WO2004050119A1 - Vaccine against enteropathogenic and enterohaemorragic escherichia coli - Google Patents

Abstract

A pharmaceutical composition, vaccine, food product or kit of parts comprising a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptides sequence, together with a pharmaceutically acceptable diluent or carrier. Vaccination with a single type of EspA is not considered to confer protective immunity, despite the high degree of sequence conservation. A combination vaccine may provide such protective immunity and may be useful in providing protection against bacterial infection.

Description

VACCINE AGAINST ENTEROPATHOGENIC AND ENTEROHAEMORRAGIC ESCHERICHIA COLI

The present invention relates to molecules, methods and vaccines for protection against bacterial infections, particularly those which cause food borne diseases.

Enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli are important causes of severe infantile diarrhoeal disease in many parts of the world. EPEC and EHEC colonise the gastrointestinal mucosa and, by subverting intestinal epithelial cell function, produce a characteristic histopathological feature known as the "attaching and effacing" (A/E) lesion. The A/E lesion is characterised by localised destruction (effacement) of brush border microvilli, intimate attachment of the bacterium to the host cell membrane and the formation of an underlying pedestal-like structure in the host cell. EPEC and EHEC are members of a family of enteric bacterial pathogens which use A/E lesion formation to colonise the host. E. coli capable of forming A/E lesions have also been recovered from diseased cattle (China et al (1999) Res Microbiol. 150(5):323-32), dog and cats (Beutin (1999) Vet Res 30(23), 285-98), rabbits (Jerse et al (1991) Infect Immun. 59(11), 3869-75) and pigs (An et al (2000) Microb Pathog. 28(5), 291-300). In mice, Citrobacter rodentium colonises gut enterocytes via A/E lesion formation and, like EHEC in humans, causes disease in the large bowel.

Enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli constitute a significant risk to human health worldwide. EPEC are the cause of severe infantile diarrhoeal disease in many parts of the developing world, while EHEC are the etiological agents of a food-borne disease that can cause acute gastro-enteritis, bloody diarrhoea, haemorrhagic colitis and haemolytic uraemic syndrome (HUS) (reviewed by Nataro and Kaper (1998) Clin Microbiol Rev 11, 142-201).

Several genes (and their encoded proteins) have been implicated in A/E lesion formation and all of these map to a 35 Kbp pathogenicity island termed the locus of enterocyte effacement or the "LEE" region (Frankel et al (1998) Mol Microbiol. 30(5), 911-21). The LEE pathogenicity island, which is present in EPEC, EHEC and C. rodentium, is necessary and sufficient for bacteria to promote the induction of A/E lesions on epithelial cells. The LEE region encodes a type III secretion system, three secreted proteins EspA, EspB and EspD, an outer membrane adhesin, intimin, and a translocated intimin receptor, Tir.

Significant progress has been made defining the molecular basis of EPEC- host cell interactions and defining the role of EPEC's virulence determinants in the regulation of host cell cytoskeletal rearrangement. However, very little is known about the host response to infection in either humans or animals. Indeed, it remains unclear whether humans or animals infected with these pathogens develop protective immunity. A better understanding of this neglected aspect of EPEC and EHEC infection is important for the design of new vaccines and novel approaches which prevent infection- driven diarrhoea. The absence of small animal models to study EPEC or EHEC directly has made the study of host response to infection problematic. In this case, conclusions about EPEC and EHEC need to be drawn from studies of other pathogens which colonise via A/E lesion formation. In this respect, C. rodentium infection of mice offers an advantage because of the wide availability of gene knockout strains and immunological reagents for this species. Whilst an imperfect model of EPEC and EHEC infection, C. rodentium infection of mice nevertheless represents the best small animal model in which to study lumenal microbial pathogens relying on A/E lesion formation for colonisation of the host. Like EPEC and EHEC, C. rodentium harbours a LEE pathogenicity island. This genetic locus contains eae and espB homologs that are essential for A/E lesion formation and colonisation of mice (Schauer et al (1993) Infect Immun. 61(11), 4654-61; Newman et al (1999) Citrobacter rodentium espB is necessary for signal transduction and for infection of laboratory mice. Infect Immun 67(11):6019-25). The A/E lesion induced by C. rodentium is ultrastructurally identical to those formed by EHEC and EPEC in animals and human intestinal in vitro organ culture (IVOC). In experimentally or naturally infected mice, large numbers of C. rodentium can be recovered from the colon and infection is associated with crypt hyperplasia, mucosal erosion and focal crypt abscesses.

For EHEC, EPEC and C. rodentium, intimate bacterial attachment is mediated through tight interaction between the outer membrane adhesion molecule intimin (Jerse et al. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA 1990 Oct;87(20):7839-4) and Tir, a receptor for intimin that is delivered to the host cell plasma membrane via a type III secretion system (TTSS) (Kenny et al Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 1997 Nov 14;91(4):511-20).

Following infection and assembly of the TTSS, EPEC and EHEC translocate a range of effector proteins to the eukaryotic cell (reviewed in Frankel et al. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol 1998 Dec;30(5):91 1-21). The injected proteins target different cellular compartments: EspF and EspG are believed to remain cytosolic (McNamara & Donnenberg. A novel proline- rich protein, EspF, is secreted from enteropathogenic Escherichia coli via the type III export pathway. F EMS Microbiol Lett 1998 Sep l;166(l):71-8; Elliott et al. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect Immun 2001 Jun;69(6):4027-33), Map targets the mitochondria (Kenny & Jepson. Targeting of an enteropathogenic Escherichia coli (EPEC) effector protein to host mitochondria. Cell Microbiol 2000 Dec;2(6):579-90) and Tir is delivered to the plasma membrane of the host cell where its central domain is exposed on the cell surface and serves as a receptor for intimin, while the amino and carboxy termini are intra-cellular (Kenny et al., 1997). Binding of intimin to Tir triggers dramatic intracellular changes including reorganisation of cytoskeletal proteins, actin polymerisation at the site of contact (Kenny et al., 1997), underneath adherent bacteria, and formation of a characteristic attaching and effacing (A/E) lesion (Frankel et al., 1998). Recently, based on sequence variation at the carboxy terminal 280 amino acids of intimin, comprising the receptor binding domain, we reported that intimin could be classified into distinct intimin types (Adu-Bobie et al. Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens).

EspA is one of the translocator TTSS proteins and a major or only component of a filamentous structure extending from the basic needle complex of the secretion apparatus, connecting the pathogen to the plasma membrane of the host cell (Ebel et al (1998) Mol Microbil 30, 147-161; Knutton et al (1998) EMBO J 17, 2166-2176). EspB and EspD are additional translocator proteins believed to form the translocation pore at the distal end of the EspA filaments (Wachter et al (1999) Mol Microbiol 31, 1695-1707; Wolff et al (1998) Mol Microbiol 28, 143-155). Under growth conditions that induced LEE gene expression, antibodies made against a recombinant EspA from EPEC strain E2348/69 stained the ~12 nm diameter EspA filaments (Knutton et al (1997) EMBO J 17, 2166-2176; Wilson et al. Role of EscF, a putative needle complex protein, in the type III protein translocation system of enteropathogenic Escherichia coli. Cell Microbiol 2001 Nov;3(l l):753-62) with, on average, each bacterium producing 12 EspA filaments (Daniell et al (2001) Cell Microbiol 3, 865-871). Although by scanning electron microscopy EHEC 0157 was reported to produce filaments resembling the EspA filaments of EPEC (Shaw et al. EspA filament-mediated protein translocation into red blood cells. Cell Microbiol 2001 Apr;3(4):213-22), no positive identification of EHEC EspA filaments has yet been made.

We confirm and positively identify expression of EspA filaments by EHEC. Further, we show, surprisingly, that EspA filaments produced by different strains are antigenically distinct, despite sharing a high degree of amino acid identity. We propose a combination EspA vaccine.

EspA is suggested as a vaccine component in WO 97/40063. WO 02/053181 suggests the use of EHEC cell culture supernatants (which may include EspA) in vaccines. Neither document suggests any need for a combination EspA vaccine.

A first aspect of the invention provides a pharmaceutical composition comprising a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence ( ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363); together with a pharmaceutically acceptable diluent or carrier.

By "EspA polypeptide" is included any full length naturally occurring EspA polypeptide or fragment thereof, or any variant either thereof which retains antigenic cross-reactivity with the naturally occuring EspA polypeptide or fragment thereof. The term "EspA" is well known to those skilled in the art, and includes a polypeptide which is a secreted protein from enteropathogenic or enterohemorrhagic E. coli and has a molecular mass of about 25 kDa as determined by SDS-PAGE. It is considered to be necessary for activating epithelial cell signal transduction, intimate contact and formation of A/E lesions. Examples of naturally occurring EspA polypeptides are given in the following: WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236, AF200363, NP_312583 (EspA EHEC 0157:H7), AAC38394 (EspA EPEC 0126:H6).

An EspA polypeptide may have at least 50%, 60% to 70%, 70% to 80%, 80 to 90% or 90 to 95% sequence identity with a naturally occurring EspA polypeptide sequence, for example as given in one of the listed accession numbers, for example in NP 312583 (EspA EHEC 0157:H7) or AAC38394 (EspA EPEC 0126:H6). In an embodiment, the EspA polypeptide has between 95% and 100% sequence identity with a naturally occurring EspA polypeptide sequence.

References providing methods of assessing sequence identity are discussed further below. A pharmaceutical composition of the invention may comprise a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two sequences of at least eight contiguous amino acids derivable from two different naturally occurring full length EspA polypeptides, and not being derivable from the same naturally occurring full length EspA polypeptide sequence. For example, the composition may comprise at least eight contiguous amino acids derivable from an EPEC Esp A and at least eight contiguous amino acids derivable from an EHEC EspA, with both sequences being present in neither the EPEC EspA nor the EHEC EspA. However, it is not essential that the amino acids are contiguous, as epitopes may be formed by secondary structures (ie may constitute amino acids from non-contiguous regions of the EspA) as well as or instead of linear epitopes, as well known to those skilled in the art. Antibodies raised against EPEC EspA are cross-reactive with EHEC EspA using denatured proteins (but not with native protein), suggesting that the antigenic variation might be due to secondary structures.

A pharmaceutical composition of the invention may comprise a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two epitopes derivable from two different naturally occurring full length EspA polypeptides and not being derivable from the same naturally occurring full length EspA polypeptide sequence. For example, the composition may comprise an epitope derivable from an EPEC Esp A and an epitope derivable from an EHEC EspA, with both epitopes being present in neither the EPEC EspA nor the EHEC EspA.

Epitope sequences may be identified by techniques well known to those skilled in the art. For example, epitope mapping techniques such as those described in Epitope Mapping Protocols (1996) Methods Mol Biol 66, Glenn E Morris, Ed, Humana Press, Totowa, New Jersey; US Patent No 4,708,871; Geysen et al (1984) PNAS 81, 3998-4002; Geysen et al (1986) Molec Immunol 23, 709-715 may be used. Linear or conformational epitopes may be identified using such methods, for example using X-ray crystallography or 2D nuclear magentic resonance-derived structural data. Antigenicity or hydrophobicity plots (such as generated using the OMIGA software available from Oxford Molecular Group, based on the algorithms of Hopp et al (1981) PNAS 78, 3824-3828 and Kyte et al (1982) J Mol Biol 157, 105-132) may also be useful in identifying epitopes.

Epitopes or compositions may be tested in the mouse/C rodentium model of infection in order to confirm the generation of an immune response and/or an effect on infection, colonisation, shedding and/or clearance.

If more than two EspA polypeptides are present in the composition, then each may be derivable from a different EspA polypeptide, but this is not essential, so long as there are two EspA polypeptides that are derivable from different EspA polypeptides and are not derivable from the same naturally occurring full length EspA. Thus, the composition may comprise two EspA polypeptides derived from a first naturally occurring full length EspA and a third Esp polypeptide derived from a second naturally occurring full length EspA.

It is preferred that an antibody crossreactive with a first EspA polypeptide in the composition and an antibody crossreactive with a second EspA polypeptide in the composition are not both crossreactive with the same naturally occurring full length EspA polypeptide. It is preferred that such antibodies are crossreactive with different naturally occurring full length EspA polypeptides. A second aspect of the invention provides a vaccine effective against bacterial infection, for example EHEC and/or EPEC infection, comprising an effective amount of the polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in relation to the preceding aspect of the invention.

A third aspect of the invention provides a food product comprising a foodstuff and a polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in relation to the preceding aspects of the invention.

A fourth aspect of the invention provides a kit of parts comprising a polypeptide and polynucleotide, polypeptides and/or polynucleotides as defined in relation to the preceding aspects of the invention and optionally a pharmaceutically acceptable diluent or carrier.

In relation to any of the preceding aspects of the invention, the polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination may comprise or encode a polypeptide or polypeptides which comprise or consist in combination of at least (1) EspA or a fragment thereof from a first bacterial strain and (2) EspA or a fragment thereof from a second bacterial strain, so long as the EspAs are not identical, or not identical over the length of any such fragment (which would have the effect of both EspA polypeptides being derivable from one of the bacterial EspAs).

Preferably the polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprise or encode a polypeptide or polypeptides in combination comprising or consisting of EspA polypeptides (preferably full length EspAs) derivable from at least two, three, four or all five of EHEC 026, EHEC O103, EHEC 0111, EHEC 0145 and EHEC 0157.

The composition, vaccine, kit of parts or food product may comprise a polypeptide or polypeptides which in combination comprise at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence. Alternatively, the composition, vaccine, kit of parts or food product may comprise a polynucleotide or polynucleotides in combination encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence. In a further alternative, the composition, vaccine, kit of parts or food product may comprise a polynucleotide (or polynucleotides) and a polypeptide (or polypeptides). For example, the polynucleotide may encode an EspA polypeptide of one type (for example an EHEC-derived EspA polypeptide), and the polypeptide may be an EspA polypeptide of a different type (for example an EPEC-derived EspA polypeptide); between them, the polynucleotide and polypeptide are capable of providing EspA polypeptides of at least two types.

Thus, the pharmaceutical composition, vaccine, food product or kit of parts comprises epitopes from more than one EspA polypeptide.

In an embodiment the composition does not comprise a cell culture supernatant (as discussed in WO 02/053181) derived from a cell co-culture of two or more different EHEC strains, or from a cell co-culture of two or more different EPEC strains, or from a cell co-culture of two or more different EHEC or EPEC strains. The composition may comprise a cell culture supernatant derived from a cell culture of a EHEC or EPEC strain, supplemented by a recombinant or purified EspA polypeptide different to that produced by the said EHEC or EPEC strain. The composition may comprise a cell culture supernatant from, for example, Salmonella expressing EspA genes or EHEC having defined mutants i.e. EspB.

EspA from the pathogenic EHEC 0157:H7 is considered to be the EspA of greatest prevalence and medical relevance; hence the preference for inclusion of sequences derived from this EspA. EspAs from EPEC 0127, EHEC 026, EHEC 0103, 0145 or EHEC 0111 are also considered to be of medical importance. Different individual EspA polypeptides or combinations of EspA-derived sequences may be preferable, depending upon the nature of the individual (human or animal) to be treated. For example, inclusion of sequences derived from 026, O103, 0111, 0145 and 0157 may be appropriate when the medicament is for vaccination of cattle or other livestock (for example pigs or pigeons), or when the medicament is for vaccination of human patients prior to foreign travel. Thus, preferred combinations of EspA-derived sequences correspond to combinations of EspAs from which the target recipient/population (human or animal) are most likely to be at risk (for example because the bacteria expressing a particular EspA are, for example, particularly harmful, or less harmful but more prevalent. A particularly useful combination may be of full length EspAs from 026, O103, 0111, 0145 and 0157.

The pharmaceutical composition, vaccine, food product or kit of parts may further comprise a further polypeptide sequence (or polynucleotide encoding such a sequence) from a further type of EspA, or from other EHEC or EPEC polypeptides, for example Tirs or intimins (see, for example, WO 02/79237 and WO 02/79240). The recipient may be human, for example a human baby or infant or child or other human with or at risk of bacterial infection. Alternatively, the recipient may be an animal, for example a domesticated animal or animal important in agriculture (ie livestock), for example cattle, sheep, goats, or poultry, for example chickens and turkeys. The recipient may preferably be a young animal, for example a calf (for example a bovine calf).

It is preferred that the bacterial infection causes an histopathologic effect on intestinal epithelial cells, the effect being known as attachment and effacement (A/E).

Advantageously, the bacterial infection comprises infection by enteropathogenic E. coli (EPEC) and/or enterohemorrhagic E. coli (EHEC), and particularly E. coli 0157:H7, 0127:H6, EHEC 026:H11, EHEC 0103 :H2 and/or EHEC Ol l l . Infection by other EHEC serotypes and shiga toxigenic E. coli (including human and bovine strains), Hafnia alvei and Citrobacter rodentium, as indicated above, are also included. The infection may be selected from one or more of the infections which cause diseases affecting humans or domestic farm animals such as cows, sheep and goats, particularly food borne diseases, notably diarrhoea, haemorrhagic colitis, acute gastroenteritis or haemolytic uraemic syndrome (HUS).

In an embodiment the polypeptide or polypeptides comprise at least a domain of EspA ie a portion of EspA that is capable of, or predicted to be capable of, folding independently in a manner similar to that in which it would fold in full length EspA. Methods of identifying such domains using computer analysis (for example incorporating analysis of hydrophobicity and/or likelihood to form an α helix or strand of a β sheet) are well known to those skilled in the art. In an embodiment the polypeptide or polypeptides comprise full length EspAs, preferably of at least two EspA, preferably of each EspA represented in the polypeptide or polypeptides.

By epitopes is included mimotopes, as well known to those skilled in the art.

The medicament may further comprise a polypeptide with a sequence (or epitope (including a mimotope) or peptidomimetic equivalent) derived from one or more other "LEE" polypeptides, for example from TirM, EspB or intimin, preferably intimin, as discussed in the Examples and well known to those skilled in the art. These other "LEE"-derived sequences may be included in the same or a different polypeptide (or polynucleotide, as appropriate) as the EspA-derived sequences.

By EspA is included variants, fragments and fusions that have interactions or activities which are substantially the same as those of the EspA sequences described herein and/or those disclosed in references (including public database references) cited above and or other public database records. It is preferred that the EspA or fragment thereof is a naturally occurring EspA or fragment thereof, or a fusion of such an EspA or fragment with a non-EspA-derived polypeptide. For example, the EspA- derived sequence may be fused with a moiety that aids expression, stability and/or purification, for example a maltose binding protein (MBP) moiety or His tag, as well known to those skilled in the art.

A "variant" will have a region which has at least 50% (preferably 60,70, 80,90, 95 or 99%) sequence identity with an EspA polypeptide as described herein or in the references indicated above, as measured by the Bestfit Program of the Wisconsin Sequence Analysis Package, version 8 for Unix. The percentage identity may be calculated by reference to a region of at least 50 amino acids (preferably at least 60, 75, or 100) of the candidate variant molecule, and the most similar region of equivalent length in the intimin sequence, allowing gaps of up to 5%.

The percent identity may be determined, for example, by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (Nucl. Acids res. 12:387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the alignment method of Neddleman and Wunsch (J. Mol. Biol. 48:443, 1970), as revised by Smith and Waterman (Adv. Appl. Math 2.482. 1981). The preferred default parameters for the GAP program include : (1) a comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Bribskov and Burgess, Nucl. Acids Res. 14:6745, 1986 as described by Schwarts and Dayhoff, eds, Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.

Preferably, the EspA polypeptide consists of a variant, or fusion (or a fragment) of a given full length wild-type EpsA which is antigenically cross-reactive with the said native full length wild-type EspA.

Preferred EspA sequences are:

EspA EHEC 0157:H7 ACCESSION NP_312583

DTSNATSW NVSASSSTST IYDLGNMSKD EWKLFEELG

VFQAAILMFS YMYQAQSNLS IAKFADMNEA SKASTTAQK

ANLVDAKIAD VQSSTDKNAK AKLPQDVIDY INDPRNDISV

TGIRD SGDL SAGDLQTVKA AISAKA NLT TWNNSQLEI QQ SNTLNLL TSARSDVQS QYRTISAISL GK EspA EPEC 0126:H6 ACCESSION AAC38394

MDTSTTASVA SA ASTSTSM AYDLGSMSKD DVID FNKLG VFQAAILMFA YMYQAQSD S IAKFADMNEA SKESTTAQKM A LVDAKIAD VQSSSDKNAK AQLPDEVISY INDPRNDITI SGIDNINAQL GAGDLQTVKA AISAKANNLT TTVNNSQLEI QQMSNTLNLL TSARSDMQSL QYRTISGISL GK

Substitutions, deletions, insertions or any subcombination may be used to arrive at a final construct. Since there are 64 possible codon sequences but only twenty known amino acids, the genetic code is degenerate in the sense that different codons may yield the same amino acid. Thus there is at least one codon for each amino acid, ie each codon yields a single amino acid and no other. It will be apparent that during translation, the proper reading frame must be maintained in order to obtain the proper amino acid sequence in the polypeptide ultimately produced.

Techniques for additions, deletions or substitutions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated site-directed mutagenesis and the polymerase chain reaction.

Oligonucleotide site-directed mutagenesis in essence involves hybridizing an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation. This technique, in various forms, is described in Zoller and Smith (1982) Nucl. Acids Res. 10, 6487.

The polypeptides may comprise more than one copy of an epitope. This may be useful in promoting an immune response, as well known to those skilled in the art.

The pharmaceutical composition, vaccine, food product, medicament or kit of parts may comprise further polypeptides or polynucleotides, as will be apparent to those skilled in the art. The polypeptide(s) or polynucleotide(s) may, for example, be included in the pharmaceutical composition, vaccine, food product or kit of parts in the form of a recombinant organism or part thereof, or product (such as a cell culture supernatant) thereof, preferably microorganism, preferably capable of expressing the polypeptides(s) ie capable of expressing the two or more EspA amino acid sequences, or alternatively capable of delivering nucleic acid encoding the polypeptide(s) to a host cell for expression therein. The recombinant microorganism is preferably a non-virulent microorganism, as well known to those skilled in the art. The recombinant microorganism may be, for example, a Bifidobacterium or a lactobacillus, or an attenuated Salmonella or BCG or attenuated E. coli. The recombinant organism may alternatively be a plant, for example making use of the teaching of WO97/40177.

The pharmaceutical composition may be useful as a vaccine, for example as a prophylactic or therapeutic vaccine, as well known to those skilled in the art. The said polypeptide or polypeptides are intended as target antigens, which are intended to promote a protective or therapeutic immune response in the treated human or animal. A further aspect of the invention provides a chimaeric polypeptide comprising or consisting of one or more copies of at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence (ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363).

Preferences for the components of the chimaeric polypeptide are as indicated above in relation to the polypeptide or polypeptides useful in the manufacture of a medicament. The chimaeric polypeptide may comprise sequences derived from a further EspA type or types.

The chimaeric polypeptide may comprise at least two sequences of at least eight contiguous amino acids derivable from different naturally occurring full length EspA polypeptides, and not being derivable from the same naturally occurring full length EspA polypeptide sequence (for example as shown in the EspA references (for example GenBank records) cited above).

The chimaeric polypeptide may comprise at least two of (1) an epitope derived from EspA from EHEC 0157 (for example EHEC 0157:H7) (2) an epitope derived from EspA from EPEC 0127 (for example EPEC 0127:H6 or EPEC 055 (for example 055:H6) (3) an epitope derived from EspA from EHEC 026 (for example 026:H11) (4) an epitope derived from EspA from EHEC 0103 (for example O103:H2) (5) an epitope derived from EspA from EHEC Ol l l and (6) an epitope derived from EspA from EHEC 0145.

Preferably the at least two epitopes are not common to all said EspAs. In view of the lack of cross-reactivity between antibodies raised to EspA from EHEC 0157:H7 and EspA from EPEC 0127:H6, we consider that any epitopes common to all EspAs must (if they exist) be of low antigenicity. Epitopes may be conformational epitopes, so it is preferred that the assessment of whether the epitope is common to all EspAs is made by assessing cross-reactivity as well as or instead of by sequence comparison.

A further aspect of the invention provides a polynucleotide encoding a chimaeric polypeptide of the invention. The polynucleotide may be in the form of a vector molecule, for example a replicable vector molecule, as well known to those skilled in the art.

A further aspect of the invention provides a recombinant microorganism, preferably bacterium, comprising a polynucleotide (for example a replicable vector) of the invention. A further aspect of the invention provides a peptidomimetic compound corresponding to the chimaeric polypeptide of the invention.

A further aspect of the invention provides an antibody preparation reactive with EspA from EHEC 0157:H7. The preparation may comprise a monoclonal antibody or may comprise a polyclonal antibody preparation. Such an antibody preparation may be useful as a diagnostic reagent or as a therapeutic agent (for example in humans), particularly in combination (either within one reagent or within a kit of parts) with an antibody preparation reactive with EspA from a different source, for example an antibody preparation reactive with EspA from EPEC 0127:H6, 026, O103, 0111, or 0145.

A further aspect of the invention provides a food product comprising a foodstuff and an antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention. A still further aspect of the invention provides a pharmaceutical composition comprising an antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention and a pharmaceutically acceptable diluent or carrier.

A further aspect of the invention provides a vaccine effective against bacterial infection, for example EHEC and/or EPEC infection, comprising an effective amount of a chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention.

A further aspect of the invention provides a pharmaceutical composition, vaccine, food product, kit of parts, antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any preceding aspect of the invention for use in medicine.

A still further aspect of the invention provides the use of a pharmaceutical composition, vaccine, food product, kit of parts, antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection.

A further aspect of the invention provides the use of a pharmaceutical composition, vaccine, food product, kit of parts, antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention in the manufacture of a composition for use as a food supplement or a food additive. A further aspect of the invention provides the use of a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence (ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363), in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection.

A further aspect of the invention provides a method for treating a human or animal with or at risk of bacterial infection, wherein the human or animal is administered a pharmaceutical composition, vaccine, food product, kit of parts, antibody (or combination of antibodies), chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism of the invention.

Preferences for the polypeptides or polynucleotides are as indicated in relation to preceding aspects of the invention.

A further aspect of the invention provides the use of (1) a peptidomimetic compound or compounds corresponding to the polypeptide or polypeptides (therapeutic polypeptide(s)) as defined in relation to any of the preceding aspects of the invention, and/or (2) antibodies or an antibody preparation reactive with the said polypeptide or polypeptides, preferably reactive with two or more epitopes (derived from two or more EspAs) as defined in relation to a preceding aspect of the invention, in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection. The medicament may be useful in preventing or reducing colonisation of the gut by the bacteria, and/or may be useful in reducing the quantity or duration of shedding of the bacteria from infected individuals.

The peptidomimetic compound, polypeptide, polynucleotide or antibodies/antibody preparation may also be useful in the manufacture of a diagnostic reagent for use in diagnosis of a human or with or at risk of bacterial infection.

A further aspect of the invention provides a method of treating a human or animal with or at risk of bacterial infection, wherein the human or animal is administered (1) a polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in relation to any of the preceding aspects of the invention and/or (2) a peptidomimetic compound or compounds corresponding to the said encoded or comprised polypeptide or polypeptides (therapeutic polypeptide(s)), as defined in relation to any of the preceding aspects of the invention, and/or (3) an antibody preparation or antibodies reactive with an epitope as defined in relation to a preceding aspect of the invention.

The term "peptidomimetic" refers to a compound that mimics the conformation and desirable features of a particular peptide as a therapeutic agent, but that avoids the undesirable features. For example, morphine is a compound which can be orally administered, and which is a peptidomimetic of the peptide endorphin.

Therapeutic applications involving peptides are limited, due to lack of oral bioavailability and to proteolytic degradation. Typically, for example, peptides are rapidly degraded in vivo by exo- and endopeptidases, resulting in generally very short biological half-lives. Another deficiency of peptides as potential therapeutic agents is their lack of bioavailability via oral administration. Degradation of the peptides by proteolytic enzymes in the gastrointestinal tract is likely to be an important contributing factor. The problem is, however, more complicated because it has been recognised that even small, cyclic peptides which are not subject to rapid metabolite inactivation nevertheless exhibit poor oral bioavailability. This is likely to be due to poor transport across the intestinal membrane and rapid clearance from the blood by hepatic extraction and subsequent excretion into the intestine. These observations suggest that multiple amide bonds may interfere with oral bioavailability. It is thought that the peptide bonds linking the amino acid residues in the peptide chain may break apart when the peptide drug is orally administered.

There are a number of different approaches to the design and synthesis of peptidomimetics. In one approach, such as disclosed by Sherman and Spatola, J. Am. Chem. Soc, 112: 433 (1990), one or more amide bonds have been replaced in an essentially isoteric manner by a variety of chemical functional groups. This stepwise approach has met with some success in that active analogues have been obtained. In some instances, these analogues have been shown to possess longer biological half-lives than their naturally- occurring counterparts. Nevertheless, this approach has limitations. Successful replacement of more than one amide bond has been rare. Consequently, the resulting analogues have remained susceptible to enzymatic inactivation elsewhere in the molecule. When replacing the peptide bond it is preferred that the new linker moiety has substantially the same charge distribution and substantially the same planarity as a peptide bond. Retro-inverso peptidomimetics, in which the peptide bonds are reversed, can be synthesised by methods known in the art, for example such as those described in Meziere et al (1997) J. Immunol. 159 3230-3237. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains. Retro-inverse peptides, which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.

In another approach, a variety of uncoded or modified amino acids such as D-amino acids and N-methyl amino acids have been used to modify mammalian peptides. Alternatively, a presumed bioactive conformation has been stabilised by a covalent modification, such as cyclisation or by incorporation of γ-lactam or other types of bridges. See, eg. Veber et al, Proc. Natl. Acad. Sci. USA, 75:2636 (1978) and Thursell et al, Biochem. Biophys. Res. Comm., 111 : 166 (1983).

A common theme among many of the synthetic strategies has been the introduction of some cyclic moiety into a peptide-based framework. The cyclic moiety restricts the conformational space of the peptide structure and this frequently results in an increased affinity of the peptide for a particular biological receptor. An added advantage of this strategy is that the introduction of a cyclic moiety into a peptide may also result in the peptide having a diminished sensitivity to cellular peptidases.

One approach to the synthesis of cyclic stabilised peptidomimetics is ring closing metathesis (RCM). This method involves steps of synthesising a peptide precursor and contacting it with a RCM catalyst to yield a conformationally restricted peptide. Suitable peptide precursors may contain two or more unsaturated C-C bonds. The method may be carried out using solid-phase-peptide-synthesis techniques. In this embodiment, the precursor, which is anchored to a solid support, is contacted with a RCM catalyst and the product is then cleaved from the solid support to yield a conformationally restricted peptide.

By an antibody is included an antibody or other immunoglobulin, or a fragment or derivative thereof, as discussed further below.

The variable heavy (V_H) and variable light (V_L) domains of the antibody are involved in antigen recognition, a fact first recognised by early protease digestion experiments. Further confirmation was found by "humanisation" of rodent antibodies. Variable domains of rodent origin may be fused to constant domains of human origin such that the resultant antibody retains the antigenic specificity of the rodent parented antibody (Morrison et al (1984) Proc. Natl. Acad. Sci. USA 81, 6851-6855).

That antigenic specificity is conferred by variable domains and is independent of the constant domains is known from experiments involving the bacterial expression of antibody fragments, all containing one or more variable domains. These molecules include Fab-like molecules (Better et al (1988) Science 240, 1041); Fv molecules (Skerra et al (1988) Science 240, 1038); single-chain Fv (ScFv) molecules where the V_H and V partner domains are linked via a flexible oligopeptide (Bird et al (1988) Science 242, 423; Huston et al (1988) Proc. Natl. Acad. Sci. USA 85, 5879) and single domain antibodies (dAbs) comprising isolated V domains (Ward et al (1989) Nature 341, 544). A general review of the techniques involved in the synthesis of antibody fragments which retain their specific binding sites is to be found in Winter & Milstein (1991) Nature 349, 293-299.

By "ScFv molecules" we mean molecules wherein the V_H and V_L partner domains are linked via a flexible oligopeptide. The advantages of using antibody fragments, rather than whole antibodies, are several-fold. The smaller size of the fragments may lead to improved pharmacological properties. Effector functions of whole antibodies, such as complement binding, are removed. Fab, Fv, ScFv and dAb antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of the said fragments.

Whole antibodies, and F(ab')₂ fragments are "bivalent". By "bivalent" we mean that the said antibodies and F(ab')₂ fragments have two antigen combining sites. In contrast, Fab, Fv, ScFv and dAb fragments are monovalent, having only one antigen combining sites.

Preferably, the antibody has an affinity for the epitope of between about lOlM^'1 to about lO^.M^"1, more preferably at least 10⁸.M'.

Suitable monoclonal antibodies to selected antigens may be prepared by known techniques, for example those disclosed in Monoclonal Antibodies: A manual of techniques, H Zola (CRC Press, 1988) and in Monoclonal Hybridoma Antibodies: Techniques and Applications, J G R Hurrell (CRC Press, 1982). Chimaeric antibodies are discussed by Neuberger et al (1988, 8th International Biotechnology Symposium Part 2, 792-799). Suitably prepared non-human antibodies can be "humanized" in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies.

Methods suitable for preparing useful antibodies or antibody preparations will be known to those skilled in the art in view of the teaching disclosed herein, and are discussed further below. A further aspect of the invention provides the use of a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence (ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363), in the manufacture of a composition for use as a food supplement or a food additive.

The food product may be adapted for consumption by animals or adapted for consumption by humans.

The food is preferably a milk substitute. Preferably, the food is suitable for administration to a human baby or infant or a young animal. However, it may be suitable for any human or animal which is susceptible to a bacterial infection, including older humans or animals. Exemplary animals include domestic cattle, especially calves; and poultry such as chickens and turkeys

The invention also relates to a food product comprising a foodstuff and an agent as defined above.

The chimaeric polypeptide or polynucleotide of the invention may also be useful in diagnosis of a bacterial infection, for example as a control for a diagnostic test, for example an immunodiagnostic test or a nucleic acid detection/characterisation test, for example involving PCR, as well known to those skilled in the art.

Polypeptides in which one or more of the amino acid residues are chemically modified, before or after the polypeptide is synthesised, may be used as antigen providing that the function of the polypeptide, namely the production of a specific immune response in vivo, remains substantially unchanged. Such modifications include forming salts with acids or bases, especially physiologically acceptable organic or inorganic acids and bases, forming an ester or amide of a terminal carboxyl group, and attaching amino acid protecting groups such as N-t-butoxycarbonyl. Such modifications may protect the polypeptide from in vivo metabolism. The polypeptide may be mannosylated or otherwise modified to increase its antigenicity, or combined with a compound for increasing its antigenicity and/or immunogenicity.

The polypeptide may comprise a viral polypeptide, for example a HBV polypeptide, as known to those skilled in the art.

The epitope(s) (for example epitope- forming amino acid sequences, or regions considered to comprise protective epitopes) may be present as single copies or as multiples, for example tandem repeats. Such tandem or multiple repeats may be sufficiently antigenic themselves to obviate the use of a carrier. It may be advantageous for the polypeptide to be formed as a loop, with the N- terminal and C-terminal ends joined together, or to add one or more Cys residues to an end to increase antigenicity and/or to allow disulphide bonds to be formed. If the epitope, for example epitope- forming amino acid sequence, is covalently linked to a carrier, preferably a polypeptide, then the arrangement is preferably such that the epitope-forming amino acid sequence forms a loop.

According to current immunological theories, a carrier function should be present in any immunogenic formulation in order to stimulate, or enhance stimulation of, the immune system. The epitope(s) as defined above in relation to the preceding aspects of the invention may be associated, for example by cross-linking, with a separate carrier, such as serum albumins, myoglobins, bacterial toxoids and keyhole limpet haemocyanin. EspA may itself act as a carrier or adjuvant. More recently developed carriers which induce T-cell help in the immune response include the hepatitis-B core antigen (also called the nucleocapsid protein), presumed T-cell epitopes such as Trir-AIa-Ser-Gly-Val-Ala-Glu-Thr-Thr-Asn-Cys, beta-galactosidase and the 163-171 peptide of interleukin-1. The latter compound may variously be regarded as a carrier or as an adjuvant or as both.

Alternatively, several copies of the same or different epitope (for example the two or more different intimins or fragments thereof) may be cross-linked to one another; in this situation there is no separate carrier as such, but a carrier function may be provided by such cross-linking. Suitable cross-linking agents include those listed as such in the Sigma and Pierce catalogues, for example glutaraldehyde, carbodiimide and succinimidyl 4-(N- maleimidomethyl)cyclohexane-l-carboxylate, the latter agent exploiting the - SH group on the C-terminal cysteine residue (if present). Any of the conventional ways of cross-linking polypeptides may be used, such as those generally described in O'Sullivan et al Anal. Biochem. (1979) 100, 100-108. For example, the first portion may be enriched with thiol groups and the second portion reacted with a bifunctional agent capable of reacting with those thiol groups, for example the N-hydroxysuccinimide ester of iodoacetic acid (NHIA) or N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), a heterobifunctional cross-linking agent which incorporates a disulphide bridge between the conjugated species. Amide and thioether bonds, for example achieved with m-maleimidobenzoyl-N-hydroxysuccinimide ester, are generally more stable in vivo than disulphide bonds.

Further useful cross-linking agents include S-acetylthioglycolic acid N- hydroxysuccinimide ester (SATA) which is a thiolating reagent for primary amines which allows deprotection of the sulphydryl group under mild conditions (Julian et al (1983) Anal. Biochem. 132, 68), dimethylsuberimidate dihydrochloride and N,N'-o-phenylenedimaleimide.

If the polypeptide is prepared by expression of a suitable nucleotide sequence in a suitable host, then it may be advantageous to express the polypeptide as a fusion product with a peptide sequence which acts as a carrier. Kabigen's "Ecosec" system is an example of such an arrangement.

Other adjuvants that may be useful include adjuvants discussed in WO 02/053181, for example VSA3, which includes DDA (see US patent No 5,951,988), and adjuvants discussed further below.

Suitable vectors or constructs which may be used to prepare a suitable recombinant polypeptide or polynucleotide will be known to those skilled in the art.

A polynucleotide capable of expressing the required polypeptide or polypeptides may be prepared using techniques well known to those skilled in the art.

It may be desirable for the polynucleotide to be capable of expressing the polypeptide(s) in the recipient, so that the human or animal may be administered the polynucleotide, leading to expression of the antigenic polypeptides (ie sequences derived from two or more EspAs) in the human or animal. The polypeptide(s), for example an EHEC EspA and an EPEC EspA as appropriate, may be expressed from any suitable polynucleotide (genetic construct) as is described below and delivered to the recipient. Typically, the genetic construct which expresses the polypeptide comprises the said polypeptide coding sequence operatively linked to a promoter which can express the transcribed polynucleotide (eg mRNA) molecule in a cell of the recipient, which may be translated to synthesise the said polypeptide. Suitable promoters will be known to those skilled in the art, and may include promoters for ubiquitously expressed genes, for example housekeeping genes or for tissue-selective genes, depending upon where it is desired to express the said polypeptide (for example, in dendritic cells or other antigen presenting cells or precursors thereof, or in mucosal cells). Preferably, a dendritic cell or dendritic precursor cell-selective promoter is used, but this is not essential, particularly if delivery or uptake of the polynucleotide is targeted to the selected cells, eg dendritic cells or precursors. Dendritic cell-selective promoters may include the CD83 or CD36 promoters.

The nucleic acid sequence capable of expressing the polypeptide(s) is preferably operatively linked to regulatory elements necessary for expression of said sequence.

"Operatively linked" refers to juxtaposition such that the normal function of the components can be performed. Thus, a coding sequence "operatively linked" to regulatory elements refers to a configuration wherein the nucleic acid sequence encoding the antigen can be expressed under the control of the regulatory sequences.

"Regulatory sequences" refers to nucleic acid sequences necessary for the expression of an operatively linked coding sequence in a particular host organism. For example, the regulatory sequences which are suitable for eukaryotic cells are promotors, polyadenylation signals, and enhancers.

"Vectors" means a DNA molecule comprising a single strand, double strand, circular or supercoiled DNA. Suitable vectors include retroviruses, adenoviruses, adeno-associated viruses, pox viruses and bacterial plasmids. Retroviral vectors are retroviruses that replicate by randomly integrating their genome into that of the host. Suitable retroviral vectors are described in WO 92/07573.

Adenovims is a linear double-standard DNA Virus. Suitable adenoviral vectors are described in Rosenfeld et al, Science, 1991, Vol. 252, page 432.

Adeno-associated viruses (AAV) belong to the parvo vims family and consist of a single strand DNA of about 4-6 KB.

Pox viral vectors are large viruses and have several sites in which genes can be inserted. They are thermostable and can be stored at room temperature. Safety studies indicate that pox viral vectors are replication-defective and cannot be transmitted from host to host or to the environment.

Targeting the vaccine to specific cell populations, for example antigen presenting cells, may be achieved, for example, either by the site of injection, use of targeting vectors and delivery systems, or selective purification of such a cell population from the recipient and ex vivo administration of the peptide or nucleic acid (for example dendritic cells may be sorted as described in Zhou et al (1995) Blood 86, 3295-3301; Roth et al (1996) Scand. J. Immunology 43, 646-651). In addition, targeting vectors may comprise a tissue- or tumour-selective promoter which directs expression of the antigen at a suitable place.

Although the genetic construct can be DNA or RNA it is preferred if it is DNA.

Preferably, the genetic construct is adapted for delivery to a human cell. Means and methods of introducing a genetic construct into a cell in or removed from an animal body are known in the art. For example, the constructs of the invention may be introduced into the cells by any convenient method, for example methods involving retroviruses, so that the constmct is inserted into the genome of the (dividing) cell. Targeted retrovimses are available for use in the invention; for example, sequences conferring specific binding affinities may be engineered into pre-existing viral env genes (see Miller & Vile (1995) Faseb J. 9, 190-199 for a review of this and other targeted vectors for gene therapy).

Preferred retroviral vectors may be lentiviral vectors such as those described in Verma & Somia (1997) Nature 389, 239-242.

Other methods involve simple delivery of the constmct into the cell for expression therein either for a limited time or, following integration into the genome, for a longer time. An example of the latter approach includes liposomes (Nassander et al (1992) Cancer Res. 52, 646-653). Other methods of delivery include adenoviruses carrying external DNA via an antibody-polylysine bridge (see Curiel Prog. Med. Virol. 40, 1-18) and transfeπϊn-polycation conjugates as carriers (Wagner et al (1990) Proc. Natl. Acad. Sci. USA 87, 3410-3414). In the first of these methods a polycation-antibody complex is formed with the DNA construct or other genetic construct of the invention, wherein the antibody is specific for either wild-type adenovims or a variant adenovims in which a new epitope has been introduced which binds the antibody. The polycation moiety binds the DNA via electrostatic interactions with the phosphate backbone. The adenovims, because it contains unaltered fibre and penton proteins, is internalised into the cell and carries into the cell with it the DNA construct of the invention. It is preferred if the polycation is polylysine. Bacterial delivery methods which may be suitable are described in Dietrich (2000) Antisense Nucleic Acid Drug Delivery 10, 391-399. For example, attenuated bacterial strains allow the administration of recombinant vaccines via the mucosal surfaces. Whereas attenuated bacteria are generally engineered to express heterologous antigens, a further approach employs infracellular bacteria for the delivery of eukaryotic antigen expression vectors (DNA vaccines). This strategy allows a direct delivery of DNA to professional antigen-presenting cells (APC), such as macrophages and dendritic cells (DC), through bacterial infection. The bacteria used for DNA vaccine delivery either enter the host cell cytosol after phagocytosis by the APC, for example, Shigella and Listeria, or they remain in the phagosomal compartment, such as Salmonella. Both intracellular localizations of the bacterial carriers may be suitable for successful delivery of DNA vaccine vectors of the present invention.

Expression of the EspA polypeptide may be under the control of inducible bacterial promoters, for example promoters that are induced when the bacterium encounters or enters a host organism environment (for example the host's gut) or binds to or enters a host cell.

Bacterial delivery is a preferred method of delivery in relation to the present invention. Oral bacterial delivery of expressed EspA antigens may be a useful delivery route. However, injection of purified EspA polypeptide(s) is considered also to be effective.

The DNA may also be delivered by adenovims wherein it is present within the adenovims particle, for example, as described below.

In the second of these methods, a high-efficiency nucleic acid delivery system that uses receptor-mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids. Human transferrin, or the chicken homologue conalbumin, or combinations thereof is covalently linked to the small DNA-binding protein protamine or to polylysines of various sizes through a disulfide linkage. These modified transferrin molecules maintain their ability to bind their cognate receptor and to mediate efficient iron transport into the cell. The transferrin-polycation molecules form electrophoretically stable complexes with DNA constmcts or other genetic constmcts of the invention independent of nucleic acid size (from short oligonucleotides to DNA of 21 kilobase pairs). When complexes of transferrin-polycation and the DNA constmcts or other genetic constmcts of the invention are supplied to the target cells, a high level of expression from the constmct in the cells is expected.

High-efficiency receptor-mediated delivery of the DNA constmcts or other genetic constmcts of the invention using the endosome-disruption activity of defective or chemically inactivated adenovims particles produced by the methods of Cotten et al (1992) Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used. This approach appears to rely on the fact that adenovimses are adapted to allow release of their DNA from an endosome without passage through the lysosome, and in the presence of, for example transferrin linked to the DNA constmct or other genetic constmct of the invention, the constmct is taken up by the cell by the same route as the adenovims particle.

This approach has the advantages that there is no need to use complex retroviral constmcts; there is no permanent modification of the genome as occurs with retroviral infection; and the targeted expression system is coupled with a targeted delivery system, thus reducing toxicity to other cell types.

"Naked DNA" and DNA complexed with cationic and neutral lipids may also be useful in introducing the DNA of the invention into cells of the recipient. Non-viral approaches to gene therapy are described in Ledley (1995) Human Gene Therapy 6, 1129-1144. Alternative targeted delivery systems are also known such as the modified adenovims system described in WO 94/10323 wherein, typically, the DNA is carried within the adenovims, or adenovims-like, particle. Michael et al (1995) Gene Therapy 2, 660-668 describes modification of adenovims to add a cell-selective moiety into a fibre protein. Mutant adenoviruses which replicate selectively in p53-deficient human tumour cells, such as those described in Bischoff et al (1996) Science 274, 373-376 are also useful for delivering the genetic construct of the invention to a cell. Thus, it will be appreciated that a further aspect of the invention provides a vims or vims-like particle comprising a genetic constmct of the invention. Other suitable viruses or vims-like particles include HSV, AAV, vaccinia, lentivims and parvovirus.

Immunoliposomes (antibody-directed liposomes) are especially useful in targeting to cell types which over-express a cell surface protein for which antibodies are available, as is possible with dendritic cells or precursors, for example using antibodies to CD1, CD14 or CD83 (or other dendritic cell or precursor cell surface molecule, as indicated above). For the preparation of immuno-liposomes MPB-PE (N-[4-(p-maleimidophenyl)butyryl]- phosphatidylethanolamine) is synthesised according to the method of Martin & Papahadjopoulos (1982) J. Biol. Chem. 257, 286-288. MPB-PE is incorporated into the liposomal bilayers to allow a covalent coupling of the antibody, or fragment thereof, to the liposomal surface. The liposome is conveniently loaded with the DNA or other genetic construct of the invention for delivery to the target cells, for example, by forming the said liposomes in a solution of the DNA or other genetic constmct, followed by sequential extmsion through polycarbonate membrane filters with 0.6 μm and 0.2 μm pore size under nitrogen pressures up to 0.8 MPa. After extrusion, entrapped DNA construct is separated from free DNA construct by ultracentrifugation at 80 000 x g for 45 min. Freshly prepared MPB-PE- liposomes in deoxygenated buffer are mixed with freshly prepared antibody (or fragment thereof) and the coupling reactions are carried out in a nitrogen atmosphere at 4°C under constant end over end rotation overnight. The immunoliposomes are separated from unconjugated antibodies by ultracentrifugation at 80 000 x g for 45 min. Immunoliposomes may be injected, for example intraperitoneally or directly into a site where the target cells are present, for example subcutaneously.

It will be appreciated that it may be desirable to be able to regulate temporally expression of the polypeptide(s) (for example antigenic polypeptides) in the cell. Thus, it may be desirable that expression of the polypeptide(s) is directly or indirectly (see below) under the control of a promoter that may be regulated, for example by the concentration of a small molecule that may be administered to the recipient when it is desired to activate or repress (depending upon whether the small molecule effects activation or repression of the said promoter) expression of the polypeptide. It will be appreciated that this may be of particular benefit if the expression constmct is stable ie capable of expressing the polypeptide (in the presence of any necessary regulatory molecules) in the said cell for a period of at least one week, one, two, three, four, five, six, eight months or one or more years. It is preferred that the expression constmct is capable of expressing the polypeptide in the said cell for a period of less than one month. A preferred construct of the invention may comprise a regulatable promoter. Examples of regulatable promoters include those referred to in the following papers: Rivera et al (1999) Proc Natl Acad Sci USA 96(15), 8657-62 (control by rapamycin, an orally bioavailable dmg, using two separate adenovims or adeno-associated vims (AAV) vectors, one encoding an inducible human growth hormone (hGH) target gene, and the other a bipartite rapamycin-regulated transcription factor); Magari et al (1997) J Clin Invest 100(11), 2865-72 (control by rapamycin); Bueler (1999) Biol Chem 380(6), 613-22 (review of adeno-associated viral vectors); Bohl et al (1998) Blood 92(5), 1512-7 (control by doxycycline in adeno-associated vector); Abmzzese et al (1996) J Mol Med 74(7), 379-92 (reviews induction factors e.g., hormones, growth factors, cytokines, cytostatics, irradiation, heat shock and associated responsive elements). Tetracycline - inducible vectors may also be used. These are activated by a relatively -non toxic antibiotic that has been shown to be useful for regulating expression in mammalian cell cultures. Also, . steroid-based inducers may be useful especially since the steroid receptor complex enters the nucleus where the DNA vector must be segregated prior to transcription.

This system may be further improved by regulating the expression at two levels, for example by using a tissue-selective promoter and a promoter controlled by an exogenous inducer/repressor, for example a small molecule inducer, as discussed above and known to those skilled in the art. Thus, one level of regulation may involve linking the appropriate polypeptide- encoding gene to an inducible promoter whilst a further level of regulation entails using a tissue-selective promoter to drive the gene encoding the requisite inducible transcription factor (which controls expression of the polypeptide (for example the antigenic polypeptide)-encoding gene from the inducible promoter). Control may further be improved by cell-type-specific targeting of the genetic constmct.

The genetic constmcts of the invention can be prepared using methods well known in the art.

The aforementioned therapeutic molecules, for example antigenic molecule, for example a chimaeric molecule or constmct of the invention or a formulation thereof, may be administered by any conventional method including oral and parenteral (eg subcutaneous or intramuscular) injection. Preferred routes include oral, intranasal or intramuscular injection. The treatment may consist of a single dose or a plurality of doses over a period of time. It will be appreciated that an inducer, for example small molecule inducer as discussed above may preferably be administered orally.

Methods of delivering genetic constmcts, for example adenoviral vector constructs to cells of a recipient will be well known to those skilled in the art. In particular, an adoptive therapy protocol may be used or, more preferably, a gene gun may be used to deliver the constmct to dendritic cells, for example in the skin.

Adoptive therapy protocols are described in Nestle et al (1998) Nature Med. 4, 328-332 and De Bmijn et al (1998) Cancer Res. 58, 724-731.

The therapeutic agent (vaccine) may be given to a subject who is being treated for the disease by some other method. Thus, although the method of treatment may be used alone it is desirable to use it as an adjuvant therapy, for example alongside conventional preventative or therapeutic methods.

Whilst it is possible for a therapeutic molecule as described herein, for example an antigenic molecule, constmct or chimaeric polypeptide, to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more acceptable carriers. The carrier(s) must be "acceptable" in the sense of being compatible with the therapeutic molecule (which may be a nucleic acid or polypeptide) and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free.

The pharmaceutical composition may further comprise a component for increasing the antigenicity and/or immungenicity of the composition, for example an adjuvant and/or a cytokine. A polyvalent antigen (cluster of antigens) may be useful.

Nasal sprays may be useful formulations.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (for an antigenic molecule, construct or chimaeric polypeptide of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. '

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in- oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (eg povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (eg sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin, or sucrose and acacia; and mouth- washes comprising the active ingredient in a suitable liquid carrier.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described. Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of an active ingredient.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

It will be appreciated that the therapeutic molecule can be delivered to the locus by any means appropriate for localised administration of a drug. For example, a solution of the therapeutic molecule can be injected directly to the site or can be delivered by infusion using an infusion pump. The constmct, for example, also can be incorporated into an implantable device which when placed at the desired site, permits the constmct to be released into the surrounding locus.

The therapeutic molecule may be administered via a hydrogel material. The hydrogel is non-inflammatory and biodegradable. Many such materials now are known, including those made from natural and synthetic polymers.

In a preferred embodiment, the method exploits a hydrogel which is liquid below body temperature but gels to form a shape-retaining semisolid hydrogel at or near body temperature. Preferred hydrogel are polymers of ethylene oxide-propylene oxide repeating units. The properties of the polymer are dependent on the molecular weight of the polymer and the relative percentage of polyethylene oxide and polypropylene oxide in the polymer. Preferred hydrogels contain from about 10% to about 80% by weight ethylene oxide and from about 20% to about 90% by weight propylene oxide. A particularly preferred hydrogel contains about 70% polyethylene oxide and 30% polypropylene oxide. Hydrogels which can be used are available, for example, from BASF Corp., Parsippany, NJ, under the tradename Pluronic^R.

A further aspect of the invention provides a vaccine effective against bacterial infection, for example EHEC and/or EPEC, comprising an effective amount of the polypeptide(s) or polynucleotide(s) as defined in relation to the first and second aspects of the invention.

Conveniently, the nucleic acid vaccine may comprise any suitable nucleic acid delivery means, as noted above. The nucleic acid, preferably DNA, may be naked (ie with substantially no other components to be administered) or it may be delivered in a liposome or as part of a viral vector delivery system.

The nucleic acid vaccine may be administered without adjuvant. The nucleic acid vaccine may also be administered with an adjuvant such as BCG or alum. Other suitable adjuvants include Aquila's QS21 stimulon (Aquila Biotech, Worcester, MA, USA) which is derived from saponin, mycobacterial extracts and synthetic bacterial cell wall mimics, and proprietary adjuvants such as Ribi's Detox. Quil A, another saponin- derived adjuvant, may also be used (Superfos, Denmark). Other adjuvants such as Freund's may also be useful. It is preferred if the nucleic acid vaccine is administered without adjuvant.

According to a further aspect of the invention there is provided a method of making an antibody preparation reactive against two or more EspAs (which may be useful in treatment or diagnosis, as indicated above), comprising administering said two or more EspAs or fragments thereof, as discussed above, to an animal and collecting and purifying the directly or indirectly resulting antibody. The antibody may preferably be polyclonal. Alternatively, the preparation may be made by combination of two or more antibodies (for example monoclonal antibodies) or antibody preparations reactive with regions of different EspAs.

By "antibody" in accordance with the invention we include molecules which comprise or consist of antigen binding fragments of an antibody including Fab, Fv, ScFc and dAb. We also include agents which incorporate such fragments as portions for targeting antigens and/or cells or vimses which display such antigens.

In accordance with this aspect of the invention there is also provided an antibody preparation, preferably a polyclonal antibody preparation reactive against two or more EspAs for use in medicine. The invention also provides the use of the antibody preparation in the manufacture of a medicament (or food supplement composition) for use in the prevention or treatment of a bacterial disease. The invention also provides a method of treatment of a human or animal with or at risk of a bacterial disease, wherein the human or animal is administered the said antibody preparation. Preferably the antibody preparation is capable of binding to two or more EspAs.

A further aspect of the invention provides a method of preventing and./or treating a bacterial disease comprising administering to a subject an effective amount of a polypeptide or polypeptides (or corresponding peptidomimetic compounds, as discused above) in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence (ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363). A further aspect of the invention provides a method of preventing and./or treating a bacterial disease comprising administering to a human or animal an effective amount of a polynucleotide encoding, or polynucleotides encoding in combination, a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence (ie as given in WO 97/40063; GenBank Accession Nos Y13068, U80908, U5681, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236 or AF200363).

Preferences in relation to the polypeptide(s) and polynucleotide(s) are as indicated in relation to preceding aspects of the invention. The subject may be administered a combination of polypeptides and polynucleotides, as discussed above.

For example, the subject may be administered two or EspA polypeptides. Preferably the EspA polypeptides are from at least two of 026, 0103, 0111, 0145 and 0157.

A further aspect of the invention provides a method of preventing and./or treating a bacterial disease comprising administering to a human or animal an effective amount of a chimaeric polypeptide, polynucleotide, antibody preparation or combination of the invention.

By "effective amount" we include the meaning that sufficient quantities of the agent are provided to produce a desired pharmaceutical effect beneficial to the health of the recipient. All documents referred to herein are, for the avoidance of doubt, hereby incorporated by reference.

The invention is now described by reference to the following, non-limiting, figures and examples.

Figure Legends

Figure 1: Immuno-fluorescence staining of EspA filaments using EPEC EspA_E2348/69 (column 1) and EHEC EspA_85-170 antisera (column 2); Hep-2 cells were infected with EPEC and EHEC strains for 3 hours and bacteria visualised by phase contrast. The EPEC antibody stained EspA filaments produced by EPEC E2348/69 (0127:H6) (row 1) and EPEC 055:H6 (row 3) whilst the EHEC antibody stained EspA filaments produced by EHEC 85-170 (0157:H7) (row 2) and EPEC 055:H7 (row 4). A positive FAS assay (column 3) indicated that all four strains produced A/E lesions on Hep-2 cells.

Figure 2: Scanning electron micrographs showing attachment of EPEC strains to RBC monolayers. Filamentous structures which did not react with the EPEC or EHEC EspA antisera but which were morphologically identical to EPEC E2348/69 EspA filaments identified by immunogold labelling (a) were seen to promote attachment of EHEC strain 026:H11 (b) and EPEC strain 0119:H6 (c) to RBC membranes. Magnification bar 0.1 μm; inset 0.0 l μm.

Exemplary compositions of the invention Antibody production method

Methods for purification of antigens and antibodies are described in Scopes, R.K. (1993) Protein purification 3rd Edition. Publisher - Springer Verlag. ISBN 0-387-94072-3 and 3-540-94072-3. The disclosure of that reference, especially chapters 7 and 9, is incorporated herein by reference.

Antibodies may be produced in a number of ways.

For polyclonal antibodies, this is simply a matter of injecting suitably prepared samples into the animal at intervals, and testing its semm for the presence of antibodies (for details, see Dunbar, B.S. & Schwoebel, E.D. (1990) Preparation of polyclonal antibodies. Methods Enzymol. 182, 663-670). But it is essential that the antigen (ie. the protein of interest) be as pure as possible. For monoclonal antibodies, the purity of the antigen is relatively unimportant if the screening procedure to detect suitable clones uses a bioassay.

Antibodies can also be produced by molecular biology techniques, with expression in bacterial or other heterologous host cells (Chiswell, D.J. & McCafferty, J. (1992) Phage antibodies: will new "coli-clonal" antibodies replace monoclonal antibodies?" Trends Biotechnol. 10, 80-84). The purification method to be adopted will depend on the source material (semm, cell culture, bacterial expression culture, etc.) and the purpose of the purification (research, diagnostic investigation, commercial production). The major methods are as follows:

1. Ammonium sulphate precipitation. The γ-globulins precipitate at a lower concentration than most other proteins, and a concentration of

33% saturation is sufficient. Either dissolve in 200g ammonium sulphate per litre of semm, or add 0.5 vol of saturated ammonium sulphate. Stir for 30 minutes, then collect the γ-globulin fraction by centrifugation, redissolve in an appropriate buffer, and remove excess ammonium sulphate by dialysis or gel filtration.

2. Polyethylene glycol precipitation. The low solubility of γ-globulins can also be exploited using PEG. Add 0.1 vol of a 50% solution of PEG 6,000 to the semm, stir for 30 minutes and collect the γ-globulins by centrifugation. Redissolve the precipitate in an appropriate buffer, and remove excess PEG by gel filtration on a column that fractionates in a range with a minimum around 6,000 Da.

3. Isoelectric precipitation. This is particularly suited for IgM molecules, and the precise conditions will depend on the exact properties of the antibody being produced.

4. Ion-exchange chromatography. Whereas most semm proteins have low isoelectric points, γ-globulins are isoelectric around neutrality, depending on the exact properties of the antibody being produced. Adsorption to cation exchangers in a buffer of around pH 6 has been used successfully, with elution with a salt gradient, or even standard saline solution to allow immediate therapeutic use.

5. Hydrophobic chromatography. The low solubility of γ-globulins reflects their relatively hydrophobic character. In the presence of sodium or ammonium sulphate, they bind to many hydrophobic adsorbents, such as "T-gel" which consists of β-mercaptoethanol coupled to divinyl sulphone-activated agarose. 6. Affinity adsorbents. Staphylococcus aureus Outer coat protein, known as Protein A, is isolated from the bacterial cells, and it interacts very specifically and strongly with the invariant region (F_c) of immunoglobulins (Kessler, S.W. (1975) Rapid isolation of antigens from cells with a staphylococcal protein A-antibody absorbent:

Parameters of the interaction of antibody-antigen complexes with protein A. J Immunol. 115, 1617-1624. Protein A has been cloned, and is available in many different forms, but the most useful is as an affinity column: Protein A coupled to agarose. A mixture containing immunoglobulins is passed through the column, and only the immunoglobulins adsorb. Elution is carried out by lowering the pH; different types of IgG elute at different pHs, and so some trials will be needed each time. The differences in the immunoglobulins in this case are not due so much to the antibody specificity, but due to different types of F_c region. Each animal species produces several forms of heavy chain varying in the F_c region; for instance, mouse immunoglobulins include subclasses IgGi, IgG_2a, and IgG₃ all of which behave differently on elution from Protein A.

Some γ-globulins do not bind well to Protein A. An alternative, Protein G from G from a Streptococcus sp., can be used. This is more satisfactory with immunoglobulins from farm animals such as sheep, goats and cattle, as well as with certain subclasses of mouse and rabbit IgGs. The most specific affinity adsorbent is the antigen itself.

The process of purifying an antibody on an antigen adsorbent is essentially the same as purifying the antigen on an antibody adsorbent. The antigen is coupled to the activated matrix, and the antibody-containing sample applied. Elution requires a process for weakening the antibody-antigen complex. This is particularly useful for purifying a specific antibody from a polyclonal mixture.

Monoclonal antibodies (MAbs) can be prepared to most antigens. The antigen-binding portion may be a part of an antibody (for example a Fab fragment) or a synthetic antibody fragment (for example a single chain Fv fragment [ScFv]). Suitable monoclonal antibodies to selected antigens may be prepared by known techniques, for example those disclosed in "Monoclonal Antibodies: A manual of techniques ", H Zola (CRC Press, 1988) and in "Monoclonal Hybridoma Antibodies: Techniques and Applications ", J G R Hurrell (CRC Press, 1982).

Chimaeric antibodies are discussed by Neuberger et al (1988, 8th International Biotechnology Symposium Part 2, 792-799).

Suitably prepared non-human antibodies can be "humanized" in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies.

Raising an antibody response in a subject

Active immunisation of a subject is preferred. In this approach, one or more polypeptides comprising in combination polypeptide sequences of two or more of EspA types are prepared in an immunogenic formulation containing suitable adjuvants and carriers and administered to the subject. Thus, the subject is administered polypeptides corresponding to two or more EspA types. It is preferred that the subject is administered two or more of EspA from EHEC 0157(:H7), EPEC 0127(:H6), 026, O103, Ol l l and 0145. By polypeptides is included peptidomimetic molecules containing EspA peptides or full length EspA or chimaeric polypeptides of the invention.

Suitable adjuvants include Freund's complete or incomplete adjuvant, detoxified cholera toxin or heat labile E. coli toxin, muramyl dipeptide, the "Isco s" of EP 109 942, EP 180 564 and EP 231 039, aluminium hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, Pluronic polyols or the Ribi adjuvant system (see, for example GB-A-2 189 141). "Pluronic" is a Registered Trade Mark. It may be advantageous not to include such an adjuvant.

Alternatively, as discussed above, a DNA vaccine may be administered.

Suitable formulations and methods for preparing same will be apparent to those skilled in the art, and are summarised in, for example, PCT/GB00/00254.

Preferred formulations include those suitable for oral administration, including topical oral administration, intranasal (mucosal) administration and parenteral administration, including intramuscular or subcutaneous injection.

Formulations suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of an active ingredient.

Examples of formulations that may be useful with the present invention are described below. Other formulations may also be used.

Example A: Injectable Formulation

Active ingredient 0.200 g

Sterile, pyrogen free phosphate buffer (pH7.0) to 10 ml

The active ingredient is dissolved in most of the phosphate buffer (35-40°C), then made up to volume and filtered through a sterile micropore filter into a sterile 10 ml amber glass vial (type 1) and sealed with sterile closures and overseals.

Example B: Intramuscular injection

Active ingredient 0.20 g Benzyl Alcohol 0.10 g

Glucofurol 75® 1.45 g

Water for Injection q.s. to 3.00 ml

The active ingredient is dissolved in the glycofurol. The benzyl alcohol is then added and dissolved, and water added to 3 ml. The mixture is then filtered through a sterile micropore filter and sealed in sterile 3 ml glass vials (type 1). Example C: Syrup Suspension

Active ingredient 0.2500 g

Sorbitol Solution 1.5000 g

Glycerol 2.0000 g

Dispersible Cellulose 0.0750 g

Sodium Benzoate 0.0050 g

Flavour, Peach 17.42.3169 0.0125 ml

Purified Water q.s. to 5.0000 ml

The sodium benzoate is dissolved in a portion of the purified water and the sorbitol solution added. The active ingredient is added and dispersed. In the glycerol is dispersed the thickener (dispersible cellulose). The two dispersions are mixed and made up to the required volume with the purified water. Further thickening is achieved as required by extra shearing of the suspension.

Example D: Suppository mg/suppository Active ingredient (63 :m)* 250 Hard Fat, BP (Witepsol H 15 - Dynamit Nobel) 1770

2020

*The active ingredient is used as a powder wherein at least 90% of the particles are of 63 μm diameter or less.

One fifth of the Witepsol HI 5 is melted in a steam-jacketed pan at 45°C maximum. The active ingredient is sifted through a 200 μm sieve and added to the molten base with mixing, using a silverson fitted with a cutting head, until a smooth dispersion is achieved. Maintaining the mixture at 45°C, the remaining Witepsol HI 5 is added to the suspension and stirred to ensure a homogenous mix. The entire suspension is passed through a 250 μm stainless steel screen and, with continuous stirring, is allowed to cool to 40°C. At a temperature of 38°C to 40°C 2.02 g of the mixture is filled into suitable plastic moulds. The suppositories are allowed to cool to room temperature.

Example E: Pessaries mg/pessary

Active ingredient 250

Anhydrate Dextrose 380

Potato Starch 363

Magnesium Stearate 7

1000

The above ingredients are mixed directly and pessaries prepared by direct compression of the resulting mixture.

Use in medicine The aforementioned active agents or a formulation thereof may be administered in a variety of ways, for non-limiting example, by any conventional method including oral and parenteral (eg subcutaneous or intramuscular) injection. The treatment may consist of a single dose or a plurality of doses over a period of time, depending on the characteristics (for example, age, weight and condition) of the subject (which may be an animal, and which may have no symptoms of disease) and/or the state of the particular bacterial disease against which the treatment (which may be prophylactic treatment) is directed. Diagnosis of disease

The agents and other compounds of the invention may also find utility as diagnostic agents. Skilled persons will appreciate that the agents and other compounds of the invention can readily be provided for use in ELISA techniques. They may also be useful in isolating or identifying bacteria (for example E. coli) expressing any type of EspA from a sample (for example a biological or food sample), for example using immuno-magnetic separation techniques. They may also be useful in diagnosis to determine if a subject has been exposed to any EspA.

Prevention of disease

The agents of the invention may find particular utility in the prevention of bacterial infections. For example, the agents can be administered to humans or animals at particular risk of exposure to bacterial infections. Such risks may arise when a human or animal is likely to, or has already, come into contact with an affected human or animal.

It will be appreciated that the agents of the invention can be used to treat humans and animals.

Antigenic variation within EspA filaments of enteropathogenic and enterohaemorrhagic Escherichia coli

Enteropathogenic E. coli (EPEC) and enterohaemorrhagic E. coli (EHEC) possess a filamentous type III secretion system (TTSS) employed to deliver effector proteins into host cells. EspA is a type III secreted protein which forms the filamentous extension to the TTSS and which interacts with host cells during early stages of "attaching & effacing" (A/E) lesion formation. By immunofluorescence, a polyclonal antibody previously raised to EspA from EPEC strain E2348/69 (0127:H6) was observed to stain ~12nm diameter EspA filaments produced by the EPEC strain but did not stain similar filaments produced ^'by EHEC strain 0157:H7. Similarly, an antibody we subsequently raised to EHEC strain 85-170 (0157:H7) EspA stained -12 nm diameter EspA filaments produced by strain 85-170 but did not stain E2348/69 EspA filaments. Given such heterogeneity between EPEC and EHEC EspA filaments, the aim of the present study was to examine antigenic variation of functional EspA filaments amongst different EPEC and EHEC serotypes. Using the EPEC EspA antisemm, EspA filaments were only observed with EPEC serotypes 0127:H6 and 055:H6, serotypes which encode identical EspA protein. When stained with the EHEC EspA antisemm, EspA filaments were only detected on EHEC strains belonging to serotype 0157:H7; the EHEC antisemm did, however, stain EspA filaments produced by the closely related EPEC serotype 055:H7 but not of any other EPEC serotype tested. Such antigenic variation amongst functional EspA filaments of EPEC and EHEC would be expected to have important implications for the development of broad range EspA-based vaccines.

Esp A filaments can readily be detected during early stages of A/E lesion formation. Accordingly, we infected Hep-2 epithelial cells with EHEC strain 85-170 (a stx negative 0157:H7) (Tzipori S et al. Role of a 60- megadalton plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect

Immun 1987 Dec;55(12):3117-25) and with EPEC strain E2348/69 (0127:H6)(Levine et al. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet 1978

May 27; 1 (8074): 1119-22) as a control for 3 hours, fixed the cells in formalin and performed indirect immunofluorescence using a rabbit EspA_{E2348 69} polyclonal antisemm (Knutton et al (1998) EMBO J 17, 2166-2176) and a goat anti-rabbit Alexa488 fluorescence conjugate (Molecular Probes). This revealed positive staining of the EPEC E2348/69 EspA filaments but no staining of corresponding structures produced by EHEC 85-170 (Figure 1). At later stages of infection bacteria induced actin accretion that could readily be detected by fluorescent actin staining (FAS) using fluorescein conjugated phalloidin (Knutton et al. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun 1989 Apr;57(4): 1290-8). Indeed, a positive FAS reaction was observed following infection with both EPEC E2348/69 and EHEC 85-170 (Figure 1). It is well documented that a positive FAS reaction, a correlate of A/E lesion formation, is dependent on formation of EspA filaments (Kenny et al (1996) Mol Microbiol 20, 313- 323; Knutton et al (1998) EMBO J 17, 2166-2176). Accordingly, we hypothesised that our inability to detect the EHEC 85-170 EspA filaments using the EPEC antisera is due to antigenic variation between the two strains.

In order to investigate possible antigenic variation, EHEC _EspA was cloned, following PCR amplification using Deep Vent™ DNA polymerase (New England Biolabs), the primer pair espA-F (5' TATCATATGGATACATCAAATGCAACATCCGTT 3') and EspA-R (5' TATGGATCCTTATTTACCAAGGGATATTGCTGAAATAG 3') and EHEC genomic DNA from the prototype strain 85:170 (0157:H7) as DNA template, into Ndel/BamHI digested pET28-a, generating plasmid pICC207 for expression as a His-tagged protein.

His6-EspA fusions were expressed in BL21 (DE3)pLysS(pICC207). An overnight culture was diluted 1 : 100 in 100ml of LB (30 μg/ml kanamycin, 30 μg/ml chloramphenicol and 0.2% glucose), grown to an OD₆₀₀ of 0.4- 0.8, at 37°C with shaking, and induced with the addition of OmM IPTG. Following a further 4 hours (30°C) incubation, bacterial cells were pelleted, resuspended in cold binding, buffer (5mM imidazole, 0.5 M NaCl, 20mM Tris-HCl, pH 7.9) and sonicated. Following removal of cell debris by centrifugation (45,000g for 30 min), the cell extracts were filtered through a 0.45μm pore size filter device and His₆-EspA was purified on a 2.5ml nickel-charged column as recommended by the manufacturer (Novagen) and described before (Knutton et al A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J 1998 Apr 15;17(8):2166-76). 80-100 μg of the recombinant His₆-EspA were used to immunise, subcutaneously in complete Freund's adjuvant, female Sandy half-lop rabbits. The animals were boosted twice with the same antigen in complete Freund's adjuvant at 3-week intervals before exsanguinations.

Employing this EHEC 85-170 EspA antisemm on infected epithelial (HEL) cells revealed staining of EspA filaments specifically in association with EHEC 85-170 bacteria whereas no staining of the EspA filaments was seen in association with EPEC E2348/69 (Figure 1). This observation not only provided the first positive identification of EspA filaments on EHEC 0157:H7, but supported the possible existence of antigenic variation between different EspA filaments.

The fact that no cross reactivity was seen between the EPEC E2348/69 and EHEC 85-170 EspA antisera prompted us to determine their reactivity with different EPEC and EHEC clinical isolates from our strain collection (Table 1). Significantly, the EspA_85-170 antisemm stained EspA filaments expressed by all three EHEC 0157:H7 strains tested but did not stain EspA filaments produced by other EHEC eg EHEC 026:H11 (Table 1). In addition, when tested against different EPEC serotypes, the EspA₈₅.₁₇₀ antisemm stained only EspA filaments of the atypical EPEC serotype 055:H7 (Table 1 ; Figure 1). Of note is the fact that the 055:H7 EPEC is believed to be the ancestral origin from which EHEC 0157:H7 emerged (Whittam et al. Clonal relationships among Escherichia coli strains that cause hemorrhagic colitis and infantile diarrhea. Infect Immun 1993 May ;61(5): 1619-2). This observation is intriguing as the level of identity between the amino acid sequence of 055:H7 and 0157:H7 EspA polypeptides (80%) is not significantly greater than the identity between E2348/69 and EHEC EspA proteins (79%). In contrast, the EspA_E2348/69 antisemm specifically stained EspA filaments of EPEC serotypes 01267:H6 and 055:H6. The antisemm did not react with EspA filaments expressed by any of the other EPEC and EHEC strains tested (Table 1; Figure 1). The crossreactivity of E2348/69 antisemm with the 055:H6 strains was not unexpected, as the amino acid sequence of the EspA protein is identical between the two serotypes (Neves et al. Molecular and ultrastructural characterisation of EspA from different enteropathogenic Escherichia coli serotypes. FEMS Microbiol Lett 1998 Dec l;169(l):73-80).

We recently demonstrated EspA filament mediated attachment of EPEC to red blood cell RBC membranes (Shaw et al. EspA filament-mediated protein translocation into Red Blood Cells. Cell Microbiol (2001) 3, 213- 222) and by scanning electron microscopy demonstrated filaments resembling EspA filaments mediating attachment of EHEC 0157 to RBCs (Shaw et al (2001)), filaments which we have now confirmed as EspA filaments by immunofluorescence. Although we were unable to demonstrate EspA filaments produced by most EPEC and EHEC serotypes by immuno-fluorescence (Table 1), scanning electron microscopy of RBCs infected with EPEC and EHEC strains which did not react with either EpsA_E2348/69 or EspAs₅.n0 antisemm did reveal filaments which mediated bacterial attachment to the RBC membrane and which resembled filaments confirmed as EspA by immunogold labelling with lOnm gold particles detected with a backscattered electron detector (Figure 2). In this Example we have shown antigenic variation between EspA filaments expressed by different EPEC and EHEC isolates. Considering the high level of amino acid sequence identity between different EPEC and EHEC EspA proteins and despite the fact that EspA genes could be grouped using PCR (China et al. Comparison of eae, tir, espA and espB genes of bovine and human attaching and effacing Escherichia coli by multiplex polymerase chain reaction. FEMS Microbiol Lett 1999 Sep l;178(l):177-82), the lack of crossreactivity was unexpected. However, this observation is significant as EspA is considered to be an important component of a veterinary EHEC vaccine. Our results imply that immunisation with EHEC 0157 EspA would potentially reduce carriage of EHEC 0157 but would not protect livestock animals from other EHEC serotypes (ie EHEC 026:H11, EHEC O103:H2 and EHEC Ol l l) which, in some countries are more prevalent than 0157 EHEC. Indeed, using the Citrobacter rodentium mouse model of infection, we recently showed that immunisation with EspA_2348/69 did not prevent colonisation of the mouse gut following oral challenge with C. rodentium (results not shown). Taken together the results presented in this Example imply that for a broad range EspA-based vaccine, a combination of recombinant or secreted EspA preparations should be required.

Assessment of EspA-specific immune responses in mouse bacterial colonisation and disease caused by Citrobacter rodentium (a model for EHEC and EPEC colonisation)

Mucosal and systemic vaccination regimes using enterotoxin-based adjuvants may be employed to elicit immune responses to recombinant EspAs, for example from EPEC strain E2348/69 (EPEC 0127:H6) and EHEC strain 85-170 (EHEC 0157:H7). Immune responses to EspA antigens in mice infected with C. rodentium are measured in order to determine whether infected animals develop acquired immunity. The study investigates modulation by EspA vaccination of the outcome of an infection with C. rodentium. Immunisation, for example parenteral immunisation, of mice with EspAs is considered significantly to limit colonisation and disease caused by experimental C. rodentium infection. Immunisation with EspA_E2348/69 alone did not prevent colonisation of the mouse gut following oral challenge with C. rodentium.

Techniques for performing tests, for example immunisation formulations and protocols, and methods for assessing immune response, in the mouse/ C. rodentium model are described in, for example, WO 02/79247 and WO 02/79240.

Claims

1. A pharmaceutical composition comprising a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence, together with a pharmaceutically acceptable diluent or carrier.

2. A pharmaceutical composition according to claim 1 comprising a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two sequences of at least eight contiguous amino acids derivable from two different naturally occurring full length EspA polypeptides, and not being derivable from the same naturally occurring full length EspA polypeptide sequence.

3. A pharmaceutical composition according to claim 1 comprising a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two epitopes derivable from two different naturally occurring full length EspA polypeptides and not being derivable from the same naturally occurring full length EspA polypeptide sequence.

4. A vaccine effective against bacterial infection, for example EHEC and/or EPEC infection, comprising an effective amount of the polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in any one of claims 1 to 3.

5. A food product comprising a foodstuff and a polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in any one of claims 1 to 3.

6. A kit of parts comprising a polypeptide and polynucleotide, polypeptides and/or polynucleotides as defined in any one of claims 1 to 3 and optionally a pharmaceutically acceptable diluent or carrier.

7. The pharmaceutical composition, vaccine, food product or kit of parts of any of the preceding claims wherein the polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprise or encode a polypeptide or polypeptides which comprise or consist in combination of EspA polypeptides (preferably full length EspAs) derivable from at least two, three, four or all five of EHEC 026, EHEC 0103, EHEC 0111, EHEC 0145 and EHEC 0157.

8. The pharmaceutical composition, vaccine, food product or kit of parts of any of the preceding claims wherein the polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprise or encode a polypeptide or polypeptides in combination comprising or consisting of at least EspA or a fragment thereof from EHEC 0157:H7 and EspA or a fragment thereof from EPEC 0127:H6.

9. A chimaeric polypeptide comprising or consisting of one or more copies of at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence.

10. The chimaeric polypeptide of claim 9 comprising or consisting of one or more copies of at least two of (1) an epitope derived from EspA from EHEC 0157 (2) an epitope derived from EspA from EPEC 0127 or EPEC 055 (3) an epitope derived from EspA from EHEC 026 (4) an epitope derived from EspA from EHEC 0103 (5) an epitope derived from EspA from EHEC 0111 and (6) an epitope derived from EspA from EHEC 0145.

11. A polynucleotide encoding a chimaeric polypeptide according to claim 9 or 10.

12. A recombinant microorganism comprising a polynucleotide according to claim 11.

13. A peptidomimetic compound corresponding to the chimaeric polypeptide of claim 9 or 10.

14. A food product comprising a foodstuff and a chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of claims 9 to 13.

15. A pharmaceutical composition comprising a chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of claims 9 to 13 and a pharmaceutically acceptable diluent or carrier.

16. A vaccine effective against bacterial infection, for example EHEC and/or EPEC infection, comprising an effective amount of chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of claims 9 to 13.

17. A pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of the preceding claims for use in medicine.

18. The use of a pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of claims 1 to 16 in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection.

19. The use of a pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, peptidomimetic compound, polynucleotide or recombinant microorganism according to any one of claims 1 to 16 in the manufacture of a composition for use as a food supplement or a food additive.

20. The use of a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence, in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection.

21. A method of treating a human or animal with or at risk of bacterial infection, wherein the human or animal is administered a pharmaceutical composition, vaccine, food product, constituents of a kit of parts, chimaeric polypeptide, peptidomimmetic compound, polynucleotide or recombinant microorganism according to any one of claims 1 to 16.

22. The use of (1) a peptidomimetic compound or compounds corresponding to the polypeptide or polypeptides as defined in any one of claims 1 to 8 and/or (2) antibodies or an antibody preparation reactive with the said polypeptide or polypeptides, in the manufacture of a medicament for the treatment of a human or animal with or at risk of bacterial infection.

23. A method of treating a human or animal with or at risk of bacterial infection, wherein the human or animal is administered (1) a polypeptide or polypeptides and/or polynucleotide or polynucleotides as defined in any one of claims 1 to 8 and/or (2) a peptidomimetic compound or compounds corresponding to the said encoded or comprised polypeptide or polypeptides, and/or (3) an antibody preparation or antibodies as defined in claim 20.

24. The use of a polypeptide or polypeptides and/or polynucleotide or polynucleotides in combination comprising or encoding a polypeptide or polypeptides in combination comprising at least two different EspA polypeptides, not being derivable from the same naturally occurring full length EspA polypeptide sequence, in the manufacture of a composition for use as a food supplement or a food additive.

25. A food product as claimed in claim 5 or 14 or use according to claim 19 or 24 wherein the food is adapted for consumption by animals.

26. A food product as claimed in claim 5 or 14 or use according to claim 19 or 24 wherein the food is adapted for consumption by humans.

27. The use or food product of any one of claims 5, 14, 19, 24, 25 or 26 wherein the food is a milk substitute.

28. The use or food product of any one of claims 5, 14, 19, 24, 25 to 26 wherein the food is suitable for administration to a human baby or infant or a young animal.

29. An antibody preparation reactive against two or more EspAs for use in medicine.

30. A pharmaceutical composition comprising an antibody preparation reactive against two or more EspAs and a pharmaceutically acceptable diluent or carrier.

31. The use of an antibody preparation as defined in claim 29 or composition as defined in claim 30 in the manufacture of a medicament or food supplement composition for use in the prevention or treatment of a bacterial disease.

32. A method of treatment of a human or animal with or at risk of a bacterial disease, wherein the human or animal is administered an antibody preparation as defined in claim 29 or composition as defined in claim 30.

33. The method or use of any of the preceding claims wherein the bacterial infection causes an histopathologic effect on intestinal epithelial cells, known as attachment and effacement (A/E).

34. The method or use of any of the preceding claims wherein the bacterial infection comprises infection by one or more of enteropathogenic E.coli (EPEC) and/or enterohemmorrhagic E.coli (EHEC), Shiga toxigenic E.coli, H.alvei, and C. rodentium.

35. The method or use according to claim 34 wherein the bacterial infection comprises E. coli 0157:H7 and wherein the polypeptide or polypeptides comprise E. coli 0157:H7 EspA or a fragment thereof.

36. The method or use of any of the preceding claims wherein the recipient is a human.

37. The pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, peptidomimetic compound, polynucleotide, recombinant microorganism, method or use according to any one of the preceding claims wherein the polypeptide or polypeptides comprise full length EspAs.

38. The pharmaceutical composition, vaccine or food product of any of the preceding claims further comprising TirM, EspB or an intimin or a fragment thereof, or a polynucleotide encoding TirM, EspB or an intimin or a fragment thereof.

39. The use of any of the preceding claims wherein the medicament or food product further comprising TirM, EspB or an intimin or a fragment thereof, or a polynucleotide encoding TirM, EspB or an intimin or a fragment thereof.

40. The pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, polynucleotide or use of any of the preceding claims wherein the polypeptide(s) or polynucleotide(s) are components of a recombinant microorganism.

41. The pharmaceutical composition, vaccine, food product, kit of parts, chimaeric polypeptide, polynucleotide or use of claim 40 wherein the recombinant microorganism is a Bifidobacterium or a lactobacillus.