WO2004044195A2 - Polynucleotides encoding agmatine coumaroyltransferase (act) and uses thereof - Google Patents

Abstract

Described are polynucleotides encoding agmatine coumaroyl transferase (ACT) which catalyzes the first step in the biosynthesis of antimicrobial hydroxycinnamoylagmatine derivatives. Furthermore described are recombinant nucleic acid molecules and vectors containing these polynucleotides and host cells, preferably plant cells, being genetically modified with these polynucleotides as well as ACT polypeptides and antibodies specifically recognizing the polypeptide. In addition, transgenic plants are described showing an increased or reduced ACT activity, preferably leading to an increased pathogen resistance when ACT activity is increased and/or to an altered cell wall composition when ACT activity is altered. Moreover, methods are described for producing antimicrobial compounds or precursors thereof as well as methods for producing biopolymers by the help of ACT.

Description

Polynucleotides encoding agmatine coumaroyltransferase (ACT) and uses thereof

The present invention relates to polynucleotides encoding agmatine coumaroyltransferase (ACT) which catalyzes the first step in the biosynthesis of antimicrobial hydroxycinnamoylagmatine derivatives. The present invention furthermore relates to recombinant nucleic acid molecules and vectors containing these polynucleotides and to host cells, preferably plant cells, being genetically modified with these polynucleotides. The present invention also relates to the ACT polypeptides and to antibodies specifically recognizing the polypeptides. In addition, the present invention relates to transgenic plants showing an increased or reduced ACT activity, preferably leading to an increased pathogen resistance when ACT activity is increased and/or to an altered cell wall composition when ACT activity is altered. Moreover, the present invention relates to methods for producing antimicrobial compounds or precursors thereof as well as to methods for producing biopolymers by the help of ACT.

By producing compounds formerly commonly known as "secondary metabolites" and now more frequently designated "natural products", the plant kingdom provides an enormous diversity of compounds which are characterized to lack a direct role in growth and development, but which are believed to have primary ecological function, i.e. being essential for the successful competition and reproduction of a given plant species in its natural environment. The term "natural products" is adopted from the industrial use of these compounds, where their chemical properties have long been valued due to their utility as pharmaceuticals, dyes, flavouring agents, fragrances, polymers, etc.

Important ecological functions in which natural products are involved are defense reactions against microbes and herbivores, protection against harmful irradiation (UV) and oxidants (e.g. ozone), allelopathic interactions, and attraction of pollinators and seed-dispersing animals (reviewed by Croteau et al., 2000). One function that has received considerable attention is the antimicrobial effect of natural products (reviewed by Dixon, 2001). More than 10.000 compounds have been characterized, and it has long been thought that natural products might be able to reduce or fully replace the use of environmentally harmful commercial synthetic pesticides. By definition, antimicrobial compounds are often divided according to their temporal synthesis. One class, the phytoanticipins, include preformed compounds synthesized as part of the normal growth and development in the plant. Another class, the phytoalexins, comprises compounds induced in response to pathogen attack or other stresses (VanEtten et al., 1994). In general, phytoanticipins are considered as an inbuilt chemical barrier protecting the plant from a range of potential pathogens (reviewed by Osbourn, 1996). Phytoalexins, on the other hand, are specifically induced upon pathogen attack, synthesized and accumulated in close proximity to the infection site (reviewed by Hammerschmidt, 1999).

Since the beginning of the 1980's, there has been increasing interest in the biosynthesis of a group of antimicrobial natural products belonging to the cinnamic acid amides. These compounds are synthesized by enzymatic condensation of a coenzyme A-activated phenylpropanoid with an amine, either an aliphatic amine derived from the polyamine biosynthesis or an arylamine, predominantly tyramine or anthranilate. The hydroxycinnamic acid amides are involved in plant defense responses, some were found to be phytoanticipins, others phytoalexins.

Phenylpropanoid conjugates of agmatine were isolated from barley seedlings almost forty years ago (Stoessl, 1965). Since then, the spatial and temporal distribution of hydroxycinnamoylagmatine derivatives have been thoroughly characterized, both in response to biotic and abiotic factors (Smith and Best, 1978). Several studies indicate that these conjugates are involved at several levels of defense in barley. Firstly, they seem to operate as phytoanticipins at certain developmental stages of the plant (Ludwig et al., 1960). Secondly, they might be implicated in cell wall strengthening to physically restrict pathogen ingress (Wei et al., 1994). Thirdly, they might operate as phytoalexins (von Rδpenack et al., 1998). Despite these many important roles in plant defense towards pathogens, the biosynthesis of the hydroxycinnamoylagmatine derivatives is still only sparsely characterized. Among the group of hydroxycinnamic acid amides, the hydroxycinnamoylagmatins and derivatives thereof were presumably first reported by Ludwig et al. (1960), who discovered an antifungal factor in the extracts of coleoptiles of young barley seedlings. In a standard spore assay (anonymous, 1943), using Monilinia fructicola as the test organism, these extracts exhibited 100% inhibition at concentrations as low as 25 ppm. Among the hydroxycinnamoylagmatines and derivatives thereof, the hordatines were subsequently identified to contribute the main antifungal activity within this group of natural compounds. Hordatines were shown to be synthesized by the dimerisation of two p-hydoxycinnamoylagmatines in an oxidative phenol coupling reaction (Stoessl, 1965). The hordatines first seemed to be confined to the genus Hordeum as preformed infectional inhibitors (phytoanticipins; Stoessl, 1970; Smith and Best, 1978), but recent studies indicate that synthesis of hydroxycinnamoylagmatine derivatives is induced in response to fungal infection of leaves (Peipp et al., 1997; von Rδpenack et al., 1998). Additionally, hydroxycinnamoylagmatine derivatives have been found in wheat (Jin et al., 2000) and histochemical staining of epidermal leaf tissue indicates that these compounds might accumulate in cereals in general as a response to fungal infection (Wei et al., 1994). Hydroxycinnamoylagmatine and its derivatives may be implicated in cell wall fortification, restricting pathogen ingress, as well as being cytotoxic to the invading pathogen (Stoessl and Unwin, 1970; Wei et al., 1994; von Rόpenack et al., 1998). Purification of hordatines from barley seedlings is the subject-matter of CA-A 889 304. Furthermore, US-A 3475459 mentions the use of hordatines A and B, isolated from barley seedlings or synthesized, as antifungal agents.

It is possible that involvement and significance of the hydroxycinnamoylagmatine derivatives in plant defense responses in barley can be established by employment of modern molecular techniques. This will, however, require that specific proteins involved in the biosynthesis of the compounds have been characterized and cloned. Generally, a N-hydroxycinnamoyltransferase (EC 2.3.1.-) seems to be a key enzyme in the biosynthesis of the hydroxycinnamic acid amides. In spite of the fact that the activity of this type of enzyme was first characterized at the example of the agmatine coumaroyl transferase (ACT) in barley (Bird and Smith, 1981), related transferases of other plant species are now by far better characterized. Three plant N-hydroxycinnamoyltransferases being involved in the synthesis of such compounds have been purified and characterised: The tyramine N-hydroxycinnamoyltransferase (THT, EC 2.3.1.110) (Hohlfeld et al., 1996; Schmidt et al., 1999; Farmer et al., 1999; Negrel and Javelle, 1997; Yu and Facchini, 1999; DE 198 46 001), the putrescine N-hydroxycinnamoyltransferase (PHT, EC 2.3.1.138) (Negrel et al., 1992) and the anthranilate N-hydroxycinnamoyl/benzoyltransferase (HCBT, EC 2.3.1.144) (Yang et al., 1997). The products of these enzymes, the hydroxycinnamoyl conjugates of tyramine or anthranilate, are also known to be involved in plant defense responses. At present the carnation HCBT cDNA (Yang et al., 1997) and THT cDNAs from tobacco, potato and red pepper (Farmer et al., 1999; Schmidt et al., 1999; Back et al., 2001) have been cloned. The amino acid sequences identity is high between the characterised THTs (Farmer et al., 1999; Back et al., 2001; DE 198 46 001), but the HCBT shares an absolute minimum of sequence similarity to the THTs (Farmer et al., 1999). Thus, although these acyltransferases have a number of related enzymatic properties, the primary structure of the enzymes differs considerably. ACT has previously been purified 100-fold from young etiolated barley seedlings and characterized as an enzyme with a molecular native size of 40 kDa, highly specific for agmatine as acyl acceptor and having broad substrate specificity with respect to the acyl donors (Bird and Smith, 1983). Since 1983, only the products hydroxycinnamoylagmatine derivatives have been detected and characterized in barley (Peipp et al., 1997; Lee et al., 1997; von Rδpenack et al., 1998; Ogura et al., 2001). However, the partial ACT purification described by Bird and Smith (1983) was insufficient in terms of providing an ACT preparation pure enough and of sufficient amount in order to perform protein sequencing. Obviously, the purification approach taken by Bird and Smith (1983) was not suited to produce such a preparation and no further attempts have been reported. Thus, there was an ongoing need in the prior art for the provision of ACT and polynucleotides encoding this protein in order to make hydroxcinnamoylagmatines and derivatives thereof accessible to plant protection applications on an economically reasonable scale.

Thus, the technical problem underlying the present invention is the provision of agmatine coumaroyltransferase (ACT) and polynucleotides encoding it. This technical problem is solved by the provision of the embodiments as characterized in the claims.

Accordingly, the present invention relates to polynucleotides selected from the group consisting of

(a) polynucleotides comprising a nucleotide sequence encoding a polypeptide with the amino acid sequence of SEQ ID NO:2;

(b) polynucleotides comprising the coding region of the nucleotide sequence shown in SEQ ID NO:1;

(c) polynucleotides comprising a nucleotide sequence encoding a fragment of the polypeptide encoded by a polynucleotide of (a) or (b), wherein said nucleotide sequence encodes a polypeptide having agmatine coumaroyltransferase (ACT) activity;

(d) polynucleotides comprising a nucleotide sequence having a sequence identity of at least 60% with a polynucleotide of any one of (a) to (c) and encoding a polypeptide having ACT activity;

(e) polynucleotides comprising a nucleotide sequence the complementary strand of which hybridizes to the polynucleotide of any one of (a) to (c), wherein said nucleotide sequence encodes a polypeptide having ACT activity; and

(f) polynucleotides comprising a nucleotide sequence that deviates from the nucleotide sequence defined in (e) by the degeneracy of the genetic code.

Thus, the present invention relates to polynucleotides encoding a polypeptide having agmatine coumaroyltransferase activity. Preferably, such polynucleotides comprise the coding region of the nucleotide sequence shown in SEQ ID NO:1 or encode a polypeptide comprising the amino acid sequence shown in SEQ ID NO:2.

The present invention is based on the successful purification of ACT activity from three days old etiolated barley seedlings to apparent homogeneity. The purification protocol applied is described in detail in the appended Examples, especially in Example 1 and Table 1. It turned out that the use of a column loaded with a reactive dye (Blue sepharose; step 2 in Table 1) and of a hydrophobicity column (t- butylsepharose; step 3 in Table 1) facilitated the major break-through in achieving a purification sufficient for protein sequencing.

The ACT purification approach previously taken by Bird and Smith (1983) involved ammonium sulphatefractionation, size exclusion and affinity chromatography using agmatine as a ligand. However, this approach only resulted in a partial purification, wherein the protein was not ready for sequencing. In the purification protocol applied in connection with the present invention, the Blue sepharose chromatography turned out to be necessary in order to enrich low-abundant ACT activity in extracts from young barley seedlings. In this step, it was critical to elute the protein with potassium chloride. The also possible elution with the substrate coumaroyl-CoA proved to be inefficient since coumaroyl-CoA turned out to interact with the reactive dye and co- eluted a number of unspecific proteins together with ACT, even after having performed additional chromatographic steps prior to Blue sepharose chromatography.

Hydrophobic interaction chromatography was chosen as the third step despite a considerable loss in total ACT activity (about 5-fold, see Table 1). This step was essential for successful ACT purification. Active ACT was only recoverable when t- butyl and not phenyl was used as the ligand in hydrophobic interaction chromatography (HIC).

The purified enzyme was highly specific for agmatine as acyl acceptor and showed highest specificity for p-coumaroyl-CoA as the acyl donor. The specific activity was 29.7 nkatxmg^"1 protein. It was found to be a single polypeptide chain of 48 kDa. As a further difficulty to be overcome, the ACT preparation purified to apparent homogeneity was highly resistant against N-terminal sequencing by Edman degradation, presumably due to a block of the N-terminus of a large proportion of the protein (estimated to about 98%). Thus, 20 pmol (1 μg) protein were sufficient for elucidating only the first 5 amino acid residues. By using 0.2 nmol (10 μg) protein, the first 15 N-terminal amino acid residues (SEQ ID NO:5) could be sequenced, finally allowing to isolate cDNA clones encoding ACT (see Example 2).

The nucleotide sequence of the polynucleotide of the barley invention is exemplified at the sequence of the ACT cDNA clone pHV-ACT5-28-6 shown in SEQ ID NO:1 and Figure 1. It encodes an amino acid sequence of 439 amino acid residues (SEQ ID NO:2 and Figure 1). This specific ACT does not contain a signal sequence, thus the active protein is expected to have a cytosolic localization.

Further cDNAs have been isolated in the course of making the present invention. This refers to two cDNAs from barley of which pHV-ACT5 (SEQ ID NO: 19) shows 99.8% sequence identity with SEQ ID NO:1 indicating that pHV-ACT5 and pHV-ACT- 5-28-6 originate from an identical mRNA species. pHV-ACT6 (SEQ ID NO:6) shows an identity of 93% to the 3' region of SEQ ID NO:1 , thus obviously encoding an isoform of the polypeptide having the amino acid sequence of SEQ ID NO:2. As is evident from activity tests performed using the heterogeneously expressed clone pHV-ACT6, it encodes an active ACT. In addition, the partial cDNA clone pTA-W3 was isolated from wheat having a nucleotide sequence (SEQ ID NO:3) being 89% identical to SEQ ID NO:1 and encoding an amino acid sequence (SEQ ID NO:4) being 95% identical to amino acid residues 87 to 439 of SEQ ID NO:2 (see Figure 5). Sequence comparisons with known amino acid sequences revealed that the ACT amino acid sequence shown in SEQ ID NO:2 is most closely related with proteins of the highly diverse superfamily of transferases catalyzing a CoA-dependent acyl transfer (e.g. as annotated in the protein family data base; Bateman et al., 2002). Further, the ACT protein of the invention shows the histidine-containing motif HIVSD (SEQ ID NO:8; in SEQ ID NO:2 at His 152), matching the highly conserved motif HXXXD (SEQ ID NO:9) characteristic for this superfamily. As the second conserved sequence typical for proteins of this superfamily, the ACT of barley shows in SEQ ID NO:2 the motif DFGXG (SEQ ID NO:10) at Asp 385. Otherwise, the barley ACT shows a low sequence identity to the amino acid sequences of other members of the transferase superfamily such as 30% to carnation N-hydroxy- cinnamoyl/benzoyltransferase (HBCT), 18% to pink clove deacetylvindoline 4-0- acetyltransferase (DAT), 16% to G. triflora anthocyanin 5-aromatic acetyltransferase (5AT) and 12% to tyramine N-hydroxycinnamoyltransferase (THT; AJ131767). According to these findings, it is evident that ACT is a new class of N- hydroxycinnamoyltransferases within the superfamily of transferases. There are five EST sequences from barley (GenBank EMBL database accession numbers BF259608, B1959297, BF628198, BI955449 and BF619699) and one EST sequence from wheat (GenBank/EMBL database accession number BM 137380) which share a high sequence homology with the barley ACT cDNA sequence isolated in connection with the present invention. The function of these EST sequences has not been known in the prior art. It can be assumed that these EST sequences do not encode a polypeptide having ACT activity since none of them encodes the two conserved sequences typical for the transferase superfamily.

The activity of ACT has been analyzed for native ACT preparations and for ACT recombinantly expressed in E. coli (see Example 3). The activity tests for native ACT were performed with the three isoenzymes ACT1 , 2 and 3. These three isoenzymes were identified and purified for the first time by applying the purification protocol developed in connection with the present invention. However, for this purpose, the protocol as summarized in Table 1 (see Example 1) has been modified by replacing the anion exchange medium Resource Q in step 4 by Monobeads Q. By applying this modified protocol, three ACT activity peaks were obtained each representing one isoenzyme (Figure 4). The recombinantly expressed ACT was obtained by inserting the coding sequence of SEQ ID NO:1 into a standard expression vector so that it was fused to a His tag and a protease cleavage site (see Example 3). Cloning the expression construct and purifying the expressed ACT was performed according to standard procedures.

The kinetic studies on the native and the recombinantly expressed ACT are described in Example 3 and their results are documented in Table 2. It was shown that the kinetic properties of the ACT preparations tested were in substantial agreement with the kinetic data previously described for partially purified ACT (Bird and Smith, 1983).

The term "agmatine coumaroyltransferase (ACT) activity" as used in connection with the polypeptide of the invention refers to the transferase activity in which a hydroxycinnamoylagmatine is synthesized from agmatine (acyl acceptor) and a hydroxycinnamoyl-CoA thiol ester (acyl donor) (see Figure 1). This enzyme activity is classified as EC 2.3.1.64 and carries the systematic name "4-coumaroyl-CoA: agmatine N4-coumaroyl-transferase". The protein of the invention is highly specific for agmatine as the acyl acceptor. In a preferred form, it also uses hydroxyagmatine as a substrate.

Compounds closely related to agmatine such as homoagmatine, arginine, homoarginine, Λ/-carbamoylputrescine, putrescine, spermidine, spermine and cadaverine preferably are not used by the protein of the invention. On the other hand, the protein of the invention has a broad substrate specificity for the acyl-CoAs comprising a variety of aromatic acyl-CoAs as reported by Bird and Smith (1983) for partially purified ACT. Preferred acyl donors are cinnamoyl-CoA, coumaroyl-CoA, caffeoyl-CoA, feruloyl-CoA and sinapoyl-CoA, with cinnamoyl-CoA, coumaroyl-CoA and feruloyl-CoA being especially preferred.

In a preferred embodiment, the protein of the invention shows at least one, preferably at least two, more preferably at least three and most preferably all of the following characteristics:

1.) The purified protein has a specific activity of at least 1 nkat/mg, preferably of at least 5 nkat mg, more preferably of at least 10 nkat/mg, still more preferably of at least 20 nkat mg, especially preferred of at least 25 nkat/mg and most preferred 29.7 nkat/mg. The unit "nkat/mg" refers to the international standard unit "nkat" for enzymatic activity and is given herein as the specific activity per mg protein. One kat corresponds to 1 mol/s or 60 x 10⁶ μmol/min or 6 x 10⁷ U.

2.) The protein has a molecular weight as determined on SDS-PAGE in the range of 30 to 70 kDa, preferably 40 to 60 kDa, more preferably 46 to 52 kDa and most preferably of about 48 to 50 kDa.

3.) The protein is active as a monomer.

4.) The protein has a cytosolic localization.

5.) The isoelectric point of the protein is between pH 4 and pH 6, preferably between pH 4.7 and pH 5.7 and most preferably between pH 5.0 and pH 5.2. Preferably, the isoelectric point of the protein is determined experimentally by isoelectric focusing according to standard techniques.

6.) The activity of the protein depends on the presence of a mercaptan such as 2- mercapto-ethanol or alpha-monothioglycerol during purification and the activity assay. Preferably, the final concentration of the mercaptan is at least 1 mM, more preferably about 10 mM.

7.) The pH optimum for the activity of the protein lies in the range of pH 6 to pH 9, preferably pH 6.5 to pH 8.5, more preferably pH 7 to pH 8 and most preferably at about pH 7.5. Furthermore, the pH optimum peak is relatively narrow showing half maximum activity at +/- 1.1 or less pH units and preferably +/- 0.6 or less pH units from the pH optimum.

8.) The temperature optimum for the activity of the protein is at a temperature between 20°C and 50°C, preferably at a temperature between 30°C and 45°C and most preferably at about 40 °C.

9.) The activity of the protein is not significantly affected by the presence of Mg²⁺ and/or Ca²⁺ ions, for instance at a concentration of 10mM at pH 7.5. Likewise the presence of up to 10% (v/v) ethanol does not significantly affect the activity of the protein. By contrast, the activity of the protein is significantly reduced by the presence of Mn²⁺, Cu²⁺ and/or Zn ²⁺ ions, for instance at a concentration of 10 mM.

10.) The activity of the protein is significantly reduced upon treatment with diethyl pyrocarbonate (DEPC), for instance if incubated for 5 min at a concentration of 1 mM. Preferably, this reduction of activity is by at least 50%, more preferably by at least 90%. Advantageously, the activity-reducing effect of DEPC can be decreased significantly by pre-incubation of the protein with a substrate such as with agmatine, e.g. at a concentration of 0.2 mM, or by coumaroyl-CoA, e.g. at a concentration of 25 μM. Preferably, said decrease of reduction of activity is by at least 10%, more preferably by at least 20% and most preferably by at least 50%.

ACT activity can be determined according to methods known to the skilled person and described in the literature, such as in Bird and Smith (1983). Preferably, ACT activity may be determined according to the method described in the Examples.

The invention in particular relates to polynucleotides containing the nucleotide sequence indicated under SEQ ID NO:1 or encoding the amino acid sequence shown under SEQ ID NO:2 or a part thereof having ACT activity.

Moreover, the present invention relates to polynucleotides which encode a polypeptide having ACT activity and the complementary strand of which hybridizes with a polynucleotide mentioned in sections (a) to (c), above. The present invention also relates to polynucleotides which encode a polypeptide, which has a homology, that is to say a sequence identity, of at least 30%, preferably of at least 40%, more preferably of at least 50%, even more preferably of at least 60% and particularly preferred of at least 70%, especially preferred of at least 80% and even more preferred of at least 90% to the entire amino acid sequence indicated in SEQ ID NO: 2, the polypeptide having ACT activity.

Moreover, the present invention relates to polynucleotides which encode a polypeptide having ACT activity and the nucleotide sequence of which has a homology, that is to say a sequence identity, of at least 40%, preferably of at least 50%, more preferably of at least 60%, even more preferably of more than 65%, in particular of at least 70%, especially preferred of at least 80%, in particular of at least 90% and even more preferred of at least 95% when compared to the coding region of the sequence shown in SEQ ID NO: 1.

It is particularly preferred that polynucleotides of the invention that encode a polypeptide having ACT show at least one of the structural characteristics described above for the ACT-encoding cDNA sequences described herein, especially that they encode the conserved motif HXXXD (SEQ ID NO: 9), preferably in the form of HIVSD (SEQ ID NO: 8) as present from position 152 to position 156 in SEQ ID NO:2, and/or the conserved motif DFGXG (SEQ ID NO: 10) as present from position 385 to position 389 in SEQ ID NO:2. /

12

The present invention also relates to polynucleotides, which encode a polypeptide having ACT activity and the sequence of which deviates from the nucleotide sequences of the above-described polynucleotides due to the degeneracy of the genetic code.

The invention also relates to polynucleotides comprising a nucleotide sequence which is complementary to the whole or a part of one of the above-mentioned sequences.

In the context of the present invention the term "hybridization" means hybridization under conventional hybridization conditions, preferably under stringent conditions, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA. In an especially preferred embodiment, the term "hybridization" means that hybridization occurs under the following conditions: Hybridization buffer: 2 x SSC; 10 x Denhardt solution (Fikoll 400 + PEG +

BSA; ratio 1 :1 :1); 0.1% SDS; 5 mM EDTA; 50 mM

Na2HP0_4;

250 μg/ml of herring sperm DNA; 50 μg/ml of tRNA; or

0.25 M of sodium phosphate buffer, pH 7.2;

1 mM EDTA

7% SDS Hybridization temperature T = 60°C Washing buffer: 2 x SSC; 0.1% SDS

Washing temperature T = 60°C.

Polynucleotides which hybridize with the polynucleotides of the invention can, in principle, encode a polypeptide having ACT activity from any organism expressing such polypeptides or can encode modified versions thereof.

Polynucleotides which hybridize with the polynucleotides disclosed in connection with the invention can for instance be isolated from genomic libraries or cDNA libraries of bacteria, fungi, plants or animals. Preferably, such polynucleotides are from plant origin, particularly preferred from a plant belonging to the monocotyledons, more preferably from the family of Poaceae and most preferably from a cereal species such as from the genus Hordeum, Triticum, Secale, Avena, Oryza, Zea, Pennisetum or Sorghum.

Such hybridizing polynucleotides may be identified and isolated by using the polynucleotides described hereinabove or parts or reverse complements thereof, for instance by hybridization according to standard methods (see for instance Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA). Polynucleotides comprising the same or substantially the same nucleotide sequence as indicated in SEQ ID NO: 1 or parts thereof can, for instance, be used as hybridization probes. The fragments used as hybridization probes can also be synthetic fragments which are prepared by usual synthesis techniques, and the sequence of which is substantially identical with that of a polynucleotide according to the invention.

The molecules hybridizing with the polynucleotides of the invention also comprise fragments, derivatives and allelic variants of the above-described polynucleotides encoding a polypeptide having ACT activity. Herein, fragments are understood to mean parts of the polynucleotides which are long enough to encode the described polypeptide, preferably showing the biological activity of a polypeptide of the invention as described above. In this context, the term derivative means that the sequences of these molecules differ from the sequences of the above-described polynucleotides in one or more positions and show a high degree of homology to these sequences, preferably within sequence ranges that are essential for protein function. Preferably, the fragments, derivatives or allelic variants encode the above- mentioned conserved motifs typical for the transferase superfamily to which the protein of the invention belongs.

Preferably, the degree of homology is determined by comparing the respective sequence with the nucleotide sequence of the coding region of SEQ ID NO: 1. When the sequences which are compared do not have the same length, the degree of homology preferably refers to the percentage of nucleotide residues in the shorter sequence which are identical to nucleotide residues in the longer sequence. The degree of homology can be determined conventionally using known computer programs such as the DNASTAR program with the ClustalW analysis. This program can be obtained from DNASTAR, Inc., 1228 South Park Street, Madison, WI 53715 or from DNASTAR, Ltd., Abacus House, West Ealing, London W13 OAS UK (support@dnastar.com) and is accessible at the server of the EMBL outstation. When using the Clustal analysis method to determine whether a particular sequence is, for instance, 80% identical to a reference sequence the settings are preferably as follows: Matrix: blosum 30; Open gap penalty: 10.0; Extend gap penalty: 0.05; Delay divergent: 40; Gap separation distance: 8 for comparisons of amino acid sequences. For nucleotide sequence comparisons, the Extend gap penalty is preferably set to 5.0.

Preferably, the degree of homology of the hybridizing polynucleotide is calculated over the complete length of its coding sequence. It is furthermore preferred that such a hybridizing polynucleotide, and in particular the coding sequence comprised therein, has a length of at least 200 nucleotides, preferably at least 400 nucleotides, more preferably of at least 600 nucleotides, even more preferably of at least 800 nucleotides and most preferably of at least 1000 nucleotides. Preferably, sequences hybridizing to a polynucleotide according to the invention comprise a region of homology of at least 90%, preferably of at least 93%, more preferably of at least 95%, still more preferably of at least 98% and particularly preferred of at least 99% identity to an above-described polynucleotide, wherein this region of homology has a length of at least 400 nucleotides, more preferably of at least 600 nucleotides, even more preferably of at least 800 nucleotides and most preferably of at least 1000 nucleotides.

Homology, moreover, means that there is a functional and/or structural equivalence between the corresponding polynucleotides or the polypeptides encoded thereby. Polynucleotides which are homologous to the above-described molecules and represent derivatives of these molecules are normally variations of these molecules which represent modifications having the same biological function. They may be either naturally occurring variations, preferably orthologs of a polynucleotide comprising the nucleotide sequence of SEQ ID NO:1, for instance sequences from other alleles, ecotypes, varieties, species, etc., or mutations, and said mutations may have formed naturally or may have been produced by deliberate mutagenesis. The variants, for instance allelic variants, may be naturally occurring variants or variants produced by chemical synthesis or variants produced by recombinant DNA techniques or combinations thereof. Deviations from the above-described polynucleotides may have been produced, e.g., by deletion, substitution, insertion and/or recombination.

The polypeptides encoded by the different variants of the polynucleotides of the invention possess certain characteristics they have in common with the polypeptide comprising the amino acid sequence of SEQ ID NO:2. These include for instance biological activity, molecular weight, immunological reactivity, conformation, etc., and physical properties, such as for instance the migration behavior in gel electrophoreses, chromatographic behavior, sedimentation coefficients, solubility, spectroscopic properties, stability, pH optimum, temperature optimum etc. The biological activity of a polypeptide of the invention, in particular the capacity to catalyze the transfer of an acyl donor compound to an acyl acceptor compound for which it is specific can be tested in conventional enzyme assays using the substrates of the polypeptide or suitable modified forms thereof.

The polynucleotides of the invention can be DNA molecules, in particular genomic DNA or cDNA. Moreover, the polynucleotides of the invention may be RNA molecules. The polynucleotides of the invention can be obtained for instance from natural sources or may be produced synthetically or by recombinant techniques, such as PCR.

In a further aspect, the present invention relates to recombinant nucleic acid molecules comprising the polynucleotide of the invention described above. The term "recombinant nucleic acid molecule" refers to a nucleic acid molecule which contains in addition to a polynucleotide of the invention as described above at least one further heterologous coding or non-coding nucleotide sequence. The term "heterologous" means that said nucleotide sequence originates from a different species or from the same species, however, from a different location in the genome than said polynucleotide to which it is added. The term "recombinant" implies that nucleotide sequences are combined into one nucleic acid molecule by the aid of human intervention. The recombinant nucleic acid molecule of the invention can be used alone or as part of a vector. For instance, the recombinant nucleic acid molecule may encode the polypeptide having ACT activity fused to a marker sequence, such as a peptide which facilitates purification of the fused polypeptide. The marker sequence may for example be a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.) which provides for convenient purification of the fusion polypeptide. Another suitable marker sequence may be the HA tag which corresponds to an epitope derived from influenza hemagglutinin polypeptide (Wilson, Cell 37 (1984), 767). As a further example, the marker sequence may be glutathione-S-transferase (GST) which, apart from providing a purification tag, enhances polypeptide stability, for instance, in bacterial expression systems. If it furthermore preferred that the marker sequence contains a protease cleavage site such as the thrombin cleavage site mentioned in Example 3 allowing to remove the marker sequence or a part of it from the expressed polypeptide.

In a preferred embodiment, the recombinant nucleic acid molecules further comprises expression control sequences operably linked to the polynucleotide comprised by the recombinant nucleic acid molecule, more preferably these recombinant nucleic acid molecules are expression cassettes. The term "operably linked" (or "operatively linked"), as used throughout the present description, refers to a linkage between one or more expression control sequences and the coding region in the polynucleotide to be expressed in such a way that expression is achieved under conditions compatible with the expression control sequence(s). Expression comprises transcription of the heterologous DNA sequence, preferably into a translatable mRNA. Regulatory elements ensuring expression in prokaryotic as well as in eukaryotic cells, preferably in plant cells, are well known to those skilled in the art. They encompass promoters, enhancers, termination signals, targeting signals and the like. Examples are given further below in connection with explanations concerning vectors. In the case of eukaryotic cells, expression control sequences may comprise poly-A signals ensuring termination of transcription and stabilization of the transcript, for example, those of the 35S RNA from Cauliflower Mosaic Virus (CaMV) or the nopaline synthase gene from Agrobacterium tumefaciens. Additional regulatory elements may include transcriptional as well as translational enhancers. A plant translational enhancer often used is the CaMV omega sequence. Similarly, the inclusion of an intron (e.g. intron-1 from the shrunken gene of maize) has been shown to increase expression levels by up to 100-fold (Mait, Transgenic Research 6 (1997), 143-156; Ni, Plant Journal 7 (1995), 661-676).

Moreover, the invention relates to vectors, in particular plasmids, cosmids, viruses, bacteriophages and other vectors commonly used in genetic engineering, which contain a polynucleotide or recombinant nucleic acid molecule of the invention as described above. In a preferred embodiment of the invention, the vectors are suitable for the transformation of bacterial cells, yeast cells, fungal cells, animal cells or, in particular, plant cells. In a particularly preferred embodiment such vectors are suitable for stable transformation of plants.

In a preferred embodiment, the vectors further comprise expression control sequences operably linked to said polynucleotides contained in the vectors. These expression control sequences may be suited to ensure transcription and synthesis of a translatable RNA in prokaryotic or eukaryotic cells.

The expression of the polynucleotides of the invention in prokaryotic or eukaryotic cells, for instance in Escherichia coli, is interesting because it permits a more precise characterization of the biological activities of the encoded polypeptide. In particular, the recombinantly expressed polypeptide may be used to identify substrate compounds that are hydrolyzed by its activity. Moreover, it is possible to express these polypeptides in such prokaryotic or eukaryotic cells which are free from interfering polypeptides. In addition, it is possible to insert different mutations into the polynucleotides encoding the polypeptide by methods usual in molecular biology (see for instance Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA), leading to the synthesis of polypeptides possibly having modified biological properties. In this regard it is on the one hand possible to produce deletion mutants in which polynucleotides are produced by progressive deletions from the 5' or 3' end of the coding DNA sequence, and said polynucleotides lead to the synthesis of correspondingly shortened polypeptides. Furthermore, the introduction of point mutations is also conceivable at positions at which a modification of the amino acid sequence for instance influences the biological activity or the regulation of the polypeptide. Moreover, mutants possessing a modified substrate or product specificity can be prepared. Furthermore, it is possible to prepare mutants having a modified activity- temperature-profile. Preferably, such mutants show an increased activity. Alternatively, mutants can be prepared the catalytic activity of which is abolished without loosing substrate binding activity.

In the case of expression in plants, plant tissue or plant cells, the introduction of mutations into the polynucleotides of the invention allows the gene expression rate and/or the activity of the polypeptides encoded by the polynucleotides of the invention to be reduced or increased.

For genetic engineering in prokaryotic cells, the polynucleotides of the invention or parts of these molecules can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences. Standard methods (see Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be connected to each other by applying adapters and linkers to the fragments. Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used. In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used. In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods.

Additionally, the present invention relates to a method for producing genetically engineered host cells comprising introducing the above-described polynucleotides, recombinant nucleic acid molecules or vectors of the invention into a host cell.

Another embodiment of the invention relates to host cells, in particular prokaryotic or eukaryotic cells, genetically engineered with the above-described polynucleotides, recombinant nucleic acid molecules or vectors of the invention or obtainable by the above-mentioned method for producing genetically engineered host cells, and to cells derived from such transformed cells and containing a polynucleotide, recombinant nucleic acid molecule or vector of the invention. In a preferred embodiment the host cell is genetically modified in such a way that it contains said polynucleotide stably integrated into the genome. The term "genetically modified" implies that the polynucleotide of the invention contained in the host cell is "heterologous" (or as used synonymously herein "foreign") with respect to the host cell. This means that said polynucleotide does not occur naturally in the host cell or that it is present in the host cell at a location in the genome different from the location of the corresponding naturally occurring polynucleotide, if present. Preferentially, the host cell of the invention is a bacterial, yeast, fungus, plant or animal (e.g. insect or vertebrate such as mammalian) cell. In a preferred embodiment, the host cell of the invention is a plant cell which may include any conceivable type of plant cell, such as cultured or non-cultured cells, protoplasts, suspension culture cells, callus cells, meristem cells, cells being part of a plant tissue, plant organ and/or plant. More preferably the polynucleotide can be expressed so as to lead to the production of a polypeptide having ACT activity. An overview of different expression systems is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456- 463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440). An overview of yeast expression systems is for instance given by Hensing et al. (Antonie van Leuwenhoek 67 (1995), 261-279), Bussineau et al. (Developments in Biological Standardization 83 (1994), 13-19), Gellissen et al. (Antonie van Leuwenhoek 62 (1992), 79-93, Fleer (Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick (Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz (Bio/Technology 9 (1991), 1067-1072).

Expression vectors have been widely described in the literature. As a rule, they contain not only a selection marker gene and a replication-origin ensuring replication in the host selected, but also a bacterial or viral promoter, and in most cases a termination signal for transcription. Between the promoter and the termination signal there is in general at least one restriction site or a polylinker which enables the insertion of a coding DNA sequence. The DNA sequence naturally controlling the transcription of the corresponding gene can be used as the promoter sequence, if it is active in the host organism used. However, this sequence can also be exchanged for other promoter sequences. It is possible to use promoters ensuring constitutive expression of the gene and inducible promoters which permit a deliberate control of the expression of the gene. Bacterial and viral promoter sequences possessing these properties are described in detail in the literature. Regulatory sequences for the expression in microorganisms (for instance E. coli, S. cerevisiae) are sufficiently described in the literature. Promoters permitting a particularly high expression of a downstream sequence are for instance the T7 promoter (Studier et al., Methods in Enzymology 185 (1990), 60-89), lacUVδ, trp, trp-lacUV5 (DeBoer et al., in Rodriguez and Chamberlin (Eds), Promoters, Structure and Function; Praeger, New York, (1982), 462-481 ; DeBoer et al., Proc. Natl. Acad. Sci. USA (1983), 21-25), Ip1, rac (Boros et al., Gene 42 (1986), 97-100). Inducible promoters are preferably used for the synthesis of polypeptides. These promoters often lead to higher polypeptide yields than do constitutive promoters. In order to obtain an optimum amount of polypeptide, a two-stage process is often used. First, the host cells are cultured under optimum conditions up to a relatively high cell density. In the second step, transcription is induced depending on the type of promoter used. In this regard, a tac promoter is particularly suitable which can be induced by lactose or I PTG (=isopropyl-β-D-thiogalactopyranoside) (deBoer et al., Proc. Natl. Acad. Sci. USA 80 (1983), 21-25). Termination signals for transcription are also described in the literature.

The transformation of the host cell with a polynucleotide, recombinant nucleic acid molecule or vector according to the invention can be carried out by standard methods, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990. The host cell is cultured in nutrient media meeting the requirements of the particular host cell used, in particular in respect of the pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc. The polypeptide according to the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Polypeptide refolding steps can be used, as necessary, in completing configuration of the polypeptide. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

Accordingly, the present invention also relates to a method for the production of a polypeptide encoded by a polynucleotide of the invention as described above in which the above-mentioned host cell is cultivated under conditions allowing for the expression of the polypeptide and in which the polypeptide is isolated from the cells and/or the culture medium.

Moreover, the invention relates to a polypeptide which is encoded by a polynucleotide according to the invention or obtainable by the above-mentioned method for the production of a polypeptide encoded by a polynucleotide of the invention.

The polypeptide of the present invention may, e.g., be a naturally purified product or a product of chemical synthetic procedures or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect or mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptide of the present invention may be glycosylated or may be non-glycosylated. The polypeptide of the invention may also include an initial methionine amino acid residue. The polypeptide according to the invention may be further modified to contain additional chemical moieties normally not being part of the polypeptide. Those derivatized moieties may, e.g., improve the stability, solubility, the biological half life or absorption of the polypeptide. The moieties may also reduce or eliminate any undesirable side effects of the polypeptide and the like. An overview for these moieties can be found, e.g., in Remington's Pharmaceutical Sciences (18^th ed., Mack Publishing Co., Easton, PA (1990)). Polyethylene glycol (PEG) is an example for such a chemical moiety which has been used for the preparation of therapeutic polypeptides. The attachment of PEG to polypeptides has been shown to protect them against proteolysis (Sada et al., J. Fermentation Bioengineering 71 (1991), 137-139). Various methods are available for the attachment of certain PEG moieties to polypeptides (for review see: Abuchowski et al., in "Enzymes as Drugs"; Holcerberg and Roberts, eds. (1981), 367-383). Generally, PEG molecules or other additional moieties are connected to the polypeptide via a reactive group found on the polypeptide. Amino groups, e.g. on lysines or the amino terminus of the polypeptide are convenient for this attachment among others.

Furthermore, the present invention also relates to an antibody specifically recognizing a polypeptide according to the invention. The antibody can be monoclonal or polyclonal and can be prepared according to methods well known in the art. The term "antibody" also comprises fragments of an antibody which still retain the binding specificity.

The polypeptide according to the invention, its fragments or other derivatives thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. The present invention in particular also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies directed against a polypeptide according to the present invention can be obtained, e.g., by direct injection of the polypeptide into an animal or by administering the polypeptide to an animal, preferably a non-human animal. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies binding the whole native polypeptide. Such antibodies can then, e.g., be used to isolate the polypeptide from tissue expressing that polypeptide or to detect it in a probe. For the preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples for such techniques include the hybridoma technique (Kόhler and Milstein, Nature 256 (1975), 495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4 (1983), 72) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985), 77-96). Techniques describing the production of single chain antibodies (e.g., U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptides according to the present invention. Furthermore, transgenic mice may be used to express humanized antibodies directed against immunogenic polypeptides of the present invention. In a further preferred embodiment, the invention relates to nucleic acid molecules specifically hybridizing with the polynucleotide of the invention; with the proviso that said nucleic acid molecule does not have the nucleotide sequence shown in any one of the GeneBank database entries having the accession nos. BF259608, BI959297, BF628198, BI955449, BF619699 and BM137380. Such hybridizing nucleic acid molecules may be oligonucleotides having a length preferably of at least 10, in particular at least 15, and particularly preferably of at least 50 nucleotides. Advantageously, their length does not exceed a length of 1000, preferably 500, more preferably 200, still more preferably 100 and most preferably 50 nucleotides. They are characterized in that they specifically hybridize to the polynucleotides of the invention, that is to say that they only to a very minor extent and preferably not at all hybridize to polynucleotides encoding another polypeptide having transferase activity. The hybridizing nucleic acid molecules according to this embodiment can be used for instance as primers for amplification techniques such as PCR or as a hybridization probe for instance in order to isolate related genes. The hybridization conditions and homology values described above in connection with the polynucleotide of the invention encoding a polypeptide having ACT activity may likewise apply in connection with the hybridizing nucleic acid molecules mentioned herein.

Furthermore, the invention relates to a method for producing a transgenic plant comprising the steps of

(a) introducing at least one of the above-described polynucleotides, recombinant nucleic acid molecules or vectors of the invention into the genome of a plant cell; and

(b) regenerating the cell of (a) to a transgenic plant.

Optionally, the method may further comprise step (c) producing progeny from the plants produced in step (b).

In a further aspect, the invention relates to transgenic plants or plant tissue comprising plant cells which are genetically engineered with the polynucleotide of the invention and/or which contain the recombinant nucleic acid molecule or the vector of the invention and to transgenic plants obtainable by the method mentioned above. Preferably, in the transgenic plant of the invention, the polynucleotide of the invention is expressed at least in one part, i.e. organ, tissue or cell type, of the plant.

The transgenic plants, plant tissues or plant cells of the invention show an altered ACT activity as compared to corresponding wild-type plants, plant tissues or plant cells. For the purpose of comparing ACT activity in plants, plant tissues and plant cells of the invention with ACT activity in corresponding wild-type plants, plant tissues or plant cells, preferentially the ACT activity is determined for samples taken from the same localization and being at the same developmental and induced (e.g. by pathogen attack) or non-induced state. The term "altered ACT activity" refers to an increase or a reduction of ACT activity. The term "increased activity" refers to a significant increase of the ACT activity in the transgenic plant, plant tissue or plant cell compared to a corresponding wild-type plant, plant tissue or plant cell. Preferably, said activity is increased in the transgenic plant, plant tissue or plant cell by at least 10%, preferably by at least 20%, more preferably by at least 50%, and even more preferred by at least 100% as compared to a corresponding wild-type plant, plant tissue or plant cell. The term "reduced activity" refers to a significant decrease of ACT activity in the transgenic plant, plant tissue or plant cell as compared to a corresponding wild-type plant, plant tissue and plant cells. Preferably, said activity is reduced in the transgenic plant by at least 10%, preferably by at least 20%, more preferably at least 20%, more preferably by at least 50% and most preferably to 100%, i.e. to complete inhibition as compared to a corresponding wild- type plant, plant tissue or plant cell.

ACT activity may be determined in suitable enzyme assays using a preparation from a plant sample. In particular, this assay is specific enough to exclude any other transferase activity present in the plant. Advantageously, a substrate compound is used for such assays for which the polypeptide of the invention is specific and which can be detected by suitable methods known in the art. However, an increase or reduction of the activity of the polypeptide of the invention may also be inferred from a significant increase of the amount of corresponding transcript and/or protein present in the transgenic plant, plant tissue or plant cell. Preferentially, transgenic plants, plant tissue or plant cells having an increased activity of the polypeptide of the invention may be characterized by an increase of the amount of transcript corresponding to the polynucleotide of the invention by at least 20%, preferably at least 50% and more preferably at least 100% as compared to the corresponding wild- type plant, plant tissue or plant cell. Likewise, it is preferred that transgenic plants, plant tissues or plant cells having an increased activity of the polypeptide of the invention may be characterized by an increase of the protein amount of the polypeptide of the invention by at least 20%, preferably at least 50% and more preferably at least 100% as compared to the corresponding wild-type plant, plant tissues or plant cells. Preferentially, transgenic plants, plant tissues or plant cells having a reduced activity of the polypeptide of the invention may be characterized by a reduction of the amount of transcript corresponding to the polynucleotide of the invention by at least 20%, preferably by at least 50% and more preferably by at least 80% as compared to the corresponding wild-type plant, plant tissue or plant cell. Likewise, it is preferred that transgenic plants, plant tissues or plant cells having a decreased activity of the polypeptide of the invention may be characterized by a decrease of the protein amount of the polypeptide of the invention by at least 20%, preferably at least 50% and more preferably at least 80% as compared to the corresponding wild-type plant, plant tissues or plant cells.

The term "altered ACT activity" in particular refers to an altered temporal and/or spatial pattern of ACT activity in the transgenic plant of the invention as compared to the corresponding wild-type plant. This may encompass transgenic plants in which ACT activity in one part or at one point in time is increased and said activity is reduced in another part or at another point in time as compared to a corresponding wild-type plant. An alteration of the temporal pattern of ACT activity may for instance involve altering the developmental pattern of ACT activity in the transgenic plant such as by providing for constitutive expression of ACT in the plant or by rendering ACT activity inducible upon an external signal, e.g. in response to stress such as draught or wounding and in particular in response to pathogen attack. The term "spatial pattern of ACT activity" refers to the presence or absence of ACT activity at all possible levels of localization, in particular at the sub-cellular level, at the tissue level or at the plant organ level. In the context of achieving enhanced resistance against a fungal pathogen, it may for example be reasonable to delimit ACT over-expression to the site of pathogen attack such as the epidermis or rhizodermis.

According to the provisions of the invention, transgenic plants can be prepared by introducing a polynucleotide into plant cells and regenerating the transformed cells to plants by methods well known to the person skilled in the art. Methods for the introduction of foreign genes into plants are also well known in the art. These include, for example, the transformation of plant cells or tissues with T-DNA using Agrobacten^'um tumefaciens or Agrobacterium rhizogenes, the fusion of protoplasts, direct gene transfer (see, e.g., EP-A 164 575), injection, electroporation, vacuum infiltration, biolistic methods like particle bombardment, pollen-mediated transformation, plant RNA virus-mediated transformation, liposome-mediated transformation, transformation using wounded or enzyme-degraded immature embryos, or wounded or enzyme-degraded embryogenic callus and other methods known in the art. The vectors used in the method of the invention may contain further functional elements, for example "left border"- and "right border"-sequences of the T- DNA of Agrobacterium which allow stable integration into the plant genome. Furthermore, methods and vectors are known to the person skilled in the art which permit the generation of marker free transgenic plants, i.e. the selectable or scorable marker gene is lost at a certain stage of plant development or plant breeding. This can be achieved by, for example co-transformation (Lyznik, Plant Mol. Biol. 13 (1989), 151-161; Peng, Plant Mol. Biol. 27 (1995), 91-104) and/or by using systems which utilize enzymes capable of promoting homologous recombination in plants (see, e.g., WO97/08331 ; Bayley, Plant Mol. Biol. 18 (1992), 353-361); Lloyd, Mol. Gen. Genet. 242 (1994), 653-657; Maeser, Mol. Gen. Genet. 230 (1991), 170-176; Onouchi, Nucl. Acids Res. 19 (1991), 6373-6378). Methods for the preparation of appropriate vectors are described by, e.g., Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA. Suitable strains of Agrobacterium tumefaciens and vectors as well as transformation of Agrobacteria and appropriate growth and selection media are well known to those skilled in the art and are described in the prior art (GV3101 (pMK90RK), Koncz, Mol. Gen. Genet. 204 (1986), 383-396; C58C1 (pGV 3850kan), Deblaere, Nucl. Acid Res. 13 (1985), 4777; Bevan, Nucleic. Acid Res. 12(1984); 8711 ; Koncz, Proc. Natl. Acad. Sci. USA 86 (1989), 8467-8471; Koncz, Plant Mol. Biol. 20 (1992), 963-976; Koncz, Specialized vectors for gene tagging and expression studies. In: Plant Molecular Biology Manual Vol 2, Gelvin and Schilperoort (Eds.), Dordrecht, The Netherlands: Kluwer Academic Publ. (1994), 1-22; EP-A-120 516; Hoekema: The Binary Plant Vector System, Offsetdrukkerij Kanters B.V., Alblasserdam (1985), Chapter V, Fraley, Crit. Rev. Plant. Sci., 4, 1-46; An, EMBO J. 4 (1985), 277-287). Although the use of Agrobacterium tumefaciens is preferred in the method of the invention, other Agrobacterium strains, such as Agrobacterium rhizogenes, may be used, for example if a phenotype conferred by said strain is desired.

Methods for the transformation using biolistic methods are well known to the person skilled in the art; see, e.g., Wan, Plant Physiol. 104 (1994), 37-48; Vasil, Bio/Technology 11 (1993), 1553-1558 and Christou (1996) Trends in Plant Science 1, 423-431. Microinjection can be performed as described in Potrykus and Spangenberg (eds.), Gene Transfer To Plants. Springer Verlag, Berlin, NY (1995). The transformation of most dicotyledonous plants is possible with the methods described above. But also for the transformation of monocotyledonous plants several successful transformation techniques have been developed. These include the transformation using biolistic methods as, e.g., described above as well as protoplast transformation, electroporation of partially permeabilized cells, introduction of DNA using glass fibers, etc. Also, the transformation of monocotyledonous plants by means of Agrobacterium-based vectors has been described (Chan et al., Plant Mol. Biol. 22 (1993), 491-506; Hiei et al., Plant J. 6 (1994) 271-282; Deng et al, Science in China 33 (1990), 28-34; Wilmink et al, Plant Cell Reports 11 (1992), 76-80; May et al., Bio/Technology 13 (1995), 486-492; Conner and Dormisse, Int. J. Plant Sci. 153 (1992), 550-555; Ritchie et al. Transgenic Res. 2 (1993), 252-265). An alternative system for transforming monocotyledonous plants is the transformation by the biolistic approach (Wan and Lemaux, Plant Physiol. 104 (1994), 37-48; Vasil et al., Bio/Technology 11 (1993), 1553-1558; Ritala et al., Plant Mol. Biol. 24 (1994) 317- 325; Spencer et al., Theor. Appl. Genet. 79 (1990), 625-631). The transformation of maize in particular has been repeatedly described in the literature (see for instance WO 95/06128, EP 0 513 849, EP 0 465 875, EP 29 24 35; Fromm et al, Biotechnology 8, (1990), 833-844; Gordon-Kamm et al., Plant Cell 2, (1990), 603- 618; Koziel et al., Biotechnology 11 (1993), 194-200; Moroc et al., Theor. Appl. Genet. 80, (1990), 721-726). The successful transformation of other types of cereals has also been described for instance of barley (Wan and Lemaux, supra; Ritala et al., supra, Krens et al., Nature 296 (1982), 72-74), wheat (Nehra et al., Plant J. 5 (1994), 285-297) and rice.

The resulting transformed plant cell can then be used to regenerate a transformed plant in a manner known by a skilled person.

The present invention likewise refers to mutant plants showing an altered ACT activity, whereby the terms of activity alteration explained above with regard to an altered ACT activity of transgenic plants accordingly apply to mutant plants. The term "mutant plant" (or "plant mutant"), refers to plants the genotype of which is modified compared to the corresponding source plants, preferably by other means than genetic engineering, i.e. the introduction of an exogenous nucleic acid molecule into plant cells. Such "mutant plants" may be provided by methods known in the art, e.g. produced under the influence of a suitable dose of ionizing radiation (e.g. x-rays, gamma or neutron radiation) or by the effect of suitable mutagens (e.g. EMS, MMS, etc.). Furthermore encompassed are mutant plants wherein the mutation occurs naturally. Mutant plants showing the desired trait, i.e. an altered ACT activity may be screened out of a pool of mutant plants generated according to standard methods. The selection may be performed for altered ACT activity in samples taken from these plants or for any other phenotypic trait that correlates with altered ACT activity such as an altered composition of phenolic compounds in the cell wall. Preferably, selection may be carried out utilizing the knowledge of the nucleotide sequence encoding ACT as provided by the present invention. Consequently, it is possible to screen for a genetic trait being indicative for an altered ACT activity. Such a screening approach may involve the application of conventional nucleic acid amplification (e.g. PCR) and/or hybridization techniques.

The transgenic plants of the invention may, in principle, be plants of any plant species. They may be both monocotyledonous and dicotyledonous plants. Preferably, the plants are useful plants, i.e. commercially important plants, cultivated by man for nutrition or for technical, in particular industrial, purposes. They may be sugar storing and/or starch-storing plants, especially cereal species (rye, barley, oat, wheat, rice, maize, millet, sago etc.), pea, marrow pea, cassava, sugar cane, sugar beet and potato; tomato, rape, soybean, hemp, flax, sunflower, cow pea or arrowroot, fiber-forming plants (e.g. flax, hemp, cotton), oil-storing plants (e.g. rape, sunflower, soybean) and protein-storing plants (e.g. legumes, cereals, soybeans). Preferably, the invention refers to cereal species. The plants within the scope of the invention also include fruit trees, palms and other trees or wooden plants being of economical value such as in forestry. Moreover, the plants of the invention may be to forage plants (e.g. forage and pasture grasses, such as alfalfa, clover, ryegrass) and vegetable plants (e.g. tomato, lettuce, chicory) or ornamental plants (e.g. roses, tulips, hyacinths).

In a preferred embodiment, the present invention relates to transgenic or mutant plants which show an increased activity of the polypeptide encoded by the polynucleotide of the invention compared to a corresponding wild-type plant. In the transgenic plants according to this embodiment, the increased ACT activity is caused by the presence of a suitable foreign nucleic acid molecule in the genome of said plants.

The term "presence of a suitable foreign nucleic acid molecule" as used herein refers to any foreign nucleic acid molecule that is present in cells of said transgenic plant but absent from the cells of the corresponding source plant. Thereby encompassed are nucleic acid molecules, e.g. gene sequences, which differ from a corresponding nucleic acid molecule in the source plant cell by at least one mutation (substitution, insertion, deletion, etc. of at least one nucleotide). Furthermore encompassed by the term "foreign" are nucleic acid molecules which are homologous with respect to the source plant cell but are situated in a different chromosomal location or differ, e.g., by way of a reversed orientation for instance with respect to the promoter. In principle, the nucleic acid molecule to be introduced in accordance with the present embodiment may be of any conceivable origin, e.g. eukaryotic or prokaryotic. It may be from any organism which comprises such molecules. Furthermore, it may be synthetic or derived from naturally occurring molecules by, e.g., modification of its sequence, i.e. it may be a variant or derivative of a naturally occurring molecule. Such variants and derivatives include but are not limited to molecules derived from naturally occurring molecules by addition, deletion, mutation of one or more nucleotides or by recombination. It is, e.g., possible to change the sequence of a naturally occurring molecule so as to match the preferred codon usage of plants, in particular of those plants in which the nucleic acid molecule shall be expressed. Preferably, the increase of ACT activity in the transgenic plant is caused by the expression of a polynucleotide of the invention which is present in cells of the transgenic plant due to genetic engineering.

The polynucleotide introduced into the transgenic plant can in principle be expressed in all or substantially all cells of the plant. However, it is also possible that it is only expressed in certain parts, organs, cell types, tissues etc. Moreover, it is possible that expression of the polynucleotide only takes place upon induction, at a certain developmental stage or, as it may be preferred in some embodiments, upon pathogen attack. In a preferred embodiment, the polynucleotide is expressed in those parts of the plant that are exposed to pathogen attack, for example the epidermis or the rhizodermis.

In order to be expressed, the polynucleotide that is introduced into a plant cell is preferably operatively linked to one or more expression control sequences, e.g. a promoter, active in this plant cell.

The promoter may be homologous or heterologous with regard to its origin and/or with regard to the gene to be expressed. Suitable promoters are for instance the promoter of the 35S RNA of the Cauliflower Mosaic Virus (see for instance US-A 5,352,605) and the ubiquitin-promoter (see for instance US-A 5,614,399) which lend themselves to constitutive expression, the patatin gene promoter B33 (Rocha-Sosa et al., EMBO J. 8 (1989), 23-29) which lends itself to a tuber-specific expression in potatoes or a promoter ensuring expression in photosynthetically active tissues only, for instance the ST-LS1 promoter (Stockhaus et al., Proc. Natl. Acad. Sci. USA 84 (1987), 7943-7947; Stockhaus et al., EMBO, J. 8 (1989) 2445-2451), the Ca/b- promoter (see for instance US-A-5,656,496, US-A-5,639,952, Bansal et al., Proc. Natl. Acad. Sci. USA 89 (1992), 3654-3658) and the Rubisco SSU promoter (see for instance US-A-5,034,322; US-A-4,962,028) or the glutelin promoter from wheat which lends itself to endosperm-specific expression (HMW promoter) (Anderson, Theoretical and Applied Genetics 96, (1998), 568-576, Thomas, Plant Cell 2 (12), (1990), 1171-1180), the glutelin promoter from rice (Takaiwa, Plant Mol. Biol. 30(6) (1996), 1207-1221, Yoshihara, FEBS Lett. 383 (1996), 213-218, Yoshihara, Plant and Cell Physiology 37 (1996), 107-111), the shrunken promoter from maize (Maas, EMBO J. 8 (11) (1990), 3447-3452, Werr, Mol. Gen. Genet. 202(3) (1986), 471-475, Werr, Mol. Gen. Genet. 212(2), (1988), 342-350), the USP promoter, the phaseolin promoter (Sengupta-Gopalan, Proc. Natl. Acad. Sci. USA 82 (1985), 3320-3324, Bustos, Plant Cell 1 (9) (1989), 839-853) or promoters of zein genes from maize (Pedersen et al., Cell 29 (1982), 1015-1026; Quatroccio et al., Plant Mol. Biol. 15 (1990), 81-93). However, promoters which are only activated at a point in time determined by external influences can also be used (see for instance WO 93/07279). In this connection, promoters of heat shock proteins which permit simple induction may be of particular interest. Likewise, artificial and/or chemically inducible promoters may be used in this context. Moreover, seed-specific promoters such as the USP promoter from Vicia faba which ensures a seed-specific expression in Vicia faba and other plants may be used (Fiedler et al., Plant Mol. Biol. 22 (1993), 669-679; Baumlein et al., Mol. Gen. Genet. 225 (1991), 459-467). Moreover, fruit-specific promoters, such as described in WO 91/01373 may be used too. In one embodiment, promoters which ensure constitutive expression are preferred. However, in another preferred embodiment, the polynucleotide may be operatively linked to a promoter which is inducible upon pathogen attack.

Moreover, the polynucleotide may be linked to a termination sequence which serves to terminate transcription correctly and to add a poly-A-tail to the transcript which is believed to have a function in the stabilization of the transcripts. Such elements are described in the literature (see for instance Gielen et al., EMBO J. 8 (1989), 23-29) and can be replaced at will.

Furthermore, if needed, polypeptide expression can in principle be targeted to any sub-localization of plant cells (e.g. cytosol, plastids, vacuole, mitochondria) or the plant (e.g. apoplast). In order to achieve the localization in a particular compartment, the coding region to be expressed may be linked to DNA sequences encoding a signal sequence (also called "transit peptide") ensuring localization in the respective compartment. It is evident that these DNA sequences are to be arranged in the same reading frame as the coding region to be expressed. Preferably, signal sequences directing expression into the apoplast are used in connection with the present invention.

In order to ensure the location in the plastids, it is conceivable to use one of the following transit peptides: of the plastidic Ferredoxin: NADP+ oxidoreductase (FNR) of spinach which is enclosed in Jansen et al. (Current Genetics 13 (1988), 517-522). In particular, the sequence ranging from nucleotides -171 to 165 of the cDNA sequence disclosed therein can be used which comprises the 5' non-translated region as well as the sequence encoding the transit peptide. Another example is the transit peptide of the waxy protein of maize including the first 34 amino acid residues of the mature waxy protein (Klόsgen et al., Mol. Gen. Genet. 217 (1989), 155-161). It is also possible to use this transit peptide without the first 34 amino acids of the mature protein. Furthermore, the signal peptides of the ribulose bisphosphate carboxylase small subunit (Wolter et al., Proc. Natl. Acad. Sci. USA 85 (1988), 846- 850; Nawrath et al., Proc. Natl. Acad. Sci. USA 91 (1994), 12760-12764), of the NADP malat dehydrogenase (Gallardo et al., Planta 197 (1995), 324-332), of the glutathione reductase (Creissen et al., Plant J. 8 (1995), 167-175) or of the R1 protein (Lorberth et al. Nature Biotechnology 16, (1998), 473-477) can be used. In order to ensure the location in the vacuole, it is conceivable to use one of the following transit peptides: the N-terminal sequence (146 amino acids) of the patatin protein (Sonnewald et al., Plant J. 1 (1991), 95-106) or the signal sequences described by Matsuoka and Neuhaus (Journal of Experimental Botany 50 (1999), 165-174); Chrispeels and Raikhel (Cell 68 (1992), 613-616); Matsuoka and Nakamura (Proc. Natl. Acad. Sci. USA 88 (1991), 834-838); Bednarek and Raikhel (Plant Cell 3 (1991), 1195-1206); and Nakamura and Matsuoka (Plant Phys. 101 (1993), 1-5).

In order to ensure the localization in the mitochondria, it is for example conceivable to use the transit peptide described by Braun (EMBO J. 11, (1992), 3219-3227). In order to ensure the localization in the apoplast, it is conceivable to use one of the following transit peptides: signal sequence of the proteinase inhibitor ll-gene (Keil et al., Nucleic Acid Res. 14 (1986), 5641-5650; von Schaewen et al., EMBO J. 9 (1990), 30-33), of the levansucrase gene from Erwinia amylovora (Geier and Geider, Phys. Mol. Plant Pathol. 42 (1993), 387-404), of a fragment of the patatin gene B33 from Solanum tuberosum, which encodes the first 33 amino acids (Rosahl et al., Mol Gen. Genet. 203 (1986), 214-220) or of the one described by Oshima et al. (Nucleic Acid Res. 18 (1990), 181).

In addition to expressing a polynucleotide of the invention that is present in a plant cell due to genetic engineering, an increase of ACT activity in transgenic plants of the invention may also be achieved by other methods known to a skilled person. For example, the endogenous ACT-encoding gene may be modified at its natural location to cause an increased ACT activity, e.g. by homologous recombination. In particular, the promoter of this gene can for instance be altered in a way that promoter activity is enhanced. In the alternative, other regulatory elements of the gene influencing for instance mRNA stability, translation or post-translational processing or the coding region of the gene can be modified so that the encoded polypeptide shows an increased activity, e.g. by specifically substituting amino acid residues in the catalytically active domain of the polypeptide. Applicable homologous recombination techniques (also known as "in vivo mutagenesis") are known to the person skilled in the art and are described in the literature. One such technique involves the use of a hybrid RNA-DNA oligonucleotide ("chimeroplast") which is introduced into cells by transformation (TIBTECH 15 (1997), 441-447; W095/15972; Kren, Hepatology 25 (1997), 1462-1468; Cole-Strauss, Science 273 (1996), 1386- 1389). Thereby, part of the DNA component of the RNA-DNA oligonucleotide is homologous with the target gene sequence, however, displays in comparison to this sequence a mutation or a heterologous region which is surrounded by the homologous regions. The term "heterologous region" refers to any sequence that can be introduced and which is different from that to be modified. By means of base pairing of the homologous regions with the target sequence followed by a homologous recombination, the mutation or the heterologous region contained in the DNA component of the RNA-DNA oligonucleotide can be transferred to the corresponding gene. By means of in vivo mutagenesis, any part of the gene encoding the polypeptide of the invention can be modified as long as it results in an increase of the activity of this protein.

Moreover, invention relates in a further preferred embodiment to transgenic or mutant plants which show a reduced activity of the polypeptide encoded by the polynucleotide of the invention compared to a corresponding wild-type plant.

The transgenic plants according to this embodiment show a reduced activity of the polypeptide of the invention due to the presence of a suitable foreign nucleic acid molecule in the genome of its cells.

Such transgenic plants may be useful objects for studying the resistance mechanism in which the polypeptide of the invention plays a role. The above explanations concerning techniques for producing transgenic plants and plant cells as well as suitable transformation techniques and vectors mentioned in connection with the transgenic plants having an increased ACT activity may be likewise applied in the present embodiment.

Methods for specifically reducing the activity of a protein in plant cells by the introduction of nucleic acid molecules are exhaustively and widely described in the literature and are known to the person skilled in the art. These include but are not limited to antisense inhibition, ribozyme inhibition, co-suppression, RNA interference, expression of dominant negative mutants, antibody expression and in vitro mutagenesis approaches.

It is particularly preferred that the nucleic acid molecule introduced into a plant cell in accordance with the present embodiment has to be expressed in the transgenic plant in order to exert the reducing effect upon ACT activity. The term "expressed" means for such a nucleic acid molecule that it is at least transcribed, and for some embodiments also translated into a protein, in at least some of the cells of the plant. Preferred examples of such nucleic acid molecules relate to those embodiments of the transgenic plants of the invention wherein said reduced ACT activity is achieved by an antisense, co-suppression, ribozyme or RNA interference effect or by the expression of antibodies or other suitable (poly)peptides capable of specifically reducing said activity or by the expression of a dominant-negative mutant. These methods are further explained in the following.

Accordingly, the use of nucleic acid molecules encoding an antisense RNA which is complementary to transcripts of a gene encoding ACT is a preferred embodiment of the present invention. Thereby, complementarity does not signify that the encoded RNA has to be 100% complementary. A low degree of complementarity may be sufficient as long as it is high enough to inhibit the expression of such an ATC protein upon expression of said RNA in plant cells. The transcribed RNA is preferably at least 90% and most preferably at least 95% complementary to the polynucleotide of the invention. In order to cause an antisense effect during the transcription in plant cells such RNA molecules have a length of at least 15 bp, preferably a length of more than 100 bp and most preferably a length or more than 500 bp, however, usually less than 1600 bp, preferably shorter than 1200 bp. Exemplary methods for achieving an antisense effect in plants are for instance described by Mϋller-Rόber (EMBO J. 11 (1992), 1229-1238), Landschϋtze (EMBO J. 14 (1995), 660-666), D'Aoust (Plant Cell 11 (1999), 2407-2418) and Keller (Plant J. 19 (1999), 131-141) and are herewith incorporated in the description of the present invention. Likewise, an antisense effect may also be achieved by applying a triple-helix approach, whereby a nucleic acid molecule complementary to a region of the gene, encoding the relevant ACT, designed according to the principles for instance laid down in Lee (Nucl. Acids Res. 6 (1979), 3073); Cooney (Science 241 (1998), 456) or Dervan (Science 251 (1991), 1360) may inhibit its transcription. A similar effect as with antisense techniques can be achieved by producing transgenic plants expressing suitable constructs in order to mediate an RNA interference (RNAi) effect. Thereby, the formation of double-stranded RNA leads to an inhibition of gene expression in a sequence-specific fashion. More specifically, in RNAi constructs, a sense portion comprising the coding region of the gene to be inactivated (or a part thereof, with or without non-translated region) is followed by a corresponding antisense sequence portion. Between both portions, an intron not necessarily originating from the same gene may be inserted. After transcription, RNAi constructs form typical hairpin structures. In accordance with the teachings of the present invention, the RNAi technique may be carried out as described by Smith (Nature 407 (2000), 319-320) or Marx (Science 288 (2000), 1370-1372).

Also DNA molecules can be employed which, during expression in plant cells, lead to the synthesis of an RNA which reduces the expression of the gene encoding the polypeptide of the invention in the plant cells due to a co-suppression effect. The principle of co-suppression as well as the production of corresponding DNA sequences is precisely described, for example, in WO 90/12084. Such DNA molecules preferably encode an RNA having a high degree of homology to transcripts of the target gene. It is, however, not absolutely necessary that the coding RNA is translatable into a protein. The principle of the co-suppression effect is known to the person skilled in the art and is, for example, described in Jorgensen, Trends BiotechnoL 8 (1990), 340-344; Niebel, Curr. Top. Microbiol. Immunol. 197 (1995), 91-103; Flavell, Curr. Top. Microbiol. Immunol. 197 (1995), 43-36; Palaqui and Vaucheret, Plant. Mol. Biol. 29 (1995), 149- 159; Vaucheret, Mol. Gen. Genet. 248 (1995), 311-317; de Borne, Mol. Gen. Genet. 243 (1994), 613-621 and in other sources. Likewise, DNA molecules encoding an RNA molecule with ribozyme activity which specifically cleaves transcripts of a gene encoding the relevant ACT protein can be used. Ribozymes are catalytically active RNA molecules capable of cleaving RNA molecules and specific target sequences. By means of recombinant DNA techniques, it is possible to alter the specificity of ribozymes. There are various classes of ribozymes. For practical applications aiming at the specific cleavage of the transcript of a certain gene, use is preferably made of representatives of the group of ribozymes belonging to the group I intron ribozyme type or of those ribozymes exhibiting the so-called "hammerhead" motif as a characteristic feature. The specific recognition of the target RNA molecule may be modified by altering the sequences flanking this motif. By base pairing with sequences in the target molecule, these sequences determine the position at which the catalytic reaction and therefore the cleavage of the target molecule takes place. Since the sequence requirements for an efficient cleavage are low, it is in principle possible to develop specific ribozymes for practically each desired RNA molecule. In order to produce DNA molecules encoding a ribozyme which specifically cleaves transcripts of a gene encoding the relevant ACT protein, for example a DNA sequence encoding a catalytic domain of a ribozyme is bilaterally linked with DNA sequences which are complementary to sequences encoding the target protein. Sequences encoding the catalytic domain may for example be the catalytic domain of the satellite DNA of the SCMo virus (Davies, Virology 177 (1990), 216-224 and Steinecke, EMBO J. 11 (1992), 1525-1530) or that of the satellite DNA of the TobR virus (Haseloff and Gerlach, Nature 334 (1988), 585-591). The expression of ribozymes in order to decrease the activity of certain proteins in cells is known to the person skilled in the art and is, for example, described in EP-B1 0 321 201. The expression of ribozymes in plant cells is for example described in Feyter (Mol. Gen. Genet. 250 (1996), 329-338).

Furthermore, nucleic acid molecules encoding antibodies specifically recognizing the relevant ACT protein in a plant, i.e. specific fragments or epitopes of such a protein, can be used for inhibiting the activity of this protein. These antibodies can be monoclonal antibodies, polyclonal antibodies or synthetic antibodies as well as fragments of antibodies, such as Fab, Fv or scFv fragments etc. Monoclonal antibodies can be prepared, for example, by the techniques as originally described in Kόhler and Milstein (Nature 256 (1975), 495) and Galfre (Meth. Enzymol. 73 (1981) 3), which comprise the fusion of mouse myeloma cells to spleen cells derived from immunized mammals. Furthermore, antibodies or fragments thereof to the aforementioned peptides can be obtained by using methods which are described, e.g., in Hariow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. Expression of antibodies or antibody-like molecules in plants can be achieved by methods well known in the art, for example, full-size antibodies (During, Plant. Mol. Biol. 15 (1990), 281-293; Hiatt, Nature 342 (1989), 469-470; Voss, Mol. Breeding 1 (1995), 39-50), Fab-fragments (De Neve, Transgenic Res. 2 (1993), 227-237), scFvs (Owen, Bio Technology 10 (1992), 790-794; Zimmermann, Mol. Breeding 4 (1998), 369-379; Tavladoraki, Nature 366 (1993), 469-472; Artsaenko, Plant J. 8 (1995), 745-750) and variable heavy chain domains (Benvenuto, Plant Mol. Biol. 17 (1991), 865-874) have been successfully expressed in tobacco, potato (Schouten, FEBS Lett. 415 (1997), 235- 241) or Arabidopsis, reaching expression levels as high as 6.8% of the total protein (Fiedler, Immunotechnology 3 (1997), 205-216).

Moreover, also nucleic acid molecules encoding peptides or polypeptides capable of reducing the activity of the relevant ACT protein other than antibodies can be used in the present context. Examples of suitable peptides or polypeptides that can be constructed in order to achieve the intended purpose can be taken from the prior art and include, for instance, binding proteins such as lectins.

In addition, nucleic acid molecules encoding a mutant form of the relevant ACT protein can be used to interfere with the activity of the wild-type protein. Such a mutant form preferably has lost its biological activity, e.g. its hydrolytic activity on glycosidic bonds, and may be derived from the corresponding wild-type protein by way of amino acid deletion(s), substitution(s), and/or additions in the amino acid sequence of the protein. Mutant forms of such proteins may show, in addition to the loss of the hydrolytic activity, an increased substrate affinity and/or an elevated stability in the cell, for instance, due to the incorporation of amino acids that stabilize proteins in the cellular environment. These mutant forms may be naturally occurring or, as preferred, genetically engineered mutants.

In another preferred embodiment, the nucleic acid molecule, the presence of which in the genome of a plant cell leads to a reduction of ACT activity, does not require its expression to exert its activity-reducing effect. Correspondingly, preferred examples relate to methods wherein said reduced ACT activity is achieved by in vivo mutagenesis or by the insertion of a heterologous DNA sequence in the ACT- encoding gene.

The term "in vivo mutagenesis", relates to methods where the sequence of the gene encoding the relevant ACT protein is modified at its natural chromosomal location such as for instance by techniques applying homologous recombination. This may be achieved by using a hybrid RNA-DNA oligonucleotide ("chimeroplast") as it is already described supra. For the purpose of reducing the activity of a certain endogenous protein, in vivo mutagenesis can in particular be directed to the promoter, e.g. the RNA polymerase binding site, as well as the coding region, in particular those parts encoding the substrate binding site or the catalytically active site or a signal sequence directing the protein to the appropriate cellular compartment. Reduction of ACT activity may furthermore be achieved by knocking out the endogenous ACT-encoding gene by way of inserting a heterologous DNA sequence into said gene. The term "heterologous DNA sequence" refers to any DNA sequences which can be inserted into the target gene via appropriate techniques other than those described above in connection with in vivo mutagenesis. The insertion of such a heterologous DNA sequence may be accompanied by other mutations in the target gene such as the deletion, inversion or rearrangement of the sequences flanking the insertion site. This embodiment of the invention includes that the introduction of a nucleic acid molecule leads to the generation of a pool, i.e. a plurality, of transgenic plants in the genome of which the nucleic acid molecule, i.e. the heterologous DNA sequence, is randomly spread over various chromosomal locations, and that this generation of transgenic plants is followed by selecting those transgenic plants out of the pool which show the desired genotype, i.e. an inactivating insertion in the relevant ACT-encoding gene and/or the desired phenotype, i.e. a reduced ACT activity and/or other phenotypic traits correlating with a reduced ACT activity.

Suitable heterologous DNA sequences that can be taken for such an approach are described in the literature and include, for instance, vector sequences capable of self-integration into the host genome or mobile genetic elements. Particularly preferred in this regard are T-DNA or transposons which are well-known to the person skilled in the art from so-called tagging experiments used for randomly knocking out genes in plants. The production of such pools of transgenic plants can for example be carried out as described in Jeon (Plant J. 22 (2000), 561-570) or Parinov (Curr. Op. BiotechnoL 11 (2000), 157-161).

Another example of insertional mutations that may result in gene silencing includes the duplication of promoter sequences which may lead to a methylation and thereby an inactivation of the promoter (Morel, Current Biology 10 (2000), 1591-1594). Furthermore, it is immediately evident to the person skilled in the art that the above- described approaches, such as antisense, ribozyme, co-suppression, in-vivo mutagenesis, RNAi, expression of antibodies, other suitable peptides or polypeptides or dominant-negative mutants and the insertion of heterologous DNA sequences, can also be used for the reduction of the expression of genes that encode a regulatory protein such as a transcription factor, that controls the expression of the relevant ACT protein or, e.g., proteins that are necessary for the ACT protein to become active.

It is also evident from the disclosure of the present invention that any combination of the above-identified approaches can be used for the generation of transgenic plants, which, due to the presence of one or more of the above-described nucleic acid molecules in their cells, display a reduced activity of the relevant ACT protein compared to corresponding source plants. Such combinations can be made, e.g., by (co-) transformation of corresponding nucleic acid molecules into the plant cell, plant tissue or plant or by crossing transgenic or mutant plants that have been generated according to different techniques. Likewise, the transgenic plants of the present invention showing a reduced ACT activity can be crossed with plants, e.g. transgenic plants, having other desired traits.

In a particularly preferred embodiment, the invention relates to transgenic or mutant plants which, upon an increased activity of the protein encoded by the polynucleotide of the invention compared to a corresponding wild-type plant, show an increased resistance against a plant pathogen to which a corresponding wild-type plant is susceptible.

The reaction catalyzed by the protein of the invention is the synthesis of hydroxy cinnamoylagmatines. Biosynthetic derivatives of these compounds, in particular the hordatines, are known for their antimicrobial activity. In view of this, it is expected that an increase of ACT activity will lead to an increase of the amount of hydroxycinnamoylagmatine derivatives in the cells and/or the apoplast of the plants and thereby to an increased pathogen resistance of these plants as compared to corresponding wild-type plants.

In the context of the present invention, the term "pathogen" refers to organisms that attack plants. It includes, for example, bacteria, viruses, viroids, fungi and protozoa. Fungal pathogens in particular species belonging to the taxonomic groups oomycota, ascomycetes and basidiomycetes (see for reference, e.g., Strasburger, Lehrbuch der Botanik, 33^rd edition, 1991 , G. Fischer Verlag, Stuttgart, Jena, New- York), are pathogens of particular interest in the context of the present invention. Examples of important pathogens are Phytophthora infestans (the causal agent of potato late blight disease), Phytophthora sojae (root rot in soybean), Peronospora parasitica (downy mildew), Magnaporthe grisea (rice blast disease), Erysiphe spp (powdery mildew), Pseudomonas syringae (bacterial blight), Erwinia amylovora (fire blight disease), Erwinia carotovora (soft rot), Botrytis cinerea (downy mildew of grape), Rhizoctonia solani and Pythium debaryanum (agents of seedling blight or damping off disease).

The term "susceptibility" refers to the capacity of a given pathogen to grow on or in the tissue of a plant. In particular, "susceptibility" refers to the growth of a pathogen on the epidermal surface and from there into the epidermis and subepidermal tissue, e.g. the mesophyll. Thus, the term "susceptibility" also covers incidents of pathogen attacks where the pathogen grows for a certain while on the host plant, however, without being capable to take up nutrients from the host and therefore without successfully colonising the host plant. In particular, successful colonization is characterized by completing that part of the pathogen's life cycle which takes place on the plant host. With regard to fungal pathogens, like for instance powdery mildew, such a successful colonisation is for instance apparent from the formation of a haustorium and of secondary hyphae.

In connection with the present invention, the term "resistant" or "resistance" refers to the property of a given plant or plant species to protect itself against an attack by a certain pathogen, whereby said protection may range from a delay to a complete inhibition of disease development. Preferably, "resistance" refers to an effective block of pathogen growth on or in said plant or plant species so that the pathogen is not able to successfully colonize the plant or plant species. Generally, resistance involves an interplay of various means that aim at blocking penetration of the pathogen into the plant. This may refer to static properties of the plant, i.e. structural, chemical or other characteristics of the plant that prevent or reduce pathogen penetration and which are constitutively present in the plant, i.e. independent of whether there is a pathogen attack or not. On the other hand, such means may also be inducible mechanisms with which a plant reacts to pathogen attack. Among these mechanisms, cell wall appositions, the expression of pathogenesis-related proteins and hypersensitive response (cell death) are prominent examples. In connection with the present invention, resistance is preferably exerted at the level of cell wall penetration. This means that the provisions of the invention preferably improve or establish resistance against a pathogen by decreasing its capacity to overcome a cell wall barrier, which preferably is the outer cell wall of the epidermis or rhizodermis. It is furthermore preferred that the provisions of the invention improve or establish resistance against a pathogen by improving static defense (i.e. the capacity of a plant to prevent cell wall penetration by a pathogen without detectably inducing an inducible defense mechanism) and/or by improving one or more inducible defense mechanisms.

Furthermore, the term "increased resistance" refers to a significant reduction of susceptibility to a pathogen in transgenic or mutant plants according to the present embodiment as compared to corresponding untreated plants. In particular, such a reduction of susceptibility may be evident from a significant reduction of penetration events and/or a significant reduction of hypersensitive reactions as for instance visible by fluorescence detection. Preferably, such a reduction of susceptibility is by at least 10%, more preferably at least 20%, still more preferably by at least 50%, even more preferably by at least 80% and most preferably to approximately 100% as compared to a corresponding wild-type in terms of the number of penetration events and/or hypersensitive reactions.

The term "increased resistance" may refer both to an enhancement of a resistance already present in the wild-type plant and to the establishment of a resistance that is not present in the wild-type plant.

In another preferred embodiment, the invention relates to transgenic or mutant plants which, upon an altered activity of the protein encoded by the polynucleotide of the invention compared to a corresponding wild-type plant, shows an altered composition of cell wall polymers as compared to a corresponding wild-type plant. The term "cell wall polymers" refers to the polymers present in the cell wall of a plant, plant tissue or plant cell, preferably to those polymers that contain phenolic compounds such as lignin or suberin. It is envisaged that an alteration of ACT activity will lead to an altered composition of cell wall polymers which in particular refers to the content of hydroxycinnamoylagmatines and derivatives thereof as monomers of the cell wall polymers in comparison to the content of hydroxycinnamoylagmatines and derivatives thereof in the cell wall polymers of corresponding wild-type plants, plant tissue or plant cells. In particular, the alteration of ACT activity may be a reduction of ACT activity leading to a reduced content of hydroxycinnamoylagmatines and derivatives thereof in the cell wall polymers, preferably by at least 20%, more preferably by at least 50% and even more preferably by at least 80% when compared to the cell wall polymers of a corresponding wild-type plant, plant tissue or plant cell. It is however preferred that said alteration of ACT activity is an increase leading to an increased content of hydroxycinnamoylagmatines and derivatives thereof in the cell wall polymers, preferably by at least 20%, more preferably by at least 50% and still more preferably by at least 100%.

An altered composition of cell wall polymers may be detected by comparing the cell wall composition of a plant tissue sample from a plant of the invention with the cell wall composition of a plant tissue sample taken from a corresponding wild-type plant. Corresponding techniques for analyzing the composition of cell walls are known by a person skilled in the art. For example, it is possible to analyze the cell wall composition by histochemical examination which may preferably involve staining of hydroxycinnamoylagmatines and derivatives thereof at the highly basic guanidine group on the arginine moiety using the Sakaguchi reagent as, e.g., described in Wei et al. (1994). Further suitable techniques include for instance Fourier transform infrared (FT-IR) microspectroscopy. By this technique, it is possible to detect significant differences of the cell wall composition, in particular with regard to carbohydrates and phenolics.

It is conceived that an altered composition, as a consequence of an increased amount of hydroxycinnamoylagmatines and/or derivatives thereof, will strengthen the cell wall towards enzymatic or mechanic degradation. However, the molecules may also be biologically active when bound to the cell wall, thus having an antimicrobial function.

The invention also relates to propagation material of the transgenic plants of the invention comprising plant cells according to the invention. The term "propagation material" comprises those components or parts of the plant which are suitable to produce offspring vegetatively or generatively. Suitable means for vegetative propagation are for instance cuttings, callus cultures, rhizomes or tubers. Other propagation material includes for instance fruits, seeds, seedlings, protoplasts, cell cultures etc. The preferred propagation materials are tubers and seeds. The invention also relates to harvestable parts of the plants of the invention such as, for instance, fruits, seeds, tubers, rootstocks, leaves or flowers.

Corresponding to the above explanations, the invention furthermore relates to a method for conferring pathogen resistance or increased pathogen resistance to a plant comprising the step of providing a transgenic or mutant plant in which the activity of the polypeptide encoded by the above-described polynucleotide of the invention is increased compared to a corresponding wild-type plant.

In a further aspect, the present invention relates to a method for modifying the properties of cell wall polymers in a plant comprising providing a transgenic or mutant plant in which the activity of a protein encoded by the above-described polynucleotide of the invention is increased or reduced compared to a corresponding wild-type plant.

Moreover, the invention relates to a method for producing an antimicrobial compound or a precursor thereof comprising

(a) incubating the polypeptide of the invention with agmatine and a p- hydroxycinnamoyl-CoA under conditions that said polypeptide is active; and

(b) recovering the antimicrobial compound or precursor thereof from the incubation mixture. By the provision of the polypeptide of the invention, it has become possible to effectively produce hydroxycinnamoylagmatine in vitro. For this purpose, the enzyme can be produced, preferably in pure form, according to methods described above, for instance by recombinant expression. The substrate agmatine is commercially available and p-hydroxycinnamoyl-CoA may be synthesized according to methods known in the art and for instance described in Stόckigt and Zenk (1975) and Meng and Campbell (1997) and in the appended Examples. The incubation step (a) can be carried out by a skilled person in accordance with conventional techniques as for instance described in Bird and Smith (Methods Enzymology 94 (1981), 344-347) and on the basis of the knowledge about the properties of the polypeptide of the invention described above in detail. Furthermore, the antimicrobial compound or precursors thereof can be recovered from the incubation mixture by suitable purification techniques known to the skilled person and described in the literature such as in Von Rόpenack et al. (J. Biol. Chem. 273 (1998), 9013-9022).

The term "antimicrobial compound" as used herein refers to the activity of said compound to inhibit growth of a microbial, preferably a fungal organism. This growth inhibiting effect preferably is detectable when the compound is present in the growth medium at a concentration of at least 1 mM, preferably of at least 100 μM, still more preferably of at least 50 μM, still more preferably of at least 10 μM and most preferably at a concentration below 10 μM.

In a further aspect, the invention relates to a method for producing an antimicrobial compound or a precursor thereof comprising

(a) culturing the host cell of the invention described above in the presence of the compounds agmatine and a p-hydroxycinnamoyl-CoA under conditions allowing for the expression of the polypeptide encoded by the polynucleotide of the invention as contained in said host cell and allowing for condensation of said compounds to take place; and

(b) recovering the antimicrobial compound or precursor thereof from the cells and/or the culture medium.

This method makes use of the ACT activity of the protein of the invention by expressing said polypeptide in a suitable host cell and letting the condensation reaction between agmatine and p-hydroxycinnamoyl-CoA take place in the culture. Depending on whether the expressed polypeptide is secreted or not, the reaction takes place in the host cell or in the medium. If the former applies, the substrate compounds have to be provided to the cell, preferably all or part of the necessary substrate compounds is taken up by the host cell from the culture medium. Secreting the protein and performing the reaction in the culture medium is the preferred form of carrying out the present method and may preferably be performed as described in Ray (Protein Expr. Purif. 26 (2002), 249-259). The culture conditions for step (a) may be chosen according to suitable techniques, such as fermentation techniques, described in the prior art. The conditions primarily depend on the growth requirements of the host cell and the conditions under which the enzyme is active.

The antimicrobial, preferably antifungal compound or precursor thereof may be recovered from the cells if the produced antimicrobial compound or precursor thereof has accumulated in the cells or from the culture medium if said compound or precursor thereof has accumulated in the culture medium. If the produced compound is toxic to the host cell, it should be removed from the culture prior to reaching a critical concentration. The person skilled in the art is familiar with suitable isolation and purification techniques.

In a preferred form, the above-outlined methods for producing an antimicrobial compound or precursor thereof further comprises

(c) reacting the compound or precursor thereof recovered in step (b) so that dimerisation takes place. The term "dimerisation" refers to the reaction by which two p- hydroxycinnamoylagmatines form a hordatine via oxidative phenol coupling as it is illustrated in Figure 9. This dimerisation reaction may be conducted by the use of horseradish peroxidase in the presence of dilute hydrogen peroxide as for example described in Stoessl (1966).

The product of (c) is a hordatine which is commonly known for its antimicrobial, in particular antifungal activity. In contrast to hordatines isolated from plants which is optically active, the hordatines obtained by horseradish peroxidase-catalysis is in a racemic form which, however, likewise shows antimicrobial activity (Stoessl (1970)). Preferably, the reaction in step (c) is carried out with the specific peroxidase naturally active in hordatine formation in plants.

In addition, the present invention relates to a method for preparing a plant protection composition comprising the steps of the aforementioned method for producing an antimicrobial compound or precursor thereof and furthermore the step of formulating the antifungal compound or precursor thereof in a form suitable for administering to plants.

The compound identified according to the above-described method(s) or an analog or derivative thereof may be further formulated in a form suitable for the application in plant cultivation. For example, it can be combined with a agriculturally acceptable carrier known in the art. The plant protection composition can be prepared by employing one or more of the above-described methods for producing an antimicrobial compound or precursor thereof in an amount sufficient for use in agriculture. The term "formulating" also encompasses further reacting a precursor of an antimicrobial compound obtained in one of the above-described methods in a way that it attains antimicrobial activity. The terms "analogs or derivatives" refer to compounds that show substantially the same activity with respect to the potential to increase resistance in plants as the originally produced compound and that are immediately recognizable by a person skilled in the art in the field of agrochemicals once being aware of the originally identified compound.

In the plant protection composition of the invention, the compound produced by one of the above-described methods or a precursor thereof may be formulated by conventional means commonly used for the application of, for example, herbicides and pesticides or agents capable of inducing systemic acquired resistance (SAR). For example, certain additives known to those skilled in the art such as stabilizers, surfactants or substances which facilitate the uptake by the plant cell, plant tissue or plant may be used as for example harpins, elicitins, salicylic acid (SA), benzol(1 ,2,3)thiadiazole-7-carbothioic acid (BTH), 2,6-dichloro isonicotinic acid (INA), jasmonic acid (JA) or methyljasmonate.

In a further aspect, the present invention relates to a method for producing a biopolymer comprising the step of extracting cell wall polymers from the above- described transgenic or mutant plants of the invention which show an altered composition of cell wall polymers as a consequence of an altered ACT activity compared to corresponding wild-type plants.

It is preferred that the obtained biopolymers contain at least one or more hydroxycinnamoylagmatine monomers. Extraction may be carried out according to standard methods as they are known to the skilled person and described in the literature such as in Von Rόbenack et al. (1998).

The present invention also relates to biopolymers obtainable by the above-described method for producing a biopolymer.

In yet another aspect, the invention relates to the use of the above-described polynucleotides recombinant nucleic acid molecules, vectors, host cells, polypeptides, antibodies or transgenic or mutant plants of the invention for the preparation of an antimicrobial compound, a precursor thereof or a plant protection composition.

For employing these uses, the skilled person may utilize the above-mentioned substances contributed by the present invention and the common general knowledge in the field of plant protection and enzymatic or recombinant production techniques for producing biologically active compounds, supplemented by the above-outlined descriptions and explanations on how to utilize the substances of the invention for producing antimicrobial compounds, precursors thereof and plant protection compositions.

Furthermore, the present invention relates to the use of the above-described polynucleotides, recombinant nucleic acid molecules, vectors, host cells, polypeptides, antibodies or transgenic or mutant plants of the invention for establishing or enhancing a pathogen resistance in a plant.

It is immediately evident to the person skilled in the art that the polynucleotides, recombinant nucleic acid molecules and vectors of the present invention can be employed to produce transgenic plants with a desired trait (see for review TIPTEC Plant Product & Crop Biotechnology 13 (1995), 312-397) comprising (i) insect resistance (Vaek, Plant Cell 5 (1987), 159-169), (ii) virus resistance (Powell, Science 232 (1986), 738-743; Pappu, World Journal of Microbiology & Biotechnology 11 (1995), 426-437; Lawson, Phytopathology 86 (1996), 56 suppl.), (iii) resistance to bacteria, insects and fungi (Duering, Molecular Breeding 2 (1996), 297-305; Strittmatter, Bio/Technology 13 (1995), 1085-1089; Estruch, Nature Biotechnology 15 (1997), 137-141), or (iv) as a genetic marker useful in breeding plants with an improved resistance to pathogens.

Also, the invention relates to the use of the above-described polynucleotides, recombinant nucleic acid molecules, vectors, host cells, polypeptides, antibodies or transgenic or mutant plants of the invention for producing a biopolymer.

These and other embodiments are disclosed and encompassed by the description and examples of the present invention. Further literature concerning any one of the methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries, using for example electronic devices. For example the public database "Medline" may be utilized which is available on the Internet, for example under http://www.ncbi.nlm.nih.gov/PubMed/medline.html. Further databases and addresses, such as http://www.ncbi.nlm.nih.gov/, http://www.infobiogen.fr/, http://www.fmi.ch/biology/research_tools.html, http://www.tigr.org/, are known to the person skilled in the art and can also be obtained using, e.g., http://www.google.de. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness is given in Berks, TIBTECH 12 (1994), 352-364.

Furthermore, the term "and/or" when occurring herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term".

The present invention is further described by reference to the following non-limiting figures and examples.

The Figures show:

Figure 1 depicts the nucleotide sequence and the deducted amino acid sequence of the ACT cDNA (clone pHV-ACT5-28-6). The same sequences are also shown under SEQ ID NOs:1 and 2. The underlined 15 N-terminal amino acid residues have been determined by Edman degradation of the purified ACT (see Example 2).

Figure 2 is a representation of a silver-stained SDS-PAGE gel showing protein from the pooled fractions of the individual ACT purification steps (see Example 1). The marker (M) is a 10 kDa ladder from 20 to 120 kDa. Lanes 1-5 correspond to the sequential purification steps given in Table 1. Lanes 1-5 represent 1.5, 1.0, 0.75, 0.5 and 0.1 μg protein, respectively.

Figure 3 provides a visualization of a silver-stained IEF gel of the purified native barley ACT (Lane 1). M, IEF marker (for further explanations see Example 1).

Figure 4 gives a plot for the separation of ACT activity into three peaks using Mono Q media as step 4 in the sequential purification of ACT (see Example 2). 1 ml fractions were collected. Solid dark line, A280; solid shaded line, KCI gradient.

Figure 5 shows an amino acid alignment of the barley ACT (pHV-ACT5-28-6; SEQ ID NO:2), the putative wheat ACT (pTA-W3-1 ; SEQ ID NO:4) and the derived amino acid sequence from a wheat EST clone (TA-EST, ace. no. BM137380). The amino acid sequence obtained by Edman degradation of the purified ACT is underlined.

Figure 6 shows a multiple alignment of amino acid sequences of plant transferases belonging to a diverse transferase protein family (a) and the corresponding species tree (b). The two highly conserved motifs are underlined in (a). Accession numbers are given in both figures, except for the ACT5-28-6. The abbreviation pHCBT in (b) indicates that these sequences are annotated as putative HCBTs. The phylogenetic tree was constructed by applying the distance matrix method using MacVector 7.0 (Oxford Molecular Software). The length of lines (corresponding to the numerical values) indicates the relative distances between nodes.

Figure 7 illustrates the affinity purification of the bacterially expressed ACT. The enzyme fractions were separated on a 4-12% SDS-NuPAGE gel and protein bands were subsequently stained with Coomassie blue. Protein from crude extract (lane 1), from the desalted extract (lane 2) and from the chromatography on the Ni⁺ -NTA-agarose (lanes 3 to 10) was applied to the gel. Lane 3 shows the runthrough, lanes 4 to 7 show the sequential washing fractions and lanes 8 to 10 show the sequentially eluted fractions of the recombinant ACT. M, molecular marker.

Figure 8 depicts the results of experiments in which DEPC sensitivity of ACT was investigated (Example 3). The His-tag purified recombinant ACT was inactivated by 1.0 mM DEPC. The influence of substrate protection against DEPC inactivation was studied by preincubating either with 25 μM Coumaroyl-CoA (S1) or 0.2 mM agmatine (S2) prior to incubation with DEPC. Residual DEPC was quenched with a corresponding amount of imidazole.

Figure 9 illustrates the biosynthesis of hordatine. The two steps depend on agmatine coumaroyltransferase (ACT) followed by an oxidative dimerisation. The p-hydroxy-cinnamoyl-CoA is either coumaroyl-CoA (R-I=H) or feruloyl-CoA (R<|=OMe). Hordatine A (R-|=R =H) is formed if both cinnamic acid derivatives are p-coumaroyl-CoA and Hordatine B (R<l=OMe and R₂=H) if one is feruloyl-CoA. Hordatine M (R2=D- glycopyranosyl) is a mixture of the glucosides of hordatines A and B.

The following Examples serve to further illustrate the invention. In the Examples the following materials and methods were used. 1. Molecular biological techniques

Unless stated otherwise in the Examples, all recombinant DNA techniques are performed according to protocols as described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfase (1993) by R.D.D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK).

2. Plant material

Barley (Hordeum vulgare L., cv Triumph) were sown on top of an approximately 3 cm layer of soil and covered with a thin layer of fine gravel. The moistened trays were wrapped in black plastic bags and placed in growth chamber (22°C, 24 h darkness). Seedlings were harvested 3 days after sowing, frozen in liquid N₂, ground to fine powder with a mortar and a pestle and then stored at -80°C for subsequent purification.

3. Chemicals and substrates

The hydroxycinnamoyl-CoA thiolesters were enzymatically synthesised using recombinant tobacco 4-coumarate:coenzyme A ligase (4CL). The Escherichia coli strain with the Nt4CL-19 plasmid (Lee and Douglas, 1996) was kindly provided by Carl Douglas (University of British Columbia). A bacterial culture (A₆oo 0.6; 100 ml) grown at 37°C was induced with 2 mM isopropylthio-β-D- thiogalactopyranoside (I PTG) for 4 h. Cells were harvested by centrifugation at 4.000xgf for 10 min, the pellet resuspended in 20 ml 0.2 M Tris (pH 7.8) sonication buffer, subsequently frozen in liquid N₂ and thawed on ice. Bacterial cells were sonicated and centrifuged at 10.000xg for 20 min at 4°C. The 4CL containing supernatant was adjusted to 30% glycerol and stored at -20°C until use. The ligase reaction consisted of 0.2 M Tris pH 7.5 containing 10 mM MgCI₂, 1 mM dithiothreitol (DTT), 25 mM ATP, 10% (v/v) 4CL protein extract, 0.2 mM hydroxycinnamic acid (Sigma) and 0.1 mM CoA (Sigma). After 15 min incubation at 37°C, synthesised cinnamoyl-CoA derivatives were purified on LC-18 SPE columns (Supelco) as described (Meng and Campbell, 1997) except that MOPS was replaced by 0.2 M Tris pH 7.5. The hydroxycinnamoyl- CoA derivatives were concentrated in a vacuum centrifuge to approximately 0.5 mM and stored at -20°C.

Buffers

The following buffers were used for enzyme purification by chromatographic procedures: (A) 100 mM Tris pH 8.5 containing 1 mM EDTA, 10 mM 2- mercaptoethanol (2-ME), 50 mM KCI and 250 mM sucrose. (B) 50 mM Tris pH 7.5 containing 1 mM EDTA, 10 mM 2-ME and 50 mM KCI. (C) as (B) but 2.5 M KCI. (D) as (B) but 2.0 M CH₃COOK replacing KCI.. (E) as (B) but 0.5 M KCI. (F) 100 mM Tris pH 7.5 containing 1 mM EDTA, 10 mM 2-ME and 50 mM KCI. Buffers (100 mM) used to determine pH optimum of the enzyme were MES (pH 5.5-6.7), Bis-Tris (pH 5.8-7.2), MOPS (pH 6.5-7.9), TES (6.8-8.2), HEPES (pH 7.0-8.4), Tris (pH 7.5-8.9), Glycine (pH 8.8-10.2) and CAPS (pH 9.7-11.1).

Determination of ACT activity

ACT activity was spectrophotometrically detected by recording the decrease in A₃₃₃ (Bird and Smith, 1983). The reaction mixture was 100 mM Tris pH 7.5 containing 1 mM EDTA, 15 mM α-monothioglycerol (αMTG), 10% (v/v) ACT extract, 10 μM hydroxycinnamoyl-CoA and 0.2 mM agmatine. Assays were started by the addition of agmatine. Hydroxycinnamoyl-CoA was slowly degraded in absence of agmatine, thus controls were subtracted. In controls agmatine were replaced by ddH₂0 (aqua bidest). Assays were performed at 25°C. The extinction coefficients for hydroxycinnamoyl-CoA derivatives suggested by Stδckigt and Zenk (1975) were used for ACT activity calculations. All assays were done in five replicates.

6. Protein quantification

The Coomassie plus protein assay reagent (Pierce) was used for quantification of protein concentration throughout purification steps using bovine serum albumin as standard.

7. Purification of ACT

All procedures were performed at 4°C and chromatography was done on a fast- protein-liquid-chromatography system (FPLC) from Pharmacia Biotech. All columns and chromatographic materials used for ACT purification were purchased from Amersham Pharmacia Biotech.

7.1 Preparation of crude extract (step 1)

Frozen ground barley seedlings (200 g) were mixed with buffer A (1:5 w/v) in a mortar and gently stirred with a pestle for 15 min. The slurry was filtered through 2 layers of nylon mesh and centrifuged at 20.000 g for 90 min. The supernatant was then filtered through a 0.20 μm filter and collected as crude extract.

7.2 Blue Sepharose affinity chromatography (step 2)

The crude protein extract was chromatographed in aliquots of each 50 ml on a Blue Sepharose column (HiTrap Blue HP, 5 ml) equilibrated in buffer B. Following loading the column was washed in 20 column volumes (CV) of buffer B before a step gradient (5 CV of 50% and 20 CV of 100%) of buffer C was applied at a flow rate of 5 ml/min. Fractions of 1 ml were collected and subsequently assayed for ACT activity.

7.3 t-Butyl HIC (hydrophobic interaction chromatography) (step 3)

Fractions containing ACT activity from the individual runs of step 2 was pooled and adjusted to 2 M CH₃COOK. The slurry was gently stirred for 2 h and then centrifuged at 10.000 g for 10 min. The supernatant was chromatographed in aliquots of each 50 ml on the -Butyl HIC column (25 ml Butyl Sepharose 4 Fast Flow in a XK 26 column) previously equilibrated in buffer D. The column was washed in 5 CV of buffer D before bound protein was eluted with a linear gradient (100-0% in 16 CV) of buffer B at a flow rate of 5 ml/min. Fractions of 8 ml were collected and assayed for ACT activity.

7.4 RESOURCE Q anion exchange chromatography (step 4)

Active protein from the individual runs of step 3 was pooled and dialysed twice for 24 h against buffer B. The dialysed protein was chromatographed in aliquots of each 50 ml on a RESOURCE Q (1 ml) column equilibrated in buffer B. The column was washed in 10 CV of buffer B before a linear gradient (0- 100% in 50 CV) of buffer E was applied at a flow rate of 2.5 ml/min. Fractions of 1 ml were collected and assayed for ACT activity.

7.5 Superose 12 gel filtration chromatography (step 5)

Active protein from the individual runs of step 4 was pooled and concentrated to ca. 100 μl in two steps using Centriplus YM-10 and Microcon YM-10 centrifugal filter devices (Amicon, Millipore). The ACT concentrate was loaded to a Superose 12 HR 10/30 equilibrated in buffer F. Protein was eluted with buffer F at a flow rate of 0.4 ml/min and fractions of 0.3 ml were collected and assayed for ACT activity.

8. Gel electrophoresis

Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out in a Hoefer Mighty Small II SE 260 vertical minigel system using NOVEX pre-cast 4-12% NuPAGE Bis-Tris 1.0 mm gels. Running buffer was 1.0 M MOPS pH 7.7 containing 1.0 M Tris Base, 69.3 mM SDS and 20.5 mM EDTA.

The isoelectric point of ACT was determined with a 2117 Multiphor II flatbed electrophoresis system using pre-cast polyacrylamide gels containing ampholines in the pH range 3.5-9.5 (Ampholine PAGplate, Amersham Pharmacia biotech). Isoelectric focusing (IEF) gels were fixed in 3.45% sulfosalicylic acid, 11.5% trichloroacetic acid and 30% ethanol. To visualise proteins, gels were subjected to silver staining using the method of Morrissey (1981) except that ethanol replaces methanol and that glutaraldehyde fixation was omitted.

9. Molecular exclusion

The molecular mass of native ACT was estimated by chromatography on the Superose 12 HR 10/30, using a molecular weight marker kit (Sigma, MW-GF- 200). The molecular mass of denatured ACT was estimated by SDS-PAGE by use of molecular weight standards (NOVEX, Mark12; Mo Bi Tec, BOA001).

10. Protein sequencing

The ACT fraction purified to apparent homogeneity was concentrated on an Amicon centrifugal filter device with 10 kDa nominal molecular weight limit (Microcon, Millipore). Concentrated protein (1-5 μg) was subjected to SDS- PAGE and transferred to Immobilon-P polyvinylidene fluoride (PVDF)- membrane (Millipore) using the Hoefer Semiphor (Pharmacia Biotech) semidry blotting system. Towbin-buffer (3 g Tris, 14.5 g glycine and 20% (v/v) methanol pr. litre) was used as transfer buffer and protein was electroblotted for 1 h at 0.8 mA/cm² gel. The transferred protein was stained with Coomassie (0.25% Coomassie Blue R-250, 10% acetic acid and 40% ethanol) for 3 min and then washed in distaining solution (10% acetic acid and 40% ethanol) for several changes. Finally the membrane was washed several times in ddH₂0 and then let to air-dry. The stained protein band was cut out and frozen in Eppendorf tubes until sequencing were performed by Edman degradation on a Procise 494 protein sequencer (Applied Biosystems). Two runs of Edman sequencing (15 cycles of automated pulse liquid chemistry) were carried out.

11. Cloning of ACT cDNA from barley and wheat

TBIastN search (Altschul et al., 1997) using the 15 Λ/-terminal amino acid residues obtained from purified ACT identified six EST clones (ace. no's BI259608, BI959297, BF628198, BI955449, BF619699 and BM137380). Two sets of primers were designed for 5' and 3' RACE, respectively. Oligo nucleotides for 3' RACE (CATGAAGATCACCGTGCACTC,

ATCCTGCTCAACGACGCC; SEQ ID Nos: 11 and 12) and for 5' RACE (GAGTGCACGGTGATCTTCATG, GGCGTCGTTGAGCAGGATCG; SEQ ID NOs: 13 and 14) were used in combination with vector primers for nested amplification from cDNA libraries. Copy DNA libraries of leaf mRNA from barley and wheat in lambda phage (ZAP-XR and ZAP, Stratagene, respectively) were used as template in the amplification reactions. RACE was performed with 500 ng cDNA as template using the editing Expand Long Template PCR System (Boehringer, Mannheim) as described by the manufacturer. Amplification was initiated by 2 min denaturing at 94^°C followed by 25 cycles of denaturing, 94^°C, 30s, annealing 58°C, 20s and elongation 68^°C, 60s + 2s/cycle. Amplification was terminated by 10 min incubation at 68^°C. PCR products were cloned in pCR4-TOPO vector and sequenced on both strands using vector and internal primers. Sequencing was carried out on an ABI 310 DNA sequencer (Applied Biosystems) using the DYEnamic ET terminator cycle sequencing kit (Amersham Biosciences). Sequences were proofread using Sequencher software ver. 3.1.1 (Gene Codes Corp., Ml, USA). Sequences and contigs were analysed by MacVector 7.0 (Oxford Molecular software).

12. Expression of recombinant ACT in E. coli

Two Ndel adapter primers

(GGAATTCCATATGAAGATCACCGTGCACTCTTC,

GGAATTCCATATGCTAGGCAAGTGGCTAACGTTGATCC; SEQ ID NOs: 15 and 16) were used to amplify the coding region of pHV-ACT5-28-6 using Dynazyme EXT polymerase (Finnzymes, Finland). Digested PCR fragments were cloned into the Ndel site of pET15b (Novagen). Fidelity and orientation was confirmed by sequencing. E. coli BL21 CodonPlus (DE3)-RIL (Stratagene) harboring the pET-ACT construct was grown in Luria Bertoni medium at 37°C to a cell density of 1.3 (OD₆oo)- Prior to induction of expression the culture was cooled to 28°C. Expression was carried out at 28°C for 3 h after addition of IPTG to 0.5 mM. Cells were harvested and resuspended in 100 mM Tris pH 8.5, 1 mM EDTA, 15 mM αMTG, 50 mM NaCl and lysed by incubation with 100 ug/ml lysozyme (Sigma) at 30°C for 15 min followed by sonication and centrifugation (20.000 g, 4°C, 20 min). The supernatant buffer was changed into 20 mM Tris pH 8.0, 5 mM imidazole and 500 mM NaCl by gel filtration (HiTrap Desalting, 5ml, Amersham Biosciences) and soluble histidine-tagged recombinant ACT was purified by Ni+-NTA- agarose (Qiagen) affinity chromatography as described by the manufacturer. After loading the column was washed with 20 mM Tris pH 8.0 containing 20 mM imidazole and 500 mM NaCl and the histidine-tagged protein eluted with 20 mM Tris pH 8.0 containing 500 mM imidazole and 500 mM NaCl. Protein samples were stored on ice. Fractions were assayed for ACT activity and purity analyzed by SDS-PAGE. 13. Chemical modification of ACT

Activity of bacterial expressed ACT was examined in the presence of diethylpyrocarbonate (DEPC). DEPC stock solutions were made up immediately before use in anhydrous alcohol. All incubations were carried out at 25°C. The affinity-purified enzyme (150 ng) was incubated with various concentrations of DEPC before dividing into working aliquots containing 7.5 ng rACT. Following 5 min incubation excess DEPC was quenched with a corresponding amount of imidazole before monitoring of ACT activity. For the substrate-protection experiment, ACT was incubated for 5 min with either 10 μM p-coumaroyl-CoA or 0.2 mM agmatine prior to the addition of 1 mM DEPC.

Example 1: Purification and characterization of agmatine hydroxycinnamoyltransferase (ACT)

ACT catalyses the first step in the synthesis of hydroxycinnamoylagmatine derivatives. This step combines the polyamine and the phenylpropanoid pathway resulting in compounds that seem to be involved in the broad-spectrum resistance of barley. ACT was previously partially purified by ammonium sulphate fractionation, size exclusion and affinity chromatography using agmatine as the ligand (Bird and Smith, 1983). In connection with the present invention, a new approach was developed using a four-column purification procedure. It was possible to succeed in purifying an ACT isoform to apparent homogeneity.

Three days old barley seedlings were chosen as source for the ACT purification because hordatine accumulation reaches its maximum within the first 3-6 days after germination, when grown at 20°C (Smith and Best, 1978; Bird and Smith, 1984). Coumaroyl-CoA was used as the hydroxycinnamoyl-CoA substrate in order to monitor the enzyme activity during purification. It was synthesised using crude extracts of E. coli expressing recombinant tobacco 4CL (Lee and Douglas, 1996) and subsequently purified on C-18 SPE columns (Meng and Campbell, 1997). The spectrum of the individual purified and concentrated hydroxycinnamoyl-CoAs was as previously reported (Stόckigt and Zenk, 1975).

Before large-scale purification was initiated, crude extracts of a number of commercial barley varieties were tested for ACT activity, however only minor differences were observed between 10 varieties compared. Seedlings grown in light showed only slightly higher ACT activity, thus etiolated seedlings were chosen as source to avoid chlorophyll in the purification. Enzyme activity could only be detected in the soluble protein extract; Table 1 lists the five step procedure for ACT purification which includes four different column chromatography principles.

The low amount of ACT activity in extracts of young barley seedlings necessitates concentration of ACT activity prior to or by the first chromatographic step to avoid excessive dilution. For this purpose, the immobilised reactive dye Cibacron Blue F3G-A was used for batch enrichment of the enzyme activity. An 11 -fold purification was obtained from the Blue Sepharose column after eluting with potassium chloride (Fig. 2, lane 2). It was possible to elute ACT specifically from Cibacron Blue F3G-A using the substrate coumaroyl-CoA, but due to interactions with the reactive dye in the chromatographic media large quantities of coumaroyl-CoA were needed to efficiently elute the enzyme. In addition, a number of unrelated proteins co-eluted with ACT even when different chromatographic steps were performed preceding the blue Sepharose step.

Table 1. Purification of ACT activity from etiolated barley seedlings.

Method Step Total Total Specific Yield Purification activity protein activity (%) (-fold)

(nkat) (mg) (nkat/mg)

Crude extract³ 1 33.4 1307 0.026 100 1

Blue Sepharose 2 25.1 86.7 0.29 75 11 f-Butyl

3 5.0 7.2 0.70 15 27

Sepharose

RESOURCE Q 4 2.0 0.384 5.13 6 201

Superose 12

5 1.0 0.033 29.7 3 1162 HR

' The crude extract was prepared from 200 g frozen etiolated barley seedlings. Hydrophobic interaction chromatography was chosen as the third step despite a considerable loss in total ACT activity was encountered, however this step was found to be essential for the successful ACT purification (Fig. 2, lane 3). Active ACT was only recoverable when f-butyl and not phenyl was used as the HIC ligand. The high potassium chloride concentration (1.25 M) from the previous blue-sepharose step accomplished the salting-out effect of the potassium acetate used to generate interactions between the enzyme and the f-butyl media.

The following anion exchange chromatography step separated ACT activity into two peaks, one containing a complex mixture of proteins and the other containing approximately 10 proteins as visualised in silver stained SDS-PAGE of which one of about 48 kDa was particular prominent (Fig. 2, lane 4). The two ACT activity peaks were each exposed to Superose 12 HR molecular size exclusion chromatography. In both chromatographic runs, the 48 kDa protein became very prominent, but the first ACT peak from the anion exchange chromatography was still not pure,, whereas the second peak provided ACT purified to apparent homogeneity (Fig. 2, lane 5) as judged by silver stained SDS-PAGE. The purification protocol outline here thus provided through five steps a 1162-fold purification, with a yield of 3%, the main loss in activity occurred by hydrophobic interaction chromatography.

Stability

Purified ACT lost about 25% of its enzyme activity when frozen to -20°C in buffer F although gently thawed, but when kept on ice in the same buffer ACT could be stored for more than a month without detectable loss of activity.

General properties of ACT

The molecular mass of native ACT was determined by chromatography on a Superose 12 HR 10/30 column calibrated with molecular-mass standards. Native ACT eluted with an apparent molecular mass of ca. 40 kDa, suggesting that the native barley ACT enzyme is a monomer. The isoelectric point of the purified native enzyme was determined by isoelectric focusing and found to be pH 5.2 (Fig. 3). Optimal ACT activity was reported after 30 min incubation in the assay buffer (Bird and Smith, 1983). It has also been observed that ACT activity in the crude extract increased upon incubation up to 30 min, however, the purified protein did not require preincubation. In contrast a 20% loss in enzyme activity was found after 15 min at 25°C. To retain ACT activity during purification the presence of a mercaptan was found to be essential. At least 1 mM mercaptan was required for optimal activity and there were no differences between 2-mercaptoethanol (2ME) and α-monothioglycerol (αMTG) at a concentration of 10 mM, but activity was reduced by 30% in the presence of dithiothreitol (DTT). Thus, 2ME and αMTG was chosen for purification and activity assays, respectively. A narrow pH optimum at pH 7.5 with half maximal activity at +/- 0.6 pH unit was detected, as previously reported (Bird and Smith, 1983). Optimal activity was achieved using Tris buffer in a concentration range of 50 mM to 100 mM. The purified ACT was not affected by up to 10 mM MgCI₂ or CaCI₂ at pH 7.5, however similar concentrations of MnCI₂, CuS0 or ZnS0₄ reduced ACT activity by 29%, 85% and 99%, respectively. Up to 10% (v/v) ethanol did not affect ACT activity. By comparison, the activity of potato THT was strongly stimulated by Ca²⁺ or Mg²⁺ (Hohlfeld et al., 1995) and the tobacco THT activity was stimulated by ethanol in the incubation mixture (Negrel and Javelle, 1997). Neither of these conditions affected ACT activity. The fact that the presence of Mn²⁺, Cu²⁺ or Zn²⁺ considerably reduced activity, can be explained by the requisite mercaptan which is readily oxidized in the presence of these metals. The maximum ACT activity rate was measured at temperatures between 20°C and 50°C. the temperature optimum lying at about 40°C. From the linear area of an Arrhenius plot the apparent energy of activation was calculated to be 55 kJ mol^"1. The kinetic properties of the purified enzyme are in good agreement with the data previously detected for partially purified barley ACT (Bird and Smith, 1983). Also the molecular native size of about 40 kDa was reported earlier. Example 2: Cloning of cDNAs encoding ACT

N-terminal sequencing of the purified barley ACT

Approximately 20 pmol (1 μg) of the ACT purified to apparent homogeneity was subjected to SDS-PAGE and subsequently electroblotted to a PVDF-membrane. The ca. 50 kDa protein was visualised by Coomassie staining, cut out and sequenced by Edman degradation. Only few pmol of phenylthiohydantoin-derivatives were detectable in the first cycle, indicating that the protein could be partially /V-terminally blocked. The first five amino acids were deduced from this Edman degradation, and a second trial was performed using 0.2 nmol (10 μg) ACT protein. Again the protein appeared partially Λ-terminally blocked, but at this time, the first fifteen amino acids were deducible: MKITVHSSKAVKPEY (SEQ ID NO:5).

Based on the effective yield of amino acid residues obtained by microsequencing, it is estimated that more than 98% of the molecules were blocked for Edman degradation. Initially, no related sequence was found by screening databases. Because the deduced amino acid sequence could represent a minor contamination of an unknown polypeptide as well, it was decided to obtain internal amino acid sequences. However, several new EST clones isolated from etiolated barley seedlings were published recently that showed exact matches with the deduced N- terminal sequence. This prompted the inventors to clone the ACT using the N- terminal sequence obtained.

Detection of three ACT isoforms

It was discovered that ACT purification in which the anion exchange chromatography media RESOURCE Q in step 4 (see Table 1 , above) was replaced with MonoBeads Q resolved ACT activity into three peaks (Fig. 4). Thus, the existence of at least three ACT isoforms in young barley seedlings could be demonstrated. After Superose 12 HR molecular exclusion, all three ACT isoforms showed apparent molecular masses of about 40 kDa. The preparations were used for kinetic studies to compare the three ACT isoforms (Table 2). Cloning of ACT cDNAs from wheat and barley

The /V-terminal peptide sequence from purified barley ACT was found to be identical or highly similar to predicted Λ/-terminal sequences of five barley and one wheat EST clone (ace. no's BF259608, BI959297, BF628198, BI955449, BF619699 and BM137380, respectively). Two nested primers having the nucleotide sequence shown under SEQ ID NOs:11 and 12 were designed to amplify the complete coding region and were used together with lambda phage primers for PCR on phage cDNA libraries from Blumeria graminis-infected leaves from barley and wheat. Two distinct bands of 1115 base pairs and 1187 base pairs were amplified by nested 3' RACE on the barley library. The PCR products were cloned and sequencing of two clones, pHV-ACT5 and pHV-ACT6, showed differences in the 3' non-coding region. Thus, they represent two distinct, partial mRNAs, but both encode a 353 amino acids long C-terminal polypeptide, being practically identical (98%). One-sided nested amplification using the primer with the nucleotide sequence shown under SEQ ID NO:11 and the two vector primers 3' to the cDNA (SEQ ID NOs: 17 and 18) yielded a 1508 base pair product (pHV-ACT5-28-6) that contained the complete coding region of ACT (SEQ ID NO:1 and Figure 1). This clone has 99.8% nucleotide sequence identity to pHV-ACT5 (SEQ ID NO: 19) and 93% sequence identity to pHV-ACT6 (SEQ ID NO:6) in the 3' region. The full-length cDNA predicts a protein of 439 amino acid residues (SEQ ID NO:2 and Figure 1) with a calculated molecular weight of 47584 Da and an isoelectric point at pH 5.04, which is consistent with the properties determined for native barley ACT (see Example 1).

The high nucleotide sequence identity between the full-length pHV-ACT5-28-6 and the partial pHV-ACT5 strongly suggests that they represent identical mRNAs. The expression of the pHV-ACT6-28-6 clone in E. coli resulted in synthesis of highly active ACT protein, strongly suggesting that pHV-ACT6 also encodes an ACT isoform.

A partial sequence was obtained from wheat (pTA-W3) encoding an amino acid sequence being nearly identical (95%) with amino acid residues 87 to 439 of barley ACT. The nucleotide sequence of the partial cDNA insert of pTA-W3 is shown in SEQ ID NO:3 and the corresponding deduced amino acid sequence in SEQ ID NO:4. An alignment of pHV-ACT5-28-6, pTA-W3 and the derived amino acid sequence from a wheat EST clone (ace. no. BM 137380) is shown in Figure 5. A comparison of the deduced amino acid sequence with the amino-terminal sequence of native barley, reveals the absence of an /V-terminal signal peptide in ACT, suggesting a cytosolic localization of the protein. This is in accordance with the purification data of presented herein.

Alignments of the ACT amino acid sequence the in protein family database (Bateman et al., 2002) reveal that ACT belongs to a highly diverse transferase superfamily responsible for CoA-dependent acyl transfer. Several plant transferases within this family have been characterized including HCBT from Dianthus caryophyllus (Yang et al., 1997), deacetylvindoline 4-O-acetyltransferase (DAT, EC 2.3.1.107) from Catharanthus roseus (St-Pierre et al., 1998) and anthocyanin 5-aromatic acyltransferase (5AT, EC 2.3.1.153) from Gentiana triflora (Fujiwara et al., 1998). The barley ACT has a histidine-containing motif, HIVSD (SEQ ID NO: 8) at residue His152. This is identical to the highly conserved motif HXXXD (SEQ ID NO: 9) found in this family. Generally, there is generally a low identity to other characterised plant transferases within this family, but a second consensus sequence, the DFGXG motif (SEQ ID NO:10; St-Pierre ef. al., 1998), can be found in ACT starting at residue Asp385. On the amino acid level pHV-ACT5-28-6 shows 30% identity to carnation HCBT1 (ace. no. CAB06427), 18% identity to pink clove DAT (ace. no. AAC99311) and only 16% to G. triflora 5AT (ace. no. BAA74428). An alignment of the protein sequences of barley pHV-ACT5-28-6 (SEQ ID NO: 2), putative rice HCBT, pink clove DAT, carnation HCBT1 and two putative Arabidopsis HCBTs is presented in Fig. 6, together with a corresponding dendrogram. Barley ACT (pHV-ACT5-28-6) congregates with the other cereal protein in the alignment, the putative rice HCBT to which it shows 37% identity.

The biological function of the hydroxycinnamoylagmatine derivatives is not yet established and ACT activity has hitherto only been detected in the young seedling. Thus it is of major interest that the ACT clones (pHV-ACT5-28-6) and putative ACT EST clones have been isolated from plants infected with fungal pathogens. The ACT clones were obtained from a cDNA library constructed from barley leaves 12 hours after inoculation with an incompatible isolate of Blumeria graminis f.sp. hordei (Bgh). One EST clone (ace. no. BI955449) was isolated from libraries of 7-day-old green leaves of Mla6 resistant barley challenged with an avirulent isolate (5874) of Bgh. Another clone (ace. no. BM137380) was isolated from wheat spikes sprayed at anthesis with Fusarium graminearum. These results suggest that ACT is involved in stress or defence responses of cereals. Putative barley ACT EST clones have also been isolated from roots (ace. no. BF259608) and rachises (ace. no. BI959297), which indicate that ACT is widely distributed in the plant.

Example 3: Heterologous expression of barley ACT in E. coli and characterization of the expression product

Expression of ACT in E. Coli

The expression construct pET-ACT contains the barley ACT5 cDNA in the expression vector pET15b and encodes ACT (SEQ ID NO: 2) with additional 20 amino acids to the /V-terminus of ACT. These 20 amino acids include a six-histidine affinity purification tag and a thrombin protease cleavage site to remove 16 of the 20 extra amino acids. The expression construct and the empty vector pET15b was transformed into BL21 CodonPlus (DE3) RIL cells which harbor additional copies of rare tRNA genes. Expression of soluble ACT was first attempted at an induction temperature of 37°C for 3 hours. At this temperature moderate levels of activity were found in the soluble pET-ACT extract and no activity was detected in the control extract. SDS-PAGE analysis of total cellular protein did show the accumulation of a ca. 50 kDa protein in the induced pET-ACT but not in the un-induced pET-ACT or in the control culture (not shown). This size corresponds to the calculated molecular weight at 49635 Da for the recombinant ACT including the His-tag and the protease site. Reducing the temperature to 28°C during induction by IPTG increased the amount of soluble recombinant enzyme produced. The recombinant ACT was affinity-purified (Fig. 7) and used for kinetic comparison to ACT purified from barley.

Substrate specificity and kinetics of native and bacterially expressed ACT

The three ACT isoforms purified from barley seedlings all showed very similar affinities (K_m) and substrate specificities (V/K_m) towards the individual tested hydroxycinnamoyl-CoAs, all showing highest specificity for coumaroyl-CoA. Only ACT3 differed slightly in that the specificity for feruloyl-CoA and caffeoyl-CoA was more than double of that detected for ACT1 and ACT2. The affinity for the acyl acceptor was also very similar between the native isoforms and highly specific for agmatine. In addition to agmatine, tyramine and putrescine were tested as acceptors for coumaroyl-CoA, but no activity could be detected. These kinetic data are in close proximity to what was found for the partially purified ACT (Bird and Smith, 1983).

Table 2. The affinity and substrate specificity of native and recombinant hydroxycinnamoyl- CoA:agmatine Λ/-hydroxycinnamoyl-transferase (ACT).

ACT1^a ACT2 ^a ACT3 ^a rACT^b

Km v/ κ_m K_m κ_m K_m v/ κ_m κ_m V/ Km

Substrate (μM) (%) (μM) (%) (μM) (%) (μM) (%)

Donors ° p-Coumaroyl-CoA 1.0 100 2.1 100 1.6 100 2.1 100

Feruloyl-CoA 6.1 14 4.1 18 1.7 58 6.6 13

Caffeoyl-CoA 5.8 6 4.3 7 5.3 17 4.3 8

Acceptor⁰

Agmatine 5.2 - 6.5 - 5.2 - 8.1 -

^a ACT1 , ACT2 and ACT3 from barley seedlings represent the three native ACT isoforms are separated during anion exchange as illustrated in Fig. 4. The number (ACTx) indicates the sequence in which the individual isoforms were eluted. ^b Recombinant ACT (rACT) expressed in E. coli and subsequently affinity purified. ^c p-Coumaroyl-CoA and agmatine were used as the common acyl donor and acyl acceptor, respectively.

The kinetic properties of the bacterially expressed ACT were very similar to the native ACT isoforms, in particular when compared to those of ACT2 (Table 2). The specific activity (189 nkatxmg^"1 protein) of the affinity-purified recombinant enzyme was, however, 6-fold of that detected for the native ACT purified to apparent homogeneity. In summary, the three characterised ACT isoforms all show highest specificity for p- coumaroyl-CoA as the acyl donor and no detectable activity using acyl acceptors other than agmatine. This specificity for the acyl acceptor has also been reported for the purified carnation HCBT, which only shows activity in the presence of anthranilate (Yang et al., 1997). In contrast, purified PHT and THT have been reported to be much broader in substrate specificity concerning acyl acceptors (Negrel et al., 1992; Hohlfeld et al., 1995; Negrel and Javelle, 1997).

The recombinant ACT showed a 6-fold specific activity of the native protein. This could indicate that ACT loses some activity during purification or that the purified protein is contaminated. The specific activity of previously purified /V-hydroxycinnamoyltransferases is in the range of 70 to 210 nkatxmg^"1 protein (Hohlfeld et al., 1996; Negrel and Javelle, 1997; Yang et al., 1997; Yu and Facchini, 1999) which is in close proximity of what was found for both native and recombinant ACT.

Chemical modification of ACT

Diethylpyrocarbonate (DEPC) is known to be a reasonably selective reagent for histidine residues, thus causing inactivation of enzymes involving histidine in the active site. Activity of the recombinant ACT decreased by about 90% upon 5 min incubation with 1 mM DEPC. Loss of activity could be a matter of denaturation, but the decrease in ACT activity was substantially reduced if ACT was preincubated for 5 min with one of the substrates before incubating with DEPC (Fig. 8), additionally supporting the presence of one or more DEPC-sensitive residues in the active site of ACT.

The ACT isolated in connection with the present invention defines a new class of proteins belonging to a superfamily of acyltransferases with very diverse biological functions. Several plant transferases have been characterised within this superfamily and two consensus sequences seem to be highly conserved within these plant transferases. The common motif HXXXD (SEQ ID NO:.9) can be found throughout this superfamily. Single-site mutation of the motif histidine indicates that it is a part of the active site of the dihydrolipoamide S-acyltransferase (Brown et al., 1994). Chemical modification of ACT using the histidine reactive DEPC suggests that a histidine is important for the catalytic mechanism of ACT, which is further emphasised by the substrate preincubation of ACT that considerably decrease the effect of DEPC. The second consensus sequences, the DFGXG (SEQ ID NO:.10), is located in the /V-termini of the transferases, but no function has yet been assigned to this motif. Example 4: Transgenic plants over-producing ACT

In order to analyze the effects of ACT expression on the plant phenotype and the utility of the ACT enzyme to plants transgenic plants can be constructed that over- express the ACT of the invention. It is expressed that accumulation of ACT products in the plant and particularly in the cell wall renders the plant more resistant to pathogen attack (von Rόpenack et al. 1998). The precursors for hydroxycinnamoylagmatines and hordatines, namely hydroxycinnamoyl-CoAs and agmatine are ubiquitous in plants. Manipulating the metabolism of these compounds creates metabolic sinks for both the phenyl-propanoid and the polyamine biosynthetic pathways. That such an interference will not be harmful to the plant can be derived from the fact that, it is known that the phenyl-propanoid pathway has a large plasticity (Whetten et al. 1998), and that the level of free agmatine has been altered in ArgDC transgenic plants without negative effects (Burtin and Michael 1997). The recipients for the ACT-encoding transgene, Brachypodium distachyon and Arabidopsis tha/iana, are model monocot and dicot species for functional genomics (Draper et al. 2001) because both have small genomes. A DNA construct needs to be made for each of the two plant species. For Arabidopsis, the Invitrogen Gateway technology (US 5,888,732) will be utilised to assure rapid progress and binary vectors for Agrobacterium mediated transformation may be carried out by the floral dip method as described in Clough (Plant J. 16 (1998), 735-743). For instance, the binary vector pK2GW7 may be used containing the CaMV 35S promoter to direct expression of the ACT. For transformation of B. distachyon the co-bombardment procedure is used applying a DuPont PDS 1000 Helium Biolistic Delivery System (BioRad) similar to a procedure developed for barley (Wan, Plant Physiol. 104 (1994), 37-48) and ACT will be cloned into a simple expression cassette containing the ubiquitin promoter from maize and the Agrobacterium NOS terminator. The transgenic plants may be selected using kanamycin for Arabidopsis and Basta/bialaphos for Brachypodium. Integration of the ACT gene may be analysed by PCR with gene specific primers and Southern blots for copy number quantification. Expression of ACT may be analysed on the translational level by activity measurements, Western blots using polyclonal antibodies currently being generated and on the transcriptional level by Northern blots or RT-PCR. Plants expressing ACT may be tested for increased penetration resistance towards powdery mildew isolates or other fungi known to be virulent on Arabidopsis and Brachypodium. The accumulation of polymerised hydroxycinnamoylagmatines and hordatines in the attacked cell wall may be followed by the specific Sakaguchi stain (Wei et al. (1994)).

CITED LITERATURE

References

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acid Res 25: 3389-3402.

Back K, Jang SM, Lee B-C, Schmidt A, Strack D, Kim KM (2001) Cloning and characterisation of a hydroxycinnamoyl-CoA:tyramine N-

(hydroxycinnamoyl)transferase induced in response to UV-C and wounding from Capsicum annuum. Plant Cell Physiol 42: 475-481.

Bateman A, Birney E, Cerruti L, Durbin R, Etwiller L, Eddy SR, Griffiths-Jones S, Howe KL, Marshall M, Sonnhammer EL (2002) The Pfam protein families database. Nucleic Acids Research 30: 276-280.

Bernards MA (2002) Demystifying suberin. Can J Bot 80: 227-240

Bernards MA, Lewis NG. (1998) The macromolecular aromatic domain in suberized tissue: A changing paradigm. Phytochemistry 47: 915-

Bird CR, Smith TA (1984) Agmatine metabolism and hordatine formation in barley seedlings. Ann Bot 53: 483-488.

Bird CR, Smith TA (1981) The biosynthesis of coumaroylagmatine in barley seedlings. Phytochemistry 20: 2345-2346.

Bird CR, Smith TA (1983) Agmatine coumaroyltransferase from barley seedlings. Phytochemistry 22: 2401-2403.

Brown NF, Anderson RC, Caplan SL, Foster DW, McGarry JD (1994) Catalytically important domains of rat carnitine palmitoyltransferase II as determined by site- directed mutagenesis and chemical modification. J Biol Chem 269: 19157-19162.

Croteau R, Kutchan TM, Lewis NG (2000) Natural products (secondary metabolites). In Buchanan BB, Gruissem W, Jones RL (eds) Biochemistry and molecular biology of plants. American Society of Plant Physiologists, MD, pp 1250-1318.

Dixon RA (2001) Natural products and plant disease resistance. Nature 411: 843-847.

Farmer MJ, Czernic P, Michael A, Negrel J (1999) Identification and characterization of cDNA clones encoding hydroxycinnamoyl-CoA:tyramine N- hydroxycinnamoyltransferase from tobacco. Eur J Biochem 263: 686-694.

Fujiwara H, Tanaka Y, Yonekura-Sakakibara K, Fukuchi-Mizutani M, Nakao M, Fukui Y, Yamaguchi M, Ashikari T, Kusumi T (1998) cDNA cloning, gene expression and subcellular localization of anthocyanin 5-aromatic acyltransferase from Gentiana triflora. Plant J 16: 421-431.

Grandmaison J, Olah GM, Van Calsteren MR, Furlan V (1993) Characterization and localization of plant phenolics ikely involved in the pathogen resistance expressed by endomycorrhizal roots. Mycorrhiza 3: 155-164.

Hammerschmidt R (1999) Phytoalexins: what have we learned after 60 years? Annu Rev Phytopathol 37:285-306.

Hohlfeld H, Scheel D, Strack D (1996) Purification of hydroxycinnamoyl-CoA: tyramine hydroxycinnamoyltransferase from cell-suspension cultures of Solanum tuberosum L. cv. Datura. Planta 199: 166-168.

Hohlfeld H, Schϋrmann W, Scheel D, Strack D (1995) Partial purification and characterisation of hydroxycinnamoyl-coenzyme A:tyramine hydroxycinnamoyltransferase from cell suspension cultures of Solanum tuberosum. Plant Physiol 107: 545-552. Jin S, Yoshida M (2000) Antifumgal compound, feruloylagmatine, induced in winter wheat exposed to a low temperature. Biosci Biotechnol Biochem 64: 1614-1617.

Lee D, Douglas CJ (1996) Two divergent members of a tobacco 4- coumarate:coenzyme A ligase (4CL) gene family. Plant Physiol 112: 193-205.

Lee J, Vogt T, Schmidt J, Parthier B, Lόbler M (1997) Methyljasmonate-induced accumulation of coumaroyl conjugates in barley leaf segments. Phytochemistry 44: 589-592.

Ludwig RA, Spencer EY, Unwin CH (1960) An antifungal factor from barley of possible significance in disease resistance. Can J Bot 38:21-29.

McLusky SR, Bennett MH, Beale MH, Lewis MJ, Gaskin P, Mansfield JW (1999) Cell wall alterations and localized accumulation of feruloyl-3'-methoxytyramine in onion epidermis at sites of attempted penetration by Botrytis allii are associated with actin polarisation, peroxidase activity and suppression of flavonoid biosynthesis. Plant J 17: 523-534.

Meng H, Campbell WH (1997) Facile enzymatic synthesis of caffeoyl-CoA. Phytochenistry 44: 605-608.

Morrissey JH (1981) Silver stain for proteins in polyacrylamide gels: A modified procedure with enhanced uniform sensitivity. Anal Biochem 117: 307-310.

Negrel J, Javelle F (1997) Purification, characterization and partial amino acid sequencing of hydroxycinnamoyl-CoA:tyramine Λ/-(hydroxycinnamoyl)transferase from tobacco cell-suspension cultures. Eur J Biochem 247: 1127-1135.

Negrel J, Paynot M, Javelle F (1992) Purification and properties of putrescine hydroxycinnamoyl transferase from tobacco (Nicotiana tabacum) cell suspensions. Plant Physiol 98: 1264-1269. Negrel J, Pollet B, Lapierre C (1996) Ether-linked ferulic acid amides in natural and wound periderms of potato tuber. Phytochemistry 43: 1195-1199.

Niemann GJ (1993) The anthranilamide phytoalexins of the caryophyllaceae and related compounds. Phytochemistry 34: 319-328.

Ogura Y, Ishihara A, Iwamura H (2001) Induction of hydroxycinnamic acid amides and tryptophan by jasmonic acid, abscisic acid and osmotic stress in barley leaves. Z Naturforsch C 56: 193-202.

Osbourn AE (1996) Preformed antimicrobial compounds and plant defense against fungal attack. Plant Cell 8:1821-1831.

Pearce G, Marchand PA, Griswold J, Lewis NG, Ryan CA (1998) Accumulation of feruloyltyramine and p-coumaroyltyramine in tomato leaves in response to wounding. Phytochemistry 47: 659-664.

Peipp H, Maier W, Schmidt J, Wray V, Strack D (1997) Abruscular mycorrhizal fungus-induced changes in the accumulation of secondary compounds in barley roots. Phytochemistry 44: 581-587.

Schmidt A, Grimm R, Schmidt J, Scheel D, Strack D, Rosahl S (1999) Cloning and expression of a potato cDNA encoding hydroxycinnamoyl-CoA:tyramine N- (hydroxycinnamoyl)transferase. J Biol Chem 274: 4273-4280.

Smith TA, Best GR (1978) Distribution of the Hordatines in barley. Phytochemistry 17: 1093-1098.

St-Pierre B, Laflamme P, Alarco AM, De Luca V (1998) The terminal O-acetyltransferase involved in vindoline biosynthesis defines a new class of proteins responsible for coenzyme A-dependent acyl transfer. Plant J 14: 703-713. Stoessl A (1965) The antifungal factors in barley - III. Isolation of p- coumaroylagmatine. Phytochemistry 4: 973-976.

Stoessl A (1966) The antifungal factors in barley - Isolation and synthesis of hordatine A. Tetrahedron Lett 7: 2849-2851.

Stoessl A (1967) The antifungal factors in barley. IV. Isolation, structure, and synthesis of the hordatines. Can J Chem 45: 1745-1760.

Stoessl A (1970) Antifungal compounds produced by higher plants. Recent Adv Phytochem 3: 143-180.

Stoessl A, Unwin CH (1970) The antifungal factors in barley. V. Antifungal activity of the hordatines. Can J Bot 48: 465-470.

Stόckigt J, Zenk MH (1975) Chemical syntheses and properties of hydroxycinnamoyl- coenzyme A derivatives. Z Naturforsch C 30: 352-358.

VanEtten HD, Mansfield JW, Bailey JA, Farmer EE (1994) Two classes of plant antibiotics: phytoalexins versus „phytoanticipins". Plant Cell 6:1191-1192.

von Rόpenack E, Parr A, Schulze-Lefert P (1998) Structural analysis and dynamics of soluble and cell wall-bound phenolics in a broad spectrum resistance to the powdery mildew fungus in barley. J Biol Chem 273: 9013-9022.

Wei YD, de Neergaard E, Thordahl-Christensen H, Collinge DB, Smedegaard- Petersen V (1994) Accumulation of putative guanidine compound in relation to other early defence reactions in epidermal cells of barley and wheat exhibiting resitance to Erysiphe graminis f.sp. hordei. Physiol Mol Plant Pathol 45: 469-484.

Yang Q, Reinhard K, Schiltz E, Matern U (1997) Characterization and heterologous expression of hydroxycinnamoyl/benzoyl-CoA:anthranilate N-hydroxycinnamoyl/ benzoyltransf erase from elicited cell cultures of carnation, Dianthus caraphyllus L. Plant Mol Biol 35: 777-789.

Yu M, Facchini PJ (1999) Purification, characterization, and immunolocaiization of hydroxycinnamoyl-CoA:tyramine /V-(hydroxycinnamoyl)transferase from opium poppy. Planta 209: 33-44.

Claims

1. A polynucleotide selected from the group consisting of

(a) polynucleotides comprising a nucleotide sequence encoding a polypeptide with the amino acid sequence of SEQ ID NO:2;

(b) polynucleotides comprising the coding region of the nucleotide sequence shown in SEQ ID NO:1 ;

(c) polynucleotides comprising a nucleotide sequence encoding a fragment of the polypeptide encoded by a polynucleotide of (a) or (b), wherein said nucleotide sequence encodes a polypeptide having agmatine coumaroyltransferase (ACT) activity;

(d) polynucleotides comprising a nucleotide sequence having a sequence identity of at least 60% with a polynucleotide of any one of (a) to (c) and encoding a polypeptide having ACT activity;

(e) polynucleotides comprising a nucleotide sequence the complementary strand of which hybridizes to the polynucleotide of any one of (a) to (c), wherein said nucleotide sequence encodes a polypeptide having ACT activity; and

(f) polynucleotides comprising a nucleotide sequence that deviates from the nucleotide sequence defined in (e) by the degeneracy of the genetic code.

2. The polynucleotide of claim 1 which is DNA or RNA.

3. A recombinant nucleic acid molecule comprising the polynucleotide of claim 1 or 2.

4. The recombinant nucleic acid molecule of claim 3 further comprising expression control sequences operably linked to said polynucleotide.

5. A vector comprising a polynucleotide of claim 1 or 2 or the recombinant nucleic acid molecule of claim 3 or 4.

6. The vector of claim 5 further comprising expression control sequences operably linked to said polynucleotide.

7. A method for producing genetically engineered host cells comprising introducing the polynucleotide of claim 1 or 2, the recombinant nucleic acid molecule of claim 3 or 4 or the vector of claim 5 or 6 into a host cell.

8. A host cell which is genetically engineered with the polynucleotide of claim 1 or 2, the recombinant nucleic acid molecule of claim 3 or 4 or the vector of claim 5 or 6 or obtainable by the method of claim 7.

9. The host cell of claim 8 which is a bacterial, yeast, fungus, plant or animal cell.

10. A method for the production of a polypeptide encoded by a polynucleotide of claim 1 or 2 in which the host cell of claim 8 or 9 is cultivated under conditions allowing for the expression of the polypeptide and in which the polypeptide is isolated from the cells and/or the culture medium.

11. A polypeptide encoded by the polynucleotide of claim 1 or 2 or obtainable by the method of claim 10.

12. An antibody specifically recognizing the polypeptide of claim 11.

13. A nucleic acid molecule specifically hybridizing with the polynucleotide of claims 1 or 2; with the proviso that said nucleic acid molecule does not have the nucleotide sequence shown in any one of the GeneBank database entries having the accession nos. BF259608, BI959297, BF628198, BI955449, BF619699 and BM137380.

14. A method for producing a transgenic plant comprising the steps of

(a) introducing the polynucleotide of claim 1 or 2, the recombinant nucleic acid molecule of claim 3 or 4 or the vector of claim 5 or 6 into the genome of a plant cell; and (b) regenerating the cell of (a) to a transgenic plant.

15. A transgenic plant or plant tissue comprising the plant cells of claim 9 or obtainable by the method of claim 14.

16. A transgenic or mutant plant which shows an increased activity of the polypeptide encoded by the polynucleotide of claim 1 or 2 compared to a corresponding wild-type plant.

17. A transgenic or mutant plant which shows a reduced activity of the polypeptide encoded by the polynucleotide of claim 1 or 2 compared to a corresponding wild-type plant.

18. The transgenic or mutant plant of claim 15 or 16 which, upon an increased activity of the protein encoded by the polynucleotide of claim 1 or 2 compared to a corresponding wild-type plant, shows an increased resistance against a plant pathogen to which a corresponding wild-type plant is susceptible.

19. The transgenic or mutant plant of any one of claims 15 to 17 which, upon an altered activity of the protein encoded by the polynucleotide of claim 1 or 2 compared to a corresponding wild-type plant, shows an altered composition of cell wall polymers as compared to a corresponding wild-type plant.

20. Propagation material or harvestable parts of the transgenic plant of any one of claims 15 to 19 comprising plant cells of claim 9.

21. A method for conferring pathogen resistance or increased pathogen resistance to a plant comprising the step of providing a transgenic or mutant plant in which the activity of the polypeptide encoded by the polynucleotide of claim 1 or 2 is increased compared to a corresponding wild-type plant.

22. A method for modifying the properties of cell wall polymers in a plant comprising providing a transgenic or mutant plant in which the activity of a protein encoded by the polynucleotide of claim 1 or 2 is increased or reduced compared to a corresponding wild-type plant.

23. A method for producing an antimicrobial compound or a precursor thereof comprising

(a) incubating the polypeptide of claim 11 with agmatine and a p- hydroxycinnamoyl-CoA under conditions that said polypeptide is active; and

(b) recovering the antimicrobial compound or precursor thereof from the incubation mixture.

24. A method for producing an antimicrobial compound or a precursor thereof comprising

(a) culturing the host cell of claim 8 or 9 in the presence of the compounds agmatine and a p-hydroxycinnamoyl-CoA under conditions allowing for the expression of the polypeptide encoded by the polynucleotide of claim 1 or 2 and allowing for condensation of said compounds to take place; and

(b) recovering the antimicrobial compound or precursor thereof from the cells and/or the culture medium.

25. The method of claim 23 or 24 further comprising

(c) reacting the compound or precursor thereof recovered in step (b) so that dimerisation takes place.

26. A method for preparing a plant protection composition comprising the steps of the method of any one of claims 23 to 25 and furthermore the step of formulating the antifungal compound or precursor thereof in a form suitable for administering to plants.

27. A method for producing a biopolymer comprising the step of extracting cell wall polymers from the transgenic or mutant plant of claim 19.

28. A biopolymer obtainable by the method of claim 27.

29. Use of the polynucleotide of claim 1 or 2, of the recombinant nucleic acid molecule of claim 3 or 4, of the vector of claim 5 or 6, of the host cell of claim 8 or 9, of the polypeptide of claim 11 , of the antibody of claim 12 or of the transgenic or mutant plant of any one of claims 14 to 16 for the preparation of an antimicrobial compound, a precursor thereof or a plant protection composition.

30. Use of the polynucleotide of claim 1 or 2, of the recombinant nucleic acid molecule of claim 3 or 4, of the vector of claim 5 or 6, of the host cell of claim 8 or 9, of the polypeptide of claim 11 , of the antibody of claim 12 or of the transgenic or mutant plant of any one of claims 14 to 16 for establishing or enhancing a pathogen resistance in a plant.

31. Use of the polynucleotide of claim 1 or 2, of the recombinant nucleic acid molecule of claim 3 or 4, of the vector of claim 5 or 6, of the host cell of claim 8 or 9, of the polypeptide of claim 11 , of the antibody of claim 12 or of the transgenic or mutant plant of any one of claims 14 to 17 for producing a biopolymer.