WO2004076673A1 - Methods and constructs for increasing the content of selected amino acids in seeds - Google Patents
Methods and constructs for increasing the content of selected amino acids in seeds Download PDFInfo
- Publication number
- WO2004076673A1 WO2004076673A1 PCT/FI2004/000105 FI2004000105W WO2004076673A1 WO 2004076673 A1 WO2004076673 A1 WO 2004076673A1 FI 2004000105 W FI2004000105 W FI 2004000105W WO 2004076673 A1 WO2004076673 A1 WO 2004076673A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- plant
- gfp
- amino acid
- promoter
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
Definitions
- the present invention relates in general to plant biotechnology.
- the invention is related to methods and constructs for increasing the content of selected amino acids in a plant species or in a tissue or an organ of a plant, including cell walls, cell membranes, oil bodies, particularly in seeds.
- the increased content is obtained by providing a recombinant nucleotide sequence construct encoding a carrier protein having in its 3 '-terminal end a polyamino acid extension.
- Compositions obtainable by the method and the use of said amino acid-enriched composition as well as plants, plant cells and cell-lines transformed with one or more of said constructs are disclosed.
- the transgenic seeds contained less sulfate and more total amino acid sulfur than the non-transgenic parent line; this was associated with a 94% increase in methionine content and a 12% reduction in cysteine content. There was no statistically significant change in other amino acids or in total nitrogen or total sulfur content of seeds.
- WO 99/15004 a chimeric construct for modifying the composition of storage organs in plants is described.
- a gene encoding a sulphur-rich protein is provided with a C-terminal KDEL extension, which enables targeting of the construct to the endoplasmic reticulum and Golgi apparatus.
- the above approaches have certain drawbacks. When large amounts of foreign proteins with no functional role for the host plant are expressed it may result in many secondary problems connected with physiological abnormalities of seeds as noticed in equivalent-type mutants created by traditional breeding methods.
- the first objective of the present invention is to provide a method, including recombinant nucleotide sequence constructs, enabling selection of constructs for effective transformation of any desired plant species with targeted expression enabling accumulation of stable protein enriched by one or more selected amino acids entailing said protein in any selected plant tissues.
- a second objective of the present invention is to provide a composition comprising a stable amino acid-enriched protein, which has accumulated in selected plant tissue combined with compatible formulation aiding additives. The use of said composition to be suitable as a direct food source from selected plant for humans as well as fodder, especially as animal feed and as a feed supplement, is suggested.
- the present invention is related to improving the quality of plant proteins by a method, which increases the content of one or more selected amino acids by targeted expression or accumulation of a protein enriched with an amino acid sequence entailing said plant protein.
- the method comprises the steps of transforming a plant with at least one recombinant nucleotide sequence constract.
- the construct comprises tissue or organ specific regulatory sequences, which drive transcription during selected stages of morphogenesis.
- the regulatory sequences are operably linked to a chimeric nucleotide sequence.
- the nucleotide sequence encoding the carrier protein is selected from nucleotide sequences encoding plant specific proteins enabling targeted expression or accumulation of the amino acid-enriched protein in a selected tissue or organ of the plant.
- the nucleotide sequence encoding the carrier protein lacks a termination codon and is from its 3 '-terminal end fused in-frame with nucleotide sequences comprising a selected number of codons encoding a selected combination of one or more amino acid residues. Said construct enables stable targeted expression or accumulation of the amino acid-enriched carrier protein having a polyamino acid extension in the selected plant tissue or organ.
- transformation construct is obtained by selecting constructs enabling stable protein translation of the polyamino acid extension and stable targeted expression or accumulation.
- the selection is carried out with an in vitro translation system (rVT) and/or a transient expression system and is subsequently confirmed with other applicable methods.
- rVT in vitro translation system
- the -VT system is primarily used to determine the optimal number of codons, which can be fused in-frame with the nucleotide sequence encoding the carrier protein without comprising the efficacy of the translation of the amino acid-enriched entailed carrier protein.
- the transient expression system comprises the construct described above fused in-frame with a nucleotide sequence encoding a reporter protein.
- This transient expression constract is introduced into a plant cell, preferably using a crOprojectile bombardment method. Thereafter, constructs providing stable, targeted expression of the reporter gene in said plant cell are selected and the nucleotide sequences encoding the reporter protein from the selected constructs are removed. Said constructs are used for production purposes by transforming plants with the constructs lacking the reporter gene as described above, preferably using Agrobacterium-mediated transformation systems.
- the method allows production of amino acid-enriched proteins, i.e. carrier proteins entailed with a polyamino acid extension comprising a selected combination of four to eighty amino acids residues.
- the amino acids are advantageously histidine, cysteine, methionine, glycine, lysine, tryptophan, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, serine, threonine, arginine, aspartate, glutamate, asparagines, glutamine or any combination thereof.
- the carrier protein enabling stable targeted expression or accumulation in a tissue or organ of a plant may be selected from proteins functioning in the intracellular trafficking pathway of the plant.
- the carrier protein is a cell wall protein or plant viral protein.
- Useful carrier proteins are for example oleosin, caleosin, steroleosin, cruciferin, napin or a plant viral movement protein.
- the regulatory sequence is favourably a promoter expressing during embryogenesis.
- Useful regulatory sequences comprise promoters, such as the napin (NAP), 35S, chimeric hybrid (HYB), 19S, nopalin, phaseolin, steroleosin, caleosin, cruciferin, Alfalfa mosaic virus (AMV), heat-shock, albumin 2S or oleosin promoters.
- the reporter protein is advantageously a detectable protein.
- Fluorescent proteins such as green fluorescent protein (GFP), a red fluorescent protein, a ⁇ -glucuronidase, an obelin or a luciferase are particularly advantageous.
- the method of the present invention is particularly useful for producing a composition comprising in plant material, including cell wall debris, an amino acid-enriched carrier protein having a polyamino acid extension, wherein the content of selected amino acids in the plant material obtained by the method as compared to the amino acid content in a corresponding unmodified wild type plant is at least 2:1.
- Said composition is useful for for producing an amino acid-enriched feed of an oil cake obtained after recovery of oil from plants.
- plants, plant cells and plant cell lines transformed with the transient expression constructs or transformation constructs are also disclosed in the present invention.
- FIG. 1 shows eighteen expression plasmids, wherein pRT means a construct containing a 35S promoter of Cauliflower mosaic virus in a plasmid vector pRTlOO (Topfer et al., Nucleic Acid Res. 15(14): 5890, 1987).
- Figure 2 shows four expression plasmids that were selected on the basis of transient expression assay data for stable transformation into Brassica campestris plants.
- NAP napin promoter
- HYB hybrid promoter i.e. the enhancer region from the CaMV 35S promoter fused to the napin promoter
- OLE oleosin
- MP Tobacco mosaic viras 30K movement protein gene
- GFP green fluorescent protein gene
- 4x four amino acid-enriched nucleotide sequence regions (cassettes). Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 3 shows the nucleotide sequence of a histidine codon-enriched sequence (A), the nucleotide sequence of a cysteine-methionine codon enriched sequence (B), the nucleotide sequence of a glycine codon-enriched sequence (C) and the nucleotide sequence of a lysine codon-enriched sequence (D).
- the protein translation sequence is shown below the nucleotide sequence.
- the asterisk indicates the transcriptional termination codon.
- Figure 4 shows the construction scheme of plasmids carrying fusions of histidine or cysteine- methionine codon-enriched DNA sequences of different lengths fused to the TMV 30K MP gene (open box "MP").
- ⁇ GEM-7Zf(+) (Promega Corporation, USA; catalogue number P2251) was used to construct histidine codon-enriched nucleotide sequences.
- Clone pGEM-His-24 contains a DNA segment coding for a 19 amino acid-long peptide containing 14 His residues ( Figure 3A).
- Figure 5A depicts the construction of expression plasmids pNAP and pHYB, wherein RT means that the construct contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOO (Topfer et al., Nucleic Acid Res. 15(14): 5890, 1987).
- the expression plasmids contain the napin promoter (NAP) or chimeric promoter (HYB) that consists of the entire napin promoter coupled with the enhancer region of the Cauliflower mosaic virus (CaMV) 35S promoter (Example 16). Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 5B depicts the cloning of the green fluorescent protein (GFP) gene into 35S CaMV and napin promoter-based plasmids, wherein RT means that the construct contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOO (Topfer et al., Nucleic Acid Res. 15(14): 5890, 1987).
- the expression plasmids contain the napin promoter (NAP) or chimeric promoter (HYB) that consists of the entire napin promoter coupled with the enhancer region of the Cauliflower mosaic virus (CaMV) 35S promoter (Example 16). Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 6 shows the relative GFP expression achieved using the 35S CaMV (a) and HYB (b) promoters in constructs pRT-OLE-4x-GFP and pHYB-OLE-4x-GFP, respectively (see Figure 1) after particle bombardment of constructs into epidermal cells of Nicotiana benthamiana (Example 8).
- Figure 7 depicts the construction of plant expression vectors consisting of the TMV 30K MP gene (MP), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes) fused to the GFP coding region, under the control of the 35S CaMV promoter.
- RT means that the constract contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOl (Topfer et al., Nucleic Acid Res. 15(14): 5890, 1987). Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 8 depicts the constraction of plant expression vectors consisting of the TMV 30K MP gene (MP), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes), fused to the GFP coding region, under the control of the napin (NAP) promoter.
- RT means that the construct contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOO (Topfer et al, Nucleic Acid Res. 15(14): 5890, 1987).
- pGEM-30K contains the 30K movement protein gene from TMV in pGEM-7Z(+) plasmid (Promega Corporation USA) (Example 7). Arrows represent promoters, and the small box labelled as "t” indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 9 depicts the constraction of plant expression vectors consisting of the TMV 30K MP gene (MP), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes), fused to the GFP coding region, under the control of the hybrid (HYB) promoter.
- RT means that the constract contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOO (Topfer et al., Nucleic Acid Res. 15(14): 5890, 1987).
- pGEM-30K contains the 30K movement protein gene form TMV in pGEM-7Z(+) plasmid (Promega Corporation USA) (Example 7). Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 10 depicts the constraction of plant expression vectors (pRT) consisting of oleosin gene (OLE), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes), fused to the GFP coding region, under the control of the 35S CaMV promoter.
- RT means that the constract contains the 35S promoter of Cauliflower mosaic virus (CaMV 35S promoter) from a plasmid vector pRTlOO (Topfer et al, Nucleic Acid Res. 15(14): 5890, 1987). See Example 6 for details of pOLE4/ll. Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- Figure 11 depicts the constraction of plant expression vectors consisting of oleosin gene (OLE), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes), fused to the GFP coding region, under the control of the napin (NAP) promoter. See Example 6 for details of pOLE4/ll. Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- OLE oleosin gene
- NAP napin
- Figure 12 depicts the constraction of plant expression vectors consisting of oleosin gene (OLE), His- or Cys-Met-enriched sequence cassettes of different length (grey boxes), fused to the GFP coding region, under the control of the hybrid (HYB) promoter. See Example 6 for details of pOLE4/ll. Arrows represent promoters, and the small box labelled as "t" indicates the transcription termination sequence. Location of several restriction sites are indicated in the Figure.
- OLE oleosin gene
- HYB hybrid
- Figure 13 shows a Western blot of pNAP-MP-4xHis-GFP (see Figure 2) expressing Brassica campestris plants.
- Lanes 1, 2 and 3 correspond to three independent pNAP-MP-4xHis-GFP transformants (lines 5.1A7, 5.1A11 and 5.1A18, respectively).
- Molecular weight markers (dots on the right hand side) are 50 kDa (upper dot) and 40 kDa (lower dot). His-antibody was used as the probe.
- Figure 14 shows a Western blot of pHYB-OLE-4xHis-GFP (see Figure 2) expressing Brassica campestris plants.
- Lanes 1, 2, 3, 5, 6 and 7 correspond to six independent pHYB-OLE-4xHis- GFP transformants (lines 17.1237, 17.1238, 17.1240, 17.20c8, 17.20cll and 17.20c20, respectively);
- lane 4 corresponds to a wild-type (untransformed) control plant.
- Molecular weight markers (lane 8, dots on the right hand side) are 50 kDa (upper dot) and 40 kDa (lower dot). His-antibody was used as the probe.
- Figure 15 shows a Western blot of pNAP-OLE-4xHis-GFP (see Figure 2) expressing Brassica campestris plants.
- Lanes 2, 3, 5, 6, 7 and 8 correspond to six independent pNAP-OLE-4xHis- GFP transformants;
- lane 4 corresponds to a wild-type (untransformed) control plant.
- Molecular weight markers (lanes 1 and 9) are 50 kDa (upper dot) and 40 kDa (lower dot). His-antibody was used as the probe.
- Recombinant nucleotide sequence constract or simply “construct” means a DNA constract, a transient expression cassette or vector or a transformation cassette or vector.
- the construct may comprise linear or circular end-to-end linked nucleotide sequences optionally inserted in a plasmid.
- transient or intermediate constracts expressing a reporter protein are designed and stable well performing transient or intermediate constructs are identified and selected to provide effective, stable transformation constracts for production purposes. From said selected, effective constracts the reporter sequence is subsequently removed to provide transformation constructs for transforming the selected plant species, which are finally used for production purposes.
- the transformation constract comprises regulatory sequences and a nucleotide sequence encoding a carrier protein fused in-frame with codons encoding the selected amino acid residues.
- the transient constract further comprises a nucleotide sequence encoding a detectable reporter protein.
- at least one nucleotide sequence cassette is included, but preferably more, for example two up to six cassettes. Each cassette comprises at least two, preferably five or more codons encoding the selected amino acid residues.
- Cassettes comprising up to ten or fifteen of the selected amino acid codons may be fused between the nucleotide sequences encoding the carrier and the reporter protein.
- nucleotide sequences encoding the reporter protein are removed from constracts, which have been found to be stable and effective, i.e. they perform as desired by showing targeted expression. These inserted constructs lacking a reporter gene areused as transformation constracts. Usually the amount of amino acid codons in a stable construct are from four to eighty.
- a cassette of nucleotide sequences or " a nucleotide sequence cassette” comprises a set of codons, which encode a polyamino acid sequence, the so called “amino acid cassette".
- cassette means an insert comprising a continuous nucleotide sequence having at least two, preferably four and any number up to about eighty codons or triplets.
- the cassettes are particularly convenient when designing different constracts and for checking their properties especially their performance in translation. However, the cassettes are not a prerequisite in the present invention. The ultimate goal is to provide a constract that encodes a carrier protein, which has a polyamino acid extension, but still has the same functionally intact properties as the corresponding native carrier protein.
- the optimal number of codons is one that provides a stable carrier protein entailed with the polyamino acid extension and thereby enriched with the selected amino acid residues.
- the number of amino acid residues, which can be stably attached as an extension is from four to about eighty amino acid residues or any number therebetween.
- amino acid cassette is also used for a nucleotide sequence or codons encoding the polyamino acid chain, which may comprise a high amount of one or more selected amino acids and which chain is stably attached to the carrier protein.
- the number of amino acid residues, which can be attached to the carrier protein may be determined by randomly inserting nucleotide sequence cassettes comprising different amounts of amino acid codons into the constract and by screening in a cell free translation system to confirm correct codon translation.
- a "cell free translation system” means an in vitro translation (IVT) system in which a normal cellular reaction is reconstituted in the absence of cells, including, for example -VT systems that can synthesise protein from mRNA using e.g. a lysate of rabbit reticulocytes or wheat germ.
- IVT in vitro translation
- a particularly advantageous system is the wheat germ cell-free translation system available for example as (TNT ® T7/SP6 Coupled Wheat Germ Extract System L5030, Promega corporation).
- “Targeted expression or accumulation” means that the amino acid-enriched protein is expressed in specific, selected plant tissues or organs or is transported to said selected tissues or organs. This can be achieved by selecting carrier proteins, which take part in "intracellular trafficking pathways". Such pathways are the membrane component-specific trafficking pathway, the organelle-specific trafficking pathway, etc. The intracellular trafficking pathways in the plant transport the expressed protein to the selected organs and tissues and thereby enable accumulation of the expressed product for example in the cell walls or cell membranes in seed.
- amino acid-enriched carrier proteins When the expression of amino acid-enriched carrier proteins in seeds of transgenic Brassica species is targeted to the cell walls of the seed cells, it enables the anchoring of the amino- enriched protein to the oilcake remaining after pressing out the oil.
- the oil cake provided with improved properties, i.e. an increased amino acid content, is a useful ingredient in composition for the feed industry.
- the amino acid-enriched protein can be expressed in mesophyll tissue of lettuce, and used directly as human nutrient source.
- the selected amino acid may be any amino acid, but preferably the amino acid is one or more of the eight essential amino acids required by human beings or livestock.
- the selected amino acids may be, for example histidine, cysteine, methionine, glycine, tryptophan, lysine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, serine, threonine, arginine, aspartate, glutamate, asparagine or glutamine.
- Any amino acid-enriched protein may be prepared by method of the present invention, particularly as exemplified by the preparation of a histidine-enriched protein.
- the amino acid-enriched protein is obtainable by providing a construct comprising a nucleotide sequence encoding a carrier protein with an extension with an optimal number of one or more codon cassettes encoding the desired amino acids e.g. His, Met-Cys, His-Met-Cys, etc.
- the amino acid codons are fused (situated or placed) between the nucleotide sequences encoding the carrier and the reporter protein in such a way that the additional amino acid residues do not disturb the normal biological functions of the carrier protein, by preventing it from taking part in a secretory intracellular trafficking pathway.
- Carrier protein in the present invention means a protein, which can be stably extended by a polyamino acid sequence or a peptide.
- the nuclotide sequence encoding the functionally intact carrier protein is fused in-frame with a nucleotide cassette comprising one or more selected codons encoding amino acid residues.
- the inserted codons encoding the desired amino acid residues may not disturb the normal biological functions of the carrier protein as compared with the corresponding native unmodified protein.
- Nucleotide sequences encoding carrier proteins useful in the present invention are selected from plant specific proteins. These plant specific proteins use secretory intracellular trafficking pathways, which enable accumulation of the amino acid-enriched protein in cell walls or membranes.
- carrier proteins have been derived from genes encoding three major seed proteins. Said genes are useful model proteins for carrying out genetic engineering with seed proteins, particularly seed proteins from the family Cruciferae. Yet, similar genetic engineering can be applied in any other plant species.
- Said three exemplified proteins, which are applied in the present invention are the seed proteins cruciferin (500 amino acid residues), napin (165 amino acids) and oleosin (165 amino acids), but other proteins, such as caleosin and steroleosin can be used as well.
- Cruciferin contains only 9 His residues per 500 amino acids.
- Napin contains only 2 His residues per 165 amino acids and oleosin does not contain His at all.
- Cruciferin, oleosin, napin, caleosin and steroleosin are applicable to be used in seeds for feed applications.
- oleosin (OLE) has been used as a model carrier protein, but other carrier proteins can be used in a similar manner.
- two related proteins, caleosin and steroleosin mentioned above are suggested as potentially useful due to the similar way they accumulate in oil bodies and cell walls of seeds.
- Oleosin is reviewed e.g. in (i) Murphy 1996. TIBTECH 14. 206-213; (ii) Methods in Mol.Biol. vol. 44: Agrobacterium protocol. Eds. K.M.A.Gartland and (iii) M.R.Daey, Humamana Press Inc. Totowa, NJ; and Brassica Oilseeds: Production and Utilization. Eds D.S.Kimber and D.I. McGregor. Cab International. 1995. Oleosin was shown to be a useful carrier protein, because it is a hydrophobic protein, has a relatively small size and is a component of the membranes surrounding the storage oil-bodies of B. campestris seeds.
- nucleotide sequence derived from a selected plant When transferring a nucleotide sequence derived from a selected plant to another selected plant, there is a potential risk of post-transscriptional gene silencing, especially, if the plants are closely related or highly homologous.
- the risk of inducing post-transcriptional gene silencing in a transgenic plant due to nucleotide sequence homology between the transgene and the endogenous gene may be avoided by using nucleotide sequences encoding carrier proteins having as little homology as possibly.
- a carrier protein encoded by Ole gene
- An advantage of using a gene encoding a movement protein (MP) is that this gene has no sequence homology to endogenous genes of B. campestris.
- carrier proteins include isomers, amino acid sequences with minor modification in some amino acid residues.
- the carrier protein may be a shortened form of tha native carrier protein.
- the nucleotide sequences encoding the "carrier protein” may also vary to a certain degree. They may for example be truncated. The only prerequisite is that the gene encoding the carrier protein has intact functional properties or biological functions which are substantially the same as those of the native carrier protein, meaning targeted expression in selected plant tissues or organs.
- the "intact functional properties” means that the expresion of said carrier protein may be targeted into a selected tissue or organ or compartment of the plant.
- the carrier protein with the polyamino acid extension must accumulate in the selected tissue, organ or compartment of the plant.
- Regulatory sequence means nucleotide sequences, which regulate the transcription and expression of the structural nucleotide sequences either by down-regulating or up-regulating transcription and expression. Regulatory sequences comprise promoters, enhancers, signal sequences, terminators, etc.
- the preferred promoters are relatively short, organ or tissue specific transcriptional promoters capable of driving the transcription of the chimeric nucleotide sequence during different stages of morphogenesis and particularly during embryogenesis.
- promoters are plant virus-derived promoters from Alfalfa mosaic viras (AMV) or Cauliflower mosaic viras (CaMV) 19S, and those that can be regulated either by environmental effects (e.g. heat) or under specific abiotic (e.g. salicylic acid-responsive) or biotic (pathogen) stress conditions.
- AMV Alfalfa mosaic viras
- CaMV Cauliflower mosaic viras
- the preferred and exemplified "transcription promoters” in the present invention are a napin (NAP) promoter, particularly one from Arabidopsis thaliana, a 35S CaMV promoter or a chimeric "hybrid” (HYB) promoter, which comprises the entire napin promoter coupled with the enhancer sequence of the CaMV 35S promoter.
- NAP napin
- HYB chimeric "hybrid”
- promoters can include any other operating regulatory sequences, particularly promoters enabling accumulation of amino acid- enriched proteins in selected tissues.
- Preferred tissues are oil bodies and cell walls of seeds.
- the napin promoter controlling the expression of the napin (NAP) gene is regulated during embryogenesis and is switched on after flowering.
- the nucleotide sequence of NAP promoter from A. thaliana has been reported (Rask et al. 1998. J. Plant. Physiol. 152, 595-599).
- An important advantage of the napin (NAP) promoter in the present invention is that it is rather short (152 bp) in comparison to the promoter of the Ole gene which is 2.1 kb.
- the 35S promoter of Cauliflower mosaic virus has been shown to be active in cells of B. campestris (Harpster et al., 1988. Mol. Gen. Genet. 212, 182-190).
- the 35S promoter is also active in embryos and the detection of transgenic B. campestris plants would be facilitated by testing the product of amino acid-enriched recombinant protein (OLE or MP) in mature leaves before flowering.
- a “reporter sequence” or “nucleotide sequence encoding a reporter protein” means a nucleotide sequence used to design an intermediate or transient construct, which enables the selection of such constracts, which allow stable targeted expression or accumulation of stable amino acid- enriched proteins with intact biological functions in the selected tissues or organs of the plants.
- the nucleotide sequence encoding the reporter protein enables easy, accurate and unambiguous identification of suitable constructs.
- the reporter sequence enables demonstration of the tissues or organs in which the promoter is activated and the conditions under which the promoter is active.
- the reporter protein is a visible or detectable protein, preferably a fluorescent protein.
- the construct with said reporter sequence is an intermediate or transient construct because the reporter sequence can be removed as soon as it has been demonstrated that carrier proteins comprising selected polyamino acid extenion is appropriately expressed. Said reporter genes are removed because they may not be present in the actual transformation constracts, which are used for production of feed or food products.
- a cell-free in vitro translation (IVT) system and a transient expression system were used to select suitable transformation constructs, which allowed undisturbed expression of the carrier protein and the amino acid cassette.
- IVT in vitro translation
- the cell-free in vitro translation (IVT) system enabled the identification and thereby the selection of the optimal number of codons that could be translated correctly without any problems.
- a transient expression assay was used to ensure protein expression and that the expressed protein had intact biological function(s) as compared to the native unmodified protein, and was expressed and accumulating in the targeted tissue or organ of the plant. This was facilitated by visual observation of the reporter protein. Confocal laser scanning microscopy was particularly useful because it allowed early detection of transgenic plants expressing amino acid-enriched proteins in-frame with the nucleotide sequence encoding the reporter protein.
- Antibody-based assays e.g. enzyme linked immuno absorbent assays
- direct amino acid analysis could be used as alternative systems to detect transgenic plants expressing amino acid-enriched proteins in-frame with the nucleotide sequence encoding the reporter protein.
- the primary objective of the present invention was to elaborate methods providing a means to increase the content of selected amino acids in plant cells tissues, such as oil bodies and cell walls, particularly, in seeds of the family Cruciferae.
- stable amino acid-enriched protein was successfully expressed during embryogenesis of transgenic Brassica campestris plants and the expressed amino acid-enriched protein accumulated in the seeds.
- the said recombinant amino acid-enriched protein was tightly bound in seed cells to membranes or cell walls (CW) and, therefore, it could be retained in seed remnants, anchored to the oilcake, after the oil was pressed out. This enabled oil to be recovered with subsequent recovery and use of the remains, i.e. the oil cake, which with its improved property, i.e.
- an amino acid-enriched composition for animal feed preparation provides a useful ingredient in an amino acid-enriched composition for animal feed preparation.
- extra amino acid for example, histidine
- histidine is in cow fodder, and is bound into normal, native proteins as in the present invention, it functions as a natural amino acid source and can be utilized normally in cow metabolism. Therefore, an amino acid-enriched, for example histidine-enriched, protein is a useful ingredient in fodder for cows functioning as a booster of milk production. Enrichment of other useful amino acids, for example, in edible lettuce leaves would allow the use of such amino acid-enriched protein(s) as a direct human food source with no further processing.
- Nucleotide sequences encoding reporter-proteins exemplified by the visually detectable green fluorescent protein (GFP), positioned downstream of the selected, desired amino acid-codon enriched sequence(s) allowed easy detection of gene expression and intracellular localization of the expressed proteins in transgenic plants.
- GFP visually detectable green fluorescent protein
- Expression of reporter protein, from various reporter fusion constracts is explified with GFP and illustrated in Figure 1 and shown in Figure 6, which shows transient expression of the selected reporter fusion constructs in single cells, exemplified by epidermal tobacco cells.
- the present invention pertains to methods for producing transformed plants, plant cells, or cell-lines that are capable of expressing a high level of amino acid-enriched carrier proteins having a stable polyamino acid extension, which are in particular localized in selected plant tissues or plant organs or paint cell compartments including seed membraneous oil bodies or cell walls.
- the method of the present invention comprises transformation of plants or plant cells with constructs enabling expression of carrier proteins entailed with an polyamino acid sequence or extension in a targeted tissue or organ of the plant
- the constract for stable transformation comprises regulatory sequences including an organ- and/or tissue-specific transcriptional promoter driving the transcription of the gene(s) of interest, encoding the carrier proteins during different stages of morphogenesis, particularly during embryogenesis.
- Said regulatory sequences are operably linked to: (a) a nucleotide sequence encoding a carrier protein without a termination codon; and (b) a nucleotide sequence comprising at least one cassette including at least two codons encoding the desired amino acid residues fused in-frame with the nucleotide sequence encoding the carrier protein.
- constracts may be made with or without the reporter gene.
- Constructs encoding amino acids under the control of the regulatory sequences including selected promoters may be analysed using in vitro translation (IVT) systems, which allows observations of the stability of the plasmids possessing of different amino acid cassettes.
- Reporter constracts may also be analysed using transient assays.
- Stable constructs comprising the nucleotide sequences encoding the carrier protein entailed at its 3 '-terminal end with the amino acid cassettes were selected using the IVT-system by providing constructs with a randomly selected number of amino acid codons, e.g. at least two amino acid codons, inserted as at least one cassette, but preferably more, for example two, four, six or eight cassettes and analyze the results obtained. If the cassette, for example, comprises 14 amino acid codons (14x), this results in amino acid-enriched carrier proteins having 28(2x), 56(4 x) and 112 (8x) amino acid-codons downstream of the gene encoding the functionally intact carrier protein (Ole or MP).
- fusion proteins were shown to be identical in size to their predicted molecular weight, when examined with SDS-PAGE gel electrophoresis and by Western blot analysis. Stability of the transgene-encoded protein products (oleosin-His and MP- His) was investigated by Western blot analysis. Analysis of (selfed) plant generations (3 rd generation) after transformation (Table 1) showed clearly that transgene expression was stable over successive generations. Moreover, Western blot analysis of those transformed plants that were examined further revealed that the size of protein product remained constant regardless of the plant generation. These analyses also showed that the amount of fusion protein product was relatively constant between plant generations, indicative of an acquired stable expression level relative to other plant proteins.
- Transformed plants may be analysed using antibodies to the carrier protein, reporter proteins or amino acids, respectively, whichever is applicaple for obtaining the desired result. Some seeds may be directly analysed for the selected amino acid content. Generally, a sequence of events was followed in which the results of the previous set of experiments were analyzed and only those constructs that were functional and suitable for later work were selected to be used in the later steps. Thus prior to the final plant transformation for production purposes, many aspects were analysed and checked by per se conventional methods to obtain the desired result. The constracts with the desired properties, including stable transformation of plants expressing stable amino acid-enriched protein are obtainable by the method describe herein,
- the reporter protein enables easy and accurate selection in a cell-free in vitro translation (IVT) system of constructs that provide reliable expression of stable amino acid-enriched carrier proteins having a detectable reporter protein combined with a transient expression system.
- IVT in vitro translation
- Said transient expression system enables verification that the biological function(s) of the carrier protein are not compromised.
- the intact biological function means that the reporter protein is expressed in oil bodies of seeds, particularly in the membranes and cell walls of seed cells.
- Those constructs exhibiting normal biological function(s) of the carrier protein as visualized by the reporter protein were selected and the nucleotide sequence encoding the reporter protein was removed. Accordingly, the nucleotide sequence encoding the carrier protein and the codons encoding the desired amino acids are fused in-frame.
- the satisfactory constructs were selected and transferred into Agrobacterium, and positive (constract-containing) clones were selected by appropriate conventional means, e.g. by dot blot analysis, Southern blot hybridization and used for transformation of plants, preferably crop plants, particularly crop plants of the family Cruciferae.
- the transformed crop plants expressed stable amino acid-enriched proteins and accumulated the said proteins in the targeted or selected plant tissue(s).
- the regulatory sequences including the transcriptional promoter, were selected among regulatory sequences including tissue- or organ-specific transcription promoters, which enable targeting of mRNA synthesis to leaf, seed, or other desired or selected plant organs and, thereby, provide targeted accumulation of amino acid-enriched protein(s) in said organs.
- the amino acid codon-enriched sequence coding for selected, desired amino acid residues is placed in-frame between the carrier protein gene and the nucleotide sequence encoding a detectable reporter gene, preferably a fluorescent reporter protein, e.g. green fluorescent protein (GFP), ⁇ -glucuronidase or luciferase.
- the preferred crop plants of the present invention belong to the family Brassicaceae, wherein amino acid-enriched, particularly histidine-enriched proteins, based on their ability to be anchored to and localized in the membranes of oil-bodies after expression, provide targeted accumulation. Based on the same principles, other constructs enabling accumulation of any other amino acid-enriched proteins in any other desired plant species and their tissues can be obtained.
- the above objectives are accomplished by transforming plants with constructs comprising nucleotide sequences encoding carrier proteins selected from relatively small plant proteins functioning in selected secretory intracellular trafficking pathways enabling accumulation in selected, targeted plant organs, e.g. leaf membranes, seed membranes, cell walls of leaves or seed cells.
- carrier proteins selected from relatively small plant proteins functioning in selected secretory intracellular trafficking pathways enabling accumulation in selected, targeted plant organs, e.g. leaf membranes, seed membranes, cell walls of leaves or seed cells.
- This is exemplified in the present invention by two distinct carrier proteins, the oleosin protein and the TMV MP protein comprising a polyamino acid tail fused in-frame to said native carrier protein subsequently accumulating in selected targeted tissues of said transgenic plants.
- nucleotide sequences coding for the carrier proteins are oleosins capable of accumulating in leaves or seed membranes and movement proteins, such as TMV MP, which can accumulate in cell walls of leaves or seed cells, when transcription is driven by an appropriate promoter.
- the nucleotide sequences encoding the carrier proteins are preferably obtained from plant species, which are not endogenous to the transformed plant host.
- the nucleotide sequence encoding one or more amino acids is conveniently provided as one or more cassettes, which are carrying the selected amino acid codons, which encode the selected peptide entailing the carrier protein.
- the cassette, comprising nucleotide sequences encoding amino acid residues is preferably located such that it does not disturb the normal biological function(s) of the carrier protein, i.e. the 3 '-terminal end of the carrier protein. If the amino acid codons are placed at the N-terminal end or somewhere in the middle of the carrier protein, the amino acid-enriched protein may not accumulate in the targeted organ as desired.
- the nucleotide sequence encoding the reporter protein is fused in the same translational frame with the extended nucleotide sequence enriched with the selected amino acid codons but lacking the termination codon.
- the optimal number of amino acid codons is about ten to eighty and is determined by checking correct protein translation in a cell-free translation system.
- the nucleotide sequence encoding the carrier protein is positioned in the 5'-proximal end of the nucleotide sequence and the reporter nucleotide sequence is positioned in the 3'-terminal end.
- the preferred carrier proteins or nucleotide sequence of interest in the present invention are OLE or TMV 30K MP.
- the OLE used in the examples of the present invention is a nucleotide sequence corresponding to the chromosomal gene of Arabidopsis thaliana coding for the seed protein oleosin (Ole), which is a component of membranes of oil-bodies in members of Cruciferae family.
- TMV 30K MP is a nucleotide sequence derived from the genomic RNA of Tobacco mosaic virus Ul (TMV Ul). The gene encodes a non-structural hydrophobic 30K protein responsible for the movement of the viral genome from cell to cell in an infected plant (movement protein, MP) through plasmodesmata (PD).
- the 30K MP is targeted to and accumulates in cell walls and also in PD, and is expressed in plants transgenic for the MP gene.
- the optimal number of amino acid codons is determined by randomly transforming constracts with nucleotide sequence encoding the carrier protein with extensions of different sizes, comprising different numbers of amino acid codons, into plants and selecting transgenic plants expressing proteins with undisturbed biological functions as compared to the native unmodified protein, assessed using a transient expression assay. Functional constructs and successful transformation can easily be demonstrated by the expression and intracellular localization of the expressed proteins, particularly the reporter protein, in transgenic plants.
- genetic engineering methods are used, which methods permit rapid identification and selection of chimeric constructs having an optimal codon content allowing stable accumulation of the amino acid enriched protein in a target plant tissue.
- the method for producing amino acid-enriched proteins in transgenic plants involves the preparation of one or more of the constructs described above.
- the preferred selection method comprises expression of a fluorescent recombinant amino acid- enriched carrier protein from constracts such as (Ole-polyamino acid-GFP or TMV MP-poly- amino acid-GFP) in a cell-free translation system.
- the cell-free translation system used in this invention is a method that unequivocally identifies correct constracts and expression of the recombinant amino acid-enriched proteins.
- the detection of fluorescence, provided by GFP, or other reporter proteins can be carried out using confocal laser scanning microscopy of seeds and/or leaves. The use of confocal laser scanning microscopy provides a convenient tool for early detection and selection of transgenic plants expressing amino acid-enriched proteins in-frame with the reporter protein.
- reporter nucleotide sequence insert was that this protein could be used as a marker to confirm that the constracts and the expression of the amino acid-enriched carrier protein, e.g. oleosin-polyamino acid-GFP or TMV MP-poly-amino acid-GFP, from recombinant sequences were correct.
- Fluorescence, particularly GFP-fluorescence can be monitored by confocal laser scanning microscopy that allows detection of Ole-polyamino acid and MP-polyamino acid expression in vivo as well as determination of their expression levels.
- Plant expression vectors comprise nucleotide sequences encoding carrier proteins, such as Ole and TMV MP fused to polyamino acid-coding sequences of varying length and carrying a reporter gene, e.g. a GFP gene positioned in the 3'-terminal end.
- carrier proteins such as Ole and TMV MP
- a reporter gene e.g. a GFP gene positioned in the 3'-terminal end.
- said constracts were fused with sequences of varying lengths enriched with desired amino acid codons, e.g. for histidine the codons CAC and CAU, for cysteine and methionine the codons TGT, TGC and ATG, for glycine the codons GGA, GGT, GGC, and GGG, and for lysine the codons are AAA and AAG.
- Stable constructs can be selected by providing constructs with a randomly selected number of amino acid codons, e.g. at least two amino acid codons, inserted as at least one cassette, but preferably more, for example two, four, six or eight cassettes and analyze the results obtained. If the cassette, for example, comprises 14 histidine codons (14x), this results in amino acid-entriched carrier proteins having 28(2x), 56(4x) and 112 (8x) His-codons downstream of the gene encoding the carrier protein (Ole or MP). Preliminary tests indicated that 8x (112 amino acids) were unstable producing deletion variants (mini-plasmids).
- Constracts such as those shown in Figure 1, comprising regulatory sequences, particularly promoters such as the napin promoter NAP, the 35S CaMV promoter or a hybrid HYB promoter were operably linked to a carrier protein, particularly Ole and/or TMV MP.
- All of the constructs comprised a nucleotide sequence encoding a reporter protein, particularly preferred is the green fluorescent protein (GFP), as a marker for selection.
- the GFP gene was fused in- frame to the amino acid-tail, which was of varying length including one or more cassettes comprising at least two amino acid codons encoding the desired amino acids. Particularly, multiples of the cassettes were used (2x, 4x, 6x).
- transient expression assays Fluorescence of the reporter protein in transient expression assays was used in preliminary experiments to identify and select the best functional constructs.
- the transient expression assays included micro-projectile bombardment of crop plant embryos as exemplified by experiments involving particle bombardment of B. campestris embryos and Nicotiana benthamiana leaves, and shown in Table 1.
- the assays demonstrated that the NAP promoter was active in embryos, whereas the HYB promoter was efficient in both embryos and epidermal leaf cells.
- the preferred transformation system was Agrobacterium-mediated transformation. Each gene constract described above was transferred into Agrobacterium tumefaciens; transformed clones were selected by Southern blot hybridization. Each of the transformed strains of Agrobacterium was then used to transform oilseed spring rape (B. campestris). Subsequent selection of transgenic plants expressing the amino acid-enriched carrier proteins (Ole-polyamino acid or -vff -polyamino acid) was performed by:
- the reporter nucleotide sequences can be removed from the corresponding constract(s) and the actual crop plants transformed with the said functionally proven, constract(s).
- the aim of the invention is to provide a composition comprising an amino acid enriched carrier protein entailed with stable amino acid cassettes in plant material, particularly anchored to the cell walls and in the oilcake obtained subsequent to recovering the oil from oil plants.
- a stable amino acid-enrichment in seed proteins could be demonstrated.
- amino acid-enriched protein is exemplified by histidine, methionine, cysteine, glycine and lysine, but the principles disclosed in the invention can be applied to any other desired amino acid(s) by inserting cassettes comprising a selected number of desired amino acid codons for any specified purposes.
- Chromosomal DNA was isolated as follows. 300 ⁇ g of A. thaliana leaf tissue was homogenized in a mortar in liquid nitrogen to a fine powder. Then 3 ml of 100 mM Tris-HCl; pH 8.0, 500 mM NaCl, 50 mM EDTA was added, with further grinding after the addition of 600 ⁇ l of 10% SDS and 500 ⁇ l of 20% polyvinylpyrrolidone (average mwt 360,000). The mixture was transferred to a polypropylene tube and incubated at 65°C for 10 min.
- the PCR reaction mixture was composed of 1 x PCR buffer (10 x buffer: 500 mM KC1, 100 mM Tris-HCl; pH 9.0 at 25°C and Triton X-100 ) with 1.5 mM MgCl 2 , l ⁇ l of Taq polymerase (5U/ ⁇ l), 0.2 mM of each dNTPs, primers at 0.4 ⁇ M and 3 ⁇ g of A. thaliana genomic DNA in 25 ⁇ l reaction volume.
- the template was denatured with heating for 3 min at 95°C, and 30 cycles of PCR were carried out with iCyclerTM (Bio-Rad) thermal cycler with denaturation at 95°C for 1 min, primer annealing at 65°C for 1.5 min, primer extension at 72°C for 2 min, with a final elongation step after 30 cycles at 72°C for 10 min.
- iCyclerTM Bio-Rad
- the PCR product of expected size (776 bp) was isolated from a 1% agarose gel after electrophoresis of the final PCR reaction mix, purified using a gel slice kit (Qiagen), and then treated with 1 unit of T4 DNA polymerase in IX T4 DNA polymerase reaction buffer (50 mM NaCl, 10 mM Tris-HCl; pH 7.9, 10 mM MgCl 2 , 1 mM dithiothreitol) supplemented with 100 mM dNTP at 14°C for 15 minutes prior to cloning.
- IX T4 DNA polymerase reaction buffer 50 mM NaCl, 10 mM Tris-HCl; pH 7.9, 10 mM MgCl 2 , 1 mM dithiothreitol
- H-P-l (SEQ ID NO:l) 5'-GCGCCTCGAGTTCACCATCACCATCACCATCACGGGCACCATCAC,
- H-P-2 (SEQ ID NO:2) 5'-CATCACCATCACCATGG and
- H-M (SEQ ID NO:3) 5'-CCGGATCCTAAAGTCGACCATGGTGATGGTGATGGTGATGGTGCC.
- oligonucleotides H- M and H-P-2 were allowed to anneal in IX AMV reverse transcriptase (RT) reaction buffer (50 mM Tris-HCl; pH 8.3, 50 mM KC1, 10 mM MgCl 2 , 0.5 mM spermidine, 10 mM DTT) for 30 min at room temperature, and chain elongation reaction was carried out in the presence of IX AMV RT buffer, 1 mM dNTPs and 1 unit of AMV RT for 45 min at 37°C.
- IX AMV reverse transcriptase (RT) reaction buffer 50 mM Tris-HCl; pH 8.3, 50 mM KC1, 10 mM MgCl 2 , 0.5 mM spermidine, 10 mM DTT
- the reaction product was separated from non-annealed oligonucleotides by agarose gel electrophoresis, purified, and annealed with the oligonucleotide H-P-l in IX DNA polymerase I large (Klenow) fragment buffer (50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT) for 30 min at room temperature.
- IX DNA polymerase I large (Klenow) fragment buffer 50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT
- the chain elongation reaction was performed with 5 units of Klenow polymerase in the presence of 25 mM of each dNTPs in IX Klenow buffer for 30 min at 37°C.
- the dsDNA fragment of expected size (79 bp) was excised from a agarose gel (after appropriate electrophoretic separation), purified digested with Xhol and BamHI, and cloned into the similarly digested cloning vector pGEM-7Zf(+) (Promega Corporation, USA; catalogue number P2251). After restriction analysis and sequencing, clone pGEM-His-24 was selected for further manipulations. This clone contained a DNA segment that could potentially code for a 19 amino acid-long peptide containing 14 His residues ( Figure 3a). The sequence of this DNA fragment was flanked by X/ ⁇ oI and -5 ⁇ mHI sites and contained also a S ZI restriction site designed for subsequent cloning steps ( Figure 3a).
- oligonucleotides C-M-P-l and C-M-P-2 were allowed to anneal in IX DNA polymerase I large (Klenow) fragment buffer (50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT) for 30 min at room temperature.
- the dsDNA fragment of expected size (50 bp) was excised from a agarose gel (after appropriate electrophoretic separation), purified, digested with Xhol and BamHI, and cloned into the similarly digested cloning vector pGEM-7Zf(+) (Promega Corporation, USA; catalogue number P2251).
- clone pGEM-Cys/Met-10 was selected for further manipulations.
- This clone contained a DNA segment that could potentially code for 16 amino acid-long peptide containing 10 Cys/Met-amino acid residues ( Figure 3b).
- the sequence of this DNA fragment was flanked by Xhol and BamHI sites and contained also a S ⁇ ZI restriction site designed for subsequent cloning step ( Figure 3b).
- GL-P-2 (SEQ ID NO:7) 5'-GGGGATCCATTTGTAGACGCCACCTCCTCCACCGCCTCCACCTCCACCAACTC
- oligonucleotides GL-P-1 and GL-P-2 were allowed to anneal in IX DNA polymerase I large (Klenow) fragment buffer (50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT) for 30 min at room temperature.
- IX DNA polymerase I large (Klenow) fragment buffer 50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT
- oligonucleotides L-P-1 and L-P-2 were allowed to anneal in IX DNA polymerase I large (Klenow) fragment buffer (50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT) for 30 min at room temperature.
- IX DNA polymerase I large (Klenow) fragment buffer 50 mM Tris-HCl; pH 7.2, 10 mM MgSO 4 , 0.1 mM DTT
- the dsDNA fragment of expected size (66 bp) was excised from agarose gel (after appropriate electrophoretic separation), purified, digested with Xhol and BamHI, and cloned into the similarly digested cloning vector pGEM-7Zf(+) (Promega Corporation, USA; catalogue number P2251).
- clone pGEM-Lys-12 was selected for further manipulations.
- This clone contained a DNA segment that could potentially code for a 22 amino acid-long peptide containing 12 lysine amino acid residues ( Figure 3d)
- the sequence of this DNA fragment was flanked by Xhol and BamHI sites and contained also a S ZI restriction site designed for subsequent cloning ( Figure 3d).
- OLE-P (SEQ ID NO: 10) 5'-AAAACCATGGCGGATACAGCTAGAGGAACCCATC and OLE-M (SEQ ID NO: 11) 5'-GGGGCCATGGGAGTAGTGTGCTGGCCACCACGAGTAC.
- OLE-P and OLE-M were used as the primers for PCR of genomic DNA from Arabidopsis thaliana (Example 1).
- the resulting PCR fragment was blunt-ended, and cloned into S l site of ⁇ GEM-3Zf (+) (Promega Corporation, USA; catalogue number P2271 ) .
- clone pOLE4H was selected.
- sequence of clone pOLE4H contains one nucleotide substitution (with no changes in the encoded amino acid sequence) in the gene intron i.e. a G to A substitution at position 513 in the pOLE4H sequence compared with the published sequence (X62353).
- OLE-3' Xhol (SEQ ID NO: 12) 5'- GCGCCTCGAGAAGTAGTGTGCTGGCCACCAC was chemically synthesized, and used as a PCR primer to amplify the oleosin coding region from plasmid pOLE4H; the PCR product was cloned into the Xhol site of pGEM7Zf(+) (Promega Corporation, USA; catalogue number P2251). After the cloning of the pOLE4H sequence using this primer, the sequence of the resulting clones was verified by sequencing to ensure that all oleosin gene coding properties were retained. Based on this analysis, clone pOLE4/ll was selected.
- pOLE4/l 1 contained a wild-type oleosin gene lacking a termination codon, flanked by Ncol and Xhol restriction sites suitable for subsequent cloning steps.
- TMV 30K MP Tobacco mosaic virus
- Oligonucleotide primer ⁇ 30K (SEQ ID NO: 13) 5'-GCGGAATTCCCATGGCTCTAGTTGTTAAAGG) and
- Oligonucleotide primer C30K (SEQ ID NO: 14) 5'-AGACCTCGAGGAAACGAATCCGATTCGGCGAC
- the first strand cDNA was synthesized from TMV genomic RNA using 20 nM of C30K primer, 1 mM dNTPs and 1 unit of AMV in IX AMV reverse transcriptase (RT) reaction buffer (50 mM Tris-HCl; 8.3, 50 mM KC1, 10 mM MgCl 2 , 0.5 mM spermidine, 10 mM DTT) for 45 min at 37°C.
- RT IX AMV reverse transcriptase
- reaction mix was subjected to PCR reaction in 1 x PCR buffer (10 x buffer: 500 mM KC1, 100 mM Tris-HCl; pH 9.0 at 25°C and Triton X-100 ) with 1.5 mM MgCl 2 , 2 ⁇ of Taq polymerase (5U/ ⁇ l), 0.2 mM of each dNTPs, primers at 0.4 ⁇ M in 25 ⁇ l reaction volume.
- the template was denatured with heating for 3 min at 95°C, and 28 cycles of PCR were carried out with iCycler (Bio-Rad) thermal cycler with denaturation at 95°C for 1 min, primer annealing at 68°C for 1.5 min, primer extension at 72°C for 2 min, with a final elongation step after 30 cycles at 72°C for 10 min.
- the resulting DNA product was cleaved by EcoRI and Xhol and cloned into EcoRI-Z/zoI-digested pG ⁇ M- 7Zf(+) (Promega Corporation, USA; catalogue number P2251).
- plasmid pG ⁇ M-30K was selected for further work.
- the termination codon of the TMV 30K MP gene was replaced by a Xhol site for subsequent fusion with the His, Cys/Met, Gly and Lys codon-enriched sequence (Examples 2-5; Figure 3a-d).
- Microprojectile (particle) bombardment was performed using the rupture disk method with a high-pressure helium-based apparatus PDS-1000 (Bio-Rad) as described in Morozov et al. (1997).
- Tungsten particles were prepared by vortexing of 60 mg in 70 % ethanol for 3-5 minutes, followed by incubation on a bench for 15 min. Mixture was pelleted by short spinning and the supernatant was removed. Sterile water was added onto pellet and vortexed for 1 min. Particles were allowed to settle for 1 minute and spinned for 2 s. The supernatant was removed. This was repeated three times. Sterile 50 % glycerol was added to bring particle concentration to 60 mg/ml.
- DNA was precipitated onto tungsten particles (M- 20, 1.3 ⁇ ) with calcium chloride and ethanol.
- Supernatant was removed and 140 ⁇ l of 70 % ethanol was added onto surface of pellet, removed and 100 % ethanol added and removed without disturbing the pellet, and repeated. 6 ⁇ l of suspension was pipetted onto macrocarrier and used for bombardment.
- a detached leaf of Nicotiana benthamiana (15-30 mm size) was placed in the center of a plastic Petri dish and bombarded on a solid support at a target distance of 7 cm. Bombardment was done with a pulse of 1350 kPa helium gas in a vacuum chamber. Inoculated leaves were analyzed 24 hours after particle bombardment. GFP fluorescence was monitored using a confocal laser scanning imaging system MRC-1024 (Bio-Rad).
- the amino acid sequence of the oleosin C-terminal portion encoded by the second exon of the oleosin gene represents hydrophilic sequence that is suitable for expression in E. coli and using as the antigen in immunizations. Therefore, the C-terminal oleosin region (aa 120-173) was selected for this purpose.
- the second exon of the oleosin gene was amplified in a PCR reaction using the plasmid pOLE4/ll (Example 6) as the template and the oligonucleotide primers:
- OLE-EX-B (SEQ ID NO: 15) (5'-TGTGGGATCCTACGCAACGGGAGAGCACCCA) and
- OLE-3'XhoI (SEQ ID NO: 12) (5'-GCGCCTCGAGAAGTAGTGTGCTGGCCACCAC)
- the 3 '-terminal portion of the oleosin gene was translationally fused to a leader sequence containing a 6xHis tag, which makes it possible to affinity purify the expressed product.
- the plasmid pQE-OLE2EX was transformed into E. coli strain M15 [ ⁇ REP4] (QIAGEN). Induction of recombinant protein expression was carried out in Luria broth by adding IPTG to a final concentration 1 mM followed by incubation on a rotary shaker at 220 rpm for 2-4 h at 37°C. The E.
- coli cells were collected from induced and non-induced control cultures, and expression of the recombinant protein was analyzed by SDS-PAG ⁇ .
- SDS- PAGE 12.5% acrylamide gels were prepared. Gels were ran at 100V/500mA for 45 1 h, and subsequently stained in CBB (0.05% Coomassie Brilliant Blue, 50% methanol, 7% glacial acetic acid) and destained in 7% methanol/5% acetic acid.
- CBB Coomassie Brilliant Blue
- Mobility of this band corresponded to the expected mobility of the His-tagged C-terminal portion of the oleosin gene (8.3 kDa).
- a cell-free in vitro translation (IVT) system enabled the selection/identification of the optimal number of codons that could be translated correctly.
- the IVT system consists of a wheat germ extract containing all the components (e.g. 70S or 80S ribosomes, tRNAs, aminoacyl-tRNA synthetases, initiation, elongation and termination factors) required for translation of exogenous RNA even in the presence of low concentrations of double-stranded RNA (dsRNA) or oxidized thiols.
- the extract also contains requisite amino acids, energy sources (ATP, GTP), energy regenerating systems (creatine phosphate and creatine phosphokinase) and other essential co- factors (Mg 2+ , K + , etc.).
- Plasmids pMP-lx, pMP-2x, pMP-4x, and pMP-6x contained the 30K MP gene fused to His-coding sequences of different repeat lengths, placed under the control of a T7 promoter. Plasmids were linearized with BamHI, and used as template in IVT with T7 RNA polymerase. Equal amounts of the resulting transcripts were translated in a wheat germ cell-free system (TNT ® T7/SP6 Coupled Wheat Germ Extract System L5030, Promega corporation).
- transcripts corresponding to clones with one, two and four repeats of the His-enriched sequence (MP-lx, MP-2x, and MP-4x) gave rise to products of predicted molecular mass, whereas transcripts potentially coding for the protein with 6 repeats of the His- enriched sequence (MP-6x) was translated inefficiently and gave rise to smeared products of low molecular mass.
- This approach for clone selection/identification is exemplified in the Examples 11-14.
- the 30K MP gene was excised from pGEM-30K with EcoRI and Xhol, and the His-codon-enriched sequence from pG ⁇ M-His-24 was excised with Xhol and BamHI. Both DNA fragments were ligated into pGEM-3Zf(+) (Promega Corporation, USA; catalogue number P2271) digested with EcoRI and BamHI ( Figure 4). The resulting clone, designated pMP-lx, had one histidine-coding sequence unit (cassette) from pG ⁇ M-His- 24 fused to the TMV 30K MP gene.
- Additional stepwise cloning steps performed to increase the length of the His-coding "tail" in the MP fusion were based on the pMP-lx plasmid. These clonings used the restriction sites Xhol and Sail which have been designed in the His codon-enriched sequence of pG ⁇ M-His-24 to be situated to the reading frame of the encoded polypeptide. Together with the fact that digestions with Xhol and S ⁇ ZI produce identical sticky ends, this preserved the reading frame of the resulting addition-enlarged His-containing sequence in the further cloning steps described below.
- the EcoRI-S ⁇ /I-fragment from pMP-lx was cloned into pMP-lx digested with EcoRI and Xhol, resulting in duplication of the histidine-coding sequence unit. Therefore, the resulting pMP-2x plasmid contained 24 histidine residues in the MP C-terminal "tail".
- Clones with 112 His codons in the C-terminal "tail" were unstable and gave rise to deletion variants (mini-plasmids) when grown in liquid medium. Lowered stability upon repeated growth in liquid medium was also observed for some of the clones with 84 histidines (pMP-6x series). Thus, for further experiments only clones with 2, 4 and 6 repeats of the His codon-enriched sequences were selected, pMP-2x, pMP-4x, and pMP-6x ( Figure 4). In plasmids pMP-lx, pMP-2x, pMP-4x, and pMP-6x, the 30K MP gene fused to His-coding sequences of different lengths was placed under the control of the T7 promoter.
- transcripts of the clones with one, two and four repeats of the His-enriched sequence (trMP-lx, trMP-2x, and trMP-4x) gave rise to the products of predicted, gradually increasing molecular masses, whereas the transcript potentially coding for a protein with 6 repeats of the His-enriched sequence (trMP-6x) was translated inefficiently and gave rise to smeared products of lower molecular mass.
- the 30K MP gene was excised from pGEM-30K with EcoRI and Xhol, and the Cys/Met-codon-enriched sequence from pG ⁇ M-Cys/Met-10 was excised with Xhol and -5 ⁇ mHJ. Both DNA fragments were ligated into pGEM-3Zf(+) (Promega Corporation, USA; catalogue number P2271) digested with EcoRI and -9 ⁇ 7nHJ ( Figure 4). The resulting clone, designated pMP-Cys/Met-lx, had one cysteine/methionine-coding sequence unit (cassette) from pG ⁇ M-Cys/Met-10 fused to the TMV 30K MP gene.
- transcripts of clones with one, two and four cassettes of the Cys/Met-enriched sequence (MP-Cys/Met-lx, MP-Cys/Met-2x, and MP- Cys/Met-4x) gave rise to the products of predicted, gradually increasing molecular masses, As exemplified in the example 11, the increase in the length of polyamino acid sequence led to a decreased stability of transcripts.
- cassettes MP-Cys/Met-2x, MP-Cys/Met-4x and MP-Cys/Met-6x
- pGEM-Gly-9 Example 4
- Figure 3c plasmid pGEM-30K containing the TMV 30K MP gene lacking its natural terminator codon
- the resulting first clone designated pMP-Gly-lx, had one glycine-coding sequence unit (cassette) from pGEM-Gly-9 fused to the TMV 30K MP gene. Subsequently, this cassette was "multiplied" as in examples 11 and 12; to generate clones pMP-Gly-2x, pMP-Gly-4x, pMP- Gly-6x, and pMP-Gly-8x.
- Plasmids were linearized with BamHI, and subjected to in vitro transcription with T7 RNA polymerase and translated in a wheat germ cell-free system (TNT ® T7/SP6 Coupled Wheat Germ Extract System L5030 Promega corporation, described in Example 10). As exemplified in example 11, the increase in the length of polyamino acid sequence led to a decreased stability of transcripts. For further experiments only the clones with 2 and 4 cassettes (MP-Gly-2x, and MP-Gly-4x) of glycine codon-enriched sequences were selected.
- a stepwise cloning procedure was carried out as in examples 11, 12 and 13 and shown in Figure 4.
- the resulting first clone designated pMP-Lys-lx
- pMP-Lys-lx had one lysine-coding sequence unit (cassette) from pGEM-Lys-12 fused to the TMV 30K MP gene.
- this cassette was "multiplied" as in examples 11, 12 and 13; to generate clones pMP-Lys-2x, pMP-Lys-4x, pMP- Lys-6x, and pMP-Lys-8x, the EcoRI-S ⁇ ZI-fragment from pMP-Lys-4x was cloned into pMP- Lys-4x digested with EcoRI and Xhol.
- pMP-Lys-4x the EcoRI-S ⁇ ZI-fragment from pMP-Lys-2x was cloned into pMP-Lys-2x digested with EcoRI and Xhol; to obtain pMP-Lys- 6x, the EcoRI-S ⁇ ZI-fragment from pMP-Lys-4x was cloned into pMP-Lys-2x digested with EcoRI and Xhol; and to obtain pMP-Lys-8x, the EcoRI-S ⁇ ZI-fragment from pMP-Lys-4x was cloned into pMP-Lys-4x digested with EcoRI and Xhol.
- Plasmids were linearized with BamHI, and subjected to in vitro transcription with T7 RNA polymerase and translated in a wheat germ cell-free system (TNT ® T7/SP6 Coupled Wheat Germ Extract System L5030 Promega corporation, described in Example 10). As exemplified in the Examples 10-12, the increase in the length of polyamino acid sequence led to a decreased stability of transcripts. For further experiments only the clones with 2 and 4 cassettes (MP-Lys-2x, and MP-Lys-4x) of lysine codon-enriched sequences were selected.
- NAP-P (SEQ ID NO: 16) 5'-TCTTACTCGAGTGAAACCAAATTAAC and
- NAP-M (SEQ ID NO: 17) 5'-CTTGTTAGCCATGGTTTGCTATTTGTG.
- the primer sequences contained X ⁇ oI and Ncol restriction sites.
- A. thaliana chromosomal D ⁇ A was isolated as described for isolation (Example 1) and cloning of the oleosin gene (Example 6).
- the PCR reaction was carried out as described above for the oleosin gene (Example 6) except that the concentration of MgCl 2 in the reaction mixture was 1.5 mM.
- the PCR product of expected size (369 bp) was isolated from a 1% agarose gel following electrophoresis.
- PCR product was purified and treated with T4 D ⁇ A polymerase in the presence of d ⁇ TP at 14°C as in example 1, and cloned into Sm ⁇ l-digested pGEM-3Zf(+) (Promega Corporation, USA; catalogue number P2271). After sequencing, clones pGEM- ⁇ AP4 and pGEM-NAP9 were selected for subsequent work EXAMPLE 16
- NAP napin promoter
- HYB chimeric promoter
- Plant expression vectors containing the napin promoter were constructed using plasmid pRTlOO
- the GFP gene was excised from pRT-GFP as the Xhol- -5 ⁇ mHI-fragment, and both DNA fragments were ligated into pRTlOl (Topfer et al., Nucleic Acids Res. 15(14): 5890, 1987). digested with EcoRI and -9 ⁇ mHI to give the constract pRT- MP-2x-GFP.
- pRTlOO contains the 35S promoter of Cauliflower mosaic viras (CaMV 35S promoter).
- the napin promoter region was excised from the plasmid pG ⁇ M-NAP4 (Example 15) with EcZ136U and Ncol and ligated into pRTlOO digested with Malawi and Ncol ( Figure 5).
- pG ⁇ M- ⁇ AP9 Example 15 was digested with Xhol, made blunt-ended with Klenow enzyme, and digested with Ncol. The resulting fragment was ligated into pRTlOO digested with EcoRV and Ncol.
- EXAMPLE 17 Cloning of His-enriched oleosin and TMV 30K MP genes into expression plasmids containing the CaMV 35S, napin, and chimeric promoters.
- the MP gene fused to two His-coding units was excised from pMP-2x with EcoRI and S ⁇ ZI ( Figure 4), the GFP gene was excised from pRT-GFP as a X/zoI--9 ⁇ mHI-fragment, and both DNA fragments were ligated into pRTlOl digested with EcoRI and -S ⁇ HI to give the construct pRT-MP-2x-GFP.
- the MP gene fused to four His-coding units was excised from pMP-4x with EcoRI and S ⁇ ZI ( Figure 4)
- the GFP gene was excised from pRT-GFP (See Figure 7 for details) as a X/ioI-B ⁇ mHI-fragment, and both DNA fragments were ligated into pRTlOl digested with EcoRI and S ⁇ mHI.
- the N-terminal portion of the TMV 30K MP gene was excised as a NcoI-HZn ⁇ I-fragment from pG ⁇ M-30K; the fragment containing the rest of the MP gene fused to two ⁇ is-coding units and the GFP gene was excised from pRT-MP-2x-GFP with HindEl and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and BamHI to give p ⁇ AP-MP-2x-GFP.
- the N-terminal portion of the TMV 30K MP gene was excised as the Ncol- HzVi ⁇ TII-fragment from pGEM-30K, and the fragment containing the rest of the MP gene fused to four ⁇ is-coding units and the GFP gene was excised from pRT-MP-4x-GFP with HindH and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and BamHI.
- the N-terminal portion of the TMV MP gene was excised as a NcoI-HOT TJJ-fragment from pGEM-30K, and the fragment containing the rest of the MP gene fused to six ⁇ is-coding units and the GFP gene was excised from pRT-MP-6x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and . ⁇ m ⁇ I ( Figure 8).
- pHYB-MP-4x-GFP To obtain pHYB-MP-4x-GFP, the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-Hm ⁇ Tfl-fragment from pGEM-30K, the fragment containing the rest of the MP gene fused to four ⁇ is-coding units and the GFP gene was excised from pRT-MP-4x-GFP with HindHI and Xbal, and both fragments were ligated into pHYB digested with Ncol and BamHI.
- the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-H ⁇ TJI-fragment from pGEM-30K, the fragment containing the rest of the MP gene fused to six ⁇ is-coding units and the GFP gene was excised from pRT-MP-6x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ YB digested with Ncol and BamHI.
- three sets of expression vectors were constructed that had the CaMV 35S, napin, or hybrid promoters, each set containing ⁇ is-coding regions of three different lengths (Figure 9).
- the oleosin gene was excised from pOLE4/ll as a Ncol-Xhol- fragment, the region containing two ⁇ is-coding sequence units fused to the GFP gene was excised from p ⁇ YB-MP-2x-GFP with Xhol and -5 ⁇ mHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and -3 ⁇ mHI resulting in the construct pRT-OLE-2x-GFP.
- the oleosin gene was excised from pOLE4/ll as a Ncol-Xhol- fragment, the region containing four His-coding sequence units fused to the GFP gene was excised from pHYB-MP-4x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and BamHI.
- the oleosin gene was excised from pOLE4/ll as a NcoI-X/zoI-fragment, the region containing six His-coding sequence units fused to the GFP gene was excised from pHYB-MP-6x-GFP with Xhol and BamHI, and then both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and
- a similar cloning scheme was applied to construct expression vectors based on the napin promoter.
- the oleosin gene was excised from pOLE4/ll as a Nc ⁇ l-X ⁇ oI-fragment, the region containing two His-coding sequence units fused to the GFP gene was excised from pHYB-MP- 2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI, resulting in construct p ⁇ AP-OLE-2x-GFP.
- the oleosin gene was excised from pOLE4/ll as a NcoI-X/ioI-fragment, the region containing four His-coding sequence units fused to the GFP gene was excised from pHYB-MP-4x-GFP plasmid with Xhol and BamHI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI.
- the oleosin gene was excised from pOLE4/ll as the NcoI-X/ioI-fragment, the region containing six His-coding sequence units fused to the GFP gene was excised from pHYB-MP-6x-GFP plasmid with Xhol and --? ⁇ mHJ, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI ( Figure 11).
- the set of expression vectors based on the hybrid promoter was constructed similarly.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/ioI-fragment, the region containing two His-coding sequence units fused to the GFP gene was excised from pHYB-MP-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and 5 ⁇ mHI, resulting in constract pHYB-OLE-2x-GFP.
- pHYB-OLE-4x-GFP To obtain pHYB-OLE-4x-GFP, the oleosin gene was excised from pOLE4/ll as a NcoI-X/ioI-fragment, the region containing four His- coding sequence units fused to the GFP gene was excised from pHYB-MP-4x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and BamHI.
- pHYB-OLE-6x-GFP the oleosin gene was excised from pOLE4/ll as a Ncol-Xhol- fragment, the region containing six His-coding sequence units fused to the GFP gene was excised from pHYB-MP-6x-GFP with Xhol and -9 ⁇ mHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and BamHI ( Figure 12).
- EXAMPLE 18 Cloning of Cys/Met-enriched oleosin and TMV 30K MP genes into expression plasmids containing the CaMV 35S, napin, and chimeric promoters.
- Cys/Met-enriched sequences of three different lengths were selected.
- the MP gene fused to two Cys/Met-coding units was excised from pMP-Cys/Met-2x with EcoRI and S ⁇ ZI, the GFP gene was excised from pRT-GFP as the X/zoI-B ⁇ / ⁇ HI-fragment, and both D ⁇ A fragments were ligated into pRTlOl digested with EcoRI and BamHI to give the construct pRT-MP-Cys/Met- 2x-GFP.
- the MP gene fused to four Cys/Met-coding units was excised from pMP-Cys/Met-4x with EcoRI and S ⁇ ZI, the GFP gene was excised from pRT-GFP as a X/zoI--5 ⁇ mFfl-fragment, and both D ⁇ A fragments were ligated into pRTlOl digested with EcoRI and BamHI to obtain pRT-MP-Cys/Met-4x-GFP ( Figure 7).
- the ⁇ -te ⁇ ninal portion of the TMV MP gene was excised as a Ncol-HindHI- fragment from pG ⁇ M-30K; the fragment containing the rest of the MP gene fused to two Cys/Met-coding units and the GFP gene was excised from pRT-MP-Cys/Met-2x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and _5 ⁇ mHI to give p ⁇ AP-MP-Cys/Met-2x-GFP.
- the N-terminal portion of the TMV 30K MP gene was excised as the NcoI-Hz ' ⁇ I-fragment from pGEM-30K, and the fragment containing the rest of the MP gene fused to four Cys/Met- coding units and the GFP gene was excised from pRT-MP-Cys/Met-2x-GFP with Hindlll and Xbal, and both fragments were ligated into pNAP digested with Ncol and BamHI.
- the N-terminal portion of the TMV MP gene was excised as a NcoI-Hz ⁇ TII-fragment from pGEM-30K, and the fragment containing the rest of the MP gene fused to six Cys/Met-coding units and the GFP gene was excised from pRT-MP- Cys/Met-6x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and BamHI ( Figure 8).
- the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-H ⁇ I-fragment from pGEM-30K, the fragment containing the rest of the MP gene fused to four ⁇ is-coding units and the GFP gene was excised from pRT-MP-Cys/Met-4x-GFP with Hind ⁇ I and Xbal, and both fragments were ligated into p ⁇ YB digested with Ncol and BamHI.
- the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-H ⁇ TII-fragment from pGEM-30K, the fragment containing the rest of the MP gene fused to six Cys/Met-coding units and the GFP gene was excised from pRT-MP-Cys/Met-6x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ YB digested with Ncol and BamHI.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/zoI-fragment, the region containing two Cys/Met-coding sequence units fused to the GFP gene was excised from p ⁇ YB-MP-Cys/Met-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and BamHI resulting in the constract pRT-OLE-Cys/Met-2x-GFP.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/ ⁇ oI-fragment, the region containing four Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP- Cys/Met-4x-GFP with Xhol and BamHI, and both DNA fragments were ligated into pRTlOO digested with Ncol and BamHI.
- the oleosin gene was excised from pOLE4/ll as a NcoI-X/ioI-fragment, the region containing six Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP-Cys/Met-6x-GFP with Xhol and BamHI, and then both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and S ⁇ mHI ( Figure 10).
- the oleosin gene was excised from pOLE4/ll as a NcoI-X/ioI-fragment, the region containing two Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP-Cys/Met-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and -9 ⁇ mHI, resulting in constract p ⁇ AP-OLE-Cys/Met-2x-GFP.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/ioI-fragment, the region containing four Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP- Cys/Met-4x-GFP plasmid with Xhol and -S ⁇ HI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI.
- the oleosin gene was excised from pOLE4/ll as the NcoI-Z/zoI-fragment, the region containing six Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP-Cys/Met- 6x-GFP plasmid with Xhol and BamHI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI ( Figure 11).
- the set of expression vectors based on the hybrid promoter was constructed in a similar manner.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/zoI-fragment, and the region containing two Cys Met-coding sequence units fused to the GFP gene was excised from pHYB- MP-Cys/Met-2x-GFP with Xhol and -3 ⁇ mFfl, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and S ⁇ mHI, resulting in construct pHYB-OLE-Cys/Met-2x-GFP.
- pHYB-OLE-Cys/Met-4x-GFP To obtain pHYB-OLE-Cys/Met-4x-GFP, the oleosin gene was excised from pOLE4/l 1 as a Ncol-Xhol- fragment, the region containing four Cys/Met-coding sequence units fused to the GFP gene was excised from pHYB-MP-Cys/Met-4x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and BamHI.
- Glycine-enriched sequences of two different lengths (with two and four repeats of the Gly- encoding sequence units) (Example 13) were selected.
- the MP gene fused to two Gly-coding units was excised from pMP-Gly-2x with EcoRI and S ⁇ ZI
- the GFP gene was excised from pRT- GFP (See Figure 7 for details) as the X/ioI-S ⁇ mHI-fragment
- both DNA fragments were ligated into pRTlOl digested with EcoRI and BamHI to give the construct pRT-MP-Gly-2x- GFP.
- the MP gene fused to four Gly-coding units was excised from pMP-Gly-4x with EcoRI and S ⁇ ZI, the GFP gene was excised from pRT-GFP as a X/ioI- ⁇ mHI-fragment, and both DNA fragments were ligated into pRTlOl digested with EcoRI and BamHI to obtain pRT-MP-Gly- 4x-GFP ( Figure 7).
- the NcoI-H TH-fragment of the TMV MP gene was excised from pG ⁇ M-30K (the fragment containing the rest of the MP gene fused to two Gly-coding units) and the GFP gene was excised from pRT-MP-Gly-2x-GFP with HindHl and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and BamHI to give p ⁇ AP-MP-Gly-2x-GFP.
- the N-terminal portion of the TMV 30K MP gene was excised as the NeoI-Hwz ⁇ T ⁇ -fragment from pGEM-30K, and the fragment containing the rest of the MP gene fused to four Gly-coding units and the GFP gene was excised from pRT-MP-Gly-2x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ AP digested with Ncol and BamHI ( Figure 8).
- the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-H ⁇ TJI-fragment from pGEM-30K, and the GFP gene was excised from pRT-MP-Gly-2x-GFP with HZn ⁇ I and Xbal, and both fragments were ligated into p ⁇ YB digested with Ncol and BamHI to give p ⁇ YB-MP-Gly-2x-GFP.
- the ⁇ -terminal portion of the TMV MP gene was excised as a NcoI-Hzn ⁇ TLT-fragment from pGEM-30K, the fragment containing the rest of the MP gene fused to two glycine-coding units and the GFP gene was excised from pRT-MP-Gly-2x-GFP with HindSI and Xbal, and both fragments were ligated into p ⁇ YB digested with Ncol and BamHI ( Figure 9).
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/ ⁇ oI-fragment, the region containing two Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP-Gly-2x-GFP with Xhol and -9 ⁇ mHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and BamHI resulting in the constract pRT-OLE-Gly-2x-GFP.
- the oleosin gene was excised from pOLE4/l 1 as a Nc ⁇ l-Xhol- fragment, the region containing four Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP-Gly-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and BamHI ( Figure 10).
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-Z/zoI-fragment, the region containing two Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP-Gly-2x-GFP with Xhol and -5 ⁇ 7nHJ, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and -5 ⁇ 7nHJ, resulting in constract p ⁇ AP-OLE-Gly-2x-GFP.
- the oleosin gene was excised from pOLE4/l l as a NcoI-X/zoI-fragment, the region containing four Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP-Gly-4x-GFP plasmid with Xhol and BamHI, and both D ⁇ A fragments were ligated into p ⁇ AP digested with Ncol and BamHI ( Figure 11).
- the set of expression vectors based on the hybrid promoter was constracted in a similar manner.
- the oleosin gene was excised from pOLE4/ll as a NcoI-X/zoI-fragment, and the region containing two Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP- Gly-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and BamHI, resulting in construct pHYB-OLE-Gly-2x-GFP.
- pHYB-OLE- Gly-4x-GFP the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/ioI-fragment, the region containing four Gly-coding sequence units fused to the GFP gene was excised from pHYB-MP- Gly-4x-GFP with Xhol and -5 ⁇ 77zHI, and both D ⁇ A fragments were ligated into pHYB digested with Ncol and BamHI ( Figure 12).
- Lysine-enriched sequences of two different lengths (with two and four repeats of the Lys- encoding sequence units) (Example 14) were selected.
- the MP gene fused to two Lys-coding units was excised from pMP-Lys-2x with EcoRI and S ⁇ ZI, the GFP gene was excised from pRT- GFP as the Xhol-BamHI-fmgment, and both DNA fragments were ligated into pRTlOl digested with EcoRI and BamHI to give the constract pRT-MP-Lys-2x-GFP.
- the MP gene fused to four Lys-coding units was excised from pMP-Lys-4x with EcoRI and S ⁇ ZI, the GFP gene was excised from pRT-GFP as a X/zoI--9 ⁇ 7nHI-fragment, and both DNA fragments were ligated into pRTlOl digested with EcoRI and BamHI to obtain pRT-MP-Lys-4x-GFP, as in examples 17-19 and in Figure 7.
- NcoI-Hm ⁇ TJI-fragment of TMV MP gene was excised from pG ⁇ M-30K (the fragment containing the rest of the MP gene fused to two Lys-coding units) and the GFP gene was excised from pRT-MP-Lys-2x-GFP with Hindlll and Xbal, and both fragments were ligated into p ⁇ AP or p ⁇ YB digested with Ncol and BamHI to give p ⁇ AP- MP-Lys-2x-GFP and p ⁇ YB-MP-Lys-2x-GFP, respectively.
- the oleosin gene was excised from pOLE4/ll as a Ncol- X ⁇ oI-fragment, the region containing two Lys-coding sequence units fused to the GFP gene was excised from p ⁇ YB-MP-Lys-2x-GFP with Xhol and BamHI, and both D ⁇ A fragments were ligated into pRTlOO digested with Ncol and BamHI resulting in the constructs pRT-OLE-Lys- 2x-GFP.
- p ⁇ AP-OLE-Lys-2x-GFP and pHYB-OLE-Lys-2x-GFP p ⁇ AP-OLE-Lys-2x-GFP and pHYB-OLE-Lys-2x-GFP.
- the oleosin gene was excised from pOLE4/l 1 as a NcoI-X/zoI-fragment, the region containing four Lys-coding sequence units fused to the GFP gene was excised from pHYB-MP-Lys-2x-GFP with Xhol and BamHI, and both DNA fragments were ligated into pRTlOO digested with Ncol and BamHI.
- a transient expression assay was used to ensure protein expression and that the expressed protein had intact biological function(s) as compared to the native unmodified protein, and was accumulating in the targeted organ. This was facilitated by . visual observation of the reporter protein. Confocal laser scanning microscopy was particularly useful because it allowed early detection of transgenic plants expressing amino acid-enriched proteins in-frame with the nucleotide sequence encoding the reporter protein.
- Antibody-based assays e.g. enzyme linked immuno absorbent assays
- direct amino acid analysis could be used as alternative systems to detect transgenic plants expressing amino acid-enriched proteins in-frame with the nucleotide sequence encoding the reporter protein.
- the coding region of the reporter protein, GFP was cloned into these plasmids.
- a gene for a red-shifted GFP mutant S65T was used.
- the GFP coding region was cloned as a NcoI--5 ⁇ 77.HI-fragment into similarly digested pRTlOO, p ⁇ AP and pHYB.
- Agrobacterium tumefaciens AGLI carrying the hyper-viralent, attenuated tumor-inducing plasmid pTi Bo542 (Lazo et al., 1991. Biotechnology 3, 963-967) were transformed by the freeze-thaw method of Holsters (Holsters et al., 1978. Mol.Gen.Genet. 163, 181-187) with some modifications.
- Agrobacteria were cultivated on LB-agar plates supplemented with 0,5 g 1 " 1 MgSO 4 for two days at 26°C, followed by cultivation on liquid 2X YT medium supplemented with 50 ⁇ g/ml rifampicin to mid-exponential phase, then washed with 150 mM NaCl and resuspended in 20 mM CaCl 2 at -1010 cfu ml "1 prior to transformation. Aliquots of cell suspension were frozen in liquid nitrogen after addition of glycerol to a final concentration of 15%. After the addition of 5 ⁇ g of DNA to cells, the cells were thawed and incubated on ice for 15 minutes, prior to heat-shock at 37°C for 5 minutes.
- explants were transferred to Medium Dl (MMO with 4 mg/L BAP, 3% sucrose, 300 mg/1 Ticarcillin, 25 mg/1 Kanamycin and 0.7% Phytoagar). After additional 2- 3 weeks incubation explants with green calli or immature green shoots were transferred to fresh Medium -XL For shoot formation, calli and immature green shoots were transfered to Medium IV (MMO with 3% sucrose, 300 mg/1 Ticarcillin, 25 mg/1 Kanamycin and 0.7% Phytoagar). Fully formed shoots were transferred to Medium V (MMO with 0.2 mg/1 IBA, 3% sucrose, 300 mg/1 Ticarcillin and 0.7% Phytoagar) for rooting. Once an established root system had formed, shoots with roots were removed from agar and transferred to moist potting soil, and grown in 16h light 8h dark photoperiod at light intensity of 12.1 ⁇ mol m "2 s "1 at 22°C.
- sequence homology at the DNA level ranges approximately from 74%-87%.
- sequence homology at the DNA level ranges approximately from 74%-87%.
- the lengths of the engineered poly-amino acid sequences were thought to be crucial for the expression of the His, Cys/Met, Gly and Lys-constracts, for two reasons including stability and inherent limitations in the production capacity of the cells.
- fusion proteins OLE-4XHis-GFP and MP-4xHis-GFP were shown to be identical in size to the predicted molecular weight, when examined with SDS-PAGE gel electrophoresis and by Western blot analysis. Stability of the transgene-encoded protein products (oleosin-His and MP- His) was investigated by Western blot analysis. Analysis of (selfed) plant generations (3 rd generation) after transformation (Table 1) showed clearly that transgene expression was stable over successive generations. Moreover, Western blot analysis of examined transformed plants further revealed that the size of protein product remained constant regardless of the plant generation. These analyses also showed that the amount of fusion protein product was relatively constant between plant generations indicative of an acquired stable expression level relative to other plant proteins.
- Transgenic plant lines of 5 and 14 series contained NAP promoter and transgenic plant lines of 8 and 17 series contained HYB promoter.
- Replicate samples of seeds destined for amino acid analysis were obtained from transgenic Brassica lines (T2) expressing four histidine cassettes (lines 5 and 8 have MP as a carrier, lines 14 and 17 have OLE as a carrier; see Figure 3 and Example 27).
- Amino acid analyses were carried out on the total protein sample obtained from seeds (Table 2). The analysis was performed in Animal Nutrition Section in Agricultural Research Centre, Jokioinen, Finland according to European Commission Directive 98/64/EC (1998).
- Transgenic Brassica campestris plant line 14.12A10 contained 30% more histidine compared to wild-type plant (Table 3). The increased amount of histidine did not accumulate at the expense of other amino acids, but altered the amount of total proteins.
- transgenic lines (8.23, 8.6A1, 14.121) and 17.20C20 and one wild type line (designated WT) were used. These lines correspond to plants transformed with an 8-series, or 14-series or 17-series histidine cassette (See Example 27). The amount of histidine is expressed as g (of histidineVKg (total protein) in Table 4.
- Table 4 The amount of histidine in Brassica campestris seeds.
- the increase of histidine was between 3-9 % when the increase of other amino acid levels were excluded.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Plant Pathology (AREA)
- Nutrition Science (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002516373A CA2516373A1 (en) | 2003-02-28 | 2004-02-27 | Methods and constructs for increasing the content of selected amino acids in seeds |
EP04715341A EP1597375A1 (en) | 2003-02-28 | 2004-02-27 | Methods and constructs for increasing the content of selected amino acids in seeds |
AU2004215201A AU2004215201A1 (en) | 2003-02-28 | 2004-02-27 | Methods and constructs for increasing the content of selected amino acids in seeds |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FI20030315 | 2003-02-28 | ||
FI20030315A FI20030315A0 (en) | 2003-02-28 | 2003-02-28 | Methods and constructions for increasing the content of selected amino acids in seeds |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2004076673A1 true WO2004076673A1 (en) | 2004-09-10 |
Family
ID=8565748
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FI2004/000105 WO2004076673A1 (en) | 2003-02-28 | 2004-02-27 | Methods and constructs for increasing the content of selected amino acids in seeds |
Country Status (7)
Country | Link |
---|---|
EP (1) | EP1597375A1 (en) |
CN (1) | CN1780914A (en) |
AU (1) | AU2004215201A1 (en) |
CA (1) | CA2516373A1 (en) |
FI (1) | FI20030315A0 (en) |
RU (1) | RU2344174C2 (en) |
WO (1) | WO2004076673A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2494051A1 (en) * | 2009-10-30 | 2012-09-05 | Agresearch Limited | Modified oil encapsulating proteins and uses thereof |
US8987551B2 (en) | 2009-10-30 | 2015-03-24 | Agresearch Limited | Modified oil encapsulating proteins and uses thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114303685B (en) * | 2020-09-29 | 2022-09-27 | 中国科学院微生物研究所 | Method for detecting generation of PTI response in monocotyledons |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1990004032A1 (en) * | 1988-10-14 | 1990-04-19 | Plant Genetic Systems N.V. | A process for the production of transgenic plants with increased nutritional value via the expression of modified 2s storage albumins |
US5003045A (en) * | 1986-08-29 | 1991-03-26 | Lubrizol Genetics, Inc. | Modified 7S legume seed storage proteins |
WO1996021029A1 (en) * | 1994-12-30 | 1996-07-11 | University Technologies International, Inc. | Oil body proteins as carriers of high value proteins |
FR2744134A1 (en) * | 1996-01-29 | 1997-08-01 | Biocem | RESERVE PROTEINS FROM PLANTS ENRICHED IN AMINO ACIDS, IN PARTICULAR ALPHA-ZEIN BUT ENRICHED IN LYSINE PLANTS EXPRESSING SUCH PROTEINS |
-
2003
- 2003-02-28 FI FI20030315A patent/FI20030315A0/en unknown
-
2004
- 2004-02-27 CN CN 200480011135 patent/CN1780914A/en active Pending
- 2004-02-27 EP EP04715341A patent/EP1597375A1/en not_active Withdrawn
- 2004-02-27 RU RU2005130158/13A patent/RU2344174C2/en not_active IP Right Cessation
- 2004-02-27 CA CA002516373A patent/CA2516373A1/en not_active Abandoned
- 2004-02-27 WO PCT/FI2004/000105 patent/WO2004076673A1/en active Application Filing
- 2004-02-27 AU AU2004215201A patent/AU2004215201A1/en not_active Abandoned
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5003045A (en) * | 1986-08-29 | 1991-03-26 | Lubrizol Genetics, Inc. | Modified 7S legume seed storage proteins |
WO1990004032A1 (en) * | 1988-10-14 | 1990-04-19 | Plant Genetic Systems N.V. | A process for the production of transgenic plants with increased nutritional value via the expression of modified 2s storage albumins |
WO1996021029A1 (en) * | 1994-12-30 | 1996-07-11 | University Technologies International, Inc. | Oil body proteins as carriers of high value proteins |
FR2744134A1 (en) * | 1996-01-29 | 1997-08-01 | Biocem | RESERVE PROTEINS FROM PLANTS ENRICHED IN AMINO ACIDS, IN PARTICULAR ALPHA-ZEIN BUT ENRICHED IN LYSINE PLANTS EXPRESSING SUCH PROTEINS |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2494051A1 (en) * | 2009-10-30 | 2012-09-05 | Agresearch Limited | Modified oil encapsulating proteins and uses thereof |
CN102741411A (en) * | 2009-10-30 | 2012-10-17 | 农业研究有限公司 | Modified oil encapsulating proteins and uses thereof |
JP2013509178A (en) * | 2009-10-30 | 2013-03-14 | アグリサーチ リミテッド | Protein encapsulating modified neutral lipid and use thereof |
EP2494051A4 (en) * | 2009-10-30 | 2013-04-17 | Agres Ltd | MODIFIED OIL ENCAPSULATION PROTEINS AND USES THEREOF |
US8987551B2 (en) | 2009-10-30 | 2015-03-24 | Agresearch Limited | Modified oil encapsulating proteins and uses thereof |
CN102741411B (en) * | 2009-10-30 | 2015-11-25 | 农业研究有限公司 | The oily packing albumen of improvement and application thereof |
AU2010313865B2 (en) * | 2009-10-30 | 2016-05-05 | Agresearch Limited | Modified oil encapsulating proteins and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
CN1780914A (en) | 2006-05-31 |
CA2516373A1 (en) | 2004-09-10 |
EP1597375A1 (en) | 2005-11-23 |
RU2344174C2 (en) | 2009-01-20 |
FI20030315A0 (en) | 2003-02-28 |
AU2004215201A1 (en) | 2004-09-10 |
RU2005130158A (en) | 2006-03-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6515201B2 (en) | Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction | |
CN102858982B (en) | A method for increasing photosynthetic carbon fixation using glycolate dehydrogenase multi-subunit fusion protein | |
US9611484B2 (en) | In vivo assembly of transcription units | |
CN102105591A (en) | A method for increasing photosynthetic carbon fixation in rice | |
AU2003251579A1 (en) | Intron double stranded rna constructs and uses thereof | |
JP2011101653A (en) | Method and composition for expression of transgene in plant | |
WO2008021974A1 (en) | Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase | |
CA2550028A1 (en) | Transgenic plants with reduced level of saturated fatty acid and methods for making them | |
JP2002531096A (en) | Methods for transforming plastids | |
WO2022072833A2 (en) | Expression constructs and methods of genetically engineering cells | |
JP2009291204A (en) | Modification of fatty acid metabolism in plant | |
CN112457380B (en) | Proteins and related biomaterials and applications for regulating fruit shape and/or juice content in plants | |
US7273966B2 (en) | Elevation of fatty acid synthase levels in plants | |
EP1597375A1 (en) | Methods and constructs for increasing the content of selected amino acids in seeds | |
JP3755146B2 (en) | Production method of transgenic plants with improved amino acid composition | |
US7179956B2 (en) | Elevation of oil levels in plants | |
US20040177400A1 (en) | Methods and constructs for increasing the content of selected amino acids in seeds | |
US20040117874A1 (en) | Methods for accumulating translocated proteins | |
Wahlroos et al. | Increase of histidine content in Brassica rapa subsp. oleifera by over-expression of histidine-rich fusion proteins | |
US7179957B1 (en) | Method for altering nitrogen or oil content of seeds by down regulating AGL11 expression or activity | |
JP3940793B2 (en) | Method of accumulating arbitrary peptides in plant protein granules | |
ZA200600734B (en) | Elevation of oil levels in plants | |
US7109396B2 (en) | Method for obtaining plants enriched in cysteine and glutathione content | |
AU744714B2 (en) | Method for altering storage organ composition | |
Bicar | Molecular and genetic characterization of the inheritance and expression of the synthetic porcine alpha-lactalbumin transgene in maize (Zea mays L.) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DPEN | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 3538/DELNP/2005 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2516373 Country of ref document: CA Ref document number: 2004215201 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2004215201 Country of ref document: AU Date of ref document: 20040227 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2004215201 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004715341 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005130158 Country of ref document: RU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 20048111352 Country of ref document: CN |
|
WWP | Wipo information: published in national office |
Ref document number: 2004715341 Country of ref document: EP |