WO2004048612A2

WO2004048612A2 - Bridge-probes for detecting non-contiguous cis-located acd sequences

Info

Publication number: WO2004048612A2
Application number: PCT/GB2003/005014
Authority: WO
Inventors: Ian Crosby; Bunce Michael
Original assignee: Dynal Biotech Limited
Priority date: 2002-11-22
Filing date: 2003-11-19
Publication date: 2004-06-10
Also published as: AU2003302441A1; WO2004048612A3; GB2395556A; GB0227271D0; AU2003302441A8

Abstract

The present invention relates to probes, methods and apparatus for the detection of the presence or absence of non-contiguous cis-located nucleic acid sequences which are characteristic of alleles including those relating to the human leukocyte antigen (HLA) which is of interest in the field of human transplantation and disease.

Description

PROBES The present invention relates to probes, methods of detection and diagnosis, and apparatus for use in such methods. In particular, the present invention relates to nucleic acid, especially oligonucleotide, probes and to methods and apparatus for the detection of the presence or absence of non-contiguous cw-located nucleic acid sequences and polymorphisms therein.

Two or more nucleic acid polymorphisms on a single molecule or strand are said to be cw-located and these occur naturally in nucleic acid sequences, particularly in alleles belonging to the human leucocyte antigen (HLA) system. As detailed by Bodmer et al (Tissue Antigens (1999) 53 407-446 ), the HLA locus is the most polymorphic in the human genome. There are currently over 240 HLA-A alleles, 478 HLA-B, 116 HLA-C, 99 HLA-DPB1, 52 DQB1 and 305 DRB1 alleles, with new alleles being discovered continuously. All HLA-A, -B, and -C alleles have similar sequences made up of blocks of polymorphisms, or sequence motifs. The differing alleles are generally made up of recombinations of these sequence motifs. The same holds for class II loci such as DRB1, DRB3, DRB4, DRB5 and DPBl.

Many methods exist for HLA genotyping. One common method utilises target DNA amplification by polymerase chain-reaction (PCR) followed by detection of polymorphic DNA sequences using sequence-specific oligonucleotide probes (SSO) (Saiki R-K et al,

Nature. 1986 Nov 13-19;324(6093):163-6). The SSO probes hybridised to target DNA may be detected by, for example, colorimetric, radioactive or fluorescent methods. In HLA genotyping the initial amplification is normally generic, but may comprise a mosaic of amplifications which when used together amplify all possible alleles of a given locus. SSO techniques were first applied to HLA genotyping (HLA-DQA1) by Saiki et al (Saiki RK et al, Nature. 1986 Nov 13- 19;324(6093): 163-6). Subsequently SSO reverse blot techniques (Erlich H et al, Eur J Immunogenet. 1991 Feb-Apr;l8(l-2):33-55) were developed. Reverse methods depend on the incorporation of a chemical label such as biotin in the initial generic PCR amplification, usually via labeled amplification primers. In the reverse dot blot, the SSO probes are bound to a solid support membrane leaving the detection end of the probe free to interact with target DNA. On a single membrane many different probes can be bound which would theoretically contain all of the polymorphisms required to genotype an individual at any given locus. When labeled DNA target is applied to the reverse dot blot membrane the DNA will only hybridise to the probes that are matched in DNA sequence. Hybridised biotin-labeled products are detected by the addition of a reporter molecule that induces a colour change in the substrate. Whether a probe will hybridise specifically to a target DNA sequence is dependent upon the amount of probe-target mismatching, mismatch position relative to the probe and probe length and is largely dependent upon the conditions for the hybridisation (such as temperature and salt concentration).

HLA alleles are constructed from a patchwork of polymorphic DNA motifs that are shared by other alleles. It is not possible to discriminate between certain sets of alleles using conventional SSO techniques due to these shared motifs and the fact that most animals are diploid, in that we all have two copies of each locus, i.e. two HLA-A alleles, two HLA-B etc. As a consequence of shared motifs, a single probe is likely to be capable of detecting a number of different alleles that compromise the specificity of the probe by detecting a large number of alleles rather than a small number of alleles or being specific for one allele. In addition, using conventional SSO techniques utilising a mixture of probes (one for each spatially separated target polymorphism), it is not possible to determine whether the motifs are present or not on the same allele since each of the probes will hybridise to different alleles if the two alleles present in the DNA both contain one or both of the target polymorphisms. A theoretical possibility to overcome such problems is to design a probe which will hybridise with two or more target polymorphisms but not with their intervening nucleic acid sequence. However, in circumstances where the target DNA motifs are spaced apart, designing a single probe with standard matching nucleotides complementary to the spatially separated target DNA motifs and the intervening sequence between them will impact on the probe' s hybridisation temperature increasing it beyond normal design constraints for conventional SSO techniques where a probe to target DNA hybridization temperature are normally within the range 35°C-65°C.

U.S. Pat. App. No. 20010019825 discloses a method of amplifying DNA for detecting target nucleic acid sequences with diagnostic primers including primer regions and probe regions which are complementary to target and reference regions respectively on a sample nucleic acid strand. Optionally, there is provided a region on the diagnostic primer that is separated by a spacer region of nucleic acid. U.S. Pat. App. No. 20020042077 discloses partially non-hybridising oligonucleotides that contain two or more hybridising segments, with any two hybridising segments separated by a non-hybridising spacer segment. The art in this application is the design of probes with multiple hybridising regions, but not specifically to detect cw-located polymorphisms for the purpose of increasing a given probe's specificity for an allele or group of alleles sharing the two or more polymorphisms.

Another major problem associated with probes that comprise two hybridising segments and a non-hybridising spacer segment is that the non- hybridising spacer, being composed either of nucleic acid or a compound with similar properties to that of nucleic acid, produces a probe that requires less stringent hybridisation conditions. The reduced stringency is to allow for hybridisation in the presence of mis-matched nucleotides/nucleosides or similar compounds within the spacer segment, which leads to problems with false positives and results that can be hard to interpret.

It is an object of the present invention to alleviate or overcome one or ore of the problems associated with the prior art.

In accordance with a first aspect of the present invention there is provided a nucleic acid probe for detecting a target nucleic acid sequence comprising two or more cz^'s-located regions separated by an intervening nucleic acid sequence of a length sufficient to form a loop or hairpin structure, the probe comprising two or more substantially contiguous nucleic acid regions capable of respectively hybridizing with respective spatially separate cw-located nucleic acid regions on the target sequence, when the intervening loop or hairpin structure on the target sequence is formed, such that base-base pairwise hybridisation between the two or more substantially contiguous regions of the probe and the respective allocated nucleic acid regions on the target sequence can be effected in use of the probe. By "substantially contiguous" is meant that the two or more hybridizing regions of the probe are separated by no more than a few, for example no more than about five or less base pairs, nucleic acid residues or other molecules (such as inert spacer molecules). Preferably the two or more hybridizing regions on the probe are contiguous. The invention relates to probes capable of detecting non-contiguous cis- located nucleic acid sequences which are characteristic of certain alleles including those relating to the human leukocyte antigen (HLA), and other genes within the major histocompatibility complex (MHC) which is of interest in the field of human transplantation and disease. However, the probe of the invention is not restricted to be determinative of genes within the MHC but can be applied to any allelic system in which the alleles have two or more cw-located regions to be detected. For example the probe according to the invention may be designed to target other polymorphic genes including, but not restricted to, thiopurine methyl transferases (TPMT), heamochromatosis gene (HFE), tumour necrosis factor (TNF), lymphotoxin (LT), mannose binding lectin (MBL), ABO and other blood grouping systems such as Secretor, Duffy and Rhesus, Factor V Leiden, platelet membrane glycoproteins (GPIIIa/IIb/Ib/IX), human platelet antigens (HP A), CC- chemokine receptor 5 (CCR5), interleukin genes and interleukin receptors, chemokine genes and chemokine receptors, cystic fibrosis genes, KIR genes, cluster differentiation antigens (CD), such as CD1, NOTCH genes, TOLL genes, heat shock proteins, xanthidin.oxidase (XO), manganese superoxide dismutase (SOD), paraxonase, N-acetyl transferase (NAT-1 and NAT2), cytochrome P450 CYP2D6 (debrisoquine hydroxylase), multidrug resistance gene 1 (MDR1) and cell adhesion molecules such as MICA, MICB, NCAM, ICAM and PECAM. The target nucleic acid sequence may comprise one or more alleles of a gene. For example the target sequence may comprise one or more alleles of HLA. Examples of other alleles that could be determined by the probe according to the invention include, but are not limited to, TPMT*3a, TΝF alleles, referred to as the allelic types -238G/-238A-308G/-308A-376G/-376A (see Knight et al

•Nature Genet. 22: 145-150, 1999), HFE C282Y (Feder et al Proc. Nat. Acad. Sci. 95: 1472-1477, 1998).

The probe of the invention is conveniently referred to as a "double-hit probe". The probe of the invention yields a significant advantage over prior art bridged probes in that the formation of a loop or hairpin structure in the intervening region of the target sequence in use of the probe allows pair- wise matching of the substantially contiguous hybridizing regions on the probe with respective cw-located non-contiguous motifs in a target allele(s), thus making the probe specific for two or more regions when present on the same allele.

The probe of the invention has a particular advantage over prior art probes in the event that there are a number of polymorphic sequences, one or more of which represent the target sequence, in the sample to be probed. A hypothetical illustration of this advantage is illustrated in Figure 1. Referring to Figur,e 1, SSO probes 1-4 (of the prior art type) could be designed to descriminate between the alleles D*9901-*9904 using polymorphisms at positions 14 and 37. If a locus specific amplicfication was used and tested with the four probes and hybridized to a locus specific PCR-amplified DNA sample one possible result is that all the probes might be positive. If so, it would not be possible to determine which pair of alleles were present in the sample as D*9901 + D*9904 is the same as D*9902 + D*9903. However, when the two polymorphisms at positions 14 and 37 are linked (in cis) by a single probe (according to the invention), the probe is specific for the two non-contiguous sequence motifs. In Figure 1 probe 5 (according to the invention) (wherein " " indicates contiguity between the two hybridizing regions) is specific for the D*9903 allele.

The absence of any molecules, hybridizing or otherwise, in the probe between the left and right arms of the probe means that the hybridization temperature (and any other hybridization condition) is determined solely by the regions on the probe which hybridise with the spatially distinct cts-located regions on the target sequence. If a probe (of the prior art type) were designed with a spacer region comprising standard matching nucleotides (capable of pairing with the intervening sequence in the target) the probe's hybridisation temperature would be increased above the normal design constraints within an SSO typing system and the probe specificity would be compromised.

Certain prior art probes are known to contain inert spacers (as described in US-A-2002/0042077, for example). However, the spacers in these prior art probes are not effective for maintaining correct spatial orientation, and thus pairwise binding on hybridization of the non-contiguous regions of the probe with -located regions on a target sequence.

Figure 2 illustrates the principle of the invention. In the first and second diagrams, the probe of the invention is shown improperly bound to a target sequence in which no hairpin structure has been formed. In the third diagram, the hairpin structure is formed and the probe is properly bound, with full pairwise binding.

The increased specificity owing to the ability of the probe of the invention to hybridise two or more non-contiguous regions of the target sequence reduces the number of alleles which can be detected by that probe and thus provides improved resolution over conventional SSO probing or any other technique involving oligonucleotide probes hybridizing to polymorphic target DNA sequences such as cDNA library screening or detection of R A polymorphims. The invention provides for cis (in phase) detection of spatially distinct target nucleic acid sequences with single diagnostic complementary DNA probes. The word cis refers to sequences that are in series on an allele, for example. The phrase 'spatially distinct' refers to discrete sequences that are located at different points along a gene or genome.

The target nucleic acid sequence may comprise one or more alleles of a gene.

The probe preferably comprises first and second regions that are capable of hybridising to first and second non-contiguous regions on the target nucleic acid sequence respectively. The regions of the probe that are capable of hybridising to the target nucleic acid sequence may comprise at least one nucleotide complementary to at least one nucleotide on the target nucleic acid sequence. The preferred range of the hybridizing regions is between 1-20 complementary nucleotides. The preferred range of the target DNA hairpin loop may be between l-600bp. The probe may comprise the equivalent of 1 to 300 nucleic acid bases in total length. Preferably the probe comprises the equivalent to 1-200 nucleic acid bases. More preferably still, the probe comprises the equivalent to 30-100 nucleic acid bases.

The probe comprises nucleic acid regions capable of hybridizing with respective cz^'-. -located nucleic acid regions on the target sequence. These nucleic acid regions of the probe will often suitably comprise nucleotides but may alternatively or also comprise modified bases (DNA analogues) which may in some cases bind to the target sequence more efficiently than conventional nucleotides. Suitable DNA analogues include, for example, amino nucleic acid (ANA), peptide nucleic acid (PNA) and locked nucleic acid (LNA). The hybridizing nucleic acid regions of the probe may also comprise nucleosides. The nucleotides, nucleosides, and/or analogues thereof which make up the hybridizing regions of the probe are preferably selected for the property they will specifically hybridise, to an adequate extent, with the target sequence. Preferably, the probe is capable of hybridising to HLA alleles, but may include any polymorphic loci where there are two or more polymorphic regions on one or more alleles within said loci.

The probe of the invention may correspond to a formula as follows: 5'-Hybl-Hyb2, e.g. 5'amino-cacgttatcctcctgg tgtccaggttccgca;

5 'amino-cgcacgttatcctcctg tgtccaggttccgca; or

5 'amino-cgcacgttatcctcct tgtccaggttccgca, 5'-Hybl-Hyb2-Hyb3, e.g. 5'amino-cacgttatcctcctgg tgtccaggttccgca tttgatacgacgatagcga, wherein ' ' denotes contiguity of the probe between hybridizing regions,

Hybl = first hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases, Hyb2 = second hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases and Hyb3 = third hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases.

In accordance with a further aspect of the present invention there is provided a method for detecting specifically two or more spatially discrete cis- located target nucleic acid sequence in a sample comprising contacting said sample with at least one probe as described herein above under conditions effective to allow formation of a loop or hairpin in the target sequence between one or more pairs of cis -located sequences and to allow hybridization of the substantially contiguous hybridising regions of the probe with respective noncontiguous regions of the target sequence, and determining whether any probe/target nucleic acid sequence hybrid is formed. Preferably the methods described hereinabove comprise the pre-step of amplifying the nucleic acid sample using a technique known in the art such as, for example, polymerase chain reaction (PCR) (Saiki RK et al Science. 1985 Dec 20;230(4732):1350-4). Preferably, the method of the invention comprises contacting the probes and sample nucleic acid under hybridising conditions. The conditions may be those used in standard SSO techniques.

Thus, the invention further provides a method for detecting a target nucleic acid sequence in a sample, wherein the target nucleic acid sequence comprises two or more cz^'-s-located regions separated by an intervening nucleic acid sequence of a length sufficient to form a loop or hairpin structure, comprising contacting the sample with a nucleic acid probe comprising two or more substantially contiguous nucleic acid regions capable of respectively hybridizing with the two or more respective spatially separate cis-located nucleic acid regions on the target sequence under conditions effective to induce the formation of a hairpin structure in the target sequence and allow base-base pairwise hybridisation between the two or more substantially contiguous regions of the probe and the respective cis- located nucleic acid regions on the target sequence, and determining the presence of any resulting hybrid.

In accordance with a further aspect of the present invention there is provided an apparatus for detecting a target nucleic acid sequence in a sample, the apparatus comprising a sample application zone and at least one probe as described hereinabove. It is a preferred feature of the present invention that the apparatus for detecting a target nucleic acid sequence in a sample may be used in a biological assay. Preferably, the biological assay is used for the detection of one or more sequences in a sample. More preferably, the biological assay is used for to detect polymorphisms in human leukocyte antigens (HLA). In accordance with another aspect of the present invention, there is provided a method of diagnosis comprising contacting a probe as herein described, designed to hybridise to an allele or number of alleles and/or mutations, with a sample from an individual and detecting the presence or absence of a resulting hybrid in order to determine the genotype of the individual. This method of diagnosis can be used to assess the precise genetic nature of an individual's condition or disease or to establish the pre-disposition of an individual to a particular condition or disease. Furthermore, the method of diagnosis may also be used to assess genotypic information on an individual. Preferably, the method of diagnosis is used to establish the status of the alleles of the human leukocyte antigens in an individual. It will be apparent to one skilled in the art that the method may be directed towards investigating other polymorphic genes.

In order that the method of the invention may be clearly understood and readily put into effect, a protocol for its operation will now be described. This protocol was used, unless otherwise indicated, in the Examples below.

The probes are conjugated to latex beads via a 5 '-amino linker that binds the probe to carboxylate moieties on the bead surface. Briefly, the conjugation process requires incubation of carboxylate beads with amino-labelled oligonucleotides in the presence of 2M l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), and 50mM N-hydroxysulfosuccinimide (NHS). Un-conjugated probe is subsequently washed away and the beads are resuspended in water and dotted onto nylon membrane (Cuno 0.8 micron) where they are allowed to dry onto the membrane. Prior to the hybridization assay the sample DNA is PCR amplified: The DNA-containing specimen and reagent mixture are heated to 95°C to separate the double-stranded DNA and expose the target sequences to the primers. As the mixture cools, the biotinylated primers anneal to their targets. The thermostable recombinant Thermus aquaticus (Taq) DNA polymerase in the presence of excess deoxynucleoside triphosphates (dNTPs), including deoxyadenosine, deoxyguanosine, deoxycytidine and deoxyuridine (in place of deoxythymidine), extends the annealed primers along the target templates to produce a biotinylated DNA sequence termed an amplicon. This process is repeated for a number of cycles, each cycle effectively doubling the amount of target DNA. For this test, an adequate number of cycles has been determined to be 35, theoretically yielding more than a billion-fold amplification.

After the PCR amplification process, the amplicons are chemically denatured (using a solution containing 3% EDTA, 1.6% sodium hydroxide) to form single strands which are then added to a well of a typing tray that contains the nylon membrane with the immobilized, sequence-specific, oligonucleotide probes. The biotin-labeled amplicons then bind (hybridise) to the sequence- specific probes and thus are "captured" onto the membrane strip. The stringent conditions for hybridisation of the amplicons to the probes ensure the specificity of the reaction.

After a stringent wash of the membrane strip to remove unbound material, a streptavidin-horseradish peroxidase (SA-HRP) conjugate is added to the well of the tray. The streptavidin binds to the biotin-labeled amplicons captured by the membrane-bound probe. After washing off unbound conjugate, the bound SA- HRP conjugate is reacted with hydrogen peroxide (H₂O₂) and tetramethylbenzidme (TMB) to form a colour complex. The reaction is stopped by several water washes. The hybridization stages may be performed manually or may be performed automatically using the Dynal AutoRELI™ 48 automated strip development apparatus (available from Dynal Biotech Ltd).

The developed strips can then be scanned using a flat-bed optical scanner and the results can be interpreted manually or by using an analysis program such as Dynal' s Pattern Matching Program (PMP).

The present invention will now be described, by way of example only, with reference to the following Figures and Examples, in which:

Figure 1 illustrates the principle of bridged and double-hit probes, discussed above;

Figure 2 illustrates further the principle of double-hit probes, discussed above.

Figure 3 illustrates probes according to the invention aligned with selected target sequences; and

Figure 4 illustrates the results of probes according to the invention hybridised with nucleic acid samples. EXAMPLE 1

These experiments were conducted in order to investigate the hybridisation of probes specific for certain alleles (DRB 1*0301/5 etc). Referring now to Figure 3, various test probes (see below) were designed for a combination of 164A-165C-172C combined with 190G-197A- 198 A polymorphisms that together are unique for DRB1 *0301/5/6/8/10-13/15/15/18-20 alleles when used on target DNA amplified with DRB1 locus specific primers. The probes DR3.44- 47 are double-hit probes according to the invention. Regions of contiguity between individual hybridising regions are indicated by ' '. The probes were designed to give positive reactions only when both arms of the double-hit probes are matched for an individual allele: the so called 'intersection specificity'. These probes are designed to have an intersection specificity of DRB 1 * 03011 /* 03012, *03051/03052, * 0308/10/11-16/18-20, *1327/41 & DRB3*0108. Cross-reactivity of the left arm might be expected (for example) with DRB3*0101 alleles whilst cross-reactivity of the right arm might be expected with DRB 1*1301 or DRB 1*1302 alleles. DNA samples containing these potentially false-positive alleles were tested along with true positive DNA samples for DRB 1*0301. The sequences of each probe are outlined in the table below.

Identity Sequence

DR3.44 5 'amino-cacgttatcctccttgtccaggttccgca

DR3.45 5'amino-cacgttatcctcctggtgtccaggttccgcac DR3.46 5'amino-cgcacgttatcctcctgtgtccaggttccgca

DR3.47 5'amino-cgcacgttatcctccttgtccaggttccgca

Probe specificity:

The probe region focusing on ~ position 164 (left arm) matches the alleles DRB 1*03011/2, DRB 1*0304, DRBl*03051/2, DRB 1*0306, DRB1*0308, DRB1*0309, DRB1*0310, DRB1*0311, DRB1*0312, DRB1*0313, DRB1*0314, DRB1*0315, DRB1*0316, DRB1*0318, DRB1*0319, DRB1*0320, DRB1*1327, DRB1*1341, DRB3*01011, DRB3*01012, DRB3*0101202, DRB3*01013, DRB3*010Ϊ4, DRB3*0102, DRB3*0104, DRB3*0106, DRB3*0107, DRB3*0108, DRB3*0110 The second region focusing on ~ position 196 (right arm) matches the alleles

DRB1*1608, DRB1*03011, DRB1*03012, DRB1*03021, DRB1*03022, DRB1*0303, DRB1*03051, DRB1*03052, DRB1*0306, DRB1*0307, DRB1*0308, DRB 0310, DRB1*0311, DRB1*0312, DRB1*0313, DRB1*0314, DRB1*0315, DRB1*0316, DRB1*0318, DRB1*0319, DRB1*0320, DRB1*1109, DRB1*1116, DRB1*1120, DRB1*1140, DRB1*13011, DRB1*13012, DRB1*13021, DRB1*13022, DRB1*1305, DRB1*1306, DRB1*1309, DRB1*1310, DRB1*1315, DRB1*1316, DRB1*1318, DRB1*1320, DRB1*1326, DRB1*1327, DRB1*1328, DRB1*1329, DRB1*1331, DRB1*1332, DRB1*1335, DRB1*1336, DRB1*1339, DRB1*1340, DRB 1341, DRB1*1342, DRB1*1343, DRB1*1402, DRB1*1403, DRB1*1406, DRB1*1409, DRB1*1412, DRB1*1413, DRB 1417, DRB1*1418, DRB1*1419, DRB1*1421, DRB1*1424, DRB1*1427, DRB1*1429, DRB1*1430, DRB1*1433, DRB3*0108 Intersection specificity:

Combining both halves of the double-hit probes gave an overall specificity for the probe of the following alleles. DRB1*03011/*03012,*03051/03052, 0308/10/11-16/18-20, 1327, 1341 & 3*0108. Probes were conjugated to 0. lmicron Polysciences latex particles and were subsequently dotted onto Cuno 0.8 micron nylon membrane and allowed to air dry at room temperature. DNA samples were amplified by PCR using generic primers for DRBl/3/4/5 (CRX28 5'-biotin- CCGGATCCTTCGTGTCCCCACAGCACG, AB60 5'-biotin- CCGAATTCCGCTGCACTGTGAAGCTCTC) and alternatively by DRB1 (primers D6 plus DAS6 or D6 plus DASl depending on cell line genotype) or DRB3 specific primers D9N plus DASl or D9N plus DAS6, again depending on the phenotype). Primers D6, D9N, DASl and DAS6 anneal to their targets at positions 15-38, 12-31, 257-278 and 257-278 respectively.

DNA from the following samples were amplified

Results

Hybridisation was carried out under the standard protocol described above. The desired intersection specificity for probes DR3.44-47 is: DRBl*03011/*03012,*03051/03052, 0308/10/11-16/18-20, 1327, 1341 & 3*0108.

The results are shown in Figure 4. Using the DRB 1 amplification (central panel) probe DR3.44 is essentially negative, whilst probes DR3.45 and DR3.46 exhibit strong crossreactivity with DRB 1*13 sequences. Probe DR3.47 exhibits very weak crossreactivity with DRB 1 * 13r

Claims

1. A nucleic acid probe for detecting a target nucleic acid sequence comprising two or more cz^'-- -located regions separated by an intervening nucleic acid sequence of a length sufficient to form a loop or hairpin structure, the probe comprising two or more substantially contiguous nucleic acid regions capable of respectively hybridizing with respective spatially separate czs-located nucleic acid regions on the target sequence, when the intervening loop or hairpin structure on the target sequence is formed, such that base-base pairwise hybridisation between the two or more substantially contiguous regions of the probe and the respective cis- located nucleic acid regions on the target sequence can be effected in use of the probe.

2. A nucleic acid probe according to claim 1 wherein the probe comprises the equivalent to 1 to 300 nucleotide bases.

3. A nucleic acid probe according to claim 1 or claim 2 wherein the target nucleic acid sequence comprises one or more alleles of a gene.

4. A nucleic acid probe according to any one of claims 1 to 3 wherein the target nucleic acid sequence comprises human leukocyte antigens (HLA). 5. A nucleic acid probe according to any one of claims 1 to 7 wherein the target nucleic acid sequence comprises the heamochromatosis gene (HFE). 6. A nucleic acid probe according to any one of claims 1 to 7 wherein the target nucleic acid sequence comprises the thiopurine methyl transferase gene (TPMT).

7. A nucleic acid probe according to any one of claims 1 to 7 wherein the target nucleic acid sequence comprises the tumour necrosis factor gene

(TNF).

8. A nucleic acid probe according to any one of claims 1 to 7 wherein the probe comprises any one or more sequences selected from the following group:

5'-Hybl-Hyb2, e.g. 5'amino-cacgttatcctcctgg tgtccaggttccgca;

5'amino-cgcacgttatcctcctg tgtccaggttccgca; or 5 'amino-cgcacgttatcc tcct tgtccaggttccgca,

5'-Hybl-Hyb2-Hyb3, e.g. 5'amino- cacgttatcctcctgg tgtccaggttccgca tttgatacgacgatagcga, wherein ' ' denotes contiguity between individual hybridizing regions on the probe, Hyb 1 = first hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases, Hyb2 = second hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases and Hyb3 = third hybridizing nucleotide region comprising, for example, 1-30 nucleotide bases. 9. A probe kit comprising first and second nucleic acid probes according to any one of claims 1 to 8, the first probe differing from the second by at least one nucleic acid base in at least one of the substantially contiguous regions such that the first probe is capable of hybridizing with a first target sequence and the second probe is capable of hybridizing with a second, polymorphic, target sequence.

10. A method for detecting a target nucleic acid sequence in a sample comprising contacting said sample with at least one nucleic acid probe according to any one of claims 1 to 9 and determining the presence of any hybridized material.

11. A method according to claim 10 comprising a pre-step of amplifying the nucleic acid sample using the polymerase chain reaction (PCR).

12. A method according to claim 10 or claim 11 comprising a step of contacting the probe and sample nucleic acid under hybridising conditions.

13. A method according to any one of claims 10 to 12 comprising a step of contacting the probes and sample nucleic under a standard sequence- specific oligonucleotide (SSO) protocol.

14. An apparatus for detecting a target nucleic acid sequence in a sample, wherein the apparatus comprises a sample application zone and at least one probe according to any one of claims 1 to 9.

15. An apparatus according to claim 14, wherein the apparatus is used in a biological assay.

16. An apparatus according to claim 15, wherein the biological assay is used for the detection of one or more sequences in a sample.

17. An apparatus according to any one of claims 14 to 16 wherein the biological assay is used to detect polymorphisms in human leukocyte antigens (HLA)..

18. A method for detecting a target nucleic acid sequence in a sample comprising contacting a sample with at least one probe according to claims 1 to 9, and determining whether any at least one probe/target nucleic acid sequence hybrid is formed. 19. A method for detecting a target nucleic acid sequence in a sample, wherein the target nucleic acid sequence comprises two or more cis- located regions separated by an intervening nucleic acid sequence of a length sufficient to form a hairpin structure, comprising contacting the sample with a nucleic acid probe comprising two or more substantially contiguous nucleic acid regions capable of respectively hybridizing with the two or more respective spatially separate cis -located nucleic acid regions on the target sequence under conditions effective to induce the formation of a hairpin structure in the target sequence and allow base-base pairwise hybridisation between the two or more substantially contiguous regions of the probe and the respective cz^'s-located nucleic acid regions on the target sequence, and determining the presence of any resulting hybrid.

20. A method of diagnosis comprising contacting a probe according to claims 1 to 9, designed to hybridise to an allele or number of alleles and/or mutations with a sample from an individual in order to determine the genotype of the individual.

21. A method of diagnosis according to claim 20, wherein method of diagnosis is used to establish the status of the alleles of human leukocyte antigens in an individual.

2. A nucleic acid probe for use in a method of detection and an apparatus for detection of a target nucleic acid sequence in a sample thereof substantially as herein described with reference to and as illustrated in the accompanying drawings.