225410A1/en
Priority to CA2524255A priority patent/CA2524255C/en
Priority to CA2519863A priority patent/CA2519863C/en
Priority to ES04722479.5T priority patent/ES2452293T3/en
Priority to PCT/NL2004/000196 priority patent/WO2004083446A2/en
Priority to AU2004221495A priority patent/AU2004221495C1/en
Priority to EP04722479.5A priority patent/EP1606407B1/en
Priority to NZ543115A priority patent/NZ543115A/en
Priority to JP2006507857A priority patent/JP2006523101A/en
Priority to CA2855229A priority patent/CA2855229C/en
Publication of WO2004083432A1 publication Critical patent/WO2004083432A1/en
Priority to US11/233,495 priority patent/US9896687B2/en
Priority to US11/233,507 priority patent/US20060099616A1/en
Priority to HK06107022.1A priority patent/HK1084694A1/en
Priority to US12/198,007 priority patent/US7534879B2/en
Priority to AU2009240879A priority patent/AU2009240879B2/en
Priority to US12/976,381 priority patent/US8759507B2/en
Priority to JP2011001581A priority patent/JP5378423B2/en
Priority to US13/550,210 priority patent/US10100304B2/en
Priority to US13/718,666 priority patent/US20130302806A1/en
Priority to JP2014011980A priority patent/JP5973477B2/en
Priority to US14/198,992 priority patent/US10190116B2/en
Priority to US14/248,279 priority patent/US10113165B2/en
Priority to US14/295,311 priority patent/US20140357855A1/en
Priority to US14/295,298 priority patent/US20140357698A1/en
Priority to US14/313,152 priority patent/US20140378527A1/en
Priority to US14/688,871 priority patent/US20150218559A1/en
Priority to US15/047,233 priority patent/US20160194636A1/en
Priority to US15/053,185 priority patent/US20160168570A1/en
Priority to US15/057,861 priority patent/US20160251658A1/en
Priority to US15/098,589 priority patent/US20160355810A1/en
Priority to US15/479,646 priority patent/US20170275624A1/en
Priority to US15/479,639 priority patent/US20170268003A1/en
Priority to US16/105,926 priority patent/US10544416B2/en
Priority to US16/230,927 priority patent/US20190225964A1/en
Priority to US16/277,593 priority patent/US20190241892A1/en
Priority to US16/709,628 priority patent/US11208657B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0016Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181Peptide nucleic acid, PNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)

Abstract

The invention provides a method for generating an oligonucleotide with which an exon may be skipped in a pre-mRNA and thus excluded from a produced mRNA thereof. Further provided are methods for altering the secondary structure of an mRNA to interfere with splicing processes and uses of the oligonucleotides and methods in the treatment of disease. Further provided are pharmaceutical compositions and methods and means for inducing skipping of several exons in a pre-mRNA.

Description

Title: Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure.
The invention relates to the fields of molecular biology and medicine. More in particular the invention relates to the restructuring of mRNA produced from pre-mRNA, and therapeutic uses thereof.
The central dogma of biology is that genetic information resides in the DNA of a cell and is expressed upon transcription of this information, where after production of the encoded protein follows by the translation machinery of the cell. This view of the flow of genetic information has prompted the pre-dominantly DNA based approach for interfering with the protein content of a cell. This view is slowly changing and alternatives for interfering at the DNA level are being pursued.
In higher eukaryotes the genetic information for proteins in the DNA of the cell is encoded in exons which are separated from each other by intronic sequences. These introns are in some cases very long. The transcription machinery generates a pre-mRNA which contains both exons and introns, while the splicing machinery, often already during the production of the pre-mRNA, generates the actual coding region for the protein by splicing together the exons present in the pre-mRNA.
Although much is known about the actual processes involved in the generation of an mRNA from a pre-mRNA, much also remains hidden. In the present invention it has been shown possible to influence the splicing process such that a different mRNA is produced. The process allows for the predictable and reproducible restructuring of mRNA produced by a splicing machinery. An oligonucleotide capable of hybridising to pre-mRNA at a location of an exon that is normally included in the mature mRNA can direct the exclusion of the thus targeted exon or a part thereof.
In the present invention means and methods are provided for the design of appropriate complementary oligonucleotides. To this end the invention provides a method for generating an oligonucleotide comprising determining, from a (predicted) secondary structure of RNA from an exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, which at least in part is complementary to said closed structure and which at least in part is complementary to said open structure. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the pre- mRNA. Herein this signalling function is referred to as an exon inclusion signal. A complementary oligonucleotide of the invention is capable of interfering with the structure of the exon and thereby capable of interfering with the exon inclusion signal of the exon. It has been found that many complementary oligonucleotides indeed comprise this capacity, some more efficient than others. Oligonucleotides of the invention, i.e. those with the said overlap directed toward open and closed structures in the native exon RNA, are a selection from all possible oligonucleotides. The selection encompasses oligonucleotides that can efficiently interfere with an exon inclusion signal. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon, and thereby interfere with the exon inclusion signal. It is found that the length of the partial complementarity to both the closed and the open structure is not extremely restricted. We have observed high efficiencies with oligonucleotides with variable lengths of complementarity in either structure. The term complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing the oligonucleotide one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridising to the complementary part. In a preferred embodiment a complementary part (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides. The complementary regions are preferably designed such that, when combined, they are specific for the exon in the pre-mRNA. Such specificity may be created with various lengths of complementary regions as this depends on the actual sequences in other (pre- )mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to the oligonucleotide decreases with increasing size of the oligonucleotide. It is clear that oligonucleotides comprising mismatches in the region of complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention. However, preferably at least the complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity, than oligonucleotides having such mismatches in one or more complementary regions. It is thought that higher hybridisation strengths, (i.e. increasing number of interactions with the opposing strand) are favourable in increasing the efficiency of the process of interfering with the splicing machinery of the system.
The secondary structure is best analysed in the context of the pre-mRNA wherein the exon resides. Such structure may be analysed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modelling programs. A non-limiting example of a suitable program is RNA mfold version 3.1 server (Mathews et al 1999, J. Mol. Biol. 288: 911-940). A person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of the exon, given the nucleotide sequence. Best predictions are obtained when providing such modelling programs with both the exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre- mRNA.
The open and closed structure to which the oligonucleotide is directed, are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure, annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. The different conformation may result in the disruption of the exon inclusion signal. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal is generated defining a different (neo) exon, i.e. with a different 5' end, a different 3' end, or both. This type of activrty is within the scope of the present invention as the targeted exon is excluded from the mRNA. The presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded. The inclusion of a neo-exon can be seen as a side effect which occurs only occasionally. There are two possibilities when exon skipping is used to restore (part of) an open reading frame that was disrupted as a result of a mutation. One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored. When selecting oligonucleotides for restoring reading frames by means of exon-skipping it is of course clear that under these conditions only those oligonucleotides are selected that indeed result in exon- skipping that restores the open reading frame, with or without a neo-exon.
Pre-mRNA can be subject to various splicing events, for instance through alternative splicing. Such events may be induced or catalysed by the environment of a cell or artificial splicing system. Thus, from the same pre- mRNA several different mRNA's may be produced. The different mRNA's all included exonic sequences, as that is the definition of an exon. However, the fluidity of the mRNA content necessitates a definition of the term exon in the present invention. An exon according to the invention is a sequence present in both the pre-mRNA and mRNA produced thereof, wherein the sequence included in the mRNA is, in the pre-mRNA, flanked on one side (first and last exon) or both sides (any other exon then the first and the last exon) by sequences not present in the mRNA. In principle any mRNA produced from the pre-mRNA qualifies for this definition. However, for the present invention, so-called dominant mRNA's are preferred, i.e. mRNA that makes up at least 5% of the mRNA produced from the pre-mRNA under the set conditions. Human immuno-deficiency virus in particular uses alternative splicing to an extreme. Some very important protein products are produced from mRNA making up even less than 5% of the total mRNA produced from said virus. The genomic RNA of retroviruses can be seen as pre-mRNA for any spliced product derived from it. As alternative splicing may vary in different cell types the exons are defined as exons in the context of the splicing conditions used in that system. As a hypothetical example; an mRNA in a muscle cell may contain an exon that as absent in an mRNA produced from the same pre-mRNA in a nerve cell. Similarly, mRNA in a cancer cell may contain an exon not present in mRNA produced from the same mRNA in a normal cell.
Alternative splicing may occur by splicing from the same pre-mRNA. However, alternative splicing may also occur through a mutation in the pre-mRNA for instance generating an additional splice acceptor and/or splice donor sequence. Such alternative splice sequences are often referred to as cryptic splice acceptor/donor sequences. Such cryptic splice sites can result in new exons (neo-exons). Inclusion of neo-exons into produced mRNA can be at least in part prevented using a method of the invention. In case a neo-exon is flanked by a cryptic and a "normal" splice donor/acceptor sequence, the neo-exon encompasses the old (paleo) exon. If in this case the original splice donor/acceptor sequence, for which the cryptic splice donor/acceptor has taken its place, is still present in the pre-mRNA, it is possible to enhance the production of mRNA containing the paleo-exon by interfering with the exon- recognition signal of the neo-exon. This interference can be both in the part of the neo-exon corresponding to the paleo-exon, or the additional part of such neo-exons. This type of exon skipping can be seen as splice correction.
The exon skipping technique can be used for many different purposes.
Preferably, however, exon skipping is used for restructuring mRNA that is produced from pre-mRNA exhibiting undesired splicing in a subject. The restructuring may be used to decrease the amount of protein produced by the cell. This is useful when the cell produces a particular undesired protein. In a preferred embodiment however, restructuring is used to promote the production of a functional protein in a cell, i.e. restructuring leads to the generation of a coding region for a functional protein. The latter embodiment is preferably used to restore an open reading frame that was lost as a result of a mutation. Preferred genes comprise a Duchenne muscular dystrophy gene, a collagen VI alpha 1 gene (COL6A1), a myotubular myopathy 1 gene (MTMl), a dysferlin gene (DYSF), a laminin-alpha 2 gene (LAMA2), an emery-dreyfuss muscular dystrophy gene (EMD), and/or a calpain 3 gene (CAPN3). The invention is further delineated by means of examples drawn from the Duchenne muscular dystrophy gene. Although this gene constitutes a particularly preferred gene in the present invention, the invention is not limited to this gene.
Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are both caused by mutations in the DMD gene, that is located on the X chromosome and codes for dystrophin (1-6). DMD has an incidence of 1:3500 newborn males. Patients suffer from progressive muscle weakness, are wheelchair bound before the age of 13 and often die before the third decade of their life (7). The generally milder BMD has an incidence of 1:20,000. BMD patients often remain ambulant for over 40 years and have longer life expectancies when compared to DMD patients (8).
Dystrophin is an essential component of the dystrophin-glycoprotein complex (DGG), which amongst others maintains the membrane stability of muscle fibers (9, 10). Frame -shifting mutations in the DMD gene result in dystrophin deficiency in muscle cells. This is accompanied by reduced levels of other DGC proteins and results in the severe phenotype found in DMD patients (11, 12). Mutations in the DMD gene that keep the reading frame intact, generate shorter, but partly functional dystrophins, associated with the less severe BMD (13, 14).
Despite extensive efforts, no clinically applicable and effective therapy for DMD patients has yet been developed (15), although a delay of the onset and/or progression of disease manifestations can be achieved by glucocorticoid therapy (16). Promising results have recently been reported by us and others on a genetic therapy aimed at restoring the reading frame of the dystrophin pre-mRNA in cells from the mdx mouse model and DMD patients (17-23). By the targeted skipping of a specific exon, a DMD phenotype can be converted into a milder BMD phenotype. The skipping of an exon can be induced by the binding of antisense oligoribonucleotides (AONs) targeting either one or both of the splice sites, or exon-internal sequences. Since an exon will only be included in the mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. This was shown to be successful, albeit with variable efficacy and efficiency (17, 18, 20, 21). We hypothesised that targeting exon-internal sequences might increase specificity and reduce interference with the splicing machinery itself. Some exons have weak splice sites and appear to require binding of a SR protein to an exon recognition sequence (ERS) or an exonic splicing enhancer (ESE) to be properly recognised by the splicing machinery (24). SR proteins are a highly conserved family of arginine/serine rich, spliceosome associated phosphoproteins essential for pre-mRNA splicing (50, 51). SR proteins appear to act early in splicing by promoting splice site recognition and spliceosome assembly. SR proteins also play a regulatory role, because they can determine alternative splice site usage in vivo and in vitro. SR proteins appear to be recruited from nuclear "speckles", in which they are concentrated, to sites of transcription in order to spatially coordinate transcription and pre-mRNA splicing within the cell nucleus (49, 52). Disruptive point mutations or AONs that block these sequences have been found to result in exon skipping (19, 22, 24-28). Using exon-internal AONs specific for an ERS-like sequence in exon 46, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion (19). Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells. We have recently shown that exon skipping can also efficiently be induced in human control muscle cells for 15 different DMD exons using exon-internal AONs (23, unpublished results). In contrast to the previous opinion that skipping can only be achieved with weak splice sites or exons containing ERS-like sequences, we have seen that of the exons that were skipped in the present invention most do not have weak splice sites nor do they contain ERS-like sequences. Thus binding of the AONs to the targeted exon per se is sufficient to cause exon skipping, either by interfering with one or more components of the splicing machinery or by altering the secondary structure of the RNA in such a manner that the splicing machinery no longer recognizes the exon. In a preferred embodiment the exon to be skipped comprises exons 2, 8, 9, 17, 19, 29, 40-46, 49-53, 55 or 59. More preferably, exons 2, 8, 9, 17, 40, 41, 42, 44, 49- 52 or 59. In yet another embodiment the exon to be skipped comprises exons 2, 29, 40, 41, 42, 43, 44, 45, 46, 49, 50, 51 or 53.
Any oligonucleotide fulfilling the requirements of the invention may be used to induce exon skipping in the DMD gene. In a preferred embodiment an oligonucleotide comprises a sequence as depicted as active in exon-skipping in table 2, or a functional equivalent thereof comprising a similar, preferably the same hybridisation capacity in kind, not necessarily in amount. Preferably an oligonucleotide comprising a sequence as depicted in table 2, derived from the exons 2, 40, 41, 42, 43, 44, 45, 49, 50, 51 or 53, demonstratably active in exon skipping.
Reading frame correction can be achieved by skipping one or two exons flanking a deletion, by skipping in-frame exons containing a nonsense mutation, or by skipping duplicated exons. This results in proteins similar to those found in various BMD patients (2, 29). A survey of the Leiden DMD mutation database [www.dmd.nl: (30)] learns that we can thus correct over 75% of DMD causing mutations (see Table 4). We show the actual therapeutic effect of exon skipping for 7 different mutations. In all patient muscle cell cultures, we were able to restore dystrophin synthesis in 75% to 80% of treated cells.
The complementary oligonucleotide generated through a method of the invention is preferably complementary to a consecutive part of between 16 and 50 nucleotides of said exon RNA. Different types of nucleic acid may be used to generate the oligonucleotide. Preferably, the oligonucleotide comprises RNA, as RNA/RNA hybrids are very stable. Since one of the aims of the exon skipping technique is to direct splicing in subjects it is preferred that the oligonucleotide RNA comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, reduced toxicity, increased intracellular transport, tissue-specificity, etc. Preferably said modification comprises a 2'-O-methyl-phosphorothioate oligoribonucleotide modification.
With the advent of nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridisation characteristics in kind not necessarily in amount as nucleic acid itself. Such equivalents are of course also part of the invention. Examples of such mimics equivalents are peptide nucleic acid, locked nucleic acid and/or a morpholino phosphorodiamidate. Suitable but non-limiting examples of equivalents of oligonucleotides of the invention can be found in (Wahlestedt, C. et al. Potent and non-toxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A 97, 5633-8. (2000). Elayadi, A.N. & Corey, D.R. Application of PNA and LNA oligomers to chemotherapy. Curr Opin Investig Drugs 2, 558-61. (2001). Larsen, H.J., Bentin, T. & Nielsen, P.E. Antisense properties of peptide nucleic acid. Biochim Biophys Acta 1489, 159-66. (1999). Braasch, D.A. & Corey, D.R. Novel antisense and peptide nucleic acid strategies for controlling gene expression. Biochemistry 41, 4503-10. (2002). Summerton, J. & Weller, D. Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev 7, 187- 95.(1997)). Hybrids between one or more of the equivalents among each other and/or together with nucleic acid are of course also part of the invention. In a preferred embodiment an equivalent comprises locked nucleic acid, as locked nucleic acid displays a higher target affinity and reduced toxicity and therefore shows a higher efficiency of exon skipping.
An oligonucleotide of the invention typically does not have to overlap with a splice donor or splice acceptor of the exon.
An oligonucleotide of the invention, or equivalent thereof, may of course be combined with other methods for interfering with the structure of an mRNA. It is for instance possible to include in a method at least one other oligonucleotide that is complementary to at least one other exon in the pre-mRNA. This can be used to prevent inclusion of two or more exons of a pre-mRNA in mRNA produced from this pre-mRNA. In a preferred embodiment, said at least one other oligonucleotide is an oligonucleotide, or equivalent thereof, generated through a method of the invention. This part of the invention is further referred to as double-or multi-exon skipping. In most cases double-exon skipping results in the exclusion of only the two targeted (complementary) exons from the pre-mRNA. However, in other cases it was found that the targeted exons and the entire region in between said exons in said pre-mRNA were not present in the produced mRNA even when other exons (intervening exons) were present in such region. This multi-skipping was notably so for the combination of oligonucleotides derived from the DMD gene, wherein one oligonucleotide for exon 45 and one oligonucleotide for exon 51 was added to a cell transcribing the DMD gene. Such a set-up resulted in mRNA being produced that did not contain exons 45 to 51. Apparently, the structure of the pre-mRNA in the presence of the mentioned oligonucleotides was such that the splicing machinery was stimulated to connect exons 44 and 52 to each other.
In the present invention it has found possible to specifically promote the skipping of also the intervening exons by providing a linkage between the two complementary oligonucleotides. To this end the invention provides a compound capable of hybridising to at least two exons in a pre-mRNA encoded by a gene, said compound comprising at least two parts wherein a first part comprises an oligonucleotide having at least 8 consecutive nucleotides that are complementary to a first of said at least two exons, and wherein a second part comprises an oligonucleotide having at least 8 consecutive nucleotides that are complementary to a second exon in said pre-mRNA. The at least two parts are linked in said compound so as to form a single molecule. The linkage may be through any means but is preferably accomplished through a nucleotide linkage. In the latter case the number of nucleotides that not contain an overlap between one or the other complementary exon can be zero, but is preferably between 4 to 40 nucleotides. The linking moiety can be any type of moiety capable of linking oligonucleotides. Currently, many different compounds are available that mimic hybridisation characteristics of oligonucleotides. Such a compound is also suitable for the present invention if such equivalent comprises similar hybridisation characteristics in kind not necessarily in amount. Suitable equivalents were mentioned earlier in this description. One or preferably, more of the oligonucleotides in the compound are generated by a method for generating an oligonucleotide of the present invention. As mentioned, oligonucleotides of the invention do not have to consist of only oligonucleotides that contribute to hybridisation to the targeted exon. There may be additional material and/or nucleotides added.
As mentioned, a preferred gene for restructuring mRNA is the DMD gene. The DMD gene is a large gene, with many different exons. Considering that the gene is located on the X-chromosome, it is mostly boys that are affected, although girls can also be affected by the disease, as they may receive a bad copy of the gene from both parents, or are suffering from a particularly biased inactivation of the functional allele due to a particularly biased X chromosome inactivation in their muscle cells. The protein is encoded by a plurality of exons (79) over a range of at least 2,6 Mb. Defects may occur in any part of the DMD gene. Skipping of a particular exon or particular exons can, very often, result in a restructured mRNA that encodes a shorter than normal but at least partially functional dystrophin protein. A practical problem in the development of a medicament based on exon-skipping technology is the plurality of mutations that may result in a deficiency in functional dystrophin protein in the cell. Despite the fact that already multiple different mutations can be corrected for by the skipping of a single exon, this plurality of mutations, requires the generation of a large number of different pharmaceuticals as for different mutations different exons need to be skipped. An advantage of a compound of the invention, i.e. a compound capable of inducing skipping of two or more exons, is that more than one exon can be skipped with a single pharmaceutical. This property is not only practically very useful in that only a limited number of pharmaceuticals need to be generated for treating many different Duchenne or Becker mutations. Another option now open to the person skilled in the art is to select particularly functional restructured dystrophin proteins and produce compounds capable of generating these preferred dystrophin proteins. Such preferred end results are further referred to as mild phenotype dystrophins. The structure of the normal dystrophin protein can be schematically represented as two endpoints having structural function (the beads), which are connected to each other by a long at least partly flexible rod. This rod is shortened in many Becker patients.
This led the field to the conclusion that not so much the length of the rod but the presence of a rod and the composition thereof (with respect to particular hinge regions in the protein), is crucial to the function per se of the dystrophin protein. Though the size of the rod may have an impact on the amount of functionality of the resulting (Becker) protein, there are many notable exceptions. These exceptions will be detailed below. There are especially benign mutations that can have a very short rod. It was noted by the inventors that many more different types of Becker patients should have been detected in the patient population. However, some types of shortened dystrophin proteins, that according to this hypothesis should have a Becker phenotype, are not detected in human population. For some of these "theoretical" Becker forms, this could just be a matter of chance. However, in the present invention it has been found, that at least some of these "potential" Becker patients have such a benign phenotype that subjects having these types of mutations do not present themselves to a doctor, or are not diagnosed as suffering from Becker's disease. With a compound of the invention it is possible to restructure DMD pre-mRNA of many different Duchenne and even Becker patients such that a mild phenotype dystrophin is generated after translation of the restructured mRNA. The invention thus provides particularly preferred compound, wherein the parts of the compounds at least comprise a first part comprising an oligonucleotide or equivalent thereof, complementary to exon 17 and a second part comprising an oligonucleotide or equivalent thereof, co plementary to exon 48. The resulting restructured mRNA encodes an in-frame shortened dystrophin protein, lacking all exons from 17 to 48. This shortened dystrophin protein mimics a mild phenotype dystrophin as mentioned above. The compound (referred to as the 17-48 compound) should according to current databases be able to deal with as much as 20% of the patients having a DMD mutation currently characterised. Another preferred compound is the 45-55 compound. This compound should according to the same calculations be able to deal with 38% of the patients having a DMD mutation thus far characterised. Yet another preferred embodiment the compound comprises a 42-55 compound or a 49-59 compound, capable of dealing with respectively 65% and 18% of the currently characterized DMD patients. Similarly preferred are a 45-49 compound and a 45-51 compound preferably in the form as disclosed in the experimental part, having the potential to treat respectively 4% and 8% of the DMD patients characterised thus far.
Also part of the invention is a compound capable of hybridising to one exon in a pre-mRNA encoded by a gene, said compound comprising at least two parts wherein a first part comprises an oligonucleotide of which at least a part of said oligonucleotide is complementary to said closed structure and wherein second part comprises an oligonucleotide of which at least part is complementary to said open structure. The open and closed structures are of course determined from a secondary structure of RNA from said exon. Preferably a compound having two distinguishable parts complementary to a single exon, comprises an oligonucleotide, or equivalent thereof, or combination thereof as mentioned above in the method for generating said oligonucleotide.
A transcription system containing a splicing system can be generated in vitro. The art has suitable systems available. However, the need for mRNA restructuring is of course predominantly felt for the manipulation of living cells. Preferably, cells in which a desired effect can be achieved through the restructuring of an mRNA. Preferred mRNA's that are restructured are listed herein above. Preferably, genes active in muscle cells are used in the present invention. Muscle cells (i.e. myotubes) are multinucleated cells in which many but not all muscle cell specific genes are transcribed via long pre-mRNA. Such long pre-mRNA's are preferred for the present invention, as restructuring of mRNA's produced from such long mRNA's is particularly efficient. It is thought, though it need not necessarily be so, that the relatively long time needed to generate the full pre-mRNA aids the efficiency of restructuring using a method or means of the invention, as more time is allowed for the process to proceed. The preferred group of genes of which the mRNA is preferably restructured in a method of the invention comprises: COL6A1 causing Bethlem myopathy, MTMl causing myotubular myopathy, DYSF (dysferlin causing Miyoshi myopathy and LGMD, LAMA2 (laminin alpha 2) causing Merosin-deficient muscular dystrophy, EMD (emerin) causing Emery- Dreyfuss muscular dystrophy, the DMD gene causing Duchenne muscular dystrophy and Becker muscular dystrophy, and CAPN3 (calpain) causing LGMD2A. Any cell may be used, however, as mentioned, a preferred cell is a cell derived from a DMD patient. Cells can be manipulated in vitro, i.e. outside the subject's body. However, ideally the cells are provided with a restructuring capacity in vivo. Suitable means for providing cells with an oligonucleotide, equivalent or compound of the invention are present in the art. Improvements in these techniques are anticipated considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect on restructuring of mRNA using a method of the invention. At present suitable means for delivering an oligonucleotide, equivalent or compound of the invention to a cell in vivo comprise, polyethylenimine (PEI) or synthetic amphiphils (SAINT- 18) suitable for nucleic acid transfections. The amphiphils show increased delivery and reduced toxicity, also when used for in vivo delivery. Preferably compounds mentioned in (Smisterova, J., Wagenaar, A., Stuart, M.C.A., Polushkin, E., ten Brinke, G., Hulst, R., Engberts, J.B.F.N., Hoekstra, D., 'Molecular shape of the Cationic Lipid Controls the Structure of the Cationic Lipid/ Dioleylphosphatidylethanolamine-DNA Complexes and the Efficiency of Gene Delivery', J. Biol. Chem. 2001, 276, 47615). The synthetic amphiphils preferably used are based upon the easily synthetically available 'long tailed' pyridinium head group based materials. Within the large group of amphiphils synthesized, several show a remarkable transfection potential combined with a low toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity.
An oligonucleotide, equivalent thereof, or a compound according to the invention may be used for at least in part altering recognition of said exon in a pre-mRNA. In this embodiment the splicing machinery is at least in part prevented from linking the exon boundaries to the mRNA. The oligonucleotide, equivalent or compound of the invention is at least in part capable of altering exon-recognition in a pre-mRNA. This use is thus also provided in the invention. The prevention of inclusion of a targeted exon in an mRNA is also provided as a use for at least in part stimulating exon skipping in a pre- mRNA. As mentioned above, the targeted exon is not included in the resulting mRNA. However, part of the exon (a neo-exon) may occasionally be retained in the produced mRNA. This sometimes occurs when the targeted exon contains a potential splice acceptor and/or splice donor sequence. In this embodiment the splicing machinery is redirected to utilize a previously not (or underused) splice acceptor/donor sequence, thereby creating a new exon (neo-exon). The neo-exon may have one end in common with the paleo-exon, although this does not always have to be the case. Thus in one aspect an oligonucleotide, equivalent or compound of the invention is used for altering the efficiency with which a splice donor or splice acceptor is used by a splicing machinery.
In view of the above, the present invention further provides the use of an oligonucleotide, an equivalent thereof or a compound of the invention for the preparation of a medicament. Further provided is a pharmaceutical preparation comprising an oligonucleotide, equivalent thereof or a compound according to the invention. Said an oligonucleotide, an equivalent thereof or a compound of the invention can be used for the preparation of a medicament for the treatment of an inherited disease. Similarly provided is a method for altering the efficiency with which an exon in a pre-mRNA is recognized by a splicing machinery, said pre-mRNA being encoded by a gene comprising at least two exons and at least one intron, said method comprising providing a transcription system comprising said splicing machinery and said gene, with an oligonucleotide, equivalent thereof or a compound according to the invention, wherein said oligonucleotide, equivalent thereof or compound is capable of hybridising to at least one of said exons, and allowing for transcription and splicing to occur in said transcription system. Preferably, said gene comprises at least 3 exons. An oligonucleotide of the invention, may be provided to a cell in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide. The expression vector is preferably introduced into the cell via a gene delivery vehicle. A preferred delivery vehicle is a viral vector such as an adenoviral vector and more preferably an adeno-associated virus vector. The invention thus also provides such expression vectors and delivery vehicles. It is within the skill of the artisan to design suitable transcripts. Preferred for the invention are PolIII driven transcripts. Preferably in the form of a fusion transcript with an Ulor U7 transcript. Such fusions may be generated as described in references 53 and 54.
\
Examples
Example 1
Results
This study includes 6 DMD patients affected by different mutations (Table 1). Patient DL 515.2 carries an exon 45-50 deletion; hence exon 51 skipping would be frame correcting. Patient DL 363.2 has a deletion of exon 45-54; the reading frame for this patient would be corrected by an exon 44 skip. For patient
50685.1, who is affected by an exon 48-50 deletion, reading frame correction requires an exon 51 skip. Patient DL 589.2 has an exon 51-55 deletion; the reading frame would be corrected by an exon 50 skip. Patient 53914.1 carries a single exon 52 deletion. Notably, in this case both the skipping of exon 51 or exon 53 would be frame correcting. Finally, patient 50423.1 has a deletion of a single base pair in exon 49, at position 7389 on cDNA level, resulting in a frame-shift and a premature stop codon in exon 49. Since exon 49 is an in- frame exon, skipping of this exon would correct the reading frame for this patient.
We have previously identified AONs with which the skipping of the mentioned target exons 44, 49, 50, 51 and 53 can be induced at concentrations of 1 μM (23). In subsequent dose-response experiments, however, we have obtained substantial skipping efficiencies with lower concentrations of 500 nM or 200 nM, and even 100 nM for most AONs (data not shown). This had the extra advantageous effect of lower doses of PEI required for transfection, which significantly reduced the levels of cytotoxicity as found in our earlier transfection experiments. Myotube cultures from the 6 DMD patients were transfected with the relevant AONs. On average 70% to 90% of cells showed specific nuclear uptake of fluorescent AONs. RNA was isolated 24 hours post- transfection and analysed by RT-PCR (Fig. 1). In all patients, the targeted exons were skipped at high efficiencies, and precisely at the exon boundaries, as confirmed by sequence analysis of the novel shorter transcripts (Fig. 1). For patient 50685.1, an additional transcript fragment was found (Fig. 1C). Sequence analysis showed that this was generated by the activation of a cryptic splice site in exon 51. This was previously also observed in human control cells treated with the same AON (23). Remarkably, low levels of spontaneous exon skipping were observed in untreated cells derived from patients DL 363.2 (exon 44 skip), DL 589.2 (exon 50 skip), and 53914.1 (exon 53 skip). RT-PCR analysis on several larger areas of the DMD gene transcript did not reveal additional, unexpected, aberrant splicing patterns induced by the AON-treatment.
The resulting in-frame transcripts should restore dystrophin synthesis. Indeed, immuno-histochemical analysis of transfected myotube cultures detected dystrophin in the majority of myotubes for each patient (Fig. 2). The therapeutic efficiency was determined by double staining, using antibodies against myosin, to identify sufficiently differentiated myotubes, and dystrophin. On average, 75% to 80% of myosin-positive rnyotubβs showed dystrophin expression. We observed clear membrane-bound dystrophin for patients DL 363.2, DL 589.2 and 53914.1 two days post-transfection (Fig. 2B, D, E). The presence of dystrophin was confirmed for each patient by Western blot analysis (Fig. 3). For patients 50685.1 and DL 363.2 we performed time course experiments, which indicated that dystrophin can be detected as soon as 16 hours post-transfection (Fig. 3D) and at increasing levels up to 7 days post-transfection (Fig. 3B). The dystrophin proteins from patients DL515.2, DL 363.2 and DL 589.2 are significantly shorter than the human control, which is due to the size of the deletion.
For one patient, DL 363.2, we also assessed whether the induction of the dystrophin synthesis resulted in the restoration of the DGC (Fig. 4). Prior to AON treatment we found reduced, mainly cytoplasmatic alpha, beta, gamma sarcoglycan and beta-dystroglycan signals (30%, 30%, 40% and 80%, respectively) (Fig. 4A). Following AON transfection, increased levels of mainly membrane-bound alpha-, beta- and gamma-sarcoglycans and beta- dystroglycan were detected in 70%, 90%, 90% and 80% of the treated myotube cultures, respectively (Fig. 4B).
DISCUSSION
The reading frame correction strategy for DMD patients is aimed at antisense- induced, targeted exon skipping. This would convert a severe DMD phenotype into a mostly milder BMD phenotype. We determined the broad applicability in 6 patients, carrying 5 different deletions and a point mutation in an exon 49 (Table 1). Following AON treatment, we show for each patient the precise skipping of the targeted exon on RNA level, and a dystrophin protein in 75% to 80% of the treated myotubes. In particular, we here report, for the first time, the application of a single AON treatment (i.e. the induced skipping of exon 51) to correct the reading frame for several different deletions.
Interestingly, the levels of exon skipping observed in the DMD patient cells are significantly higher than those previously obtained in human control cells (23). Typically, the novel skip transcript is the major product. This can be explained by the action of the nonsense-mediated decay (NMD) process (25,
32). In control cells, the skip of an out-of-frame exon results in an out-of-frame transcript, which will be susceptible to NMD. In patient cells, the skip of a target exon results in an in-frame transcript that would be resistant to NMD and thus more stable than the out-of-frame transcript originally present. For three of the patients (DL 363.2, DL 589.2 and 53914.1) we detected low levels of spontaneous skipping of exons 44, 50 and 53 in untreated cells. This phenomenon has previously also been described for so-called revertant muscle fibers (33-35). These dystrophin positive fibers are present in low amounts (2% to 10%) in DMD muscles, and are considered to be the result of secondary somatic mutations and/or alternative splicing that restore the reading frame. The existence of revertant fibers has been suggested to correlate with the severity of the disease (36, 37).
Restoration of the dystrophin synthesis could be detected as soon as 16 hours post-transfection. At two days post-transfection, dystrophin was detected at the membrane indicating that these novel BMD-like proteins are likely in part functional. Furthermore, we show that restoration of the dystrophin synthesis appears to re-establish the formation of the dystrophin- glycoprotein complex.
In patients DL 363.2 and DL 589.2, the targeted exon skipping enlarged the deletions to span exons 44-54 and 50-55, respectively. So far, these deletions, have not been reported in DMD or BMD patients. This means that they either do not exist, or generate a very mild phenotype not diagnosed as BMD. Considering both the large variety of BMD mutations and the markedly lower incidence of BMD observed, we consider the last explanation more plausible than the first. The out-of-frame deletions from patients DL 515.1, 50685.1 and 50423.1 were converted into in-frame deletions as observed in BMD patients carrying deletions of exon 45-51, exon 48-51 and exon 49 (30, 38- 40). Noteworthy, the exon 48-51 deletion has even been described in an asymptomatic person (40). On the other hand however, there are also DMD patients carrying such deletions (38, 41-43). Since most of these theoretically in-frame deletions have been detected on DNA level only, we hypothesize that the dystrophin deficiency in these DMD patients may be caused by additional aberrant splicing patterns on RNA level, resulting in an out-of-frame transcript. It is feasible to correct over 75% of the mutations reported in the Leiden
DMD-mutation database (30). Our results indicate that, antisense-induced reading frame correction will be a promising therapeutic approach for many DMD patients carrying different deletions and point mutations. Towards the establishment of clinical trials, we are currently investigating and optimising delivery methods in muscle tissue of mice in vivo. MATERIAL AND METHODS AONs and primers
The AONs applied (Table 1) were previously described (23). They contain a 5' fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2'-O- methyl modified ribose molecules (Eurogentec, Belgium). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno-histochemical analyses. Primers for RT-PCR analysis (sequences available upon request) were synthesised by Eurogentec (Belgium) or by Isogen Bioscience BV (The Netherlands).
Myogenic cell cultures and AON transfections
Primary human myoblasts from patients DL 515.2 (deletion exon 45-50), DL
363.2 (deletion exon 45-54), 50685.1 (deletion exon 48-50), DL 589.2 (deletion exon 51-55) and 53914.1 (deletion exon 52) were isolated from a muscle biopsy and cultured as described (44). Cultures were seeded in collagen pre-coated flasks and plates (Vitrogen 100, Cohesion). Myotubes were obtained from confluent myoblast cultures, following 7 to 14 days of serum-deprivation. They were subsequently transfected using polyethylenimine (PEI) for 3 h in low- serum medium, according to the manufacturer's instructions (ExGen500; MBI Fermentas), and with 3.5 μl PEI applied per μg of transfected AON. For RT- PCR analysis, concentrations of 500 nM AON were used. At this concentration highest skipping levels can be obtained, albeit with moderate levels of cell death. Since for immunohistochemical and western blot analysis more viable myotubes are required, concentrations of 200 nM were applied.
For patient 50423.1, who carries a point mutation in exon 49, only fibroblasts were available. Following infection (MOI 50-100) with an adenoviral vector containing the MyoD gene (AdδOMyoD), the fibroblasts were forced into myogenesis according to protocols described previously (45-47). Two hours post-infection the medium was replaced by low serum medium, and cells were incubated for 8 to 10 days until myotubes were formed. Transfection conditions were identical to those described above.
RNA isolation and RT-PCR analysis At 24 h post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, The Netherlands). 300 ng of total RNA was used for RT-PCR analysis using C.therm polymerase (Roche Diagnostics, The Netherlands) in a 20 μl reaction at 60 °C for 30 min, primed with different DMD gene-specific reverse primers (Table 1). Primary PCRs were performed by 20 cycles of 94 °C (40 sec), 60 °C (40 sec) and 72 °C (60 sec). One μl of these reactions was then reamplified in nested PCRs by 32 cycles of 94 °C (40 sec), 60 °C (40 sec) and 72 °C (60 sec). PCR products were analysed on 1.5% or 2% agarose gels. Noteworthy, no evidence for a significant preference for the amplification of shorter fragments was obtained in PCR analyses on a defined series of mixtures of known quantities of the normal and shorter transcript fragments (data not shown).
Sequence Analysis
RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) and analysed on an ABI 3700 Sequencer (PE Applied Biosystems).
Protein isolation and Western blot analysis
Protein extracts were isolated from treated myotube cultures (25 cm2 flasks), using 150 μl of treatment buffer (75 mM Tris-HCl pH 6.8, 15% SDS, 5% b- mercaptoethanol, 2% glycerol, 0.001% bromophenol blue), at 2 to 4 days post- transfection depending on the survival rate of the myotubes. For the time course experiments, protein extracts were isolated 4h, 8h, 16h, 24h and 48h post-transfection (for patient 50685.1) or at 2 days, 4 days and 7 days post- transfection (for patient DL 363.2).
Polyacrylamide gel electrophoresis and Western blotting were performed as described by Anderson et al, with some minor adjustments (48). Briefly, samples (75 μl) were run overnight at 4 °C on a 4% to 7% polyacrylamide gradient gel. Gels were blotted to nitrocellulose for 5 to 6 hours at 4 °C. Blots were blocked for 1 h with 5% non-fat dried milk in TBST buffer (10 mM Tris-HCl, 0.15 M NaCl, 0.5% Tween 20, pH 8) followed by an overnight incubation with NCL-DYS2 (which recognizes dystrophin) diluted 1:50. HRP- conjugated anti-mouse (Santa Cruz) diluted 1:10,000 was used as a secondary antibody. Immuno -re active bands were visualised using Lumi-Lightplus Western Blotting Substrate and scanned with a Lumi-Imager (Roche Diagnostics, The Netherlands).
Immuno -histochemical Analysis
Treated myotube cultures were fixed in — 20°C methanol at 1 to 4 days post- transfection, depending of the survival rate of the myotubes. Prior to reaction with the different antibodies, the cells were incubated for 1 in a blocking solution containing 5% horse serum (Gibco BRL) and 0.05 % Tween-20 (Sigma) in PBS (Gibco BRL). All antibodies used were diluted in this blocking solution. The following antibodies were applied: desmin polyclonal antibody (ICN Biomedicals) diluted 1:100, myosin monoclonal antibody diluted 1:100 (MF20; Developmental Studies Hybridoma Bank, University of Iowa), myosin polyclonal antibody L53 diluted 1:100 (a gift from Dr M. van den Hoff, AMC, The Netherlands), MANDYSl (a gift from Dr G. Morris, North East Wales Institute, UK) diluted 1:10 and NCL-DYS2 (Novacastra Laboratories Ltd) diluted 1:10 to detect dystrophin, NCL-a-SARC (Novacastra Laboratories Ltd) diluted 1:75, NCL-b-SARC (Novacastra Laboratories Ltd) diluted 1:50, NCL-g- SARC (Novacastra Laboratories Ltd) diluted 1:50 and NCL-b-DG (Novacastra Laboratories Ltd) diluted 1:50 to detect α-sarcoglycan, β-sarcoglycan, y- sarcoglycan and β-dystroglycan, respectively. After 1 h incubation, slides were rinsed and incubated for 1 h with the secondary antibodies Alexa Fluor 594 goat anti-rabbit conjugate diluted 1:1000 or Alexa Fluor 488 goat anti- mouse conjugate diluted 1:250 (Molecular Probes Inc). The slides were analysed using a Leica confocal microscope equipped with epifluorescence optics. Digital images were captured using a CCD camera (Photometries).
Example 2
Materials and methods
AONs and primers
A series of AONs (two per exon, see Table 2) was designed to bind to exon- internal target sequences showing a relatively high purine-content and, preferably, an open secondary pre-mRNA structure (at 37 °C), as predicted by the RNA mfold version 3.1 server [22]. The AONs varied in length between 15 and 24 bp, with G/C contents between 26 and 67%. They were synthesized with the following chemical modifications: a δ'-fruorescein group (6-FAM), a full-length phosphorothioate backbone and 2'-O-methyl modified ribose molecules (Eurogentec, Belgium). The primers used for reverse transcription— polymerase chain reaction (RT— PCR) analysis (Table 3) were synthesized by Eurogentec (Belgium) or by Isogen Bioscience BV (The Netherlands).
In vitro experiments
Primary human myoblasts were isolated from a muscle biopsy from a non- affected individual (KM108) by enzymatic dissociation. Briefly, the tissue was homogenized in a solution containing 5 mg/ml collagenase type VIII (Sigma), 5 mg/ml bovine albumin fraction V (Sigma), 1% trypsin (Gibco BRL) in PBS (Gibco BRL). Following serial incubation steps of 15 min at 37 °C, suspensions containing the dissociated cells were added to, and pooled in, an equal volume of proliferation medium (Nut.Mix F-10 (HAM) with GlutaMax-1, Gibco BRL) supplemented with 20% fetal bovine serum (Gibco BRL) and 1% penicillin/streptomycin solution (Gibco BRL). After centrifugation, the cells were plated and further cultured in proliferation medium, using flasks that were pre-coated with purified bovine dermal collagen (Vitrogen 100; Cohesion). The myogenic cell content of the culture, as determined by the percentage of desmin-positive cells in an immunohistochemical assay, was improved to 58% by repetitive preplating [23]. Myotubes were obtained from confluent myoblast cultures following 7-14 days of incubation in low-serum medium (DMEM
(Gibco BRL), supplemented with 2% GlutaMax-1, 1% glucose, 2% fetal bovine serum and 1% penicillin/streptomycin solution). For transfection of the myotube cultures, we used polyethylenimine (PEI; ExGen 500) according to the manufacturer's instructions (MBI Ferine ntas). The cultures were transfected for 3 h in low-serum medium with 1 mM of each AON linked to PEI at a ratio-equivalent of 3.5.
RNA isolation and RT-PCR analysis At 24 h post-transfection, total RNA was isolated from the myotube cultures using RNAzol B according to the manufacturer's instructions (Campro Scientific, The Netherlands). One microgram of RNA was then used for RT-PCR analysis using C. therm polymerase (Roche Diagnostics) in a 20 μl reaction at 60 °C for 30 min, primed with different DMD gene-specific reverse (RT) primers (Table 3). Primary PCRs were carried out with outer primer sets (see Table 3), for 20 cycles of 94 °C (40 s), 60 °C (40 s), and 72 °C (90 s). One microliter of this reaction was then reamplified in nested PCRs using the appropriate primer combinations (Table 3) for 32 cycles of 94 °C (40 s), 60 °C (40 s), and 72 °C (60 s). PCR products were analysed on 1.5 or 2% agarose gels. Sequence analysis RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems), and analysed on an ABI 3700 Sequencer (PE Applied Biosystems).
Results
In vitro exon skipping AONs were empirically analysed for the induction of exon skipping following transfection into human control myotube cultures, using the cationic polymer polyethylenimine (PEI). As determined by the nuclear uptake of the fluorescent AONs, average transfection efficiencies of 60-80% were obtained. At 24 h post-transfection, transcripts were analysed by RT— PCR using different primer combinations encompassing the targeted exons (Table 3). Of the 30 AONs tested, a total of 21 (70%) reproducibly generated shorter transcript fragments with sizes corresponding to the specific skipping of the targeted exons (Fig. 5 and Table 2). In fact, as confirmed by sequence analysis of the shorter transcripts (data not shown), we could induce the specific skipping of 13 out of the 15 exons targeted (five out of the seven in- frame exons, and eight out of the eight out-of-frame exons). No skipping of exons 47 and 48 was detected (Fig. 5e,g).
In the specific transcript regions that were screened in these experiments, we observed in the non-transfected control myotubes alternative splicing patterns around exons 2 and 29 (Fig. 5b,c). The alternative products were sequenced and found to be due to the skipping of exons 2—7 (in-frame), exons 3—7 (out-of-frame), exons 28-29 (in-frame), and exons 27—29 (in-frame). This genuinely occurring exon skipping was also detected previously in human skeletal muscle [24,25]. Remarkably, the level of the alternative splicing was significantly enhanced by the AON treatment of the transfected myotube cultures. Noteworthy also is the observation that h2AONl not only induced exon 2 skipping in the normal transcript, but also in one of the alternative transcripts consisting of exons 1 and 2 spliced to exon 8 (Fig. 5b).
The majority of AONs induced the precise skipping of the targeted exons, using the original splice sites of the adjacent exons. However, in response to h51AON2, an in-frame cryptic splice site was used in exon 51 (Fig. 5h). The level of this alternatively spliced product was variable in serial transfection experiments. Finally, in some of the transfection experiments, additional aberrant splicing fragments were detected due to the co-skipping of adjacent exons. Their incidence, however, was inconsistent, and at very low levels.
References to example 2 (numbering in this part refers strictly to numbering maintained in example 2)
[1] Hoffman EP, Brown Jr RH, Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 1987;51:919-928.
[2] Monaco AP, Bertelson CJ, Liechti-Gallati S, Moser H, Kunkel LM. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 1988;2:90-95.
[3] Koenig M, Beggs AH, Moyer M, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am J Hum Genet 1989;45:498-506.
[4] Zubrzycka-Gaarn EE, Bulman DE, Karpati G, et al. The Duchenne muscular dystrophy gene product is localized in sarcolemma of human skeletal muscle. Nature 1988;333:466-469.
[5] Yoshida M, Ozawa E. Glycoprotein complex anchoring dystrophin to sarcolemma. J Biochem (Tokyo) 1990;108:748-752.
[6] Ervasti JM, Campbell KP. Membrane organization of the dystrophinglycoprotein complex. Cell 1991;66:1121-1131. [7] Koenig M, Monaco AP, Kunkel LM. The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988;53:219-226. [8] van Deutekom JC, Floyd SS, Booth DK, et al. Implications of maturation for viral gene delivery to skeletal muscle. Neuromuscul Disord 1998;8:135- 148.
[9] Mayeda A, Hayase Y, Inoue H, Ohtsuka E, Ohshima Y. Surveying cis- acting sequences of pre-mRNA by adding antisense 20-O-methyl oligoribonucleotides to a splicing reaction. J Biochem (Tokyo) 1990; 108:399- 405. [10] Galderisi U, Cascino A, Giordano A. Antisense oligonucleotides as therapeutic agents. J Cell Physiol 1999;181:251-257. [11] Baker BF, Monia BP. Novel mechanisms for antisense-mediated regulation of gene expression. Biochim Biophys Acta 1999;1489:3-18. [12] Kole R, Sazani P. Antisense effects in the cell nucleus: modification of splicing. Curr Opin Mol Ther 2001;3:229-234.
[13] Sicinski P, Geng Y, Ryder-Cook AS, Barnard EA, Darlison MG, Barnard PJ. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 1989;244:1578-1580. [14] Dunckley MG, Manoharan M, Villiet P, Eperon IC, Dickson G. Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum Mol Genet 1998;7:1083-1090. [15] Mann CJ, Honeyman K, Cheng AJ, et al. Antisense -induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc Natl Acad Sci USA 2001;98:42-47. [16] Wilton SD, Lloyd F, Carville K, et al. Specific removal of the nonsense mutation from the mdx dystrophin mRNA using anti-sense oligonucleotides. Neuromuscul Disord 1999;9:330-338.
[17] Takeshima Y, Wada H, Yagi M, et al. Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient. Brain Dev 2001;23:788-790. [18] Pramono ZA, Takeshima Y, Alimsardjono H, Ishii A, Takeda S, Matsuo M. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem Biophys Res Commun 1996;226:445-449. [19] Watakabe A, Tanaka K, Shimura Y. The role of exon sequences in splice site selection. Genes Dev 1993;7:407-418.
[20] Tanaka K, Watakabe A, Shimura Y. Polyp urine sequences within a downstream exon function as a splicing enhancer. Mol Cell Biol 1994;14:1347— 1354. [21] van Deutekom JC, Bremmer-Bout M, Janson AA, et al. Antisenseinduced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum Mol Genet 2001;10:1547-1554. [22] Mathews DH, Sabina J, Zuker M, Turner DH. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999;288:911-940.
[23] Richler C, Yaffe D. The in vitro cultivation and differentiation capacities of myogenic cell lines. Dev Biol 1970;23:1-22.
[24] Surono A, Takeshima Y, Wibawa T, Pramono ZA, Matsuo M. Six novel transcripts that remove a huge intron ranging from 250 to 800 kb are produced by alternative splicing of the 50 region of the dystrophin gene in human skeletal muscle. Biochem Biophys Res Commun 1997;239:895-899. [25] Shiga N, Takeshima Y, Sakamoto H, et al. Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J Clin Invest 1997;100:2204r-2210.
[26] Wells DJ, Wells KE, Asante EA, et al. Expression of human fulllength and minidystrophin in transgenic mdx mice: implications for gene therapy of Duchenne muscular dystrophy. Hum Mol Genet 1995;4:1245-1250. [27] Sironi M, Pozzoli U, Cagliani R, Comi GP, Bardoni A, Bresolin N. Analysis of splicing parameters in the dystrophin gene: relevance for physiological and pathogenetic splicing mechanisms. Hum Genet 2001;109:73-84.
A. Aartsma-Rus et al. / Neuromuscular Disorders 12 (2002) S71-S77.
Example 3
RESULTS Double-exon skipping in two DMD patients
This study includes two DMD patients affected by different frame-disrupting mutations in the DMD gene that require the skip of two exons for correction of the reading frame (Table 5). Patient DL 90.3 carries a nonsense mutation in exon 43. Considering that this single exon is out-of-frame, the skipping of exon 43 would remove the nonsense mutation but not restore the reading frame. Since the combination with exon 44 is in-frame, we aimed in this patient at double-exon skipping, targeting both these exons. Patient DL 470.2 is affected by a deletion of exons 46 to 50. Frame restoration would require a double-exon skipping of both exons flanking the deletion. Myotubes cultures from both patients were transfected with a mixture of exon 43 and 44 specific AONs (DL90.3) or exon 45 and 51 specific AONs (DL470.2). The individual AONs (Table 5) were previously highly effective in single exon skipping. Transfection efficiencies were typically over 80%, as indicated by the number of cells with specific nuclear uptake of the fluorescent AONs. RT-PCR analysis at 24 to 48 hours post-transfection, indeed demonstrated the feasibility of specific double- exon skipping in both samples (Fig 6 and 7). This was confirmed by sequence analysis (data not shown). Additional shorter transcript fragments were obtained due to single-exon skipping: in patient DL 90.3 exon 44 skipping (Fig.6), and in patient DL470.2 exon 51 skipping (Fig.7). Multi-exon skipping
The splicing of exon 44 directly to exon 52 (as induced in DL470.2) generates an in-frame transcript. We hypothesized that by inducing the skipping of the entire stretch of exons in between, i.e. multi-exon skipping, we would induce a BMD-like deletion (45-51) that covers and restores several known, smaller, DMD mutations. This would further enlarge the group of DMD patients that would benefit from one type of frame correction. The feasibility of multi-exon skipping was first shown in human control myotubes that were treated with a mixture of the exon 45 and 51 specific AONs (Fig. 7; KM 109). We then applied it to myotubes from a third DMD patient carrying an exon 48-50 deletion
(50685.1). By the AON-induced skipping of the (remaining) stretch of exons in between, and including, exons 45 and 51, we obtained the anticipated smaller in-frame transcript with exon 44 spliced to exon 52 (Fig.7).
Double- and multi-exon skipping using a U-linked AON-combination
The skipping of more than one exon from one pre-mRNA molecule requires that both AONs are present in the same nucleus, targeting the same molecule. To enlarge this chance, we here studied the feasibility of one combined AON carrying both AONs specific for exons 45 and 51 (h45AON5 and lι51AON2) linked by 10 uracil nucleotides (Table 5). Following transfection of this "U- linker AON" into myotubes from human control, and the DMD patients DL470.2 and 50685.1, RT-PCR analysis demonstrated its efficacy to generate the anticipated in-frame transcript with exon 44 spliced to exon 52 (Fig.7). This multi-exon skipping occurred specifically and precisely at the exon- boundaries as confirmed by sequence analysis (data not shown). In contrast to patient DL 470.2, the U-linker AON was a slightly more efficient than the mixture of AONs in the human control and in patient 50685.1.
MATERIAL AND METHODS AONs and primers AONs (Table 5) targeting exons 43, 44 and 51 were previously described [Aartsma-Rus, 2002]. AONs targeting exon 45 were newly designed (sequences upon request). All AONs contain a 5' fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2'-O-methyl modified ribose molecules (Eurogentec, Belgium). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno- histochemical analyses. Primers for RT-PCR analysis (Table 5, sequences available upon request) were synthesised by Eurogentec (Belgium).
RNA isolation and RT-PCR analysis
At 24 to 48 h post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, The Netherlands). 300 ng of total RNA were used for RT-PCR analysis using C. therm polymerase (Roche Diagnostics, The Netherlands) in a 20 μl reaction at 60 °C for 30 min, primed with different DMD gene-specific reverse primers (Table 5). Primary PCRs were performed by 20 cycles of 94 °C (40 sec), 60 °C (40 sec) and 72 °C (60 sec). One μl of these reactions was then re-amplified in nested PCRs by 32 cycles of 94 °C (40 sec), 60 °C (40 sec) and 72 °C (60 sec). PCR products were analysed on 1.5% or 2% agarose gels. For quantification of the transcript products, nested PCR's were performed using 24 cycles. PCR products were analysed using the DNA 7500 LabChip® Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands).
Sequence Analysis
RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) and analysed on an ABI 3700 Sequencer (PE Applied Biosystems). Example 4.
Expression vectors encoding a transcript comprising an oligonucleotide of the invention.
Due to the defined turnover rate of both the dystrophin pre-mRNA and the AONs, our DMD frame-correction therapy would require repetitive administrations of AONs. In addition, relatively high levels of antisense RNA will be necessary within the nucleus, where transcription and splicing of the dystrophin pre-mRNA occur. Therefore, we have set up a vector system in which specific AON sequences are incorporated into a modified gene. In this example this embodiment is described for U7 small nuclear RNA (U7snRNA). U7snRNA is the RNA component of the U7 ribonucleoprotein particle (U7snRNP) that is involved in the processing of the 3' end of histone pre- mRNAs. Inherent to its function, U7snRNA is efficiently transported back from the cytoplasm to the nucleus in which it gets subsequently incorporated into very stable U7snRNP complexes. A similar approach was successfully applied in AON-based gene therapy studies on β-thalassemia (53, 54). In these studies, different plasmids were engineered containing a modified U7snRNA gene from which the natural antisense sequence directed to the histone pre- mRNA was replaced with antisense sequences targeted to different β- thalassemia-associated aberrant splicing sites in the β-globin gene. Following transfection of these plasmids, correct splicing and expression of the full- length β-globin protein could be restored with an efficiency of up to 65% in cultured cells expressing the different mutant β-globin genes.
We have engineered various U7snRNA gene constructs as described in reference 53 with the modification that the β-globin sequences were exactly replaced by the antisense sequences derived from the different AONs. In this example, the sequences were replaced by the antisense sequences of m46AON4, 6, 9, or 11 that were effective in inducing the skipping of mouse exon 46. A sense construct was included as negative control (m46SON6). Following construct validation by sequencing, the plasmids were tested in vitro by transfection into cultured C2C12 mouse myoblasts. The U7snRNA- m46AON6 construct was most efficient.
To enhance delivery of the AON-U7snRNA gene constructs, we have cloned them into recombinant adeno-associated viral (rAAV) vectors. AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper- dependent life cycle. In contrast to other viruses (adenovirus, retrovirus, and herpes simplex virus), rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle. Whereas application of rAAV in classical DMD "gene addition" studies has been hindered by its restricted packaging limits (< 5 kb), we apply rAAV for the efficient delivery of the much smaller U7snRNA antisense constructs (< 600 bp) to mature murine skeletal muscle. The rAAV-U7-AON vectors also contain the gene for green fluorescence protein (GFP-cDNA), which allows analysis of fransduction efficiencies in muscle post- injection. High titre virus productions were effective in inducing exon skipping.
Brief description of the drawings
Figure 1. RT-PCR and sequence analysis of dystrophin mRNA fragments of the AON-treated DMD patient myotube cultures, focussing on the regions encompassing the exons targeted for skipping. Shorter, novel transcripts were observed when compared to the untransfected myotube cultures (NT). Sequence analysis confirmed the precise skipping of the targeted exons. An alternatively spliced product, detected for patient 50685.1 (C) was sequenced and found to be derived from activation of a cryptic splice site in exon 51. Shorter fragments, detected in untransfected myotube cultures from DL 363.2 (B), DL 589.2 (D) and 53914.1 (E), were sequenced and found to be the result of the spontaneous skipping of exons 44, 50 and 53, respectively. Note that in some analyses, additional fragments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.
Figure 2. Immuno-histochemical analysis of the AON-treated myotube cultures from the 6 different DMD patients. Cells were stained for myosin to identify fully differentiated myotubes (not shown). Monoclonal antibodies MANDYSl (middle panel) and Dys2 (right panel) were used to detect dystrophin 1 to 4 days post-transfection. No dystrophin signals could be detected in untreated cells stained with MANDYSl (left panel) nor Dys2 (not shown), whereas clear, mainly cytoplasmatic, dystrophin signals could be detected for each patient upon the induced exon skipping. In patients DL 363.2 (B), DL 589.2 (D) and 53914.1 (E) dystrophin membrane signals could be observed. We note that membrane signals were more often found for Dys2, which recognizes the full-length dystrophin. MANDYSl recognizes an internal part of dystrophin and is more prone to generate cytoplasmatic signals, since it also detects dystrophin in the first stages of synthesis. Magnification 63x. Figure 3. Western blot analysis of the AON-treated myotube cultures. Monoclonal antibody DY4 was used to detect dystrophin. Protein extracts isolated from human control myotube cultures (HC) were used as a positive control (C and F). To avoid overexposure, this sample was 1 to 10 diluted. To demonstrate equal loading of protein samples, blots were additionally stained with an antibody against myosin. No, or, as a result of spontaneous exon skipping, very low (B and C) levels of dystrophin were detected in non- transfected myotube cultures (NT). Clear dystrophin signals were observed in AON-treated myotube cultures for each of the patients. For 50685.1 and DL 363.2, a time-course experiment was performed. Dystrophin could be detected 16 h post-transfection and was found at increasing levels at 24 h and 48 h post-transfection for 50685.1 (D). For DL 363.2 dystrophin could be detected in increasing levels up to 7 days post-transfection (B). For patients DL 515.2 (A), DL 363.2 (B) and DL 589.2 (E) the detected dystrophin was significantly shorter than the control dystrophin. This is due to the size of the deletions in these patients.
Figure 4. Immuno-histochemical analysis of 4 DGC proteins from treated myotube cultures from patient DL 363.2. Cells were stained for myosin to identify sufficiently differentiated myotubes (not shown). Monoclonal antibodies NCL-a-SARC, NCL-b-SARC, NCL-g-SARC and NCL-b-DG were used to detect α-sarcoglycan, β-sarcoglycan, γ-sarcoglycan and β-dystroglycan, respectively. These proteins were detected in reduced percentages (~40%) in untreated myotubes, and were mainly located in the cytoplasm (A). Following AON treatment, however, α-sarcoglycan was detected in 70%, β-sarcoglycan was detected in 90%, γ-sarcoglycan was detected in 90% and β-dystroglycan was detected in 80% of the myotubes, and the proteins were mostly membrane- bound (B). Magnification 63x. Fig. 5. RT-PCR analysis of human dystrophin mRNA in the regions encompassing the exons targeted for skipping. Shorter, novel transcript fragments were observed following transfection with the different AONs when compared to non-transfected myotube cultures (NT). Sequence analysis (not shown) confirmed the skipping of the targeted exons, as indicated by the labels adjacent to the images. Alternatively spliced products, detected in the regions around exon 2 (b), exon 29 (c), and exon 51 (h), were sequenced and found to be derived from either co-skipping of adjacent exons or usage of a cryptic splice site. No specific (RT— ) PCR products were obtained. In some analyses, additional fragments, lightly shorter than the wild-type products, were present. This was due to heteroduplex formation.
Figure 6. Double-exon skipping in DMD patient DL90.3 carrying a nonsense mutation in the out-of-frame exon 43. RT-PCR analysis of dystrophin mRNA fragments of AON-treated myotubes from this patient showed a shorter, novel transcript not present in untransfected myotubes (NT). Sequence analysis confirmed the precise skipping of the targeted exons 43 and 44. Besides this double-skip, we also detected a single exon 44 skip. Note that the additional fragment, slightly shorter than the wild-type product, is due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control.
Figure 7
Double- and multi-exon skipping in human control myotubes (KM 109), DMD patient DL 470.2, carrying a deletion of exons 46 to 50, and DMD patient 50685.1, carrying a deletion of exons 48 to 50. (A) RT-PCR analysis of dystrophin mRNA fragments in the myotube cultures treated with either a mixture of h45AON5 and h51AON2 (mix) or with a U-linked combination of AONs (U: h45AON5 linked to h51AON2 by 10 uracil nucleotides). In all samples treated with either the mix of AONs or the U-linker AON, a shorter transcript fragment was detected that contained exon 44 spliced to exon 52, and that was not present in untreated myotubes (NT). This novel, in-frame transcript arose from double-exon skipping in patient DL 470.2 (the targeted exons 45 and 51 are directly flanking the deletion), but from multi-exon skipping in both the human control and patient 50685.1. In the treated patient myotube cultures, additional shorter fragments were observed due to single- exon 45 and single-exon 51 skipping. Note that in some lanes, other f agments, slightly shorter than the wild-type products, were present. This was due to heteroduplex formation. 100 bp: size marker, -RT-PCR: negative control. (B) All fragments were quantified using the DNA 7500 labchip® and the Bioanalyzer (Agilent). The percentage of double- or multi-exon 45 to 51 skipping was determined by the ratio of this fragment to the total of transcript fragments. The U-combined AON seems less efficient in DL 470.2, but more efficient in KM 109 and 50685.1, when compared to the mixture of AONs.
References (to the general part, excluding example 2)
1. Hoffman, E. P., Brown, R. H., Jr., Kunkel, L. M. (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell, 51, 919-928.
2. Hoffman, E. P., Fischbeck, K. H., Brown, R. H., Johnson, M., Medori, R., Loike, J. D., Harris, J. B., Waterston, R., Brooke, M., Specht, L., et al. (1988) Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N. Engl. J. Med., 318, 1363-1368. 3. Den Dunnen, J. T., Grootscholten, P. M., Bakker, E., Blonden, L. A., Ginjaar, H. B., Wapenaar, M. C, van Paassen, H. M., van Broeckhoven, C, Pearson, P. L., van Ommen, G. J. (1989) Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum. Genet., 45, 835-847. 4. Koenig, M., Beggs, A. H., Moyer, M., Scherpf, S., Heindrich, K.,
Bettecken, T., Meng, G., Muller, C. R., Lindlof, M., Kaariainen, H., et al. (1989) The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am. J. Hum. Genet., 45, 498-506.
5. Tuffery-Giraud, S., Chambert, S., Demaillβ, J., Claustres, M. (1999) Point mutations in the dystrophin gene: evidence for frequent use of cryptic splice sites as a result of splicing defects. Hum. Mutat., 14, 359-368.
6. Prior, T. W., Bartolo, C, Pearl, D. K., Papp, A. C, Snyder, P. J., Sedra, M. S., Burghes, A. H., Mendell, J. R. (1995) Spectrum of small mutations in the dystrophin coding region. Am. J. Hum. Genet., 57, 22-33. 7. Moser, H. (1984) Duchenne muscular dystrophy: pathogenetic aspects and genetic prevention. Hum. Genet., 66, 17-40.
8. Emery, A. E. (2002) The muscular dystrophies. Lancet, 359, 687-695.
9. Yoshida, M., Ozawa, E. (1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem. (Tokyo), 108, 748-752. 10. Ervasti, J. M., Campbell, K. P. (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell, 66, 1121-1131.
11. Di Blasi, C, Morandi, L., Barresi, R., Blasevich, F., Cornelio, F., Mora, M. (1996) Dystrophin-associated protein abnormalities in dystrophin-deficient muscle fibers from symptomatic and asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta Neuropathol. (Berl), 92, 369-377.
12. Ervasti, J. M., Ohlendieck, K, Kahl, S. D., Gaver, M. G., Campbell, K. P. (1990) Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature, 345, 315-319. 13. Matsumura, K., Burghes, A. H., Mora, M., Tome, F. M., Morandi, L.,
Cornello, F., Leturcq, F., Jeanpierre, M., Kaplan, J. C, Reinert, P., et al. (1994) Immunohistochemical analysis of dystrophin-associated proteins in Becker/Duchenne muscular dystrophy with huge in-frame deletions in the NH2-terminal and rod domains of dystrophin. J. Clin. Invest., 93, 99-105. 14. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. (1988) An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 2, 90-95. 15. Clemens, P. R., Duncan, F. J. (2001) Progress in gene therapy for Duchenne muscular dystrophy. Curr. Neurol. Neurosci. Rep., 1, 89-96. 16. Khan, M. A. (1993) Corticosteroid therapy in Duchenne muscular dystrophy. J. Neurol. Sci., 120, 8-14.
17. De Angelis, F. G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., Bozzoni, I. (2002) Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. USA, 99, 9456-9461.
18. Mann, C. J., Honeyman, K., Cheng, A. J., Ly, T., Lloyd, F., Fletcher, S., Morgan, J. E., Partridge, T. A., Wilton, S. D. (2001) Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl. Acad. Sci. USA, 98, 42-47. 19. van Deutekom, J. C, Bremmer-Bout, M., Janson, A. A., Ginjaar, I. B., Baas, F., den Dunnen, J. T., van Ommen, G. J. (2001) Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum. Mol. Genet., 10, 1547-1554. 20. Wilton, S. D., Lloyd, F., Carville, K., Fletcher, S., Honeyman, K,
Agrawal, S., Kole, R. (1999) Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscul. Disord., 9, 330-338.
21. Dunckley, M. G., Manoharan, M., Villiet, P., Eperon, I. C, Dickson, G. (1998) Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet., 7, 1083-1090.
22. Takeshima, Y., Wada, H., Yagi, M., Ishikawa, Y., Minami, R., Nakamura, H., Matsuo, M. (2001) Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient. Brain Dev., 23, 788-790.
23. Aartsma-Rus, A., Bremmer-Bout, M., Janson, A., den Dunnen, J., van Ommen, G., van Deutekom, J. (2002) Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul. Disord., 12, S71. 24. Shiga, N., Takeshima, Y., Sakamoto, H., Inoue, K., Yokota, Y.,
Yokoyama, M., Matsuo, M. (1997) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest., 100, 2204-2210. 25. Cartegni, L., Chew, S. L., Krainer, A. R. (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet., 3, 285-298.
26. Schaal, T. D., Maniatis, T. (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol. Cell. Biol, 19, 261-273. 27. Takeshima, Y., Nishio, H., Sakamoto, H., Nakamura, H., Matsuo, M. (1995) Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe. J. Clin. Invest., 95, 515-520. 28. Pramono, Z. A., Takeshima, Y., Alimsardjono, H., Ishii, A., Takeda, S., Matsuo, M. (1996) Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem. Biophys. Res. Commun., 226, 445-449. 29. Koenig, M., Monaco, A. P., Kunkel, L. M. (1988) The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell, 53, 219-226.
30. Den Dunnen, J. (1996) The Leiden Muscular Dystrophy pages; http://www.dmd.nl.
31. Mann, C. J., Honeyman, K., McClorey, G., Fletcher, S., Wilton, S. D. (2002) Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene Med., 4, 644-654.
32. Kerr, T. P., Sewry, C. A., Robb, S. A., Roberts, R. G. (2001) Long mutant dystrophins and variable phenotypes: evasion of nonsense-mediated decay? Hum. Genet., 109, 402-407. 33. Klein, C. J., Coovert, D. D., Bulman, D. E., Ray, P. N., Mendell, J. R., Burghes, A. H. (1992) Somatic reversion/suppression in Duchenne muscular dystrophy (DMD): evidence supporting a frame-restoring mechanism in rare dystrophin-positive fibers. Am. J. Hum. Genet., 50, 950-959.
34. Sherratt, T. G., Vulliamy, T., Dubowitz, V., Sewry, C. A., Strong, P. N. (1993) Exon skipping and translation in patients with frameshift deletions in the dystrophin gene. Am. J. Hum. Genet., 53, 1007-1015.
35. Lu, Q. L., Morris, G. E., Wilton, S. D., Ly, T., Artem'yeva, O. V., Strong, P., Partridge, T. A. (2000) Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion. J. Cell Biol., 148, 985-996. 36. Nicholson, L. V., Johnson, M. A., Bushby, K. M., Ga dner-Medwin, D. (1993) Functional significance of dystrophin positive fibres in Duchenne muscular dystrophy. Arch. Dis. Child, 68, 632-636.
37. Vainzof, M., Passos-Bueno, M. R., Takata, R. I., Pavanello Rde, C, Zatz, M. (1993) Intrafamilial variability in dystrophin abundance correlated with difference in the severity of the phenotype. J. Neurol. Sci., 119, 38-42.
38. Singh, V., Sinha, S., Mishra, S., Chaturvedi, L. S., Pradhan, S., Mittal, R. D., Mittal, B. (1997) Proportion and pattern of dystrophin gene deletions in north Indian Duchenne and Becker muscular dystrophy patients. Hum. Genet., 99, 206-208.
39. Melacini, P., Fanin, M., Danieli, G. A., Fasoli, G., Villanova, C, Angelini, C, Vitiello, L., Miorelli, M., Buja, G. F., Mostacciuolo, M. L., et al. (1993) Cardiac involvement in Becker muscular dystrophy. J. Am. Coll. Cardiol., 22, 1927-1934. 40. Melis, M. A., Cau, M., Muntoni, F., Mateddu, A., Galanello, R., Boccone, L., Deidda, F., Loi, D., Cao, A. (1998) Elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families. Europ. J. Paediatr. Neurol., 2, 255-261.
41. Onengut, S., Kavaslar, G. N., Battaloglu, E., Serdaroglu, P., Deymeer, F., Ozdemir, C, Calafell, F., Tolun, A. (2000) Deletion pattern in the dystrophin gene in Turks and a comparison with Europeans and Indians. Ann. Hum. Genet., 64, 33-40.
42. Rosenberg, C, Navajas, L., Vagenas, D. F., Bakker, E., Vainzof, M., Passos-Bueno, M. R., Takata, R. I., Van Ommen, G. J., Zatz, M., Den Dunnen, J. T. (1998) Clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization. Neuromuscul. Disord., 8, 447-452.
43. Sertic, J., Barisic, N., Sostarko, M., Brzovic, Z., Stavljenic-Rukavina, A. (1997) Deletion screening of the Duchenne/Becker muscular dystrophy gene in Croatian population. Coll. Antropol., 21, 151-156. 44. Rando, T. A., Blau, H. M. (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J. Cell Biol., 125, 1275-1287.
45. Murry, C. E., Kay, M. A., Bartosek, T., Hauschka, S. D., Schwartz, S. M. (1996) Muscle differentiation during repair of myocardial necrosis in rats via gene transfer with MyoD. J. Clin. Invest., 98, 2209-2217.
46. Roest, P. A., van der Tuijn, A. C, Ginjaar, H. B., Hoeben, R. C, Hoger- Vorst, F. B., Bakker, E., den Dunnen, J. T., van Ommen, G. J. (1996) Application of in vitro Myo-differentiation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul. Disord., 6, 195-202.
47. Havenga, M. J., Lemckert, A. A., Ophorst, O. J., van Meijer, M., Germeraad, W. T., Grimbergen, J., van Den Doel, M. A., Vogels, R., van Deutekom, J., Janson, A. A., et al. (2002) Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J. Virol., 76, 4612- 4620.
48. Anderson, L. V., Davison, K. (1999) Multiplex Western blotting system for the analysis of muscular dystrophy proteins. Am. J. Pathol., 154, 1017- 1022. 49. Neugebauer, KM, et al., J Cell Biol 129:899-908 (1995).
50. Tacke R and Manley JL, Proc Soc Exp Biol Med 220:59-63 (1999).
51. Graveley BR et al, Curr Biol 9:R6-7 (1999).
52. Misteli T et al., Nature 387:523-527 (1997).
53. Gorman L, Suter D, Emerick V, et al. Stable alteration of pre mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998;95:4929 4934.
54. Suter D, Tomasini R, Reber U, et al. Double target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta thalassemic mutations. Hum Mol Genet 1999;8:2415 2423 Table 1.
Overview of the patients, the AONs and the primer sets used in this study
Figure imgf000048_0001
aAON sequences were published previously (23). bPrimer sequences available upon request.
Table 2
Characteristics of the AONs used to study the targeted skipping of 15 different DMD exons3
Name Antisense sequence (5 '-3') Length (bp) G/C% ϋ/C% Exon skip Transcript h2AON 1 cccauuuugugaauguuuucuuuu 24 29 75 + OF h2AON 2 uugugcauuuacccauuuugug 22 36 68 - OF h29AON 1 uauccucugaaugucgcauc 20 45 65 + IF h29AON 2 gguuauccucugaaugucgc 20 50 60 + IF h40AON 1 gagccuuuuuucuucuuug 19 37 79 + IF h40AON 2 uccuuucgucucugggcuc 19 58 79 + IF h41AON 1 cuccucuuucuucuucugc 19 47 95 + IF h41AON 2 cuucgaaacugagcaaauuu 20 35 50 + IF h42 ON 1 cuugugagacaugagug 17 47 41 + IF h42 ON 2 cagagacuccucuugcuu 18 50 67 + IF h43AON 1 ugcugcugucuucuugcu 18 50 78 - OF h43AON 2 uuguuaacuuuuucccauu 19 26 79 + OF h44AON 1 cgccgccauuucucaacag 19 58 63 + OF h44AON 2 uuuguauuuagcauguuccc 20 35 70 + OF h45AON 1 gcugaauuauuucuucccc 19 42 74 - OF h45AON 5 gcccaaugccauccugg 17 65 58 + OF h46AON 4b cugcuuccuccaacc 15 60 80 + OF h46AON 8b gcuuuucuuuuaguugcugc 20 40 75 + OF h47AON 1 ucuugcucuucugggcuu 18 50 78 - IF h47AON 2 cuugagcmiauuuucaaguuu 21 29 67 - IF h48AON 1 uuucuccuuguuucuc 16 38 94 - IF h48AON 2 ccauaaauuuccaacugauuc 21 33 62 - IF h49AON 1 cuuccacauccgguuguuu 19 47 74 -f- IF h49AON 2 guggcugguuuuuccuugu 19 47 68 + IF h50AON 1 cucagagcucagaucuu 17 47 59 + OF h50AON 2 ggcugcuuugcccuc 15 67 73 - OF h51AON 1 ucaaggaagauggcauuucu 20 40 45 + OF h51AON 2 ccucugugauuuuauaacuugau 23 30 65 + OF
Figure imgf000049_0001
h53AON 1 cuguugccuccgguucug 18 61 72 + OF h53AON 2 uuggcucuggccuguccu 18 61 72 - OF
a Two AONs were tested per exon. Their different lengths and G/C contents (%) did not correlate to their effectivity in exon skipping (1, induced skipping, 2, no skipping) . The AONs were directed to purine (A/G) - rich sequences as indicated by their (antisense) ϋ/C content (%) . Skipping of the target exons resulted in either an in-frame (IF) or an out-of-frame (OF) transcript. b van Deutekom et al., 2001 [21].
Figure imgf000050_0001
Figure imgf000050_0002
Table 3
Primer sets used for the RT-PCR analyses to detect the skipping of the targeted exons6
Target exon RT-primer Primary PCR Nested PCR primer set primer set
2 h4r hlfl-h4r hlf2-h3r 2 h9r hlfl-h9r hlf2-h8r
29 h31r h25f-h31r h26f-h30r 40 h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r 42 h44r h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r h41f-h47r h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r h45f-h47r 47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h4βf-h51r 49 h52r h44f-h52r h46f-h51r 50 h52r h44f-h52r h4βf-h51r 51 h53r h47f-h53r h49f-h52r 53 h55r h50f-h55r h51f-h54r
Primer sequences are available upon request,
Figure imgf000051_0001
Figure imgf000051_0002
Table 4
Overview and frequency of the DMD-causing mutations in the Leiden DMD (LDMD) Database, theoretically correctable by skipping one of the 12 exons successfully targeted in this study
Skippable exon Therapeutic for DMD-mutations :
Deletions % of deletions Duplications % of duplications No. of nonsense
(exons) in LDMD Database (exons) in LDMD Database mutations in
(exons) LDMD Database
2 3-7, 3-19, 3-21 2.9 9.0
29 5
40 1
41 4
42 0
43 44, 44-47, 44-49, 3.7 43 3.0 44-51
44 5-43, 14-43, 19-43, 7.: 44 3.0
30-43, 35-43,
36-43, 40-43, 42-43,
45, 45-54
46 21-45, 45, 47-54, 5.6 47-56
49 50 51, 51-53, 51-55 5.2 50 3.0 51 45-50, 47-50, 48-50, 17.5 51 1.5
49-50, 50, 52,
52-63
53 10-52, 45-52, 46-52, 7.5
47-52, 48-52, 49-52,
50-52, 52
Figure imgf000052_0001
Table 5.
Overview of the patients, the AONs and the primer sets used in example 3
Figure imgf000053_0001
aSeperate AON sequences were published previously [Aartsma-Rus, 2002]. bPrimer sequences available upon request.
CU linker AON consists of h45AONδ linked to h51AON2 by 10 uracils.

Claims

Claims
1. A method for generating an oligonucleotide comprising determining, from a secondary structure of RNA from an exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and δ subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is complementary to said closed structure and of which at least another part of said oligonucleotide is complementary to said open structure.
2. A method according to claim 1, wherein said open and closed structures are adjacent to each other. 0
3. A method according to claim 1 or claim 2, wherein said oligonucleotide is complementary to a consecutive part of between 14 and 50 nucleotides of said RNA.
4. A method according to any one of claims 1-3, wherein said oligonucleotide comprises RNA.
5 5. A method according to claim 4, wherein said RNA contains a modification.
6. A method according to any one of claims 1-δ, wherein pre-mRNA comprising said exon exhibits undesired splicing in a subject.
7. A method according to claim 6, wherein the absence of said exon 0 from mRNA produced from said pre-mRNA, generates a coding region for a protein.
8. A method according to claim 6 or claim 7, wherein the gene from which said RNA comprising said exon is transcribed, encodes an aberrant Duchenne muscular dystrophy gene (DMD), a collagen VI alpha 1 gene δ (COL6A1), a myotubular myopathy 1 gene (MTMl), a dysferlin gene (DYSF), a laminin-alpha 2 gene (LAMA2), an emery-dreyfuss muscular dystrophy gene (EMD), and/or a calpain 3 gene (CAPN3).
9. A method according to claim 8, wherein said gene is the Duchenne muscular dystrophy gene.
10. A method according to any one of claims 9, wherein said exon comprises exon 2, 8, 9, 17, 19, 29, 40-46, 49-δ3, δδ or 59.
11. A method according to any one of claims 1-9, wherein an equivalent of said oligonucleotide is generated comprising similar hybridisation characteristics in kind not necessarily in amount.
12. A method according to claim 11, wherein said equivalent comprises peptide nucleic acid, locked nucleic acid and/or a morpholino phosphorodiamidate.
13. A method according to claim 12, wherein said equivalent comprises locked nucleic acid.
14. A method according to any one of claims 1-13, wherein the oligonucleotide or equivalent thereof, does not overlap a splice donor and/or a splice acceptor sequence of said exon.
15. An oligonucleotide or equivalent thereof obtainable by a method according to any one of claims 1-14.
16. A compound capable of hybridising to at least two exons in a pre- mRNA encoded by a gene, said compound comprising at least two parts wherein a first part comprises an oligonucleotide having at least 8 consecutive nucleotides that are complementary to a first of said at least two exons, and wherein a second part comprises an oligonucleotide having at least 8 consecutive nucleotides that are complementary to a second exon in said pre- mRNA.
17. A compound according to claim 16, wherein said compound comprises between 16 to 80 nucleotides.
18. A compound according to claim 16 or claim 17, wherein said first and said second exon are separated in said pre-mRNA by at least one exon to which said oligonucleotide is not complementary.
19. A compound according to any one of claims 16-18, wherein stretches of nucleotides complementary to said at least two exons are separated by a linking moiety.
20. A compound according to claim 19, wherein said linking moiety comprises between 4-40 nucleotides.
21. An oligonucleotide or compound according to any one of claims 16- 20, comprising an oligonucleotide or an equivalent thereof, comprising similar δ hybridisation characteristics in kind not necessarily in amount.
22. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims lδ-21, for at least in part altering recognition of said exon, or exons in a pre-mRNA.
23. Use of an oligonucleotide, equivalent thereof or compound according 0 to any one of claims lδ-21, for the preparation of a medicament.
24. A pharmaceutical preparation comprising an oligonucleotide, equivalent thereof or compound according to any one of claims lδ-21.
25. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for the preparation of a medicament for the 5 treatment of an inherited disease.
26. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for inducing exon skipping in a pre-mRNA.
27. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for altering exon-recognition in a pre-mRNA 0
28. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for altering the efficiency with which a splice donor or splice acceptor sequence is used by a splicing machinery.
29. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for inducing exon-skipping of two or more exons in 5 a pre-mRNA.
30. Use of an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, for inducing exon-skipping of three or more exons in a pre-mRNA.
31. Use of an oligonucleotide, equivalent thereof or compound according 0 to any one of claims 15-21, for inducing skipping of said at least two exons and a sequence located between said at least two exons (intervening sequence) on said pre-mRNA.
32. Use according to claim 31, wherein said intervening sequence comprises a further exon or exons.
33. A method for altering the efficiency with which an exon in a pre- mRNA is recognized by a splicing machinery, said pre-mRNA being encoded by a gene comprising at least two exons and at least one intron, said method comprising providing a transcription system comprising said splicing machinery and said gene, with an oligonucleotide, equivalent thereof or compound according to any one of claims 15-21, wherein said oligonucleotide, equivalent or compound is capable of hybridising to at least one of said exons, and allowing for transcription and splicing to occur in said transcription system.
34. A method according to claim 33, wherein said gene comprises at least 3 exons.
PCT/NL2003/000214 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure WO2004083432A1 (en)

Priority Applications (37)

Application Number Priority Date Filing Date Title
PCT/NL2003/000214 WO2004083432A1 (en) 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
AU2003225410A AU2003225410A1 (en) 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
CA2524255A CA2524255C (en) 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
CA2855229A CA2855229C (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
ES04722479.5T ES2452293T3 (en) 2003-03-21 2004-03-22 Modulation of exon identification in pre-mRNA by interference with the secondary structure of the RNA
JP2006507857A JP2006523101A (en) 2003-03-21 2004-03-22 Regulation of exon recognition in pre-mRNA by interference of RNA secondary structure
PCT/NL2004/000196 WO2004083446A2 (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
AU2004221495A AU2004221495C1 (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
EP04722479.5A EP1606407B1 (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
CA2519863A CA2519863C (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
NZ543115A NZ543115A (en) 2003-03-21 2004-03-22 Compound capable of inducing skipping of two or more exons, is that more than one exon can be skipped with a single pharmaceutical for treating many different Duchenne or Becker mutations
US11/233,495 US9896687B2 (en) 2003-03-21 2005-09-21 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US11/233,507 US20060099616A1 (en) 2003-03-21 2005-09-21 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
HK06107022.1A HK1084694A1 (en) 2003-03-21 2006-06-20 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US12/198,007 US7534879B2 (en) 2003-03-21 2008-08-25 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
AU2009240879A AU2009240879B2 (en) 2003-03-21 2009-11-27 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US12/976,381 US8759507B2 (en) 2003-03-21 2010-12-22 Modulation of exon recognition in pre-mRNA by interfering RNA structure
JP2011001581A JP5378423B2 (en) 2003-03-21 2011-01-07 Regulation of exon recognition in pre-mRNA by interference of RNA secondary structure
US13/550,210 US10100304B2 (en) 2003-03-21 2012-07-16 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US13/718,666 US20130302806A1 (en) 2003-03-21 2012-12-18 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
JP2014011980A JP5973477B2 (en) 2003-03-21 2014-01-27 Regulation of exon recognition in pre-mRNA by interference of RNA secondary structure
US14/198,992 US10190116B2 (en) 2003-03-21 2014-03-06 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US14/248,279 US10113165B2 (en) 2003-03-21 2014-04-08 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US14/295,311 US20140357855A1 (en) 2003-03-21 2014-06-03 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US14/295,298 US20140357698A1 (en) 2003-03-21 2014-06-03 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US14/313,152 US20140378527A1 (en) 2003-03-21 2014-06-24 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US14/688,871 US20150218559A1 (en) 2003-03-21 2015-04-16 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US15/047,233 US20160194636A1 (en) 2003-03-21 2016-02-18 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US15/053,185 US20160168570A1 (en) 2003-03-21 2016-02-25 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US15/057,861 US20160251658A1 (en) 2003-03-21 2016-03-01 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US15/098,589 US20160355810A1 (en) 2003-03-21 2016-04-14 Modulation of Exon Recognition in Pre-mRNA By Interfering with the Secondary RNA Structure
US15/479,639 US20170268003A1 (en) 2003-03-21 2017-04-05 Methods of Inducing Exon Skipping
US15/479,646 US20170275624A1 (en) 2003-03-21 2017-04-05 Methods of Inducing Exon Skipping
US16/105,926 US10544416B2 (en) 2003-03-21 2018-08-20 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US16/230,927 US20190225964A1 (en) 2003-03-21 2018-12-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US16/277,593 US20190241892A1 (en) 2003-03-21 2019-02-15 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US16/709,628 US11208657B2 (en) 2003-03-21 2019-12-10 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/NL2003/000214 WO2004083432A1 (en) 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/248,279 Continuation US10113165B2 (en) 2003-03-21 2014-04-08 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/233,495 Continuation US9896687B2 (en) 2003-03-21 2005-09-21 Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

Publications (1)

Publication Number Publication Date
WO2004083432A1 true WO2004083432A1 (en) 2004-09-30

Family

ID=33028995

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/NL2003/000214 WO2004083432A1 (en) 2003-03-21 2003-03-21 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
PCT/NL2004/000196 WO2004083446A2 (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/NL2004/000196 WO2004083446A2 (en) 2003-03-21 2004-03-22 Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure

Country Status (9)

Country Link
US (22) US9896687B2 (en)
EP (1) EP1606407B1 (en)
JP (3) JP2006523101A (en)
AU (3) AU2003225410A1 (en)
CA (3) CA2524255C (en)
ES (1) ES2452293T3 (en)
HK (1) HK1084694A1 (en)
NZ (1) NZ543115A (en)
WO (2) WO2004083432A1 (en)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006000057A1 (en) * 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Antisense oligonucleotides for inducing exon skipping and methods of use thereof
WO2006112705A2 (en) * 2005-04-22 2006-10-26 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the binding of sr proteins and by interfering with secondary rna structure.
WO2007133812A2 (en) * 2005-12-30 2007-11-22 Philadelphia Health & Education Corporation, D/B/A Drexel University College Of Medicine Improved carriers for delivery of nucleic acid agents to cells and tissues
US7534879B2 (en) 2003-03-21 2009-05-19 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
JP2009537129A (en) * 2006-05-19 2009-10-29 アカデミッシュ ジーケンフイス ライデン Means and methods for inducing exon skipping
US7902160B2 (en) 2002-11-25 2011-03-08 Masafumi Matsuo ENA nucleic acid drugs modifying splicing in mRNA precursor
WO2011053144A2 (en) 2009-10-29 2011-05-05 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Methods and compositions for dysferlin exon-skipping
WO2011054659A1 (en) * 2009-10-16 2011-05-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Exon skipping therapy for dysferlinopathies
WO2011078672A1 (en) 2009-12-24 2011-06-30 Prosensa Technologies B.V. Molecule for treating an inflammatory disorder
US7973015B2 (en) 2000-09-21 2011-07-05 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
US8067569B2 (en) 2000-05-04 2011-11-29 Avi Biopharma, Inc. Splice-region antisense composition and method
ITRM20100310A1 (en) * 2010-06-08 2011-12-09 Amsterdam Molecular Therapeutics Amt Ip B V MODIFIED SNRNAS FOR USE IN THERAPY
US8084601B2 (en) 2008-09-11 2011-12-27 Royal Holloway And Bedford New College Royal Holloway, University Of London Oligomers
WO2012018257A1 (en) * 2010-08-05 2012-02-09 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins
US8263760B2 (en) 2008-02-08 2012-09-11 Prosensa Holding Bv Methods and means for treating DNA repeat instability associated genetic disorders
US8268962B2 (en) 2007-07-12 2012-09-18 Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs or tissues
US8304398B2 (en) 2006-04-20 2012-11-06 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly or abnormally expressed gene
EP2614827A2 (en) 2007-10-26 2013-07-17 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
US8609065B2 (en) 2007-07-12 2013-12-17 Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs, tissues or tumor cells
US8637483B2 (en) 2009-11-12 2014-01-28 The University Of Western Australia Antisense molecules and methods for treating pathologies
US8865883B2 (en) 2008-10-24 2014-10-21 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9139828B2 (en) 2008-05-14 2015-09-22 Prosensa Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US9217148B2 (en) 2013-03-14 2015-12-22 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US9506058B2 (en) 2013-03-15 2016-11-29 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
WO2018005805A1 (en) 2016-06-30 2018-01-04 Sarepta Therapeutics, Inc. Exon skipping oligomers for muscular dystrophy
US9890379B2 (en) 2006-08-11 2018-02-13 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
CN108026531A (en) * 2015-09-15 2018-05-11 日本新药株式会社 Antisensenucleic acids
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
WO2018118662A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2018118627A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2018118599A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
RU2674600C2 (en) * 2012-07-03 2018-12-11 Просенса Текнолоджиз Б.В. Oligonucleotide for treatment of muscular dystrophy patients
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10179912B2 (en) 2012-01-27 2019-01-15 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
WO2019059973A1 (en) 2017-09-22 2019-03-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2019067981A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
WO2019067975A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
WO2019067979A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
EP3018211B1 (en) 2010-09-01 2019-08-07 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10450568B2 (en) 2015-10-09 2019-10-22 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US10533171B2 (en) 2009-04-24 2020-01-14 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US10563198B2 (en) 2015-03-11 2020-02-18 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
US10758629B2 (en) 2018-05-29 2020-09-01 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
USRE48468E1 (en) 2007-10-26 2021-03-16 Biomarin Technologies B.V. Means and methods for counteracting muscle disorders
US11053494B2 (en) 2014-08-09 2021-07-06 Research Institute At Nationwide Children's Hospital Methods and materials for activating an internal ribosome entry site in exon 5 of the DMD gene
WO2021172498A1 (en) 2020-02-28 2021-09-02 日本新薬株式会社 Antisense nucleic acid inducing skipping of exon 51
US11230707B2 (en) 2013-04-20 2022-01-25 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted U7SNRNA polynucleotide constructs
USRE48960E1 (en) 2004-06-28 2022-03-08 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof

Families Citing this family (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2874384B1 (en) * 2004-08-17 2010-07-30 Genethon ADENO-ASSOCIATED VIRAL VECTOR FOR PRODUCING EXON JUMP IN A GENE ENCODING A PROTEIN WITH DISPENSABLE DOMAINS
NL1027479C2 (en) * 2004-10-21 2006-05-01 Synvolux Ip B V Protection of biologically active molecules with the help of amphiphiles.
CA2596506C (en) 2005-02-09 2021-04-06 Avi Biopharma, Inc. Antisense composition and method for treating muscle atrophy
CN101213203A (en) * 2005-04-29 2008-07-02 教堂山北卡罗莱纳州大学 Methods and compositions for regulated expression of nucleic acid at post-transcriptional level
US7785834B2 (en) * 2005-11-10 2010-08-31 Ercole Biotech, Inc. Soluble TNF receptors and their use in treatment of disease
KR101789603B1 (en) * 2005-11-10 2017-11-21 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 Splice switching oligomers for tnf superfamily receptors and their use in treatment of disease
US20090264353A1 (en) * 2007-10-19 2009-10-22 Santaris Pharma A/S Splice Switching Oligomers for TNF Superfamily Receptors and their Use in Treatment of Disease
ES2532634T5 (en) * 2008-10-27 2018-04-30 Biomarin Technologies B.V. Procedures and means for efficient skipping of exon 45 in the pre-mRNA of Duchenne muscular dystrophy
JP2012523225A (en) 2009-04-10 2012-10-04 アソシアシオン・アンスティテュ・ドゥ・ミオロジー Tricyclo-DNA antisense oligonucleotides, compositions and methods for treatment of disease
US20100303776A1 (en) * 2009-04-16 2010-12-02 The University Of North Carolina At Chapel Hill Methods and compositions for regulated expression of multiple nucleic acids
KR101742334B1 (en) * 2009-05-08 2017-06-01 큐알엔에이, 인크. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to dmd family
WO2011024077A2 (en) * 2009-08-31 2011-03-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Exon skipping therapy for functional amelioration of semi functional dystrophin in becker and duchenne muscular dystrophy
AU2014280918B2 (en) * 2009-12-18 2016-11-17 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat HSF1-related diseases
US8293718B2 (en) 2009-12-18 2012-10-23 Novartis Ag Organic compositions to treat HSF1-related diseases
JP5795072B2 (en) 2010-10-22 2015-10-14 ソンギュングヮン ユニバーシティ ファウンデーション フォー コーポレート コラボレーション Nucleic acid molecules that induce RNA interference and uses thereof
WO2012138223A2 (en) 2011-04-05 2012-10-11 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Compounds and methods for altering activin receptor-like kinase signalling
JP5850519B2 (en) 2011-05-09 2016-02-03 ネッパジーン株式会社 A therapeutic agent for muscular dystrophy containing morpholino-loaded bubble liposomes as active ingredients
GB201115218D0 (en) * 2011-09-02 2011-10-19 Glaxo Group Ltd Novel process
US20130085139A1 (en) 2011-10-04 2013-04-04 Royal Holloway And Bedford New College Oligomers
CA2861247C (en) * 2011-12-28 2021-11-16 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
CN108148838A (en) 2012-05-22 2018-06-12 奥利克斯医药有限公司 The nucleic acid molecules and purposes of induction RNA interference with intracellular penetration capacity
DK2970964T3 (en) 2013-03-14 2019-04-01 Sarepta Therapeutics Inc EXON SKIPPING COMPOSITIONS FOR TREATMENT OF MUSCLE DYROPHY
CA2936829A1 (en) 2014-01-24 2015-07-30 Am-Pharma B.V. Downstream processing of an alkaline phosphatase
RU2683635C2 (en) 2014-01-24 2019-03-29 Ам-Фарма Б.В. Hybrid proteins alike alkaline phosphatase
GB201410693D0 (en) 2014-06-16 2014-07-30 Univ Southampton Splicing modulation
US9840706B2 (en) * 2014-06-17 2017-12-12 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US9976143B2 (en) 2014-10-03 2018-05-22 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
MA41795A (en) 2015-03-18 2018-01-23 Sarepta Therapeutics Inc EXCLUSION OF AN EXON INDUCED BY ANTISENSE COMPOUNDS IN MYOSTATIN
JP2018530560A (en) 2015-10-09 2018-10-18 サレプタ セラピューティクス, インコーポレイテッド Compositions and methods for the treatment of Duchenne muscular dystrophy and related disorders
EP3359685A1 (en) 2015-10-09 2018-08-15 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
FR3044926B1 (en) 2015-12-09 2020-01-31 Genethon EFFICIENT GENE THERAPY TOOLS FOR JUMPING DYSTROPHIN EXON 53
WO2017106377A1 (en) 2015-12-14 2017-06-22 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant mental retardation-5 and dravet syndrome
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
WO2018007475A1 (en) 2016-07-05 2018-01-11 Biomarin Technologies B.V. Pre-mrna splice switching or modulating oligonucleotides comprising bicyclic scaffold moieties, with improved characteristics for the treatment of genetic disorders
US11655470B2 (en) 2016-07-05 2023-05-23 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Diagnosing COL6-related disorders and methods for treating same
GB201711809D0 (en) * 2017-07-21 2017-09-06 Governors Of The Univ Of Alberta Antisense oligonucleotide
CN111278991B (en) 2017-08-25 2022-04-01 斯托克制药公司 Antisense oligomers for the treatment of conditions and diseases
GB2610100B (en) * 2017-10-23 2023-08-16 Stoke Therapeutics Inc Antisense oligomers for treatment of non-sense mediated RNA decay based conditions and diseases
CA3108282A1 (en) 2018-08-02 2020-02-06 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
WO2020028864A1 (en) 2018-08-02 2020-02-06 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US20220235354A1 (en) * 2019-04-25 2022-07-28 Avidity Biosciences, Inc. Nucleic acid compositions and methods of multi-exon skipping
CA3165316A1 (en) * 2019-12-19 2021-06-24 Nippon Shinyaku Co., Ltd. Antisense nucleic acid enabling exon skipping
CA3173647A1 (en) 2020-05-11 2021-11-18 Isabel AZNAREZ Opa1 antisense oligomers for treatment of conditions and diseases
AU2022271873A1 (en) 2021-05-10 2024-01-04 Entrada Therapeutics, Inc. Compositions and methods for intracellular therapeutics
WO2022271818A1 (en) 2021-06-23 2022-12-29 Entrada Therapeutics, Inc. Antisense compounds and methods for targeting cug repeats
TW202307208A (en) * 2021-06-23 2023-02-16 日商日本新藥股份有限公司 Combination of antisense oligomers
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
EP4215614A1 (en) 2022-01-24 2023-07-26 Dynacure Combination therapy for dystrophin-related diseases

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1133993A1 (en) * 2000-03-10 2001-09-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Substances for the treatment of spinal muscular atrophy
EP1191097A1 (en) * 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induction of exon skipping in eukaryotic cells

Family Cites Families (123)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US115824A (en) * 1871-06-13 Improvement in wheel-borers and key-way cutters
US49173A (en) * 1865-08-01 Improvement in sled-brakes
US56077A (en) * 1866-07-03 Improvement in harness-motion of looms
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5541308A (en) * 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5766847A (en) * 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
DE3834636A1 (en) 1988-10-11 1990-04-19 Max Planck Gesellschaft METHOD FOR ANALYZING LENGTH POLYMORPHISMS IN DNA AREAS
US6867195B1 (en) * 1989-03-21 2005-03-15 Vical Incorporated Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
FR2675803B1 (en) * 1991-04-25 1996-09-06 Genset Sa CLOSED, ANTISENSE AND SENSE OLIGONUCLEOTIDES AND THEIR APPLICATIONS.
CA2082411A1 (en) * 1991-06-28 1992-12-29 Robert D. Rosenberg Localized oligonucleotide therapy
JPH07501204A (en) 1991-06-28 1995-02-09 マサチューセッツ インスティテュート オブ テクノロジー Topical oligonucleotide therapy
US6200747B1 (en) * 1992-01-28 2001-03-13 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5869252A (en) * 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
US6172208B1 (en) * 1992-07-06 2001-01-09 Genzyme Corporation Oligonucleotides modified with conjugate groups
US5418139A (en) * 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
CA2116280A1 (en) 1993-03-05 1994-09-06 Marcy E. Macdonald Huntingtin dna, protein and uses thereof
EP0698092B1 (en) * 1993-05-11 2007-07-25 The University Of North Carolina At Chapel Hill Antisense oligonucleotides which combat aberrant splicing and methods of using the same
US5741645A (en) * 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5627263A (en) * 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
DE4342605A1 (en) 1993-12-14 1995-06-22 Buna Gmbh Functionalized olefin homo- and copolymers
US5962332A (en) * 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
DE69503126T2 (en) 1994-05-05 1998-11-12 Beckman Instruments Inc REPETITIVE OLIGONUCLEOTIDE MATRIX
US5968909A (en) 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
US5854223A (en) 1995-10-06 1998-12-29 The Trustees Of Columbia University In The City Of New York S-DC28 as an antirestenosis agent after balloon injury
US20070173465A9 (en) 1995-10-11 2007-07-26 Monahan Sean D Expression of zeta negative and zeta positive nucleic acids using a dystrophin gene
US7034009B2 (en) 1995-10-26 2006-04-25 Sirna Therapeutics, Inc. Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US6300060B1 (en) * 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
PT862629E (en) * 1995-11-23 2002-01-30 Amgen Inc EPITHELIAL MEMBRANE PROTEIN-1
US6392069B2 (en) * 1996-01-08 2002-05-21 Canji, Inc. Compositions for enhancing delivery of nucleic acids to cells
TR199801581T2 (en) 1996-02-14 1998-10-21 Isis Pharmaceuticals, Inc. �ekerle de�i�tirilmi� bo�luklu oligon�kleotid’ler.
EP0869186A4 (en) * 1996-07-18 2002-04-03 Srl Inc Method for the diagnosis of spinocerebellar ataxia type 2 and primers therefor
IL128124A0 (en) * 1996-08-02 1999-11-30 Genesense Technologies Inc Antitumor antisense sequences directed against r1 and r2 components of ribonucleotide reductase
EP0878543A1 (en) 1996-10-30 1998-11-18 Srl, Inc. cDNA FRAGMENTS OF GENE CAUSATIVE OF SPINOCEREBELLAR ATAXIA TYPE 2
US5853995A (en) * 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
AU6591798A (en) 1997-03-31 1998-10-22 Yale University Nucleic acid catalysts
US20020137890A1 (en) * 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
AU7265298A (en) 1997-04-29 1998-11-24 Trustees Of Boston University Methods and compositions for targeted dna differential display
US6329501B1 (en) 1997-05-29 2001-12-11 Auburn University Methods and compositions for targeting compounds to muscle
US6280938B1 (en) * 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
US6514755B1 (en) * 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
US6794499B2 (en) * 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
AU750947C (en) 1997-09-22 2003-05-22 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Nucleic acid catalysts with endonuclease activity
US6130207A (en) * 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
JP3012923B2 (en) * 1998-01-26 2000-02-28 新潟大学長 Drug for treating CAG repeat disease
KR100280219B1 (en) * 1998-02-26 2001-04-02 이수빈 Diagnostic Method and Diagnostic Reagent of Neuropsychiatric Disease Using Trinucleic Acid Repeat Sequence
US6322978B1 (en) * 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
JP2002512794A (en) 1998-04-29 2002-05-08 リボザイム・ファーマシューティカルズ・インコーポレーテッド Nucleotide triphosphates and their incorporation into ribozymes
US20030096955A1 (en) * 1998-09-01 2003-05-22 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO2000018895A1 (en) * 1998-09-25 2000-04-06 The Children's Medical Center Corporation Short peptides which selectively modulate the activity of protein kinases
US6210892B1 (en) * 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
ATE332969T1 (en) 1998-10-26 2006-08-15 Avi Biopharma Inc MORPHOLINE-BASED P53 ANTISENSE OLIGONUCLEOTIDE AND USES THEREOF
US6399575B1 (en) * 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US6133031A (en) * 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
US20040226056A1 (en) * 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US20020049173A1 (en) * 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) * 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
JP2000325085A (en) * 1999-05-21 2000-11-28 Masafumi Matsuo Pharmaceutical composition for treatment of duchenne muscular dystrophy
US20030236214A1 (en) * 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
AU5625500A (en) * 1999-06-18 2001-01-09 Emory University Huntington disease cellular model: stably transfected pc12 cells expressing mutant huntingtin
JP2004512810A (en) 1999-08-31 2004-04-30 サーナ・セラピューティクス・インコーポレイテッド Modulators of gene expression based on nucleic acids
US6165786A (en) * 1999-11-03 2000-12-26 Isis Pharmaceuticals, Inc. Antisense modulation of nucleolin expression
EP1257639A2 (en) 2000-02-08 2002-11-20 Ribozyme Pharmaceuticals, Inc. Nucleozymes with endonuclease activity
US6211164B1 (en) * 2000-03-10 2001-04-03 Abbott Laboratories Antisense oligonucleotides of the human chk1 gene and uses thereof
US20020187931A1 (en) 2000-04-13 2002-12-12 Michael Hayden Modulating cell survival by modulating huntingtin function
US6653467B1 (en) 2000-04-26 2003-11-25 Jcr Pharmaceutical Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
DE60139394D1 (en) 2000-04-28 2009-09-10 Asklepios Biopharmaceutical In DNA Sequencing Coding for the Dystrophin-Minigene and Method of Using the Same
CA2407942A1 (en) 2000-05-01 2001-11-08 Hybridon, Inc. Modulation of oligonucleotide cpg-mediated immune stimulation by positional modification of nucleosides
AU2001259706A1 (en) * 2000-05-09 2001-11-20 Reliable Biopharmaceutical, Inc. Polymeric compounds useful as prodrugs
EP1294866B1 (en) * 2000-05-31 2010-04-14 Serono Genetics Institute S.A. Use of acrp30 globular head to promote increases in muscle mass and muscle differentiation
CN1326990A (en) 2000-06-07 2001-12-19 上海博德基因开发有限公司 New polypeptide-human DNA-like CGG repeative conjugated protein 16.17 and polynucleotide for encoding such polypeptide
US20030124523A1 (en) * 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US6794192B2 (en) * 2000-06-29 2004-09-21 Pfizer Inc. Target
RU2165149C1 (en) 2000-07-03 2001-04-20 Шапошников Валерий Геннадьевич "sugar wool" products forming and packaging method
US6727355B2 (en) * 2000-08-25 2004-04-27 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
AU3922802A (en) 2000-10-02 2002-05-27 Keck Graduate Inst Methods for identifying nucleotides at defined positions in target nucleic acidsusing fluorescence polarization
WO2002029056A2 (en) * 2000-10-06 2002-04-11 Regents Of The University Of Michigan Mini-dystrophin nucleic acid and peptide sequences
US6623927B1 (en) * 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
WO2002044329A2 (en) 2000-11-30 2002-06-06 Uab Research Foundation Receptor-mediated uptake of peptides that bind the human transferrin receptor
US7001994B2 (en) * 2001-01-18 2006-02-21 Genzyme Corporation Methods for introducing mannose 6-phosphate and other oligosaccharides onto glycoproteins
TWI329129B (en) * 2001-02-08 2010-08-21 Wyeth Corp Modified and stabilized gdf propeptides and uses thereof
WO2002085308A2 (en) * 2001-04-24 2002-10-31 Epigenesis Pharmaceuticals, Inc. Antisense and anti-inflammatory based compositions to treat respiratory disorders
CA2414782C (en) * 2001-05-11 2012-10-09 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
US20050282188A1 (en) * 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050277133A1 (en) * 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20050014172A1 (en) * 2002-02-20 2005-01-20 Ivan Richards RNA interference mediated inhibition of muscarinic cholinergic receptor gene expression using short interfering nucleic acid (siNA)
IL143379A (en) 2001-05-24 2013-11-28 Yissum Res Dev Co Antisense oligonucleotide against the r isophorm of human ache and uses thereof
WO2003013437A2 (en) 2001-08-07 2003-02-20 University Of Delaware Compositions and methods for the prevention and treatment of huntington's disease
US20070264194A1 (en) 2001-08-10 2007-11-15 The Scripps Research Institute Peptides That Bind To Atherosclerotic Lesions
US20060074034A1 (en) * 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
WO2003037172A2 (en) 2001-11-01 2003-05-08 Gpc Biotech Inc. Endothelial-cell binding peptides for diagnosis and therapy
US6759946B2 (en) * 2001-12-06 2004-07-06 Mitsubishi Electric Research Laboratories, Inc. Home appliances network
US20030134790A1 (en) * 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
US20030203356A1 (en) 2002-01-22 2003-10-30 The Cleveland Clinic Foundation RNase L activator-antisense complexes
WO2003069330A1 (en) * 2002-02-11 2003-08-21 The Trustees Of Columbia University In The City Of New York System and method for identifying proteins involved in force-initiated signal transduction
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
ES2339934T3 (en) * 2002-03-01 2010-05-27 The Administrators Of The Tulane Educational Fund CONJUGATES OF CITOTOXIC AGENTS AND BIOLOGICALLY ACTIVE PEPTIDES.
US20040101852A1 (en) * 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
US20040102395A1 (en) 2002-11-22 2004-05-27 Isis Pharmaceuticals Inc. Modulation of IAP-like expression
JP3995996B2 (en) * 2002-06-21 2007-10-24 エスアイアイ・プリンテック株式会社 Ink jet head and ink jet recording apparatus
JP2006507841A (en) * 2002-11-14 2006-03-09 ダーマコン, インコーポレイテッド Functional and ultrafunctional siRNA
EP1605978B1 (en) * 2003-03-07 2010-09-01 Alnylam Pharmaceuticals Inc. Therapeutic compositions
CA2524255C (en) 2003-03-21 2014-02-11 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US7589189B2 (en) 2003-05-14 2009-09-15 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
WO2004108157A2 (en) 2003-06-02 2004-12-16 Wyeth Use of myostatin (gdf8) inhibitors in conjunction with corticosteroids for treating neuromuscular disorders
US20050048495A1 (en) * 2003-08-29 2005-03-03 Baker Brenda F. Isoform-specific targeting of splice variants
EP4272748A3 (en) * 2004-06-28 2024-03-27 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
KR100663277B1 (en) * 2004-12-20 2007-01-02 삼성전자주식회사 Device and?method for processing system-related event in wireless terminal
WO2007123391A1 (en) 2006-04-20 2007-11-01 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly expressed gene.
EP1857548A1 (en) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
JP2010505897A (en) 2006-10-11 2010-02-25 マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エー・ファオ Influenza target
ES2694726T3 (en) * 2007-06-29 2018-12-26 Sarepta Therapeutics, Inc. Tissue specific peptide conjugates and methods
JP2010533170A (en) 2007-07-12 2010-10-21 プロセンサ テクノロジーズ ビー.ブイ. Molecules for targeting compounds to various selected organs, tissues or tumor cells
JP5706157B2 (en) 2007-07-12 2015-04-22 プロセンサ テクノロジーズ ビー.ブイ.Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs or tissues
EP2203173B1 (en) 2007-10-26 2015-12-23 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
WO2009099326A1 (en) 2008-02-08 2009-08-13 Prosensa Holding Bv Methods and means for treating dna repeat instability associated genetic disorders
EP2119783A1 (en) 2008-05-14 2009-11-18 Prosensa Technologies B.V. Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means
US8084601B2 (en) 2008-09-11 2011-12-27 Royal Holloway And Bedford New College Royal Holloway, University Of London Oligomers
JP5864257B2 (en) * 2008-10-24 2016-02-17 サレプタ セラピューティクス, インコーポレイテッド Multiple exon skipping compositions for DMD
CN105838714B (en) 2009-11-12 2020-07-17 西澳大利亚大学 Antisense molecules and methods of treating diseases
JP6141018B2 (en) 2009-12-24 2017-06-07 バイオマリン テクノロジーズ ベー.フェー. Molecules for treating inflammatory disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1133993A1 (en) * 2000-03-10 2001-09-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Substances for the treatment of spinal muscular atrophy
EP1191097A1 (en) * 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induction of exon skipping in eukaryotic cells

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
AARTSMA-RUS ANNEMIEKE ET AL: "Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy.", NEUROMUSCULAR DISORDERS: NMD. ENGLAND OCT 2002, vol. 12 Suppl 1, October 2002 (2002-10-01), pages S71 - S77, XP002250906, ISSN: 0960-8966 *
DE ANGELIS FERNANDA GABRIELLA ET AL: "Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. UNITED STATES 9 JUL 2002, vol. 99, no. 14, 9 July 2002 (2002-07-09), pages 9456 - 9461, XP002250907, ISSN: 0027-8424 *
DICKSON G ET AL: "Screening for antisense modulation of dystrophin pre-mRNA splicing.", NEUROMUSCULAR DISORDERS: NMD. ENGLAND OCT 2002, vol. 12 Suppl 1, October 2002 (2002-10-01), pages S67 - S70, XP009015078, ISSN: 0960-8966 *
DUNCKLEY MATTHEW G ET AL: "Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides.", HUMAN MOLECULAR GENETICS, vol. 7, no. 7, July 1998 (1998-07-01), pages 1083 - 1090, XP002250904, ISSN: 0964-6906 *
LU Q L ET AL: "Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion.", JOURNAL OF CELL BIOLOGY, vol. 148, no. 5, 6 March 2000 (2000-03-06), pages 985 - 995, XP002250909, ISSN: 0021-9525 *
MANN CHRISTOPHER J ET AL: "Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 98, no. 1, 2 January 2001 (2001-01-02), January 2, 2001, pages 42 - 47, XP002250903, ISSN: 0027-8424 *
MANN CHRISTOPHER J ET AL: "Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy.", THE JOURNAL OF GENE MEDICINE. ENGLAND 2002 NOV-DEC, vol. 4, no. 6, November 2002 (2002-11-01), pages 644 - 654, XP009015057, ISSN: 1099-498X *
SUTER D ET AL: "DOUBLE-TARGET ANTISENSE U7 SNRNAS PROMOTE EFFICIENT SKIPPING OF AN ABERRANT EXON IN THREE HUMAN BETA-THALASSEMIC MUTATIONS", HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 8, December 1999 (1999-12-01), pages 2415 - 2423, XP000973208, ISSN: 0964-6906 *
VAN DEUTEKOM JUDITH C T ET AL: "Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells.", HUMAN MOLECULAR GENETICS, vol. 10, no. 15, 2001, pages 1547 - 1554, XP002250908, ISSN: 0964-6906 *

Cited By (187)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9416361B2 (en) 2000-05-04 2016-08-16 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US8895722B2 (en) 2000-05-04 2014-11-25 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US10533174B2 (en) 2000-05-04 2020-01-14 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US8067569B2 (en) 2000-05-04 2011-11-29 Avi Biopharma, Inc. Splice-region antisense composition and method
US8436163B2 (en) 2000-05-04 2013-05-07 Avi Biopharma, Inc. Splice-region antisense composition and method
EP2594641B1 (en) 2000-09-21 2015-12-30 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
EP2594640B1 (en) 2000-09-21 2015-12-30 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
EP2594642B1 (en) 2000-09-21 2015-12-30 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
EP2602322B1 (en) 2000-09-21 2016-03-02 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
US7973015B2 (en) 2000-09-21 2011-07-05 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
EP2636741B1 (en) 2000-09-21 2016-04-27 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
US9657050B2 (en) 2002-11-25 2017-05-23 Masafumi Matsuo ENA nucleic acid pharmaceuticals capable of modifying splicing of mRNA precursors
US9657049B2 (en) 2002-11-25 2017-05-23 Masafumi Matsuo ENA nucleic acid pharmaceuticals capable of modifying splicing of mRNA precursors
US7902160B2 (en) 2002-11-25 2011-03-08 Masafumi Matsuo ENA nucleic acid drugs modifying splicing in mRNA precursor
US9243026B2 (en) 2002-11-25 2016-01-26 Daiichi Sankyo Company, Limited ENA nucleic acid pharmaceuticals capable of modifying splicing of mRNA precursors
US8624019B2 (en) 2002-11-25 2014-01-07 Masafumi Matsuo ENA nucleic acid drugs modifying splicing in mRNA precursor
US9896687B2 (en) 2003-03-21 2018-02-20 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US10113165B2 (en) 2003-03-21 2018-10-30 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US7534879B2 (en) 2003-03-21 2009-05-19 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US10190116B2 (en) 2003-03-21 2019-01-29 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US10544416B2 (en) 2003-03-21 2020-01-28 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US11208657B2 (en) 2003-03-21 2021-12-28 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US8759507B2 (en) 2003-03-21 2014-06-24 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering RNA structure
USRE47751E1 (en) 2004-06-28 2019-12-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
EP2206781B1 (en) 2004-06-28 2015-12-02 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE48960E1 (en) 2004-06-28 2022-03-08 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10421966B2 (en) 2004-06-28 2019-09-24 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9447415B2 (en) 2004-06-28 2016-09-20 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9441229B2 (en) 2004-06-28 2016-09-13 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8450474B2 (en) 2004-06-28 2013-05-28 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8455636B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8455635B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8455634B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE47691E1 (en) 2004-06-28 2019-11-05 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8476423B2 (en) 2004-06-28 2013-07-02 The University of Western Austrailia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8486907B2 (en) 2004-06-28 2013-07-16 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US7807816B2 (en) 2004-06-28 2010-10-05 University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8524880B2 (en) 2004-06-28 2013-09-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
WO2006000057A1 (en) * 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10266827B2 (en) 2004-06-28 2019-04-23 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9422555B2 (en) 2004-06-28 2016-08-23 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8232384B2 (en) 2004-06-28 2012-07-31 University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE47769E1 (en) 2004-06-28 2019-12-17 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US7960541B2 (en) 2004-06-28 2011-06-14 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9994851B2 (en) 2004-06-28 2018-06-12 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9249416B2 (en) 2004-06-28 2016-02-02 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10995337B2 (en) 2004-06-28 2021-05-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9018368B2 (en) 2004-06-28 2015-04-28 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9024007B2 (en) 2004-06-28 2015-05-05 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9035040B2 (en) 2004-06-28 2015-05-19 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10227590B2 (en) 2004-06-28 2019-03-12 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10968450B2 (en) 2004-06-28 2021-04-06 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9175286B2 (en) 2004-06-28 2015-11-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9605262B2 (en) 2004-06-28 2017-03-28 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10781451B2 (en) 2004-06-28 2020-09-22 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
WO2006112705A3 (en) * 2005-04-22 2006-12-14 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the binding of sr proteins and by interfering with secondary rna structure.
AU2006237727B2 (en) * 2005-04-22 2012-06-28 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the binding of SR proteins and by interfering with secondary RNA structure.
WO2006112705A2 (en) * 2005-04-22 2006-10-26 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the binding of sr proteins and by interfering with secondary rna structure.
WO2007133812A3 (en) * 2005-12-30 2008-10-23 Philadelphia Health & Educatio Improved carriers for delivery of nucleic acid agents to cells and tissues
WO2007133812A2 (en) * 2005-12-30 2007-11-22 Philadelphia Health & Education Corporation, D/B/A Drexel University College Of Medicine Improved carriers for delivery of nucleic acid agents to cells and tissues
US8304398B2 (en) 2006-04-20 2012-11-06 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly or abnormally expressed gene
US8361979B2 (en) 2006-05-19 2013-01-29 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
JP2009537129A (en) * 2006-05-19 2009-10-29 アカデミッシュ ジーケンフイス ライデン Means and methods for inducing exon skipping
US9890379B2 (en) 2006-08-11 2018-02-13 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
US11274299B2 (en) 2006-08-11 2022-03-15 Vico Therapeutics B.V. Methods and means for treating DNA repeat instability associated genetic disorders
US10689646B2 (en) 2006-08-11 2020-06-23 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
US8609065B2 (en) 2007-07-12 2013-12-17 Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs, tissues or tumor cells
US8268962B2 (en) 2007-07-12 2012-09-18 Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs or tissues
EP3238737A1 (en) 2007-10-26 2017-11-01 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
US10876114B2 (en) 2007-10-26 2020-12-29 Biomarin Technologies B.V. Methods and means for efficient skipping of at least one of the following exons of the human Duchenne muscular dystrophy gene: 43, 46, 50-53
US9926557B2 (en) 2007-10-26 2018-03-27 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in Duchenne muscular dystrophy pre-mRNA
EP2614827A2 (en) 2007-10-26 2013-07-17 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
EP2203173B1 (en) 2007-10-26 2015-12-23 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
USRE48468E1 (en) 2007-10-26 2021-03-16 Biomarin Technologies B.V. Means and methods for counteracting muscle disorders
US9243245B2 (en) 2007-10-26 2016-01-26 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
US9499818B2 (en) 2007-10-26 2016-11-22 BioMarin Technologies, B.V. Methods and means for efficient skipping of at least one of the exons 51-53, 55, 57 and 59 of the human duchenne muscular dystrophy gene
US11427820B2 (en) 2007-10-26 2022-08-30 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in Duchenne muscular dystrophy pre-mRNA
US9528109B2 (en) 2007-10-26 2016-12-27 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in duchenne muscular dystrophy pre-mRNA
US8263760B2 (en) 2008-02-08 2012-09-11 Prosensa Holding Bv Methods and means for treating DNA repeat instability associated genetic disorders
US9139828B2 (en) 2008-05-14 2015-09-22 Prosensa Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US10246707B2 (en) 2008-05-14 2019-04-02 Biomarin Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US9970010B2 (en) 2008-09-11 2018-05-15 Royal Holloway, University Of London Oligomers
US9243251B2 (en) 2008-09-11 2016-01-26 Royal Holloway, University Of London Oligomers
US8324371B2 (en) 2008-09-11 2012-12-04 Royal Holloway and Bedford New College, University of London Oligomers
US10457944B2 (en) 2008-09-11 2019-10-29 Royal Holloway, University Of London Oligomers
US8461325B2 (en) 2008-09-11 2013-06-11 Royal Holloway, University Of London Oligomers
US9650632B2 (en) 2008-09-11 2017-05-16 Royal Holloway, University Of London Oligomers
US8552172B2 (en) 2008-09-11 2013-10-08 Linda POPPLEWELL Oligomers
US11697811B2 (en) 2008-09-11 2023-07-11 Royal Holloway, University Of London Oligomers
US8084601B2 (en) 2008-09-11 2011-12-27 Royal Holloway And Bedford New College Royal Holloway, University Of London Oligomers
US9243252B2 (en) 2008-09-11 2016-01-26 Royal Holloway, University Of London Oligomers
US9234198B1 (en) 2008-10-24 2016-01-12 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9453225B2 (en) 2008-10-24 2016-09-27 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9447417B2 (en) 2008-10-24 2016-09-20 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9447416B2 (en) 2008-10-24 2016-09-20 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9434948B2 (en) 2008-10-24 2016-09-06 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
TWI488965B (en) * 2008-10-24 2015-06-21 Sarepta Therapeutics Inc Multiple exon skipping compositions for dmd
TWI563086B (en) * 2008-10-24 2016-12-21 Sarepta Therapeutics Inc Multiple exon skipping compositions for dmd
US8871918B2 (en) 2008-10-24 2014-10-28 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US8865883B2 (en) 2008-10-24 2014-10-21 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US11634714B2 (en) 2009-04-24 2023-04-25 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US11034956B2 (en) 2009-04-24 2021-06-15 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US10533171B2 (en) 2009-04-24 2020-01-14 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
WO2011054659A1 (en) * 2009-10-16 2011-05-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Exon skipping therapy for dysferlinopathies
US8586560B2 (en) 2009-10-16 2013-11-19 Institut National De La Sante Et De La Recherche Medicale (Inserm) Exon skipping therapy for dysferlinopathies
WO2011053144A3 (en) * 2009-10-29 2011-08-11 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Methods and compositions for dysferlin exon-skipping
WO2011053144A2 (en) 2009-10-29 2011-05-05 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Methods and compositions for dysferlin exon-skipping
US10287586B2 (en) 2009-11-12 2019-05-14 The University Of Western Australia Antisense molecules and methods for treating pathologies
US9758783B2 (en) 2009-11-12 2017-09-12 The University Of Western Australia Antisense molecules and methods for treating pathologies
US11447776B2 (en) 2009-11-12 2022-09-20 The University Of Western Australia Antisense molecules and methods for treating pathologies
US10781450B2 (en) 2009-11-12 2020-09-22 Sarepta Therapeutics, Inc. Antisense molecules and methods for treating pathologies
US9228187B2 (en) 2009-11-12 2016-01-05 The University Of Western Australia Antisense molecules and methods for treating pathologies
US8637483B2 (en) 2009-11-12 2014-01-28 The University Of Western Australia Antisense molecules and methods for treating pathologies
WO2011078672A1 (en) 2009-12-24 2011-06-30 Prosensa Technologies B.V. Molecule for treating an inflammatory disorder
WO2011154851A1 (en) * 2010-06-08 2011-12-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. MODIFIED snRNAs FOR USE IN THERAPY
WO2011154427A1 (en) * 2010-06-08 2011-12-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. MODIFIED snRNAs FOR USE IN THERAPY
ITRM20100310A1 (en) * 2010-06-08 2011-12-09 Amsterdam Molecular Therapeutics Amt Ip B V MODIFIED SNRNAS FOR USE IN THERAPY
US10590421B2 (en) 2010-08-05 2020-03-17 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Antisense oligonucleotide directed removal of proteolytic cleavage sites, the HCHWA-D mutation, and trinucleotide repeat expansions
WO2012018257A1 (en) * 2010-08-05 2012-02-09 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins
US10364432B2 (en) 2010-08-05 2019-07-30 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins
US9611471B2 (en) 2010-08-05 2017-04-04 Academisch Ziekenhuis Leiden Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins
US10647741B2 (en) 2010-09-01 2020-05-12 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10487106B2 (en) 2010-09-01 2019-11-26 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10385092B2 (en) 2010-09-01 2019-08-20 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10407461B2 (en) 2010-09-01 2019-09-10 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10662217B2 (en) 2010-09-01 2020-05-26 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10870676B2 (en) 2010-09-01 2020-12-22 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
EP3018211B1 (en) 2010-09-01 2019-08-07 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US11028122B1 (en) 2010-09-01 2021-06-08 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10683322B2 (en) 2010-09-01 2020-06-16 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10913946B2 (en) 2012-01-27 2021-02-09 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
US10179912B2 (en) 2012-01-27 2019-01-15 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
RU2674600C2 (en) * 2012-07-03 2018-12-11 Просенса Текнолоджиз Б.В. Oligonucleotide for treatment of muscular dystrophy patients
CN110257379B (en) * 2012-07-03 2023-08-11 马林生物科技有限公司 Oligonucleotides for treating patients with muscular dystrophy
CN110257379A (en) * 2012-07-03 2019-09-20 马林生物科技有限公司 For treating the oligonucleotides of muscular dystrophy patient
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US11932851B2 (en) 2013-03-14 2024-03-19 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US9217148B2 (en) 2013-03-14 2015-12-22 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US10907154B2 (en) 2013-03-14 2021-02-02 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US10337003B2 (en) 2013-03-15 2019-07-02 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US10364431B2 (en) 2013-03-15 2019-07-30 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US9506058B2 (en) 2013-03-15 2016-11-29 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US11230707B2 (en) 2013-04-20 2022-01-25 Research Institute At Nationwide Children's Hospital Recombinant adeno-associated virus delivery of exon 2-targeted U7SNRNA polynucleotide constructs
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US11053494B2 (en) 2014-08-09 2021-07-06 Research Institute At Nationwide Children's Hospital Methods and materials for activating an internal ribosome entry site in exon 5 of the DMD gene
US10563198B2 (en) 2015-03-11 2020-02-18 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
US11352626B2 (en) 2015-03-11 2022-06-07 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
CN108026531B (en) * 2015-09-15 2021-09-14 日本新药株式会社 Antisense nucleic acid
CN108026531A (en) * 2015-09-15 2018-05-11 日本新药株式会社 Antisensenucleic acids
US10450568B2 (en) 2015-10-09 2019-10-22 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2018005805A1 (en) 2016-06-30 2018-01-04 Sarepta Therapeutics, Inc. Exon skipping oligomers for muscular dystrophy
US11382981B2 (en) 2016-12-19 2022-07-12 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US11642364B2 (en) 2016-12-19 2023-05-09 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US10888578B2 (en) 2016-12-19 2021-01-12 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2018118599A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2018118662A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
EP4122497A1 (en) 2016-12-19 2023-01-25 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2018118627A1 (en) 2016-12-19 2018-06-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US11000600B2 (en) 2016-12-19 2021-05-11 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US11395855B2 (en) 2016-12-19 2022-07-26 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
EP4115908A1 (en) 2016-12-19 2023-01-11 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2019059973A1 (en) 2017-09-22 2019-03-28 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
WO2019067981A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
WO2019067975A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
WO2019067979A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. Combination therapies for treating muscular dystrophy
US11491238B2 (en) 2018-05-29 2022-11-08 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US10758629B2 (en) 2018-05-29 2020-09-01 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US11338041B2 (en) 2018-05-29 2022-05-24 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US10765760B2 (en) 2018-05-29 2020-09-08 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
KR20220145865A (en) 2020-02-28 2022-10-31 니뽄 신야쿠 가부시키가이샤 Antisense nucleic acid that induces skipping of exon 51
WO2021172498A1 (en) 2020-02-28 2021-09-02 日本新薬株式会社 Antisense nucleic acid inducing skipping of exon 51
US11781140B2 (en) 2020-02-28 2023-10-10 Nippon Shinyaku Co., Ltd. Antisense nucleic acid inducing skipping of exon 51

Also Published As

Publication number Publication date
CA2855229C (en) 2018-01-16
US10113165B2 (en) 2018-10-30
US9896687B2 (en) 2018-02-20
US10100304B2 (en) 2018-10-16
US20110312086A1 (en) 2011-12-22
US20130302806A1 (en) 2013-11-14
WO2004083446A2 (en) 2004-09-30
US20190225964A1 (en) 2019-07-25
CA2519863C (en) 2015-06-23
US20190112602A1 (en) 2019-04-18
US20160168570A1 (en) 2016-06-16
EP1606407B1 (en) 2013-12-18
US20160251658A1 (en) 2016-09-01
JP2014138589A (en) 2014-07-31
US10190116B2 (en) 2019-01-29
US20160194636A1 (en) 2016-07-07
US20140275212A1 (en) 2014-09-18
US20170268003A1 (en) 2017-09-21
US7534879B2 (en) 2009-05-19
AU2009240879A1 (en) 2009-12-17
US20160355810A1 (en) 2016-12-08
US20150080563A2 (en) 2015-03-19
CA2855229A1 (en) 2004-09-30
AU2004221495C1 (en) 2010-08-12
CA2524255A1 (en) 2004-09-30
JP5973477B2 (en) 2016-08-23
US20150218559A1 (en) 2015-08-06
US20090076246A1 (en) 2009-03-19
US11208657B2 (en) 2021-12-28
US20140378527A1 (en) 2014-12-25
US20140213635A1 (en) 2014-07-31
AU2009240879B2 (en) 2012-07-26
US20140357698A1 (en) 2014-12-04
AU2004221495A1 (en) 2004-09-30
EP1606407A2 (en) 2005-12-21
JP2006523101A (en) 2006-10-12
US20130072671A1 (en) 2013-03-21
US20190241892A1 (en) 2019-08-08
ES2452293T3 (en) 2014-03-31
AU2003225410A1 (en) 2004-10-11
CA2524255C (en) 2014-02-11
US10544416B2 (en) 2020-01-28
HK1084694A1 (en) 2006-08-04
US20170275624A1 (en) 2017-09-28
NZ543115A (en) 2008-01-31
US20200385717A1 (en) 2020-12-10
AU2004221495B2 (en) 2009-08-27
JP2011101655A (en) 2011-05-26
WO2004083446A3 (en) 2005-02-10
US20060147952A1 (en) 2006-07-06
US8759507B2 (en) 2014-06-24
JP5378423B2 (en) 2013-12-25
US20140357855A1 (en) 2014-12-04
CA2519863A1 (en) 2004-09-30
US20060099616A1 (en) 2006-05-11

Similar Documents

Publication Publication Date Title
US11208657B2 (en) Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
CA2796440C (en) Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2524255

Country of ref document: CA

Ref document number: 11233495

Country of ref document: US

122 Ep: pct application non-entry in european phase
WWP Wipo information: published in national office

Ref document number: 11233495

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: JP