WO2004067770A1

WO2004067770A1 - Active dna nanocompartment and its preparation

Info

Publication number: WO2004067770A1
Application number: PCT/CN2004/000058
Authority: WO
Inventors: Youdong Mao; Qi Ouyang
Original assignee: Peking University
Priority date: 2003-01-16
Filing date: 2004-01-16
Publication date: 2004-08-12
Also published as: CN1182257C; CN1425777A

Abstract

The present invention provides a molecular switch―active DNA nanocompartment which can be operated mechanically on molecular level, a method for preparing this nanocompartment is also disclosed. The present active DNA nanocompartment can be operated manually on molecular level, including molecule capture, gene recognition, micro-energy storage and release, and can be used in investigation of molecular biology and biochemistry as well as preparation and development of biophysics material (such as biochips).

Description

Active gene molecular nano-cabin and preparation method thereof

The invention belongs to the technical field of molecular mechanical device based on gene molecules, and belongs to the field of cross-technology of physics and life sciences. Background technique:

Gene-based molecular mechanical devices are a cutting-edge technology that has only begun to appear in recent years. In the current technology, the most basic is a single-function device based on a few gene molecules, which are typically as follows: First, the BZ helix structure of DNA is used to achieve 180-degree mechanical rotation (Reference: Chengde Mao, Weiqiong Sun, Zhiyong Shen & Nadrian C. Seeman. A nanomechanical device based on the BZ transition of DNA. Nature (1999) 144-146; Molecular forceps (Reference: Bernard Yurke, et al. A DNA-fueled molecular machine made of DNA. Nature, 406, (2000) 605-608). The feature of this type of DNA molecular device is that it has a single function and is more demonstrative than practical, that is, it shows people the possibility of technical implementation of mechanical manipulation at the nanoscale and molecular level, but it does not provide Any method and approach that can be used in practical applications. The other is an oligofunctional device based on a relatively large number of gene molecules. This aspect was first designed by scientists such as Hao Yan in 2002 (References: Hao Yan, Xiaoping Zhang, Zhiyong Shen & Nadrian C. Seeman. A Robust DNA mechanical devices controlled by hybridization topology. Nature, 415, (2002) 62-65), this new type of molecular device is composed of multiple mechanical units repeatedly arranged, and each mechanical unit is ) The two topological isomers are converted to achieve mechanical rotation. Since the two-hybrid molecular mechanical unit can be repeatedly extended over a long distance, the mechanical rotation of the mechanical unit can trigger the mechanical transmission, thereby achieving multi-level nano-scale mechanical handling. However, although the nano-mechanical function of this molecular device has been demonstrated, since it does not further solve the problem of how to use the actual application system, this molecular device is still far from practical applications.

In general, research on molecular mechanical devices has just begun internationally. On the one hand, the research is relatively preliminary, and the experiments are not rich enough. On the other hand, the exploration of scientific principles is far from being applied. Summary of the invention:

The object of the present invention is to provide a switchable tool capable of performing mechanical operations at the molecular level. Sex DNA molecule nanocompartment (Active DNA Nanocompartment) is a kind of molecular mechanical device that can be artificially controlled by collectively forming an array of oligonucleotides closely arranged on the surface of a solid substrate.

Another object of the present invention is to provide a method for preparing the active gene molecule nanocabin.

The technical solution of the present invention is as follows-an active gene molecule nano-cabin, which is composed of multiple gene molecular units repeatedly arranged on a solid substrate, and each gene molecular unit includes a double-strand and a single-strand; relative to a solid substrate, The double-stranded part is close to the substrate, and the double-stranded part is far away from the substrate. One end of the single-stranded part is fixed to the surface of the solid substrate. The double-stranded part of each gene molecular unit is closely arranged to form a dense molecular film, so that the A nano-scale molecular compartment is formed between the molecular film and the surface of the solid substrate.

In the active gene molecule nanocabin, the length of the double-stranded portion is: more than three bases; the length of the single-stranded portion is: more than one base.

In the active gene molecule nano-cabin, a selected substrate is a solid material at normal temperature, such as a metal electrode, a silicon wafer, quartz glass, and the like.

The selection of the basic physical parameters of the active gene molecule nano-cavity and the gene molecular unit is recommended to adopt the following settings: In order to improve the hybridization efficiency and better insulation, the length of the single-stranded portion is 5 to 40 bases, and is determined by A or T Base composition; double-stranded part is 15 or more in length.

In the active gene molecule nanocabin, the coverage density of the gene molecular unit on the substrate surface is optimally in the range of (5.4 ± 1.8) x 10 ¹² (molecules per square centimeter). In this coverage density range, the effect of the molecular nanocabin is most obvious.

A method for preparing an active gene molecule nano-cabin includes the following steps:

(1) Select an appropriate solid substrate, and determine the chemical group of the solid substrate based on the interaction between the solid substrate and the gene and molecular unit forming the nanocabin. For example, the thiol group is usually used to bind DNA on the gold surface. Glass surface using amino, etc .;

(2) The surface portion of the solid substrate on which the genetic molecular unit is to be connected is subjected to necessary pretreatment. If the result of step (1) requires the surface modification of the solid substrate, the surface of the solid substrate should be chemically modified, such as modified amino groups. Or carboxyl, etc .; '-

(3) selecting the base sequence and basic physical parameters of the molecular unit of the gene, that is, the length of the single-stranded portion and the length of the double-stranded portion;

(4) According to the result of step (2), prepare a genetic reagent for the gene molecular unit. If the result of step (1) requires the gene molecular unit to be used to connect one end of a solid substrate for modification, then the gene molecular unit should be End Chemical modification, such as modification of thiol, amino or carboxyl;

(5) One end of a predetermined amount of the gene molecular unit is fixedly connected to the surface of the solid substrate, and its surface density must be sufficient to make the double-stranded part form a molecular film; that is, the active gene molecular nano-chamber is prepared. The prepared device is stored in a storage solution for use.

In the preparation method, the selected substrate is a solid material at normal temperature, such as a metal electrode, a silicon wafer, quartz glass, and the like.

In the preparation method, the double-stranded portion is formed by hybridizing a gene fragment to be detected and a gene fragment complementary thereto.

In the preparation method, the selection of the basic physical parameters of the gene molecular unit is recommended to adopt the following settings: the length of the single-stranded portion is 5 to 40 bases, which is composed of A or T bases; and the length of the double-stranded portion is 15 or more.

In the preparation method, the coverage density of the DNA molecular unit on the substrate surface is optimally in a range of (5.4 ± 1.8) X 10 ¹² (molecules per square centimeter).

The basic operating principle of the active gene molecular nano-cabin: We may wish to call the complementary strand of the double-stranded part as a switch molecule. When the switch molecule of the double-stranded part is eluted from the double-strand, the molecular compartment is opened and is in an open state; When the molecules immobilized on the surface of the substrate and the switch molecules are fully hybridized, a double-stranded portion is formed again, and the molecular compartment is closed and is in a closed state. The specific operation method includes the following two aspects-opening operation: Method 1. Place the device in a biochemical buffer suitable for DNA retention activity, such as Tris buffer, phosphate buffer, etc. The pH of the biochemical buffer is recommended to be 7 ~ 8 Raise the ambient temperature of the solution to above the melting chain temperature (Tm) of the double-stranded portion of the nanocavity molecular unit, and the molecular nanocavity can be opened after a certain time; method two, the device is placed in a formaldehyde or urea solution, Shake for 5 to 15 minutes.

Shut down operation: Place the device in the hybridization solution containing switch molecules. You can choose 20 mM Tris-HCl buffer (pH = 7.8) containing ImM magnesium ions; keep the temperature of the solution below Tm, or From a high temperature to a low temperature, the molecular nanocabin can be closed after a certain period of time.

The present invention utilizes the potential of DNA in molecular mechanical devices from a completely new perspective, and is characterized by: First, the special spatial structure provided by the DNA Array is utilized; Second, the multiple secondary structure of the gene molecule is skillfully used. Shape (Polymoiphism) and designability; Third, the use of changes in the spatial structure caused by collective molecular molecules to achieve mechanical switching. The present invention provides a tool for performing manual operations at the molecular level, including molecular capture, gene identification, micro-energy storage and release, which are all unavailable and available in existing macro tools. It can be applied to the research of molecular biology and biochemistry, and is widely used in the manufacture and development of biophysical materials (such as biochips). Brief description of the drawings:

Figure 1 is a schematic diagram of the structure and operation of an active gene molecule nanocabin. In the figure:

1-Typical sequence of single-stranded DNA fragments for surface modification

2—Typical sequence of a single-stranded DNA fragment used to close a gene nanopod

3—Double-stranded DNA membrane formed when the gene nano-chamber is closed

4-Single-stranded DNA portion supporting a double-stranded DNA membrane

5—Substrate surface

6—Single-stranded DNA fragment for closing the gene nanocabin

Figure 2 is a voltammetric scan curve obtained by cyclic voltammetry of a probe after a target gene is detected by a biosensor based on an active gene molecule nano-cavity.

Figure 3 (a) Typical cyclic voltammetry characteristic curve detected from a 10μηα electrode. The solid line corresponds to the state in which the gene nanochamber is closed with certain observable electronically active molecules, and the dashed line corresponds to the state in which the gene nanochamber is not completely closed. (B) The melting curve observed by the method of detecting the redox signal of the tightly closed molecule corresponds to the wild type, and the dashed line corresponds to the mutant type.

Figure 4 Melting curve obtained by detecting the fluorescence signal of a tightly closed molecule. detailed description

Example 1:

In order to prepare a biosensor based on an active gene nanopod, the device is used to detect a target gene with a sequence of 3'GACTCCTCCCCGGTCT5 '(SEQ ID NO: 1), and the sequence to be detected and the complementary strand portion of the probe hybridize to form a double Strand, constituting the double-stranded DNA membrane of the nanocabin.

Preparation takes the following steps:

(1) The DNA molecular unit used to construct the gene nano-chamber is designed as follows: the single-stranded portion is 10 bases in length (sequence: AAAAAAAAAA (SEQ ID NO: 2)), and the double-stranded portion is 16 bases in length,

5 'AAAAAAAAAACTGAGGAGGGGCCAGA3' (SEQ ID NO: 3).

(2) Prepare a disc gold electrode with a diameter of 1mm as the substrate for the probe of the biosensor.

(3) Modify the 5 ′ end of the DNA molecular unit designed according to step (1) to a thiol-HS, and then prepare the DNA molecular unit into a 500 nM solution with a solvent of 20 mM Tris-HCl buffer containing ImM magnesium ions liquid

(pH = 7.8). At the same time, an equal amount of 3, GACTCCTCCCCGGTCT5 '(SEQ ID NO: 1) sequence is prepared The oligonucleotide is dissolved in the same solvent and mixed with the above solution to hybridize it. The holding time is 1 to 2 hours.

(4) Immerse the prepared disk electrode in step (2) in step (3) to complete the hybridization solution. The maintenance time is 12 ~ 24 hours at room temperature.

(5) Immerse the biosensor probe completed in step (4) in a 30% urea or formaldehyde solution, and shake and elute for 5 to 15 minutes.

(6) Clean the biosensor probe and store it in 20 mM Tris buffer, pH = 8.0. The method of using the biosensor is as follows:

For detection, the hybridization solution was 20 mM Tris buffer, pH = 8.0, containing 1 to 10 μM TH, and hybridized overnight at 37 ° C. After hybridization, rinse the probe in 0.5 M Tris buffer (containing 1 M sodium salt) for 1 to 3 minutes. The detection was then performed in a three-electrode system, with Pt as the counter electrode and Ag-AgCl as the reference electrode. The electrolyte was 20 mM Tris buffer, pH = 7.0, and contained 1 mM magnesium ions. Take out the electrode probe from the hybridization solution, connect the electrode probe as a working electrode to the three-electrode system, and perform linear voltammetry scanning on the probe. The typical results are shown in Figure 2: The solid line indicates that the expected target gene is detected, the dotted line Indicates that the expected target gene was not detected; p in the figure is the magnitude of the peak current, which is proportional to the number of electronically active molecules confined by the gene nanochamber; it can be seen from the figure that the solid line corresponds to the gene nanochamber being closed The state of a certain observable electronically active molecule, the dashed line corresponds to the state in which the gene nano-chamber is not completely closed. Example 2:,

This example demonstrates an experiment using a gene nanocabin to identify a gene sequence with a mismatch. The sequence to be detected with a mismatched base is 5'-TCTGGCC CTCCTCAG-3 '(SEQ ID NO: 4), where X = C corresponds to the wild type and = 0 or D corresponds to the mutant type. The sequence to be detected and the complementary strand portion of the probe hybridize to form a double strand, forming a double-stranded DNA membrane of the nanocabin.

A method of preparing an electrode probe and a method for detecting the gene are as described in "Example 1". The diameter of the electrode was 10 μm. Figure 3 shows the comparison of wild-type and mutant detection results. Figure 3 (a) shows the results of a typical linear voltammetry scan, where the solid line corresponds to the detection of wild-type and the dashed line corresponds to the detection of mutations. Type of situation. The corresponding detection conditions are: the scanning speed is 4 volts per second, the electrolyte is a phosphate buffer solution with a pH of 7.0, and the reporter is Methylene blue. This result indicates that the probe has a sensitive signal response to the wild type, which is reflected in the peak current _p of the cyclic voltammetry curve, but has no clear signal response to the mutant type, and it is difficult to observe the peak current. Figure 3 (b) shows that as the temperature decreases, A change in the signal response of the reporter is detected. The small triangle curve corresponds to the detection result of the wild type, and the small square curve corresponds to the detection result of the mutant type. Because the melting temperature of the target DNA is around 50 ° C, the wild-type curve suddenly decays between 45 ° C and 50 ° C. We can make a comparison: The curve in Figure 3 is the melting curve observed by fluorescent labeling. The dashed line corresponds to the mutant type. The melting curve shown by the reporter molecule confined by the nano-cabin is steeper than this curve. Much more. This is actually the result of the tight closing effect of the nanocabin. As long as the hybridization ratio of the double-stranded DNA membrane is less than 70-80%, the nanocabin is equivalent to being fully dozed, so the wild-type curve decreases near the melting temperature Much faster than the traditional melting curve. These experiments show that the application of the nanocabin to identify single base mutations has better accuracy. Example 3:

This example shows an experiment of identifying a mismatched base by using a nanocell on the surface of SiO ₂ with a fluorescent molecule as a reporter molecule. The sequence to be detected is as described in "Example 2". The sequence to be detected and the complementary strand portion of the probe hybridize to form a double strand, forming a double-stranded DNA membrane of the nanocabin.

The preparation steps of the nano-cavity on the surface of SiO ₂ are as follows:

(1) ultrasonically clean the surface of Si0 ₂ ;

(2) _{_{_{NH 4 OH: H 2 0 2}}} : ¾0 = 1: 1: 5 ratio solution immersion SiO ₂ substrate at 80 ° C, for about 10 minutes;

(3) immerse the Si0 ₂ substrate at 80 ° C. with a ratio solution of HC1: ¾0 ₂ : ¾0 = 1: 1: 5 for about 10 minutes;

(4) has double distilled water, ethanol, acetone, toluene rinse Si0 ₂ substrate surface;

(5) immerse the SiO ₂ substrate with 5% GPTS ((3-Glycidoxypropyl) trimethoxysilane, solvent is toluene) at 80 ° C, and shake for about 10 minutes;

(6) successively with toluene, acetone, distilled water, rinsed with acetone Si0 ₂ substrate surface;

(7) The Si0 ₂ substrate was dried one hour 120 ° C;

(8) immersed in a 0.05M HC1 at 80 ° C Si0 ₂ substrate, shaken for about 3 hours, and then rinsed with double distilled water and of DMF;

(9) Soak the SiO ₂ substrate at room temperature with 5% CDI, Γ-Carbonyldiimidazole, C ₇ H ₆ N ₄ 0, and DMF), shake for about 30 minutes, and then rinse with acetone;

(10) rinse the surface of the Si0 ₂ substrate with Na ₂ C0 ₃ ;

(1 1) Assemble DNA with amino group modified at one end, Na ₂ C0 ₃ / NaHC0 ₃ buffer, temperature 4 ° C, last 12 hour;

Hybridization was performed in Na ₂ C0 ₃ / NaHC0 ₃ buffer at 40 ° F for a duration of 12-24 hours. Detection can be performed under an inverted fluorescence microscope or specialized fluorescence detection equipment. Figure 4 shows the relative changes in fluorescence intensity detected with temperature. In the figure, S indicates the number of bases in the single-stranded portion of the nanocabin. From the figure, a rule similar to "Example 2" can be seen, indicating that the mechanical effect of the nano-cavity is not strongly affected by the substrate or the reporter.

Claims

Claim

1. An active gene molecule nano-chamber, which is characterized in that a plurality of gene molecular units are repeatedly arranged on a solid substrate, and each gene molecular unit includes a double-strand and a single-strand; relative to the solid substrate, the single-strand portion is close to Substrate, the double-stranded part is far from the substrate; one end of the single-stranded part is fixedly connected to the surface of the solid substrate; the double-stranded part of each gene molecular unit is closely arranged to form a dense molecular film, so that the molecular film formed in the double-stranded part Between the surface of the solid substrate and the surface of the nano-scale molecular compartment.

2. The active gene molecule nanocabin according to claim 1, wherein the solid substrate is selected from a metal electrode, a silicon wafer or a quartz glass.

3. The active gene molecule nanocabin according to claim 1 or 2, characterized in that the basic physical parameters of the gene molecular unit are: the length of the single-stranded portion is 5 to 40 bases, and is composed of A or T bases; The length of the chain part is 15 or more.

4. The active gene molecule nanocabin according to claim 1 or 2, wherein the coverage density of the gene molecular unit on the substrate surface is in the range of (5.4 ± 1.8) X 10 ^u .

5. The active gene molecule nanocabin according to claim 3, wherein the coverage density of the gene molecular unit on the substrate surface is in a range of (5.4 ± 1.8) x 10 ¹² .

6. A method for preparing an active gene molecule nano-cabin, comprising the following steps:

(1) selecting an appropriate solid substrate, and determining the chemical group of the solid substrate between the solid substrate and the genetic molecular unit forming the nano-cavity according to the interaction characteristics;

(2) performing necessary pretreatment on the surface portion of the solid substrate to which the genetic molecular unit is to be connected; if the result of step (1) requires surface modification of the solid substrate, a certain chemical modification should be performed on the surface of the solid substrate;

(4) According to the result of step (2), prepare a genetic reagent for the gene molecular unit. If the result of step (1) requires the gene molecular unit to be used to connect one end of a solid substrate for modification, then the gene molecular unit should be Certain chemical modification on the ends;-

(5) One end of a predetermined amount of the gene molecular unit is fixedly connected to the surface of the solid substrate, and its surface density must be sufficient to make the double-stranded part form a molecular film; that is, the active gene molecular nano-chamber is prepared.

7. The method according to claim 6, wherein the substrate selected in step (1) is selected from a metal electrode, a silicon wafer, or quartz glass.

8. The preparation method according to claim 6 or 7, characterized in that the basic physical parameters of the molecular unit of the gene are: the length of the single-stranded portion is 5 to 40 bases, and is composed of A or T bases; Section length is 15 or more.

The preparation method according to claim 6 or 7, characterized in that: the coverage density of the gene molecular unit on the substrate surface is in a range of (5.4 ± 1.8) x 10 ¹² .

10. The preparation method according to claim 8, wherein the coverage density of the gene molecular unit on the substrate surface is in the range of (5.4 ± 1.8) × 10 ¹² .