WO2004050891A1

WO2004050891A1 - Method of producing protein

Info

Publication number: WO2004050891A1
Application number: PCT/JP2003/015593
Authority: WO
Inventors: Keiko Matsubara
Original assignee: Zoegene Corporation
Priority date: 2002-12-05
Filing date: 2003-12-05
Publication date: 2004-06-17
Also published as: JP2006129702A; AU2003289202A1

Abstract

It is intended to provide a method of synthesizing a protein at a high synthesis efficiency by which a translation reaction can be continued for a long time in a cell-free protein synthesis system, which is applicable to a large-scaled reaction system and which can be carried out by using a simple apparatus. It is also intended to provide a method of performing the synthesis and purification of a protein in a single container after the completion of the synthesis reaction as described above. Moreover, it is intended to provide a reagent kit and an apparatus for carrying out these methods. Namely, a method of producing a target protein with the use of a cell-free protein synthesis system characterized in that the protein is synthesized by bringing a liquid mixture for a transcription/translation reaction or a translation reaction into contact, via an interface, with a gel or a sol containing a substance to be consumed in the transcription/translation reaction or the translation reaction in both of its matrix and its exclusion volume.

Description

Specification

Technology for protein production

The present invention relates to a method for producing a target protein using a cell-free protein synthesis system. More specifically, the present invention relates to a gel or sol containing a substance consumed in a transcription, translation reaction or translation reaction (hereinafter sometimes referred to as “protein synthesis reaction”) in both its matrix and excluded volume. A method for performing protein synthesis by bringing a transcription / translation reaction or translation reaction solution into contact with an interface, a reagent kit for performing the method, and a method for performing the method. And related devices. Background art

In a cell-free protein synthesis reaction, when performing a protein synthesis reaction in a batch, there is a problem that the reaction is stopped halfway and a sufficient amount of protein synthesis cannot be obtained. Therefore, Spirin et al. Were able to continuously supply raw materials, amino acids, ATP, and GTP to cell-free protein synthesis reaction solutions prepared by conventional methods through ultrafiltration membranes, and were synthesized. By removing the target protein from the reaction solution (continuous cell-free protein synthesis reaction), we succeeded in maintaining the reaction time for more than 20 hours, and achieved a protein synthesis yield more than 20 times that of the past. (AS Spirin, et al., (1998), Science, 242, 1162-1164; hereinafter, this may be referred to as "dialysis method").

Endo et al. Reported that the synthesis reaction solution (reaction phase) containing biological extracts and the substrate * energy source solution (feed phase) were free-diffused through the direct contact interface between the two phases, and the substrate As the energy source molecules are continuously supplied to the translation reaction system in the reaction phase, the duration of the synthesis reaction is extended by diluting and excluding by-products generated in the reaction phase into the supply phase. Thus, a diffusion continuous batch-based cell-free protein synthesis method based on the principle of increasing the efficiency of the synthesis reaction has been proposed (WO 02/4939). "). This way In, there was a drawback that the operation was relatively difficult because it was necessary to layer both phases so that the liquid contact interface between the reaction phase and the supply phase would not be disturbed. In addition, if the area of the interface is large or the amount of the solution to be overlaid is large, the interface is difficult to be formed. Therefore, the method is particularly suitable when a small amount of a synthesis reaction solution is used to synthesize a small amount of protein. Furthermore, the synthesis reaction inhibition product produced by the protein synthesis reaction cannot be separated from the protein synthesis product (polysome), so that the synthesis amount is low compared with the dialysis method.

Further, according to Endo et al., In a cell-free protein synthesis system, a reaction vessel used in the synthesis system is prepared by a carrier capable of molecular sieving, and the material involved in the cell-free protein synthesis system is transferred to the mobile phase. A method of recovering a synthetic protein as a result of performing a cell-free protein synthesis reaction during the development has been proposed (Japanese Patent Application Laid-Open No. 2000-316595). The present method is advantageous in that the synthesized protein is separated and purified in the carrier while having the same protein synthesis ability as the above-mentioned dialysis method and overlay method. However, it was necessary to continuously add the feed solution as a developing solution to the carrier, and the structure of the reaction apparatus was not always suitable for automation.

Furthermore, Japanese Patent Application Laid-Open No. 2003-525256 16 discloses that the low-molecular components (supply) of the reaction mixture, in particular, the substrate consumed by the reaction, are sufficiently homogeneously distributed in the entire reactor space. In the reactor space, only the excluded volume of the matrix can be used for polymer components, especially catalytically active reactants (reactants) in the reactor space, and only the conversion of the substrate can be performed in the excluded volume of the matrix. Discloses a method for performing protein synthesis. In this method, it is necessary to fill the excluded volume of the matrix with the reaction solution.Therefore, the process of swelling the matrix with the supply solution and exchanging with the reaction solution, specifically, supplying the reaction solution with a pump, After adding the reaction solution, a step of stirring these components in the column is essential. Therefore, the structure of the reactor used in this method was not necessarily appropriate for automation.

Cell-free protein synthesis is a technology that requires automation in certain aspects. For this purpose, there is a demand for a synthesis method that can maintain high protein synthesis ability with a simple synthesizer and that can be applied to a reaction system having a large capacity. Had been. Disclosure of the invention

A first object of the present invention is to provide a cell-free protein synthesis system in which the translation reaction lasts for a long time, is applicable to a reaction system having a large capacity, and has a protein synthesis ability that can be performed by a simple synthesizer. It is to provide a high cell-free protein synthesis method.

A second object of the present invention is to provide a method for separating and purifying a target protein synthesized in the same container after a transcription / translation reaction or a translation reaction.

A third object of the present invention is to provide a reagent kit for performing the protein synthesis reaction, and a fourth object of the present invention is to provide an apparatus for producing a target protein using the protein synthesis reaction system. It is to be.

The present inventors have conducted intensive studies to achieve the above object of the present invention. As a result, a gel or sol containing a substance consumed in a transcription / translation reaction or a translation reaction in both its matrix and excluded volume, According to protein synthesis by contacting a transcription / translation reaction or translation reaction solution with an interface, the protein synthesis reaction is maintained for a long time, and a gel filtration agent is used as a matrix. According to this, it was found that the target protein synthesized by the gel filtration agent was separated and purified.

That is, according to the present invention, (1) a method for producing a target protein using a cell-free protein synthesis system, wherein a substance consumed in a transcription / translation reaction or a translation reaction is reduced in both the matrix and the excluded volume. A method comprising performing protein synthesis by bringing a transcription / translation reaction or a translation reaction solution into contact with the gel or sol contained in the above with an interface.

(2) The method according to (1), wherein a substance consumed in a transcription / translation reaction or a translation reaction is supplied to the gel or sol via a dialysis membrane.

(3) The method according to the above (1) or (2), wherein the gel or sol comprises a polymer substance as a constituent.

(4) The high molecular substance is a gel filtration agent, and after the transcription / translation reaction or the translation reaction, Characterized in that the synthesized target protein is separated and purified in the same container.

The method according to any one of (1) to (3),

(5) The method according to (3) or (4) above, wherein the polymer substance has an affinity for the target protein or a partial polypeptide thereof.

(6) The method according to any one of (1) to (3) above, wherein the gel comprises agarose as a constituent element.

(7) The method according to any one of (1) to (6) above, wherein the target protein is a poorly water-soluble protein.

(8) For use in the method according to any one of (1) to (7) above, wherein the substance consumed in the transcription / translation reaction or translation reaction of the cell-free protein synthesis system is contained in both the matrix and the excluded volume. Gel or sol,

(9) Cell-free protein synthesis by the method according to any one of (1) to (7), including at least a gel or sol component and an aqueous solution containing a substance consumed in a translation reaction, or a mixture thereof. A reagent kit for producing the target protein in the system,

(10) Transfer the transcription / translation reaction or translation reaction solution to a gel or sol containing at least the substance consumed in the transcription / translation reaction or translation reaction of the cell-free protein synthesis system in both its matrix and the excluded volume. An apparatus for producing a target protein using a cell-free protein synthesis system, which comprises means for performing protein synthesis by contacting with

Is provided. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a graph showing the amount of GST-GFP protein synthesized by the method of the present invention, the dialysis cup method, and the overlay method.

FIG. 2 is a graph showing the amount of GST-GFP protein synthesized by the method of the present invention and the overlay method.

FIG. 3 is an electrophoresis photograph showing the GST-PK7 protein synthesized by the method of the present invention and the dialysis method. FIG. 4 is a graph showing the amount of solubilized PK7-GST protein synthesized by the method of the present invention, the dialysis cup method, and the overlay method.

FIG. 5 is a graph showing the amount of GST-GFP protein synthesized by the method of the present invention and the method of performing a protein synthesis reaction in an excluded volume. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments of the present invention will be described in more detail.

(1) Cell-free protein synthesis system

The present invention relates to a method for producing a target protein using a cell-free protein synthesis system, comprising: a gel or a sol containing a substance consumed in a transcription / translation reaction or a translation reaction in both its matrix and excluded volume; This method is characterized in that protein synthesis is performed by bringing a transcription / translation reaction or a translation reaction solution into contact with an interface.

In the present invention, the cell-free protein synthesis system refers to a method for synthesizing a target protein encoded by a gene without using living cells. Specifically, water-soluble components containing substances required for protein synthesis such as ribosomes and tRNAs are extracted from cells, and translation type I, RNA polymerase, transcription / translation substrates, energy sources, etc. are further added. A reaction solution for transcription / translation or translation (hereinafter sometimes referred to as a “reaction solution”) is prepared and cultured in an artificial container for protein synthesis.

The cell extract used in the cell-free protein synthesis system includes those extracted from cells such as Escherichia coli, plant seed germ, and egret reticulocytes. As a method for preparing the cell extract, a method known per se or a commercially available method can be used. Specifically, the E. coli extract is prepared by the method described in Pratt, J., et al., Transcription and Translation, Haraes, 179-209, BD & Higgins, SJ eds., IRL Press, 0xford (1984). It can be prepared according to it. As a commercially available cell-free protein synthesis system or cell extract, those derived from Escherichia coli include E. coli S30 extract system (manufactured by Promega) and RTS 500 Rapid Translation System (manufactured by Roche). Origin is Rabbit Reticulocyte Lysate Sytera (manufactured by Promega) and the like, and those derived from wheat germ include PRO TEIOS ™ (manufactured by T0Y0B0). Among them, it is preferable to use a system of an embryo extract of a plant seed, and as a plant seed, a plant of the grass family such as wheat, oats, and rice is preferable. As the cell-free synthesis system used in the present invention, a protein synthesis system having high polyribosome-forming activity is preferable, and therefore, a system using a wheat germ extract is preferable. Methods for preparing a wheat germ extract include, for example, Johnston, FB et al., Nature, 179, 160-161 (1957), or Erickson, AH et al., (1996) Meth. In Enzymol., 96, 38- 50 and the like can be used. Furthermore, treatments such as removing endosperm containing translation inhibitory factors contained in the extract, for example, tritin, thionine, nuclease, and the like (Japanese Patent Application Laid-Open No. 2000-236896), and It is also preferable to carry out a treatment for suppressing the activation of the translation inhibitory factor (Japanese Patent Application Laid-Open No. Hei 7-23084). The cell extract thus obtained can be used in a protein synthesis system by a method similar to the conventional method.

The composition of the reaction solution includes the above-mentioned cell extract, translation type, substrate amino acid, energy source, various ions, buffer, ATP regeneration system, nuclease inhibitor, tRM, reducing agent, polyethylene glycol, 3 ' , 5, 1 cAMP, folate, antibacterial agents, etc. are included. When DNA is used as the type I translation, it may further contain a substrate for RA synthesis required for the transcription reaction, RNA polymerase, and the like. These are prepared by appropriately selecting according to the target protein and the type of the protein synthesis system to be used. The amino acids serving as the substrate are 20 kinds of amino acids constituting the protein, and each is suitably in the range of 0.05 to 1.0 mM. Examples of the energy source include ATP and GTP, and it is preferable to add 1.0 to 1.5 mM of ATP and 0.2 to 0.3 mM of GTP. Examples of the various ions and their appropriate concentrations in the reaction solution include 60 to 150 mM potassium acetate, and 1 to 10 mM magnesium acetate. As the buffer, 15 to 5 OmM Hepes-K0H, 10 to 5 OmM Tris-acetic acid, or 15 to 3 OmM Hepes and 15 to 3 OmM Hepes-Na are used. Can be The ATP regeneration system may be a combination of phosphoenol pyruvate and pyruvate kinase, or 12 to 20 mM creatine phosphate (creatine phosphate) and 0.2 to 1.6. Ug / jul creatine kinase combinations. Nuclear Examples of the acid-degrading enzyme inhibitors include ribonuclease inhibitors of 0.01 to 3.0 U per μl of the reaction solution, and nuclease inhibitors of 0.01 to 3 U.

Among them, specific examples of ribonuclease inhibitors include human placenta-derived RNase inhibitor (T0Y0B0, etc.) and the like. tRA can be obtained by the method described in Moniter, R., et al., Biochim. Biophys. Acta., 43, 1 (1960) or the like, or a commercially available product can be used. Examples of the reducing agent include dithiothreitol of 0.1 to 5.0 niM. Examples of the antibacterial agent include 0.001 to 0.01% sodium azide, and 0.1 to 0.2 mg / ml ampicillin. As the nucleic acid stabilizer, 0.3 to 0.5 mM spermidine or the like is used. Furthermore, as the RNA polymerase, those suitable for one of the promoters included in translation type I are used. Specifically, for example, SP6RA polymerase ゃ T7 RNA polymerase and the like can be used. These addition amounts are appropriately selected to prepare a synthesis reaction solution. The target protein synthesis reaction is carried out by culturing the above reaction solution in an appropriate container at an appropriate temperature for an appropriate time. The target protein may be any protein that can be synthesized in a cell-free protein synthesis system. However, when a poorly water-soluble protein is synthesized by the method of the present invention, it becomes more water-soluble than other methods. The effect is high.

When a wheat germ extract is used, the culture is carried out at a temperature of 10 to 40 ° C, preferably 15 to 30 ° C, and more preferably 20 to 26 ° C. The reaction time is not particularly limited as long as protein synthesis is performed. However, when a system for supplying a substance consumed in the transcription / translation reaction or the translation reaction is used as in the present invention, the reaction lasts up to about 75 hours. (2) Preparation of gel or sol containing feed

In the present invention, when performing the above-mentioned cell-free protein synthesis, a substance consumed in a transcription / translation reaction or a translation reaction (in this specification, this may be referred to as a “supply”) is referred to as a matrix and a matrix. Protein synthesis is performed by bringing a transcription / translation reaction or translation reaction solution into contact with a gel or a zole contained in both excluded volumes with an interface.

Substances (supply) consumed in the transcription / translation reaction or translation reaction It means all substances consumed in the cell-free protein synthesis reaction, but the gel or sol of the present invention does not need to include all of them, and can be appropriately selected according to each reaction system. )), And the like. The amount of the supply contained in the gel or the sol may be an amount sufficient to perform the target protein synthesis reaction when performing the protein synthesis reaction using this. Examples of a method for preparing a gel or sol containing the feed in both the matrix and the excluded volume include, for example, a solution containing the gel or sol containing the feed (hereinafter, this may be referred to as a “feed solution”). A method for equilibration is given. After equilibration, the feed liquid in the supernatant portion that exceeds the volume of the gel or sol is preferably removed so that the reaction solution does not become thin because the reaction solution comes into contact with the interface. ,. When agarose gel or the like is used as the gel, a method of dissolving agarose, cooling to an appropriate temperature, adding a concentrated supply solution thereto, and further cooling is used. As the supply solution in this case, a solution containing a substance consumed in the protein synthesis reaction in the cell-free protein synthesis system of the above (1) at almost the same concentration as the reaction solution is preferably used.

Specifically, when the protein synthesis reaction in the cell-free protein synthesis system is only a translation reaction, 20 L-amino acids of 0.25 to 0.4 mM, ATP of 1.0 to 1.5 mM, 2 to 0.3 mM GTP, 60 to: I 50 mM potassium acetate,:! To 1 OmM magnesium acetate, phosphoenolpyruvate and pyruvate kinase, or 12.0 to 20. OraM creatine phosphate (creatine phosphate) and 0.2 to 1.6

Creatine kinase, 0.3-0.5 raM perimedin, 0.1-5. OraM dithiothreitol, feed solution containing 0.3-3.0 U ribonuclease inhibitor per 1 jul 15-5 OmM Hepes-K0H, or 10-5 OraM Tris-acetic acid solution may include 15-3 OmM Hepes and 15-3 OmM Hepes-Na.

The gel or sol used in the present invention means that the above-mentioned feed can be contained in both the matrix and the excluded volume, and the feed and the synthesized object are formed between the feed and the reaction solution having an interface. Any substance may be used as long as proteins, degradation products, and the like can be freely diffused. Specifically, those with polymer substances as constituent elements Is mentioned. Here, genole refers to a state in which the above components have lost independent fluidity and are aggregated and solidified.A sol is a state in which the components are dispersed in a liquid and exhibit fluidity. A thing. Preferred examples of the gel used in the present invention include those having agarose or acrylamide as a constituent element. Preferred examples of the sol include those having a gel filtration agent, an affinity gel agent, magnetic beads, and the like as constituent elements.

In the present specification, the matrix means a space occupied by gel or sol constituent molecules among spaces occupied by gel or sol. The excluded volume means the space occupied by the gel or sol other than the matrix.

As a method for preparing the gel or sol containing the feed, a gel or sol having the above-mentioned properties and having an amount sufficient for carrying out the cell-free protein synthesis reaction of (1) above in both the force, the matrix and the excluded volume is required. There is no particular limitation as long as the method contains the feed.

Hereinafter, a case where agarose gel is used as an example of the gel will be specifically described. Agarose is selected so as to be purified to such an extent that it does not affect the above-mentioned protein synthesis reaction, and to maintain a suitable strength that does not dissolve when a cell-free protein synthesis reaction is performed under the conditions described below. Specifically, Agaroses (manufactured by Nippon Gene) and the like are preferably used. As a method for preparing agarose gel, the above agarose is 0.1 to 15% by weight, preferably 0.1 to 1.0%, more preferably 0.2 to 0.5%, most preferably Is suspended in water or a buffer solution contained in the reaction solution to a concentration of 0.3%, heated to dissolve agarose, and then cooled.

The agarose gel thus prepared can be supplied with a supply by immersing the agarose gel in a solution containing a supply described below (hereinafter, this may be referred to as a “supply solution”) or Alternatively, a method of dissolving agarose as described above, cooling the mixture to an appropriate temperature, adding a concentrated supply solution thereto, and further cooling the mixture may be mentioned. Here, the appropriate temperature is equal to or higher than the freezing point of the agarose used and lower than the temperature at which the feed is denatured. Specifically, 30 to 50 ° C is preferable. In addition, the concentrated feed solution refers to a solution that has been concentrated so that the concentration of the feed solution in the finally prepared agarose gel is as described below. Also, the ag When immersing the loin gel, the immersing time is not particularly limited as long as the supplied material sufficiently permeates the agarose gel, but is preferably 1 hour or more. The temperature at the time of immersion is preferably low, for example, 4 ° C. in order to maintain the activity of the feed. Further, after dipping in the supply solution, it is preferable to remove the supply solution attached to the contact surface before contacting the solution with the reaction solution. As a specific removing method, there is a method in which agarose gel is taken out from the common solution using tweezers or the like, and the contact surface of the gel with the reaction solution is contacted with paper or the like.

The agarose gel containing the supplied material may be prepared in a container for performing a protein synthesis reaction (hereinafter, this may be referred to as a “reaction container”), or the agarose gel may be prepared using an appropriate container. Later, it may be appropriately shaped according to the reaction vessel. As described below, the shape of the agarose gel to be adjusted is such that when the reaction solution is brought into contact with an interface, the supply material, the synthesized target protein, the decomposed product, etc. There is no particular limitation as long as the shape is such that the diffusion is performed freely and the strength is maintained such that the agarose gel is not dissolved during the reaction. Preferably, a shape having a wide contact surface with the reaction solution is used. Specific examples include those solidified in a reaction vessel, small particles, and those shaped according to the shape of the bottom surface of the reaction solution.

Hereinafter, specific examples of the reaction vessel and an example of a method for preparing an agarose gel containing a suitable supply material will be described in detail. The reaction vessel may be any as long as it can carry out the cell-free protein synthesis reaction of the present invention. Specifically, for example, a plastic tube, a spin column, a multi-well plate, etc. Is preferably used.

The plastic tube may be of any shape, and specific examples thereof include a 1.5-2 ml capacity eppendorf tube, a 5-5 O ml capacity plastic tube, and the like. In addition, those having a filter having an appropriate pore size at the bottom thereof are also included. An appropriate pore size is preferably a range in which a substance necessary for a protein synthesis reaction does not pass, and a feed, a synthesized target protein, a degradation product, and the like can freely pass. Specifically, a filter having a pore size of 0.1 to 0.45 ra, a dialysis membrane having a limiting molecular weight of 10 kD to 300 kD, ultrafiltration, or the like is used. bra When a stick tube is used, the agarose gel containing the feed is preferably prepared in the tube by the above-described method, or formed so as to be immersed in the reaction solution charged in the tube.

A spin column has a filter with an appropriate pore size at the bottom and can be centrifuged by a centrifuge. Here, the appropriate pore size means a pore size that allows the synthesized target protein to pass therethrough, but does not allow gel and sol components to pass through. Specifically, for example, a filter having a filter of 0.1 to 0.45 / xm or a dialysis membrane having a limiting molecular weight of 10 kD to 300 kD is preferable. A capacity of 0.5 to 1 Oml is preferably used. When a spin column is used, the agarose gel containing the feed is preferably prepared in the tube by the above-described method, or is shaped so as to be immersed in the reaction solution charged in the tube. The method of containing the feed is the same as described above. In the case of a spin column, a centrifugal separator may be used in a state where the agarose gel is contained. Therefore, it is preferable to use agarose having a concentration of 0.1 to 2% agarose.

The plastic multi-well plate used in the method of the present invention is not particularly limited, but the 1-well has a capacity of 0.1 to 5 O ml, and a filter having a pore size of 0.2 2 / m at the bottom or a limiter. Those having a dialysis membrane having a molecular weight of 10 kD to 300 kD are preferably used. Even when a multi-well plate is used, the agarose gel containing the feed material is either solidified in the well by the above-described method or shaped so as to be immersed in the reaction solution charged in the well. Things are preferred. The method for incorporating the feed can be performed in the same manner as described above.

Further, a case where a gel filtration agent is used as an example of the sol will be specifically described. The gel filtration agent is purified to such an extent that it does not affect the above-mentioned protein synthesis reaction, has no non-specific adsorptivity, and can contain the above-mentioned feed, and the feed, synthesized target protein, and degradation A substance that can diffuse freely but can form an interface with the reaction solution is selected and used. Specific examples of the gel filtration agent include Cef Adex (manufactured by Amersham Bioscience), Cefacryl (manufactured by Amersham Bioscience), Sepharose (manufactured by Amersham Bioscience), and the like. Of these, SEPHADEX G—25, G—50, Sefacryl S 30 O, Sepharose 4B is preferably used. Of these, SEPHADEX G-50 Force S is more preferable, and SEPHADEX G-5 O Fine is particularly preferable. Further, as described later, the synthesized target protein can be purified by using a gel filtration agent having an affinity for the target protein or a part of the polypeptide.

The gel filtration agent equilibrates it with the same feed solution as above. The equilibration method is appropriately adjusted according to the selected gel filtration agent. Equilibration of the gel filtration agent may be performed in a reaction vessel, or may be performed in an appropriate vessel and then transferred to the reaction vessel. When a sol is used, a column tube, a spin column, a multiwell plate, a cup, or the like is preferably used as the reaction vessel. As for the multi-well plate and the cup, those having the same filter or dialysis membrane at the bottom can be used. In particular, cups with filters (for example, Stericup, manufactured by Millipore) are also used as mass applications.

(3) Target protein synthesis reaction

In the present invention, the transcription / translation reaction solution or the translation reaction solution is brought into contact with the gel or sol containing the supply described in the above (2) with an interface, and cultured at an appropriate temperature to obtain the target protein. Can be synthesized. As the transcription / translation reaction solution or the translation reaction solution, those described in the above (1) can be used. The amount of the reaction solution used for the synthesis reaction is not particularly limited, but is usually from lOAil to 50ml, preferably from 5μl to 1Oml. The amount of the gel or sol that brings such a reaction solution into contact with an interface may be an amount that can supply a supply such that protein synthesis in the reaction solution can be sufficiently performed. Specifically, when the reaction solution is 50/1 to lml, it is preferable to use a gel or sol having a volume of about 0.1 to 10m1.

The method of adding the reaction solution so as to have an interface with the gel and the sol in the reaction vessel includes a method in which the supply in the gel and the sol is freely diffused into the reaction solution. There is no particular limitation as long as the method has a sufficient contact surface. When agarose gel is used as the gel, and when the agarose gel is prepared by solidifying it in the reaction solution, a method of placing the reaction solution on the agarose gel is preferable. In the case of agarose gel prepared to be immersed in the reaction solution, the reaction solution and the agarose gel are placed in a reaction vessel. A method of introducing a loin gel is used. At this time, the order in which the agarose gel is charged is not particularly limited. However, if the reaction solution is charged after the agarose gel is charged, the operation can be performed without taking into account the scattering of the reaction solution when the agarose gel is charged. As described above, specific examples of the method of bringing the reaction solution into contact with the gel and the sol with an interface include a method in which the reaction solution is overlaid on the surface of the sol or the gel, or a method in which a solid gel is charged into the reaction solution. And a method of contacting the surface of the sol or gel with an interface. The protein synthesis reaction is as described in (1) above. Further, it is preferable that the device has a sealing means so that the reaction solution is not evaporated and concentrated during the protein synthesis reaction.

Further, when a gel filtration agent is used as an example of the sol, after filling the reaction container with the gel filtration agent equilibrated with the supply solution described in (2) above, the reaction solution is layered on top of this. The method is preferred.

In the above-mentioned protein synthesis reaction, when the above-mentioned filter having an appropriate pore size or a dialysis membrane at the bottom is used as the reaction vessel, the above-mentioned supply solution is further contacted via the filter or the dialysis membrane. You can also do so. Specifically, for example, when a filter having the above-mentioned filter at the bottom of the multi-well plate is used, it is preferable that a container is further provided so that the bottom of the well can be used, and a supply solution is placed in the container. .

(4) Recovery and purification of target protein

The target protein thus synthesized can be obtained by recovering the target protein from the reaction solution, gel or sol and, if necessary, purifying it by an appropriate method.

Recovery of the target protein from the reaction solution, gel or sol can be appropriately selected and performed depending on the respective reaction system. In the case of performing a protein synthesis reaction using agarose gel as an example of the gel, the reaction is performed by performing the protein synthesis reaction as described in (3) above, and then centrifuging the reaction vessel and collecting the supernatant. The solution can be recovered. The reaction solution can also be collected from the bottom of the reaction vessel or the top of the agarose gel using a pipe or the like. After collecting the reaction solution, an appropriate amount of a buffer solution that can be used biochemically is added to the reaction vessel, and The recovery rate can be increased by recovering using a pipe or the like. Furthermore, if necessary, the target protein contained in the agarose gel can be recovered, for example, by freeze-thawing the agarose gel and centrifuging it. As a method of centrifugation, it is preferable to put the melted agarose gel in a suitable container and centrifuge it at 300 to 1000 rpm. Here, if the above-mentioned spin column is used as a container, the collection can be further simplified. When a spin column is used as the reaction vessel, the target protein can be collected as necessary, for example, by freeze-thawing agarose gel together with the reaction solution and centrifuging the agarose gel in the same manner as described above. .

When protein synthesis is performed using a gel filtration agent as an example of a sol, a buffer that can be used biochemically in the column after the reaction is completed (hereinafter, this may be referred to as “eluate”) And the target protein can be recovered by eluting the target protein from the column. By recovering the target protein by such a method, the target protein can be purified and obtained in the same container as the protein synthesis reaction.

As a specific elution method, when a spin column is used, the same centrifugation operation as in the case of agarose gel is preferably used. When a multiwell plate or cup is used, the above eluate can be collected by a pipette or the like. Furthermore, when a multiwell plate / cup having a filter at the bottom is used as the reaction vessel, the above-mentioned eluate can be recovered by the same centrifugation operation and suction operation as in the case of agarose gel. In addition, when using a spin column or multi-well plate, the recovery rate can be increased by adding the eluate and suspending the gel, and then recovering the solution added as described above in an appropriate method. Possible eluents used include 20 mM phosphate buffer (PBS) containing 10 O mM NaCl, and salts including 10 to 500 mM NaCl 10 to: Hepes_K0H of LOO raM, Alternatively, a 10 to 10 O mM Tris-acetic acid solution or the like may be used. In order to prevent the ribosome from being decomposed by the eluate and being unable to be separated from the target protein, a buffer solution containing 5 to 20 mM magnesium ion can be used. Elution time, centrifugation, etc., should be appropriately selected depending on the gel filtration agent and target protein used. Can be adjusted.

The recovered eluate can be purified by a known method suitable for the target protein.

Here, by using a polymer substance having an affinity for the target protein or its partial polypeptide (hereinafter, this may be referred to as an “affinity gel carrier”) as the sol, the target protein can be converted to an affinity gel carrier. It can be purified by two-take mouth chromatography. Examples of the combination of the affinity gel carrier and the target protein used include an antibody column to which the target protein antibody is bound and the target protein, a fusion protein of guanoretathione sepharose and gu ^ tathione-1s transferase with the target protein, Examples include target proteins in which a nickel column is bound to a HIS tag. When such an affinity gel carrier is used, it is not necessary that all of the sol is composed of the carrier, and the sol can be used as a mixture with the sol comprising the gel filtration agent described in the above (2). Examples of the mixing method include a method of laminating a plurality of types of sols, a method of using a sol prepared by mixing a plurality of components, and the like. Further, by using magnetic beads having an affinity for the target protein, the target protein can be purified by a known method suitable for each magnetic bead.

The target protein that has been intensively recovered and purified can be confirmed by a commonly used method known per se. Specifically, it is separated by SDS-polyacrylamide gel electrophoresis and stained with Coomassie Priliant Blue (CBB) or by autoradiography when amino acids containing radioisotope atoms are used. And so on.

(5) Reagent kit for cell-free protein synthesis

In the present invention, a target protein is produced in a cell-free protein synthesis system, which comprises at least a component of the gel or sol and an aqueous solution having a substance consumed in a translation reaction, or a mixture thereof. A reagent kit is provided. The kit includes, in addition to the above, reagents for a cell-free protein synthesis reaction, components necessary for preparing the reaction solution described in (1) above, RNA polymerase, translation type I nucleic acid for positive control, translationべ Bec for making mold But not necessarily all of them, and any combination of reagents and containers may be used as long as it is a kit that can be used in the method for producing the target protein of the present invention.

(6) Cell-free protein synthesizer

In the present invention, there is provided a means for performing protein synthesis by bringing the transcription and translation reaction solution into contact with a gel or sol containing at least a substance consumed in the transcription and / or translation reaction in both its matrix and the excluded volume. An apparatus for producing a target protein in a cell-free protein synthesis system is provided. The apparatus further includes means for preparing DNA as a base for translation type I, means for performing a transcription reaction on the DNA, means for recovering and purifying the synthesized target protein, and confirming the obtained target protein. However, it is not necessary to include all of them, and any combination of means may be used as long as it can be used in the method for producing the target protein of the present invention. Example

Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited by these Examples.

Example 1 Method for synthesizing target protein using carrier for gel filtration

(1) Preparation of wheat germ extract and type I

A wheat germ extract was prepared according to the method described in Madin, K. et al., Proc. Natl. Acad. Sci. USA., 97, 559-564 (2000). Oligo DNA containing the SP6 promoter sequence and the ribosome binding sequence in the order of 5, → 3 'was obtained by synthesis and tatttttttttacattaacaacatttttaggccttttggccataagggccaaa: rooster c row 5), while pXen-2 (GenBank accession No. U81274) was type I GST, PreScission protease (Amersham Pharmacia Biotech, Inc., sometimes referred to as “psp”). I got it. Next, the above sequence 5 and sequence 6 were ligated by ligation PCR in the order of 5 ′ → 3 ′, and at this time, Smal and SfiI site were also added to the 3 ′ side. Also, Natl. Acad. Sci. USA, 99 (23), 14652-14657, 2002) from pEU3b (Sawasaki., T. et al, Proc. Natl. Acad. The transfected vector was previously cleaved with Nael, Sfil. Ligation of the sequence 3 treated with this vector and Sfi I was carried out via the 5 'blunt end and the 3' Sfi I site. Thus solid terpolymer was prepared (pEU- SS4) is, SP6 promoter _P EU vector, a ribosome binding sequence, GST, psp cleavage site, DNA cloning site (Sma I, Sfi I) is inserted for expression wheat germ Vector. The vector for GST-GFP gene expression (mirror type) is a DNA sequence encoding GFP (Haas, J. et al., Curr. Biol., 6 (3), 315-324 (1996), Plasmid- _P CaMV35S- A DNA fragment was obtained by PCR using sGFP (S65T) -N0S3 '(25)) in the form of a rust, the 5' side was blunt-ended, and the 3 'side was Sfil-added, followed by treatment with SfiI. The pEU_SS4 vector cleaved by treatment with Sma I and Sfi I was ligated with blunt ends on the 5 'side and Sfi I sites on the 3' side. Using this plasmid DNA as type II, transcription was performed using SP6 RNA Polymerase (Proraega), and the obtained mRNA was purified by ethanol precipitation to prepare.

(2) Preparation of sol

Sephadex _G25, G50M, G50F, G50SF, Sephacrylolé S300, Sepharose 6B gel (manufactured by Amersham Biosciences) were suspended in 3 volumes of pure water, allowed to stand, and the supernatant was discarded and washed. Three times the volume of the feed solution (30 mM HEPES-K0H, pH 7.6, 100 mM potassium acetate, 2.7 raM magnesium acetate, 0.4 mM spermidine, 2.5 raM dithiothreitol, 20 kinds of amino acids ( (0.3 raM), 1.2 raM ATP, 0.25 raM GTP, 16 mM creatine phosphate). 10 ml of this sol was packed in a column (2.5 cm in diameter, 10 cm in length) (made of Bio-Radne earth), and 10 ml of the above-mentioned feed solution was added thereto, and eluted until the liquid surface reached the gel surface.

(3) Reaction solution preparation and protein synthesis reaction

The reaction solution for cell-free protein synthesis using the wheat germ extract was 48% of the volume of the wheat germ extract prepared in (1) above, 30 mM HEPES-K0H, pH 7.6, 100 raM potassium acetate, 2.7 mM magnesium acetate, 0.4 raM spermidine, 2.5 mM dithiothreitol, 20 kinds of L-amino acids (0.3 mM each), 1.2 mM ATP, 0.25 mM GTP, 16 The above mRNA (1 mg / ml reaction volume) was prepared and used for raM creatine phosphate, 0.2 mg / ml creatine kinase, and 800 units / ml ribonuclease inhibitor (RNasinTM, manufactured by Promega). This reaction solution was gently placed on the surface of the sol in the column prepared in 500 μΐ above in (2), and reacted at 26 ° C for 48 hours.

(4) Recovery of protein

After the above reaction, the column tip was opened and eluted until the reaction solution surface reached the gel surface. 10 ml of elution buffer (PBS) was added to the gel so that the gel surface was not disturbed, and the mixture was flown, and fractions of 2 ml each were collected. Of the eluate of each fraction, {μ} was diluted 1/500, and then the amount of the target protein (GST-GFP) contained in the kit was measured using an ELISA kit (manufactured by Amersham Bioscience) using an anti-GST antibody. The amount of protein synthesized per ml of reaction solution is shown in Fig. 1 as the average value of each fraction.

(5) Control experiment

Using 25 zl of the reaction solution containing the translation type I described in the above (1) and 4 ml of the feed solution, protein synthesis was carried out by the method described in WOO 2/24939 (layered method). Natl. Acad. Sci. USA., 97, 559-564 (2000), a similar reaction solution (25 μl) was used as described in Madin, K. et al., Proc. Natl. Protein synthesis was performed using 1 and the feed solution 125 / zl. After the reaction, the reaction solution is collected in a pipette, and Ιμΐ of each is diluted 1/500, and then the target protein (GST) contained in an ELISA kit (Amersham Biosciences) using an anti-GST antibody is used. -GFP) was measured, and the amount of synthesis per lm of the reaction solution was quantified and compared with the experimental result of (4) above.

(6) Comparison of the amount of target protein synthesized

From these results, it was found that in each of the systems using G25, G50M, G50F, G50 SF, S300, and Sepharose 4B, more GST-GFP was synthesized than in the overlay method. Among the three gels, a large amount of GST-GFP was synthesized even at G50F. Figure 1 shows a comparison between the amount of protein synthesized using G5OF and control experiments. In the figure, the vertical axis indicates the amount of GST-GFP as the target protein synthesized per 1 ml of the reaction solution. As is apparent from the figure, the method of the present invention According to the results, a larger amount of GST-GFP is synthesized than in the conventional cup method and the multi-layer method, and four times as much protein as in the multi-layer method is obtained. The protein was obtained. Example 2 Protein synthesis method using agarose gel

(1) Preparation of agarose gel

(1) 2% agarose S (manufactured by Futtsubon Gene) suspended in Milli-Q water was melted by heating and poured into a sterile petri dish to a thickness of 5 瞧 and 3 to solidify. The agarose was withdrawn from a lcm or 0.5cm diameter tube, placed in a 5 Oml tube (Falcon), and concentrated 4 times (4 times as described in Example 1 (2)). Q water was added to make up a total of 1X feed. The tube was placed in a refrigerator to equilibrate the agarose gel to the feed.

(ii) 4% agarose S (manufactured by Futatsu Gene) suspended in Milli-Q water was dissolved by heating and cooled to 40 ° C. An equal amount of a 2-fold concentrated feed solution (composition: 2 times as described in Example (2)) at room temperature was added and mixed, and 4 ml was immediately poured into a 15-ml tube (Falcon). It is.

(2) Protein synthesis reaction

Type 、 was obtained by synthesis of oligo DNA containing the SP6 promoter sequence and the ribosome binding sequence in the order of 5 ′ → 3 ′ (sequence 5), while the DNA sequence encoding GFP (Haas, J. et al. , Curr. Biol., 6 (3), 315-324 (1996), Plasmid- _P CaMV35S-sGFP (S65T) -N0S3 '(25)) Was obtained by the PCR method. Next, the above sequences were ligated in the order of 5 ′ → 3 ′ by ligation PCR. At this time, Sfilsite was added to the 3 ′ side. In addition, an SfiI site was introduced from pEU3b (Sawasaki., T. et al, Proc. Natl. Acad. Sci. USA, 99 (23), 14652-14657, 2002), excluding the SP6 promoter sequence and the Ω sequence. The resulting vector was cleaved with Nae I and Sfi I in advance, and ligated with the sequence treated with Sfi I, blunt ends on the 5 ′ side, and Sfi I sites on the 3 side.

Into each well of a 24-hole round bottom deep-well plate (manufactured by Whatman), put 1001, 501, 30/1 of the same reaction solution as described in Example 1 (2) above. The agarose gel of (i) prepared in (1) above was immersed in each volume of the reaction solution so that the circular side surface was in contact with the round bottom surface (in an upright state). The deep pellet was sealed with a seal and reacted at 26 ° C for 24 and 48 hours. Three types of agar mouth were used: 5 cm thick lcm (large agarose), 5 mm thick 0.5 mm (middle agarose), and 3 mm thick 5 mm diameter (small agarose).

Also, place the reaction solution on top of the agarose gel solidified in the tube of (ii) prepared in (1) above at 100 μΐ and 200 μl, cover the tube, cover at 24 The reaction was performed for 48 hours. After completion of the reaction, the reaction solution was collected using a pipette. (3) Comparison of the amount of target protein synthesized

The amount of target protein (GFP) synthesized was separated by native polyacrylamide electrophoresis, stained with CBB, and the amount of synthesis per 1 ml of the reaction solution was quantified based on the intensity of the band corresponding to GFP. In the above (1) (i) of the synthesis reaction performed in multiples using the agarose gel, the amount of synthesized GFP per μl of the reaction solution was determined by immersing a large amount of agarose in 100 μl of the reaction solution, 50 μl. In the order of 1 in which agarose was immersed and 50 μl in which agarose was immersed, the amount was almost the same, and almost the same amount as in the dialysis cup method was obtained.

In addition, in the synthesis reaction performed in a plastic tube using the agarose gel prepared in (ii) in (1) above, the amount of synthetic GFP per 1 μl of the reaction solution was 200 // 1 More than at the time, and in each case, it was larger than the amount synthesized by the conventional multilayer method. Example 3 Protein synthesis method using agarose gel 2

(1) Preparation of wheat germ extract and type I

The wheat germ extract was prepared according to the method described in Madin, K. et al., Pro Natl. Acad. Sci. USA., 97, 559-564 (2000). An oligo DNA containing the SP6 promoter sequence and the ribosome binding sequence in the order of 5 ′ → 3 ′ was obtained by synthesis (aaagccggccgatttaggtgacactatagaacatcaacatcttacattttacattataattttcactctc tatttttttttacattaacaacatttttaggccttttggccataagggBank. As GST, PreScission protease (Amersham Pharmacia Biotech, hereinafter sometimes referred to as “psp”) A DNA fragment (ctggaagttctgttccagggtccc: sequence 6) containing a cleavage site in the order of 5 ′ → 3 ′ was obtained by PCR. Next, the above sequence 5 and sequence 6 were ligated by ligation PCR in the order of 5 ′ → 3 ′, and at this time, Smal and SfiI sites were added to the 3 side. From pEU3b (Sawasaki., T. et al, Proc. Natl. Acad. Sci. USA, 99 (23), 14652-14657, 2002), Nael, except for the SP6 promoter sequence, The vector into which the Sfil site was introduced was cleaved with Nael, Sfil in advance. Ligation of the sequence 3 treated with this vector and SfiI was carried out through the 5 ′ blunt end and the 3 ′ SfiI site. The vector (pEU-SS4) prepared in this manner is an expression vector for wheat germ in which the SP6 promoter, ribosome binding sequence, GST, psp cleavage site, and DNA cloning sites (Sma I, Sfi I) have been inserted into the pEU vector. It is. The vector for GST-GFP gene expression (type II) contains a DNA sequence encoding GFP (Haas, J. et al., Curr. Biol., 6 (3), 315-324 (1996), Plasmid- _P CaMV35S- sGFP (S65T) -N0S3 '(25)) was made into a 铸 type, a 5'-side was blunt-ended, and a Sfil was added to the 3'-side, a DNA fragment was obtained by PCR, and then treated with SfiI. The pEU-SS4 vector cleaved by treatment with SmaI and SfiI was ligated with blunt ends on the 5 side and SfiI site on the 3 side. Using this plasmid DNA as type III, transcription was carried out using SP6 RNA Polymerase (Proraega), and the obtained mRNA was purified by ethanol precipitation to prepare.

(2) Preparation of agarose gel

Heat was applied to 0.6% and 1.0% agarose S (manufactured by Nitsubon Gene) suspended in Milli-Q to dissolve it, and cooled to 40 ° C. The feed solution was concentrated twice at room temperature (the composition was twice as described in Example 1 (2), specifically 60 mM HEPES-K0H, pH 7.6, 200 mM potassium acetate, 5.4 raM Add and mix equal amounts of magnesium acetate, 0.8 mM spermidine, 5 mM dithiothreitol, 20 L-amino acids (0.6 mM each), 2.4 raM ATP, 0.5 raM GTP, 32 raM creatine phosphate, and mix quickly and pyrogen-free 0.5 ml each was poured into a tube (1.5 ml capacity, manufactured by BM Instruments), and the mixture was further cooled.

(3) Protein synthesis reaction On the agarose gel of the tube of (2) above, the same reaction solution as described in Example 1 (3) was added so as to form a 15 μl, 30 μl, and 60 1 layer, respectively, and the tube was covered. And reacted at 26 ° C. for 22 hours. After completion of the reaction, centrifugation was performed at 15,000 rpm for 1 hour, and the reaction solution of the supernatant was recovered.

As a control experiment, 25 μl of the reaction solution containing the translation type I described in (1) above and 125 ml of the feed solution were used as described in WO 2002/24939, using a 96-well square bottom titer plate (manufactured by Sumilon). Protein synthesis was performed by the method described above (layered method).

(4) Comparison of the amount of target protein synthesized

The amount of the target protein (GST-GFP) synthesized was determined by GST-ELISA measurement. As described in (3) above, the reaction solution 11 recovered from this method and the overlay method was diluted to 1Z500, respectively, and then diluted with an ELISA kit (Amersham Bioscience) using an anti-GST antibody. Target protein contained

(GST-GFP) was measured.

The result is shown in FIG. In the figure, the vertical axis indicates the amount of the target protein reacted with the anti-GST antibody (per 1 ml of the reaction solution). As is clear from the figure, in the synthesis method using agarose solidified in a tube, the agarose concentration is 0.3%, the synthesis amount is higher than 0.5%, and the reaction volume added on the agarose gel is less than 15μ1. 30 μ1 and 60 // 1 produced higher amounts of protein. In the case of 60 µl overlay on 0.3% agarose gel, about 1.5 times the amount of protein synthesis was obtained compared to the overlay method. Example 4 Synthesis of poorly water-soluble protein

(1) Preparation of type 鎵

As the poorly water-soluble protein, ΡΚ7 protein (Helix Research Institute, Inc., clone No. NT2RP2001529-1-1), which became insoluble when synthesized by the above-mentioned overlay method or the like, was used. The 0RF fragment of PK7 (SEQ ID NO: 1) was obtained by PCR using a 5′-side primer (SEQ ID NO: 2) and a 3′-side primer (SEQ ID NO: 3).

This was inserted into the cloning site of the vector (pEU-SS4) described in Example 1 (1). Using the plasmid DNA prepared as described above as type I, transcription was performed using SP6 RNA Polymerase (Promega), and the obtained RNA was purified by ethanol precipitation.

(2) Sol preparation and protein synthesis reaction

In the same manner as in Example 1 (2), Sephadex-1 G5 OF (manufactured by Amersham Biosciences) was equilibrated with a supply solution, and the sol 1 Om1 was equilibrated with a column (Bio-Radnet) having an inner diameter of 2.5 cm and a length of 10 cm. And 10 ml of the above feed solution was added thereto, and eluted until the liquid surface reached the gel surface. The reaction solution for cell-free protein synthesis using the wheat germ extract was 48% of the wheat germ extract prepared in Example 1 (1) above, 30 mM HEPES-K0H, pH 7.6, and 100 mM acetate acetate. , 2.7mM magnesium acetate, 0.4m spermidine, 2.5mM dithiothreitol, 20 kinds of L-amino acids (0.3mM each), 1.2mM ATP, 0.25mM GTP, 16mM creatine phosphate, 0.2mg / ml creatine kinase And 800 units / ml ribonuclease inhibitor (RNasinTM, manufactured by Promega) to which the above-mentioned mRNA (1 mg / ml reaction volume) was added. 500 μl of the above reaction solution was gently placed on the sol surface in the column, and the reaction was carried out at 26 ° C. for 48 hours. After the above reaction, the column tip was opened and eluted until the surface of the reaction solution reached the gel surface. Elution buffer (PBS) (10 ml) was added without disturbing the gel surface, and the mixture was allowed to flow, and fractions (2 ml each) were collected. Of these, fractions 1 to 5 were collected from 30 μl for 1 minute, and this was centrifuged at 15, OO rpm to obtain a supernatant. The precipitate was boiled with the same amount of SDS-polyacrylamide gel electrophoresis buffer as the supernatant. Of these, 20 µl of each was separated by SDS-polyacrylamide gel electrophoresis, stained with CBB, and the amount of synthesis was quantified from the intensity of the band corresponding to GST-PK7. In addition, those not subjected to centrifugation were similarly quantified. Further, the same protein was synthesized using the same dialysis cup method and overlay method as described in Example 1, and the obtained reaction solution was collected with a pipette. After 30 minutes, separation was performed by SDS-polyacrylamide gel electrophoresis, and after CBB staining, the amount of synthesis was quantified based on the intensity of the band corresponding to GST-ΡΚ7. Fig. 3 shows the results of electrophoresis showing the synthesized GSII-II protein.

In the figure, Τ indicates that the sample was not centrifuged, S indicates the supernatant, and Ρ indicates the precipitate. Shows the amount of protein to be applied. As is clear from the figure, the GST-PK7 force present in the precipitate in the dialysis cup method is not seen in the method of the present invention.

(3) Comparison of synthetic protein levels

1 μl of each eluate fraction collected as described in (2) above, and 1 μl of the reaction solution recovered from the dialysis cup method and the overlay method, were subjected to anti-GST antibody (Amersham Biosciences, Inc.). The amount of the target protein (GST-PK7) contained was measured by the ELISA method using the above method. Figure 4 shows the results. In the figure, the vertical axis indicates the amount of the target protein reacted with the anti-GST antibody. The proteins measured by this method are all solubilized. As is evident from the figure, when synthesized by the dialysis cup method, the poorly water-soluble protein, which was contained in a large amount in the precipitate, was most often synthesized in the state of being solubilized by the method of the present invention. Was. Comparative Example 1 Comparison with the case where the reaction solution is placed in the excluded volume

(1) Preparation of wheat germ extract, 铸 type and protein synthesis reaction solution

The wheat germ extract was prepared according to the method described in Madin, K. et al., Proc. Natl. Acad. Sci. USA., 97, 559-564 (2000). Oligo DNA containing the SP6 promoter sequence and ribosome binding sequence in the order of 5, → 3 'was obtained by synthesis, and tatttttttttacattaacaacatttttaggccttttggccataagggccaaa: d column 5), while pXen-2 (GenBank accession No. U81274) was used as a GST A DNA fragment (ctggaagttctgttccagggtccc: sequence 6) containing a PreScission protease (Amersham Pharmacia Biotech, Inc., hereinafter sometimes referred to as “psp”) cleavage site in the order of 5 ′ → 3 ′ was obtained by PCR. Next, the above sequence 5 and sequence 6 were ligated by ligation PCR in the order of 5 ′ → 3 ′. At this time, Smal and SfiI sites were added to the 3 ′ side. From pEU3b (Sawasaki., T. et al, Proc. Natl. Acad. Sci. USA, 99 (23), 14652-14657, 2002), Nael, except for the SP6 promoter sequence, the Ω sequence and the multicloning site. The vector into which the Sfil site was introduced was cleaved in advance with Nael, SfiI. Sequence 3 treated with this vector and Sfi I was added to the 5 ' Ligation was conducted via the Sfi I site on the 3rd side. Such base pin definition one was created (pEU- SS4) is, SP6 promoter foremost _P EU vector, a ribosome binding sequence, GST, psp cleavage site, D NA claw Jung site (Sma I, Sfi I) was inserted It is an expression vector for wheat germ. The vector for GST-GFP gene expression (type III) contains a DNA sequence encoding GFP (Haas, J. et al., Curr. Biol., 6 (3), 315-324 (1996), Plasmid-pCaMV35S-sGFP (S65T) -N0S3 '(25)) was made into a 铸 type, the 5' side was blunt-ended, and the 3 'side was sifted with Sfil to obtain a DNA fragment by PCR, followed by treatment with Sfi I, The pEU_SS4 vector, which had been cleaved by Sma I and Sfi I treatment in advance, was ligated with blunt ends on the 5 'side and Sfi I sites on the 3 side. Using this plasmid DNA as type I, transcription was carried out using SP6 RNA Polymerase (Promega), and the obtained mRNA was purified by ethanol precipitation to prepare. The reaction solution for cell-free protein synthesis using the wheat germ extract was 48% of the above-mentioned wheat germ extract, 30 mM HEPES-K0H, pH 7.6, 100 mM potassium acetate, 2.7 mM acetic acid. Magnesium, 0.4 mM spermidine, 2.5 mM dithiothreitole, 20 L-amino acids (0.3 mM each), 1.2 mM ATP, 0.25 mM GTP, 16 mM creatine phosphate, 0.2 mM 133 μl of the above-mentioned mRNA (1 mg / ml reaction volume) was prepared in 267 μl of 2 mg / ml creatine kinase, 800 units / ml ribonuclease inhibitor (RNasinTM, manufactured by Promega), and used as a reaction solution.

(2) Sol preparation and protein synthesis reaction

(The method of the present invention: indicated by Α in FIG. 5)

Sephadex-1 G50F gel (manufactured by Amersham Biosciences) is suspended in 3 volumes of pure water, allowed to stand, discarded supernatant, washed, and then 3 volumes of feed solution (30 mM HEPES-K0H, pH 7.6, 100 mM potassium acetate, 2.7 mM magnesium acetate, 0.4 mM spermidine, 2.5 mM dithiothreitol, 20 kinds of L-amino acids (0.3 mM each), 1.2 mM ATP, 0.25 mM GTP, 16 mM creatine phosphate) and equilibrated twice. 1.2 ml of this sol is packed into a 1.5 mm ID, 5 cm long column (manufactured by Bio-Rad), and 2.4 ml of the above-mentioned feed solution is added until the liquid level reaches the gel surface. After elution, the mixture was equilibrated. 60 μl of the reaction solution was overlaid on the column and reacted at 26 ° (48 hours).

(Method of performing protein synthesis reaction in excluded volume: indicated by Β in Figure 5) A sol 1.211) 1 similarly equilibrated in the same manner as above was filled in a force ram (manufactured by Bio-Rad) having an inner diameter of 1.5111111 and a length of 5 cm, and equilibrated by adding 2.4 ml of the above-mentioned feed solution. 400 μl of the reaction solution was applied to the column, permeated into the sol, and reacted at 26 ° C. for 48 hours.

(Method 2 for performing protein synthesis reaction in the excluded volume: indicated by C in Fig. 5) 1.2 ml of the same equilibrated sol as above and a force of 5 cm in length and 1.5 mra in diameter (Biorad) After that, the liquid in the excluded volume of the sol was removed by suction with a syringe from the end of the column. Into another empty 1.5 mm inner diameter, 5 cm long column (manufactured by Bio-Rad), put the 400; / 1 reaction solution, and then put the sol from which the feed solution in the excluded volume has been removed. The reaction was carried out at 26 ° C. for 48 hours.

(Control: indicated by the overlay method in Fig. 5)

Using the reaction solution 251 containing translation type I described in (1) above and 4 ml of the feed solution, protein synthesis was carried out by the method (layering method) described in WOO 2/24939.

(3) Recovery of protein

After the above reaction, the column tip was opened, and in the method of the present invention, elution was carried out until the reaction solution surface reached the gel surface. In the method for protein synthesis in the excluded volume, elution was carried out by flowing 1.2 ml of elution buffer (PBS) with added gel so that the gel surface was not disturbed. Furthermore, in the overlay method, the reaction solution was collected with a pipette. After diluting 1 μl of the collected solution to 1500, the amount of the target protein (GST-GFP) contained in the ELISA kit (manufactured by Amersham Bioscience) using an anti-GST antibody was measured. The amount of protein synthesized per 1 ml of the reaction solution is shown in FIG. 5 as the average value of each fraction. As is clear from the figure, the method of performing the reaction in the exclusion volume had a protein synthesis amount of only about 1 to 4 to 13 of the method of the present invention, and was about 1Z2 compared to the overlay method. . Industrial potential

According to the present invention, a translation reaction in a cell-free protein synthesis system is long-lasting, is applicable to a reaction system having a large capacity, and can be performed by a simple synthesizer. A method for synthesizing a cell-free protein with high growth efficiency is provided. Further, according to the present invention, a method for separating and purifying a protein synthesized in the same container after a transcription / translation reaction or a translation reaction, a reagent kit for performing the protein synthesis reaction, and a protein obtained by the protein synthesis reaction Can also be manufactured. Further, according to the method of the present invention for synthesizing a target protein using a gel filtration agent as a sol, the protein synthesized is diffused to the sol side, so that it is insoluble when synthesized by a normal cell-free protein synthesis method. Was obtained in a dissolved state.

This application is an application claiming priority based on a Japanese patent application (Japanese Patent Application No. 2002-3504 62) filed on February 5, 2002, the contents of which are incorporated herein by reference. Taken in as a reference. The contents of the documents cited in this specification are also incorporated herein by reference.

Claims

The scope of the claims

1. A method for producing a target protein using a cell-free protein synthesis system, wherein the transcription / translation reaction is performed on a gel or sol containing a substance consumed in a transcription reaction or a translation reaction in both its matrix and excluded volume. A method comprising performing protein synthesis by bringing a reaction or translation reaction solution into contact with an interface.

2. The method according to claim 1, wherein the gel or the sol is supplied with a transcription / translation reaction or a substance consumed in the translation reaction via a dialysis membrane.

3. The method according to claim 1, wherein the gel or the sol is composed of a polymer substance.

4. The high molecular substance is a gel filtration agent, and after the transcription / translation reaction or translation reaction, the synthesized target protein is separated and purified in the same container. The described method.

5. The method according to claim 3, wherein the high-molecular substance has an affinity for the target protein or a partial polypeptide thereof.

6. The method according to any one of claims 1 to 3, wherein the gel comprises agarose as a component.

7. The method according to any one of claims 1 to 6, wherein the target protein is a poorly water-soluble protein.

8. A gel or sol for use in the method according to any one of claims 1 to 7, wherein a substance consumed in a transcription / translation reaction or a translation reaction of a cell-free protein synthesis system is contained in both the matrix and the excluded volume. .

9. The method according to any one of claims 1 to 7, comprising an aqueous solution containing at least a gel or sol component and a substance consumed in a translation reaction, or a mixture thereof. Reagent kit for protein production.

10. At least the transcription of a cell-free protein synthesis system * Transfer the transcription / translation reaction or translation reaction solution to a gel or sol containing substances consumed in the translation reaction or translation reaction in both its matrix and excluded volume. By contacting with An apparatus for producing a target protein using a cell-free protein synthesis system, comprising means for performing protein synthesis.