WO2004050695A2

WO2004050695A2 - Expression of polypeptides in filamentous fungi

Info

Publication number: WO2004050695A2
Application number: PCT/DK2003/000838
Authority: WO
Inventors: Trier Mogens Hansen
Original assignee: Novozymes A/S
Priority date: 2002-12-05
Filing date: 2003-12-05
Publication date: 2004-06-17
Also published as: WO2004050695A3; AU2003286128A1; AU2003286128A8

Abstract

The invention relates to expression of polypeptides in fungi by inserting or adding a peptide extension of one or more amino acid residues between the signal peptide and the polypeptide of interest. The said peptide extension may for example be the propertied sequence of lipase B from candida antarctica (ATPLVKR) or modified forms thereof.

Description

TITLE: EXPRESSION OF POLYPEPTIDES IN FILAMENTOUS FUNGI

FIELD OF THE INVENTION

The present invention is directed to processes of homologous and/or heterologous production of a polypeptide of interest in a filamentous fungus. The processes provide increased yields of the polypeptide of interest. The invention is also directed towards modified polypeptides, DNA constructs encoding the modified polypeptide, vectors, and filamentous fungal host cells suitable for use in the process of the invention. Finally the invention relates to the use of a DNA sequence of the invention in a process of the invention.

BACKGROUND OF THE INVENTION

The use of recombinant host cells for expression of polypeptides has made industrial use of polypeptides including enzymes feasible. Even though mammalian and yeast host cells are the most commonly used eukaryotic host cells, filamentous fungal host cells are also widely used today. The production yields have been improved significantly over the last few decades, but there is still a need for increasing the production yields.

DEFINITIONS

In the context of the present invention the term "upstream" when used in relation to a nucleic acid sequence (e.g. a DNA sequence) or an amino acid sequence is to be understood as one or more nucleotide(s) or one or more amino acid(s) physically located on the proximal site of any given point in relation to the 5' -> 3' or N-terminal ->C-terminal direction of the nucleic acid or amino acid sequence, respectively.

SUMMARY OF THE INVENTION

The present invention is directed towards providing a process for homologous and/or heterologous production of a polypeptide of interest in a filamentous fungal host cell.

The inventor found that increased production yields of a p olypeptide o f i nterest m ay b e obtained by first providing a modified DNA sequence by inserting a DNA sequence encoding one or more amino acid residues in between a DNA sequence encoding the mature polypeptide of interest and an adjacent upstream DNA sequence encoding a N-terminal signal peptide, respectively; then introducing said modified DNA sequence into a parent filamentous fungus host cell to provide a transformant; culturing said transformant under conditions resulting in expression and secretion of the polypeptide of interest, isolating the polypeptide of interest. Thus, in a first aspect the invention relates to a process for producing a polypeptide of interest in a filamentous fungus, which process comprises: (a) providing a modified DNA sequence by inserting a DNA sequence encoding one or more amino acid residues in between a DNA sequence encoding a mature polypeptide of interest and the adjacent upstream DNA sequence encoding the N-terminal signal peptide;

(b) introducing said modified DNA sequence provided in step (a) into a parent filamentous fungal host cell providing a transformant;

(c) culturing said transformant obtained in step (b) under conditions resulting in expression and secretion of the polypeptide of interest,

(d) isolating the polypeptide of interest.

In another embodiment the invention relates to a process for producing a polypeptide of interest in a filamentous fungus of a parent filamentous fungus, which parent filamentous fungus, comprises a DNA sequence encoding a polypeptide of interest adjacent to a D NA sequence encoding an N-terminal signal peptide, which process comprises:

(a) providing a transformant of the parent filamentous fungus capable of expressing the polypeptide of interest, wherein the transformant comprises the DNA sequence of the parent filamentous fungus encoding the polypeptide of interest and further having a DNA sequence encoding one or more amino acids inserted in between the DNA sequence encoding the polypeptide and the DNA sequence encoding the adjacent upstream signal peptide so that the expressed polypeptide of interest has one or more amino acids inserted between the polypeptide of interest and the N-terminal signal peptide,

(b) culturing the transformant obtained in step (a) under conditions conducive to the production of the polypeptide of interest;

(c) isolating the secreted polypeptide of interest from the culture medium.

The filamentous fungal host cell may in a preferred embodiment be of the genus Aspergillus, Fusarium, Trichoderma, Penicillium or Humicola.

In still another aspect the invention relates to a modified polypeptide consisting of a polypeptide of interest and a N-terminal signal peptide having one or more amino acid residues or a stretch of amino acid residues located in between the polypeptide of interest and the N- terminal signal peptide in comparison to the parent polypeptide of interest consisting of the corresponding polypeptide of interest and the corresponding N-terminal signal peptide.

The invention also relates to a DNA sequence or a DNA construct encoding a modified polypeptide according to the invention.

In another aspect the invention also relates to a recombinant expression vector which carries a DNA sequence or DNA construct of the invention. Further, the invention relates to a mutant filamentous fungal host cell which is transformed with a DNA sequence, DNA construct or expression vector of the invention. The invention also relates to the use of a DNA sequence of the invention in a process of producing polypeptides of the invention.

Finally the invention relates to a filamentous host cell carrying a DNA sequence, DNA construct or expression vector of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the expression yields of modified DNA sequences according to the invention.

DETAILED DESCRIPTION OF THE INVENTION The process of the invention

The present inventor has found that by inserting a DNA sequence encoding one or more amino acids in between the DNA sequences encoding a polypeptide of interest and an adjacent N-terminal signal peptide improved yields is obtained.

According to the first aspect the invention relates to a process for producing a polypeptide of interest in a filamentous fungus, which process comprises:

(a) providing a modified DNA sequence by inserting a DNA sequence encoding one or more amino acid residues in between a DNA sequence encoding a polypeptide of interest and the adjacent upstream DNA sequence encoding the N-terminal signal peptide;

(d) isolating the polypeptide of interest.

In another embodiment the invention relates to a process for producing a polypeptide of interest in a filamentous fungus of a parent filamentous fungus, which parent filamentous fungus, comprises a DNA sequence encoding a polypeptide of interest adjacent to a D NA sequence encoding an N-terminal signal peptide, which process comprises: (a) providing a transformant of the parent filamentous fungus capable of expressing the polypeptide of interest, wherein the transformant comprises the DNA sequence of the parent filamentous fungus encoding the polypeptide of interest and further having a DNA sequence encoding one or more amino acids inserted in between the DNA sequence encoding the polypeptide and the DNA sequence encoding the adjacent upstream signal peptide so that the expressed polypeptide of interest has one or more amino acids inserted between the polypeptide of interest and the N-terminal signal peptide, (b) culturing the transformant obtained in step (a) under conditions conducive to the production of the polypeptide of interest; (c) isolating the secreted polypeptide of interest from the culture medium.

The inserted DNA sequence encodes one or more amino acids or a stretch of amino acid residues consisting of from 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 to 50 or more amino acids, in particular 3- 25 amino acids, preferably 4-10 amino acids, especially 5 to 7 amino acids. The inserted DNA sequence may encode any natural amino acids, i.e., amino acid residues selected from the group consisting of Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), Asp, (D), Asn (N), Cys (C), Glu (E), Gin (Q), Gly (G), His (H), lie (I), Met (M), Phe (F), Ser (S), Tyr (Y), and Trp (W), preferably Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg ( R), e specially Ala (A) or Leu (L). If the inserted DNA sequence encodes two or more amino acids, e.g. a stretch of amino acids, said amino acids may be the same amino acid or they m ay d ifferent a mino a cids. P referred a mino a cid r esidues o r s tretches o f a mino acids include A; AT; ATP; ATPL, ATPLV, ATPLVK; ATPLVKR (SEQ ID NO. 8); ATPLVAA (SEQ ID NO.9); ATGLVKR (SEQ ID NO.11 ); ATELVKR (SEQ ID No.12); L; LP; LPA; LPAP (SEQ ID NO. 10). The "polypeptide of interest" may be any polypeptide. In particular it may be an enzyme, such as a carbohydrase (E.C. 3.2.1 , an enzyme capable of catalysing hydrolysis of O-or S- glycosyl compounds), particularly a dextranase (E.C. 3.2.1.11 , an enzyme capable of catalyzing endohydrolysis of 1 ,6-alpha glucosidic linkages in dextran), a lactase (E.C. 3.2.1.108, an enzyme capable of catalyzing the reaction of: H₂O + lactose -> D-galactose + D- glucose), an amylase, such as alpha-amylase (E.C.3.2.1.1 , an enzyme capable of catalyzing endohydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides containing three or more 1 ,4-alpha-linked D-glucose units), beta-amylase (E.C. 3.2.1.2, an enzyme capable of catalyzing h ydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides so as to remove successive maltose units from the non-reducing ends of the chains), maltogenic amylase (E.C.3.2.1.133, an enzyme capable of catalyzing hydrolysis of (1->4)-alpha-D-glucosidic linkages in polysaccharides so as to remove successive a-maltose residues from the non- reducing ends of the chains), galactanase (E.C.3.2.1.23, an enzyme capable of catalyzing hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides or E.C.3.2.1.89, an enzyme capable of catalyzing endohydrolysis of 1 ,4-D-galactosidic linkages in arabinogalactans), such as a galactanase derived from the genus Humicola, in particular Humicola insolens. In the context of the present invention, the term "E.C." (Enzyme Class) refers to the internationally recognized enzyme classification system, Recommendations (1992) of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, Academic Press, Inc., 1992. The polypeptide of interest may also be albumin, e.g. human serum albumin. The polypeptide of interest may be foreign or native to the parent filamentous fungus host cell, wherein the term "foreign" refers to a polypeptide which is not expressed naturally by the fungus, while the term "native" refers to a polypeptide expressed naturally by the fungus. If the polypeptide is foreign to the host cell the production of the polypeptide is also referred to as heterologous production, and if the polypeptide is native to the host cell, the production of the polypeptide is also referred to as homologous to the host cell.

The filamentous fungus host cell may be as described below.

HOST CELLS The host cell of the invention is a filamentous fungus.

The h ost cell of t he i nvention e ither comprises a D NA s equence, D NA c onstruct o r an expression vector of the invention. It is advantageous to use a host cell of the invention in recombinant production of a polypeptide of interest. The cell may be transformed with the DNA construct of the invention encoding the polypeptide of interest, conveniently by integrating the DNA construct in one or more copies into the host chromosome. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA construct into the host chromosome may be performed according to conventional methods, e.g., by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described below in connection with the different types of host cells.

The term "filamentous fungal host cell" refers in the context of the present invention both to a host cell carrying a DNA sequence encoding a modified polypeptide of the invention, or a DNA construct comprising said DNA sequence or an expression vector comprising said DNA sequence or DNA construct and to a host cell into which a modified DNA sequence of the invention is introduced according to a method of the present invention.

The term "parent filamentous fungus" refers in the context of the present invention to a fungal cell comprising a DNA sequence encoding a polypeptide of interest adjacent to a DNA sequence encoding an N-terminal signal peptide.The following examples of host cells is intended also to be examples of parent filamentous fungus.

Filamentous fungal Host Cells

The host cell of the invention is a filamentous fungus represented by one of the following groups of Ascomycota, include, e.g., Neurospora, Eupenicillium {=Penicillium), Emehcella (=Aspergillus), Eurotium (=Aspergillus). In a preferred embodiment, the filamentous fungus belongs to one of the filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK. The filamentous fungi are characterized by a vegetative mycelium composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In a more particular embodiment, the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, and Trichoderma or a teleomorph or synonym thereof. In an even more particular embodiment, the filamentous fungal host cell is an Aspergillus cell. In another even more particular embodiment, the filamentous fungal host cell is an Acremonium cell. In another even more particular embodiment, the filamentous fungal host cell is a Fusarium cell. In another even more particular embodiment, the filamentous fungal host cell is a Humicola cell. In another even more particular embodiment, the filamentous fungal host cell is a Mucor cell. In another even more particular embodiment, the filamentous fungal host cell is a Myceliophthora cell. In another even more particular embodiment, the filamentous fungal host cell is a Neurospora cell. In another even more particular embodiment, the filamentous fungal host cell is a Penicillium cell. In another even more particular embodiment, the filamentous fungal host cell is a Thielavia cell. In another even more particular embodiment, the filamentous fungal host cell is a Tolypocladium cell. In another even more particular embodiment, the filamentous fungal host cell is a Trichoderma cell. In a most particular embodiment, the filamentous f ungal h ost cell i s a n A spergillus a wamori, A spergillus foetidus, Aspergillus japonicus, Aspergillus aculeatus, Aspergillus niger or Aspergillus oryzae cell. In another particular embodiment, the filamentous fungal host cell is a Fusarium cell of the section Discolor (also known as the section Fusarium). For example, the filamentous fungal host cell may be a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum (in the perfect state named Gibberella zeae, previously Sphaeria, synonym with Gibberella roseum and Gibberella roseum f.sp. ceralis), Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium trichothecioides or Fusarium venenatum cell. In another preffered embodiment, the filamentous fungal host cell is a Fusarium strain of the section Elegans, e.g., Fusarium oxysporum. In another most particular embodiment, the filamentous fungal host cell is a Humicola insolens or Humicola lanuginosa cell. In another most particular embodiment, the filamentous fungal host cell is a Mucor miehei cell. In another most particular embodiment, the filamentous fungal host cell is a Myceliophthora thermophilum cell. In another most particular embodiment, the filamentous fungal host cell is a Neurospora crassa cell. In another most particular embodiment, the filamentous fungal host cell is a Penicillium purpurogenum, Penicillium chrysogenum or Penicillium funiculosum (WO 00/68401) cell. In another most particular embodiment, the filamentous fungal host cell is a Thielavia terrestris cell. In another most particular embodiment, the Trichoderma cell is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cell. In a particular embodiment of the invention the filamentous fungal host cell is a protease deficient or protease minus strain. This may for example be the protease deficient strain Aspergillus oryzae JaL 125 having the alkaline protease gene named "alp" deleted. This strain is described in WO 97/35956 (Novozymes), or EP patent no. 429,490, or the TPAP free host cell, in particular a strain of A. niger, disclosed in WO 96/14404. Further, also host cells, especially A. niger or A. oryzae, with reduced production of the transcriptional activator (prtT) as described in WO 01/68864 are specifically contemplated according to the invention. The host cell may also be toxin and/or mycotoxin free, for instance, free of cyclopiazonic acid, kojic acid, 3- nitropropionic acid and/or aflatoxins. Examples of such strains are disclosed in WO 00/39322 (from Novozymes A/S) Also filamentous fungal host cells (as described in WO 98/01470) comprising a DNA construct comprising a DNA sequence encoding a transcription factor exhibiting activity in regulating the expression of an alpha-amylase promoter in a filamentous fungus is contemplated according to the invention. Another example of a suitable filamentous host cell is the JaL355 cell described in example 1 of PA 2003 00169.

Transformation of Filamentous Fungal Host Cells

Filamentous fungal host cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023, EP 184,438, and Yelton et a/., 1984, Proceedings of the National Academy of Sciences USA 81 :1470-1474. A suitable method of transforming Fusarium species is described by Malardier et al., 1989, Gene 78:147-156 or in co-pending US Serial No. 08/269,449.

CONTROL SEQUENCES

The term "control sequences" is defined herein to include all components, which are necessary or advantageous for expression of the coding sequence of the DNA (nucleic acid) sequence encoding the polypeptide of interest. Each control sequence may be native or foreign to the DNA (nucleic acid) sequence encoding the polypeptide of interest. Such control sequences include, but are not limited to, a leader, transcription initiation site, a polyadenylation sequence, a pro-peptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, i.e. to enable expression of the polypeptide of interest; the control sequences include a promoter, and transcriptional and translational stop s ignals. T he control sequences may be provided with linkers, e.g., for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the DNA sequence encoding a polypeptide.

The DNA sequence encoding the polypeptide of interest may be operably linked to one or more of said control sequence(s), wherein the term "operably linked" is to be understood as said control sequence(s) affects the transcription and/or translation of the DNA sequence encoding the polypeptide of interest.

PROMOTERS

The control sequence may be an appropriate promoter sequence, a DNA (nucleic acid) sequence, which is recognized by a host cell for expression of the DNA sequence encoding the polypeptide of interest. The promoter sequence contains transcriptional and translational control sequences, which mediate the expression of the polypeptide of interest. The promoter may be any DNA (nucleic acid) sequence, which shows transcriptional activity in the host cell of choice and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

Filamentous Fungal Promoters

Examples of suitable promoters for directing the transcription of the DNA (nucleic acid) constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus nidulans those phosphate isomerase, Aspergillus oryzae alkaline protease, Aspergillus oryzae those phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium oxysporum trypsin-like protease (as described in U.S. Patent No. 4,288,627, which is incorporated herein by reference), and hybrids thereof. Particularly preferred promoters for use in filamentous fungal host cells are the TAKA amylase, NA2-tpi (a hybrid of the promoters from the genes encoding Aspergillus niger neutral alpha-amylase and Aspergillus nidulans those phosphate isomerase), and glaA promoters.

TRANSCRIPTION TERMINATORS

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the DNA (nucleic acid) sequence encoding the polypeptide of interest. Any terminator, which is functional in the host cell of choice, may be used according to the present invention.

Fungal Terminators

Preferred terminators for filamentous fungal host cells are obtained from the genes encoding Aspergillus niger neutral alpha-amylase, Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha- glucosidase, and Fusarium oxysporum trypsin-like protease.

LEADER SEQUENCES

The control sequence may also be a suitable leader sequence, a non-translated region of mRNA, which is important for translation by the host cell. T he l eader s equence i s o perably linked to the 5' terminus of the DNA (nucleic acid) sequence encoding the polypeptide of interest. Any leader sequence, which is functional in the host cell of choice, may be used in the present invention.

Fungal Leader Sequences

Preferred leaders for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase and Aspergillus oryzae those phosphate isomerase (TPI) and combinations thereof.

POLYADENYLATION SEQUENCES

The control sequence may also be a polyadenylation sequence, a sequence which is operably linked to the 3' terminus of the DNA (nucleic acid) sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence, which is functional in the host cell of choice, may be used in the present invention.

Fungal Polyadenylation Sequences

Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, and Aspergillus niger alpha-glucosidase.

SIGNAL PEPTIDE

The control sequence may also be a signal peptide-coding region, which codes for a n amino acid sequence linked to the amino terminus of the mature polypeptide, which can direct the expressed polypeptide of interest into the cell's secretory pathway. The 5' end of the coding sequence of the DNA (nucleic acid) sequence may inherently contain a signal peptide-coding region naturally linked in translation reading frame with the segment of the coding region, which encodes the secreted protein. Alternatively, the 5' end of the coding sequence may contain a signal peptide-coding region, which is foreign to that portion of the coding sequence, which encodes the secreted protein. The foreign signal peptide-coding region may be required where the coding sequence does not normally contain a signal peptide-coding region. Alternatively, the foreign signal peptide-coding region may simply replace the natural signal peptide-coding region in order to obtain enhanced secretion of the protein(s) relative to the natural signal peptide- coding region normally associated with the coding sequence. The signal peptide-coding region may be obtained from a glucoamylase or an amylase gene from an Aspergillus species, a lipase or proteinase gene from a Rhizomucor species, the gene for the alpha-factor from Saccharomyces cerevisiae, an amylase or a protease gene from a Bacillus species, or the calf preprochymosin gene. However, any signal peptide-coding region capable of directing the expressed protein into the secretory pathway of a host cell of choice may be used in the present invention.

Fungal Signal Peptide Sequences An effective signal peptide coding region for filamentous fungal host cells is the s ignal peptide coding region obtained from Aspergillus oryzae TAKA amylase gene, Aspergillus niger neutral amylase gene, the Rhizomucor miehei aspartic proteinase gene, the Humicola lanuginosa cellulase gene, the Candida antactica lipase B gene or the Rhizomucor miehei lipase gene.

PROPEPTIDE SEQUENCES

The control sequence may also be a pro-peptide coding region, which codes for an amino acid sequence positioned at the amino terminus of a polypeptide of interest. The resultant polypeptide is known as a pro-enzyme or pro-polypeptide (or a zymogen in some cases). A pro- polypeptide is often inactive and can be converted to mature active polypeptide by catalytic or autocatalytic cleavage of the pro-peptide from the pro-polypeptide. The pro-peptide coding region may be obtained from the Bacillus subtilis a lkaline p rotease g ene ( aprE), the Bacillus subtilis neutral protease gene (nprT), the Saccharomyces cerevisiae alpha-factor gene, the Candida antactica lipase B gene, Thermomyces lanuginosus lipase gene or the Myceliophthora thermophilum laccase gene (WO 95/33836).

The DNA (nucleic acid) constructs of the present invention may also comprise one or more DNA (nucleic acid) sequences, which encode one or more factors that are advantageous in the expression of the polypeptide of interest, e.g., an activator (e.g., a trans-acting factor), a chaperone, and a processing protease. Any factor that is functional in the host cell of choice may be used in the present invention. The nucleic acids encoding one or more of these factors are not necessarily in tandem with the DNA (nucleic acid) sequence encoding the polypeptide of interest.

An activator is a protein, which activates transcription of a nucleic acid sequence encoding a polypeptide (Kudla et al., 1990, EMBO Journal 9:1355-1364; Jarai and Buxton, 1994, Current Genetics 26:2238-244; Verdier, 1990, Yeast 6:271-297). The nucleic acid sequence encoding an activator may be obtained from the genes encoding Bacillus stearothermophilus NprA (nprA), Saccharomyces cerevisiae heme activator protein 1 (hapl), Saccharomyces cerevisiae galactose metabolizing protein 4 (gal4), and Aspergillus nidulans ammonia regulation protein {areA), and A. oryzae amyR. For further examples, see Verdier, 1990, supra and MacKenzie et al. , 1993, Journal of General Microbiology 139:2295-2307. A chaperone is a protein, which assists another polypeptide in folding properly (Haiti et al.,

1994, TIBS 19:20-25; Bergeron et ai, 1994, TIBS 19:124-128; Demolder et al., 1994, Journal of Biotechnology 32:179-189; Craig, 1993, Science 260:1902-1903; Gething and Sambrook, 1992, Nature 355:33-45; Puig and Gilbert, 1994, Journal of Biological Chemistry 269:7764-7771 ; Wang and Tsou, 1993, The FASEB Journal 7:1515-11157; Robinson et al., 1994, Bio/Technology 1 :381-384). The nucleic acid sequence encoding a chaperone may be obtained from the genes encoding Bacillus subtilis GroE proteins, Aspergillus oryzae protein disulphide isomerase, Saccharomyces cerevisiae calnexin, Saccharomyces cerevisiae BiP/GRP78, and Saccharomyces cerevisiae Hsp70. For further examples, see Gething and Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York, and Hartl et al. , 1994, TIBS 19:20-25.

A processing protease is a protease that cleaves a pro-peptide to generate a mature biochemically active polypeptide (Enderlin and Ogrydziak, 1994, Yeast 10:67-79; Fuller ef a/., 1989, Proceedings of the National Academy of Sciences USA 86:1434-1438; Julius et ai, 1984, Cell 37:1075-1089; Julius et al., 1983, Cell 32:839-852). The nucleic acid sequence encoding a processing protease may be obtained from the genes encoding Aspergillus niger Kex2, Saccharomyces cerevisiae dipeptidylaminopeptidase, Saccharomyces cerevisiae Kex2, and Yarrowia lipolytica dibasic processing endoprotease (xprβ), tripeptidyl aminopeptidase (TPAP)(WO 96/14404), and the A. oryzae dipeptidyl aminopeptidase.

REGULATORY SEQUENCES

It may also be desirable to add regulatory sequences, which allow the regulation of the expression of the polypeptide of interest relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and the Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those, which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene, which is amplified in the presence of methotrexate, and the metallothionein genes, which are amplified with heavy metals. In these cases, the DNA (nucleic acid) sequence encoding the polypeptide of interest would be placed in tandem with the regulatory sequence.

DNA CONSTRUCT

The present invention also relates to a DNA sequence encoding a modified polypeptide of the invention (see below) and a DNA construct comprising said DNA sequence. Furthermore, the present invention also relates to a recombinant expression vector which comprises said DNA sequence or said DNA construct, wherein the DNA sequence of DNA construct may be operably linked to control elements facilitating expression of the modified polypeptide. Said DNA sequence, DNA construct or recombinant expression vector may be used in a method of the present invention. As used herein the term "DNA construct or nucleic acid construct" is intended to indicate any nucleic acid molecule of cDNA, genomic DNA, synthetic DNA or RNA origin. The term "construct" is i ntended t o i ndicate a n ucleic a cid s egment w hich m ay b e s ingle- o r d ouble- stranded, and which may be based on a complete or partial naturally occurring nucleotide sequence encoding a polypeptide of interest. The construct may optionally contain other nucleic acid segments.

The DNA of interest may suitably be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library and screening for DNA sequences coding for all or part of the polypeptide by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al., supra). The nucleic acid construct may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981 ), 1859 - 1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.

Furthermore, the nucleic acid construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire nucleic acid construct, in accordance with standard techniques.

The n ucleic a cid construct may also be prepared by polymerase chain reaction using specific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491.

EXPRESSION VECTORS

The present invention also relates to recombinant expression vectors comprising a DNA (nucleic acid) sequence of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the polypeptide at such sites. Alternatively, the nucleic acid sequence of the present invention may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression, and possibly secretion.

The recombinant expression vector may be any vector (e.g., a plasmid or virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the DNA (nucleic acid) sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extra-chromosomal entity, the replication of which i s independent of chromosomal replication, e.g., a plasmid, an extra-chromosomal element, a mini- chromosome, a cosmid or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) i nto which it has been integrated. The vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.

Markers

The vectors of the present invention preferably contain one or more selectable markers, which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

Examples of selectable markers for use in a filamentous fungal host cell may be selected from the group including, but not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), and glufosinate resistance markers, as well as equivalents from other species. Preferred for use in an Aspergillus cell are the amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae and the bar marker of Streptomyces hygroscopicus. Furthermore, selection may be accomplished by co-transformation, e.g., as described in WO 91/17243, where the selectable marker is on a separate vector.

The vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome of the cell.

The vectors of the present invention may be integrated into the host cell genome when introduced into a host cell. For integration, the vector may rely on the DNA (nucleic acid) sequence encoding the polypeptide of interest or any other element of the vector for stable integration of the vector into the genome by homologous or none homologous recombination. Alternatively, the vector may contain additional DNA (nucleic acid) sequences for directing integration by homologous recombination into the genome of the host cell. The additional DNA (nucleic acid) sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1 ,500 base pairs, preferably 400 to 1 ,500 base pairs, and most preferably 800 to 1 ,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination. These nucleic acid sequences may be any sequence that is homologous with a target sequence in the genome of the host cell, and, furthermore, may be non-encoding or encoding sequences.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. For replication in fungi the episomal replicating AMA1 plasmid vector disclosed in WO 00/24883 may be used.

More than one copy of a DNA (nucleic acid) sequence encoding a polypeptide of interest may be inserted into the host cell to amplify expression of the DNA (nucleic acid) sequence. Stable amplification of the DNA (nucleic acid) sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome using methods well known in the art and selecting for transformants.

The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention comprising the insertion of one or more amino acid residues in between the polypeptide of interest and the signal peptide are well known to one skilled in the art (see, e.g., Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).

Expression of the polypeptide of interest

The polypeptide of interest may be produced by inserting a DNA sequence encoding one or more amino acid residues of the invention in between a DNA sequence encoding a polypeptide of interest and an adjacent upstream DNA sequence encoding an N-terminal signal peptide and producing the polypeptide by the processes of the invention. The modified DNA sequence comprising the one or more amino acid residues of the invention may by integrated on the chromosome of the host cell or be expressed from an expression vector. An expression vector typically includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and optionally a repressor gene or various activator genes. The resulting polypeptide of interest may be recovered by methods known in the art. For example, the polypeptide of interest may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulphate precipitation), SDS- PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

MODIFIED POLYPEPTIDE The present invention also relates to a modified polypeptide comprising or consisting of a polypeptide of interest and a N-terminal signal peptide having one or more amino acid residues or a stretch of amino acid residues located in between the polypeptide of interest and the N- terminal signal peptide in comparison to the parent polypeptide of interest comprising or consisting of the corresponding polypeptide of interest and the corresponding N-terminal signal peptide.

In particular, from 1 ,2,3,4,5,6,7,8,9, or 10 to 50 amino acids, in particular 3-25 amino acids, preferably 4-10 amino acids, especially 5 to 7 amino acids are inserted in between the polypeptide of interest and the N-terminal signal peptide in the modified polypeptide. The amino acid located in between the polypeptide of interest and the N-terminal signal peptide in the modified may be one or more of Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), Asp, (D), Asn (N), Cys (C), Glu (E), Gin (Q), Gly (G), His (H), lie (I), Met (M), Phe (F), Ser (S), Tyr (Y), and Trp (W), preferably Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), especially Ala (A) or Leu (L). More particularly the amino acid residue or stretch of amino acid residues inserted into the modified polypeptide is one selected from the group consisting of:

A; AT; ATP; ATPL, ATPLV, ATPLVK; ATPLVKR (SEQ ID NO. 8); ATPLVAA (SEQ ID NO.9); ATGLVKR (SEQ ID NO.11 ); ATELVKR (SEQ ID No.12); L; LP; LPA; LPAP (SEQ ID NO. 10). The polypeptide of interest in the modified polypeptide may be may be any polypeptide. In particular it may be an enzyme, such as a carbohydrase (E.C. 3.2.1 , an enzyme capable of catalysing hydrolysis of O-or S-glycosyl compounds), particularly a dextranase (E.C. 3.2.1.11 , an enzyme capable of catalyzing endohydrolysis of 1 ,6-alpha glucosidic linkages in dextran), a lactase (E.C. 3.2.1.108, an enzyme capable of catalyzing the reaction of: H₂O + lactose -> D- galactose + D-glucose), an amylase, such as alpha-amylase (E.C.3.2.1.1 , an enzyme capable of catalyzing endohydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides containing three or more 1 ,4-alpha-linked D-glucose units), beta-amylase (E.C. 3.2.1.2, an enzyme capable of catalyzing hydrolysis of 1 ,4-alpha-D-glucosidic linkages in polysaccharides so as to remove successive maltose units from the non-reducing ends of the chains), maltogenic amylase (E.C.3.2.1.133, an enzyme capable of catalyzing hydrolysis of (1->4)-alpha-D- glucosidic linkages in polysaccharides so as to remove successive a-maltose residues from the non-reducing ends of the chains), galactanase (E.C.3.2.1.23, an enzyme capable of catalyzing hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D- galactosides or E.C.3.2.1.89, an enzyme capable of catalyzing endohydrolysis of 1 ,4-D- galactosidic linkages in arabinogalactans), such as a galactanase derived from the genus Humicola, in particular Humicola insolens. In the context of the present invention, the term "E.C." (Enzyme Class) refers to the internationally recognized enzyme classification system, Recommendations (1992) of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, Academic Press, Inc., 1992. The polypeptide of interest may also be albumin, e.g human serum albumin.

MATERIALS AND METHODS Material:

Media

YPD: 10 g yeast extract, 20 g peptone, H₂O to 900 ml. Autoclaved, 100 ml 20% glucose (sterile filtered) added. YPM: 10 g yeast extract, 20 g peptone, H₂O to 900 ml. Autoclaved, 100 ml 20% maltodextrin

(sterile filtered) added.

10 x Basal salt: 75 g yeast nitrogen base, 113 g succinic acid, 68 g NaOH, H₂O ad 1000 ml, sterile filtered.

SC-URA: 100 ml 10 x Basal salt, 28 ml 20% casamino acids without vitamins, 10 ml 1% tryptophan, H₂O ad 900 ml, autoclaved, 3.6 ml 5% threonine and 100 ml 20% glucose or 20% galactose added.

SC-agar: SC-URA, 20 g/l agar added.

SC-variant agar: 20 g agar, 20 ml 10 x Basal salt, H₂O ad 900 ml, autoclaved

AZCL galactan (Megazyme, Australia)

Host cell:

Aspergillus oryzae strain BECh2 disclosed in WO 00/39322 (from Novozymes A S)

Aspergillus oryzae JaL355 disclosed in PA 2003 00169 example 1.

DH10b commercially available cells from Invtitrogen.

Plasmids:

Unmodified and modified DNA sequences according to the invention in example 1 were cloned in the expression plasmid pCaHj 527 disclosed in WO 01/12794 (From Novozymes A/S). pCR4 blunt commercially available from Invitrogen. pENI2516 disclosed in PA 2003 00169 example 2. pMT1335 disclosed in Hoegh I et al. (1995), Can. J. Bot. 73(Suppl. 1), S870.

Primers:

Primer 190203J1 (SEQ ID NO. 13): ATGGACGGATCCACAATGAAGTGGGTAACCTTTATTTCC Primer 190203J2 (SEQ ID NO. 14): ATGGACCCGCGGCTCGAGTTATAAGCCTAAGGCAGCTTGACTTGC Primer 19670 (SEQ ID NO.16): CCCCATCCTTTAACTATAGCG Primer 19672 (SEQ ID NO. 17): CCACACTTCTCTTCCTTCCTC Primer 090903J1 (SEQ ID NO. 18): GCCACTCCTTTGGTGAAGCGTGATGCACACAAGAGTGAGGTT Primer 090903J4 (SEQ ID NO. 19): ACGCTTCACCAAAGGAGTGGC

Methods:

Transformation of Asperpillus oryzae (general procedure) 100 mL of YPD (Sherman et al., (1981 ), Methods in Yeast Genetics, Cold Spring Harbor

Laboratory) were inoculated with spores of A. oryzae and incubated with shaking for about 24 hours. The mycelium was harvested by filtration through miracloth and washed with 200 mL of 0.6 M MgSO The mycelium was suspended in 15 mL of 1.2 M MgSO 10 mM NaH2PO4, pH 5.8. The suspension was cooled on ice and 1 mL of buffer containing 120 mg of Novozym™

234 was added. After 5 min., 1 mL of 12 mg/mL BSA (Sigma type H25) was added and incubation with gentle agitation continued for 1.5-2.5 hours at 37C until a large number of protoplasts are visible in a sample inspected under the microscope.

The suspension was filtered through miracloth, the filtrate transferred to a sterile tube and overlayed with 5 mL of 0.6 M sorbitol, 100 mM Tris-HCI, pH 7.0. Centrifugation was performed for 15 min. at 1000 g and the protoplasts were collected from the top of the MgSO4 cushion. 2 volumes of STC (1.2 M sorbitol, 10 mM Tris-HCI, pH 7.5, 10 mM CaC-2) were added to the protoplast suspension and the mixture is centrifugated for 5 min. at 1000 g. The protoplast pellet was resuspended in 3 mL of STC and repelleted. This was repeated. Finally, the protoplasts were resuspended in 0.2-1 mL of STC.

100 microL of protoplast suspension were mixed with 5-25 micro g of p3SR2 (an A. nidulans amdS gene carrying plasmid described in Hynes et al., Mol. and Cel. Biol., Vol. 3, No. 8, 1430-1439, Aug.1983) in 10 microL of STC. The mixture was left at room temperature for 25 min. 0.2 mL of 60% PEG 4000 (BDH 29576), 10 mM CaCI₂ and 10 mM Tris-HCI, pH 7.5 was added and carefully mixed (twice) and finally 0.85 mL of the same solution were added and carefully mixed. The mixture was left at room temperature for 25 min., spun at 2.500 g for 15 min. and the pellet was resuspended in 2 mL of 1.2M sorbitol. After one more sedimentation the protoplasts were spread on minimal plates (Cove, (1966), Biochem. Biophys. Acta 113, 51-56) containing 1.0 M sucrose, pH 7.0, 10 mM acetamide as nitrogen source and 20 mM CsCI to inhibit background growth. After incubation for 4-7 days at 37C spores were picked, suspended in sterile water and spread for single colonies. This procedure is repeated and spores of a single colony after the second re-isolation were stored as a defined transformant.

Fed batch fermentation

Fed batch fermentation is performed in a medium comprising maltodextrin as a carbon source, urea as a nitrogen source and yeast extract. The fed batch fermentation is performed by inoculating a shake flask culture of A. oryzae host cells in question into a medium comprising 3.5% of the carbon source and 0.5% of the nitrogen source. After 24 hours of cultivation at pH 5.0 and 34°C the continuous supply of additional carbon and nitrogen sources are initiated. The carbon source is kept as the limiting factor and it is secured that oxygen is present in excess. The fed batch cultivation is continued for 4 days, after which the enzymes can be recovered by centrifugation, ultrafiltration, clear filtration and germ filtration. Further purification may be done by anionexchange chromatographic methods known in the art.

Screening of A. oryzae transformants for galactanase activity

The tranformants is plated on SC agar containing 0.1% AZCL galactan (Megazyme, Australia) and 2% Galactose and incubated for 3-5 days at 30°C. Galactanase positive colonies are identified as colonies surrounded by a blue halo.

Galactanase activity assay

The Molecular weight and iso-electric point of the enzymes was determined as described in WO 94/21785.

The activities of the enzymes were measured either by the release of reducing sugars from lupin galactan (MegaZyme, Australia) or by the release of blue colour from AZCL-potato- galactan (MegaZyme, Australia).

0.5ml 0.4% AZCL-potato-galactan was mixed with 0.5ml 0.1 M citrate/phosphate buffer of optimal pH and 10 microL of a suitably diluted enzyme solution was added. Incubations were carried out in Eppendorf Thermomixers for 15 minutes at 30°C (if not otherwise specified) before heat-inactivation of the enzymes at 95°C for 20 minutes. Enzyme incubations were carried out in triplicate and a blank was produced in which enzyme was added but immediately inactivated. After centrifugation the absorbance of the supernatant was measured in microtiter plates at 620 nm and the blank value was subtracted.

0.5% solutions of lupin galactan were made in 0.1 M citrate/phosphate of the optimal pH (if not otherwise specified), 10 microL of suitably diluted enzyme solution was added to 1 ml of substrate and incubations were carried out at 30°C for 15 minutes before heat-inactivation at 95°C for 20 minutes. Reducing sugars were determined by reaction, in microtiter plates, with a PHBAH reagent comprising 0.15 g of para hydroxy benzoic acid hydrazide (Sigma H-9882), 0.50g of potassium-sodium tartrate (Merck 8087) and 2% NaOH solution up to 10.0ml. Results of blanks were subtracted. Galactose was used as a standard. pH and temperature optimums were measured on AZCL-galactan. 0.1 M citrate/phosphate buffers of pH (2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0) were used for determination of pH optimum. In order to determine the temperature optimum, 0.1 M citrate/phosphate buffers at optimal pH were used for reaction at different temperatures for 15 minutes. Km and specific activity was found by carrying out incubations at lupin galactan concentrations (S) ranging from 0.025 to 1.5% and measure the reducing sugars produced, then calculate the reaction rate (v), picture S/v as a function of S, carry out linear regression analysis, finding the slope (=1Λ max) and the intercept (Km/Vmax) and calculating Km and the specific activity (=Vmax/E), where E is the amount of enzyme added.

EXAMPLES

Example 1

Expression of Humicola insolens galactanase in Aspergillus oryzae having a propeptide consisting of 2-7 amino acid residues inserted between the signalpeptide and the mature peptideseguence.

Standard DNA manipulation techniques were used to produce DNA constructions encoding combinations of a signal peptide, an optional propeptide, and the mature H. insolens DSM 1800 galactanase (see SEQ ID NO: 1 and Fig. 1 ). The various signal-propeptide- galactanase encoding sequences were inserted between the promoter and transcription terminator sequences of the expression plasmid pCaHj527 to give the expression plasmids denoted pMTxxxx in Fig. 1. Each of the expression plasmids constructed was transformed into Aspergillus oryzae strain BECh2 by the method described above. 30 transformants were isolated for each expression plasmid. All of the isolated transformants were grown in shake flasks and screened for the yield of galactanase activity on SC-agar plates with the AZCL galactanase assay. The highest yielding transformant(s) from each expression plasmid were selected for preservation and were given strain numbers of the format MTxxxx (see Fig. 1). These selected strains were subsequently grown in fermentors as described above and the yield of galactanase activity determined. In Fig. 1 the yields are given in grams of galactanase per liter of culture supernatant. Assay conditions and specific activity for the H. insolens galactanase were as given in WO 97/32014. Example 2

Cloning of the gene encoding Human Serum albumin (HSA).

A PCR reaction was performed with the primer 190203J1 (SEQ ID NO. 13) and primer 190203J2 (SEQ I D N O. 1 4) and Human adult male liver first strand cDNA as template using the Pwo- polymerase (Roche) and with the following conditions: one cycle at 94 degrees C for 5 min, 25 cycles of (94 degrees C for 30 sec, 55 degrees C for 30 sec, 72 degrees C for 3 min), and one cycle of 72 degrees C for 7 min. The resulting PCR fragment was cloned into pCR4 blunt using the TOPO kit as recommended by manufacture (Invitrogen, cat no. 601059) resulting in plasmid pENI3046.

The plasmid pENI3046 was cut with BamHI and Sacll and the gene was isolated from agarose gel. The plasmid pENI2516 (disclosed in PA 2003 00169 example 2) was cut with BamHI and Sacll and this vector was isolated from an agarose gel. The vector (of pENI2516) and the HSA gene (from pENI3046) was ligated and transformed into DH10b. The resulting plasmid was named pENI3054. pEN 13054 was transformed into JaL355 and expression of the HSA gene was tested by running culture supernatant on SDS-PAGE.

Results: There was no detectable band around 66 kDa corresponding to HSA. Thus the JaL355 cells were not capable of expressing HSA.

Example 3

Cloning of DNA seguence encoding Candida antarctica lipase B signal peptide and prepropeptide upstream of the sequence encoding the secreted HSA. At first the following two PCR reactions were performed to create a) the HSA cDNA and b) a vector comprising the signal (SEQ ID NO.6) and propeptide (SEQ ID NO.8) sequence from the Candida Antarctica lipase B gene: a) A PCR reaction with Proof start (Qiagen) was run using pENI3054 as template and primer 19670 (SEQ ID NO. 16) and primer 090903J1 (SEQ ID NO. 18). PCR was run under the following conditions: one cycle at 94 degrees C for 5 min, 25 cycles of (94 degrees C for 30 sec, 55 degrees C for 30 sec, 72 degrees C for 3 min), and one cycle of 72 degrees C for 7 min. The resulting PCR fragment was purified from a 1.5 % agarose gel.

b) A PCR reaction with Proof start (Qiagen) was run using pMT1335 as template and primer 19672 (SEQ ID NO. 17) and 090903J4 (SEQ ID NO. 19). PCR was run under t he following conditions: o ne cycle at 94 degrees C for 5 min, 25 cycles of (94 degrees C for 30 sec, 55 degrees C for 30 sec, 72 degrees C for 3 min), and one cycle of 72 degrees C for 7 min. The resulting PCR fragment was purified on a 1.5 % agarose gel.

The purified PCR fragments from the above reactions a) and b) were purified and used as template with Primer 19670 (SEQ ID NO. 16) and 19672 (SEQ ID NO. 17) for another PCR reaction with Proof Start. PCR was run with the following conditions: one cycle at 94 degrees C for 5 min, 25 cycles of (94 degrees C for 30 sec, 55 degrees C for 30 sec, 72 degrees C for 3 min), and one cycle of 72 degrees C for 7 min.

The resulting PCR fragment and pENI2516 (vector) were both cut with BamHI and Xhol and purified on 1.5 % agarose gel. The vector and PCR fragment were ligated and transformed into

DH 10b cells (Invitrogen).

The resulting plasmid named pENI3235 was transformed into JaL355 and expression of HSA was tested by running the culture supernatant on SDS-PAGE.

Claims

1. A p rocess for p roducing a polypeptide of i nterest i n a f ilamentous f ungus, which p rocess comprises:

(d) isolating the polypeptide of interest.

2. A process for producing a polypeptide of interest in a filamentous fungus of a parent filamentous fungus, which parent filamentous fungus, comprises a DNA sequence encoding a polypeptide of interest adjacent to a DNA sequence encoding an N-terminal signal peptide, which process comprises:

(c) isolating the secreted polypeptide of interest from the culture medium.

3. The process according to any of the preceding claims, wherein the inserted DNA sequence encode one or more amino acid residues consisting of from 1 ,2,3,4,5,6,7,8,9, or 10 to 50 amino acids, in particular 3 -25 amino acids, preferably 4 -10 amino acids, especially 5 -7 amino acids.

4. The process according to any of the preceding claim, wherein the inserted DNA sequence encode one or more amino acid residues comprising an amino acid residue selected from the group consisting of Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), Asp, (D), Asn (N), Cys (C), Glu (E), Gin (Q), Gly (G), His (H), He (I), Met (M), Phe (F), Ser (S), Tyr (Y), and Trp (W), preferably Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), especially Ala (A) or Leu ( ).

5. The process according to any of the preceding claims, wherein the inserted DNA sequence encodes one or more amino acid residues, which amino acid residue(s) comprises: A; AT; ATP; ATPL, ATPLV, ATPLVK; ATPLVKR (SEQ ID NO. 8); ATPLVAA (SEQ ID NO.9); ATGLVKR (SEQ ID NO.11 ); ATELVKR (SEQ ID No.12); L; LP; LPA; LPAP (SEQ ID NO. 10).

6. The process according to any of the preceding claims, wherein the filamentous fungus is of the genus Aspergillus, preferably A. oryzae, A. niger, or A. awamori, Fusarium, such as Fusarium oxysporium, Fusarium graminearum (in the perfect state named Gribberella zeae, previously Sphaeria zeae, synonym with Gibberella roseum and Gibberella roseum f. sp. cerealis), or Fusarium sulphureum (In the prefect state named Gibberella puricaris, synonym with Fusarium trichothecioides, Fusarium bactridioides, Fusarium sambucium, Fusarium roseum, and Fusarium roseum var. graminearum), Fusarium cerealis (synonym with Fusarium crokkwellnse), or Fusarium venenatum, Trichoderma, preferably Trichoderma reesei or Trichoderma harzianum, Penicillium funiculosum or Penicillium chrysogenum, or Humicola.

7. The process according to any of the preceding claims, wherein the polypeptide of interest is a carbohydrase, such as a dextranase, a lactase, an amylase, such as alpha-amylase, beta- amylase, m altogenic a mylase, g alactanase, s uch a s a g alactanase derived from the genus Humicola, especially the species H. insolens or human serum albumin.

8. The process according to any of the preceding claims, wherein the polypeptide of interest is foreign or native to the parent filamentous fungus.

9. The process according to any of the preceding claims, wherein the filamentous fungus comprises a DNA sequence encoding the p olypeptide of i nterest o perably l inked to control elements, said control elements having functions facilitating gene expression, said control elements including one or more control elements selected from the group of a promoter, transcription initiation sites, transcription terminator sites, and polyadenylation functions.

10. The process according to any of the preceding claims, wherein the promoter is preceded by one or more upstream activating sequences.

11. The p rocess a ccording to a ny of the preceding claims, wherein the filamentous fungus comprises a selection marker, preferably A. nidulans amdS or A. oryzae pyrG.

12. A modified polypeptide consisting of a polypeptide of interest and a N-terminal signal peptide having one or more amino acid residues or a stretch of amino acid residues located in between the polypeptide of interest and the N-terminal signal peptide in comparison to the parent polypeptide of interest consisting of the corresponding polypeptide of interest and the corresponding N-terminal signal peptide.

13. The modified polypeptide of the preceding claim, wherein from 1 ,2,3,4,5,6,7,8,9, or 10 to 50 amino acids, in particular 3-25 amino acids, preferably 4-10 amino acids, especially 5 to 7 amino acids are inserted in between the polypeptide of interest and the N-terminal signal peptide.

14. The modified polypeptide of the preceding claims, wherein the amino acid located in between the polypeptide of interest and the N-terminal signal peptide is one or more of Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), Asp, (D), Asn (N), Cys (C), Glu (E), Gin (Q), Gly (G), His (H), lie (I), Met (M), Phe (F), Ser (S), Tyr (Y), and Trp (W), preferably Ala (A), Thr (T), Pro (P), Leu (L), Val (V), Lys (K), Arg (R), especially Ala (A) or Leu (L).

15. The modified polypeptide of any of the preceding claims, wherein the inserted amino acid residue or stretch of amino acid residues is one selected from the group consisting of: A; AT; ATP; ATPL, ATPLV, ATPLVK; ATPLVKR (SEQ ID NO. 8); ATPLVAA (SEQ ID NO.9); ATGLVKR (SEQ ID NO.11 ); ATELVKR (SEQ ID No.12); L; LP; LPA; LPAP (SEQ ID NO. 10).

16. The modified polypeptide of any of the preceding claims, wherein the polypeptide of interest is a carbohydrase, particularly a dextranase, a lactase, an amylase, such as alpha-amylase, beta-amylase, maltogenic amylase, galactanase, such as a galactanase derived from the genus Humicola, in particular the species H. insolens or human serum albumin.

17. A DNA sequence encoding a modified polypeptide according to any one of claims 12-16.

18. A DNA construct comprising a DNA sequence of claim 17 encoding a modified polypeptide of any one of claims 12-16.

19. A recombinant expression vector which comprises a DNA sequence of claim 17 or a DNA construct of claim 18 operably linked to control elements facilitating gene expression.

20. A filamentous fungal host cell, wherein the host cell carries a DNA sequence of claim 17 or a DNA construct of claim 18 or an expression vector of claim 19.

21. The cell of claim 20, wherein the cell is a filamentous fungus cell selected from the group consisting of a strain belonging to a species of Aspergillus, preferably Aspergillus oryzae, Aspergillus niger, Aspergillus awamori, or a strain of Fusarium, such as a strain of Fusarium oxyspoium, Fusarium graminearum (in the perfect state named Gribberella zeae, previously Sphaeria zeae, synonym with Gibberella roseum and Gibberella roseum f. sp. cerealis), or Fusarium sulphureum (In the prefect state named Gibberella puricaris, synonym with Fusarium trichothecioides, Fusarium bactridioides, Fusarium sambucium, Fusarium roseum, and Fusarium roseum var. graminearum), Fusarium cerealis (synonym with Fusarium crokkwellnse), or Fusarium venenatum, or Trichoderma, such as Trichoderma reesei or Trichoderma harzianum, Penicillium funiculosum or Penicillium chrysogenum, Fusarium or Humicola.

22. The cell of any of the preceding claims, wherein a DNA sequence of claim 17 or a DNA construct of claim 18 or an expression vector of claim 19 is integrated in one or more copies into the cell chromosome.

23. A use of a DNA sequence of claim 17 or a DNA construct of claim 18 or an expression vector of claim 19 in a process according to any of the claims 1-11.