WO2004074466A1

WO2004074466A1 - Novel cell line, preparation method thereof and use of same, particularly for monitoring changes in chromatin texture

Info

Publication number: WO2004074466A1
Application number: PCT/FR2004/000308
Authority: WO
Inventors: Laurent Heliot; Didier Louis Arthur Deslee; Pierre-Yves Perche; Claire Nadine Marie Vourc'h
Original assignee: Centre National De La Recherche Scientifique
Priority date: 2003-02-12
Filing date: 2004-02-11
Publication date: 2004-09-02
Also published as: FR2850979A1

Abstract

The invention relates to cells from a stable cell line, e. g. monoclonal, having at least one inactive X chromosome, expressing a fusion protein comprising a protein which is associated with heterochromatin, such as a histone variant, and a fluorescent protein. The invention also relates to a method of preparing the stable cell line and to the use of said stable cell line cells for the screening of agents that can modify the texture of the chromatin and, in particular, the inactive state of the inactive X chromosome.

Description

NOVEL CELL LINE, PREPARATION METHOD AND USE THEREOF, IN PARTICULAR FOR MONITORING THE DEVELOPMENT OF THE CHROMATINE TEXTURE

The present invention relates to a new cell line, its preparation process and its use, in particular for monitoring the evolution of the texture of chromatin.

Interphasic chromatin, made up of the association of genomic DNA and proteins, can take a condensed form, transcriptionally inactive, heterocliromatin. This condensed form results from the compaction of DNA carried out by certain proteins, including in particular histones, such as the histones of the nucleosome H2A, H2B, H3, H4 or even Hl.

A special case of heterochromatic formation is the inactive X chromosome, or Xi. Indeed, in female mammalian cells one of the two X chromosomes is almost completely transcriptionally inactive, which makes it possible to compensate for the doubling of the number of copies of genes linked to the X chromosome compared to male cells. During the interphase this chromosome Xi is visible under microscopy in the form of a condensed nuclear element, the Barr's corpuscle, and has the same characteristics as the constitutive heterochromatin, namely: hypermethylation of the CpG islets, hypoacetylation of the histones of heart H3 and H4 and a late replication in phase S. The inactive X chromosome moreover expresses an RNA which is specific to it TARN Xist (Bro n et al, 1992).

The change in the texture of chromatin, that is to say the level of condensation of chromatin, is responsible and / or indicative of significant changes in the level of expression of genes, in particular at the transcriptional level. Indeed, as shown by the classic experiments carried out on the polytenic chromosomes of dipteran larvae, the condensation of a previously decondensed region corresponds to a halt in the transcription of the genes located in this region. Conversely, the decondensation of a previously condensed region corresponds to a derepression of the transcription of the genes of this region.

It has been shown that certain proteins are more particularly associated with heterochromatic regions and in particular with chromosome Xi. The macroH2A protein (Pehrson and Fried, 1992) is a particular example. This protein, made up of 372 amino acids, is about 3 times larger than that of a conventional histone; a third of the protein, located on the N-terminal side, has 64% sequence similarity to the histone H2A, the rest of the protein does not have any particular homologies. It has been demonstrated that this protein, and in particular the macroH2Al subtype, is concentrated preferentially in the inactive X chromosome (Costanzi and Pehrson, 1998). However, other heterochromatic elements of the nucleus also seem to contain this protein (Perche et al, 2000), but in a less concentrated manner.

Different cellular models allowing to visualize the chromosome Xi, as well as other heterochromatic elements, using a fusion protein containing the macroH2A protein and a marker protein have been produced. In one of the cases, the model uses cells of HEK-293 cell line (ATCC CRL-1573, Graliam et al, 1977) transformed by a construct coding for a fusion protein macroH2Al-Myc (Chadwick et al, 2002); the cells are fixed using formaldehyde and visualized in immunofluorescence. The cell line used (HEK-293) is a primary human embryonic kidney cell line immortalized by transformation with a type 5 adenovirus, this line contains several inactive X chromosomes. In another case, the empirical cell model consists of cells from primary cultures of female human fibroblasts (Perche et al, 2000), therefore having limited multiplication potential. These cells are transformed by a construct expressing a GFP-macroH2A fusion protein. GFP is a green-emitting fluorescence protein, well known to those skilled in the art (Chalfïe et al, 1994, US Patent No. 5,491,084).

To date, there is no mention in the literature of a stable cell line allowing the study of the dynamics of chromatin.

One of the aspects of the invention is to provide a new stable cell line making it possible in particular to follow the evolution of the texture of the chromatin. One of the advantageous aspects of the invention is to provide a new cell line making it possible to follow the evolution of the state of inactivation of the chromosome Xi, one of the other aspects of the invention is to provide a new stable cell line allowing to observe the evolution of the texture of chromatin in a standard cellular environment. One of the other aspects of the invention is to provide a new cell line making it possible to test the effects of certain agents on the texture of chromatin, in particular heterochromatin, and in particular on the state of inactivation of the chromosome Xi .

The present invention relates to cells of stable cell line, having at least one inactive X chromosome, expressing a fusion protein comprising: - a protein associated with heterochromatin and

- a fluorescent protein.

The term “inactive X chromosome” designates an X chromosome expressing the Xist RNA (Brown and α /., 1992) The term “fusion protein” designates a protein formed from the covalent association, by means of a peptide bond. , at least two peptides, polypeptides and / or proteins.

The term “stable cell line” denotes a cell line whose nucleotide sequence coding for the fusion protein is integrated into a chromosome.

Advantageously, the stability of the cell line can be verified at any time by the resistance of said cell line to a selection agent causing cell death, such as an antibiotic.

The term “selection agent” denotes a compound which causes the death of cells not expressing the nucleotide sequence coding for the fusion protein, said nucleotide sequence also coding for a gene for resistance to said compound. The term “fluorescent protein” denotes a protein emitting light radiation, also designated by fluorescence, in response to light excitation.

The term “protein associated with heterochromatin” denotes a protein constituting rheterochromatin and in particular a protein involved in the compaction of DNA and which can participate in the inhibition of DNA transcription. According to an advantageous embodiment, the cell line is monoclonal, the cells of said cell line having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year.

The term “monoclonal” designates a cell line resulting from the division of a single cell. Viability is defined as the ability of cells in the cell line to multiply.

The advantage of having a monoclonal cell line according to the invention is to create a standard cellular environment. The term “standard cellular environment” denotes a set of cells whose genetic characteristics are substantially identical. According to another advantageous embodiment, in the cells of the invention the protein associated with heterochromatin is a histone variant.

The term histone variant denotes a non-allelic isoform of a natural or majority histone, such as H2A, H2B, H3, H4 or Hl, and which differs from said natural or majority histone by mutation, deletion or insertion of at minus one amino acid. Histone variants are constitutive of chromatin, these proteins may also constitute rheterochromatin and may have a transcription repression function.

The invention relates in particular to cells for which the protein associated with heterochromatin is associated with the inactive X chromosome.

The association of the protein associated with heterochromatin with the inactive X chromosome can be verified by the location of the labeling of said protein associated with heterochromatin, for example using a specific antibody, on the same nuclear element as labeling of TARN Xist, for example by fluorescent in situ hybridization (FISH). One of the advantages of using the inactive X chromosome is that it is essentially heterochromatic. The inactive X chromosome is the most readily identifiable heterochromatic region in mammalian cells.

According to another embodiment, the cells of the invention are capable of being observed alive under fluorescence microscopy, the excitation wavelength being from approximately 380 nm to approximately 600 µm.

The metabolic processes of the cells of the invention are active during the observation of said cells, in particular the processes of modification of the texture of chromatin.

“Fluorescence microscopy” denotes an observation method using a microscope comprising a light source making it possible to excite fluorescent molecules and a receptor sensitive to the fluorescence emitted by said molecules.

The term “chromatin texture” denotes the distribution in the cell nucleus, or the topology, of an intensity corresponding to a labeling of the chromatin and in particular reflecting the level of condensation of the chromatin. This concept is notably defined by Colomb et al. (1991) and used by Mongelard et al. (1999). The measurement of the texture of the chromatin or of the level of condensation of the chromatin or of the state of inactivation of a chromosome is in particular carried out by fluorescence imaging by measuring the topological variations of a fluorescent labeling of the chromatin, in particular through the light intensity emitted by fluorescence microscopy. The invention relates in particular to cells, in which the ratio between the molar concentration of the fusion protein expressed and the molar concentration of the protein associated with the heterochromatin naturally expressed by said cells is less than approximately 3, in particular including about 0.1 to about 2 and especially less than about 1. “Protein associated with naturally expressed heterochromatin” denotes the protein corresponding to the protein associated with heterochromatin included in the fusion protein and the gene of which is present in said cells before transformation by a DNA construct coding for the above fusion protein. The above ratio can be measured by Western blotting using antibodies against the protein associated with rheterochromatin.

The advantage of the value of the above ratio is that it makes it possible to maintain the total level of expression of the protein associated with heterochromatin at a level close to the natural state, the above ratio makes it possible in particular to maintain the viability of the cell. If this ratio is greater than about 3, the viability of the above cells is significantly lower than that of the corresponding cells not expressing the fusion protein.

According to another advantageous embodiment of the invention, the cells are derived from a cell line chosen from HEK-293 and hTERT-RPEl.

"The cells are derived from a cell line" means that the cells are cells of cell lines transfected with a transgene coding for a fusion protein as defined above.

The HEK-293 cell line is described by Graliam et al, 1977. The hTERT-RPE1 cell line is described by Bodnar et al, 1998.

The HEK-293 cell line is a female line comprising at least two inactive X chromosomes. In addition, HEK-293 cells are adherent in cell culture, which facilitates their observation under microscopy. Furthermore, these cells express a surface receptor for vitronectin, composed of the beta-1 subunit of integrin and the alpha-v subunit of the vitronectin receptor. This receptor constitutes a target for the research of synthetic or natural molecules implicated in cancers and osteoporosis (Henry et al, 2002).

According to an advantageous embodiment, in the cells of the invention the protein associated with heterochromatin is a modified histone, in particular a histone variant, chosen from a protein of the macroH2A family, in particular macroH2Al.l or macroH2A1.2 . The characteristics of macroH2A are described in Pehrson and Fried, 1992. macroH2Al.l and macroH2A1.2 are two isoforms of macroH2Al (Pehrson and Fried, 1992) encoded by the same gene and resulting from alternative splicing of the same pre RNA -messenger.

The macroH2A protein is more concentrated in the inactive X chromosome than in other chromosomes, notably the active X chromosome (Costanzi and Pehrson, 1998). The macroH2A protein is expressed in essentially all cells of the body, in mammals and also in birds. This protein allows essentially total labeling of the inactive X chromosome.

The invention relates in particular to cells, in which the fluorescent protein is chosen from a list comprising YFP, GFP, CFP, BFP, DsRed and HcRed.

GFP denotes a protein emitting a green fluorescence (of approximate wavelength 507 nm) corresponding to the protein emitting a green fluorescence from Aequorea Victoria (Chalfie et al, 1994, US Patent No. 5,491,084) or from

Renilla reniformis (US patent application No. 2002/0064842) or being derived from these proteins by mutation, insertion and / or deletion of at least one amino acid.

The following are designated by YFP (Ormô et al, 1996), CFP (Heim et al, 1996) and BFP (Heim et al,

1996) proteins emitting respectively a yellow (approximately wavelength 527 nm), cyan (approximately wavelength 475 nm) and blue (approximately wavelength 440 nm) fluorescence and derived from GFP by mutation, insertion and / or deletion of at least one amino acid.

DsRed denotes a protein emitting a red color fluorescence (with an approximate wavelength of 580 nm) corresponding to the protein emitting a red color of Discosoma sp. (Matz et al, 1999) or being derived therefrom by mutation, insertion and / or deletion of at least one amino acid. The term HcRed denotes a protein emitting a red color fluorescence (of wavelength approximately 588 or 618 nm) corresponding to the protein emitting a red color of Heteractis crispa (Gurskaya et al, 2001) or being derived from it by mutation, insertion and / or deletion of at least one amino acid.

According to a preferred embodiment, the fluorescent protein, in particular GFP, is encoded by a humanized gene.

The term “humanized gene” denotes a gene of which at least one of the codons has been replaced by a synonymous codon, the frequency of use of which by the human translational apparatus is higher than that of the replaced codon.

These proteins can be used in fluorescence microscopy. They make it possible in particular to carry out FRAP (return of fluorescence after photo-bleaching), FRET (transfer of fluorescence energy by resonance) or co-localization (localization of molecules at the same time within the same cell) experiments. ). According to another embodiment, the cells are derived from cells of the HEK-293 line in which the protein associated with heterochromatin is macroH2A1.2 and the fluorescent protein is YFP.

Advantageously, the N-terminal end of the macroH2A protein is linked to the C-terminal end of the YFP protein.

Advantageously, the YFP protein is of the EYFP type.

Advantageously, the YFP protein can be used for fluorescence resonance energy transfer (FRET) experiments.

According to another embodiment, the subject of the invention is a protein comprising the fusion protein (SEQ ID NO: 2) constituted by macroH2Al .2 and the protein YFP.

The subject of the invention is also the nucleotide sequence (SEQ ID NO: 1) coding for the above fusion protein.

The invention also relates to a method for preparing cells of stable cell line, having at least one inactive X cliromosome, expressing a fusion protein comprising:

a protein associated with heterochromatin, in particular a modified histone, in particular a protein associated with the inactive X chromosome, and

- a fluorescent protein, comprising: - a step of selection from cells of cell line transformed by a nucleotide sequence coding for said fusion protein, in particular by culture of said transformed cells in the presence of a selection agent in order to eliminate the cells untransformed and the transformed cells having integrated said nucleotide sequence in a transient manner, in order to obtain cells of stable cell line.

The term “transient” denotes a nucleotide sequence which has not integrated into a chromosome of the transformed cell.

The selection agent is, for example, an antibiotic, such as geneticin (G418), puromycin, basticidin S, phleomycin or hygromycin B. The invention relates more particularly to a method for preparing cells of monoclonal cell line cells stable, having at least one inactive X chromosome, expressing a fusion protein comprising:

a protein associated with heterochromatin, in particular a modified histone, in particular a protein associated with the active X chromosome, and a fluorescent protein, said cells having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year, comprising:

a step of selection by flow cytometry among the cells of stable cell line obtained by the implementation of the above method to obtain cells of stable monoclonal cell line having a viability greater than about 5 days, in particular about 1 month, and preferably about 1 year.

Advantageously, the cells emitting a fluorescence detected using an LP filter

(high pass) 530 nm are selected by flow cytometry with a light excitation at 488 nm so that the cells retained have a fluorescence intensity significantly different from the background noise.

The invention relates more particularly to a process for the preparation of cells of stable monoclonal cell line derived from the cell line HEK-293, expressing a fusion protein comprising the factor macroH2A1.2 and the fluorescent protein YFP. The invention relates in particular to cells as obtained by the implementation of the above method.

The invention also relates to a process for the preparation of cells of cell line defined above, comprising:

a step of selection from cells of cell line transformed by a nucleotide sequence coding for said fusion protein, in particular by culturing said transformed cells in the presence of a selection agent in order to eliminate the non-transformed cells and the transformed cells having transiently integrated said nucleotide sequence and the recovery of cells of stable cell line and optionally, a step of selection by flow cytometry from the above said cells of stable cell line to obtain cells of stable monoclonal cell line having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year. The subject of the invention is also the use of the cells of the above cell line, to follow the evolution of the texture of the chromatin present in said cells and in particular the state of inactivation of at least one inactive X chromosome. present in said cells.

The term “inactive X chromosome inactivation state” denotes the level of condensation of the constituent chromatin of the inactive X chromosome. The state of inactivation of the inactive X chromosome or the level of condensation of the chromatin constituting the inactive X chromosome is in particular measurable by fluorescence imaging, by measuring the topological variations of a fluorescent labeling of the chromatin, in particular through the light intensity emitted by fluorescence microscopy.

The subject of the invention is also the use of the cells of the above cell line, to follow the evolution of the texture of the heterochromatin present in said cells.

The evolution of the texture of chromatin, in particular of heterochromatin, is in particular monitored using a fusion protein comprising a protein associated with heterochromatin and a fluorescent protein. The fusion protein is a fluorescent marker of heterochromatin. When the heterochromatin decondenses (into chromatin), the light intensity of the marking due to said fusion protein decreases. When the chromatin condenses (into heterochromatin), the light marking due to said fusion protein appears and / or the light intensity of the marking increases. The invention also relates to a method for monitoring the evolution of the texture of chromatin and in particular the state of inactivation of the inactive X chromosome comprising the observation under fluorescence microscopy of the texture of chromatin and in particular of the state of inactivation of at least one inactive X chromosome of the above cells.

A subject of the invention is also the use of the cells of the above cell lines to screen for agents capable of modifying the texture of the chromatin and in particular the state of inactivation of the inactive X chromosome, such as cell parasites or viruses, radiation or radiation, organic or inorganic, synthetic or natural molecules, and in particular xenobiotic compounds, molecules of pharmaceutical interest, drugs, drugs, metals, hormones, cellular extracts.

The term “xenobiotic” designates a substance foreign to a given organism and having toxic properties with respect to this organism.

The invention also relates to a method for screening agents to be tested, such as cellular parasites or viruses, radiation or radiation, organic or inorganic, synthetic or natural molecules, and in particular xenobiotic compounds, pharmaceutical molecules, drugs, medicaments, metals, hormones, cellular extracts capable of modifying the texture of the chromatin and in particular the state of inactivation of the inactive X chromosome, comprising, - observation under fluorescence microscopy of the texture of the chromatin and in particular of the state of inactivation of at least one inactive X chromosome of the above cells,

- adding an agent to be tested to the cells observed, - monitoring under fluorescence microscopy the evolution of the texture of the chromatin and in particular the state of condensation of at least one inactive X chromosome of the cells to which an agent to be tested has been added, to evaluate the effect of said agent to be tested on the texture of the chromatin and in particular on the state of inactivation of the active X chromosome. The cells of the cell line of the invention express a protein associated with the heterochromatic regions, in particular with the inactive X chromosome, coupled to a fluorescent marker thus making it possible to observe the evolution of the texture of the chromatin and in particular the evolution of the state of inactivation of the inactive X chromosome, in response to certain agents inducing condensation or decondensation of chromatin. The cell line of the invention is stable, which makes it possible to observe the evolution of the texture of chromatin in a standard cellular environment, thus limiting the experimental variability linked to the cells used, in particular in the context of the evaluation of effects of modification of the chromatin texture induced by certain agents.

Advantageously, the cell line of the invention makes it possible to test the effects of certain agents, in particular in the context of high-throughput screening, such as cellular parasites or viruses, radiation or radiation, organic or inorganic, synthetic molecules. or natural, and in particular xenobiotic compounds, pharmaceutical molecules, drugs, medicaments, metals, hormones, cellular extracts, on the texture of the chromatin, and in particular on the state of inactivation of the mactive X chromosome. The modification of the texture of chromatin, and in particular of the inactive state of the inactive X chromosome due to the effects of these compounds can indeed significantly alter the gene expression profile of a cell, leading to dysregulations pathologies that can lead to cancer-type developments, for example.

Figure 1A and Figure 1B

FIGS. 1A and 1B represent the fluorescence profile obtained in cell sorter (FACS), of HEK-293 cells transfected with stable pEYFP-Cl-macroH2A. The abscissa axis, graduated on a logarithmic scale, corresponds to the fluorescence intensity measured. The ordinate axis corresponds to the percentage of cells having a given fluorescence value.

In Figure 1A, three fluorescence peaks, marked 1, 2 and 3 are visible. Peak 1 corresponds to non-fluorescent cells, - peak 2 to weakly or moderately fluorescent cells (54% of the total of sorted cells), peak 3 to strongly fluorescent cells (3% of the total of sorted cells).

In Figure 1B, the sorted cells come from peak 2 obtained during the first passage through a cell sorter (corresponding to Figure 1A). The peak marked with an arrow represents the cells emitting weak or medium fluorescence, these cells represent 71% of the total of the sorted cells.

Figure 2

FIG. 2 represents a photograph of a Western transfer carried out from protein extracts of cells of three HEK-293 lines, transfected with pEYFP-Cl-macroH2A, different monoclonal stable cells and of cells of a control HEK-293 line . Lane A corresponds to the control line, tracks B, C and D each correspond to a HEK-293 line, transfected with pEYFP-Cl-macroH2A, different monoclonal stable. On the left side of the transfer, the migration limits corresponding to proteins of molecular weight 85 kDa and 39 kDa are marked with arrows. On the right side of the transfer, the bands corresponding to the YFP-macroH2A protein and to the endogenous macroH2A protein are identified by arrows. Proteins are identified using a rabbit anti-macroH2A1.2 polyclonal antibody.

Figure 3 Figure 3 shows a photograph obtained by confocal microscopy of HEK-293 cells, transfected with pEYFP-Cl-macroH2A, stable monoconal. Four cells named A, B, C and D are visible on this plan. Two inactive X chromosomes labeled with the protein YFP ~ macroH2A are visible in cell C in the form of two clear spots located on either side of the cell.

Figure 4

FIG. 4 represents the nucleotide sequence of the gene of the fusion protein YFP-macroH2A (in capital letters) superimposed on the corresponding peptide sequence of the protein YFP-macroH2A in three-letter code of amino acids. Example 1

Construction of the plasmid peYFP-Cl-macroH2A

The DNA sequence corresponding to macroH2A1.2 was amplified by PCR from a cDNA library of fetal human skeletal muscle (Marathon-Ready PCR cDNA, Clontech, USA). Two PCRs were carried out using the following pairs of oligonucleotide primers:

Macro 1.2-5 '(SEQ ID NO: 3): 5' ctgacccttattcacagtgaaatcagtaatttag 3 'Macro 1.X-3' (SEQ ID NO: 4): 5 'gttggcgtccagcttggccatttcctgcacatag 3'

Macro l.X-5 '(SEQ ID NO: 5): 5' ccatgtcgagccgcggtgggaagaagaagtcc 3 'Macro 1.2-3' (SEQ ID NO: 6): 5 'gtgtttcctaggtcatctttagggtcaatg 3'

The two products obtained then served as a template in a third PCR in the presence of the oligonucleotides Macro 1.2-5 'and Macro 1.2-3' to form a DNA fragment containing the entire coding sequence of macroH2A1.2 and at the ends. from which the restriction sites BglE in 5 'and EcoRI in 3' are found. The PCR fragment obtained was digested with these enzymes and inserted into the corresponding restriction sites of the plasmid pΕYFP-Cl (Clontech, USA) downstream of the open reading phase encoding YFP, to form the open reading phase (SΕQ ID NO : 1) (Figure 4) coding for the fusion protein YFP-macroH2A (SΕQ ID NO: 2) (Figure 4). The plasmid thus obtained was named pΕYFP-Cl-macroH2A, this plasmid also carries the Kan ^r gene conferring resistance to geneticin (G418).

Transfection of HΕK-293 cells with the plasmid pΕYFP-Cl-macroH2A Cells of the HΕK-293 line (ATCC CRL-1573) were transfected with the plasmid pΕYFP-Cl-macroH2A.

The HΕK-293 cells are maintained in culture dishes with a diameter of 100 mm (Falcon), in particular in DMΕM 10% SNF culture medium containing 500 ml of DULBΕCCO'MΕM medium with glutamax, without sodium pyruvate (DMΕM, GIBCO), 50 ml of decomplemented fetal calf serum (SNF) and 2.75 ml of gentamycin 10 mg / ml. The cell culture medium is renewed every 3 days: the cells are detached using a trypsin solution (1% trypsin, gentamycin 8 μg / ml) and taken up in DMΕM 10% SNF buffer for a volume final 10 ml. A volume of 1.5 ml of this suspension is then transferred to a new dish containing 8.5 ml of DMΕM 10% SNF medium. One day before transfection 2.5 ml of HEK-293 cells in culture are removed and mixed with 12.5 ml of DMEM 10% SNF medium, 5 ml of this suspension are then distributed in the cells with a diameter of 35 mm in boxes. 6-cell polystyrene (Costar).

The transfection is carried out on the alveoli with 70% confluence, as estimated under a microscope. After washing with 1 ml of OPTIMEM medium without serum (GEBCO), 900 μl of this same medium are deposited in the selected cells. 100 μl of a mixture, pre-incubated for 20 minutes, then containing 50 μl of EXGEΝ medium and 50 μl of the plasmid solution pEYFP-Cl-macroH2A at 0.02 μg / μl are then added. EXGEΝ medium contains 4 μl of EXGEΝ 500 transfecting agent (EUROMEDEX) and water in sufficient quantity for 50 μl. The plates are then placed in a CO ₂ (5%) oven at 37 ° C. 6 hours later, 4 ml of DMEM 20% SNF medium are added and the plates are incubated for 48 hours under the same conditions.

Obtained transfected cells are verified by observation of the fluorescence emitted by the cells present in the cells using an AXIONERT 135 TV microscope, YFP filter (excitation wavelength 488 nm, emitted fluorescence observed at beyond 525 nm).

Obtaining stable lines HEK-293 transfected with the plasmid pEYFP-Cl-macroH2A

The transfected cells are detached from their support by trypsinolye and taken up in a volume of 1.25 ml of 10% SNF DMEM medium per cell. A volume of 312 μl is then taken and diluted in 60 ml of DMEM 10% SNF + G 18 selection medium containing 1 mg / ml of G418 (or geneticin, GIBCO). This suspension is then distributed in 5 boxes of polystyrene with a diameter of 100 mm. The dishes are incubated for 3 days under the conditions mentioned above without changing the medium, then the selection medium is renewed by half every 2 days for 10 days.

When the cell layers arrive at approximately 80% confluence, the cells of a dish are detached by trypsinolysis and taken up in 1.25 ml of DMEM medium 10% SNF. A volume of 312 μl is again withdrawn and diluted in 60 ml of the selection medium DMEM 10% SVF + G418. This suspension is distributed as before in 5 boxes of polystyrene with a diameter of 100 mm and an incubation similar to that described above is carried out.

At the end of this stage, the cell lines obtained are considered to be stable. The selection pressure to which the cells were subjected during 26 days made it possible to select the cells for which the transgene is present and integrated into a chromosome.

Selection of a stable monoclonal line The cell carpet of one of the preceding culture dishes is detached by trypsinolysis and the cells obtained are taken up in 1 ml of DMEM + G418 medium (without serum). This suspension is then passed through a cell sorter (FACS) of the Coulter Elie EPICS type. The cells are excited by an argon laser with a wavelength of 488 nm and the emission of fluorescence is observed beyond 525 nm using a YFP filter. During a first passage of the cells, three peaks of fluorescence, corresponding to the cells not emitting fluorescence, emitting a weak to medium fluorescence or emitting a strong fluorescence are observable (FIG. 1A). A second passage made it possible to individually recover cells from the peak of low to medium florescence and the peak of strong fluorescence in 96-well plates containing 100 μl of selection medium without serum. The fluorescence profile of the cells recovered in the low to medium fluorescence peak is shown in Figure 1B. 5 plates were used for the weak to medium fluorescence peak and 1 plate for the strong fluorescence peak. 100 μl of DMEM medium 20% S VF + G418 are then added and it is checked 12 to 24 hours later that each well contains only one cell. The plates are then incubated for 1 week in a CO ₂ oven (5%) without renewing the medium. The medium is then replaced by 100 μl of DMEM 10% SNF + G418 medium which is renewed with 50 μl every 3 days for 10 days.

Following this incubation, the wells are observed directly using an AXIOVERT 135 TV microscope, YFP filter and the wells having a cell layer whose fluorescence is homogeneous are selected. These wells have a monoclonal cell population (ie from the same cell). The cells of the corresponding wells are then detached by trypsinolysis and taken up in 2 ml of DMEM 10% S VF + G418 medium. 18 clones from the low to medium fluorescence peak and 11 clones from the strong fluorescence peak were thus selected. The suspension obtained for each selected clonal population is distributed in 2 24-well plates (ΝUΝUCLEOΝ), one of which contains glass slides treated with type I collagen (EUROMEDEX) at 30 μg / ml. When the cell cultures on glass slides are at 70% confluence, these are rinsed with PBS (phosphate buffered saline) and fixed with PFA 3% (paraformaldehyde 3% in PBS). The slides are then observed using an ZEISS AXIOVERT 100M inverted microscope, x63 objective, YFP filter to validate the presence of homogeneous fluorescence, cells at different stages of cell divisions and fluorescent nuclear corpuscles. The cells of the plates corresponding to the plates with glass coverslips for which these observations proved to be positive were detached by trypsinolysis and cultured in a 100 mm dish with the selection medium DMEM 10% SVF + G418 0.3 mg / ml . The final clone was chosen after several successive observation phases in BIOPTECH dishes using an inverted microscope ZEISS -AXIOVERT 100M, x63 objective, YFP filter, to check the persistence of the characteristics of homogeneous fluorescence, from cells to different stage of fluorescent nuclear cell divisions and corpuscles. This selection step makes it possible to obtain a stable, monoclonal cell line, viable in the long term, the viability in culture of the selected cells is indeed greater than 1 year, and having well defined fluorescence characteristics.

Example 2 Expression of the YFP-macroH2A Fusion Protein

The expression of the fusion protein YFP-macroH2A by HEK-293 cells transfected with the stable monoclonal plasmid pEYFP-Cl-macroH2A was measured by Western blotting and compared with the expression of the endogenous macroH2A1.2 protein for three. HEK-293 lines transfected with plasmid pEYFP-Cl-macroH2A different monoclonal stable (Figure 2).

The cells of the different cell lines were cultured under the conditions described above and then centrifuged. The cell pellets obtained were then taken up in a 9M urea solution and subjected to sonication. Four samples of 10 μg of protein extracts thus obtained were then deposited respectively on four tracks of an SDS / PAGE 8% gel. After electrophoretic migration and transfer of the proteins to the membrane according to techniques well known to those skilled in the art, the transfer membrane was incubated in the presence of a rabbit polyclonal antibody directed against the protein macroH2A1.2. The labeling was revealed using an anti-rabbit antibody coupled to peroxidase (Promega Biotech Corporation). The results presented in FIG. 2 indicate that for each of the lines tested the amount of YFP-macroH2A fusion protein expressed is less than the amount of endogenous macroH2A1.2 protein expressed. Example 3

Observation under fluorescence microscopy of nuclear domains marked by YFP- macroH2A

Three observation modes under fluorescence microscopy were used:

Conventional fluorescence microscopy

The cells are fixed with paraformaldehyde 3% in PBS and observed with a straight microscope equipped with a 50 watt mercury lamp and a set of filters XF1068, XF2030 and XF3074 (Omega Optical, USA). The images are acquired by a CCD camera.

Inverted fluorescence microscopy on living cells

The cells to be observed are cultured and observed in culture dishes with a glass bottom of 17 mm, as described in Example 1. During the observation, the culture medium L15 (GIBCO) supplemented with 10% of FCS is used to compensate for the absence of CO ₂ enrichment. The cells are maintained at constant or variable controlled temperature (between 32 ° C and 40 ° C) according to the experiments. The inverted microscope is equipped with the set of filters XF1068, XF2030 and XF3074 (Omega Optical, USA). The cells are observed alive for several hours at the rate of an image acquisition every 3 to 60 minutes by means of a CCD camera controlled by the Metamorph software (Universal hnaging, USA).

Confocal microscopy on living cells

The cells to be observed are placed in culture dishes with a glass bottom of 17 mm in L15 medium (GIBCO) supplemented with 10% of FCS. The culture dishes are placed on the stage of the confocal microscope in a temperature-controlled incubator. The fluorophores are excited by an Argon laser (Lasos, USA) at 515 nm (<5 mW) and analyzed via a confocal multi-PMT system equipped with a spectral light separation device (SP2, Leica , Mein heim, Germany). The inactive X chromosome is then visible in the form of a well-defined light zone (Figure 3).

Example 4

Observation of the evolution of the texture of chromatin in response to the addition of agents to be tested to cells of stable monoclonal line HE-293 transfected with the plasmid r-EYFP-Cl- macroH2A The cells obtained following the implementation of Example 1 are placed in culture dishes with a glass bottom of 17 mm in L15 medium (GIBCO) supplemented with 10% of FCS. The culture dishes used are provided with a perfusion device allowing the controlled introduction of the agents to be tested into the culture medium. The dishes are placed on the stage of an inverted microscope equipped with an enclosure allowing the regulation of the cell culture conditions. The microscope used is also provided with a CCD camera (charge transfer circuit). The entire system is controlled by Metamorph software (Universal, Imaging, USA) which controls the microscope and the motorized stage, records and controls the culture conditions and manages the acquisition of images during the experiment.

Initially, different fields of observation of cells, including in particular an inactive X chromosome, are defined by the operator, it is also possible to choose different magnifications, these parameters are then recorded by the control software. Following the configuration, the observation process is divided into three stages, normalization, acquisition and analysis. This process can be carried out semi-manually or automatically: the normalization step consists in fixing the reference state before the cells are brought into contact with the agent (s) for a period fixed by the operator or by the control software, - the cells are then placed in the presence of the agent to be tested using the injection device or by spraying. A suite of image acquisition is launched for a predefined duration or dependent on the changes in texture over time, - the analysis of the texture is carried out in real time, during the experiment, or a posteriori.

The texture analysis algorithms used are notably described by Colomb et al

(1991), Pappas (1992), Einstein et al. (2002) and Albregsten et al. (1994). The results obtained make it possible to evaluate the influence of the agent (s) to be tested on the texture of the chromatin and in particular on the state of inactivation of the inactive X chromosome. This method can also be used in the context of high throughput screening. REFERENCES

Albregsten F., Havard D.E. & Yogesan K. Gray level variance matrix: A new approach to higher order statistical texture analysis. Proceedings of the Third International Conference on Automation, Robotics and Computer Vision 1994, 2: 658-63.

Bodnar A.G., Ouellette M., Frolkis M., Holt S.E., Chiu C.P., Morin G.B., Harley C.B., Shay J.W., Lichtsteiner S. & Wright W.E. Extension of life-span by introduction of telomerase into normal human cells. Science 1998, 279: 349-52.

Brown C.J., Hendrich B.D., Rupert J.L., Lafreniere R.G., Xing Y., Lawrence J. & Willard H.F. The human Xist gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized with the nucleus. Cell 1992, 71: 527-542. Chadwick B.P. & Willard H.F. Cell cycle-dependent locahzation of macroH2A in chromatin ofthe inactive X chromosome. J. CellBiol. 2002, 157: 1113-1123

Chalfie M., Tu Y., Euskirchen G., Ward W.W. & Prasher DC. Green fluorescent protein as a marker for gene expression. Science 1994, 263: 802-5.

Colomb E., Dussert C. & Martin PM. Nuclear texture parameters as discriminant factors in cell cycle and drug sensitivity studies. Cytometry 1991, 12: 15-25.

Costanzi C. & Pehrson J.R. Histone macroH2Al is concentrated in the inactive X chromosome of female mammals. Nature 1998, 393: 599-601.

Einstein A.J., Wu H. & Gil J. Detrended fluctuation analysis of chromatin texture for diagnosis in breast cytology. Fractals 2002, 10: 19-25 Graham F.L., Smiley J., Russell W.C. & Nairn R. Characteristics of a human cell line transforaied by DNA from human adenovirus type 5. J. Gen. Virol 1977, 36: 59-74.

Gurskaya N.G., Fradkov A.F., Terskikh A., Matz M.V., Labas Y.A., Martynov V.I., Yanushevich Y.G., Lukyanov K.A. & Lukyanov S.A. GFP-like chromoproteins as a source of far-red fluorescent proteins. FEBS Lett. 2001, 507: 16-20.

Henry C, Moitessier N. & Chapleur Y. Nitronectin receptor alpha (V) beta (3) integrin antagonists: chemical and structural requirements for activity and selectivity. Mini. Rev. Med. Chern. 2002, 2: 531-42.

Heim R. & Tsien R.Y. Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr. Biol 1996, 6: 178-82.

Matz MN, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML & Lukyanov SA Fluorescent proteins from nonbioluminescent Anthozoa species. Nαt. Biotechnol. 1999, 17: 969-73. Mongelard F., Nourc'h C, Robert-Νicoud M. & Usson Y. Quantitative assessment of the alteration of chromatin during the course of FISH procedures. Fluorescent in situ hybridization. Cytometry 1999, 36: 96-101.

Ormô M., Cubitt A.B., Kallio K., Gross L.A., Tsien R.Y. & Remington S.J. Crystal structure of theAequorea Victoria green fluorescent protein. Science 1996, 273: 1392-5.

Pappas T.Ν. An adaptive clustering algorithm for image segmentation. IEEE Trans. On Signal Processing 1992, 40: 901-41.

Pehrson J.R. & Fried N.A. MacroH2A, a core histone containing a large nonhistone region. Science 1992, 257: 1398-1400.

Perche P.Y., Nourc'h C, Konecny L., Souchier C, Robert-Νicoud M., Dimitrov S. & Khochbm S. Higher concentrations of histone macroH2A in the Barr body are correlated with higher nucleosome density. Current Biology 2000, 10: 1531-4.

Claims

1. Stable cell line cells, having at least one inactive X chromosome, expressing a fusion protein comprising: - a protein associated with heterochromatin and

- a fluorescent protein.

2. Cell line cells according to claim 1, for which said cell line is monoclonal, said cells having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year.

3. Cells according to claim 1 or 2, in which the protein associated with heterochromatin is a histone variant.

4. Cells according to one of claims 1 to 3, for which the protein associated with heterochromatin is associated with the active X chromosome.

5. Cells according to one of claims 1 to 4, capable of being observed alive under fluorescence microscopy, the excitation wavelength being from approximately 380 nm to approximately 600 nm.

6. Cells according to one of claims 1 to 5, in which the ratio between the molar concentration of the fusion protein expressed and the molar concentration of the protein associated with the heterochromatin naturally expressed by said cells is less than approximately 3, in particular comprised from approximately 0.1 to approximately 2 and in particular less than approximately 1.

7. Cells according to one of claims 1 to 6, derived from a cell line chosen from HEK-293 and hTERT-RPEl.

8. Cells according to one of claims 1 to 7, in which the protein associated with heterochromatin is a modified histone, in particular a histone variant, chosen from a protein of the macroH2A family, in particular macroH2Al.l or macroH2A1. 2.

9. Cells according to one of claims 1 to 8, in which the fluorescent protein is chosen from a list comprising YFP, GFP, CFP, BFP, DsRed and HcRed.

10. Cells according to one of claims 1 to 9, derived from cells of the HEK- line

293 and in which the protein associated with heterochromatin is macroH2A1.2 and the fluorescent protein is YFP.

11. Protein comprising the fusion protein (SEQ ID NO: 2) constituted by macroH2Al .2 and the protein YFP.

12. Nucleotide sequence (SEQ ID NO: 1) coding for a protein according to claim 11.

13. Method for preparing cells of stable cell line, having at least one inactive X chromosome, expressing a fusion protein comprising:

a protein associated with rheterochromatin, in particular a modified histone, in particular a protein associated with the inactive X chromosome, and

- a fluorescent protein, comprising:

a step of selection from cells of cell line transformed by a nucleotide sequence coding for said fusion protein, in particular by culturing said transformed cells in the presence of a selection agent in order to eliminate the non-transformed cells and the transformed cells having transiently integrated said nucleotide sequence, to obtain cells of stable cell line.

14. Method for preparing cells of stable monoclonal cell line, having at least one inactive X chromosome, expressing a fusion protein comprising: - a protein associated with heterochromatin, in particular a modified histone, in particular a protein associated with inactive X chromosome , and

a fluorescent protein, said cells having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year, comprising: a step of selection by flow cytometry from the cells of stable cell line obtained by the implementation of the method according to claim 13, in order to obtain cells of stable monoclonal cell line having a viability greater than approximately 5 days, in particular approximately 1 months and preferably about 1 year.

15. The method of preparation according to claim 14, of cells of stable monoclonal cell line derived from the cell line HEK-293, expressing a fusion protein comprising the factor macroH2Al .2 and the fluorescent protein YFP.

16. Cells as obtained by implementing the method according to one of claims 13 to 15.

17. Method for preparing cells of cell line according to one of claims 1 to 10, comprising: a step of selection from cells of cell line transformed by a nucleotide sequence coding for said fusion protein, in particular by culture of said cells transformed in the presence of a selection agent in order to eliminate the non-transformed cells and the transformed cells which have integrated said nucleotide sequence in a transient manner and the recovery of cells of stable cell line and optionally,

a step of selection by flow cytometry from the above-mentioned cells of stable cell line, in order to obtain cells of stable monoclonal cell line having a viability greater than approximately 5 days, in particular approximately 1 month and preferably approximately 1 year.

18. Use of cells of cell line according to one of claims 1 to 10 and 16, to follow the evolution of the texture of the chromatin present in said cells and in particular the state of inactivation of at least one X chromosome inactive present in said cells.

19. Method for monitoring the evolution of the texture of chromatin and in particular the state of inactivation of the inactive X chromosome comprising observation under fluorescence microscopy of the texture of chromatin and in particular the state of condensation at least one inactive X chromosome of the cells according to one of claims 1 to 10 and 16.

20. Use of cells of cell lines according to one of claims 1 to 10 and 16 for screening agents capable of modifying the texture of chromatin and in particular the state of inactivation of the active X chromosome, such as cellular parasites or viruses, radiation or radiation, organic or inorganic, synthetic or natural molecules, and in particular xenobiotic compounds, pharmaceutical molecules, drugs, drugs, metals, hormones, cell extracts.

21. Method for screening agents to be tested, such as cellular parasites or viruses, radiation or radiation, organic or inorganic, synthetic or natural molecules, and in particular xenobiotic compounds, pharmaceutical molecules, drugs, drugs, metals, hormones, cellular extracts, capable of modifying the texture of the chromatin and in particular the state of inactivation of the inactive X chromosome, comprising,

the observation by fluorescence microscopy of the texture of the chromatin and in particular of the state of inactivation of at least one inactive X chromosome of cells according to one of claims 1 to 10 and 16,

- adding an agent to be tested to the cells observed,

- monitoring under fluorescence microscopy the evolution of the texture of chromatin and in particular the state of condensation of at least one inactive X chromosome of the cells to which an agent to be tested has been added, to evaluate the effect of said agent to be tested on the texture of the chromatin and in particular on the inactivation state of the inactive X chromosome.