WO2004050878A1

WO2004050878A1 - Method for modifying the expression of polypeptides in recombinant expression systems

Info

Publication number: WO2004050878A1
Application number: PCT/EP2003/013410
Authority: WO
Inventors: Walter Meinl; Hans Rudolf Glatt
Original assignee: Deutsches Institut für Ernährungsforschung
Priority date: 2002-11-29
Filing date: 2003-11-28
Publication date: 2004-06-17
Also published as: DE10255852A1; AU2003302690A1; DE10255852B4

Abstract

The invention relates to a method for modifying the expression of polypeptides in recombinant expression systems, according to which N-terminal codons in a gene that is to be expressed are replaced by a) synonymous codons and b) codons that are rare for the respective recombinant expression system. The inventive method can be carried out by means of a plurality of different expression systems. The invention further relates to a correspondingly mutated nucleic acid molecule in which N-terminal codons are replaced by synonymous codons and codons that are rare for the respective recombinant expression system, host cells, and a method for expressing the mutated genes.

Description

Method for changing expression of polypeptides in recombinant

expression systems

The present invention relates to a method for changing the expression of polypeptides in recombinant expression systems, in which N-terminal codons in a gene to be expressed are replaced by a) synonymous and b) codons rare for the respective recombinant expression system. The method can be carried out with a variety of different expression systems. The invention further relates to a correspondingly mutated nucleic acid molecule in which N-terminal codons have been replaced by synonymous codons which are rare for the respective recombinant expression system, and to host cells and a method for expressing the mutated genes.

The amino acid sequence of a protein can be derived from the nucleotide sequence of the gene in question in units of three successive nucleobases (one codon). When translated, the codons of the messenger RNA (mRNA) pair with the complementary anticodon region of the transfer RNA (tRNA), which is loaded (activated) with an amino acid specific for this anticodon. Since there are four different bases, 64 triplets are possible as codons. The genetic code in living nature is (almost) universal, which means that all organisms use the same code.

Three of the possible codons (UAA, UAG and UGA) stand for the translation stop. The remaining 61 codons code for only 20 different amino acids because the genetic code (probably for evolutionary reasons) is degenerate. According to the "wobble" model, many of the nucleobases at the third position in the triplet of a codon are no longer relevant for coding. This means that there can be several codons for one amino acid. In fact, with the exception of methionine (AUG) and tryptophan (UGG) for the further amino acids each have at least two codons for the amino acids.

The amino acids arginine, leucine and serine can each be coded by six, alanine, glycine, proline, threonine and valine by four each and isoleucine by three different base sequences. The frequency analysis shows an unequal use of the principally equivalent codons depending on the species, with some codons occurring extremely rarely in the messenger RNAs, especially in the case of the amino acids mentioned above. Due to the rapid development in genetic engineering, many different approaches are now available for targeted changes in the codons of a gene. One type of change concerns the synonymous base exchange, which alters the nucleotide sequence, but leaves the amino acid sequence unchanged. However, there are only a few studies on the consequences of such a base exchange. It is postulated that the frequency of the codons used reflects the frequency of the tRNA which recognizes them [1]. It has been shown that such rarely used codons do not occur in mRNA sequences that code for highly expressed proteins.

For example, the use of rare codons could be a regulatory mechanism that prevents the over-expression of these proteins [1]. Furthermore, it is known in the prior art that the expression of a protein in E. coli can be reduced by replacing synonymous codons with rare codons, in particular in a sequence of several rare codons in succession [2-4].

The recombinant expression of proteins in the most diverse expression systems has increased exponentially in the past decades. Nowadays proteins are produced on an industrial scale in particular unicellular organisms and, among other things, in the production and preservation of food (e.g. dairy products, baked goods), in the production of complex chemicals and detergents, in agriculture and - last but not least - in the pharmaceutical sector Industry (eg insulin and other hormones, cytokines, antibiotics) are used. Further examples are recombinant vaccines, microbial insecticides, technical enzymes (proteases, amylases, cellulases) and microbial polyesters.

US 4,945,051 describes a DNA segment which codes for a signal peptide. Using this signal sequence, recombinantly produced human lysozyme is exported into the culture medium and can thus be produced on a large scale.

US 5,082,767 describes a method for determining non-random codon pairing in an organism. The results are used to optimize codon pairing and to control translation efficiency. US 5,436,391 describes a synthetic insecticidal gene in which the codon use has been adapted to Graminaceae and in particular rice.

No. 5,874,304 describes a “humanized” “green fluorescent protein” (GFP) which is adapted for high expression in mammalian cells, in particular in human cells. The codon usage is changed to a more suitable one for humans.

WO 99/14338 describes the codon adaptation of a LIP1 lipase from the yeast Candida rugosa to the expression in S. cerevisiae.

Lakey et al. (2000, [5]) described that by replacing rare codons with more synonymous, the heterologous expression of proteins in E. coli and other organisms was increased.

Despite the various approaches, such as those mentioned above, to avoid the problems in the expression of recombinant proteins, they still persist and are, among other things, poor solubility, the formation of inclusion bodies and denaturation, and above all a poor (low ) and unstable expression There is therefore still a need for simple and effective methods to improve the expression of recombinant proteins on the broadest possible basis.

It is therefore an object of the present invention to provide such a simple and effective method for the controlled expression of recombinant proteins on the broadest possible basis. Other objects and aspects of the invention will become apparent upon studying the following description and examples of the present invention.

The object of the present invention is achieved by a method for changing the expression of polypeptides in recombinant expression systems, in which N-terminal codons in a gene to be expressed are replaced by a) synonymous and b) codons rare for the respective recombinant expression system. Surprisingly, it was found within the scope of the experiments on which the invention is based that when heterologous expression of a human enzyme, namely SULT1A2 * 2 in a bacterial host such as Salmonella typhimurium LT2 TA1538, expression was achieved ten times higher when codons in the N-terminal region were counteracted synonymous rare codons of the bacterium (i.e. host) were exchanged. This was confirmed in follow-up examinations in which other peptides (e.g. SULT1A1 * V and SULT2Blb), host organisms (Escherichia coli), selection markers (neomycin resistance) and rare codons (e.g. GCA for alanine, CCA for proline and GGA for glycine) were used. The fact that the introduction of rare codons would have a positive effect on expression is diametrically opposed to previous approaches to codon adaptation. Without wishing to be bound by theory, it is assumed that the present effect is due to the number and regulation as well as the stoichiometry of the tRNAs involved in the translation of the mRNA. Because the tRNAs compete for the amino acids, some of the rarer tRNAs may be activated differently than others. In addition, their stabilities could have a different regulatory effect at the start of translation at the N-terminus of the protein than at any other point on the protein. Therefore, the positioning of the codons plays a significant role in their effects.

Due to the fact that different frequencies of the tRNAs and the codons occur in all organisms and the regulation of the tRNAs is probably based on an extremely old common mechanism for the sake of the history of the evolution of translation, it is assumed that the method according to the invention is even fundamentally different suitable for expression control in any organism.

In addition to the insertion of rare codons in the N-terminus of the gene to be expressed, more frequent codons can of course also be inserted. The change in expression according to the invention can therefore be an increase or decrease in expression. Thus, when the goal is to decrease expression, the present invention relates to reverse substitution, i.e. rare codons are exchanged for more frequent ones.

For the purposes of the present invention, “N-terminus” means the region between the start codon for methionine or F-Met (hereinafter referred to as codon “1”) to approximately amino acid 20 of the translated peptide. In the case of translation in eukaryotic cells, the areas to be modified can also be immediately connected to highly served leader, signal and / or translocation signals of the growing peptide chain lie, but this need not necessarily be the case. A method according to the invention is preferred; in which at least one of the N-terminal codons 1 to 20 of the N-terminus of the gene to be expressed is replaced. It is further preferred that at least one of the N-terminal codons 1 to 10 of the N-terminus of the gene to be expressed is replaced.

Because of the above-mentioned properties of the method according to the invention, it can be used in a variety of expression systems. So these can be selected from:

Non-human animals or their tissues, such as, for example, Drosophila, Caenorhabditis, sheep, cows, goats, rabbits, mice, rats, hamsters, zebrafish, monkeys and pigs, and organs of these animals,

Plants or their tissues, such as, for example, arabidopsis, lupines, rice, potatoes, maize, oilseed rape, tomato, their leaves and callus cultures of the plants mentioned, and organs of the plants,

Mushrooms and their tissues, such as mycorrhiza or tuber melanosporum,

prokaryotic individual cells, such as, for example, Gram-positive or Gram-negative bacteria, such as, for example, Bacillus subtilis, Lactococcus, Escherichia coli, Salmonella typhimurium, Caulobacter, Pseudomonas or Streptomycetes,

- Eukaryotic individual cells such as yeasts such as Saccharomyces, Hansenula and Pichia, insect cell lines and mammalian cell lines such as CHO cells, V79 cells, COS cells or human or monkey cell lines, and

- cell-free expression systems, protoplasts and baculovirus systems.

According to a further aspect of the method according to the invention, any recombinant gene can be of interest as the gene to be expressed. These genes are preferably selected from bacterial genes, eukaryotic cDNAs and viral genes. The expression of genes which code for proteins of economic interest is particularly preferred. Furthermore, the weak expression of problematic (poorly or only laboriously) to be expressed genes can be improved by means of the method according to the invention. The further preferred genes of the method according to the invention are selected from the genes for hormones, cytokines, antibiotics, proteases, amylases, lipases, cellulases, insecticides, antibodies and fragments thereof, polymerases, restriction enzymes, enzymes which are involved in the synthesis of secondary metabolites in plants or fungi are involved and selective onsmarkern. The genes for insulin, chitosan, chymosin, lysozyme, interferons, interleukins, growth hormones, erythropoietin, foreign matter-processing enzymes and transmembrane transporters are very particularly preferred.

Another aspect of the present invention relates to a method, wherein the gene to be expressed is selected from the genes for xenobiotic-eliminating enzymes, such as, for example, the cytochrome P-450, alcoholdehydrogenases, glutathione transferases, N-acetyltransferases, UDP-glucuronosyltransferases and sulfotransferases ( SULT).

According to a further aspect of the present invention, this relates to a method which is characterized in that the expression system is Salmonella typhimurium LT2 and in the gene to be expressed at least one Ν-terminal codon for alanine by GCU or GCA, for arginine by AGA or AGG or CGA or CGG, for glutamine by CAA, for glycine by GGA or GGG, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUC or CUA, for lysine by AAG, for proline by CCU or CCC or CCA, for Serine is replaced by UCU or UCC or UCA or AGU, for threonine by ACU or ACA and for valine by GUA or GUG.

According to yet another aspect of the present invention, this relates to a method which is characterized in that the expression system is Escherichia coli Kl 2, and in the gene to be expressed at least one Ν-terminal codon for alanine by GCU, for arginine by AGA or AGG or CGA or CGG, for glutamate by GAG, for glycine by GGA or GGG, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUC or CUA, for lysine by AAG, for proline by CCU or CCC or CCA, for Serine is replaced by UCA, for threonine by ACU or ACA and for valine by GUA.

According to a still further aspect of the present invention, this relates to a method which is characterized in that the expression system is Lactococcus lactis, and in the gene to be expressed at least one Ν-terminal codon for Ala in by GCC or GCG, for arginine by AGG or CGC or CGG, for asparagine by AAC, for aspartate by GAC, for cysteine by UGC, for glutamine by CAG, for glutamate by GAG, for glycine by GGC or GGG, for histidine by CAC, for isoleucine by AUA or AUC, for leucine by CUC or CUG or CUA, for lysine by AAG, for phenylalanine UUC, for proline by CCC or CCG, for serine by UCG or UCC, for threonine by ACC or ACG, for tyrosine by UAC and for valine by GUC or GUG.

According to a further aspect of the present invention, this relates to a method which is characterized in that the expression system is Saccharomyces cerevisiae and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGC or CGA or CGG, for glutamine by CAG, for glutamate by GAG, for glycine by GGC or GGG, for leucine by CUU or CUC or CUG or CUA, for proline by CCC or CCG, for serine by UCG or AGC, for threonine by ACG and for valine GUG is replaced.

According to a further aspect of the present invention, this relates to a method which is characterized in that the expression system is derived from Homo sapiens and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGU or CGA, for glutamine by CAA, for glutamate by GAG, for glycine by GGU, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUA, for proline by CCG, for serine by UCG, for threonine by ACG and for valine by GUU or GUA is replaced.

According to a further aspect of the present invention, this relates to a method which is characterized in that the expression system is Critelus griseus or is derived therefrom, and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGU or CGA, for glutamine by CAA, for glutamate by GAG, for glycine by GGU, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUA, for proline by CCG, for serine by UCA or UCG, for threonine by ACG and for Valin is replaced by GUU or GUA.

According to a still further aspect of the present invention, this relates to a method which is characterized in that the expression system is or is derived from Oryza sativa, and in the gene to be expressed at least one N-terminal codon for alanine by GCA, for arginine by CGU or CGA, for glycine by GGU or GGA, for isoleucine by AUA, for leucine by UUA or CUA, for lysine by AAA, for serine by AGU and for valine by GUA. According to a further aspect of the present invention, this relates to a method which is characterized in that the expression system is Arabidopsis thaliana or is derived therefrom, and in the gene to be expressed at least one N-terminal codon for alanine by GCC or GCG, for arginine by CGC or CGA or CGG, for aspartate by GAC, for glycine by GGC or GGG, for isoleucine by AUA, for leucine by UUA or CUA or CUG, for proline by CCC or CCG, for serine by UCC or UCG or AGC, for threonine is replaced by ACG and for valine by GUC or GUA.

The frequencies of the individual codons are different for each organism. The organisms shown above are therefore only a selection of sample organisms. How the codon frequency is to be determined and how the sequence to be expressed is then to be adapted to the respective host organism can be found in the abovementioned examples and the following table of the codon frequencies and the literature available in the prior art on codon adaptations and can be adapted without difficulty to all other organisms and expression systems which are not yet listed in Table 1 below. The codon frequency can also be adapted accordingly to the enzymes and tRNAs present for in vitro expression. For this purpose, these systems can also be modified accordingly compared to the commercially available systems.

Table 1: Rarely used codons (numbers taken from [6]); n _a = number of codons coding for amino acid a;

/ _c (a) = frequency with which codon c is used for coding amino acid a;

1 Rare codon: / _c (a) <n _{a +} 1 (marked in bold in Table 1);

Coded amino acid: Ala = alanine, Arg = arginine, Asn = asparagine, Asp = aspartate, Cys = cysteine, Gin = glutamine, Glu = glutamate, Gly = glycine, His = histidine, Ile = isoleucine, Leu = leucine, Lys = lysine , Met = methionine, Phe = phenylalanine, Pro = proline, Ser = serine, Thr = threonine, Trp = tryptophan, Tyr = tyrosine and Val = valine; and Organisms: ST = Salmonella typhimurium LT2, EC = Escherichia coli Kl 2, LL = Lactococcus lactis, SC = Saccharomyces cerevisiae, HS = Homo sapiens, CG = Critelus griseus, OS = Oryza sativa and AT = Arabidopsis thaliana

Codon Coded amino acid / _c (a) * 100

ST EC LL SC HS CG OS AT

GCU Ala 13 16 41 38 26 32 22 44

GCC Ala 30 27 15 22 40 38 33 16

GCA Ala 13 21 34 29 23 23 19 27

GCG Ala 44 36 10 11 11 7 27 14

AGA Arg 4 4 27 48 21 19 15 35

AGG Arg 3 2 6 21 20 19 23 20

CGU Arg 33 38 36 15 8 11 11 17

CGC Arg 41 40 10 6 19 18 23 7

CGA Arg 6 6 16 7 11 13 9 12

CGG Arg 12 10 6 4 21 20 18 9

AAU Asn 47 45 75 59 46 45 43 52

AAC Asn 53 55 25 41 54 55 57 48

GAU Asp 61 63 73 65 46 46 47 68

GAC Asp 39 37 27 35 54 54 53 32

UGU Cys 42 44 79 63 45 46 34 60

UGC Cys 58 56 21 37 55 54 66 40

CAA Gin 29 35 82 69 26 23 40 56

CAG Gin 71 65 18 31 74 77 60 44

GAA Glu 63 69 81 71 42 40 36 52

GAG Glu 37 31 19 29 58 60 64 48

GGU Gly 24 34 38 47 16 20 20 34

GGC Gly 48 40 12 19 34 34 38 14

GGA Gly 12 11 37 22 25 24 20 37

GGG Gly 16 15 13 12 25 21 22 15

CAU His 58 57 73 64 41 43 45 61

CAC His 42 43 27 36 59 57 55 39

AUU Ile 50 51 63 46 36 35 34 41

AUC Ile 41 42 20 26 48 51 47 35

AUA Ile 9 7 16 27 16 13 20 24

UUA Leu 12 13 34 28 7 6 7 14

UUG Leu 12 13 21 29 13 14 17 22

CUU Leu 11 10 24 13 13 13 17 26

CUC Leu 10 10 7 6 20 29 28 17

CUA Leu 5 4 9 14 7 8 9 11

CUG Leu 50 50 5 11 40 40 23 11

AAA Lys 74 76 80 58 42 38 32 48

AAG Lys 26 24 20 42 58 62 68 52

AUG Met 100 100 100 100 100 100 100 100

UUU Phe 60 57 75 59 46 46 37 51

UUC Phe 40 43 25 41 54 54 63 49

CCU Pro 16 16 37 31 28 32 24 38

CCC Pro 16 12 9 15 33 32 22 11

CCA Pro 13 19 46 42 27 28 25 33

CCG Pro 55 53 8 12 11 8 30 17 ucu Ser 12 15 26 26 18 21 16 28

UCC Ser 17 15 5 16 22 23 21 13

UCA Ser 11 12 31 21 15 14 15 20

UCG Ser ^• 16 15 6 10 6 5 15 10

AGU Ser 13 15 23 16 15 15 12 16 Codon Coded amino acid Λ (a) * 100

Sr EC LL SC HS CG OS AT

AGC Ser 30 28 10 11 24 22 21 13

ACU Thr 12 17 36 35 24 26 22 34

ACC Thr 43 43 14 21 36 38 32 20

ACA Thr 11 13 38 30 28 28 23 31

ACG Thr 34 27 12 14 12 8 22 15

UGG Trp 100 100 100 100 100 100 100 100

UAU Tyr 60 57 74 56 44 44 39 52

UAC Tyr 40 43 26 44 56 56 61 48

GUU Val 22 26 48 39 18 17 24 41

GUC Val 26 22 16 21 24 24 30 19

GUA Val 16 15 23 21 11 12 10 15

GUG Val 13 37 14 19 47 46 36 26

The way in which the nucleotide exchanges are introduced into N-terminal codons to be modified can be carried out by any suitable means available in the prior art. These preferably include, among other things, a conventional mutagenesis method, such as, for example, PCR mutagenesis (for example using mutated primers or the errors introduced by the polymerase), site-specific mutagenesis (“site-directed mutagenesis”), ligation mutagenesis , chemical mutagenesis by means of suitable chemicals or mutagenesis by homologous recombination.

A further aspect of the present invention then relates to a nucleic acid molecule in which N-terminal codons have been replaced by synonymous codons which are rare for the respective recombinant expression system and which is produced by means of one of the methods according to the invention mentioned above.

Accordingly, a further aspect of the present invention relates to a DNA or RNA vector molecule which comprises at least one or more nucleic acid molecule (s) as mentioned above and which can be expressed in a suitable expression system. This expression is carried out by the inserted mutations in a controlled or adapted manner.

Another aspect of the present invention relates to a host cell or a host organism that expresses a DNA or RNA vector molecule according to the present invention. All expression systems mentioned above can be used as organisms. Pro or eukaryotic single cells, such as, for example, Gram-positive or Gram-negative bacteria, yeasts, insect cell lines and mammalian cell lines, such as, for example, CHO cells, V79 cells, COS cells, human cell lines or monkey cell lines, are particularly preferred. A further aspect of the present invention then relates to a method for expressing a recombinant polypeptide in an expression system, comprising the steps of a) providing the gene for the polypeptide to be recombinantly expressed, b) providing a suitable expression system, c) performing one method according to the invention as mentioned above, d) introducing the mutated gene from step c) into the suitable expression system, and e) expression of the gene and obtaining the polypeptide to be expressed recombinantly from the expression system. In addition to the otherwise specified circumstances and conditions, the type of introduction into the expression system in step d) depends on the particular expression construct that is to be introduced into the system. Types of transformation or transfection are known to those skilled in the art and include chemical and physical transfer methods such as, but not limited to, electroporation, particle transfer, liposome transfer, infection, conjugation, coprecipitation method or DMSO-mediated transformation. The receipt and expression of the polypeptide to be recombinantly expressed from the expression system in step e) also depends, inter alia, on the type of expression system and the polypeptide to be expressed. In some cases this can also be cleaned from the culture medium. Furthermore, the expressed protein can be contained in body fluids such as blood and urine or in animal products such as milk. A large number of corresponding cleaning methods are known to the person skilled in the art. These can easily be adjusted accordingly. The same applies to expression, whether constitutive or induced, for example by temperature or other factors. A last aspect of the present invention then relates to the recombinant polypeptide which is obtained by a process according to the invention.

The invention will now be described further with reference to the accompanying figures and the sequence listing, without being restricted thereto. The figures show:

1 shows an immunoblot of the cytosol of the Salmonella typhimurium strains TA1538

(O), TA1538-1A2 * 1 (* 1), TA15381A2 * 1Z (* 1Z), TA1538-1A2 * 2 (* 2) and TA15381A2 * 1Y (* 2Y). In the left four lanes, the amount of cytosol (ug protein) was adjusted to the expression level of the respective strain (which was estimated from previous experiments), in the right four lanes an equal amount of cytosol (4 ug protein) was used for all strains. FIG. 2 shows an immunoblot of the cytosol of the Salmonella typhimurium strains TA1538.

2Blb (clones 1 and 2) (lb / 1, lb / 2), and TA15382Blb * lX (clones 1-4) (XI, X2, X3, X4). The same amount of cytosol (30 μg protein) was used for both strains and different clones were analyzed according to the numbering.

FIG. 3 shows an immunoblot of the cytosol of the Escherichia coli strains XL1-1A2 * 1 (* 1),

XL1-1A2 * 1Z (* 1Z), XL1-1A2 * 2 (* 2) and XL1-1A2 * 1Y (* 2Y). The same amount of cytosol (5 μg) was used for all strains.

FIG. 4 an immunoblot of the cytosol of the E. coli strains XLl-2Blb (lb) (XL1-

2Blb * lX (X). The same amount of cytosol (30 µg protein) was used for both strains.

SEQ ID No. 1 shows forward primer (FI) 5'-GAG CTC AGG ACC ATG GAG CTG ATC,

SEQ ID No. 2 shows the reverse primer (R1) 5 * -ACT CTC TCT AGA GTG ACC CCA GGA

GC,

SEQ ID No. Figure 3 shows forward primer (F4): 5'-AACAGACC ATG GAG CTA ATA CAA GAC

ATA TCA AGG CCG CCA C,

SEQ ID No. Figure 4 shows forward primer (F5): 5'-AACAGACC ATG GAG CTA ATA CAA GAC

ACA TCA AGG CCG CCA C,

SEQ ID No. Figure 5 shows forward primer (F2): 5'-GAAGAAGAACCCTATGACCAAC.

SEQ ID No. 6 shows forward primer (F3) 5'-CTC AGG ACC ATG GAG CTG ATC CAG

GAC ATC TCT,

SEQ ID No. 7 shows forward primer (F6): 5'-TCCCTAGTCGACGCCATGGCGTCTCCC,

SEQ ID No. 8 shows reverse primer (R2): 5'-

ACTGACAAGCTTATTATGAGGGTCGTGG, and

SEQ ID No. 9 shows forward primer (F7): 5'-GAC GGA CCA GCA GAG CCA CAA ATA

CCA GGA CTA TGG GAC.

Examples

Isolation of SULTlA2 * 2cDNA

SULT1A2cDNA was isolated from human liver samples using the reverse transcriptase (RT) polymerase chain reaction (PCR). Total RNA was under isolated using the RNeasy mini kit from Qiagen (Hilden, Germany). 2 μg of total RNA were subjected to an RT with Superscript ™ II (Lifetechnologies, Rockville, MD, USA) using an 18-mer oligo-DT primer (Bio TEZ, Berlin, Germany) at 42 ° C. for one hour , 2 μl of the RT reaction product were amplified for SULT1 A cDNA in subsequent PCR using two units of Kombipol ™ -DNA polymerase mix (Invitec, Berlin, Germany) in a final volume of 50 μl according to the recommendations of Manufacturer uses. The forward primer (FI) 5'-GAG CTC AGG ACC ATG GAG CTG ATC (SEQ ID No. 1) introduced an Nco I site at the position of the translation start codon of SULTA2. The reverse primer (R1) 5'-ACT CTC TCT AGA GTG ACC CCA GGA GC (SEQ ID No. 2) introduced a 3'-Xba I restriction site in the 3 'flanking region. The reaction conditions for the PCR were: 5 minutes at 95 ° C for denaturation, 1 minute at 94 ° C for the later denaturation steps, 1 minute at 60 ° C for annealing and 1 minute at 72 ° C for extension (30 cycles); and a final extension step at 72 ° C for 10 minutes. Due to the high sequence homology, this primer would amplify all SULT1 A cDNAs that are present in the sample. Therefore, a Barn HI (MBI-Fermentas, Wilnius, Lithuania) restriction digest was carried out followed by 1% agaraoe gel electrophoresis in order to specifically digest and resolve the SULTA1 cDNA. The remaining 900 bp full length SULT cDNA was extracted from the gel using the Qiaex II gel extraction kit (Qiagen) and then used as a template for a second PCR under the same conditions to enrich the PCR product for SULT1A2.

Construction of SULT1A2 * 1 cDNA

The procedure of isolating SULT1A2 cDNA was carried out separately with liver samples from two subjects. In both cases, only SULT1 A2 * 2 cDNA was obtained. Therefore, SULT1A2 * 1 cDNA was constructed by site-directed in vitro mutagenesis of SULT1A2 * 2 cDNA in two successive PCR reactions. In the first PCR, the codon for Thr (ACC) was mutated to an Asn codon (AAC) using the internal forward primer (F2): 5'-GAAGAAGAACCCTATGACCAAC (SEQ ID No. 5). Using the same reverse primer (R1) used to isolate SULT1A2 * 2, the PCR resulted in a 3'-terminal 224 bp fragment which was then used as the reverse primer (R2) in a second PCR step has been. The forward primer (F3) 5'-CTCAGGACCATGGAGCTGATCCAGGACATCTCT (SEQ ID No. 6) in the second PCR reaction was designed so that codon 7 encoded Ile (ATC) instead Thr (ACC) and that a silent C to T mutation between SULT1A2 * 2 and SULT1A2 * 1, which was described in the sequence database, was also introduced. The resulting long length product was cloned into the modified prokaryotic expression vector pKK233-2 using the 5'-Nco I and the 3'-Xba / restriction site. Sequencing confirmed that the subcloned cDΝA was identical to that reported in the database for SULT1A2 * 1 (HAST4v) (Genbank, accession number U28169).

Synonymous exchange of codons in SULT1A2 * 1 and SULT1A2 * 2 cDΝA

In order to change the expression levels of the SULT1A2 * 1 and * 2 proteins, some codons after the translation start codon were exchanged for those which are rarely used by S. typhimurium. The codon usage data was obtained from http: Wwww.carzusa.or.jp/codon/. For the generation of SULT1A2 * 1Z, the forward primer F4 5'-AACAGACC ATG GAG CTA ATA CAA GAC ATA TCA AGG CCG CCA C (SEQ ID Νo. 3), together with Rl (SEQ ID Νo. 2) as the reverse primer and SULT1A2 * 1 cDΝA used as a template. For the generation of SULT1A2 * 2Y, the sequence of the forward primer F5 5'-AACAGACC ATG GAG CTA ATA CAA GAC ACA TCA AGG CCG CCA C (SEQ ID Νo. 4) was used and the PCR was carried out with the reverse primer R1 (SEQ ID Νo . 2) and the SULT1 A2 * 2 cDΝA template. In both cases the PCR conditions were the same as for the previous constructs. Using this procedure, the following codons were exchanged in both cDΝAs: ³ Leu CTG (54% use under synonymous codons) to CTA (4%), ⁴ Ile ATC (47%) to ATA (7%), ⁵ Glu CAG (73 %) to CAA (27%), ⁹ Arg CGC (42%) to AGG (1%). The natural codon for ⁸ Ser differs between the two allelic variants: SULT1A2 * 1 TCT (14%) and SULT1A2 * 2 TCC (19%). This was exchanged for TCA (9%) in both artificial cDΝAs. The changed region also includes codon 7, which codes for different amino acids in the two allelic variants. The following synonymous exchanges were carried out: ⁷ Ile ATC (47%) to ATA (7%) in SULT1A2 * 1 and ⁷ Thr ACC (45%) to ACA (10%) in SULT1A2 * 2. These artificial cDΝAs, which are synonymous with SULT1A2 * 1 and SULT1A2 * 2, were named SULT1A2 * 1Z and SULT1A2 * 2Y, respectively.

Construction of an expression vector for SULT1A2

The vector pKK233-2 had proven to be suitable for the constructive expression of SULT in E. coli and S. typhimurium. However, the polylinker region of this vector only exists from three restriction sites, Nco I (at the 5 'end), Pst I and Hind III. This caused a problem because SULT1A2 cDNA has three internal Pst I sites and one Hind III restriction site. In order to obtain an alternative restriction site for the 3 'end of the cDNA, an Nco VPvu I fragment of pKK233-2 was replaced by the corresponding fragment of the prokaryotic expression vector pTRC99A (Pharmacia), which is a derivative of pKK233-2 and which pUC18 polylinker site exchanged. The sequence of the modified pKK233-2 vector is identical to pKK233-2, except for the polylinker site of the newly inserted fragment from pTRC99A.

The direct use of pTRC99A was avoided because this plasmid codes for a Lacl ^q repressor protein. Therefore, expression of cDNA from this vector is dependent on induction by galactose analogs. pKK233-2 and the modified pKK233-2 vector lack this Lac-I ^q repressor sequence, which therefore enables constructive expression in S. typhimurium TA1538 which does not express any endogenous LacI ^q repressor.

Isolation and cloning of the SULT2Blb cDNA

SULTBlb cDNA was isolated from human placenta samples using RT-PCR. The reverse transcription was carried out analogously to the SULTlA2 isolation. For the specific amplification of the SULT2Blb cDNA, the forward primer F6 5'-TCC CTA GTC GAC GCC ATG GCG TCT CCC (SEQ ID No. 7) and the reverse primer R2 5'-ACT GAC AAG CTT ATT ATG AGG GTC GTG G (SEQ ID No . 8) which insert an Nco I at the 5 'end of the amplicate and an Hin dlll restriction site at the 3' end. The number of PCR cycles was increased to 40, otherwise the PCR was carried out as described for SULT1A2. The PCR resulted in a homogeneous amplification, which was ligated via the introduced restriction sites into the p-KK233-2 vector, which had also been digested with Nco I / Hin dlll, and which could be transfected into E. coli. An E. coli clone could be isolated in which the cDNA inserted into the pKK233-2 Velctor matched the SULT2Blb reference sequence (GenBank, accession number U92315). The plasmid was then transferred into S. typhimurium TA1538 analogously to the SULT1A2 plasmids.

Synonymous exchange of codons in the SULTBlb cDNA

The wild-type SULT2Blb cDNA was only weakly expressed in S. typhimurium. 6-20 times more protein compared to other SULT had to be used for the Western blot to get a clear signal. In order to change the expression level of the SULT2Blb protein, a few codons after the translation start codon were exchanged for those which are rarely used by S. typhimurium, analogously to the method described. For the generation of SULT2Blb * lX, the forward primer F7 5'-GAC GGA CCA GCA GAG CCA CAA ATA CCA GGA CTA TGG GAC (SEQ ID No. 9), together with R2 (SEQ ID No. 8) as the reverse primer and SULT2Blb cDNA used as a template. The PCR conditions were the same as in the preparation of the wild-type cDNA; however, only 30 cycles were performed. Using this procedure, the following codons were exchanged in the SULT2Blb cDNA: ⁴ Gly GGG (16%) to GGA (12%), ⁵ Pro CCC (16%) to CCA (13%), ⁶ Ala GCC (30%) GCA (13%), ⁸ Pro CCC (16%) to CCA (13%) ⁹ Gln CAG (71%) to CAA (29%), and ¹⁰ Ile ATC (41%) to ATA (9%), ^π Pro CCG (55%) to CCA (13%) and ¹² Leu TTG (12%) to CTA (5%). This artificial cDNA, which is synonymous with SULT2Blb * l, was named SULT2Blb * lX. Primer F7 did not contain the Nco I site and the translation start codon to limit the length. In order to clone the cDNA into the vector pKK233-2 and to place the start codon in the same reading frame for the SULT2Blb * lX cDNA, the vector was restricted with Nco I. The resulting overhang of the opposite strand was filled in with DNA polymerase I (Klenow fragment), so that a smooth end with the sequence ATG was formed. The SULT2Blb * lX cDNA was then cloned into the vector with its smooth 5 'end and the Hin dlll restricted 3' end.

immunoblots

Cytosolic proteins (1-30 ug per lane) were resolved by SDS-polyacrylamide (110 mg / ml gel electrophoresis) according to the Lämmli method. After electrophoresis, the Hyobond ECL membrane proteins (Amersham Pharmacia Biotech, Little Chalfont, UK) were transferred. Two immune sera were used to detect SULT1 A2. An immune serum obtained in sheep against purified human SULT1 A3 protein recognized all human SULTIA proteins. The second immune serum was obtained in rabbits against a peptide (15 amino acids) contained in SULT1A1 and SULT1A2, but not in SULT1A3. Therefore, the serum only recognizes the first two forms. For the detection of SULT2Blb, an immune serum obtained in rabbits against the splice variant SULT2Bla was used, which also recognizes SULT2Blb, but no other human SULT. The bands recognized by the antibody were analyzed using stronger chemiluminescence (Amersham) visualized with the help of the Fuji LAS-lOOO imaging system (Raytests, Straubenhardt, Germany).

Expression in E. coWKL-1

In addition to the expression in S. typhimurium, the expression of the cDNAs described in E. coli Kl 2 strain XL-1 was also examined. For this purpose, the galactose analogue IPTG (1 mM) was added to the medium in order to induce the expression of the cDNAs. E. coli also showed an increase in expression when using rare codons, which was even stronger than in S. typhimurium.

credentials

1. Zhang, SP, Zubay, G, Goldman, E. Low-usage codons in Escherichia coli, yeast, fruit fly and primates. Gene, 1991; 105: 61-72.

2. Goldman, E, Rosenberg, AH, Zubay, G, Studier, FW. Consecutive low-usage leucine codons block translation only when near the 5 'end of a message in Escherichia coli. J Mol Biol, 1995; 245: 467-73.

3. Zhang, S, Goldman, E, Zubay, G. Clustering of low usage codons and ribosome movement. JTheor Biol, 1994; 170: 339-54.

4. Rosenberg, AH, Goldman, E, Dünn, JJ, Studier, FW, Zubay, G. Effects of consecutive AGG codons on translation in Escherichia coli, demonstrated with a versatile codon test system. JBacteriol, 1993; 175: 716-22.

5. Lakey, DL, Voladri, RK, Edwards, KM, Hager, C, Samten, B, Wallis, RS, et al. Enhanced production of recombinant Mycobacterium tuberculosis antigens in Escherichia coli by replacement of low-usage codons. Infect Immun, 2000; 68: 233-8.

6. Nakamura, Y, Gojobori, T, Ikemura, T. Codon usage tabulated from international DNA sequence databases: Status for the year 2000. Nucleic Acids Res, 2000; 28: 292.

Claims

claims

1. Method for changing the expression of polypeptides in recombinant expression systems, in which N-terminal codons in a gene to be expressed are replaced by a) synonymous and b) codons rare for the respective recombinant expression system.

2. The method of claim 1, wherein the change in expression is an increase or decrease in expression.

3. The method according to claim 1 or 2, characterized in that at least one of the N-terminal codons 1 to 20 of the N-terminus is replaced.

4. The method according to claim 3, characterized in that at least one of the N-terminal codons 1 to 10 of the N-terminus is replaced.

5. The method according to any one of claims 1 to 4, characterized in that the expression system is selected from fungi, non-human animals and their tissues, plants and their tissues or pro- or eukaryotic individual cells, cell-free expression systems, protoplasts or baculovirus systems.

6. The method according to claim 5, characterized in that the expression system is selected from fungi, non-human animals and their tissues, such as for example Sophia, Caenorhabditis, sheep, cows, goats, rabbits, mice, rats, hamsters, zebra fish , Monkeys and pigs, as well as organs of these animals.

7. The method according to claim 5, characterized in that the expression system is selected from plants and their tissues, such as Arabidopsis, lupins, rice, potatoes, corn, rape, tomato, their leaves and callus cultures of the plants, and organs of the plants.

8. The method according to claim 5, characterized in that the expression system is selected from pro- or eukaryotic single cells, such as Gram-positive or Gram-negative bacteria, yeast, insect cell lines and mammalian cell lines, such as, for example, CHO cells, V79 cells, COS cells, human cell lines or monkey cell lines.

9. The method according to claim 8, characterized in that the Gram-positive or Gram-negative bacteria are selected from Bacillus subtilis, Lactococcus, Escherichia coli, Salmonella typhimurium, Caulobacter, Pseudomonas or Streptomycetes and the yeasts are selected from Saccharomyces, Hansenula and Pichia ,

10. The method according to any one of claims 1 to 9, characterized in that the gene to be expressed is selected from bacterial genes, eukaryotic cDNAs and viral genes.

11. The method according to claim 10, characterized in that the gene to be expressed is selected from the genes for hormones, cytokines, antibiotics, proteases, amylases, lipases, cellulases, insecticides, antibodies and fragments thereof, polymerases, restriction enzymes, enzymes are involved in the synthesis of secondary metabolites in plants or fungi and selection markers.

12. The method according to claim 11, characterized in that the gene to be expressed is selected from the genes for insulin, chitosan, chymosin, lysozyme, interferons, interleukins, growth hormones, erythropoietin, foreign matter-processing enzymes and transmembrane transporters.

13. The method according to claim 11, characterized in that the gene to be expressed is selected from the genes for xenobiotics metabolizing enzymes, such as cytochrome P-450, alcoholdehydrogenases, glutathione transferases, N-acetyltransferases, UDP-glucuronosyltransferases and sulfotransferases (SULT ).

14. The method according to any one of claims 1 to 13, characterized in that the expression system is Salmonella typhimurium LT2, and in the gene to be expressed at least one Ν-terminal codon for alanine by GCU or GCA, for arginine by AGA or AGG or CGA or CGG, for glutamine by CAA, for glycine by GGA or GGG, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUC or CUA, for lysine by AAG, for proline by CCU or CCC or CCA, for serine by UCU or UCC or UCA or AGU, for threonine by ACU or ACA and for valine by GUA or GUG.

15. The method according to any one of claims 1 to 13, characterized in that the expression system is Escherichia coli K12, and in the gene to be expressed at least one N-terminal codon for alanine by GCU, for arginine by AGA or AGG or CGA or CGG, for glutamate by GAG, for glycine by GGA or GGG, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUC or CUA, for lysine by AAG, for proline by CCU or CCC or CCA, for serine by UCA, for Threonine is replaced by ACU or ACA and for valine by GUA.

16. The method according to any one of claims 1 to 13, characterized in that the expression system is Lactococcus lactis, and in the gene to be expressed at least one N-terminal codon for alanine by GCC or GCG, for arginine by AGG or CGC or CGG, for Asparagine by AAC, for aspartate by GAC, for cysteine by UGC, for glutamine by CAG, for glutamate by GAG, for glycine by GGC or GGG, for histidine by CAC, for isoleucine by AUA or AUC, for leucine by CUC or CUG or CUA, for lysine by AAG, for phenylalanine by UUC, for proline by CCC or CCG, for serine by UCG or UCC, for threonine by ACC or ACG, for tyrosine by UAC and for valine by GUC or GUG.

17. The method according to any one of claims 1 to 13, characterized in that the expression system is Saccharomyces cerevisiae, and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGC or CGA or CGG, for glutamine CAG, for glutamate by GAG, for glycine by GGC or GGG, for leucine by CUU or CUC or CUG or CUA, for proline by CCC or CCG, for serine by UCG or AGC, for threonine by ACG and for valine by GUG ,

18. The method according to any one of claims 1 to 13, characterized in that the expression system is derived from Homo sapiens, and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGU or CGA, for glutamine CAA, for glutamate with GAG, for glycine with GGU, for isoleucine with AUA, for leucine with UUA or UUG or CUU or CUA, for proline with CCG, for serine with UCG, for threonine with ACG and for valine with GUU or GUA becomes.

19. The method according to any one of claims 1 to 13, characterized in that the expression system Critelus griseus or is derived therefrom, and in the gene to be expressed at least one N-terminal codon for alanine by GCG, for arginine by CGU or CGA, for Glutamine by CAA, for glutamate by GAG, for glycine by GGU, for isoleucine by AUA, for leucine by UUA or UUG or CUU or CUA, for proline by CCG, for serine by UCA or UCG, for threonine by ACG and for valine GUU or GUA is replaced.

20. The method according to any one of claims 1 to 13, characterized in that the expression system Oryza sativa or is derived therefrom, and in the gene to be expressed at least one N-terminal codon for alanine by GCA, for arginine by CGU or CGA, for Glycine is replaced by GGU or GGA, isoleucine by AUA, leucine by UUA or CUA, lysine by AAA, serine by AGU and valine by GUA.

21. The method according to any one of claims 1 to 13, characterized in that the expression system is Arabidopsis thaliana or is derived therefrom, and in the gene to be expressed at least one N-terminal codon for alanine by GCC or GCG, for arginine by CGC or CGA or CGG, for aspartate by GAC, for glycine by GGC or GGG, for isoleucine by AUA, for leucine by UUA or CUA or CUG, for proline by CCC or CCG, for serine by UCC or UCG or AGC, for threonine by ACG and for valine is replaced by GUC or GUA.

22. The method according to any one of claims 1 to 21, characterized in that the N-terminal codons by a conventional mutagenesis method, such as a PCR mutagenesis, site-specific mutagenesis, ligation mutagenesis, chemical mutagenesis or mutagenesis by homologous recombination, be replaced.

23. Nucleic acid molecule in which N-terminal codons have been replaced by synonymous codons rare for the respective recombinant expression system, produced by a method according to one of claims 1 to 22.

24. DNA or RNA vector molecule which comprises at least one or more nucleic acid molecule (s) according to claim 23 and which is expressible in an expression system.

25. A host cell that expresses a DNA or RNA vector molecule according to claim 24.

26. Host cell according to claim 25, selected from pro- or eukaryotic single cells, such as, for example, Gram-positive or Gram-negative bacteria, yeasts, insect cell lines and mammalian cell lines, such as, for example, CHO cells, V79 cells, COS cells or human or monkey cell lines.

27. A method for expressing a recombinant polypeptide in an expression system, comprising a) providing the gene for the polypeptide to be recombinantly expressed, b) providing a suitable expression system, c) performing a method according to one of claims 1 to 22, d ) Introducing the mutated gene from step c) into the suitable expression system, and e) expressing the gene and obtaining the polypeptide to be expressed recombinantly from the expression system.

28. Recombinant polypeptide obtained by a method according to approach 27.