WO2004081173A2

WO2004081173A2 - Nucleotide sequences regulating gene expression and constructs and methods utilizing same

Info

Publication number: WO2004081173A2
Application number: PCT/IL2004/000235
Authority: WO
Inventors: Hagai Karchi; Rafael Meissner; Gil Ronen; Ezekiel Golan; Larisa Rabinovich; Naama Zeliger; Noa Savir
Original assignee: Evogene Ltd.
Priority date: 2003-03-12
Filing date: 2004-03-11
Publication date: 2004-09-23
Also published as: EP1606304A4; EP1606304A2; CN100430481C; US20100205691A1; US7695968B2; CA2519009A1; CA2519009C; AU2004219858B2; CN101386855A; BRPI0408735A; US20070022503A1; WO2004081173A3; CN1788014A; AU2004219858A1

Abstract

Novel plant derived regulatory sequences and constructs and methods of using such sequences for directing expression of exogenous polynucleotide sequences in plants are provided

Description

NUCLEOTIDE SEQUENCES REGULATING GENE EXPRESSION AND CONSTRUCTS AND METHODS UTILIZING SAME

FIELD AND BACKGROUND OF THE INVENTION The present invention relates to isolated polynucleotides which are capable of regulating gene expression in an organism and more specifically, to novel nucleic acid sequences which include constitutive, inducible, tissue-specific and developmental stage-specific promoters which are capable of directing gene expression in plants.

A promoter is a nucleic acid sequence approximately 200-1500 base pairs (bp) in length which is typically located upstream of coding sequences. A promoter functions in directing transcription of an adjacent coding sequence and thus acts as a switch for gene expression in an organism. Thus, all cellular processes are ultimately governed by the activity of promoters, making such regulatory elements important research and commercial tools. Promoters are routinely utilized for heterologous gene expression in commercial expression systems, gene therapy and a variety of research applications.

The choice of the promoter sequence determines when, where and how strongly the heterologous gene of choice is expressed. Accordingly, when a constitutive expression throughout an organism is desired, a constitutive promoter is preferably utilized. On the other hand, when triggered gene expression is desired, an inductive promoter is preferred. Likewise, when an expression is to be confined to a particular tissue, or a particular physiological or developmental stage, a tissue specific or a stage specific promoter is respectively preferred.

Constitutive promoters are active throughout the cell cycle and have been utilized to express heterologous genes in transgenic plants, such that the expression of traits encoded by the heterologous genes is effected throughout the plant at all time. Examples of known constitutive promoters often used for plant transformation include the cauliflower heat shock protein 80 (hsp80) promoter, 35S cauliflower mosaic virus promoter, nopaline synthase (nos) promoter, octopine (ocs) Agrobacterium promoter and the ann opine synthase (mas) Agrobacterium promoter.

Inducible promoters can be switched on by an inducing agent and are typically active as long as they are exposed to the inducing agent. The inducing agent can be a chemical agent, such as a metabolite, growth regulator, herbicide, or phenolic compound, or a physiological stress directly imposed upon the plant such as cold, heat, salt, toxins, or through the action of a microbial pathogen or an insecticidal pest. Accordingly, inducible promoters can be utilized to regulate expression of desired traits, such as genes that control insect pests or microbial pathogens, whereby the protein is only produced shortly upon infection or first bites of the insect and transiently so as to decrease selective pressure for resistant insects. For example, plants can be transformed to express insecticidal or fungicidal traits such as the Bacillus thuringiensis (Bt) toxins, viruses coat proteins, glucanases, chitinases or phytoalexins. In another example, plants can be transformed to tolerate herbicides by overexpressing, upon exposure to a herbicide, the acetohydroxy acid synthease enzyme, which neutralizes multiple types of herbicides [Hattori, J. et al, Mol. General. Genet. 246: 419 (1995)].

Several fruit-specific promoters have been described, including an apple- isolated Thi promoter (U.S. Pat. No. 6,392,122); a strawberry-isolated promoter (U.S. Pat. No. 6,080,914); tomato-isolated E4 and E8 promoters (U.S. Pat. No. 5,859,330); a polygalacturonase promoter (U.S. Pat. No. 4,943,674); and the 2AII tomato gene promoter [Van Haaren et al, Plant Mol. Biol. 21 : 625-640 (1993)]. Such fruit specific promoters can be utilized, for example, to modify fruit ripening by regulating expression of ACC deaminase which inhibits biosynthesis of ethylene. Other gene products which may be desired to express in fruit tissue include genes encoding flavor or color traits, such as thaumatin, cyclase or sucrose phosphate synthase.

Seed specific promoters have been described in U.S, Pat. Nos. 6,403,862, 5,608,152 and 5,504,200; and in U.S. Patent Application Ser. Nos. 09/998059 and 10/137964. Such seed specific promoters can be utilized, for example, to alter the levels of saturated or unsaturated fatty acids; to increase levels of lysine- or sulfur- containing amino acids, or to modify the amount of starch contained in seeds.

Several promoters which regulate gene expression specifically during germination stage have been described, including the α-glucoronidase and the cystatin-1 barely-isolated promoters (U.S. Pat. No. 6,359,196), and the hydrolase promoter [Skriver et al, Proc. Natl. Acad. Sci. USA, 88:7266-7270 (1991)]. While reducing the present invention to practice, the present inventors have uncovered several regulatory sequences which exhibit a wide range of promoter activities in plants, as is further described hereinunder, such regulatory sequences can be used in a variety of commercial and research applications. SUMMARY OF THE INVENTION

According to one aspect of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181,

186, 191, 196, 201, 202, 211, 210 and 213, wherein the isolated polynucleotide is capable of regulating expression of at least one polynucleotide sequence operably linked thereto.

According to another aspect of the present invention there is provided a nucleic acid construct which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213. According to yet another aspect of the present invention there is provided a transgenic cell which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191 , 196, 201,202, 203, 210 and 213.

According to still another aspect of the present invention there is provided a transgenic cell comprising the nucleic acid construct which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 1 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213.

According to an additional aspect of the present invention there is provided a transgenic organism which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1 , 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213. According to yet an additional aspect of the present invention there is provided a transgenic organism comprising a nucleic acid construct which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213.

According to still an additional aspect of the present invention there is provided a transgenic plant which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 1 16,

121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201,

202, 203, 210 and 213.

According to a further aspect of the present invention there is provided a transgenic plant comprising a nucleic acid construct which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91 , 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213.

According to yet a further aspect of the present invention there is provided a method of producing a transgenic plant comprising transforming a plant with an isolated polynucleotide which includes a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1 , 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 1 11, 1 16, 121, 126, 131, 136, 141 , 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213. According to still a further aspect of the present invention there is provided a method of producing a transgenic plant comprising transforming a plant with a nucleic acid construct which includes the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202,

203, 210 and 213.

According to still a further aspect of the present invention there is provided a method of expressing a polypeptide of interest in a cell comprising transforming the cell with a nucleic acid construct including a polynucleotide sequence encoding the polypeptide of interest operably linked to a regulatory nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213 thereby expressing the polypeptide of interest in the cell.

According to still a further aspect of the present invention there is provided a method of co-expressing two polypeptides of interest in a cell comprising transforming the cell with a nucleic acid construct including two polynucleotide sequences encoding the two polypeptides of interest operably linked to a regulatory nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 111, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213 such that said two polynucleotide sequences flank said regulatory nucleic acid sequence, thereby expressing the two polypeptides of interest in the cell. According to further features in preferred embodiments of the invention described below, the isolated polynucleotide includes at least one promoter region.

According to still further features in the described preferred embodiments the nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1 , 6, 41 , 46, 51, 86, 121, 136, 171, 181 and 202, and whereas the at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a constitutive manner.

According to still further features in the described preferred embodiments the nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 81, 91, 96, 101, 1 16, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196, 201, 203, 210 and 213, and whereas the at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in an inductive manner.

According to still further features in the described preferred embodiments the nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 91, 116, 126, 141, 146, 151 , 156, 161, 166, 176, 186, 191, 196, 201, 203, 210 and 213, and whereas the at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a tissue specific manner.

According to still further features in the described preferred embodiments the nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 81, 96, 101, 106 and 131, and whereas the at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a developmental stage specific manner.

According to still further features in the described preferred embodiments the nucleic acid construct further includes at least one heterologous polynucleotide operably linked to the isolated polynucleotide.

According to still further features in the described preferred embodiments the at least one heterologous polynucleotide is a reporter gene.

According to still further features in the described preferred embodiments the nucleic acid construct further includes two heterologous polynucleotides each being operably linked to an end of the isolated polynucleotide such that the two heterologous polynucleotides flank the isolated polynucleotide.

The present invention successfully addresses the shortcomings of the presently known configurations by providing a plurality of isolated polynucleotide sequences which exhibit a wide spectrum of promoter function patterns. These polynucleotides can be used to generate nucleic acid constmcts, such as expression vectors suitable for transforming an organism. Such nucleic acid constructs can be used to promote expression of desired traits or expression products in transgenic organisms, such as plants, in a constitutive, induced, tissue specific, or a developmental stage specific manner.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

In the drawings: FIGs. la-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 11 operably linked to a luciferase encoding sequence. Figure la shows the transgenic plant under normal light. Figure lb is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression luciferase in flower tissue.

FIGs. 2a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 21 operably linked to a luciferase encoding sequence. Figure 2a shows the transgenic plant under normal light. Figure 2b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in root tissue.

FIGs. 3a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 36 operably linked to a luciferase encoding sequence. Figure 3a shows the transgenic plant under normal light. Figure 3b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in root and flower tissue. FIGs. 4a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 61 operably linked to a luciferase encoding sequence. Figure 4a shows the transgenic plant under normal light. Figure 4b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in young tissue.

FIGs. 5a-b are photographs showing an Arabidopsis thaliana seedling transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 66 operably linked to a luciferase encoding sequence. Figure 5a shows the transgenic plant under normal light. Figure 5b is an ultra-low light photograph of the same plant in the dark, illustrating an expression of luciferase in leaf tissue.

FIGs. 6a-b are photographs showing an Arabidopsis thaliana mature plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 66 operably linked to a luciferase encoding sequence. Figure 6a shows the transgenic plant under normal light. Figure 6b is an ultra-low light photograph of the same plant in the dark, illustrating an expression of luciferase in stem tissue.

FIGs. 7a-b are photographs showing an Arabidopsis thaliana plant seedlings transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 81 operably linked to a luciferase encoding sequence. Figure 7a shows the transgenic plant under normal light. Figure 7b is an ultra-low light photograph of the same plant in the dark, illustrating an expression of luciferase in above ground tissue. FIGs. 8a-b are photographs showing an Arabidopsis thaliana mature plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 81 operably linked to a luciferase encoding sequence. Figure 8a shows the transgenic plant under normal light. Figure 8b is an ultra-low light photograph of the same plant in the dark, illustrating an expression of luciferase in flower tissue.

FIGs. 9a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 91 operably linked to a luciferase encoding sequence. Figure 9a shows the transgenic plant under normal light. Figure 9b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in root and flower tissue.

FIGs. lOa-b are photographs showing an Arabidopsis thaliana seedling transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 96 operably linked to a luciferase encoding sequence. Figure 10a shows the transgenic plant under normal light. Figure 10b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in above ground tissue. FIGs. l la-b are photographs showing an Arabidopsis thaliana mature plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 96 operably linked to a luciferase encoding sequence. Figure

11a shows the transgenic plant under normal light. Figure l ib is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in above ground tissue.

FIGs. 12a-b are photographs showing seeds of an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 111 operably linked to a luciferase encoding sequence. Figure 12a shows the seeds under normal light. Figure 12b is an ultra-low light photograph of the same seeds in the dark, illustrating a specific expression of luciferase in seeds.

FIGs. 13a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 111 operably linked to a luciferase encoding sequence. Figure 13a shows the transgenic plant under normal light. Figure 13b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in roots.

FIGs. 14a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 121 operably linked to a luciferase encoding sequence. Figure 14a shows the transgenic plant under normal light. Figure 14b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in meristematic tissue.

FIGs. 15a-b are photographs showing an Arabidopsis thaliana seedling transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 126 operably linked to a luciferase encoding sequence. Figure 15a shows the transgenic plant under normal light. Figure 15b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in root meristematic tissue. FIGs. 16a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 126 operably linked to a luciferase encoding sequence. Figure 16a shows the transgenic plant under normal light. Figure 16b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in flower meristematic tissue.

FIGs. 17a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 131 operably linked to a luciferase encoding sequence. Figure

17a shows the transgenic plant under normal light. Figure 17b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in leaf tissue.

FIGs. 18a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 136 operably linked to a luciferase encoding sequence. Figure 18a shows the transgenic plant under normal light. Figure 18b is an ultra-low light photograph of the same plant in the dark, illustrating a non-specific constitutive expression of luciferase. FIGs. 19a-b are photographs showing an Arabidopsis thaliana seedling transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 156 operably linked to a luciferase encoding sequence. Figure 19a shows the transgenic plant under normal light. Figure 19b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in above ground tissue.

FIGs. 20a-b are photographs showing an Arabidopsis thaliana mature plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 156 operably linked to a luciferase encoding sequence. Figure 20a shows the transgenic plant under normal light. Figure 20b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in above ground tissue.

FIGs. 21a-b are photographs showing seeds of an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 161 operably linked to a luciferase encoding sequence. Figure 21a shows the seeds under normal light. Figure 21b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in seed tissue. FIGs. 22a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 186 operably linked to a luciferase encoding sequence. Figure

22a shows the transgenic plant under normal light. Figure 22b is an ultra-low light photograph of the same plant in the dark, illustrating an expression of luciferase in stalk and stem tissue.

FIGs. 23a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 191 operably linked to a luciferase encoding sequence. Figure 23a shows the transgenic plant under normal light. Figure 23b is an ultra-low light photograph of the same plant in the dark, illustrating a weak expression of luciferase in vegetative tissue.

FIGs. 24a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 201 operably linked to a luciferase encoding sequence. Figure 24a shows the transgenic plant under normal light. Figure 24b is an ultra-low light photograph of the same plant in the dark, illustrating an above ground tissue specific expression of luciferase.

FIGs. 25a-b are photographs showing an Arabidopsis thaliana plant transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 176 operably linked to a luciferase encoding sequence. Figure 25a shows the transgenic plant under normal light. Figure 25b is an ultra-low light photograph of the same plant in the dark, illustrating a specific expression of luciferase in flower tissue. FIGs. 26a-b are photographs showing transformed Arabidopsis thaliana plants transformed with nucleic acid constructs including partial DREs operably each linked to a GUS encoding sequence. Figure 26a shows a plant transformed with a nucleic acid construct including the nucleic acid sequence set forth in SEQ ID NO: 210 operably linked to a GUS encoding sequence. Figure 26b shows root tips of a plant, transformed with a nucleic acid construct comprising the nucleic acid sequence set forth in SEQ ID NO: 213 operably linked to a GUS encoding sequence.

FIG. 27 is a nucleic acid sequence alignment between DRE 6669 (SEQ ID NO: 61, QUERY) and a prior art sequence (SEQ ID NO: 214, SBJCT), revealing a different 5' sequence which is important for constitutive expression, as is exemplified in the Examples section hereinbelow.

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention provides isolated polynucleotides capable of regulating the expression of operably linked heterologous polynucleotides, and more specifically, novel nucleic acid sequences which are capable of promoting gene expression in a constitutive, inductive, tissue specific and/or developmental stage specific manner. The present invention also provides nucleic acid constructs, as well transgenic organisms which carry the polynucleotides of the present invention and methods of producing thereof.

The principles and operation of the present invention may be better understood with reference to the accompanying descriptions.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following descriptions or illustrated in the Examples section. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

The term "polynucleotide" or the phrase "'nucleic acid sequence" are used herein interchangeably and refer to a polymer of deoxyrebonucleotide (DNA) or ribonucleotide (RNA).

The phrase "heterologous polynucleotide" refers to a polynucleotide sequence which originates from a heterologous organism or to a polynucleotide sequence which is linked to a regulatory sequence of the same organism which does not normally regulate expression of the polynucleotide sequence in the organism.

PCT Publication WO 02/07989 describes a unique approach developed by the present inventors in order to uncover novel regulatory sequences in organisms such as plants. This approach combines molecular and bioinformatics techniques for high throughput isolation of DNA regulating elements (DREs), located within the non- transcribed (non-coding) regions of the genome and which include, for example, promoters, enhancers, suppressors, silencers, locus control regions and the like. Utilizing this approach, the present inventors have uncovered several novel polynucleotide sequences which, as illustrated in the Examples section which follows, exhibit regulatory activity in plants.

Thus, according to one aspect of the present invention, there is provided isolated polynucleotides which are capable of regulating the expression of at least one polynucleotide operably linked thereto. As is further described in the Examples section which follows, these isolated polynucleotides are as set forth in SEQ ID NOS:

1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11,

116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202 and 203, or fragments (e.g., SEQ ID NOS: 210 and 213), variants or derivatives thereof.

A coding nucleic acid sequence is "operably linked" to a regulatory sequence if it is capable of exerting a regulatory effect on the coding sequence linked thereto. Preferably, the regulatory sequence is positioned 1-500 bp upstream of the ATG codon of the coding nucleic acid sequence, although it will be appreciated that regulatory sequences can also exert their effect when positioned elsewhere with respect to the coding nucleic acid sequence (e.g., within an intron).

As is clearly illustrated in the Examples section which follows, the isolated polynucleotides of the present invention are capable of regulating expression of a coding nucleic acid sequence (e.g., luciferase) operably linked thereto (see Figures 1- 25).

The isolated polynucleotides of the present invention range in length from 174 to 3, 348 nucleotides and include one or more sequence regions which are capable of recognizing and binding RNA polymerase II and other proteins (trans-acting transcription factors) involved in transcription.

Although most of the isolated polynucleotides described herein include one promoter region, some include two distinct promoter regions each positioned on a different strand of the same genomic sequence. Such bidirectional DREs are further described in the Examples section which follows (see for example, Tables 3-17). As is further illustrated by the Examples section which follows, the isolated polynucleotides of the present invention exhibit a range of activities and tissue specificities. Thus for example, the nucleic acid sequences set forth in SEQ ID NOS:l, 6,

41, 46, 51, 86, 121, 136, 171, 181 and 202 or fragment, variants or derivatives thereof, are capable of directing transcription of coding nucleic acid sequences operably linked thereto in a constitutive manner and thus include a constitutive promoter region.

In another example, the nucleic acid sequences set forth in SEQ ID NOS: 1,

11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 81, 91, 96, 101, 116, 126, 141, 146, 151,

156, 161, 166, 176, 186, 191, 196, 201 and 203, or fragments (e.g., SEQ ID NOS: 210 and 213), variants or derivatives thereof, are capable of directing transcription of coding nucleic acid sequences operably linked thereto in an inductive manner and thus include an inductive promoter region.

In yet another example, the nucleic acid sequences set forth in SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 91, 116, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196, 201 and 203, or fragments (e.g., SEQ ID NOS: 210 and 213), variants or derivatives thereof, are capable of directing transcription of coding nucleic acid sequences operably linked thereto in a tissue specific manner and thus include a tissue specific promoter region.

In further yet another example, the nucleic acid sequences set forth in SEQ ID NOS: 81, 96, 101, 106 and 131 , or fragment, variants or derivatives thereof, are capable of directing transcription of coding nucleic acid sequences operably linked thereto in a developmental stage specific manner and thus include a developmental stage specific promoter region.

Preferably, the polynucleotide of the present invention are modified to create variations in the molecule sequences such as to enhance their promoting activities, using methods known in the art, such as PCR-based DNA modification, or standard DNA mutagenesis techniques, or by chemically synthesizing the modified polynucleotides.

Accordingly, the sequences set forth in SEQ ID NOS: 1 , 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 1 16, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202 and 203 may be truncated or deleted and still retain the capacity of directing the transcription of an operably linked DNA sequence (e.g., SEQ ID NOS: 210 and 213). The minimal length of a promoter region can be determined by systematically removing sequences from the 5' and 3 '-ends of the isolated polynucleotide by standard techniques known in the art, including but not limited to removal of restriction enzyme fragments or digestion with nucleases. Consequently, any sequence fragments, portions, or regions of the disclosed polypeptide sequences of the present invention can be used as regulatory sequences. It will be appreciated that modified sequences (mutated, truncated and the like) can acquire different transcriptional properties such as the direction of different pattern of gene expression as compared to the unmodified element (e.g., SEQ ID NO: 61 as compared to SEQ ID NO: 213, see the Examples section which follows). Optionally, the sequences set forth in SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31,

36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202 and 203 may be modified, for example for expression in a range of plant systems. In another approach, novel hybrid promoters can be designed or engineered by a number of methods. Many promoters contain upstream sequences which activate, enhance or define the strength and/or specificity of the promoter, such as described, for example, by Atchison [Ann. Rev. Cell Biol. 4:127 (1988)]. T-DNA genes, for example contain "TATA" boxes defining the site of transcription initiation and other upstream elements located upstream of the transcription initiation site modulate transcription levels [Gelvin In: Transgenic Plants (Kung, S.-D. and Us,R., eds, San Diego: Academic Press, pp.49-87, (1988)]. Another chimeric promoter combined a trimer of the octopine synthase (ocs) activator to the mannopine synthase (mas) activator plus promoter and reported an increase in expression of a reporter gene [Min Ni et al, The Plant Journal 7:661 (1995)]. The upstream regulatory sequences of the polynucleotide sequences of present invention can be used for the construction of such chimeric or hybrid promoters. Methods for construction of variant promoters include, but are not limited to, combining control elements of different promoters or duplicating portions or regions of a promoter (see for example, U.S. Pat. Nos. 5,110,732 and 5,097,025). Those of skill in the art are familiar with the specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant organisms and the screening and isolation of genes, [see for example Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, (1989); Mailga et al, Methods in Plant Molecular Biology, Cold Spring Harbor Press, (1995); Birren et al, Genome

Analysis: volume 1, Analyzing DNA, (1997); volume 2, Detecting Genes, (1998); volume 3, Cloning Systems, (1999); and volume 4, Mapping Genomes, (1999), Cold

Spring Harbor, N.Y]. The polynucleotides of the present invention, or fragment, variants or derivatives thereof, _. can be incoφorated into nucleic acid constructs, preferably expression constructs (i.e., expression vectors) which can be introduced and replicate in a host cell.

Thus, according to another aspect of the present invention there is a provided a nucleic acid construct which includes at least one of the polynucleotides of the present invention, or fragments, variants or derivatives thereof.

Preferably, the nucleic acid construct of the present invention includes at least one operably linked heterologous polynucleotide. More preferably, at least one operably linked reporter gene. The phrase "reporter gene" used herein refers to a gene encoding a selectable, screenable or detectable phenotype.

Reporter genes which may be utilized in the present invention may include, but not limited to, LUX or LUC coding for luciferase, GUS coding for β- glucoronidase, GFP coding for green-fluorescent protein, or antibiotic or herbicide tolerance genes. A general review of suitable markers is found in Wilmink and Dons,

Plant Mol. Biol. Reprt. 1 1 : 165-185 (1993).

Further preferably, the nucleic acid construct of the present invention includes at least one heterologous polynucleotide encoding a desirable trait or an expression product. A desirable trait which may be utilized in this invention may include, but not limited to, any phenotype associated with organism's moφhology, physiology, growth and development, yield, produce quality, nutritional enhancement, disease or pest resistance, or stress tolerance.

Alternatively, the heterologous polynucleotide can encode any naturally occurring or man-made recombinant protein, such as pharmaceutical proteins [e.g., growth factors and antibodies Schillberg Naturwissenschaften. (2003) Apr;90(4):145-

55] and food additives. It will be appreciated that molecular farming is a well-proven way of producing a range of recombinant proteins, as described in details in Ma Nat Rev Genet. 2003 Oct;4(10):794-805; Twyman Trends Biotechnol. 2003

Dec;21(12):570-8.

An expression product which may be utilized in this invention may include, but not limited to, pharmaceutical polypeptides, industrial enzymes, oils, dyes, flavors, biofuels, or industrial biopolymers.

In cases of bidirectional DREs, the nucleic acid construct of this invention may include two heterologous polynucleotides each being operably linked to an end of the isolated polynucleotide of this invention, such that the two heterologous polynucleotides flank the isolated polynucleotide of this invention. The nucleic acid construct can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome. Preferably, the nucleic acid construct of the present invention is a plasmid vector, more preferably a binary vector.

The phrase "binary vector" refers to an expression vector which carries a modified T-region from Ti plasmid, enable to be multiplied both in E. coli and in Agrobacterium cells, and usually comprising reporter gene(s) for plant transformation between the two boarder regions. A binary vector suitable for the present invention includes pBI21 13, pBI121, pGA482, pGAH, pBIG, pBIlOl (Clonetech), or a modification thereof such as pVERl which is a modified pBIlOl plasmid, where the GUS gene was replaced by the LucII gene from pGL3-Basic (Promega).

The nucleic acid construct of the present invention can be utilized to transform a host cell. Thus, according to another aspect of the present invention there is provided a transgenic cell, a transgenic organism or a transgenic plant which is transformed with an isolated polynucleotide of the present invention. Preferably the transgenic cell, the transgenic organism or the transgenic plant is transformed with the nucleic acid construct of the present invention.

As used herein, the terms "transgenic" or "transformed" are used interchangeably referring to a cell or an organism into which cloned genetic material has been transferred. Methods of introducing nucleic acid constructs into a cell, an organism or a plant are well known in the art. Accordingly, suitable methods for introducing nucleic acid sequences into plants include, but are not limited to, bacterial infection, direct deliver}- of DNA (e.g., via PEG-mediated transformation, desiccation/inhibition-mediated DNA uptake, elecfroporation, agitation with silicon carbide fibers, and acceleration of DNA coated particles, such as described by

Potrykus Ann. Rev. Plant Physiol. Plant Mol. Biol. 42:205-225 (1991).

Methods for specifically transforming dicots primarily use Agrobacterium tumefaciens. For example, transgenic plants reported include but are not limited to cotton (U.S. Pat. Nos. 5,004,863, 5,159,135, 5,518,908; and WO 97/43430), soybean

[U.S. Pat. Nos. 5,569,834, 5,416,011; McCabe et al, Bio/Technology, 6:923 (1988); and Christou et al, Plant Physiol., 87:671, (1988)]; Brassica (U.S. Pat. No.

5,463,174), and peanut [Cheng et al, Plant Cell Rep., 15: 653, (1996)]. Similar methods have been reported in the transformation of monocots.

Transformation and plant regeneration using these methods have been described for a number of crops including but not limited to asparagus [Asparagus officinalis; Bytebier et al, Proc. Natl. Acad. Sci. U.S.A., 84: 5345, (1987); barley (Hordeum vulgarae; Wan and Lemaux, Plant Physiol., 104: 37, (1994)]; maize [Zea mays; Rhodes, C. A., et al, Science, 240: 204, (1988); Gordon-Kamm, et al, Plant Cell, 2: 603, (1990); Fromm, et al, Bio/Technology, 8: 833, (1990); Koziel, et al, Bio/Technology, 11 : 194, (1993)]; oats [Avena sativa; Somers, et al, Bio/Technology, 10: 1589, (1992)]; orchardgrass [Dactylis glornerata; Horn, et al, Plant Cell Rep., 7: 469, (1988); rice [Oryza sativa, including indica and japonica varieties, Toriyama, et al., Bio/Technology, 6: 10, (1988); Zhang, et al. Plant Cell Rep., 7: 379, (1988); Luo and Wu, Plant Mol. Biol. Rep., 6: 165, (1988); Zhang and Wu, Theor. Appl. Genet., 76: 835, (1988); Christou, et al, Bio/Technology, 9: 957, (1991); sorghum [Sorghum bicolor; Casas, A. M., et al, Proc. Natl. Acad. Sci. U.S.A., 90: 1 1212, (1993)]; sugar cane [Saccharum spp.; Bower and Birch, Plant J., 2: 409, (1992)]; tall fescue [Festuca arundinacea; Wang,„Z. Y. et al, Bio/Technology, 10: 691, (1992)]; turfgrass [Agrostis palustris; Zhong^'et al, Plant Cell Rep., 13: 1, (1993)]; wheat [Triticum aestivum; Vasil et al, Bio/Technology, 10: 667, (1992); Weeks T., et al, Plant Physiol., 102: 1077, (1993); Becker, et al, Plant, J. 5: 299, (1994)], and alfalfa [Masoud, S. A., et al, Transgen. Res., 5: 313, (1996)]. It is apparent to those of skill in the art that a number of transformation methodologies can be used and modified for production of stable transgenic plants from any number of target crops of interest. The transformed plants can be analyzed for the expression features conferred by the polynucleotides of the present invention, using methods known in the art for the analysis of transformed plants. A variety of methods are used to assess gene expression and determine if the introduced gene(s) is integrated, functioning properly, and inherited as expected. Preferably, the promoters can are evaluated by determining the expression levels and the expression features of genes to which the promoters are operatively linked. A preliminary assessment of promoter function can be determined by a transient assay method using reporter genes, but a more definitive promoter assessment can be determined from the analysis of stable plants. Methods for plant analysis include but are not limited to Southern blots or northern blots, PCR-based approaches, biochemical analyses, phenotypic screening methods, field evaluations, and immunodiagnostic assays.

Preferably, the capacity of isolated polynucleotides of this invention to promote gene expression in plants is evaluated according to phenotypic expression of reporter genes using procedures as described in the Examples section that follows. Briefly, the expression of luciferase in transgenic Arabidopsis is determined and consistently classified by quantitatively scoring certain features of expression, such as the intensity, specificity, development stage and positioning of expression. Accordingly, a luciferase gene that is expressed in a constitutive manner would indicate a putative constitutive promoter activity of the isolated polynucleotide. Likewise, a luciferase gene that is expressed in an inductive, tissue specific or a development-stage specific manner, would respectively indicate a putative inductive, a tissue specific or a stage specific promoter activity.

Hence, the present invention provides a plurality of isolated polynucleotide sequences which exhibit a wide spectmm of promoter function patterns. These polynucleotides can be used to generate nucleic acid constmcts, such as expression vectors suitable for transforming an organism. Such nucleic acid constracts can be used to promote expression of desired traits or expression products in transgenic organisms, such as plants, in a constitutive, induced, tissue specific, or a developmental stage specific manner.

Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al, (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al, "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al, "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531 ; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" λ^olumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521 ; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al, "Strategies for Protem

Purification and Characterization - A Laboratory Course Manual" CSHL Press

(1996); all of which are incoφorated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incoφorated herein by reference.

IDENTIFICA TION, ISOLA TION AND CHARA CTERIZA TION OF DNA REGULA TING ELEMENTS (DREs) Novel DREs were identified by luciferase expression assay driven by bioinformatically identified DNA fragments from Arabidopsis thaliana genomic DNA. Positive DREs were fused upstream a reporter gene in a vector which was used to transform Arabidopsis thaliana plants. The reporter gene expression driven by these DREs was characterized.

MA TERIALSAND EXPERIMENTAL METHODS

Isolation of DREs: A high throughput method of cloning DNA regulating elements (DREs) using a single reaction tube, referred to herein as the "one-tube" method, was utilized in order to enable large scale production of DRE transformed plants. Accordingly, genomic DNA (gDNA) was extracted from leaves of

Arabidopsis thaliana Coll using DNAeasy Plant Mini Kit (Qiagen, Germany).

Primers for PCR amplification of DREs were designed using PRIMER3^® software and modified to contain restriction sites absent from the DRE sequence, for PCR product insertion into pVERl binary plasmid, which is a pBIlOl (clontech) modified plasmid, where the GUS reporter gene was replaced by LucII gene from pGL3-Basic

(promega). Briefly, GUS gene was cut out of pBIlOl using the blunt restriction enzymes Ecll36II and Smal. The pGL-Basic plasmid [after eliminating the Hindlll and BamHI sites, by digestion, fill-in using klenow fragment (Roche) and self ligating the plasmid, using T4 DNA ligase (Roche)] was cut Sad and Xbal and the LucII gene insert was inserted into pBluescript, digested with the same enzymes. The new plasmid was digested Smal, as a result a blunt ends LucII gene was cut out. The LucII gene was inserted into The pBI plasmid instead of the GUS gene. To eliminate all possible read-through of the Nos-promoter, which regulates Kanamycin resistance gene on pBIlOl, a poly-A signal was added between the Nos-terminator and the LucII gene. Poly-A signal was amplified from pGL3-Basic using proof reading Taq polymerase PFU (Promega) and using primers 5'-aggtacttggagcggccgca-3' and 5'- tagagaaatgttctggcacctg-3'. The Product was inserted into Hindlll site on pVerl after filling the overhang 5' ends, using Klenow fragment (Roche).

Polymerase chain reaction analyses were performed using Taq Expand Long Template PCR kit (Roche), according to the manufacturer's instractions, using as thermal cycle: 92 °C/2 min → 10 x [94 °C/10 min → 55 °C/30 sec → 68 °C/5 min] → 18 x [94 °C/10 min → 55 °C/30 sec → 68 °C/5 min (+ 20 sec each cycle)] → 68 °C/7 min. PCR products were double-digested with restriction endonucleases according to the protocols described in Table 1.

Cloning of DREs in luciferase reporter gene expression: PCR amplified

DREs were cloned into a luciferase reporter gene expression vector pVERl, derived from the binary vector pBIlOl (Clontech), was double-digested using the same restriction endonucleases used to excise cloned DREs from vector, purified using PCR Purification Kit (Qiagen, Germany), treated with alkaline-phophatase (Roche) according to the manufacturer's instructions and re-purified using PCR Purification

Kit (Qiagen, Germany). Insertion of DRE into vector pVERl was performed by adding to DRE digests: 500 ng of double digested pVerl plasmid, 1 μl of T4 DNA ligase (40 U/μl; Roche) and 6 μl of T4 buffer (Roche). Following overnight incubation of ligation mixes at 4 °C, Agrobacterium turnefaciens GV303 competent cells were transformed using 1-2 μl of ligation reaction mixture by elecfroporation, using a MicroPulser electroporator (Biorad), 0.2 cm cuvettes (Biorad) and EC-2 electroporation program (Biorad). Agrobacterium cells were grown on LB at 28 °C for 3 h and plated on LB-agar plates supplemented with the antibiotics gentamycin 50 mg/L (Sigma) and kanamycin 50 mg/L (Sigma). Plates were then incubated at 28 °C for 48 h. Cloned DREs were identified by PCR analysis of bacterial colony DNA using the vector specific, insert flanking upstream and downstream primers 5'- AGGTACTTGGAGCGGCCGCA-3⁵ and 5'-CGAACACCACGGTAGGCTG-3\ respectively and the thermal cycle: 92 °C/3 min → 31 x [94 °C/30 sec → 54 °C/30 sec → 72 °C/Xmin (X = length (kb) of longest PCR product expected)] → 72 °C/10 min. Positive Agr-obacterium colonies were subsequently used for Arabidopsis plant transformation.

Plant transformation and cultivation: Arabidopsis thaliana Columbia (To plants) were transformed using the Floral Dip procedure described by Clough SJ and Bent AF [The Plant J. 16:735-743 (1998)] and by Desfeux et al. [Plant Physiology 123:895-904 (2000)] with minor modifications. Briefly, To Plants were sown in 250 ml pots filled with wet peat-based growth mix. The pots were covered with aluminum foil and a plastic dome, kept at 4 °C for 3 - 4 days, then uncovered and incubated in a growth chamber at 18 - 24 °C under 16/8 hr light/dark cycle. The To plants were ready for transformation six days before anthesis.

Single colonies of Agrobacterium carrying plant DREs were cultured in LB medium supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures were incubated at 28°C for 48 hours under vigorous shaking and centrifuged at 4000 φm for 5 minutes. The pellets comprising Agrobacterium cells were resuspended in a transformation medium which contained half-strength (2.15 g/L) Murashig-Skoog (Duchefa); 0.044 μM benzylamino purine (Sigma); 112 μg/L B5 Gambourg vitamins (Sigma); 5% sucrose; and 0.2 ml/L Silwet L-77 (OSI Specialists, CT) in double-distilled water , at pH of 5.7.

Transformation of To plants was effected by inverting each plant into an Agrobacterium suspension such that the above ground plant tissue was submerged for 3-5 seconds. Each inoculated T₀ plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and kept in the dark at room temperature for eighteen hours to facilitate infection and transformation. Transformed (transgenic) plants were then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic To plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry then seeds were harvested from plants and kept at room temperature until sowing

Generating Tj and T₂ transgenic plants harboring DREs: Seeds collected from transgenic To plants were surface-sterilized by soaking in 70% ethanol for 1 minute, followed by soaking in 5% sodium hypochloride and 0.05% triton for 5 minutes. The surface-sterilized seeds were thoroughly washed in sterile distilled water then placed on culture plates containing half-strength Murashig-Skoog (Duchefa); 2% sucrose; 0.8% plant agar; 50 mM kanamycin; and 200 mM carbenicylin (Duchefa). The culture plates were incubated at 4°C for 48 hours then transferred to a growth room at 25°C for an additional week of incubation. Vital T] Arabidopsis plants were transferred to a fresh culture plates for another week of incubation. Following incubation the Ti plants were removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic were allowed to grow in a greenhouse to maturity. Seeds harvested from T] plants were cultured and grown to maturity as T plants under the same conditions as used for culturing and growing the Ti plants.

Evaluating DRE gene-promoting activity in transgenic plants: The ability of DREs to promote gene expression in plants was determined based on the expression of luciferase reporter gene. Accordingly, transgenic Arabidopsis plantlets at a development stage of 2-3 true leaves were subjected to luminescence assays using the procedure described by Messinner R. [Plant. J. 22:265 (2000)]. The imaging of luciferase was performed in a darkroom using ultra-low light detection camera (Princeton Instmments Inc., USA). Using the procedure described by Messinner R. [Plant. J. 22:265 (2000)]. Scoring promoter activity in transgenic plants: DREs promoting gene expression was characterized based luciferase expression in transgenic plants using quantitative values such as to enable consistent evaluations of a large volume of transgenic plants, as follows:

Scoring distribution and intensity of expression: The distribution of reporter genes' expression in transgenic plants was presented in a three variables functions, as follows: (i) plant ID (X axis), (ii) plant organ (Y axis), and (iii) development stage (Z axis). The intensity of expression, relevant to any of these three variables, was measured by a distribution function value (DF), referred hereinbelow as f_x .(Promoter). The DF received a value ranging from 0 to 5, representing no expression and the highest expression intensity, respectively.

Scoring specificity of expression: The specificity of reporter genes' expression in transgenic plants was calculated by summing two independent addends: (a) the zero value/nonzero values ratio, as described in table 2 below and which further referred to as the Binary Function B( ); and (b) the variance of the nonzero values only.

Table 2

The Organ Specificity expression value (SpOr) was calculated according to the following equation:

SpOr (promoter ) = Var _y (Av _x . (f_{x y} . (promoter ))\_y>0 )+ B Av _{x :} (f_{x }}, . promoter )))

Whereas Var is the variance, Av is the average and B is the Binary Function.

The development Stage Specificity expression value (SpDs) was calculated according to the following equation: SpDS (promoter )= Var _ {Av_x^y(f (promoter ))\_Z>Q )+ B Av _{x y} f_{x y} .(promoter )))

Whereas Var is the variance, Av is the average and B is the Binary Function.

Scoring position effect: Similarly to the Binary Factor approach described above, position values were also classified as either zero or nonzero values. Accordingly, the reporter genes' expression in a given organ in a given development stage was measured by a Local Position Effect value (LoPoEf). The Position Effect value (PoEf) was the average of all the Local Position Effects, calculate in three steps as follows:

0 f (promote = 0 1) K promote^ ^ ^(^^ ^3^ -

2)

LoPoEf (promoter , organ ,developmen t _ stage ) = no _ of _ 0s _ in h_{x vsr} ._=z (promoter )) no _ of _ non _ 0s _ in (h_{x v=γ} ._=z (promoter )) mm no _ of _^ non _ Qs _ in ψ _y__γ . ^ (promoter ))' no _ of _ 0s _ in _\h _r .^ promoter ))

3) PoEf (promoter ) = Av (LoPoEf (promoter , Y, Z )) . Scoring expression level: The average expression level value (ExLe) and the

ExLe variance (VrExLe) were calculated per each DRE promoter x plant organ x plant development stage combination, according the following equations: ExLe(promoter, organ, development _ stage) = Av_x (f_x (promoter))

VrExLe(promoter , organ, development _ stage) - var (f , (promoter)). Scoring evaluation reliability: The General Reliability value (Grel) was the number of independent plants that were used for evaluating a specific DRE promoter activity. Hence, G Re l(promoter) = Count (f_x . (promoter)) . The Development

Stage Reliability value (Rel(DS)) was the number of independent plants that were used for evaluating a specific DRE promoter activity in any given plant developing stage. Re I (promoter, development _ stage) = Count _{x]2=developmem} __stage (f_{x y :} (promoter)) .

Creation of partial fragments from vDREs 4209 and 6669: Genomic DNA derived from Arabidopsis thaliana var ColO was extracted and PCR-amplified using oligonucleotide primers complementary to sequences within vDRE 4209 (SEQ ID NO:36) [sense primer 5'- GTTGGTTCGTCGACTAGAGAAGGT -3' (SEQ ID NO: 208), antisense primer 5'- TTGGATCCGGGAGGCAATGATGCTTTAG - 3' (SEQ ID NO: 209)], and vDRE 6669 (SEQ ID NO:61) [sense primer 5'- TTGTAAGCTTGCAGGGATACGGATGGGTAG -3' (SEQ ID NO: 211), antisense primer 5'- AAATATTGGATCCTTTGGGGTTCTC - 3' (SEQ ID NO: 212)]. The above PCR amplifications resulted in a 470 bp fragment, containing bp 76-548 of the original vDRE 4209 (SEQ ID NO:210) and a 1569 bp fragment, containing bp 748-2316 of the original vDRE 6669 (SEQ ID NO:213), respectively.

PCR products were digested with Hindlll and BamHI and ligated into the binary vector, pBI121 (Clontech, accession number: AF485783) upstream to the GUS gene, generating plasmids p4209short-GUS , and p6669short-GUS, respectively. Arabidopsis plants (var colO) were transformed with the binary constructs generated (ρ4209short-GUS and p6669short-GUS), and GUS activity was analyzed on 10 independent TI transformed plants using standard GUS staining protocol [Jefferson RA, Kavanagh TA, Bevan MW. 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6(13): 3901-7]. Genomic DNA extraction, PCR amplification, DNA restriction, ligation and transformation of Arabidopsis plant were preformed according to the protocols described above.

EXPERIMENTAL RESULTS

Characterization of DREs :

Various features of the isolated DREs of the present invention are described in Tables 3-17 which follow. As is clearly evident from the Table provided data, the DREs of the present invention exhibit a wide range of gene-promoting activities including: constitutive, inductive, tissue specific, and stage specific activities.

Table 3

¹ ID number of the DRE as assigned by the present inventors

² Internal reference assigned by the present inventors to a cluster of A) abidopsis genes (contig) downstream or upstream of the DRE

³ Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression , Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression

⁴ A PCR primer for isolating the DRE from Ai abidopsis genomic DNA

⁵ Position Effect Values (PoEf), Development Stage-Specificity Values (SpDs) and Organ Specificity Values (SpOr) were calculated as described in the materials and methods section hereinabove

⁶ No = number. Ave = average, Var = variance Table 4

' ID number of the DRE as assigned by the present inventors.

² Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE.

³ Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression ; Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression. A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁵ Position Effect Values (PoEf), Development Stage-Specificity Values (SpDs) and Organ Specificity Values (SpOr) were calculated as described in the materials and methods section hereinabove.

⁶ No. = number; Ave. = average; Var. = variance. Table 5

' ID number of the DRE as assigned by the present inventors

² Internal reference assigned by the present inventors to a cluster of Ai abidopsis genes (contig) downstream or upstream of the DRE

⁴ A PCR primer for isolating the DRE from Ai abidopsis genomic DNA

⁶ No = number, Ave = average. Var = variance Table 6

ID number of the DRE as assigned by the present inventors ' Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE

⁴ A PCR primer for isolating the DRE from Ai abidopsis genomic DNA

⁶ No = number, Ave = average, Var = variance Table 7

' ID number of the DRE as assigned by the present inventors.

³ Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression ; Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 8

ID number of the DRE as assigned by the present inventors

Internal reference assigned by the present inventors to a cluster of Ai abidopsis genes (contig) downstream or upstream of the DRE

³ Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression , Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression A PCR primer for isolating the DRE from A? abidopsis genomic DNA

6 No = number, Ave = average, Var = variance Table 9

¹ ID number of the DRE as assigned by the present inventors.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 10

ID number of the DRE as assigned by the present inventors. Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 11

¹ ID numbei of the DRE as assigned by the present inventors.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average: Var. = variance. Table 12

ID number of the DRE as assigned by the present inventors ^* Internal reference assigned by the present inventors to a cluster of ^' A abidopsis genes (contig) downstream or upstream of the DRE

⁴ A PCR primer for isolating the DRE fiom A abidopsis genomic DNA

No = number Ave = average, Var = variance Table 13

ID number of the DRE as assigned by the present inventors.

Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 14

ID number of the DRE as assigned by the present inventors. ² Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE.

Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression ; Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 15

¹ ID number of the DRE as assigned by the present inventors.

" Internal reference assigned by the present inventors to a cluster oϊ Arabidopsis genes (contig) downstream or upstream of the DRE.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 16

ID number of the DRE as assigned by the present inventors.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Table 17

¹ ID number of the DRE as assigned by the present inventors.

³ Unidirectional implies that only the sense strand of the DRE is capable of regulating gene expression : Bidirectional implies that both the sense and antisense strands of the DRE are capable of regulating gene expression.

⁴ A PCR primer for isolating the DRE from Arabidopsis genomic DNA.

⁶ No. = number; Ave. = average; Var. = variance. Deletion analysis of DREs 4209 and 6669:

The ability of partial DRE sequences to modify in vivo gene expression pattern, was tested by comparing reporter gene expression driven by unmodified

DREs (SEQ ID NO:36 and 61) with that of deletion mutants thereof (SEQ ID NO:210 and 213, respectively) .

GUS expression pattern in p4209short-GUS (including the DRE 4209 partial sequence set forth in SEQ ID NO:210) transformed plants was similar to that driven by the full length promoter sequence, DRE 4209 (SEQ ID NO:36). As is shown in Figure

26a, expression was strong in roots, mainly root tips, as well as in flower buds. Insterstingly, p4209short-GUS transformed plants exhibited lower reporter gene expression in veins, while leaves exhibited higher expression. Note, expression in seeds was not examined.

GUS expression pattern in the p6669short-GUS (comprising the DRE 6669 partial sequence set forth in SEQ ID NO:213) transformed plants was restricted to the root tips (Figure 26b) while expression in other young or meristematic tissues, as was obtained by the full length DRE 6669 promoter (SEQ ID NO:61), was lost.

These results demonstrate that the 5' nucleic acid sequence of SEQ ID NO: 61 (e.g., nucleotide coordinates 1-747), is important for constitutive gene expression. Indeed, a DNA sequence (SEQ ID NO: 214, see Figure 27 WO 02/16655) which does not include the 5' first 400 nucleotides of SEQ ID NO: 61 has been implicated in stress regulated gene expression.

These results indicate that the promoters of the present invention may be modified by partial deletions, to generate inductive or tissue specific expression pattern as demonstrated for DRE 6669 (SEQ ID NO:61). As is clearly illustrated by Tables 3-17 and Figures 1-26, the DREs isolated according to the teachings of the present invention exhibit a wide range of activities as well as a wide range of tissue and developmental stage specificities. The DREs of the present invention were classified according to function as determined using the Arabidopsis assay described hereinabove. The luciferase gene was expressed in a constitutive manner in Arabidopsis when functionally linked to SEQ ID NOS: 1, 6, 41, 46, 51, 86, 121, 136, 171, 181 and 202 (illustrated in Figure 18), thus the promoters of these DREs are putatively classified herein as constitutive promoters. The luciferase gene was expressed in an inductive manner in Arabidopsis when functionally linked to SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 81, 91, 96, 101, 116, 126, 141, 146, 151, 156, 161, 166, 176 and 203, thus the promoters of these DREs are putatively classified herein as inductive promoters. The luciferase gene was expressed in a young or meristematic, tissue-specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 61, 121, 126, 213 (illustrated in Figures 4, 14, 15, 16 and 26b), thus the promoters of these DREs are putatively classified herein as young or meristematic, tissue-specific promoters.

The luciferase gene was expressed in root tissue specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 21, 36, 91, 111, and 126 (illustrated in Figures 2, 3, 9, and 13), thus the promoters of these DREs are putatively classified herein as root tissue-specific promoters

The luciferase gene was expressed in an above ground tissue-specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 16, 26, 31, 66, 71, 76, 81, 96, 106, 101, 116, 131, 146, 151, 156, 161, 166, 196, 201 and 203 (illustrate in

Figures 10, 11, 17, 19 and 20), thus the promoters of these DREs are putatively classified herein as above ground tissue-specific promoters.

The luciferase gene was expressed in a stem tissue specific manner in Arabidopsis when functionally linked to SEQ ID NO: 186 (illustrated in Figure 22), thus the promoter(s) of this DRE are putatively classified herein as stem tissue specific promoter(s).

The luciferase gene was expressed in a flower tissue specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 11, 36, 81, 91, 126, 176 and 210 (illustrated in Figures 1, 3, 9 and 26a), thus the promoters of these DREs are putatively classified herein as flower tissue-specific promoters.

The luciferase gene was expressed in a fruit (silique) tissue specific manner in Arabidopsis when functionally linked to SEQ ID NO: 56 , thus the promoter(s) of this DRE are putatively classified herein as fruit (silique) tissue specific promoter(s).

The luciferase gene was expressed in a seed tissue specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 1, 156, and 161 (illustrated in figures 12 and 21), thus the promoters of these DREs are putatively classified herein as seed tissue specific promoters. The luciferase gene was expressed in a developmental stage specific manner in Arabidopsis when functionally linked to SEQ ID NOS: 81, 96, 101, 106, and 131 (illustrated comparatively in Figures 5-6, 7-8, 10-11 and 15-16), thus the promoters of these DREs are putatively classified herein as _, developmental stage specific promoters.

The GUS gene was expressed in an inductive manner in Arabidopsis when functionally linked to SEQ ID NOS: 210 and 213 (illustrated in Figure 26b), thus the promoters of these partial DREs sequences are putatively classified herein as inductive promoters. The GUS gene was expressed in a root, as well as in a flower bud tissue specific manner in Arabidopsis when functionally linked to SEQ ID NO: 210 (illustrated in Figure 26a), thus the promoter of this partial DRE sequence is putatively classified herein as a root as well as a flower tissue-specific promoter.

The GUS gene was expressed in a root-tip tissue specific manner in Arabidopsis when functionally linked to SEQ ID NO: 213 (illustrated in Figure 26b), thus this promoter is putatively classified herein as a root tissue-specific promoter.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents, patent applications and sequences identified by their accession numbers mentioned in this specification are herein incoφorated in their entirety by reference into the specification, to the same extent as if each individual publication, patent, patent application or sequence identified by their accession number was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213 wherein the isolated polynucleotide is capable of regulating expression of at least one polynucleotide sequence operably linked thereto.

2. The isolated polynucleotide of claim 1, wherein said isolated polynucleotide includes at least one promoter region.

3. The isolated polynucleotide of claim 2, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 6, 41, 46, 51, 86, 121, 136, 171, 181 and 202, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a constitutive manner.

4. The isolated polynucleotide of claim 2, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 81, 91, 96, 101, 116, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196, 201, 203, 210 and 213, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in an inductive manner.

5. The isolated polynucleotide of claim 2, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 91, 116, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196, 201, 203, 210 and 213, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a tissue specific manner.

6. The isolated polynucleotide of claim 2, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 81, 96, 101, 106 and 131, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a developmental stage specific manner.

7. A nucleic acid construct, comprising the isolated polynucleotide of claim 1.

8. The nucleic acid construct of claim 7, further comprising at least one heterologous polynucleotide operably linked to the isolated polynucleotide.

9. The nucleic acid construct of claim 8, wherein said at least one heterologous polynucleotide is a reporter gene.

10. The nucleic acid contrast of claim 8, further comprising two heterologous polynucleotides each being operably linked to an end of the isolated polynucleotide such that said two heterologous polynucleotides flank the isolated polynucleotide.

1 1. The nucleic acid construct of claim 7, wherein said isolated polynucleotide includes at least one promoter region.

12. The nucleic acid construct of claim 11, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 6, 41, 46, 51, 86, 121, 136, 171, 181 and 202, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a constitutive manner.

13. The nucleic acid construct of claim 11, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 81, 91, 96, 101, 116, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196, 201, 203, 210 and 213 and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in an inductive manner.

14. The nucleic acid construct of claim 11, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 1, 11, 16, 21, 26, 31, 36, 56, 61, 66, 71, 76, 91, 116, 126, 141, 146, 151, 156, 161, 166, 176, 186, 191, 196,^' 201, 203, 210 and 213 and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a tissue specific manner.

15. The nucleic acid construct of claim 11, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOS: 81, 96, 101, 106 and 131, and whereas said at least one promoter region is capable of directing transcription of said at least one polynucleotide sequence in a developmental stage specific manner.

16. A transgenic cell comprising the isolated polynucleotide of claim 1.

17. A transgenic cell comprising the nucleic acid construct of claim 7.

18. A transgenic organism comprising the isolated polynucleotide of claim 1.

19. A transgenic organism comprising the nucleic acid construct of claim

7.

20. A transgenic plant comprising the isolated polynucleotide of claim 1.

21. A transgenic plant comprising the nucleic acid construct of claim 7.

22. A method of producing a transgenic plant, comprising transforming a plant with the polynucleotide of claim 1.

23. A method of producing a transgenic plant, comprising transforming a plant with the nucleic acid construct of claim 7.

24. A method of expressing a polypeptide of interest in a cell comprising transforming the cell with a nucleic acid construct including a polynucleotide sequence encoding the polypeptide of interest operably linked to a regulatory nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 11, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 11, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213 thereby expressing the polypeptide of interest in the cell.

25. A method of co-expressing two polypeptides of interest in a cell comprising transforming the cell with a nucleic acid construct including two polynucleotide sequences encoding the two polypeptides of interest operably linked to a regulatory nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1, 6, 1 1, 16, 21, 26, 31, 36, 41, 46, 56, 61, 66, 71, 76, 81, 86, 91, 96, 101, 106, 1 1, 116, 121, 126, 131, 136, 141, 146, 151, 156, 161, 166, 171, 176, 181, 186, 191, 196, 201, 202, 203, 210 and 213 such that said two polynucleotide sequences flank said regulatory nucleic acid sequence, thereby expressing the two polypeptides of interest in the cell.