WO2004061408A2

WO2004061408A2 - Use of a non-specific inhibitor of the 5ht2b receptor for the treatment of prostate cancer

Info

Publication number: WO2004061408A2
Application number: PCT/FR2003/003878
Authority: WO
Inventors: Alain Latil; Laurent Chene; Serge Grisoni; Hugues Bienayme
Original assignee: Urogene
Priority date: 2002-12-26
Filing date: 2003-12-23
Publication date: 2004-07-22
Also published as: AU2003299399A8; FR2849382A1; WO2004060390A3; WO2004061408A3; AU2003303568A8; AU2003303568A1; AU2003299399A1; WO2004060390A2

Abstract

The invention relates to the use of a non-specific inhibitor interacting with the 5HT2B receptor, preferably ritanserin, for the production of a medicament that is intended for the treatment of prostate cancer.

Description

061408

1

USE OF A NON-SPECIFIC HTR2B RECEPTOR INHIBITOR FOR THE TREATMENT OF PROSTATE CANCER

The invention relates to the treatment of prostate cancer. More specifically, the subject of the invention is the use of the HTR2B gene or of the signaling pathway of this receptor for the treatment of prostate cancer.

Prostate cancer is the most common cancer in non-smoking men. Its prevalence for men over 50 is estimated at 15% and 3% of the overall population from this age limit will die. It has become a real public health problem due to the aging of the population. Mortality from prostate cancer is directly related to the stage of discovery of the condition. The treatment methods for prostate cancer depend mainly on the stage at diagnosis and the age of the patient. At an early stage where the disease is still confined to the prostate gland, cancer can be curable by radical prostatectomy or prostatic irradiation. However, in addition to the annoying side effects resulting from these two therapeutic solutions, it has been shown that the benefit of these curative treatments is observed only in patients whose life expectancy is greater than 10 years, due to the often slow evolution of these localized tumors.

The search for effective and low-cost treatments to eradicate this pathology is therefore still relevant.

Prostate cancer is an adenocarcinoma that can be characterized by the transition from paracrine regulation to autocrine regulation of the growth of the epithelial component (Culig and β /., 1996).

The identification of genes expressed differently in prostate malignant tumors and in healthy prostate tissue could thus allow the discovery of key genes in the process of malignant transformation of prostate epithelial cells and more generally of epithelial cells. These genes could then be used not only as diagnostic markers but also as new targets for the therapy of prostate cancer.

The Applicant is more particularly interested in the identification of genes whose expression is positively deregulated in prostate cancers; which suggests an activating function of tumorigenesis by the genes thus identified.

By this approach, the Applicant has demonstrated that the HTR2B gene is overexpressed in prostate tumors from the clinical stage T1 according to the TNM 1997 classification. The latter is based on anatomo-clinical criteria and distinguishes four stages, the stage Tl which corresponds to cancers which are not palpable and not visible by imaging, the T2 stage which corresponds to cancers limited to the prostate (apex and capsule included), the T3 stage which corresponds to cancers whose extension goes beyond the capsule and stage T4 which corresponds to cancers spread to adjacent organs (bladder neck, urethral sphincter, rectum, pelvic wall). When the tumor presents a loco-regional extension and / or distant metastases, palliative treatment is decreed. As prostate cancer is androgen-dependent, the most suitable treatment is androgen withdrawal. The effectiveness of hormone therapy is limited in time; indeed, after a variable delay depending on the tumors, the escape phase appears marked by a resumption of the evolution of the disease. The tumor is then androgen-independent and HTR2B is also overexpressed in these stages.

The HTR2B gene is a 5-hydroxytryptamine receptor more commonly known as serotonin. This family of serotonin receptors belongs to the large family of rhodopsin receptors including, inter alia, the bradykinin, endothelin, neurotensin receptors, etc. The 14 HTR receptors (also called 5-HTR) are listed in 7 sub- types HTR1 to HTR7, and in particular comprise 3 forms HTR2 (HTR2A, HTR2B, and HTR2C). The use of the HTR2B gene for therapeutic indication has already been described in other pathologies (for example migraine or intestinal irritation syndrome), but never for the treatment of prostate cancer.

However, a link has already been established between certain serotonin receptors and cancer treatment.

In fact, the document WO 02/43652 proposes to use psychotropic agents in the treatment of tumors. In particular, reference is made to clozapine, described as an HTR1A antagonist in this document but which seems in reality to be an HTR2A antagonist and a partial HTR1C agonist. This document also proposes to use psychotropic agents such as fluoxetine or paroxetine. These agents are known to act on the reuptake of serotonin and therefore, by their action on the availability of the ligand, affect all the receptors of this family.

Document EP-A-0 0727 206 discloses the use of sertraline in the treatment of certain cancers, for example that of the prostate. Sertraline is however also known to act on the reuptake of serotonin and therefore, like fluoxetine and paroxetine mentioned above, affects all the receptors of this family.

WO 92/04014 establishes a relationship between ritanserin, an inhibitor of HTR1A, HTR2 and HTR7 receptors, and the treatment of cancer in general. However, this document reveals that this molecule is not effective on all types of cancer tissue. In addition, it recommends using as a selection criterion, for the choice of target tumor cells to be treated, the presence of the 5HT1A receptor (also known as 5HT2-like).

However, none of these documents establishes a link between the HTR2B receptor and the inhibition of the proliferation of prostate tumor cells.

The messenger RNA sequence of HTR2B, available in the GENBANK database under the access number NM 000867 (This sequence corresponds to the sequence SEQ ID 1 in the appendix) comprises an ORF (Open Reading Frame) of 1446 bases, which is located between the 56 ^th and the 1501 ^th nucleotide of this sequence. This ORF is surrounded by a 5 'non-coding region of 55 bases and a 3' non-coding region of 290 bases. The ORF encodes a protein of 481 residues (ie a weight of approximately 54 Da), named protein 5HT2B whose sequence is available in the GENBANK database under the access number NM 000868. The sequence of the protein 5HT2B corresponds to the sequence SEQ ID 2 in the appendix.

The protein 5HT2B is a receptor coupled to G proteins (RCPG) comprising 7 transmembrane regions (7TM). The signal comes through Phosphatidylinositol (called second messenger) and Phospholipase C.

As already stated, the Applicant has demonstrated for the first time that the HTR2B gene is overexpressed in prostate tumor cells. In addition, the Applicant has shown that serotonin and BW723C86 (specific agonist of the HTR2B and HTR2C receptors) had an effect on cell proliferation (Example 2 below) and that ritanserin (antagonist HTR1 A, HTR2A, HTR2B, HTR2C and HTR7) was able to block this proliferation via its inhibitory component of HTR2B (Examples 3, 4 and 5 below).

Consequently, the subject of the invention is the use of a non-specific inhibitor interacting with the 5HT2B receptor for the manufacture of a medicament intended for the treatment of prostate cancer.

In the following description and in the claims, by the expressions

"non-specific inhibitor of the 5HT2B receptor" means any molecule having a strong affinity for the 5HT2B receptor, preferably of the order of nM, but also having a significant affinity for other receptors, in particular those of the same family, HTR2. An advantageous inhibitor according to the invention is ritanserin, which has a constant inhibition (Ki) of the order of nM for the HTR2 receptors (1 nM, 1.6 nM, 0.4 nM for, respectively, 5HT2A, 5HT2B and 5HT2C) , 20 nM for 5-HT7 and

> 100 nM for 5HT1A. More generally, it can be: any molecule antagonist of the extracellular or intracellular part of the 5HT2B receptor which can restore in the tumor tissue a biological activity of the 5HT2B protein similar to that encountered in normal tissue, any agonist molecule reverse of the extracellular or intracellular part of the 5HT2B receptor can induce a complete absence of biological activity. - "interacting with the 5HT2B receptor" means any molecule exerting its inhibitory activity on 5HT2B via a direct physical interaction with this receptor. Inhibitors thus acting at another level of this signaling pathway, in particular at the level of availability of ligand (reuptake of serotonin), are thus excluded.

Likewise, the expression “biological activity” denotes the activity induced by the protein 5HT2B on the cellular proliferation of tumor cells and on the invasive capacity of these same cells.

In the case of molecules acting on the intracellular part of the 5HT2B receptor, the inhibitor is synthesized in intracytoplasmic form in order to inhibit its signal.

According to a first embodiment, the inhibitor can consist of a small molecule. In this case, the identification of such molecules can be carried out by high-throughput or targeted screening of libraries of molecules such as chemical or other compounds (phytotheque, etc.) in the presence of the 5HT2B protein by well-known techniques. those skilled in the art, the principle being to identify the molecules which bind to the 5HT2B receptor.

An advantageous screening technique corresponds to binding or "cell-based assays". These tests give rise to the identification of "Hits", that is to say molecules which can cling to 5HT2B with good affinity. This anchoring to 5HT2B cannot be displaced by the natural ligand. These families of "hits" will be tested for their activity on cell proliferation and the invasive capacity of tumor cells and will then undergo chemical optimization in order to give a "lead". The inhibitory molecules can also be obtained by in silico methods after determination of the atomic coordinates of the 5HT2B protein, then screening of a library of chemical molecules.

The modes of administration, the dosages and the galenical forms of the pharmaceutical compositions according to the invention can be determined in the usual way by a person skilled in the art, in particular according to the criteria generally taken into account for the establishment of a therapeutic treatment. adapted to a patient, such as for example the age or body weight of the patient, the seriousness of his general condition, the tolerance to treatment, the side effects observed, etc.

In general, a therapeutically or prophylactically effective amount varying from approximately 1 μg to approximately 1 g per dose can be administered to human adults.

In a second embodiment, the inhibitor is a peptide.

The peptide can be introduced directly into the body or indirectly, via its coding sequence, by transfection of cells.

In this case, the nucleic acid coding for the peptide may be combined with one or more agents which improve the transfection efficiency and / or the stability of said vector and / or the protection of said peptide in vivo against the immune system of the host organism. These substances are widely documented in the literature accessible to those skilled in the art. By way of illustration but not limitation, it may be a chemical agent which modifies cellular permeability such as bupivacaine, liposomes, lipids in particular cationic, nuclear or viral proteins, or microparticles of silica, gold or tungsten. These substances can be used alone or in combination.

The quantity to be used as a drug depends in particular on the construction of nucleic acid itself, on the individual to whom this nucleic acid is administered, on the mode administration and type of formulation and pathology. Generally, a therapeutically or prophylactically effective amount ranging from about 1 g to about 1 g per dose can be administered to human adults.

The inhibitors can be administered by any conventional route of administration such as in particular the parenteral route or these can be injected intradermally or intraepidermally by the technique of the gene gun.

The choice of route of administration depends in particular on the formulation chosen. Targeted administration to the prostate tissue may be particularly advantageous.

The invention also relates to a method of inhibiting the proliferative and invasive capacity of epithelial tumor cells by inhibition of 5HT2B receptors, in particular of prostate epithelial tumor cells, and more broadly a method of treating prostate cancer, according to which: to a patient, an effective amount of the pharmaceutical composition previously described.

The target patient is generally a human being, but the application can also be extended to any mammal if necessary.

The invention also relates to a method of in vitro detection of the tumor character of cells contained in a biological sample, according to which: the mRNAs of the HTR2B gene or the 5HT2B protein are quantified in the cells of the biological sample, - the mRNAs are quantified of the HTR2B gene or the 5HT2B protein in healthy cells, an increase in the amount of mRNA of the HTR2B gene or the 5HT2B protein in the cells of the biological sample compared to the healthy cells marking the tumor character of the biological sample.

In practice, the mRNA of the HTR2B gene corresponds, as identified previously, to the sequence SEQ ID 1. Similarly, the protein 5HT2B corresponds to the sequence SEQ ID 2 identified previously. As a biological sample, a biological sample containing prostate or other cells is used, depending on the cancer to be treated.

The Applicant has in fact found that the tumor character of prostate cells was proven when the quantity of mRNA of the HTR2B gene or the 5HT2B protein in tumor cells contained in a biological sample was at least 1.5 times greater than that found in healthy cells.

The expression "prostate cells" covers, within the meaning of the invention, not only prostate cells but also metastasized cells, in particular cancer cells of prostatic origin having invaded the lymph nodes, the bones.

The quantification of the mRNAs of the HTR2B gene or of the 5HT2B protein in cells, for example of prostatic origin, can be carried out by various techniques known to those skilled in the art.

In particular and in a first embodiment, the quantification of the mRNAs of the HTR2B gene in the cells of the biological sample, for example the prostate cells, is carried out by RT-PCR from RNA extracted from the prostate cells contained in the biological sample. The primers used in this technique are specific for the HTR2B gene, which means that they hybridize specifically with the sequence SEQ ID 1 or its complement under appropriate hybridization conditions usually used by those skilled in the art, preferably in stringent conditions.

The primers used are nucleic acids which comprise at least 17 nucleotides, preferably at least 20 nucleotides and less than 27 nucleotides. Advantageously, they correspond to the sequences SEQ ID 3, SEQ ID 4, SEQ ID 5, SEQ ID 6. The homology of the primers with the above-mentioned sequences is generally determined using sequence analysis software such as OLIGO4S or PRIMER -EXPRESS and the specificity of these sequences is determined by software sequence analysis such as BLASTN (Altschul et al, 1990), FASTA (Pearson et al, 1,888) or DNASIS (Hitachi Software Engineering America Ltd.).

The stringency conditions of a hybridization between two nucleic acids are defined with respect to the temperature at which 50% of the paired strands separate (Tm). For sequences comprising more than 30 bases, Tm is defined by the relationship: Tm = 81.5 + 0.41 (% G + C) + 16.6 log (cation concentration) - 0.63 (% formamide) - (600 / number of bases).

For sequences of length less than 30 bases, Tm can be defined approximately by the relation: Tm = 4 (G + C) + 2 (A + T).

It is commonly accepted by a person skilled in the art that under stringent hybridization conditions, conditions in which the aspecific sequences do not hybridize, the hybridization temperature is approximately from 5 to 30 ° C., preferably from 5 to 10 ° C below Tm, and the hybridization buffers are preferably solutions of high ionic strength such as for example a 6xSSC solution.

In a second embodiment, the quantification of the mRNAs of the HTR2B gene in the cells of the biological sample, for example the prostate cells is carried out by Northern Blot. The probes used are nucleic acids comprising at least 10 nucleotides, preferably at least 20 nucleotides, preferably still at least 100 nucleotides and which specifically hybridize with the sequence SEQ ID 1 or its complement. The appropriate hybridization conditions correspond to the temperature and ionic strength conditions usually used by those skilled in the art, preferably they correspond to stringent conditions as defined above.

The quantification of the 5HT2B protein is carried out by contacting at least one antibody directed specifically against at least 15 aa of SEQ ID2, with the biological sample under conditions allowing the possible formation of specific immunological complexes between the protein. 5HT2B and the said one or more antibodies and by the detection of specific immunological complexes possibly formed (Western Blot).

The antibodies directed specifically against the 5HT2B protein used are monoclonal antibodies (BD Pharmingen).

The invention also relates to a kit for implementing the method described above.

In the embodiment according to which the quantification of the mRNAs of the HTR2B gene is carried out by RT-PCR or Northern Blot, the kit comprises:

the pairs of primers or probes specific for the HTR2B gene, in particular the sequences SEQ ID 3, SEQ ID 4, SEQ ID 5, SEQ ID 6,

- buffers and enzymes necessary for amplification and hybridization reactions.

In the embodiment according to which the quantification of the 5HT2B protein is carried out by immunological test, the kit contains:

- at least one antibody specific for the 5HT2B protein, optionally attached to a support, - means for revealing the formation of specific antigen / antibody complexes between the 5HT2B protein and said antibody and / or means for quantifying these complexes.

The invention will now be described in detail with the aid of the appended figures.

Figure 1 :

Expression of HTR2B at the level of messenger TARN in 18 normal prostate samples, 34 clinically localized prostate tumors (17 pT2 pathological stages and 1 7 pT3 pathological stages) and 9 hormone-independent prostate tumors. The expression of the HTR2B gene in each tissue is expressed relative to the expression of the PP1A gene which is used as endogenous control (as described in the text c / method). The expression of the HTR2B gene was also normalized so that the average expression of the 18 normal prostate samples was equal to 1. Figure 2: Location of the 5HT2B protein by immunohistochemistry. Normal and tumor samples are cut and spread on slides, then fixed with acetone. The slides are incubated with the primary antibody (BD Pharmingen ™), then the secondary anti-mouse antibody coupled to peroxidase (Novostain Universal Quick Kit). The revelation is made with the streptavidin / AEC complex (ZYMED). The cells are then observed using a fluorescence microscope. FIG. 2 represents a normal prostate section (N) and tumor prostate sections (T) on which the hybridization was carried out with the monoclonal antibody 5HT2B (BD Pharmingen ™).

Figure 3: Activation of cell proliferation by serotonin (natural ligand for HTR receptors) and compound BW723C86 (agonist HTR2B and HTR2C).

Cell proliferation is measured 24 hours after treatment with the compounds. Serotonin and BW723C86 are added at the doses shown in the graph. The results are expressed as a percentage of luminescence, reflecting the number of cells relative to the average of the duplicates of control samples, this for each cell line. The standard deviations are obtained by taking into account the values of two independent experiments carried out in duplicate.

Figure 4: Effect of ritanserin (HTR1A, HTR-2 and HTR-7 receptor antagonist)

+/- serotonin or B W723C86 on the proliferation of prostate cells CaHPNIO and

PC3

Cell proliferation is measured five days after treatment with the compounds. Ritanserin (1 μM) is added 2 hours before serotonin or BW723C86 (added at the doses indicated on the graph). The results are expressed as a percentage of luminescence, reflecting the number of cells relative to the average of the duplicates of control samples, this for each cell line. The standard deviations are obtained by taking into account the values of two independent experiments carried out in duplicate.

Figure 5: In vitro effect of different doses of Ritanserine on the proliferation of prostate tumor cells LNCaP and PC3. Cell proliferation is measured six days after treatment with the Ritanserin compound at the doses indicated on the graph. The results are expressed as a percentage of luminescence, reflecting the number of cells relative to the average of the duplicates of control samples, this for each cell line. The standard deviations are obtained by taking into account the values of two independent experiments carried out in duplicate.

Figure 6: In vitro effect of Way 100635 and SB 269970 on the proliferation of PC3 prostate tumor cells. Cell proliferation is measured six days after treatment with the compound Way 100635 (a specific 5-HT1A antagonist) or SB 269970 (a specific 5-HT7 antagonist), at the doses indicated on the graph. The results are expressed as a percentage of luminescence, reflecting the number of cells relative to the average of the duplicates of control samples, this for each cell line. The standard deviations are obtained by taking into account the values of two independent experiments carried out in duplicate.

Figure 7: In vitro effect of RS 127445 (specific antagonist of the HTR2B receptor) on the proliferation of PC3 prostate tumor cells. Cell proliferation is measured seven days after treatment with compound RS 127445 at the doses indicated in the graph. The results are expressed as a percentage of luminescence, reflecting the number of cells relative to the average of the duplicates of control samples, this for each cell line. The standard deviations are obtained by taking into account the values of two independent experiments carried out in duplicate.

Figure 8: In vivo effect of Ritanserine on the proliferation of PC3 prostate tumor cells.

The experiment was carried out on 24 immunocompromised mice (Swiss nude), grafted with a PC3 cell suspension subcutaneously. Treatment begins on day 22 after the transplant when the tumor size reaches 200 mm ³ . The animals are divided into 4 homogeneous groups (π = 6 per group) with tumor sizes between 200 and 250 mm ^" . One of the groups is treated by the vehicle (Ethanol-propylene glycol-water) then that the other group is treated with a dose of 30 mg / kg of Ritanserin. The average tumor volume for mice of the same group (n = 6) is given in mm ³ . Two weekly measurements of tumor size are performed.

Figure 9: Comparison of tumor weights

After excision, the weight of tumors from ectotopic grafts performed in nude mice is analyzed in each group. Inhibition of tumor weight is observed in the group treated with Ritanserin.

Figure 10: Study by immunohistochemistry of the proliferative state of grafted PC3 cells in nude mice

The tumor samples from PC3 cells grafted into nude mice (as described in Example 4) are cut and spread on slides, then fixed with an ethanol (95%) / acetic acid (5%) mixture. The slides are incubated with the primary rabbit monoclonal antibody (Interchim), then the secondary anti-rabbit goat antibody coupled with peroxidase (Santa Cruz). The revelation is made with the streptavidin / AEC complex (ZYMED).

The cells are then observed using a fluorescence microscope.

Figure 10 represents sections of tumors after excision in nude mice not treated (NT) or treated with Ritanserine, on which the hybridization was carried out with the monoclonal antibody Ki67 (Interchim), which reports the state proliferative of cells.

EXAMPLE 1 Analysis of the Expression of the HTR2B Gene in Prostate Tumors and Prostate Tumor Lines

1 / Patients and samples

Forty-three primary prostate tumors were analyzed. The tumor samples are from patients who have had surgery. Thirty four patients had prostate tumors which were clinically localized

[limited to the prostate in 17 cases (pT2), and presenting an extracapsular extension in 17 cases (pT3)], and 9 presented with recurrent hormone-refractory carcinomas of the prostate.

2 / Selected tissues Samples of malignant tumor localized to the prostate gland (stages pT2 and pT3) were obtained by radical prostatectomy, while those for hormone-refractory tumors were obtained by transurethral resection.

A part of the selected tissues was immediately placed in liquid nitrogen for a potential extraction of nucleic acids, while the adjacent sections were stained with H / E (Hematoxyline and Eosine) and examined histologically in the pathology department of the centers investigators.

The pre-selected counterpart (placed in liquid nitrogen) is subject to a new histological examination in the laboratory by an anatomopathologist to confirm the malignancy of the sample.

The malignant areas are then carefully dissected so as to obtain a homogeneous cell population and thus avoid any "dilution" of the genetic modifications specific to the tumors with the nucleic acids of normal and reactive cells present in the same sample.

For these reasons, a sample is considered suitable for molecular studies if all of the epithelial cells are tumor. Histological diagnosis, clinical classification based on the TMM system and Gleason scores (Mellinger et al, 1967; Schroder et al, 1992) were determined in each case during manipulation after surgery. Nine were hormone-refractory tumors whereas after a pathological examination 17 of the 34 clinically localized tumors were pT2 and 17 were pT3. Gleason scores for the selected tumor areas were established before extraction: Gleason 4-6 (7 cases), 7 (21 cases) and 8-10 (15 cases).

In addition to a commercial pool of healthy human prostate tissue (commercial pool; BD Biosciences Clontech: Human Prostate total RNA, Ref: 64108-1), the Non-tumor counterpart of 18 fragments of prostate tissue obtained after radical prostatectomy was used to determine the reference amount of mRNA for the HTR2B gene in healthy prostate tissue. These 18 tissue samples were checked and selected for their absence of tumor foci but also according to their cell composition (epithelium / stroma ratio); indeed, the samples with a major stromal component were excluded due to a probable benign hyperplasia (BPH) of these samples.

3 / RNA extraction and cDNA synthesis / RNA extraction

Total RNAs were extracted from tissue samples using guanidium isothiocyanate, phenol and chloroform (Chomczynski & Sacchi, 1987). The quality of the RNAs was checked by agarose gel electrophoresis and staining with ethidium bromide on the basis of non-degradation of the 18S and 28S RNAs. The 18S and 28S RNA bands were visualized under ultraviolet light.

h / Synthesis of the cDNAs The RNAs underwent reverse transcription in a final volume of 20 μl containing an RT IX buffer (500 mM of each dNTP, 3 mM of MgCl ₂ , 75 mM of KC1, 50 mM of Tris-HCl at pH 8.3), 10 units of Rnasin ^® ribonuclease inhibitor (Promega, Madison, WI), 10 mM dithiothreitol, 50 units of Superscript II Rnase H ^" reverse transcriptase (Gibco BRL, Gaithersburg, MD), 1.5 mM of random hexamers (Pharmacia, Uppsala, Sweden) and 1 μg of total RNA The samples were incubated at 20 ° C for 10 minutes and at 42 ° C for 30 minutes, and reverse transcriptase was inactivated by heating at 99 ° C for 5 minutes and cooling to 5 ° C for 5 minutes.

c / Real-Time RT-PCR cl / Method The quantitative values were obtained from the number of threshold cycles (Ct) from which the increase in the signal corresponding to an exponential amplification of the PCR product begins to be detected (in using a Biosystems PE analysis program). The precise amount of total RNA added to each reaction (based on optical density) and its quality (i.e., the absence of extensive degradation) are both difficult to control. Consequently, the transcripts of the PPIA gene encoding peptidylprolyl isomerase A (cyclophilin A) were quantified as an endogenous RNA control, then each sample was normalized on the basis of its content in transcripts of the PPIA gene.

Numerous genes have been tested as endogenous RNA controls (for example the gene coding for human ribosomal acid phosphoprotein (RPLPO) or the gene coding for the 18S ribosomal subunit), the PPIA gene has been retained because of its constant expression level both in normal prostate tissue, tumor, and prostatic cell lines.

The expression results of the HTR2B gene called N-HTR2B are expressed in difference of N-times between the relative expression of the HTR2B gene compared to the PPIA gene were

. _, _τ „ΔQ sample calculated by the formula N-HTR ₂ B = 2 where the Ct value of the sample was determined by subtracting the average value (each sample was tested twice) of the Ct of the HTR2B gene from the mean Ct value of the PPIA gene. The N-HTR ₂ B values were normalized so that the mean N-HTR2B value of the 18 healthy prostate samples corresponds to a value of 1.

c2 / Primers and products for PCR The primers were chosen with the assistance of the computer programs Oligo 4 (National Biosciences, Plymouth, MN) and Primer express (Perkin-Elmer Applied Biosystems, Foster city, CA). BLASTN research (Altschul et al, 1990) was carried out against dbEST and nr (the non-redundant game of GenBank, EMBL and DDBJ sequence databases) to confirm the total specificity of the nucleotide sequences chosen as primers for genes of interest to quantify. To avoid amplification of contaminating genomic DNA, the primers were chosen so that one of the primers straddles two exons. The nucleotide sequences of the primers are as follows:

HTR2B I ^e 'couple Upper 5' GTGCCATTTCAGTGGATCGTTACATA 3 '(SEQ ID 3) Lower 5'GCCAGTGAGCCAAAGAGCATGA 3' (SEQ ID 4)

2 ^couplem torque

Upper 5'GTGGTGTGGTTAATTTCAATAGGCATT 3 '(SEQ ID 5) Lower 5' CAGCCAGTGAGCCAAAGAGCAT 3 '(SEQ ID 6)

PPIA

Upper 5'- GTC AAC CCC ACC GTG TTC TT-3 '

Lower 5'-CTG CTG TCT TTG GGA CCT TGT -3 '

c3 / PCR amplification All PCR reactions were performed using a Prism ABI 7900 sequence detection system (Perkin-Elmer Applied Biosystems). PCR was performed using the SYBR ^® Green PCR Core reagent kit (Perkin-Elmer Applied Biosystems). The conditions during the thermal cycles include an initial denaturation step at 95 ° C for 10 minutes and 45 cycles including 15 seconds at 95 ° C followed by 1 minute at 65 ° C. The experiments were performed in duplicate for each data point (samples and controls).

4 / Results

Relative expression levels of the HTR2B gene were quantified in 43 malignant prostate tumors, 18 healthy prostate tissues, and in 47 healthy human prostate tissues from a commercial tissue pool (Clontech). The expression levels are determined in the form of relationships between the HTR2B gene and the reference gene PPIA, in order to correct the variations in quantity of RNA. A significant increase in HTR2B expression is observed in prostate tumors compared to normal tissue; 26 (60%) of the 43 tumors showed an increase in expression of at least a factor of 1.5 (see Figure 1).

The results obtained on prostate tissue are collated in Table 1.

Table 1

HTR2B is expressed in the prostate tumor lines LNCaP and PC3 (American Tissue Type Culture Collection (Rockville, MD, USA) and in the epithelial prostatic line, immortalized by HPV (CaHPVlO).

EXAMPLE 2 Proliferation Tests with Serotonin and with BW723C86, and Inhibition by Ritanserin

1 / Proliferation test

This test aims to demonstrate the proliferative effect of serotonin on tumor cells and then the opposite effect when 5HT2B is blocked. The cells are seeded in 96-well plates. PC3 cells (endogenous expression of serotonin (= 204.1 fmol / cell) are seeded at the rate of 2000 cells per well in 100 μl of RMP1 medium containing 5% of SFV and glutamine (ImM). CaHPVlO cells (expression endogenous serotonin 15.6 fmol / cell) are seeded at the rate of 5,000 cells per well in 100 μl of RPMI medium containing 10% of SVF, glutamine (I mM) and EGF (10 ng / μl). medium of the cells is changed, they are placed in the presence of their respective mediums but without serum Serotonin (Sigma) and BW723C86 (Sigma) are added at the indicated concentration. are treated with Ritanserine (Sigma), this compound is added 2 hours before serotonin and BW723C86. The Ritanserine being resuspended in DMSO, the cells are ultimately in contact with 1% DMSO, for the control well the cells are placed in the presence of medium also containing 1% DMSO. Each experimental condition is carried out in duplicate. Cell proliferation is measured by the Cell Titer Glo kit (Promega). The protocol is that recommended by the manufacturer. Briefly 100 μl of reconstituted buffer is added to each well. The plates are placed for 2 min with gentle shaking, then incubated for 10 min at room temperature. The luminescent signal measured is proportional to the number of living cells. The results indicated are calculated as a percentage of luminescence relative to the control well for each experiment.

2 / Results a / Effect on the proliferation of serotonin and BW723C86 The CaHPVl O and PC3 cells are treated with increasing concentrations of serotonin and BW723C86 (FIG. 3). Cell proliferation is measured

24 hours after treatment. The results shown are the average of two independent experiments. A proliferation increase of 10 to 20% is observed for CaHPV10 cells at doses ranging from 10 ^"5 to 10 ^{" 9} M of serotonin. When the cells are treated with the compound BW723C86, the increase in proliferation is greater. The dose effect appears and reaches its maximum with a 25% increase in proliferation at the concentration of 10 ^"7 M of BW723C86. For PC3 cells, a dose effect of serotonin is observed on stimulation of proliferation which is at its maximum (between 35 and 45% increase), at concentrations of 10 ^"7 M and 10 ^{" 6} M of serotonin. The effect of BW723C86 is most significant from a dose of at least

10 ^"7 M, resulting in an increase in cell proliferation of 20%.

h / Inhibition of 5HT2B The effect of Ritanserine is tested on the proliferation of CaHPVlO and PC3 cells

(figure 4). Cell proliferation is measured five days after treatment. The results shown are from an experiment representative of three independent experiments. The values of the graph are the average of duplicates made in the same experimental conditions. Ritanserine, in the absence of any stimulation, causes a 20% decrease in proliferation on CaHPVlO and PC3 cells. The CaHPVlO cells see their proliferation stimulated by 10% by serotonin and by 20% by BW723C86 when these agonists are added at the concentration of 10 ^"8 M. A similar stimulation of the order of 10 to 20%> is observed when PC3 cells are treated with serotonin or BW723C86 When Ritanserin is added 2 hours before serotonin or BW723C86 10-20% _> inhibition of proliferation is observed for both CaHPV10 and PC3. more important is observed in the case of PC3 cells stimulated by BW723C86 at 10 ^"9 M, Ritanserine inhibiting the proliferation of meadows by 40%>.

EXAMPLE 3 Inhibition of Proliferation of Prostate Cancer Cells by Ritanserin (C ₇ H ₂₅ FN ₃ OS)

1 / Proliferation inhibition test

This test aims to demonstrate the anti-proliferative effect of Ritanserine on tumor cells. As in Example 2, the cells are seeded in 96-well culture plates in 10 ml of RPMI 1640 supplemented with 5% FCS and ImM glutamine per well. Twenty four hours after seeding, the cells are treated with Ritanserin. The proliferation is measured after 4 and 6 days of treatment with Ritanserine. The prostate tumor cells LNCaP, and PC3 are treated with increasing concentrations of Ritanserin (5, 25 and 50 μM). In some wells (controls), only the solvent of Ritanserine is added. The revelation is made by adding 10 μl of Uptiblue (Interchim) to each well. After a 3 hour incubation at 37 ° C, the fluorescence is measured (Ex560 / Em590). The fluorescence is proportional to the number of living cells in the wells. In order to obtain an index of the proliferation of the cells, the fluorescence emitted in the wells having undergone the treatment with Ritanserine is related to the fluorescence emitted in the control wells. The results are given as a percentage of proliferation relative to the control. 2 / Results

The effect of Ritanserine is tested on the proliferation of prostate tumor cells LNCaP and PC3. The specificity of Ritanserine for the various 5HT receptors is given by the inhibition constant (Ki) which is of the order of nM for the receptors (1 nM, 1.6 nM, 0.4 nM for 5HT2A, 5HT2B and 5HT2C respectively). that it is 20 nM for 5-HT7 and> 100 for 5HT1A. Cell proliferation is measured on day 4 and 6 after treatment. Under the experimental conditions described above, on day 6, a dose of 10 μM of Ritanserine leads to a reduction in the proliferation of LNCaP and PC3 cells by 50% (IC50). A dose effect of Ritanserine on the inhibition of proliferation is observed with, from the dose of 25 μM, an inhibition of the order of 80% both on LNCaP and PC3. The results are shown in Figure 5. The values in the graph are the average of duplicates made under the same experimental conditions.

EXAMPLE 4 Inhibition of the Proliferation of Prostate Cancer Cells Treated with Way 100635, SB 269970 or RS127445

1 / Proliferation inhibition test As in Example 2, the cells are seeded in 96-well culture plates in 100 μl of RPMI 1640 supplemented with 5% FCS and ImM glutamine per well. Twenty-four hours after seeding, the cells are treated with the test compound.

Proliferation is measured after 4 and 6 days of treatment with Way 100635 or SB 269970. Prostate PC3 cells are treated with increasing concentrations (5, 25 and 50 μM) of Way 100635 (a specific 5-HT1A antagonist) or SB 269970 (a specific 5-HT7 antagonist). In some wells (controls), only the solvent for the compounds is added. The proliferation is measured after 1, 3, 5 and 7 days of treatment with RS127445 (a specific 5-HT2B antagonist). For the proliferation experiments with reading at 5 and 7 days, the cells are seeded at lower cell densities than those used for reading at 1, 2, and 3 days in order to avoid that the cells arrive at confluence. On the day of treatment, the medium is replaced by fresh culture medium in which the compound has been diluted to the concentration to be tested. The PC3 prostate cells are treated with increasing concentrations of RS 127445 (1, 10, 50 and 100 μM). In some wells (controls), only the solvent of RS127445 is added. For treatments at 5 and 7 days, the medium is also renewed at 4 days with fresh medium containing the compound at the concentration tested.

The revelation is made by adding 1 μl of Uptiblue (Interchim) to each well. After a 3 hour incubation at 37 ° C, the fluorescence is measured (Ex560 / Em590). The fluorescence is proportional to the number of living cells in the wells. In order to obtain an index of cell proliferation, the fluorescence emitted in the wells which have undergone the treatment with the test compound is related to the fluorescence emitted in the control wells. The results are given as a percentage of proliferation relative to the control.

2 / Results The Way 100635 effect, an antagonist compound specific for the 5HT1A receptor, and of SB 269970, an antagonist compound specific for the 5HT7 receptor, is tested on the proliferation of PC3 cells. The specificity of Way 100635 for the 5HT1A receptor is given by the inhibition constant (Ki) which is less than 1nM for this receptor while no affinity is reported for the other 5-HT receptors. The specificity of SB 269970 for the 5HT7 receptor is given by the inhibition constant (Ki) which is 1.2 nM for this receptor while it is> 100 for 5HT1A, 5HT2A, 5HT2B and 5HT2C. Cell proliferation is measured on day 4 and 6 after treatment. Under the experimental conditions previously described, on day 6 no inhibition of the proliferation of PC3 cells by the compounds Way 100635 and SB 269970 at doses of 5, 25 and 50 μM is observed (FIG. 6).

The lack of effect of these two compounds clearly indicates that the inhibition of the proliferation of prostate cells LNCaP and PC3 treated with Ritanserine is mediated by the 5-HT2 receptors.

The effect of RS127445, a specific antagonist compound for the 5HT2B receptor, is tested on the proliferation of PC3 cells. The specificity of RS127445 for the 5HT2B receptor is given by the inhibition constant (Ki) which is 1nM for this receptor whereas it is 4000, 500, 400,> 300 for respectively 5HT1A, 5HT2A, 5HT2C and 5HT7. Cell proliferation is measured on day 1, 3, 5, 7 after treatment. Under the experimental conditions previously described, on day 7 a dose of 25 μM of RS 127445 leads to a reduction in the proliferation of the cells by 50% o (IC50). A dose effect of RS 127445 on the inhibition of proliferation is observed: the inhibition of proliferation is all the greater the higher the dose of RS127445. The most important effect is observed on day 7 with a dose of 100 μM. Under these conditions, the inhibition is 100% for the PC3 line. These results are reported in Figure 7. They indicate that, among the 5-HT2 receptors, the 5-HT2B receptor plays a predominant role in the proliferation of prostate cancer cells, largely affected by the presence of a specific inhibitor of this receptor .

EXAMPLE 5 Inhibition by Ritanserin of the Growth of the PC3 Tumor Implanted in Nude Immunocompromised Mice

1) Materials and methods

The experiment was carried out on immunocompromised mice (Swiss nude) adults weighing approximately 30 g (5 weeks of age on arrival). Throughout the experimental period, these animals were kept under standard animal facility conditions (light cycle 12h / 12h, granules and water ad libitum and containment level P2). Twenty four nude mice were grafted with a PC3 cell suspension (2.10 ° cells + Matrigel) subcutaneously on the right flank. The measurement of tumor size and body weight are monitored periodically. Treatment begins on day 22 after the transplant when the tumor size reaches 200 mm ³ . The animals are divided into 2 homogeneous groups (n = 6 per group) with tumor sizes between 200 and 250 mm ³ .

Homogeneity is checked by taking into account the group mean and standard deviation.

A first in vivo study carried out showed a 32% inhibition of the tumor growth slope in the mice of this group treated with a dose of 15 mg / kg of Ritanserine in comparison with the control group treated by the vehicle. Given these results and the good tolerance of the mice treated with this compound, a group of mice (n = 6) is treated with a dose of 30 mg / kg. The other group (control) is treated by the vehicle (Ethanol-propylene glycol-water). The treatment consists of 5 applications per week in the intraperitoneal cavity (ip) and this for 5 weeks with an injection volume of 200 μl / mouse: Two weekly measurements of tumor size, body weight and food consumption animals are performed.

2 / Results a-Animal health: The weight of the mice and food intake A loss of body weight of 2 grams was observed during the first week of treatment with Ritanserine and this for all the doses used. However, this weight loss stabilized thereafter during the treatment and did not vary until 5 weeks of treatment. Equivalent weight loss was also observed in the group of untreated mice reflecting the development of the disease. In addition, this weight loss did not affect the health of the experimental animals; this is confirmed by the appearance of the animals and their food intake.

b-Evolution of tumor growth: ritanserin shows significant growth inhibition of heterotopic xenophobic PC3 tumors in nude mice from the ^9th day of treatment. Treatment with ritanserin significantly reduced the development of tumors in animals treated with the vehicle (control). In the last days of treatment this compound allowed an increasingly large reduction in tumor size (Figure 8) as well as an increase in food intake and body weight representative of the improvement in animal health. . This statistical study uses ANOVA and the Tukey test for multiple comparisons made on the average, n = 6 (± SEM) of the tumor growth of each experimental group. The comparison of tumor growth between the groups corresponds to 13 measurements of tumor volume (2 per week) and 35 days of treatment.

c-Comparison of tumor weights:

Inhibition of the weight of the tumor is observed in the treated groups; a reduction of around 55% in the average weight of tumors treated with Ritanserin is observed (Figure 9). These results are in agreement with the observations on the evolution of tumor growth.

proliferative state of PC3 cells grafted in nude mice by immunohistochemistry:

The tumor samples from PC3 cells grafted in nude mice are cut and spread on slides, then fixed with an ethanol (95%) / acetic acid (5%) mixture. The slides are incubated with the primary rabbit monoclonal antibody (Interchim), then the secondary anti-rabbit goat antibody coupled with peroxidase (Santa Cruz). The revelation is made with the streptavidin / AEC complex (ZYMED). The cells are then observed using a fluorescence microscope. Nude mice not treated with Ritanserine present tumors whose percentage of ki67-labeled nuclei, correlated to the number of proliferating cells, is around 10%> which is in agreement with the literature. The proliferative state of the grafted PC3 cells in nude mice treated with Ritanserin present tumors whose percentage of nuclei marked with ki67 is close to 0% _> , suggesting that total proliferation of prostate cancer cells treated with ritanserin. These results confirm the inhibition of the proliferation of prostate cells by Ritanserine, results observed in vivo by a reduction in the size of the tumor in nude mice. An example of the results obtained is given in Figure 10.

REFERENCES

1. Culig Z., Hobisch A., Cronauer M., Radmayr C., Hittmair A., Zhang J., Thurnher M., Bartsch G., Klocker H. Regulation of prostatic growth and function by peptide growth factors. The Prostate (1996), 28 (6): 392-405. 2. Altschul S. F., W. Gish, W. Miller, E.W. Myers, and DJ. Lipman Basic local alignment search tool. J. Mol. Biol. (1990): 215, 403-410.

3. Mellinger GT., Gleason D. & Bailar JIII. J. Urol (1961), 97: 331-337.

4. Schroder FH., Hermanek P., Denis L., Fair WR., Gospodarowicz MK., Pavone-Macaluso M., The Prostate (1992), Suppl. 4: 129-138. 5. Chomczynski & Sacchi. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. (1987),

162 (1): 156-159. 6. Pearson W.R., Lipman D.J .; Improved tools for biological sequence comparison.

Proc. Natl. Acad. Sci. U.S.A. (1988), 85: 2444-2448. 7. Sambrook J., Fritsch, E.F., Maniatis, T. Molecular Cloning. A Laboratory

Manual. Second Edition. Ed. Chris Nolan. Cold Spring Harbor Laboratory Press

(USA).

Claims

1 / Use of a non-specific inhibitor interacting with the 5HT2B receptor for the manufacture of a medicament intended for the treatment of prostate cancer.

2 / Use according to claim 1, characterized in that the inhibitor is ritanserin.

3 / Use according to claim 1, characterized in that the inhibitor is an antagonist of the extracellular or intracellular part of the 5HT2B receptor.

4 / Use according to claim 1, characterized in that the inhibitor is an inverse agonist of the extracellular or intracellular part of the 5HT2B receptor.

5 / Use according to claim 1, characterized in that the inhibitor is obtained by high throughput or targeted screening of libraries of chemical or other molecules (phytotheque ..) in the presence of the protein 5HT2B.

6 / Use according to claim 1, characterized in that the inhibitor is a peptide.