WO2004043992A2 - Imaging protein-protein interactions in living subjects - Google Patents

Abstract

Methods for imaging protein-protein interactions in living animals and in cell culture and for the study of protein-protein interactions in cells maintained in their natural in vivo environment are disclosed. Also disclosed are methods for the in vivo evaluation of new pharmaceuticals targeted to modulate protein-protein interactions. Fig. 1 is a schematic diagram of the inducible yeast two-hybrid (IY2H) system for imaging the interaction of proteins X and Y.

Description

IMAGING PROTEIN-PROTEIN INTERACTIONS IN LIVING SUBJECTS

BACKGROUND OF THE INVENTION

Cytosolic and cell surface protein-protein interactions play major roles in normal cellular functions and biological responses, hi particular, many cytosolic and cell surface protein-protein interactions are involved in disease pathways. For example, attacks by pathogens such as viruses and bacteria on mammalian cells typically begin with interactions between viral or bacterial proteins and mammalian cell surface proteins. In addition, many protein-protein interactions between factors in the transcriptional machineries are also valuable drug targets. Protein-protein interactions are also involved, for example, in the assembly of enzyme subunits; in antigen-antibody reactions; in forming the supramolecular structures of ribosomes, filaments, and viruses; in transport; and in the interaction of receptors on a cell with growth factors and hormones. Products of oncogenes can give rise to neoplastic transformation through protein-protein interactions. Systems of identifying compounds capable of modulating protein-protein interactions have been developed for in vitro systems. One such method is directed towards the use of DNA inteins, which are peptide sequences capable of directing protein trans-splicing both in vivo and in vitro (see U.S. Patent No. 6,551,786). An intein is an intervening protein sequence in a protein precursor that is excised from the protein precursor during protein splicing.

While methods have been developed that can determine protein-protein interactions in vitro, adapting these assays to in vivo conditions has required significant effort. These methods include detection using positron emission tomography (PET), single photon emission computed tomography, magnetic resonance imaging, and/or fluorescence optical imaging with green fluorescent protein (GFP).

Many of these methods are derived from yeast two-hybrid systems. In a typical two- hybrid assay, a known protein that forms part of a DNA-binding domain is screened against a library of all possible proteins present as transcriptional activation domain hybrids. A positive result is characterized by the expression of a reporter gene that can confer a selective quality to the cell (e.g. survival on minimal media), or the ability to visualize positive results by using luciferase or GFP as the reporter protein.

Constitutively expressing viral promoters do provide for higher reporter gene expression, however tissue-specificity has been difficult to achieve. The use of weaker, more specific promoters limits the ability to detect the reporter gene expression in vivo. Tissue- specific promoters are very useful in vivo to limit expression of potentially cytotoxic transgenes to the tissue of interest. There are several methods of increasing levels of reporter protein, including the use of chimeric promoters that retain tissue-specificity, enhancement at the post-transcriptional level, or a two-step transcriptional amplification (TSTA). TSTA involves tissue-specific expression of the GAL4-NP16 fusion protein, which in turn drives reporter gene expression regulated by GAL4 minimal promoters (Iyer et al., 2001).

An efficient in vivo assay system based on an easily detectible signal, such as an optical signal, which allowed assessment of protein-protein interactions in living organisms or cells would thus have great potential for screening therapeutic agents implicated in facilitating or disturbing protein-protein interactions associated with various diseases and pathologies.

SUMMARY OF THE INVENTION h one aspect of the present invention, a yeast two-hybrid system is used, such that when two proteins of interest interact within the organism of interest, a reporter gene is activated to produce a signal detectable outside of the animal. See, for example, FIG. 1, for a schematic diagram of one such system. h another aspect of the invention, a reporter protein is split into two portions, each of which is silent until brought into contact with the other. Each portion of the reporter is linked to one of the two proteins of interest such that the two portions are brought together to become functional if and only if the two proteins of interest interact. See, for example, FIG.

6 for a schematic diagram of two such systems, a complementation approach (FIG. 6A) and a reconstitution approach (FIG. 6B). In another aspect of the present invention, protein-protein interactions in living animals are measured to determine the efficacy of drugs administered to modulate or block the protein-protein interaction.

In another aspect of the present invention, drugs targeting protein-protein interactions may be optimized by administering the drugs to living animals having the protein-protein interaction system of the present invention, monitoring any resultant signal change, and selecting drugs producing the desired response.

Yet another aspect of the present invention is directed to the use of the disclosed protein-protein interaction assay to monitor and assess signal transduction in living animals, i still another aspect of the present invention, the disclosed protein-protein interaction assay is used to monitor and assess protein-protein interaction during development in a transgenic animal. f another aspect of the present invention, a cell line or transgenic animal is marked with vector sets developed utilizing coding regions for the two proteins of interest, followed by optical imaging to quantitate protein-protein interaction in the presence and absence of pharmaceuticals designed to modulate the interaction. As will be appreciated by the skilled practitioner, this technique will significantly accelerate drug validation by allowing testing in vivo. These and other objects and features of the invention will be more fully appreciated when the following detailed description of the invention is read in conjunction with the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Schematic diagram of the IY2H system for imaging the interaction of proteins X and Y. The first step involves the vectors pA-gal4-x and pB-vpl6-y, which are used to drive transcription of gal4-x and vpl6-y through use of promoters A and B. In the second step, the two fusion proteins GAL4-X and VP16-Y interact because of the specificity of protein X for protein Y. Subsequently, GAL4-X-Y-VP16 binds to GAL4-binding sites [five GAL4-binding sites (bs) are available] on a reporter template. This leads to VP16- mediated transactivation of firefly luciferase reporter gene expression under the control of GAL4 response elements in a minimal promoter. Transcription of the firefly luciferase reporter gene leads to firefly luciferase protein, which, in turn, leads to a detectable visible light signal in the presence of the appropriate substrate (D-luciferin), ATP, Mg²⁺, and oxygen. Here, an inducible IY2H system is shown while using the NF-κB promoter for either pA or pB and TNF-α-mediated induction. The use of the IY2H system allows indirect monitoring of protein-protein interactions through VP16-mediated transactivation of a reporter gene.

FIG. 2. (A) IY2H system-mediated /? expression. 293T cells were transiently transfected with (i) PA+PB+PR, (ii) PA+PD+PR, and (Hi) PB+PC+PR. After 24 h in the absence and presence of TNF-α, the cells were harvested and assayed for FL activity. RLU, relative light units. Error bars represent SEM for triplicate measurements. (B) IY2H system with interacting and noninteracting protein partners. (Note logarithmic scale for v axis.) 239T cells were transiently transfected with plasmids (i) PC+PD+PR (interacting protein partners) and (ii) PD+PF+PR (noninteracting protein partners). After 24 h, the cells were harvested and assayed for FL activity. Error bars represent SEM for triplicate measurements. (C) Control cell culture studies. 293T cells were transiently transfected with (i) PR alone, (t PA+PR, (Hi) PB+PR, and (rv) PE alone. After 24 h in the absence and presence of TNF- α, the cells were harvested and assayed for FL activity. (Note logarithmic scale for y axis.) Error bars represent SEM for triplicate measurements.

FIG, 3. (A) Effect of TNF-α concentration on fl expression. 293T cells were transiently transfected with plasmids PA+PB+PR. The cells were harvested 24 h after transfection in the presence of different concentrations of TNF-α and assayed for FL activity. Error bars represent SEM for triplicate measurements. (B) Effects of TNF-α exposure time on_/Z expression. 293T cells were transiently transfected with plasmids PA+PB+PR. After a fixed time period of exposure to 0.05 g/ml TNF-α, the cells were harvested and assayed for FL activity. Error bars represent SEM for triplicate measurements. FIG. 4. In vivo optical CCD imaging of mice carrying transiently transfected

293T cells for induction of the yeast two-hybrid system. All images shown are the visible light image superimposed on the optical CCD bioluminescent image with a scale in photons/sec per cm² per steradian (sr). Mice are imaged in a supine position 5 min after injection of D-luciferin. A) A nude mouse was imaged repetitively after being implanted with 293T cells transiently transfected with plasmids PA+PB+PR, and the mouse did not receive any TNF-α. There is some minimal gain in signal from the peritoneum over 30 h. Some other mice did show higher signals at later times. (B) A different nude mouse was imaged repetitively after being implanted with 293T cells transiently transfected with plasmids PA+PB+PR with TNF-α administration immediately after obtaining each image. There is a marked gain in signal from the peritoneum over 30 h. Note that the cells disperse from time 20 to 30 h, so the signal appears to come from a larger region. This particular mouse did not show as high a level of induction as other mice and showed induction relatively later at 20 h as opposed to other mice, which first showed induction at 8 h.

FIG. 5. Comparison of mice-imaging data with and without TNF-α induction. Mean [maximum (photons/sec per cm² per sr)] in six induced mice and four uninduced mice as a function of time. (Note logarithmic scale for axis.) All mice had i.p. injection of 1 x 10⁶ 293T cells transiently transfected with plasmids PA+PB+PR. The induced group shows a significantly greater signal (P < 0.05) at 8, 20, and 30 h as compared with preinduction levels at time 0. The induced group shows a significantly greater (P < 0.05) signal at 8 h as compared with the uninduced group. At 0 h, there is no significant difference between the induced and uninduced groups. Error bars represent SEM.

FIG. 6. Schematic diagram of two strategies for using split reporters to monitor protein-protein interactions. (A) Complementation mediated restoration of firefly luciferase activity. N-terminal half of firefly luciferase is attached to protein X through a short peptide FFAGYC and C-terminal half of firefly luciferase is connected to protein Y through the peptide CLKS. Interaction of protein X and Y recovers Flue activity through protein complementation. (B) Split Intein (DnaE) mediated protein splicing leads to firefly luciferase reconstitution. The N-terminal half of firefly luciferase is connected to N- terminal half of DnaE (DnaE-n) with peptide FFAGYC. The N-terminal half of DnaE in turn connected to protein X. Similarly C-terminal half of firefly luciferase is connected to the C- terminal half of DnaE (DnaE-c) with peptide CLKS, and the C-terminal of intein is in turn connected to protein Y. The interaction of proteins X and Y mediates reconstitution through splicing of the N and C halves of DnaE.

FIG. 7. Schematic representation of the plasmid constructs made and used in this study. Shown on top of each bar are the parts of genes (Nfluc, N-terminal half of firefly luciferase; Cfluc, C-terminal half of firefly luciferase; flue, firefly luciferase; DnaE-n, N- terminal half of intein DnaE; DnaE-c, C-terminal half of intein DnaE; MyoD, cDNA sequence of amino acids 1-318 of myogenic regulatory protein; Id, cDNA sequence of a ino acids 29-148 of negative regulatory protein of myogenic differentiation; p53, amino acids 72- 390 of murine p53 gene) and promoter sequences (cmv, cytomegalovirus promoter; NFKB promoter).

FIG. 8. (A) Complementation based split-luciferase activity in transiently transfected 293T cells. 293T cells were transiently transfected with plasmid constructs PQ, PDi, PIi (only parts of firefly luciferase), PCi plus PDi (complementation), PDi plus PIi (no interaction) and PKi (full firefly luciferase). The cells were harvested after 24 hrs and assayed for Flue activity. The relative light unit (RLU) per microgram of protein is represented. Error bars represent SEM for triplicate measurements. (B) Reconstitution of split-luciferase in transiently transfected 293T cells. 293T cells were transiently transfected with plasmid constructs PEi, PF], PJi (only parts of firefly luciferase), PEi plus PFi (reconstitution), PFi plus PJj (no interaction) and PKi (full firefly luciferase). The cells were harvested after 24 hrs and assayed for Flue activity. The RLU per microgram of protein is represented. Error bars represent SEM for triplicate measurements. (C) Western blot of protein extracts from transient transfection studies in 293T cells. The protein band of ~80 kDa was detected only in the cells transfected with both PEi and PFi (reconstitution) or PKi, and not from other studies in which the full Flue protein was not recovered. FIG. 9. Effect of TNF-α on activation of flue expression. (A) Complementation strategy. 293T cells were transiently transfected with plasmids P , PD_ls PGi, PDi plus PGi, PCi plus PDi. The cells were harvested after 24 hrs in the presence or absence of TNF- and assayed for Flue activity. The relative light units (RLU) per microgram of protein was estimated and compared for the induction. The cells transfected with plasmid constructs PGi and PDi plus PGi carrying NFKB promoter/enhancer elements showed significant increase upon TNF-α induction. The cells transfected with plasmid constructs PCi plus PDi carrying CMV promoter showed significant increase upon TNF-α induction, but was significantly less than the constructs carrying NFKB promoter/enhancer elements. (B) Reconstitution Strategy. 293T cells transiently transfected with plasmids PEi, PFi, PH_ls PEi plus PFi and PF] plus PHi were harvested after 24 hrs in the presence and absence of TNF- α and assayed for Flue activity. The relative light units (RLU) per microgram of protein was estimated and compared for the induction. The cells transfected with plasmid constructs PHi and PFi plus PHi carrying NFKB promoter/enhancer elements showed significant increase in flue expression upon TNF-α induction. The cells transfected with plasmid constructs PEi plus PFi carrying CMV promoter also showed significant increase upon induction, but was significantly less than the cells transfected with plasmid constructs carrying NFKB promoter/enhancer elements. FIG. 10. In vivo optical CCD imaging of mice carrying transiently transfected

293T cells for induction of the complementation based split-luciferase system. All images shown are the visible light image superimposed on the optical CCD bioluminescence image with a scale in photons/sec/cm²/steridian (sr). Mice were imaged in a supine position after intraperitoneal injection of D-Luciferin. (A) Set of nude mice were repetitively imaged after subcutaneous implantation of 293T cells transiently transfected with plasmids PDi (site B), PGi (site C), PDi plus PGi (site D), and mock transfected cells (site A). One group of mice was induced with TNF- α and the other group was not induced. Images are from one representative mouse from each group immediately after implanting cells (0 hrs), 18 hrs and 36 hrs after TNF-α. induction. The induced mouse showed higher Flue signal at site D when compared to the mouse not receiving TNF-α. The Flue signal significantly increases after receiving TNF-α. (B). Graphs showing the uninduced (top graph) and induced (bottom graph) group with mean values across 6 mice from each group. The error bars represent SEM. The induced group showed a significantly higher signal at 18 and 36 hours compared to the uninduced group from the site containing 293T cells transfected with plasmids PDi plus PGi.

FIG. 11. In vivo optical CCD imaging of mice carrying transiently transfected 293T cells for induction of the reconstitution based split-luciferase system. (A) Set of nude mice were repetitively imaged after subcutaneous implantation of 293T cells transiently transfected with plasmids PFi (site B), PHi (site C), PFi plus PHi (site D) and mock transfected cells (site A). One group of mice was induced with TNF- α and the other group was not induced. Images are from one representative mouse from each group immediately after implanting cells (0 hrs), 18 hrs and 36 hrs after TNF- α induction. The induced mouse showed significantly higher Flue signal at site D when compared to the mouse not receiving TNF-α. (B). Graphs showing the uninduced (top graph) and induced (bottom graph) group with mean values across 6 mice from each group. The error bars represent SEM. The induced group showed a significantly higher signal at 18 and 36 hours compared to the uninduced group from the site containing 293T cells transfected with both plasmids PFi plus PHi. FIG. 12. A. Schematic diagram showing different split points with nucleotide positions in 5¹ to 3' direction. The right-directed arrow (f) indicates the forward priming position and the left-directed arrow (r) indicates the reverse priming positions. The positive signs at nucleotide positions 669-670 and 687-688 indicate the split points restored activity during complementation with interacting proteins MyoD and Id. B. Amino acid (311) sequence of synthetic renilla luciferase protein with bolded amino acids showing the split sites. C. Diagram showing the plasmid constructs (i, ii) made for each split site with interacting proteins MyoD and ID under the control of the CMV promoter with linker (GGGGS)₂. (iii). The N-hrluc-ld construct with NFKB promoter/enhancer elements to modulate the system.

FIG. 13. Protein-protein interaction mediated fragment-assisted complementation of the split hrluc system in transiently transfected 293T cells. The signal from cells cotransfected with both N-hrluc-ld and C-hrluc-MyoD shows significant recovered activity as compared to cells transfected with N-hrluc-ld alone and also significant recovered activity as compared to all other plasmids shown. The signal from cells transfected with C-hrluc-MyoD is not significantly different from mock-transfected cells. The error bar is the SEM of six samples. FIG. 14. A. Comparison of protein-protein interaction-mediated fragment-assisted complementation of split firefly luciferase, split synthetic renilla luciferase and native reporters of firefly luciferase, renilla luciferase, and synthetic renilla luciferase in transiently transfected 293T cells. The error bar is the SEM of six samples. B. The TNF- α -modulated protein-protein interaction-mediated fragment-assisted complementation of the split hrluc system in transiently transfected 293T cells. The error bar is the SEM of six samples.

DETAILED DESCRIPTION OF THE INVENTION

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described.

All patents, patent applications, journal articles and other publications mentioned in this specification are incorporated herein in their entireties by reference for the purpose of describing and disclosing, for example, compositions and methodologies that are described in the publications which might be used in connection with the presently described invention.

The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventor is not entitled to antedate such disclosure by virtue of prior invention.

The present invention relates generally to methods for studying protein-protein interactions inside living organisms in which one can image in a living animal the interaction of two proteins and the degree of that interaction. This approach facilitates the study of protein-protein interactions to understand fundamental cell biology and will enable the in vivo testing of pharmaceuticals designed to modulate protein-protein interactions.

Molecular imaging instrumentation and techniques. Molecular imaging technology in living subjects has recently been reviewed in Massoud, T. F. and Gambhir, S.S.

(2003) Genes & Development 17: 545-580, hereby incorporated by reference in its entirety. The various existing imaging technologies differ in five main aspects: spatial and temporal resolution, depth penetration, energy expended for image generation (ionizing or nonionizing, depending on which component of the electromagnetic radiation spectrum is exploited for image generation), availability of injectable biocompatible molecular probes, and the respective detection threshold of probes for a given technology. Collapsing the volume of an animal or tumor into a single image, known as planar imaging, is generally fast, the data sets generated are small, and imaging can be done in high throughput fashion, at the expense of internal resolution. Tomographic imaging allows a virtual slice of the subject to be obtained and is usually quantitative and capable of displaying internal anatomic structures and/or functional information, but generally requires longer acquisition times and higher energy expenditure. Volumetric image acquisition shows a volume of interest in all three dimensions and results in the highest spatial information content, although it can generate very large data sets. Further reviews of issues centered on molecular imaging techniques can be found elsewhere (Cherry and Gambhir 2001, liar J. 42:219-232; Weissleder 2001, Nat. Biotech. 19:316-317, 2002, Nat. Rev. Cancer 2:11-18; Weissleder and Mahmood 2001, Radiology 219:316-333; Chatziioannou 2002, Eur. J. Nucl. Med. 29:98-114). Moreover, a glossary of molecular imaging terminology has been published recently to enhance collaborative efforts between multiple disciplines (Wagenaar et al. 2001, Acad. Radiol. 8:409-420). Table 1 outlines some of the general characteristics of the imaging modalities available, some of which are discussed in more detail below. The skilled practitioner will recognize that other imaging modalities, as, for example, shown in Table 1, are suitable for practice of the present invention.

Radionuclide imaging. Positron emission tomography (PET) records high-energy γ - rays emitted from within the subject. Natural biological molecules can be labeled with a positron-emitting isotope that is capable of producing two γ -rays through emission of a positron from its nucleus, which eventually annihilates with a nearby electron to produce two 511,000-eV γ -rays at ~180° apart. Positron-emitting isotopes frequently used include ¹⁵O, ¹³N, ⁿC, and ¹⁸F, the latter used as a substitute for hydrogen. Other less commonly used positron emitters include ¹⁴O, ⁶⁴Cu, ⁶²Cu, ¹²⁴L ⁷⁶Br, ⁸²Rb, and ⁶⁸Ga. Most of these isotopes are produced in a cyclotron, but some can be produced using a generator (e.g., ⁶⁸Ga, ⁸²Rb). Labeled molecular probes (see below) or tracers can be introduced into the subject, and then PET imaging can follow the distribution and concentration of the injected molecules.

Many of the positron-emitting isotopes used have relatively short half-lives (e.g., ¹⁸F has tι_/2 = 110 min), so that the chemical reactions leading to incorporation of the isotope into the parent molecule and subsequent introduction into the subject must take place relatively quickly. PET radiopharmacies exist throughout the world and are capable of providing commonly used PET tracers on a daily basis (Gambhir 2002, Nat. Rev. Cancer 2:683-693). Table I Characteristics of imaging modalities available and guide to finding the appropriate molecular imaging approach

Portion of EM radiation spectrum used Type of Amount of

Imaging in image Spatial Temporal molecular molecular technique generation resolution' Depth resolutιon^b Sensιtιvtty^c robe^d probe used

Positron emission high energy -γ 1-2 mm no limit 10 sec to 10 "-10 > Ridiolabeled nanograms tomography (PET) rays minutes mole/L direct or indirect

Single photon lower energy no limit 10"¹⁰-10 ^l radiolabeled nanograms emission computed rays mole/L direct or tomography indirect (SPECT)

Optical visible light 3-5 mm' 1-2 cm seconds to activatable micrograms to bioluminescence minutes indirect' milligrams imaging

Optical fluorescence visible light or 2-3 mm^g seconds to not well activatable, micrograms to imaging near-infrared minutes characterized, direct or milligrams likely indirect

₁₀-9_₁₀-i2 mole/L

Magnetic resonance radio waves 25-100 μm no limit minutes to ιo-³-ιo-⁵ activatable, micrograms to imaging (MRI) hours mole/L direct or milligrams indirect

Computed X rays 50-200 μ no limit mmutes not well may be not applicable tomography (CTJ characterized possible (see text)

Ultrasound high frequency 50-500 μm millimeters to seconds to not well limited micrograms to sound centimeters minutes characterized activatable milligrams direct

Table 1 Continued

Ability to scale

Quantitative to human Perturbation ul degree imaging biological system Principal use Advantages Disadvantages Cost¹ yes no metabolic high sensitivity PET c> clotron or $$$s reporter/gene isotopes can generator needed expression substitute naturally relatively low receptor/hgand occurring atoms spatial resolution enzyme quantitative radiation to subject targeting translational research yes no reporter/gene many molecular relatively low spatial $$$ expression probes available resolution because receptor/ligand can image multiple of sensitivity probes colltmation simultaneously radiation may be adapted to clinical imaging systems

+ to ++ yes but limited yes if necessary to reporter/gene highest sensitivity, low spatial $s give mass expression, cell quick, easy, resolution, current quantity of trafficking low cost, relative 2D imaging only, molecular probe high throughput relatively surface weighted limited translational research yes but limited yes if necessary to reporter/gene high sensitivity, relatively low spatial give mass expression, cell detects resolution, quantity of trafficking fluorochrome in surface weighted¹ molecular probe live and dead cells yes if necessary to morphological highest spatial relatively low give mass reporter/gene resolution, sensitivity, long quantity of expression, combines scan and molecular probe receptor/hgand morphological and postprocessing if many functional imaging time, mass receptors quantity of probe may be needed not as MRI, and also morphological bone and tumor limited "molecular" $$ applicable if excessive imaging, applications, radiation dose anatomical imaging limited soft tissue resolution, radiation morphological real time, low cost limited spatial resolution, mostly morphological

"Spatial resolution is a measure of the accuracy or detail of graphic display in the images expressed in millimeters It is the minimum distance between two independently measured objects that can be distinguished separately It is a measure of how fine the image is

'Temporal resolution is the frequency at which the final tntcipretible version at images can be recorded/captured from the subject once the imaging process is initiated This relates to the time required to collect enough events to form an image, and to the responsiveness of the imaging system to rates of any change induced by the operator or in the biological system at hand ^cScnsitjvity, the ability to detect a molecular probe when it is present, relative to the background, measured in moles per liter

*rypc of molecular probe See text

This includes cost of equipment and cost per study For details of instrumentation vendors, visit Web site www mi central org

'Spatial resolution of btoluminescencc and reflectance fluorescence is depth dependent For btoluminescencc, the resolution ts slightly worse or equal to the depth of the object, that is, an object 3-5 mm deep has an -3-5 mm spatial resolution

'Use of fluorescence tomography is likely to result in better spatial resolution ^hThιs depth applies to reflectance fluorescence Fluorescence tomography can likely image objects at greater depths (2-6 cm]

'Dioluminescencc may also offer direct means of imaging through the use of the Renilla luciferase protein Feasibility studies are underway

'Except for fluorescence tomography, which has better spatial resolution and can image at greater depths

Isotopes that are β-emitters (e.g., ³H, ¹⁴C) are not useful for noninvasive imaging of living subjects because β-particles (electrons) do not travel significant distances; they are used instead in autoradiography. γ-Emitting isotopes (e.g., ^99mTc, ^ulIn, ¹²³I, ¹³¹I) can also be used for imaging living subjects but require different types of scanners known as gamma cameras, which when rotated around the subject (then known as single photon emission computed tomography, SPECT), can result in production of tomographic images. For a more detailed review of SPECT imaging, see Rosenthal et al. 1995, J. Nucl. Med. 36:1489-1513.

Detection of γ -rays is achieved through scintigraphic instrumentation, which consists of an array of scintillation crystals to convert γ -ray energy into visible light, suitable light sensors, readout electronics, and image processing units. The coincidence detection of both γ -rays in PET within nanoseconds of each other defines the line of response in space and thus the direction of flight. In contrast to SPECT, attenuation (quantifiable reduction in events present at the face of the detector due to absorption or scatter through tissues) of the emitted radiation in PET can be corrected precisely because the total length through the body determines the attenuation factor along a coincidence line. By doing so, quantitative information about the tracer distribution can be obtained. The reconstruction software then takes the coincidence events measured at all angular and linear positions to reconstruct an image that depicts the localization and concentration of the positron-emitting radioisotope within a plane of the organ that was scanned. If single photon emitters are used, the direction of flight has to be determined by geometric collimation. Because the emission of γ-rays from the subject is isotropic, such collimation is needed to restrict data to γ-rays of certain predefined directions. The main difference between SPECT and PET measurements is the necessity of lead collimators for the definition of the angle of incidence, compared with electronic collimation in the case of PET. The sensitivity of PET is relatively high in the range of 10^_π-10^-12 mole/L, and is independent of the location depth of the reporter probe of interest. Typically, several million cells accumulating reporter probe have to be in relative close proximity for a PET scanner to record them as a distinct entity relative to the background. In SPECT, collimator design is always a compromise between spatial resolution and sensitivity: reducing the size of the holes or using longer septae improves spatial resolution but reduces sensitivity at the same time. The use of collimators in SPECT results in a very low detection efficiency of ~10^~4 times the emitted number of γ-rays. PET is therefore at least a log order more sensitive than SPECT. For example, even a triple-head SPECT system designed to image ^99mTc-labeled tracers in the human brain is 15 times less sensitive than a PET if a 1-cm resolution is assumed in both systems. One alternative to PET that attempts to overcome sensitivity limitations, and that can also be adapted to available clinical systems, is "pinhole SPECT" for imaging small animals, with a reported spatial resolution as high as 1.7 mm. Even higher resolutions (200 μm) are possible with micropinhole apertures and 1251 SPECT imaging

(Beekman et al. 2002, Eur. J. Nucl. Med. Mol. Imaging 29:933-938).

Positron-emitting isotopes can usually be substituted readily for naturally occurring atoms, and therefore PET is a ore robust technique than SPECT for imaging most molecular events. An important principle to note is that because all isotopes used result in two γ -rays of the same energy, if two molecular probes, each with a separate isotope, are injected simultaneously, it would not be possible for the PET detectors to distinguish them. Therefore, to investigate multiple molecular events, molecular probes are usually injected separately, allowing for the decay of one isotope prior to administration of the other. SPECT, on the other hand, does allow simultaneous detection of multiple events owing to the use of multiple isotopes, each with different-energy γ -rays. In practice, the concurrent use of several SPECT isotopes, without perturbation of the underlying parent molecules, would have to be possible before a clear advantage could be achieved for SPECT over PET in multiple-event imaging. The images from a PET scanner, although often shown in color, reflect identical-energy γ - ray events, and the color scale usually reflects the concentration of isotope in various locations of the body. The spatial resolution of most clinical PET scanners is ~(6-8)³ mm³, but higher resolution clinical brain scamiers have been developed approaching resolutions of ~3³ mm³.

In recent years, small animal micro-PET scanners have been developed. These systems typically have a spatial resolution of ~2³ mm³ (Cherry and Gambhir 2001, liar. Res. 42: 219-232), but newer generation systems in final stages of development will have a resolution of ~1³ mm³ (Chatziioannou et al. 2001, Phys. Med. Biol. 46: 2899-2910). Development of molecular imaging assays with PET is particularly advantageous because of the ability to validate them in cell culture and small animal models prior to using the same reporter probe in established clinical PET centers around the world. The ability to perform translational research from a cell culture setting to preclinical animal models to clinical applications is one of the most unique and powerful features of PET technology. Further reviews of PET in small animals are to be found in Cherry and Gambhir, supra, Luker and Piwnica-Worms (2001, Acad. Radiol. 8:4-14), Price (2001, Trends Mol. Med. 7:442-446), Reader and Zweit (2001, Trends Pharmacol. Sci. 22:604-607), and Chatziioannou (2002, Eur. J. Nucl. Med. 29:98-114).

Optical imaging. Optical imaging techniques have already been developed for in vitro and ex vivo applications in molecular and cellular biology (e.g., fluorescence microscopy and in benchtop luminometry using commercial substrate kits for bioluminescence). An extension of this concept toward noninvasive in vivo imaging with light photons represents an interesting avenue for extracting relevant biological information from living subjects. Progress in optical molecular imaging strategies has come from the recent development of targeted bioluminescence probes, near-infrared fluorochromes, activatable near-infrared fluorochromes, and red-shifted fluorescent proteins (Weissleder

2001). A notable theoretical advantage of optical techniques is the fact that multiple probes with different spectral characteristics could potentially be used for multichannel imaging, similar to in vivo karyotyping. Optical imaging also allows for a relatively low-cost alternative to studying reporter gene expression in small animal models (see below). A fundamental issue in optical imaging of living subjects is how to detect light emitted from the body, this being relevant to both bioluminescence and fluorescence imaging, hi this regard, several technical advances for imaging very low levels of visible light have now emerged, allowing the use of highly sensitive detectors in living subjects, and not just restricted to cell cultures and small transparent animals. Charged coupled device (CCD) detectors are made of silicon crystals sliced into thin sheets for fabrication into integrated circuits using similar technologies to those used in making computer silicon chips. For a detailed overview of CCD technology, please refer to Spibey et al. (2001, Electrophoresis 22:829-836). One of the properties of silicon-based detectors is their high sensitivity to light, allowing them to detect light in the visible to near-infrared range. CCD cameras operate by converting light photons at wavelengths between 400 and 1000 nm that strike a CCD pixel with an energy of just 2-3 eN (as opposed to high-energy γ-rays of 511 keN in PET that would easily traverse a CCD chip) into electrons. A CCD contains semiconductors that are connected so that the output of one serves as the input of the next. In this way, an electrical charge pattern, corresponding to the intensity of incoming photons, is read out of the CCD into an output register and amplifier at the edge of the CCD for digitization. Older intensified CCD cameras had much lower sensitivities than newer-generation cooled CCD cameras. This is because thermal noise (termed "dark -current") from thermal energy within the silicon lattice of a CCD chip resulted in constant release of electrons. Thermal noise is dramatically reduced if the chip is cooled; dark current falls by a factor of 10 for every 20°C decrease in temperature (Spibey, supra). For bioluminescence imaging, CCD cameras are usually mounted in a light-tight specimen chamber, and are attached to a cryogenic refrigeration unit (for camera cooling to -120°C to -150°C). A camera controller, linked to a computer system, is used for data acquisition and analysis. A bioluminescence image is often shown as a color image that is superimposed on a gray-scale photographic image of the small animal using overlay and image analysis software. Usually a region of interest is manually selected over an area of signal intensity, and the maximum or average intensity is recorded as photons per second per centimeter squared per steradian (a steradian is a unit of solid angle). Whenever the exposure conditions (including time, fstop, height of sample shelf, binning ratio, and time after injection with optical substrate) are kept identical, the measurements are highly reproducible (in the present inventor's laboratory to within 6%).

The main advantage of optical bioluminescence imaging is that it can be used to detect very low levels of signal because the light emitted is virtually backgroundfree. It is quick and easy to perform and allows rapid testing of biological hypotheses and proofs of principle in living experimental models. It is also uniquely suited for high-throughput imaging because of its ease of operation, short acquisition times (typically 10-60 sec), and the possibility of simultaneous measurement of six or more anesthetized living mice. However, the cooled CCD camera has three main drawbacks: Firstly, the efficiency of light transmission through an opaque animal can be somewhat limited and depends on tissue type and tissue scattering. Skin and muscle have the highest transmission and are fairly wavelength-dependent, whereas organs with a high vascular content such as liver and spleen have the lowest transmission because of absorption of light by oxyhemoglobin and deoxyhemoglobin. Estimates from in vitro studies show that the net reduction of bioluminescence signal is ~10-fold for every centimeter of tissue depth, varying with the exact tissue type. Secondly, images obtained from the cooled CCD camera are two- dimensional and lack depth information. However, it is expected that future bioluminescence image acquisition using rotating CCD cameras or multiple views of the same animal with a single CCD camera may allow volumetric imaging, especially when combined with novel red-shifted luciferases that have better tissue penetration. A third limitation is the lack of an equivalent imaging modality applicable for human studies, thus preventing direct translation of developed methods for clinical use.

In fluorescence imaging, an excitation light of one wavelength (in the visible light range of 395-600 nm) illuminates the living subject, and a CCD camera (usually a less- sensitive version than the cooled CCD required in bioluminescence detection, for technical reasons discussed in Golden and Ligler 2002, Biosens. Bioelectron. 17:719) collects an emission light of shifted wavelength. Cells tagged with fluorescently labeled antibodies or those in which expression of the green fluorescent protein (GFP) gene (or its variants; Lippincott-Schwartz et al. 2001, Nat. Rev. Mol. Cell Biol. 2:444-456; Remington 2002, Nat. Biotechnol. 20:28-29) is introduced can be followed by this technique. GFP is a protein from the jellyfish Aequorea ictoria that has become very popular over the last decade as a reporter in fixed and cultured cells and tissues. Wild-type GFP emits green (509-nm) light when excited by violet (395-nm) light. The variant EGFP has a shifted excitation spectrum to longer wavelengths and has increased (35-fold) brightaess. Between 1000 and 10,000 fluorescently labeled cells in the peritoneal cavity of a mouse can be imaged on its external surface. It may be necessary to expose internal organs surgically prior to their imaging, although this is true of bioluminescence imaging as well. The two main advantages of fluorescence imaging are that it can be used as a reporter in both live and fixed cells/tissues and no substrate is required for its visualization. This simple, reflectance type of fluorescence imaging has been used extensively in studies of feasibility and development of these approaches. However, these systems are not quantitative, and the image information is surface-weighted (anything closer to the surface will appear brighter compared with deeper structures). One clear difference between the two modalities is the observation of significantly more background signal owing to autofluorescence of tissues in fluorescence imaging as compared with bioluminescence imaging.

In contrast to fluorescence imaging in the visible light range, the use of the near- infrared (NTR) spectrum in the 700-900-nm range maximizes tissue penetration and minimizes autofluorescence from nontarget tissue. This is because hemoglobin and water, the major absorbers of visible and infrared light, respectively, have their lowest absorption coefficients in the NIR region. Several NIR fluorochromes have recently become available that can be coupled to affinity molecules (peptides, antibodies) or that are activatable. This type of NTR fluorescence reflectance imaging is still limited to targets that are fairly near the illuminated surface.

A newer approach to fluorescence imaging of deeper structures uses fluorescence- mediated tomography (Ntziachristos and Weissleder 2002, Med. Phys. 29:803-809; Ntziachristos et al. 2002, Nat. Med. 8:757-760). The subject is exposed to continuous wave or pulsed light from different sources, and detectors arranged in a spatially defined order in an imaging chamber capture the emitted light. Mathematical processing of this information results in a reconstructed tomographic image. Resulting images have a resolution of 1-2 mm, and the fluorochrome detection threshold is in the nanomolar range. Recent attempts at constructing a CCD based scanner for tomography of fluorescent NIR probes have also yielded encouraging results. Prototype instruments attain better than 3-mm resolution, have linear detection within more than two orders of magnitude of fluorochrome concentration, and can detect fluorescent objects at femtomolar quantities in small animal-like geometries. Fluorescence-mediated tomography is still in its infancy, requiring extensive mathematical validation prior to practical implementation. Methods for studying protein-protem interactions. Inducible yeast two-hybrid system. A two-step transcriptional amplification (TSTA) approach for enhancing reporter gene expression from weak promoters in living mice has been described. (Iyer, M. et al. (2001) Proc. Natl. Acad. Sci. 98:14595-14600.) This system uses a GAL4-VP16 transactivation strategy to amplify expression of either the bioluminescent firefly luciferase (ft) or herpes simplex virus type 1 thymidine kinase (HSVl-t/) PET reporter genes. Significant reporter gene expression is generated only when the GAL4-NP16 fusion binds to GAL4-binding sites, leading to NP16-mediated transactivation of the reporter template. This system has been refined for even greater amplification through creating a single vector construct with potential feedback elements (Zhang, J. et al., 2002, Mol. Ther. 3:223-32). In the present invention, the GAL4 and NP16 proteins are translated separately and are brought together through specific interactions of two proteins of interest X and Y (FIG. 1). The production of the fusion proteins GAL4-X and NP16-Y was modulated and the interactions of X and Y lead to the formation of the protein GAL4-X-Y-VP16, which is needed for transactivation of the reporter template, as described below in Example 1. The reporter template contains five GAL4 DNA-binding sites and utilizes the fl reporter gene. (Note that fl or flue refers to the firefly luciferase gene and FL or Flue, to the enzyme.) Transcription of fl leads to FL, which is quantitatively imaged by injecting D-luciferin into the subject. D-Luciferin serves as a substrate for FL and leads to CCD-detectable bioluminescence.

To validate the IY2H system, the present inventor used the two proteins ID and MyoD, which are known to strongly interact in vivo. MyoD normally is expressed in skeletal muscle and is a myogenic regulatory protein. The ID protein acts as a negative regulator of

10 myogenic differentiation. MyoD and ID are members of the helix-loop-helix family of nuclear proteins. (Note that id-gal4 and myoD-vplό refer to the fusion genes whereas ID- GAL4 and MyoD-NP16 refer to the fusion proteins.) To modulate the expression of these two proteins, the ΝF-KB promoter was used to drive expression of the id-gαl4 and/or myoD- vplό fusion genes while using tumor necrosis factor α (TΝF-α) to induce the ΝF-κB

15 promoter. TΝF-α is a pleiotropic cytokine secreted by lipopolysaccharide-stimulated macrophages that induces a variety of cell-specific events and causes tumor necrosis in vivo when injected in tumor-bearing mice. The type 1 TΝF- α receptor is a 55-kDa protein that is associated with a variety of functions when activated, including apoptosis, ΝF-κB activation, and Jun N-terminal kinase activation. The induction of both NF-κB activity and apoptosis by

20 type 1 TNF- α receptor is mediated through its intracellular "death domain" region. In the TNF- α -mediated activation of NF-κB, a pathway is stimulated in which the last step is the phosphorylation-dependent degradation of IκB, the negative regulator of NF-κB, by proteosomes. This promoter was chosen because it previously has been shown to be modulated in cell culture and in living animals with TNF-α.

25

293T cells were transiently transfected with various combinations of plasmids first to verify fl expression in cell culture under various inducible and constitutive conditions along with the appropriate controls. Cooled CCD imaging experiments were then performed in living mice implanted in the peritoneum with transiently transfected 293T cells to validate the

~_π ability to image protein-protein interaction in living mice by using TNF-α to modulate the system.

Split reporter protein. A split reporter protein approach can be used for studying protein-protein interactions through either complementation or reconstitution strategies (FIG. 6). Complementation strategies do not require the formation of a mature protein from split proteins. Intracistronic complementation of β-galactosidase using interacting proteins has been used to measure the rate of interaction between two proteins. Reconstitution strategies attempt to reconstitute the mature reporter protein. Protein splicing is a post-translational process that releases matured protein following proper ligation without altering protein activity. Inteins are protein domains that perform a cis- splicing reaction to excise themselves post-translationally from nascent polypeptide chains, forming a new peptide bonds between the exteins. Inteins also can be split into two parts and expressed as inactive forms that can regain their activity once brought together. i Example 2, below, an approach is used whereby split firefly luciferase reporter proteins consisting of the N-terminal (NFluc: 1-437 aa) and the C-terminal (CFluc: 438-554 aa) are inactive until closely approximated (complementation strategy) or spliced together (reconstitution strategy), through the interaction of two test proteins that are known to strongly interact (MyoD and Id). MyoD and Id are members of the helix-loop-helix (HLH) family of nuclear proteins. MyoD is expressed in skeletal muscle and is a myogenic regulatory protein. The Id protein acts as a negative regulator of myogenic differentiation and can associate with three HLH proteins MyoD; El 2 and E47.

To monitor different intracellular protein networks, it will be essential to have a multireporting system for use with both intact cells and living animals. For this, it is important to generate different optical split reporter proteins with substrate specificity. The enzymes of firefly luciferase and renilla luciferase react with different substrates with no cross-reactivity. The firefly luciferase emission spectrum is in the range 575-610 nm, whereas that of renilla luciferase is 440-550 nm. Therefore, in Example 3, synthetic renilla luciferase (hrluc), a second optical bioluminescence reporter gene, was used for developing a protein- fragment assisted complementation system.

The general features required for designing a protein-fragment assisted complementation assay (PCA) (Figure 6A), also referred to as split protein technology, are the need for a relatively small monomeric protein, well-established crystal structure, simple assay system, and generalizable applicability. Renilla luciferase (rluc), a monomeric 36-kDa, does not require ATP or posttranslational modification for its activity and also functions as a genetic reporter immediately following translation. The cDNA encoding renilla protein that catalyzes coelenterate luciferin (coelenterazine) oxidation to produce light was originally cloned from the marine organism Renilla reniformis (Sea pansy). This native renilla luciferase (rluc) gene sequence contains codons that are not frequently used in mammalian cells, which limits its expression efficiency in mammalian cells. The synthetic renilla luciferase is a systematically redesigned renilla luciferase gene with only codon changes for higher expression in mammalian cells (Promega, Technical manual no. 237 (1-3)). The protein encoded by both reporter genes is identical. The recovered activity from protein fragments of a reporter protein is anticipated to be lower than that of an intact reporter protein. This and the need to study different levels of interactions between proteins in the cellular network make it necessary to develop a highly sensitive reporter system. Therefore, the present inventor used the gene sequence coding for synthetic renilla luciferase in this study to develop such a system. Although synthetic renilla luciferase, the modified form of renilla luciferase, has many of the required components needed for developing a protein- fragment-assisted complementation assay, a crystal structure is lacking to identify potential sites to generate suitable fragments of the protein. Hence, in this study, for the first time, the present inventor validated a split synthetic renilla luciferase-based complementation system to study protein-protein interactions by selecting six different split sites. The split sites were selected to also allow future study of intein-mediated reconstitution of renilla luciferase. The intein-mediated splicing of split protein fragments requires the amino acid cysteine to be at the +1 position of the C part of the protein fragment to generate efficient reconstitution. Furthermore, the presence of more than one consecutive glycine molecule in a protein serves as a natural flexible linker. Considering those two factors, six different split sites were selected to generate fragments for the protein-fragment-assisted complementation strategy. Three of these sites were before cysteine molecules, one was before two consecutive glycine residues, one was at a convenient restriction enzyme site, and one was selected at random.

The complementation-based recovery of split protein activity was studied in five different cell lines, as described below in Example 3. The system was studied with a constitutive CMN promoter and modulated by using TΝFR, an interleukin that controls ΝF B promoter/enhancer elements in cells. The signal measured from the complementing synthetic renilla luciferase (hrluc) fragments driven by a MyoD-Id protein-protein interaction shows significantly higher renilla luciferase activity than control studies that also include fragments without interacting proteins or with two noninteracting proteins (MyoD and p53). The split synthetic renilla luciferase strategy developed herein should be useful for studying protein-protein interactions when utilized alone or in combination with other split reporters, such as split firefly luciferase.

Transgenic Animals. Transgenic animals comprise exogenous DΝA incorporated into the animal's cells to effect a permanent or transient genetic change, preferably a permanent genetic change. Permanent genetic change is generally achieved by introduction of the DΝA into the genome of the cell. Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like. Generally, transgenic animals are mammals, most typically mice. The exogenous nucleic acid sequence may be present as an extrachromosomal element or stably integrated in all or a portion of the animal's cells, especially in germ cells. Unless otherwise indicated, a transgenic animal comprises stable changes to the germline sequence. During the initial construction of the animal, chimeric animals (chimeras) are generated, in which only a subset of cells have the altered genome. Chimeras may then be bred to generate offspring heterozygous for the trans gene. Male and female heterozygotes are may then be bred to generate homozygous transgenic animals.

Typically, transgenic animals are generated using transgenes from a different species or transgenes with an altered nucleic acid sequence. For example, a human gene, may be introduced as a transgene into the genome of a mouse or other animal. The introduced gene may be a wild-type gene, naturally occurring polymorphism, or a genetically manipulated sequence, for example having deletions, substitutions or insertions in the coding or non coding regions. For example, an introduced transgene may include split reporter genes, such as a split firefly luciferase gene or renilla luciferase gene, which may become functional via complementation or reconstitution when exposed to appropriate test proteins or, alternatively, which may become non-functional when exposed to a particular test protein that blocks complementation or reconstitution. Such a transgene, when introduced into a transgenic animal or cells in culture, is useful for testing potential therapeutic agents known or believed to interact with a particular target protein implicated in a disease or disorder. Where the introduced gene is a coding sequence, it is usually operably linked to a promoter, which may be constitutive or inducible, and other regulatory sequences required for expression in the host animal.

Methods of Making Transgenic Animals. Transgenic animals can be produced by any suitable method known in the art, such as manipulation of embryos, embryonic stem cells, etc. Transgenic animals may be made through homologous recombination, where the endogenous locus is altered. Alternatively, a nucleic acid construct is randomly integrated into the genome. Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like. Numerous methods for preparing transgenic animals are now known and others will likely be developed. See, e.g., U.S. Pats. Nos. 6,252,131, 6,455,757, 6,028,245, and 5,766,879, all incorporated herein by reference. Any method that produces a transgenic animal expressing expressing a reporter gene following complementation or reconstitution is suitable for use in the practice of the present invention. The microinjection technique is particularly useful for incorporating transgenes into the genome without the accompanying removal of other genes.

Drug Screening Assays. The transgenic animals described herein may be used to identify compounds affecting protein-protein interactions and thus useful in the treatment of those pathologies associated with particular protein interactions. For example, transgenic animals comprising split reporter genes may be treated with various candidate compounds and the resulting effect, if any, on reporter gene expression, as, for example, resulting from blocking or modulating complementation or reconstitution of the reporter gene, evaluated. As will be appreciated by one of skill in the art, such screening may also be done in cell culture. Preferably, the compounds screened are suitable for use in humans. The subject animals may be used by themselves, or in combination with control animals. Control animals may have, for example, intact reporter genes, or may be transgenic for a control construct that does not contain a reporter gene sequence. Therapeutic Agents. Once compounds have been identified in drug screening assays as affecting protein-protein interactions implicated in various pathologies, these compounds can be used as therapeutic agents, provided they are biocompatible with the animals, preferably humans, to whom they are administered. The therapeutic agents of the present invention can be formulated into pharmaceutical compositions by combination with appropriate pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. Administration of the compounds can be administered in a variety of ways known in the art, as, for example, by oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal, etc., administration.

Depending upon the particular route of administration, a variety of pharmaceutically acceptable carriers, well known in the art can be used. These carriers include, but are not limited to, sugars, starches, cellulose and its derivatives, malt, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline, and pyrogen free water. Preservatives and other additives can also be present. For example, antimicrobial, antioxidant, chelating agents, and inert gases can be added (see, generally, Remington's Pharmaceutical Sciences, 16th Edition, Mack, (1980)).

The concentration of therapeutically active compound in the formulation may vary from about 0.1 100 wt. %.

Those of skill will readily appreciate that dose levels can vary as a function of the specific therapeutic agents, the severity of the symptoms and the susceptibility of the subject to side effects. Preferred dosages for a given therapeutic agent are readily determinable by those of skill in the art by a variety of means. A preferred means is to measure the physiological potency of a given therapeutic agent.

The invention is illustrated by the following Examples. These examples are for illustrative purposes only and are not intended to limit the invention.

Example 1: Noninvasive Quantitative Imaging of Protein-protein Interactions in Living Subjects

Chemicals. TNF-α was purchased from Sigma, and Superfect transfection reagent was purchased from Qiagen. Luciferase assay kit was purchased from Promega, and D- luciferin for use with in vivo./? imaging was purchased from Xenogen (Alameda, CA). The polyclonal antibody against the GAL4 protein was a kind gift from M. Carey (University of

California, Los Angeles).

Cell Culture. Human embryonic kidney cancer cells, 293T (ATCC, Manassas, NA), were grown in MEM supplemented with 10% FBS and 1% penicillin/streptomycin solution. The C6 rat glioma cells were kindly provided by Margaret Black (Washington State

University, Pullman) and were grown in deficient DMEM, supplemented with 5% FBS and 1% penicillin/streptomycin/L-glutamine. The N_2a cells were obtained from V. P. Mauro (Scripps Research Institute, La Jolla, CA) and were grown in DMEM (high glucose) supplemented with 10% FBS and 1% penicillin/streptomycin.

Plasmid Construction. All plasmids used are shown in Table 2. The PC, PD, and PR vectors were obtained from the CheckMate Mammalian Two-Hybrid system kit purchased from Promega. The PC vector contains the yeast GAL4 DNA-binding domain fused with the cDNA of ID protein, and the PD vector contains the HSN NP16 activation domain fused with a segment of murine MyoD cDΝA. The PR vector contains five GAL4-binding sites upstream of a minimal TATA box, which, in turn, is upstream of 7. The PA and PB vectors were constructed to replace the constitutive cytomegalovirus (CMN) promoter with TΝF-α- inducible ΝF-KB response elements, as described below.

Table 2. Plasmids used in Example 1

Nomenclature Plasmid

PA pNF-κB-gal4-id PB pNF-κB-vpl6-myoD

PC pCMV-gal4-id

PD pCMN-vpl6-myoD

PE pCMN-fl

PF pCMN-gal4-p53 PR pCMN-(gal4bs)₅-fl

The 194-bp segment consisting of a short, 39-bp ΝF-kB response element (kB4) and a 148-bp-long TATA-like promoter (P_TA ) was excised from pΝF-κB-Luc (CLONTECH) by Kpnl and H dffl digestion and cloned in pBAD-MycΗisA (Invitrogen) to generate proper restriction sites suitable for cloning in PC/PD vector. PC vector was digested completely with BglE and then partially with HmdIII to excise the 750 bp of CMN promoter. To construct the PA plasmid, the pBAD-ΝF-κB-MycΗisA was digested with BgHl and H dIII to release the kB4-EχAL fragment, which then cloned into partially digested PC vector.

To construct the PB plasmid, we digested the pCMN-vpl6 (available with the kit) vector completely with BglϊL and partially with H dIII to remove the CMN promoter. The same kB4-P_TA fragment released by BgHl and Hrødffl digestion of pBAD-ΝF-κB-MycΗisA vector then was inserted into the above-mentioned pCMN-vplδ/Eg-tTI-Hindlll fragment. The MyoD fragment from PD vector was released with BamRl and Kpnl and finally cloned into the BamΗI and Kpnl sites of pNF-κB-v l6 plasmid to obtain the PB plasmid. The PF vector expresses the GAL4- binding domain and amino acids 72-390 of murine p53 as hybrid protein and was obtained from the Mammalian Two-Hybrid Assay kit from Stratagene.

Cell Transfections and Luciferase Assay. On day 1, 293T cells were plated in 12- well plates in MEM containing 10% FBS. Transient transfections were performed 24 h later by using Superfect transfection reagent. Each transfection mix consisted of 1.5 μg of the effector and reporter plasmids or reporter plasmid alone per well. Three hours after transfection, TNF-α was added to the medium at a concentration of 0.05 μgjvaλ and the cells were incubated for 24 h. The cells were harvested and assayed for FL activity by using the Dual-Reporter Luciferase Assay System (Promega) and a luminometer (Lumat 9507; Berthold, Nashua, NH) with an integration time of 10 sec. For TNF-α dose-response experiments, 293T cells were transiently transfected in the presence of different concentrations of TNF-α (0.005, 0.01, 0.05, and 0.1 μgl l). After 24 h, the cells were assayed for FL activity. Identical studies were repeated by using a fixed concentration of 0.05 μg/ml TNF-α and varying times of exposure to TNF-α (0, 6, 8, and 24 h). The same experiments were repeated with two other cell lines (C6 and N _a) cultured in different media.

In Vivo Optical Imaging of fl Expression by Using a Cooled CCD Camera. 293T cells were transiently transfected with either plasmid PR alone or plasmids PA+PB+PR. The cells were harvested 3 h after transfection and resuspended in PBS. An aliquot of 1 x 10⁶ cells was injected i.p. in anesthetized (ketamine/xylazine, 4:1) nude mice. Fifteen minutes after injection of the cells, 100 μl of D-luciferin (30 mg/ml) was injected 5 min before imaging. Throughout the study, D-luciferin and TNF-α were injected i.p. After the first scan, the mice were injected i.p. with 0.5 μg of TNF-α and imaged again after 8, 22, 30, and 48 h. Each time after scanning, the mice were reinjected with another dose of TNF-α. A total of six mice were used for the PA+PB+PR group that received TNF-α, and four mice were used for the PA+PB+PR group that did not receive TNF-α. Four control mice were injected i.p. with 293T cells transiently transfected with PR alone or PA+PF+PR and imaged repetitively over 24 h with (n = 2) and without (n = 1) repetitive injection of TNF-α every 8 h. All mice were imaged by using a cooled CCD camera (Xenogen INIS; Xenogen).

The animals were placed supine in a light-tight chamber, and a gray-scale reference image was obtained under low-level illumination. Photons emitted from cells implanted in the mice were collected and integrated for a period of 2 min. Images were obtained by using LINING IMAGE software (Xenogen) and IGOR image analysis software (WaveMetrics, Lake Oswego, OR). For quantitation of measured light, regions of interest were drawn over the peritoneal region and maximum photons/sec per cm² per steradian were obtained as described previously (Wu, J. C. et al. (2001) Mol. Ther. 4: 297-306). Statistical Testing. All cell culture and mouse group comparisons were performed with a Student=s t test by using Microsoft EXCEL 98. Nalues of P < 0.05 were considered statistically significant. Results The IY2H System Mediates the Interaction of ID and MyoD Proteins as

Measured by fl Reporter Gene Expression. In transient transfection of PA+PB+PR into 293T cells, fl expression was relatively low in the absence of TΝF-α but in its presence was significantly higher (P < 0.05) (FIG. 2-4). The level of induction was approximately 4-fold. When one of the two proteins (ID or MyoD) is constitutively expressed and the other is driven by ΝF-κB, there is no significant induction observed (FIG. 2-4). Of note are the lower levels of fl expression when PB+PC vs. PA+PD are used. In transient transfection of plasmids PC+PD+PR into 293T cells, fl expression is relatively high and likely a result of the constitutive expression of GAL4-ID and NP16-MyoD proteins (FIG. IB). In transient transfection of plasmids PD+PF+PR, there is relatively low_ 7 expression because of the lack of significant interaction between MyoD and p53 proteins (FIG. IB).

The appropriate negative control studies also were performed by using transient transfection studies in 293T cells and plasmids PR alone, PA+PR, and PB+PR with and without TΝF-α induction (FIG. 1C). The negative controls do not show any significant induction in fl expression pre- and post-TΝF-α and show significantly lower (P < 0.05) fl expression than the postinduction values seen in FIG. 1A with PA+PB+PR. The positive control (PE alone) has a relatively high signal and does not show inducibility in the presence of TΝF-α (FIG. 1 .

To show that the IY2H system is specifically inducible only in cells in which there are TΝF-α receptors, plasmids PA+PB+PR were transiently transfected into 293T, C6, and Ν_2a cells, and FL signal quantitated both with and without exposure to TNF-α. These studies show induction in 293T cells and lack of significant induction in the two other cell lines, demonstrating the requirement of the NF-κB signal transduction pathway for induction of the IY2H system. A Western blot analysis performed on protein extracted from 293T cells pre- and postinduction shows that there is presence of GAL4 protein and that it is relatively higher postinduction (data not shown). Furthermore, in 293T cells not transiently transfected, there is no band observed on the Western blot (data not shown).

Expression of fl for the IY2H system in the presence of TNF-α therefore is achievable in 293T cells. These results validate the concept that expression of both gal4-id and vpl6- myoD leads to the production of GAL4-ID and NPI6-MyoD proteins. The interaction of ID and MyoD then leads to transactivation of fl, allowing indirect confirmation regarding ID- MyoD interaction. Furthermore, the system requires the presence of both ID and MyoD and induction with TΝF-α requires an intact ΝF-κB signal transduction pathway, as demonstrated with the control studies. The IY2H System Can Be Modulated by TNF-α Concentration in Cell Culture.

To test the ability to modulate the IY2H system, plasmids PA+PB+PR were transfected into 293T cells and the cells exposed to increasing concentrations of TNF-α for a fixed time period of 24 h. Increasing levels of TNF-α led to increases in FL signal up to a concentration of 0.005 μglml, and then a progressive gradual decrease in FL signal was seen at higher concentrations (FIG. 3A). To study the time kinetics of TNF-α-mediated induction, the above studies were repeated with a fixed TNF-α concentration of 0.05 μglml and levels of FL signal were measured over a course of 24 h. These studies show that peak levels of FL are observed at approximately 8 hours after introduction of TNF-α (FIG. 32?) and that FL signal remains relatively fixed out to 24 hours. These results demonstrate that the IY2H system can be modulated in a continuous fashion with increasing doses of TNF-α and that there is a time- dependent response that peaks at approximately 8 h and then is relatively fixed out to 24 h.

The IY2H System Can Be Used to Image Protein-Protein Interactions in Living Mice. To test further the utility of the IY2H system in vivo, 293T cells transiently transfected (with plasmids PA+PB+PR, PB+PF+PR, or PR alone) were injected i.p. in nude mice. Mice injected i.p. with 293T cells transiently transfected with PA+PB+PR that are not induced with TNF-α show a relatively low but increasing^? expression over the course of 30 h (FIG. 4-4). Mice injected i.p. with 293T cells transiently transfected with PA+PB+PR that are induced with TNF-α show increasing fl expression over 30 h (FIG. 4B). Mice injected i.p. with control 293T cells transfected with PR alone or PB+PF+PR (noninteracting proteins) show relatively low_/7 expression (<9 x 10³ photons/sec per cm² per steradian) from the peritoneum pre- and postinduction with TNF-α (data not shown). These results are indicative of the specificity of TNF-α in activating the NF-KB promoter, leading to production of ID and MyoD proteins and subsequent transactivation of the reporter template in vivo. Transcriptional activation with (n = 6) and without (n = 4) TNF-α administration across 10 mice each injected i.p. with 1 x 10⁶293T cells transiently transfected with plasmids PA+PB+PR over the course of 30 h is illustrated in FIG. 5. IY2H system-mediated fl expression shows a significant gain (P < 0.05) at 8 h as compared with the uninduced group. At 20 and 30 h, there is greater induction in the induced group relative to the uninduced group but it is not statistically significant. There is significantly greater (P < 0.05) fl expression at 8, 20, and 30 h in the induced group as compared with preinduction levels at 0 h. There is a greater variability in vivo as compared with cell culture results. These results demonstrate the ability to image the interaction of two proteins in living subjects. Discussion The present inventor has first show in cell culture that the IY2H systems show significant transactivation of fl expression only when there is coexpression of the genes coding for the two proteins JD and MyoD. Control studies using two noninteracting proteins (p53 and MyoD) show background levels of 7? expression as do controls using the reporter template alone or one of the two proteins (ID and MyoD) without its corresponding interacting protein partner. TNF-α-mediated induction of the IY2H system shows fl expression that is time- and dose-dependent. C6 and N_2a cells that lack TNF-α type 1 receptors also served as controls and do not show significant induction of/I expression in the presence of TNF-α.

The present inventor further tested the utility of the IY2H system in vivo to noninvasively and quantitatively image protein-protein interactions. To validate this system in vivo, several issues needed consideration. These included the development of (i) cell lines stably expressing the two effector and reporter constructs and (ii) construction of adenoviral or retroviral vectors containing all of the components of the system. Both approaches require considerable time before they can be tested in vivo. To develop an approach that can achieve quicker throughput and expedite the process of in vivo evaluation, transiently transfected 293T cells were injected i.p. in nude mice. The mice were imaged by using a sensitive, cooled CCD camera. The IY2H system was studied with and without TNF-α induction to enhance transcription from the NF-κB promoter. All IY2H mice displayed very low levels of fl expression immediately after cells were implanted. Eight hours after TNF-α administration, the mice representing the IY2H system showed a significantly greater level of fl expression when compared with mice that did not receive TNF-α. Relatively high levels of induction with an approximately 20-fold (8 h), 5 -fold (20 h), and 3 -fold (30 h) gain for the IY2H system over the mice not receiving TNF-α were observed. The level of IY2H-based_ι 7 expression in vivo is dependent on the pharmacokinetics of TNF-α availability to cells and likely is dependent on TNF-α dosage, frequency, and route of administration. In cell culture studies and in vivo, the peak induction is at 8 h. h cell culture at 24 h, there was an approximately 4-fold gain for the induced vs. uninduced system (FIG. 1A), which is comparable to an approximately 5-fold gain seen in vivo at 20 h (FIG. 5).

Preferably, the in vivo sensitivity of the IY2H system is high enough so that minimal levels of changes in protein-protein interaction can be detected in a living animal. An in vivo level of FL signal at 8 h for the induced system that was approximately 20-fold greater than the identical, noninduced system and approximately 60-fold greater than the system in which noninteracting protein partners (MyoD and p53) were transiently transfected was achieved. The level of induction for the noninduced and induced system will depend, in part, on the leakiness of the promoter and the degree to which it can be induced by TNF-α or other factors. Feedback-amplification strategies, more sensitive reporter genes, and the use of stable cell lines in which clones can be preselected with low levels of uninduced expression and high levels of induced expression can be used to further enhance the sensitivity potential. One disadvantage of using stable clones is the longer time it takes to isolate such clones, but, for cases in which prolonged studies of protein-protein interaction are needed, stable clones or transgenic models will be useful. Although the transiently transfected 293T cells were placed relatively close to the surface of the animal in the peritoneum, the cells actually can be placed anywhere within the mouse and enough light can be transmitted through tissues to be detected externally (Bhaumik, S. & Gambhir, S.S. (2002) Proc. Natl. Acad. Sci. 99: 377- 382). The exact location of cells may be important for studying specific protein-protein interactions while cells are in their normal environment.

In the current work, three distinct vectors were used to test the IY2H system. In future applications, a single vector can be used in which both the inducible systems and the reporter template are combined. With the use of appropriately placed multicloning sites, it should be possible to readily change the promoters, coding sequences for proteins of interest, as well as the reporter gene itself. This then would allow rapid testing of any two new proteins of interest. Although the firefly luciferase reporter gene was used in this example, it is easily possible to use a PET reporter gene (Gambhir, S.S. et al. (1999) Nucl. Med. Biol. 26: 481-490; Herschman, H. et al. (2000) J Neurosci. Res. 59: 699-705)), green fluorescent reporter gene (Yang, M. et al. (1998) Cancer Res. 58: 4217-4221), or other reporter genes (reviewed in Ray, P. et al. (2001) Semin. Nucl. Med. 31: 312-320) with the appropriate instrumentation for imaging expression in living animals. For a description of the use of optical imaging of firefly luciferase activity in living animals, see U.S. Pats. Nos. 5,650,135 and 6,217,847, the entire contents of which are incorporated by reference herein. It also should be possible to use fusion reporters (e.g., luciferase fused with a PET reporter gene) to perform imaging with multiple modalities on the same living animal.

Both components of the IY2H system were induced by the use of the NF-κB promoter. Even without induction with TNF-α, the NF-κB promoter shows transcriptional activity as evidenced by increasing fl expression over time. When expression of both protein- coding sequences is under control of the CMV promoter, then/? expression is the greatest. Although the current system was validated with the CMN and ΝF-κB promoters, in future applications, it may be desirable to use promoters that normally regulate expression of the coding region of the proteins of interest. It also may be important to be able to have the protein concentrations in a range that is near-equivalent to their normal ranges so that protein- protein interactions are not biased because of nonphysiological levels of protein concentrations.

Several limitations of the current approach merit some discussion. The current system cannot fully identify the time kinetics of protein-protein interaction. If two proteins interact for some time and then stop, it still may be the case that fl expression will persist even when the two proteins are no longer interacting. This is due to an inherent time lag in the IY2H system because it is only after sufficient levels of both proteins exist that one achieves transactivation of the reporter template. Future studies to look at the half-lives of the fusion proteins, reporter mRNA, and protein will help to better characterize the full kinetics of the current system. Alternate approaches that reconstitute a reporter protein directly through the interaction of two proteins of interest may allow more direct kinetic measurements of protein-protein interactions (Johnson N. & Varshavsky, A. (1994) Proc. Natl. Acad. Sci. 91: 10340-10344). It also should be noted that the current system is dependent on the two proteins of interest interacting in the vicinity of the reporter template. If the two proteins interact, but not in a location near the reporter template, then there may not be any transactivation.

Direct extensions of the current work should allow novel investigations of protein- protein interactions in living subjects. Studies of protein-protein interaction already have evolved significantly from studies in vitro to those in living cells. The present invention may be used to take an existing protein-protein interaction and study it in detail in the normal cellular environment of a living subject. The advantage of this methodology is that it allows extracellular factors that may modulate protein-protein interactions to be studied carefully. Furthermore, pharmaceuticals that can modulate protein-protein interaction now potentially can be tested directly in living subjects.

Example 2: Noninvasive Quantitative Imaging of Protein-protein Interactions in Living Subjects Using Reporter Protein Complementation and Reconstitution Strategies

Abbreviations: Flue, firefly luciferase enzyme/protein; flue, firefly luciferase reporter gene; NFluc, N-terminal half of firefly luciferase enzyme/protein; Nfluc, N-terminal half of firefly luciferase gene; CFluc, C-terminal half of firefly luciferase enzyme/protein; Cfluc, C- terminal half of firefly luciferase gene; CCD, charge-coupled device; CMV, cytomegalovirus; TNF-α, tumor necrosis factor α.

Plasmid constructs and reagents. The N-half of firefly luciferase gene (with C terminal linker peptide FFAGYC) was released from the vector pIRES DSL (Y/S) (Ozawa, T. et al. (2001) Anal. Chem. 73: 2516-21) by Nhe I and Hind III restriction enzymes and ligated to pcDNA 3.1(+) vector (Invitrogen, Carlsbad, California) backbone to construct vector PA^ The cDNA of gene id released from pBIND-Id of Promega's mammalian two hybrid system kit containing vector by BamHL and Xhol and cloned in the C-terminal of vector PAi to construct vector PCi. The N-half of DnαE was PCR amplified using the template pIRES E>SE (Y/S) and cloned in the H dIII site of vector PCi to construct vector PΕi .

The CMN promoter of the vectors PCi and PΕi were replaced by cloning the ΝFKB promoter/enhancer elements sub-cloned from the vector pΝFκB-Luc of Stratagene in pΕT15b at BgπiiHindUl restriction enzyme sites to construct vectors PGi and PΗi.

The amino acids between 72-390 of murine p53 gene were released from the vector supplied in the Mammalian Two hybrid assay kit of Stratagene and cloned to vectors PCi and PEi by replacing the fragment Id with restriction enzymes HmdIII and Xhol and constructed vectors PIi and P i. The vector PKi was constructed by ligating the Flue gene released from vector ρNFκB-Luc by Mel and Xhol to pcDNA 3.1 (+). The PCR amplified fragment of Cfluc containing start codon was cloned in the NTzel and Xhol site of pcDΝA 3.1 to generate vector PBi. The PCR amplified fragment of MyoD with start codon was ligated to pcDΝA 3.1 (+) in Nhel/BamHl site and further inserted with the PCR product of Cfluc with linker peptide CLKS in the EαmHI and Xl ol site to construct vector PDi. The PCR amplified C-half of DnaE was cloned at the Bam HI site of vector PDi to construct vector PFi.

Table 3. Plasmids used in Exam le 2

Linker 1 encodes FFAGYC polypeptide Linker 2 encodes CLKS polypeptide

Superfect transfection reagent, plasmid extraction kit, and DΝA gel extraction kit were purchased from Qiagen. TΝF-α, HRP substrates and antibiotics for bacterial culture were purchased from Sigma. Luciferase assay kit, monoclonal antibody against firefly luciferase and anti-mouse IgG - HRP conjugate, CheckMate mammalian two hybrids kit were purchased from Promega. Mammalian two-hybrid kit was purchased form Stratagene. D- Luciferin was purchased from Xenogen (Alameda, CA). Bacterial culture media were purchased from Difco. ECL kit was purchased from Amersham Pharmacia.

Cell culture. Human embryonic kidney cancer cells, 293T (ATCC, Manassas, VA) were grown in MEM supplemented with 10% FBS and 1% penicillin/streptomycin solution. The Ν _a cells (Mouse neuroblastoma cells) were obtained from V.P. Mauro (Scripps Research Institute, La Jolla, CA) and COS-1 (Monkey kidney cells) cells were grown in DMEM (high glucose) supplemented with 10% FBS and 1 % penicillin/ streptomycin. Cell Transfection and Luciferase assay. Transfections were performed in 80% confluent 24 hrs old cultures of 293 T, COS-1 and N _a cells. In 12 well plates, 200 ng/well Nfluc and 300-ng/well Cfluc were used for transfection. For the transfection in 100 mm petri dish 2 and 3 μg of Nfluc and Cfluc were used, respectively. Volumes of Superfect used were as recommended by the manufacturer. For cell induction, 0.05 μg/ml TNF-α were added immediately after transfection and assayed 24 hrs later.

Western blot analysis. Transfection (PC PD_b PEj, PF] and PKi) and co- transfection (PCi plus PDi and PEi plus PFi) of plasmid constructs were made in 293T cells. After 24 hrs incubation at 37° C and 5% CO₂, cells were washed twice in PBS and lysed mechanically in a buffer containing lOmM Tris- HCl (pH 8.0), ImM EDTA, ImM DTT with 20% glycerol and 0.1 mM PMSF. The samples were centrifuged at 4°C, 10,000 rpm for 5 minutes. Protein was estimated, and 10 mg of protein from each sample was mixed with two volume of sample buffer and boiled for 5 minutes. Denatured samples were electrophoresed in 12 % acrylamide gel and transferred to PVDF membrane using Hoefer semi blot apparatus. Membrane was immediately transferred to PBS containing 3% milk powder and blocked for 3 hrs with proper mixing. Membrane was incubated with primary antibody (monoclonal anti- Fluc antibody) overnight at room temperature with proper shaking. Washed membrane was incubated for 1 hr with donkey anti-mouse IgG-HRP conjugate for 1 hr. Immunochemical detection was carried out using the substrates from ECL kit of Amersham for 30 seconds and 5 minutes.

Imaging Split flue Expression in Living Mice Using a Cooled CCD Camera. The 293T cells were transiently transfected with plasmids PCi and PDi separately and co- transfected with P plus PDi. The cells were harvested after incubating in the medium with serum for 2 hrs post transfection. Cells were suspended in Phosphate Buffered Saline (PBS). An aliquot of 1 x 10⁶ cells from each combination (PCi, PDi, PCi plus PDi and mock transfected cells) were implanted subcutaneously in four different sites in the ventral side of anesthetized (ketamine-xylazine, 4:1) nude mice. Immediately after cell implantation, 100 μl D-Luciferin (30 mg/ml) was injected intraperitoneally and the mice imaged at one-minute intervals until reaching the maximum photon counts. For modulating in vivo imaging signals, 293T cells were transfected with plasmids PDi, PGi, and PDi plus PGi for evaluating the complementation strategy and with plasmids PFi, PHi, and PFi plus PHi for evaluating the reconstitution strategy. After transfection, cells were harvested and implanted subcutaneously in mice as described above. Following the first scan, the mice were injected intraperitoneally with 0.5 μg TNF-α and imaged 18 hrs later. The animals were then re-induced with equivalent concentration of TNF- α, and scanned 18 hrs later (i.e. at 36 hrs post implantation). A total of six mice were used for each strategy with equal number of controls. All mice were imaged using a cooled CCD camera (Xenogen JVIS, Xenogen Corp. Alameda, CA). The animals were placed supine in a light-tight chamber and a gray scale reference image was obtained under low-level illumination. Photons emitted from cells implanted in the mice were collected and integrated for a period of 1 minute. Images were obtained using Living Image Software (Xenogen Corporation, Alameda, CA) and Igor Image Analysis Software (Wavemetrics, Seattle, WA). To quantify the measured light, regions of interest were drawn over the tumor region showing light signal and maximum photons/sec/cm²/steridian (sr) were obtained as previously validated (Bhaumik, S. and Gambhir, S.S. (2002) Proc. Natl. Acad. Sci. 99: 377-82). Results

Cells transiently expressing Nfluc give greater activity than cells expressing Cfluc, but both are markedly less than cells expressing the full flue reporter gene, h order to achieve a low backgroimd signal it would be ideal for cells expressing each split half of flue to produce minimal activity when exposed to the substrate D-Luciferin. Transient transfection studies in COS-1, N _a, and 293T cells with either plasmid PA] or PBi alone show that NFluc produces 15 ± 5 fold higher background activity than CFluc alone (P < 0.01). Furthermore, the NFluc and CFluc activities were respectively 25-fold and >1, 000-fold less than in cells transfected with plasmid PKi (Flue), indicating relatively low background activity of each split reporter as compared to the intact full reporter.

To minimize the background activity of NFluc, it was determined that 200 ng DNA per well for any plasmid containing Nfluc is optimal when using 12-well culture plates (data not shown). This was the amount used for all subsequent transfection studies.

Complementation and reconstitution of Flue activity in transient transfection cell culture studies can be achieved through the interaction of proteins Id and MyoD. Co-transfection of plasmid constructs PCi plus PDi was studied in COS-1, 293T andN₂ cells to test the complementation strategy. Co-transfection of plasmid constructs PCi plus PDj shows respectively a 15 ± 5 fold or a 500 + 50 fold higher Flue activity than in cells transfected with either PCi or PDi alone (FIG. 8A, 293T cells) (the S.E.M. is across all three cell lines). The complementation activity achieved for PCi plus PDi is approximately 40- 60% of that for cells transfected with the plasmid encoding the full reporter (PKi). Co- transfection of constructs PDi plus PIi shows Flue activity which is approximately 10 fold less than P alone and approximately 100 fold less than the co-transfection of PC] plus PDi, consistent with a lack of any significant complementation when utilizing two non-interacting proteins (p53 and MyoD).

The Flue activity measured when co-transfecting with the plasmid constructs PEi plus PFi (reconstitution strategy) is not significantly higher than that from the constructs without intein (complementation strategy) in all three cell lines tested. (FIG. 8B, 293T cells). Again, the activity seen when using plasmids PEi plus PFi is significantly higher (P < 0.01) than when using PEi or PFi alone or PFj plus PJi (non-interacting protein control), and is approximately 45-60% of that for cells transfected with the plasmid encoding the full reporter (PKi). Similar results were obtained across all cell lines tested, except that the absolute level of Flue activity is highest with 293T cells, so these were used for all subsequent studies. These results demonstrate that both the complementation and reconstitution strategies are capable of producing significant specific signal following the interaction of MyoD and Id proteins in cell culture.

Western blot analysis from cell transfection studies shows the full Flue protein is recovered when using the reconstitution strategy. To verify the difference between the complementation and reconstitution strategies at the protein level, proteins isolated from 293T cells transfected with a combination of vector constructs were separated by SDS PAGE. Membrane transferred proteins were detected by using a monoclonal antibody against firefly luciferase. These results show a band position of approximately 80 kDa from firefly luciferase and the protein reconstituted from the cells co-transfected with vector constructs PEi plus PFi (FIG. 8C). The cells transfected with vector constructs PQ, PEi and PCi plus PDi (complementation strategy) synthesized fusion proteins carrying Id, MyoD, DnaE and parts of NFluc and CFluc show no visible bands at low exposure times (FIG. 8C, 30 seconds) but very weak bands are seen with longer exposure (5 minutes) (data not shown) due to low specificity against the monoclonal antibody used for detection. The cells transfected with vector constructs PDi and PFi show no detectable bands. These data support the finding that the monoclonal antibody specifically detected the complete Flue synthesized by cells transfected with plasmid PKi as well as luciferase protein reconstituted from the vectors carrying Nfluc and Cfluc with DnaE.

Flue activity can be modulated by TNF-α in cell culture for both the complementation and reconstitution strategies. To modulate the interaction of the split proteins, the CMN promoter in plasmid constructs PQ and PEi was replaced with ΝF-κB promoter/enhancer elements (KB4-PT_AL) to create plasmids PGi and PHi respectively (FIG. 7). To test the ability to modulate the system, plasmids PDi plus PGi (complementation strategy) or PFi plus PHi (reconstitution strategy) were transfected into 293T cells and induced with TNF-α for a 24-hour period. Flue activity obtained with Nfluc under the NF-kB promoter/enhancer element is 50 ± 10 % less than with the CMN promoter. The activity is significantly (P < 0.01) higher (13 ± 2 fold) than that of pre-induction levels in both strategies (FIG. 9). There is no significant difference when transiently transfecting cells with the plasmids PDi plus PGi versus PFi plus PHi. Co-transfection of plasmid constructs with CMN promoter PCi plus PDi or PEi plus PFi show smaller but significant induction (P = 0.009 and 0.02 respectively) with TΝF-α which is much less than the constructs with ΝF-κB promoter.

Flue activity recovered through protein-protein interaction mediated complementation/reconstitution can be imaged in living mice. Cooled CCD imaging of mice implanted with one million 293 T cells mock transfected, or transiently transfected with constructs PCi, PDi, or PCi plus PDi (complementation) show low background signal at time

0 [< 2.9 ± 0.7xl0³ p/s/cm²/steridian (sr)] and significant (P < 0.05) signal only from the cells co-transfected with constructs PCi plus PDi (2.5 ± 0.87 x 10⁵ ρ/s/cm²/sr) at time 16-24 hours. The signals from cells transfected with either P or PDi alone at 16-24 hours are 1.22 + 0.3 x 10⁴ p/s/cm²/sr and 6.08 ± 1.2 x 10³ p/s/cm²/sr, respectively. The animals implanted with cells transfected with PEi plus PFi (reconstitution) shows the signal that is 10 ± 2% greater with PCi plus PDi (complementation) but this is not statistically significant (images not shown).

Flue activity recovered through protein-protein interaction mediated complementation/reconstitution and modulated by TNF-α can be imaged in living mice. In order to test the effect of in vivo modulation on the split firefly luciferase system, we subcutaneously implanted nude mice in each of four separate body locations with one million transiently transfected 293T cells containing the constructs PDi, PG] and PD] plus PGj (complementation strategy), and mock-transfected cells. Similarly another set of mice was implanted with 293T cells transfected with plasmid constructs PFi, PHi, and PFi plus PHi (reconstitution strategy), and mock-transfected cells. Mice implanted with cells that did not receive TNF-α show relatively low signal over the course of 36 hours in both the complementation strategy (FIG. 10) and reconstitution strategy (FIG. 11). Mice intraperitoneally injected with TNF-α show significant increase in signal over the study period (P < 0.05). The split luciferase system-mediated flue expression shows a significant gain (P < 0.05) in the induced group than the uninduced group at 18 and 36 hours. These results demonstrate that it is possible to image in living subjects protein-protein interactions by both the inducible complementation and reconstitution strategies. Discussion This study validates the ability to use split firefly luciferase to monitor the interaction of two proteins in cell culture and in living mice, using both complementation and reconstitution strategies. Although previous studies have validated the use of various split reporters in cell culture (Rossi, F., Charlton, C. A. & Blau, H. M. (1997) Proc. Natl. Acad. Sci. USA 94: 8405-10; Ozawa, et al. (2001) Anal. Chem. 73: 2516-21; Ozawa, et al. (2001) Anal. Chem. 73: 5866-74; Rossi, F. M., et al. (2000) Met. Enzymol. 328: 231-51), this is the first study to do so in living subjects.

This is also the first study to demonstrate that complementation using split firefly luciferase is feasible. This complementation was demonstrated both in cell culture and in cells implanted in living subjects. Two known strongly interacting proteins, MyoD and Id, were chosen as the two test proteins, but it is likely that this system would be sensitive enough for detection of other protein partners as well, based on the robust levels of signal obtained. Importantly, the background level of split reporter signal is relatively low compared to the signal after protein interaction, both in cell culture and in living subjects. Transient transfection studies were used to readily validate this approach, but stable clones, viral gene delivery, as well as transgenic models could also be used. The optical bioluminescence approaches have been shown to be relatively sensitive at all depths and locations within a living mouse (Rossi, F. M., et al. (2000) Met. Enzymol. 328: 231-51) so that the current approach could potentially be applied to study protein-protein interactions anywhere within a mouse model. The choice of the NF-κB promoter in the current work was due to the ability to induce this promoter in vivo as characterized in our previous study (Ray, P., et al. (2002) Proc. Natl. Acad. Sci. USA 99: 3105-3110). Future applications could potentially link expression of each split reporter to different endogenous promoters so as to better mimic endogenous protein levels.

The reconstitution strategy results in the formation of a new complete reporter protein that maintains its activity even in the absence of continuing interaction between the protein partners. A portion of the optical signal obtained from the intein mediated split reporter protein strategy may include activity obtained from complementation as opposed to solely reconstitution. The western blot analysis supports that significant reconstitution is occurring in the reconstitution strategy (PEi+PFi), but quantitation of the exact amount will require further investigation. The reduction in the optical signal observed as compared to using the fully intact reporter protein may in part be due to the use of split intein with split exteins, and also due to the efficiency of the two interacting proteins in bringing the inteins together. It has been reported that the intact intein-mediated trans-splicing of exteins occur rapidly even at wide range of temperatures and the kinetics of the intermediate steps have been investigated (Martin, D. D., Xu, M. Q. & Evans, T. C, Jr. (2001) Biochemistry 40, 1393- 402).

In the complementation strategy, fusion proteins need protein interaction to be maintained to retain reporter activity. The reconstitution and complementation strategies yield comparable signal allowing for the use of either approach without a compromise in reporter sensitivity. One might expect that reconstitution might be more sensitive since it produces intact reporter protein, but complementation was found to be a comparable approach for Flue with the current choice of protein partners (MyoD and Id). The ability of the complementation approach to work in cell culture and in vivo should allow this robust strategy to be utilized in various future applications. The complementation strategy is easier to implement, and if proven as robust with many different protein partners, may be the preferred strategy over reconstitution. Moreover, the split reporter strategies (complementation and reconstitution) can be used to study cellular events that occur in any part of the cell, solving a key limitation of the yeast two-hybrid approach. Further studies will illustrate the relative merits of the reconstitution, complementation, and yeast two-hybrid approaches. Other split reporters may be useful with other noninvasive imaging modalities (e.g., split Herpes Simplex Virus Type-1 thymidine kinase reporter proteins for use with PET), as well as approaches to link split reporters to small antisense oHgodeoxynucleotides for potential imaging of endogenous mRNA levels. Systems imaging approaches to study cells in their normal environment within an animal subject should be facilitated with the approaches developed herein. The approaches developed should provide an efficient system for the continuous observation of protein-protein interactions in a particular network pathway under different conditions in vivo. Direct extensions of the current approach should also lead to the ability to study pharmaceuticals that modulate protein-protein interactions in living subjects in order to accelerate and expand the scope of drug development and testing in an in vivo setting.

Example 3. Monitoring Protein-Protein Interactions Using Split Synthetic Renilla Luciferase Protein-Fragment-Assisted Complementation

Abbreviations, hrluc, synthetic renilla luciferase enzyme/protein; hrluc, synthetic renilla luciferase reporter gene; N-hrluc, N-terminal portion of synthetic renilla luciferase enzyme/protein; N-hrluc, N-terminal portion of synthetic renilla luciferase reporter gene; C- hrluc, C-terminal portion of synthetic luciferase enzyme/protein; C-hrluc, C-terminal portion of synthetic renilla luciferase gene; flue, firefly luciferase enzyme/protein; split-flue, N and C portions of firefly luciferase enzyme/protein; TNF-α, tumor necrosis factor α. Chemicals, Enzymes, and Reagents. Restriction and modification enzymes and ligase were purchased from New England Biolabs (Beverly, MA). PCR amplification was used for generating the fragments of N and C portions of the synthetic renilla luciferase gene at each split point using the primers shown in Table 4 and the template plasmid phRL-CMV from Promega (Madison, WI). The cDNA of genes Id and MyoD were amplified from Promega's CheckMate Mammalian two-hybrid system kit containing vectors pBIND-Id and pACT-MyoD, respectively, by using the primers listed in Table 4. The NFKB promoter/enhancer element was used from the vector pNFκB-Luc of Stratagene (La Jolla, CA). Superfect transfection reagent, plasmid extraction kits, and DNA gel extraction kits were purchased from Qiagen (Valencia, CA). TNF-α and antibiotics for bacterial culture were purchased from Sigma (St. Louis, MO). CheckMate Mammalian two-hybrid kit was purchased from Promega. Coelenterazine was purchased from Biotium (Hayward, CA). Bacterial culture media were purchased from Difco (Franklin Lakes, NJ). Cell culture medium, FBS, penicillin, streptomycin, sodium bicarbonate, and all cell culture plates were purchased from GJ-BCO BRL (Frederick, MD). Construction of Plasmids. The N and C portions of the synthetic renilla luciferase gene for each split point linked in-frame with the coding sequence for the interacting proteins Table Η Nucleotide Sequence and the Positions of PCR Primers with Linkers Used for Constructing the Different Split Synthetic Renilla Luciferase Clones primer name primer sequence {5' — 3') position

N forward primer ATATGCTAGCC ACC ATGCCT CC A AGCTCT 1 - 16

NP I reverse primer ATATGAATTCCCGAGCCCACCACTCAGGCC 69-50

NP 2 reverse primer ATATGAATTCTCTAGCC ACGCGCTCC ATCT 216- 197

NP 3 reverse primer ATATGAATTCAGCCCCCCAGTCGTGGCCCA 369-350

NP 4 reverse primer ATATGAATTCATCCTCCTCGATGTCACGCC 486-467

NP 5 reverse primer ATATGAATTCCATCTCGCGACCCCAGGA 669-652

NP 6 reverse primer ATATGAATTCGCCTCCCTTAACGAGAGG 687-670

C reverse primer ATATCTCGAGTTACTGCTCGTTCTTCAGCAC 933-913

CP 1 forward primer ATATGGATCCTGCAAGCAAATGAACGTGCTG 70-90

CP 2 forward primer ATATGGATCCTGCATCATCCCTGATCTGATC 217-237

CP 3 forward primer ATATGGATCCTGTCTCGCCTTTCACTACTCC 370-390

CP 4 forward primer ATATGGATCCATCGCCCTGATCAAGAGCGAA 4S7- 507

CP 5 forward primer ATATGGATCCCCTCTCGTTAAGGGAGGCAA 670-689

CP 6 forward primer ATATGGATCCAAGCCCG ACCTCGTCCAG ATT 688- 708

Id forward primer with linker ATATGAATTCGGTGGCGGAGGGAGCGGTGGCGGAGGGAGCCATAAATTC

Id reverse primer ATATCTCGAGATTAACCCTCACTAAAGC

MyoD forward primer ATTAGCTAGCCCGAGTGCCACAAAGTTAAGACC

MyoD reverse primer with linker ATATGGATCCGCTCCCACCTCCCCCTGAACCGCCTCCACCAACCACCTG ATAAATCGCATTGGGGT

* The bold letters in each primer sequence are the regions of the restriction enzyme recognition site

were amplified from the plasmid templates using the corresponding primers indicated in

Table 4. The primers were designed with convenient restriction enzyme sites for cloning. A linker sequence (GGGGS)₂ was added to the forward primer of Id and reverse primer of MyoD. The clones were constructed in a pcDNA 3.1(+) vector backbone. The clones confirmed by sequencing were used for the study (Figure 12C). Plasmids were constructed using techniques well known in the art.

Cell Culture. Human embryonic kidney cancer cells, 293T (ATCC-CRL-11268, Manassas, VA) were grown in MEM supplemented with 10% FBS and 1% penicillin/streptomycin solution. The N_2a cells (mouse neuroblastoma cells) were obtained from V. P. Mauro (Scripps Research Institute, La Jolla, CA) and COS-1 (monkey kidney cells) cells were grown in DMEM (high glucose) supplemented with 10% FBS and 1% penicillin streptomycin. C6 rat glioma cells were maintained in glucose-deficient DMEM supplemented with 0.01% histidinol, 10% FBS, and 1% penicillin/streptomycin/glucose. U87 human malignant glioma cells purchased from ATCC (HTB-14) were grown in MEM supplemented with 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 0.15% sodium bicarbonate, 1% penicillin/streptomycin, and 10% FBS.

Cell Transfection and Luciferase Assay. Transfections were performed in 80% confluent 24-h-old cultures of 293T, COS-1, N_2a, C6, and U87 cells. In 12-well plates, 100 ng/well of DNA for plasmids containing the N portion of synthetic renilla luciferase gene (N- hrluc) and 500-ng/well for plasmids containing the C portion of synthetic renilla luciferase gene (C-hrluc) were used for transfection. For transfection, different combinations of DΝA were mixed with 75 μL of serum-free medium and 6 μL of Superfect and were kept at 25 °C for 10 min. The cells were washed twice with phosphate buffered saline (PBS) pH 7.0. The DΝA/superfect complex was mixed with 400 μL of complete medium and added to the cells. The cells were incubated at 37°C with 5% CO₂ for 3 h. After 3 h, the cells were washed twice with PBS, 1 mL of complete medium was added, and the cells were incubated at 37 °C with 5% CO₂. The cells were assayed for luciferase activity after 24 h. For comparison of different optical reporters, 100 ng/well of DΝA from flue, hrluc, rluc, and N- hrluc plasmids with coding sequences was used. The plasmids containing N-hrluc DΝA concentration (100 ng/well) were considered for the comparison of different optical reporter genes. Because C-hrluc provides only the remaining part of the protein for activity recovery, even if it is expressed in greater quantity, there will not be any increase in the net hrluc activity due to its low background activity. Volumes of Superfect used were as recommended by the manufacturer. For cell induction, 0.05 μg/mL TΝF-α was added immediately after transfection and assayed 24 h later. The luminometer assay for renilla luciferase was performed by following a previously published protocol. In brief, the cells were lysed in 200 μL of lx passive lysis buffer from Promega by placing them in a shaker for 15 min at 25°C. The lysates were collected and centrifuged for 5 min at 10 000 rpm at 25 °C. The samples were assayed by mixing 20 μL of cell supernatant (renilla luciferase enzyme), 1 μL of the substrate coelenterazine (1 mg/mL), and 100 μL of 0.05 M sodium phosphate buffer at pH 7.0, followed by photon counting in the luminometer (Turner Designs, model no. T 20/20, Sunnyvale, CA) for 10 s at 25 °C. Similarly, using Promega's luciferase assay kit, the assay for firefly luciferase was performed. The readings were normalized by measuring the concentration of proteins from the cell lysates by using the Bio-Rad (Hercules, CA) protein assay reagent and represented as relative light units (RLU) per microgram of protein per minute. Results and Discussion Split Synthetic Renilla Luciferase Shows Complementation-Based Restoration of

Enzyme Activity by the Fragments Generated from Two out of Six Chosen Split Sites. Complementation-based restoration of enzyme activity by two interacting proteins requires correctly folded portions of the proteins in close proximity. Six different sites were selected to generate fragments of N and C portions of the synthetic renilla luciferase reporter protein to study the protein-protein interaction-assisted folding to form active enzyme (Figure 12A,B). The flexible linker (GGGGS)₂ was used between the interacting proteins and the fragments of synthetic renilla luciferase to enhance proper folding (Figure 12C). (Galarneau, A.; Primeau, M.; Trudeau, L. E.; Michnick, S. W. Nat. Biotechnol. 2002, 20, 619-622.) The split site selected at nucleotide position 687-688, located after coding regions for two consecutive glycine molecules, shows efficient recovery of the hrluc activity through the interaction of the MyoD and Id proteins (Figure 13). The cells cotransfected with vector constructs carrying N and C portions of the synthetic renilla luciferase gene without interacting proteins or with noninteracting proteins (MyoD and p53) show significantly higher signal than mock-transfected cells but significantly lower than that obtained from MyoD and Id interaction. The split site at nucleotide position 669-670 shows complementation activity that is 20% less than the split site at nucleotide position 687-688 (data not shown). The other four sites studied did not lead to fragments that recovered significant activity relative to background. Construct N-hrluc-ld shows significantly higher (P < 0.05) activity than the C-/zr/wc-MyoD construct or studies employing mock transfection. The recovery of activity from the split sites at nucleotide positions 669-670 and 687-688 indicates that both of these split points are probably in a region of the hrluc protein that only partially affects the active site(s) of the protein molecule. The identification of other sites to generate protein fragments that might yield potentially better complementation-assisted activity necessitates the availability of a well-established crystal structure for the protein or the selection of additional split sites by permutation combination. There may be a possibility that future studies could reveal more optimal split sites, but the 687-688 split site should be useful for future studies because of its relatively low background and high complementation- based signals. The remainder of the studies were, therefore, performed only with the constructs made using the split site at nucleotide position 687-688.

The Signal Achieved Through Split Synthetic Renilla Luciferase Activity Is Significantly Higher than Split Firefly Luciferase after MyoD-Id Interaction. To compare the sensitivity of split synthetic renilla luciferase and split firefly luciferase with the interacting proteins MyoD and Id, transfection and cotransfection of different vector constructs with and without interacting proteins and intact native renilla luciferase, synthetic renilla luciferase, and firefly luciferase were studied in 293T cells. The signal achieved through MyoD- Id interaction-mediated split synthetic renilla luciferase activity from the cells cotransfected with constructs is significantly more (P < 0.01) (a factor of x 2) than the cells cotransfected with vector constructs with N and C portions of firefly luciferase fragments with the same interacting proteins (Figure 14A). The signal achieved through MyoD-Id interaction-mediated split synthetic renilla luciferase activity from the cells cotransfected with constructs is 10 + 2% of the cells transfected with intact synthetic renilla luciferase, 8 + 1 times more than the activity seen from cells transfected with native renilla luciferase, and 90 +_5% of the activity of cells transfected with intact firefly luciferase (Figure 14A). The N portion of the split protein encoded by 75% of the hrluc gene shows significant signal over mock-transfected cells (P < 0.05) (Figure 13). The activity obtained from the cells transfected with C-hrluc and C-hrluc-MyoD is not significantly different from mock- transfected cells (Figure 13). These results indicate that the split synthetic renilla luciferase system is more sensitive than the split firefly luciferase system under the conditions tested. These data also support the finding that the split synthetic renilla luciferase is as robust as the native firefly luciferase.

Split Synthetic Renilla Luciferase Shows Protein-Fragment-Assisted Recovery of Enzyme Activity by MyoD-Id Interactions in All Five Different Cell Lines Studied. Transfection and cotransfection of the N and C portions of synthetic renilla luciferase gene with and without interacting proteins were studied in 293T, C6, COS-1, N_2a and U87 cells. The cotransfection of N and C portions of synthetic renilla luciferase with the interacting proteins MyoD and Id shows significantly higher (P < 0.01) activity (15 + 5 times) than the cells transfected with N-hrluc, N-hrluc-ld, and N-hrluc + C-hrluc in 293T cells (Figure 13). The ratio of recovered activity obtained in C6, U87, COS-1, and N_2a cells was similar to 293T cells. The magnitudes of the activity obtained through protein interactions from different cell lines studied are on the order of 293T (highest), N_2a (60 ± 5% activity of 293T cells), COS-1 (45 ± 10% activity of 293T cells), U87 (30 ± 5% activity of 293T cells), and C6 (20 + 10%) activity of 293T cells). The variations in the activity observed in different cell lines are likely due to different transfection efficiencies and different transcriptional/translational efficiencies. The efficiency of transfection and the level of transgene expression depends on various parameters, including the types of promoters used, types of cell lines used, types of vector backbone used for cloning the transgene, and also the types of proteins expressed. (Siedow, A.; Gratchev, A.; Hanski, C. Eur. J. Cell Biol. 2000, 79, 150-153.)

Split Synthetic Renilla Luciferase Activity Can Be Modulated by TNF-α by Controlling the Expression Level of One Fragment under NFKB Promoter Enhancer

Elements. The protein-protein interaction-mediated split synthetic renilla luciferase activity can be modulated by controlling the level of expression of one of the two fragments generated for the study. The NFKB promoter/enhancer element was used for modulating the level of expression of N-hrluc-ld. Transfection and cotransfection of 293T cells with N-hrluc- Id carrying NFkB promoter/enhancer elements and C-hrluc-My driven by the CMV promoter induced with TNF-α for a period of 24 h show a significant (P < 0.01) increase (30 +5 times) in their enzyme activity over the cells without TNF-α (Figure 14B). The cells transfected with NFκB-N-hrluc-ld with TΝF-α show activity similar to N-hrluc under CMV promoter. The signal seen by the cells transfected with ΝFκB-N~/.r/«c-Id without TΝF-α and C-hrluc with and without TΝF-α is not significantly different from the mock-transfected cells. These results verify the ability to modulate the signal by controlling levels of transcription of one of the two split reporters.

To date, several techniques have been developed for studying protein-protein interactions, and each has its own advantages and limitations. Many proteins identified for studying protein interactions have been identified by the formation of homotetramers by intracistronic complementation of mutants. ( ehrman, T.; Kleaveland, B.; Her, J. H.; Balint, R. F.; Blau, H. M. Proc. Νatl. Acad. Sci. U.S.A. 2002, 99, 3469-3474.) Larger proteins may be sterically hindered during the complementation process. (Rossi, F. M.; Blakely, B. T.; Blau, H. M. Trends Cell Biol. 2000, 10, 119-122.) Selections of irreversible mutants with no self-complementation properties are important for developing an intracistronic complementation system. The protein-fragment-assisted complementation assay uses the fragments of the protein that lack the selfcomplementation problem. Therefore, it is essential to use small monomeric reporter molecules that might avoid all of the abovementioned obstacles to development of an ideal system to study protein-protein interactions for various applications. The synthetic renilla luciferase encoding a 36-kDa monomeric optical reporter protein is a suitable small protein identified for studying protein-protein interactions through a protein-fragment-assisted complementation strategy. The limitation associated with the use of renilla luciferase is its relatively rapid reaction kinetics requiring early time-point measurements. (Bhaumik, S.; Gambhir, S. S. Proc. Νatl. Acad. Sci. U.S.A. 2002, 99, 377- 382.) Because of its optical nature with signal amplifiable through an enzymatic process, it may prove to be a unique reporter system for studying protein-protein interactions in cells and small living animals. This system can be further extended for studying protein-protein interactions using different protein partners with variable affinity to potentially obtain a significant signal from weaker interactions. The split synthetic renilla luciferase can also be tested with intein- mediated reconstitution approaches in further studies, and some of the current split sites have already been selected on the basis of this potential future application. The splicing-mediated split-protein approach generates reconstituted complete protein and is less dependent on the characteristics of the split sites, as long as the required components for the protein splicing mechanism are present. (Wu, H.; Xu, M. Q.; Liu, X. Q. Biochim. Biophys. Acta 1998, 1387, 422-432; Wu, H.; Hu, Z.; Liu, X. Q. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 9226-9231; Lew, B. M.; Mills, K. V.; Paulus, H. Biopolymers 1999, 51, 355-362.) In contrast, the protein- fragment-assisted complementation approach described here maintains the portions of the protein in a nonligated state. Hence, it is important to identify the exact site to generate fragments that can fold properly without disturbing the active site. (Michnick, S. W.; Remy, I; Campbell- Valois, F. X.; Vallee-Belisle, A.; Pelletier, J. N. Methods Enzymol. 2000, 328, 208-230.) Leucine-zipper-based complementation (Ghosh, I.; Hamilton, A. D.; Regan, L. J. Am. Chem. Soc. 2000, 122, 5658-5659) and intein (VMAl)-mediated protein splicing have been studied in GFP (green fluorescent protein) and its variant EGFP (enhanced green fluorescent protein), respectively, using fragments generated by two different split positions. These studies support the fact that it is not necessarily one identical site that would work optimally for both complementation and inteinmediated splicing strategies. The splicing mediated split firefly luciferase has been reported with amino acid modifications at the split sites to compensate splicing machineries. (Ozawa, T.; Takeuchi, M.; Kaihara, A.; Sato, M.; Umezawa, Y. Anal.Chem. 2001, 73, 5866-5874; Ozawa, T.; Kaihara, A.; Sato, M.; Tachihara, K.; Umezawa, Y. Anal. Chem. 2001, 73, 2516-2521.) As well, intracistronic complementation using ,β-galactosidase has been reported with the selection of two inactive mutants, one with a deletion of 30 amino acids and a second with the N-terminal 788 amino acids that restore enzyme activity when complementation occurs. (Rossi, F.; Charlton, C. A.; Blau, H. M. Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 8405-8410; Rossi, F. M.; Blakely, B. T.; Blau, H. M. Trends Cell Biol. 2000, 10, 119-122.) A drawback associated with the use of mutants for studying protein complementation is the formation of self-complemented molecules that produce reporter signal even in the absence of protein interactions. In this study, the present inventor succeeded in obtaining active split renilla luciferase fragment- assisted complementation through protein-protein interaction. The development of advanced systems to quantify optical reporter signals from both cell culture and living subjects may lead to many new applications to help understand fundamental intracellular processes as well as development of drugs to modulate them.

It should be noted that although the present invention has been described herein with reference to its use in mice, the methods are applicable to other animals as well. In general, the present technique can be used with any animal up to about the size of a large rat. hi addition, the present technique may be used with animals of any size, including those larger than mice and rats, so long as the signal can be detected. Generally, in larger animals bioluminescent signals can be detected from a source located within about 2 centimeters of the outer surface of the animal. It should be further noted that although the reconstitution method for testing protein-protein interactions has been described with reference to dnaE intein, other inteins may used, as will be appreciated by one of skill in the art.

While this invention has been described in detail with reference to a certain preferred embodiments, it should be appreciated that the present invention is not limited to those precise embodiments. Rather, in view of the present disclosure, which describes the current best mode for practicing the invention, many modifications and variations would present themselves to those of skill in the art without departing from the scope and spirit of this invention. The scope of the invention is, therefore, indicated by the following claims rather than by the foregoing description. All changes, modifications, and variations coming within the meaning and range of equivalency of the claims are to be considered within their scope.

Claims

WHAT IS CLAIMED IS :

1. A noninvasive method for detecting the interaction of a first protein ("X") with a second protein ("Y") within a living subject, comprising providing a first vector, comprising a polynucleoti.de encoding X fused to gal4 gene operably linked to a first promoter; providing a second vector, comprising a polynucleotide encoding Y fused to vplό gene operably linked to a second promoter; administering the first vector and the second vector to the living subject; administering to the living subject a reporter template comprising a GAL4-binding site upstream of a mimmal promoter and a reporter gene, wherein the reporter gene encodes a light-emitting polypeptide; expressing the GAL4-X fusion protein; expressing the VP16-Y fusion protein; after a period of time in which the GAL4-X fusion protein can interact with the VP16-

Y fusion protein and the GAL4-X-Y-VP16 protein can interact with the GAL4-binding site on the reporter template to transactivate the reporter gene to thereby express the light- emitting polypeptide, immobilizing the living subject within the detection field of a photodetection device, and detecting light emission from the living subject.

2. The method of claim 1, wherein the reporter gene is selected from the group consisting of firefly luciferase gene, PET reporter gene, renilla luciferase gene, synthetic renilla luciferase gene and green fluorescent reporter gene.

3. The method of claim 2, wherein the reporter gene is firefly luciferase gene.

4. The method of claim 3, further comprising the step of administering D- luciferin to the living subject.

5. The method of claim 1 , wherein the first promoter is an inducible promoter.

6. The method of claim 5, wherein the first promoter is NF-kB promoter.

7. The method of claim 6, further comprising administering TNF-α to induce the NF-κB promoter.

8. A noninvasive method for detecting the interaction of a first protein ("X") with a second protein ("Y") within a living subject, comprising providing a first vector encoding a first linked polypeptide, comprising a polynucleotide encoding an N-terminal portion of a reporter gene linked to a polynucleotide encoding X via a first polynucleotide linker ("n-reporter-linkerl-x"); providing a second vector encoding a second linked polypeptide, comprising a polynucleotide encoding a C-terminal portion of the reporter gene linked to a polynucleotide encoding Y via a second polynucleotide linker ("c-reporter-linker2-y"); administering the first vector and the second vector to the living subject; expressing the first linked polypeptide ("N-reporter-linkerl-X"); expressing the second linked polypeptide ("C-reporter-linker2-Y"); and after a period of time in which N-reporter-linkerl-X can interact with the C-reporter- Iinker2-Y via the interaction of X and Y to thereby recover reporter activity through complementation of N-reporter and C-reporter, detecting reporter activity.

9. The method of claim 8, wherein the reporter gene is firefly luciferase gene.

10. The method of claim 9, further comprising the steps of administering D- luciferin to the living subject.

11. The method of claim 10, wherein reporter activity is detected by immobilizing the living subject within the detection field of a photodetection device and detecting light emission from the living subject.

12. The method of claim 8, wherein the first polynucleotide linker encodes the polypeptide FFAGYC.

13. The method of claim 8, wherein the second polynucleotide linker encodes the polypeptide CLKS.

14. A noninvasive method for detecting the interaction of a first protein ("X") with a second protein ("Y") within a living subject, comprising providing a first vector encoding a first linked polypeptide, comprising a polynucleotide encoding an N-terminal portion of a reporter gene linked via a first polynucleotide linker to an N-terminal portion of dnaE operably fused to a polynucleotide encoding X ("n-reporter-linkerl-n-dnaE-x"); providing a second vector encoding a second linked polypeptide, comprising a polynucleotide encoding a C-terminal portion of the reporter gene linked via a second polynucleotide linker to a C-terminal portion of dnaE operably fused to a polynucleotide encoding Y ("c-reporter-linker2-c-dnaE-y"); administering the first vector and the second vector to the living subject; expressing the first linked polypeptide ("N-reporter-linkerl-DnaE-X"); expressing the second linked polypeptide ("C-reporter-linker2-DnaE-Y"); allowing a period of time sufficient for the first linked polypeptide to interact with the second linked polypeptide via the interaction of X and Y to thereby recover reporter activity through reconstitution of reporter polypeptide via intein mediated splicing of N-reporter and C-reporter; and detecting reporter activity in the living subject.

15. The method of claim 14, wherein the reporter gene is firefly luciferase gene.

16. The method of claim 15, further comprising the step of administering D- luciferin to the living subject.

17. The method of claim 16, wherein reporter activity is detected by immobilizing the living subject within the detection field of a photodetection device and detecting light emission from the living subject.

18. A method to determine efficacy of a test compound administered to modulate or block the interaction of a protein X with a protein Y in a living animal, the method comprising: providing a first vector, comprising a polynucleotide encoding X fused to gal4 gene operably linked to a first promoter; providing a second vector, comprising a polynucleotide encoding Y fused to vplό gene operably linked to a second promoter; administering the first vector and the second vector to the living subject; administering to the living subject a reporter template comprising a GAI-4-binding site upstream of a minimal promoter and a reporter gene, wherein the reporter gene encodes a light-emitting polypeptide; administering the test compound to the living animal; expressing the GAL4-X fusion protein; expressing the NP16-Y fusion protein; after a period of time in which the GAL4-X fusion protein can interact with the VP16- Y fusion protein and the GAL4-X-Y-VP16 protein can interact with the GAL4-binding site on the reporter template to transactivate the reporter gene to thereby express the light- emitting polypeptide, immobilizing the living subject within the detection field of a photodetection device, and detecting light emission from the living subject.

19. The method of claim 18, wherein the reporter gene is selected from the group consisting of firefly luciferase gene, PET reporter gene, renilla luciferase gene, synthetic renilla luciferase gene and green fluorescent reporter gene.

20. The method of claim 19, wherein the reporter gene is firefly luciferase gene.

21. The method of claim 20, further comprising the step of administering D- luciferin to the living subject.

22. The method of claim 18, wherein the first promoter is an inducible promoter.

23. The method of claim 22, wherein the first promoter is ΝF-κB promoter.

24. The method of claim 23, further comprising administering TNF-α to induce the NF-kB promoter.

25. A method to determine efficacy of a test compound administered to modulate or block the interaction of a polypeptide X with a polypeptide Y in a living subject, the method comprising: providing a first vector encoding a first linked polypeptide, comprising a polynucleotide encoding an N-terminal portion of a reporter gene linked to a polynucleotide encoding X via a first polynucleotide linker ("n-reporter-linkerl-x"); providing a second vector encoding a second linked polypeptide, comprising a polynucleotide encoding a C-terminal portion of the reporter gene linked to a polynucleotide encoding Y via a second polynucleotide linker ("c-reporter-linker2-y"); administering the first vector and the second vector to the living subject; administering the test compound to the living subject; expressing the first linked polypeptide ("N-reporter-linkerl-X"); expressing the second linked polypeptide ("C-reporter-linker2-Y"); and after a period of time in which N-reporter-linkerl-X can interact with the C-reporter- Iinker2-Y via the interaction of X and Y to thereby recover reporter activity through complementation of N-reporter and C-reporter, detecting reporter activity.

26. The method of claim 25, wherein the reporter gene is firefly luciferase gene.

27. The method of claim 26, further comprising the steps of administering D- luciferin to the living subject.

28. The method of claim 27, wherein reporter activity is detected by immobilizing the living subject within the detection field of a photodetection device and detecting light emission from the living subject.

29. The method of claim 25, wherein the first polynucleotide linker encodes the polypeptide FFAGYC. ^•'

30. The method of claim25, wherein the second polynucleotide linker encodes the polypeptide CLKS.

31. A method to determine efficacy of a test compound administered to modulate or block the interaction of a polypeptide X with a polypeptide Y in a living subject, the method comprising: providing a first vector encoding a first linked polypeptide, comprising a polynucleotide encoding an N-terminal portion of a reporter gene linked via a first polynucleotide linker to an N-terminal portion of dnaE operably fused to a polynucleotide encoding X ("n-reporter-linkerl-n-dnaE-x"); providing a second vector encoding a second linked polypeptide, comprising a polynucleotide encoding a C-terminal portion of the reporter gene linked via a second polynucleotide linker to a C-terminal portion of dnaE operably fused to a polynucleotide encoding Y ("c-reporter'linker2-c-dnaE-y"); administering the first vector and the second vector to the living subject; administering the test compound to the living subject; expressing the first linked polypeptide ("N-reporter-linkerl-DnaE-X"); expressing the second linked polypeptide ("C-reporter-linker2-DnaE-Y"); allowing a period of time sufficient for the first linked polypeptide to interact with the second linked polypeptide via the interaction of X and Y to thereby recover reporter activity through reconstitution of reporter polypeptide via intein mediated splicing of N-reporter and C-reporter; and detecting reporter activity in the living subject.

32. The method of claim 31 , wherein the reporter gene is firefly luciferase gene.

33. The method of claim 32, further comprising the step of administering D- luciferin to the living subject.

34. The method of claim 33, wherein reporter activity is detected by immobilizing the living subject within the detection field of a photodetection device and detecting light emission from the living subject.