WO2004042081A1 - Specific haplotypes of the mdr1 gene and their use in diagnosis and therapy - Google Patents

Abstract

The invention relates to specific constellations of the genetic variability of the MDR1 gene, expressed in the form of haplotype pairs, and to their use for individual drug therapy and for predicting the risk of tumor diseases in humans. The invention also relates to the identification of additional functionally relevant haplotypes of the MDR1 gene.

Description

 Specific haplo types of the MDRI gene and their use in diagnosis and

therapy

The present invention relates to specific constellations of the genetic variability of the MDRI gene, expressed in the form of haplotype pairs, and their use for individual drug therapy and for risk prediction of tumor diseases in humans. The present invention also relates to the identification of further functionally relevant haplotypes of the MDRI gene.

The "Multidrug Resistance Gene" MDR-1 (cDΝA sequence database number NM_000927, SEQ ID No. 7, also M29428 for Exon6_Intron6_Exon7, M29432 for Exon l l_Intronl l_Exon 12_Intron 12_Exonl3, M29440 for Exon 21 and M294 NT79 for Exon 21 and M294 Exon 17) hereinafter referred to as "reference sequences", genomic sequence in part in Chen et al. 1990) is a representative of the ATP-binding cassette (ABC) superfamily of membrane transporters (also called ABCB1), which contains various important proteins, among others. of drug transport coded. MDRI, also known as PGY1 or GP170, was discovered more than 20 years ago that it has an ability to confer so-called "multidrug" resistance to antineoplastic agents in tumor cells (Juliano RL, Ling V., 1976) Chromosome 7-located MDRI gene encodes the P-glycoprotein (PGP), which, via an ATP-dependent mechanism, contains a number of chemically unrelated lipophilic compounds (including digoxin, anthracyclines, vinca alkaloids, amitriptylines, as well as antineoplastic (antineoplastic) drugs for cancer therapy and Sestamibi) was exported to extracellular space (Seelig A., 1998, Kerb et al. 2001).

The PGP also plays an important role in mass transport through the blood-brain barrier. It is involved in the excretion of xenobiotics and medication in bile and urine, protecting the body from toxic substances, but also influencing drug absorption from the gastrointestinal tract. PGP is mainly located in the apical membrane of excretory cells in the liver, kidney, intestinal tract, and the endothelial cell layer of the capillary blood vessels at blood-tissue barrier sites. The potential role of PGP on pharmacokinetics and clinically significant Drug-drug interactions have been widely studied. Important active ingredients, such as the immunosuppressant cyclosporin A or the HIV protease inhibitor indinavir, are influenced by intestinal PGP, which can lead to serious clinical consequences (Schinkel et al, 1995, Kim et al., 1998).

The MDRI consists of 28 exons (sequence regions coding for the protein) with the intronic sequence regions lying between them, the coding region comprising 3845 base pairs. Worldwide studies of the sequence variability of this gene have led to the discovery of a total of 48 nucleotide exchanges, so-called SNPs (single nucleotide polymorphism), in various ethnic groups

3 in the non-coding sequence area,

26 in intronic areas, and

19 variants in coding areas (Pauli-Magnus et al., 2002).

A few variants lead to amino acid changes in the encoded PGP protein. Little is known about the functional importance of the intronic sequence regions, nor about the possible meaning of the SNPs in exonic regions that do not result in an amino acid exchange and no transcription stop. Pauli-Magnus et al. (2002) predicted 134 different haplotypes using the Clark method when investigating the variability of the MDRI gene in 247 people.

The MDRI gene has been studied intensively for several years. A number of papers have been published on the genetic variability of this gene in various ethnic populations, which in addition to examining the variability also aim to clarify the meaning of individual SNPs and to relate them to the function of the PGP.

In the course of the elucidation of the human genome, it has shown itself to be more variable than originally assumed. A large number (of almost 100 variants) of SNPs is already known for individual genes. These sequence variants of a particular gene do not occur in all conceivable combinations on a chromosome, but certain, specific combinations have developed in the course of evolution, which are to be referred to here as haplotypes. The number of actually existing haplotypes in a population can still be very high Comparison to the theoretically possible of 2 ⁿ with n biallelic variants, whereby their frequencies are usually very different. A particular challenge of genome research is to find the combinations of a gene sequence that are important for the expression and function of the gene products and their networks. It is assumed that individual SNPs are irrelevant because they have arisen accidentally, but have not had a negative effect on the organism carrying it, while other SNPs, in combination, influence various functions of the organism in an order of magnitude relevant to the organism. This influence can be both positive and negative depending on the specific function under consideration and other genetic and non-genetic factors. In the course of evolution, both function-relevant and functionally insignificant sequence variants may have been combined, ie not every sequence variant in a combination must necessarily make its own relevant contribution to the function-changing overall contribution of the haplotype.

The MDRI gene has been studied intensively for several years. The following work on genetic variability should be mentioned in this context:

Hoffmeyer et al. (2000) and Cascorbi et al. (2001), which contain own investigations and besides the examination of the frequencies also about a significant association of the

Report polymorphism at position 3435 on the expression level of the protein and on the steady-state plasma concentration of digoxin, and

Goto et al. (2002) on the C ₃₄₃₅ T polymorphism and its possible effect on the

Expression level of CYP3 A4, and

Tang et al. (2002) on haplotype profiles and coupling imbalance in the MDRI gene in three Asian populations.

The work of Tang et al. examines in particular the coupling imbalance between the four common SNPs they found in the three Asian populations and the frequencies of the haplotypes formed from the three SNPs at positions 1236, 2677 and 3435 in the coding sequence region. They suspect that the associations of the SNP reported at position 3435 by various groups should be due to a strong coupling imbalance to a previously undiscovered variant in the MDRI gene that causes the functional changes. In particular, two of the variants of the MDRI gene, namely the variant at position 3435 in exon 26 and the variant at position 2677 in exon 21, were examined particularly intensively with regard to their association with various functional parameters of drug transport. This is an investigation by Kim et al. (2001) on the transport capacity of the PGP of fexofenadine in an African-American and an American population of European origin. The work of Kim et al. represents genotypes as haplotype pairs. Then the genotypes which correspond to positions 2677 and 3435 either on both chromosomes of the reference sequence or which are mutated on both chromosomes are compared individually in terms of their fexofenadine transport and a difference between the two homozygous forms postulated in each case. Kim et al (19) describe the MDRI genotypes on the basis of allelic combinations (haplotype pairs), derived from the 11 polymorphisms determined in their investigation. They also analyzed the most common allelic combinations * 1 / * 1, 1/2 and * 2 / * 2, the assignment of which was based on differences in the DNA sequences of MDRI positions 1236, 2677 and 3435, and the postulated genotype phenotype Associations for fexofenadine kinetics.

In a work by Kurata et al. (2002) on the transport capacity of the PGP for digoxin in a Japanese population, a similar study for digoxin transport was carried out for the three genotypes. They postulated that the genotype of the MDRI gene affects drug transport.

It is an object of the present invention to provide a method for analyzing the genetic variability of the MDRI gene, expressed in the form of specific haplotype pairs, and thus a reliable individual drug therapy and diagnosis and risk prediction of tumor diseases of the individual mammal, in particular humans to enable.

According to a first aspect of the present invention, this object is achieved in a mammal by a method for diagnosing mass transport and / or a genetic predisposition for a disease which is related to the specific constellations of the genetic variability of the MDRI gene in a mammal Steps include: determining the haplotype of the MDRI gene, comprising analyzing at least five "Single Nucleotide Polymorphisms" (SNP) in an MDRI genomic Locus-derived nucleic acid or a fragment thereof, which was obtained from the mammal, the analyzed SNPs from the specific combination of at least 1) exon 6 + 139: C-> T, 2) cDNA 1236: C-> T, 3) exon 17-76: T-> A, 4) cDNA 2677: G-> T or G-> A, and cDNA 3435: C-> T (Chen et al., 1990).

The haplotype analysis that led to this invention does not assume that only a single SNP affects function, as described in the work by Tang et al. was assumed, but it is based on the assumption that the specific combination of several SNPs, in this case five, affects the function. The present invention thus relates to the constellations of the genetic variability of the MDRI gene, expressed in the form of specific haplotype pairs, which exist due to the occurrence of genetic sequence variants in the human population, and for reliable individual drug therapy, and for the diagnosis and risk prediction of tumor diseases of the individual human being can be used.

It is based on the haplotype pair of a test subject, the haplotype being based on the specific combination of at least five intronic and exonic variants, namely exon 6 + 139, cDNA 1236, exon17-76, cDNA 2677 and cDNA 3435. It has now been found that these haplotypes play a decisive role in the expression and transport performance of endogenous and exogenous substances of the encoded protein, and also play a role in tumor genesis.

A preferred embodiment of the method for diagnosis and risk prediction according to the invention further consists in determining the haplotype pair of the MDRI gene for a human by means of the method according to the invention as stated above and the subsequent comparison of the haplotype pair found in the mammal with the risk profiles for the examined Mass transfer and / or genetic predisposition to the disease.

The diagnostic method according to the invention thus preferably consists of the following general sub-steps: 1. provision of the genomic material of a mammal or a human, 2. determination of the genotype by means of methods known per se, 3. determination of the haplotype pair by means of corresponding prediction programs or Laboratory determination, and 4. Comparison of the haplotype pair found in a subject with the risk profiles for the transport function under consideration or the cancer.

The essence of the invention lies in a complex view of the already known information on the variability of the MDRI gene, which makes it possible to explain previous contradictions in the interpretation and to use the genomic variability of the MDRI gene for risk prediction at a higher level. This enables increased accuracy in the prediction of certain phenotypes regarding the MDRI gene, which was not possible with any of the previously known analyzes.

The present invention thus shows for the first time that the presence in humans of specific haplotypes as part of the genotype of the MDRI gene, which are formed from a combination of at least five SNPs, represents a genetic risk factor for the predisposition to cancer or an influence on it Expression and transport capacity of the PGP possesses and thus the individual transport of many important drugs, such as Digoxin determined.

In the context of the present invention, the term “predisposition” means that it can relate to all aspects of the disease or the transport capacity, such as, for example, the subtype, but also to the form, the severity and the age of onset of a cancer, depending on others factors.

In the context of the present invention, the term “risk profile” means a compilation of examination data of the respective patient or a specific patient group, which has been obtained on the basis of further medical examinations. Such examinations include further genetic analyzes, such as, for example, parentage, kinship and family analyzes Analysis of other genes, data from risk groups, such as drug users, smokers, overweight people, medical history, cultural and social living conditions, diet, nutrition, amount of physical activity and belonging to a specific race.

“Analysis” of “single nucleotide polymorphisms” (SNP) in an MDRI genomic locus derived nucleic acid or a fragment thereof means in the sense of the present invention both the analysis of one of the five specific SNPs mentioned, namely exon 6 + 139: C-> T, cDNA 1236: C-> T, Exonl7 -76: T-> A, cDNA 2677: G-> T or G-> A and cDNA 3435: C-> T. Alternatively, it is also possible to analyze an SNP that is coupled with a frequency of essentially 100% to an SNP of the five specific SNPs mentioned. This coupled SNP thus provides the same statistical information as the SNP of the combination mentioned (or the “set”). Furthermore, the term analysis also includes the examination of the above-mentioned SNP positions in different human races, for example the Afro-American one , Asian or Caucasian breed and the analysis of the SNP positions should not be restricted to a specific nucleotide exchange, as in the above case of the SNP cDNA 2677: G-> T or G-> A, for example, two different mutations / There are exchanges, both of which can be used for analysis.

In the context of the present invention, the terms “allele” and “haplotype” are used synonymously. A haplotype can be characterized both by a single sequence variant and by the combination of several sequence variants in one chromosome, based on the specified positions.

The inventors have now found that certain variants of MDRI for mass transport and / or a genetic predisposition for a disease which is related to the specific constellations of the genetic variability of the MDRI gene are diagnostic in a mammal. In addition to being used for diagnosis, some of these variants can bring about the observed effect directly by a functional modification of the production of the MDRI protein in the cells. Furthermore, these variants can be used to determine further polymorphisms with diagnostic and / or functional relevance which are expected to be closely linked to the other sequence variants by phenomena such as "linkage disequilibrium". Although all five polymorphisms of the present invention were previously described as For the first time, the present invention provides genetic and therapeutically meaningful and useful haplotypes as combinations of two known as haplotypes.

A method of the present invention is preferred, in which the mass transport involves the transport of digoxin, antibiotics such as vinblastine and cyclosporin A, and antineoplastic (antineoplastic) drugs for cancer therapy, in particular by means of Blood-brain barrier, the placental barrier (Smit et al, 1999) and / or the excretion of xenobiotics and drugs in bile and urine. The following additional substances may be present in their transport and thus their effects and / or side effects changed by the present haplotype: aldosterone, amprenavir, bilirubin, cimetidine, diltiazem, indinavir, itaconazole, loperamide, sparfloxocin, vecuronium, chlorpromazine, cisplatin, clozapine, CP 117227, flunitrazepam, haloperidol, methotrexate, pararosaniline, prenylamine, promazine, quinacrine 2HC1, a-factor pheromone, aldosterone, amiodarone, azidopine, bepredil, BIBW22BS, bisanthen, catharantine, cefazolin, cefantarone, cefotarine, 100 Dexamethasone, dexniguldipine, dibucain, dilitazem, dipyrdiamol, domperidone, emetin, S-farnesylcysteine methyl ester, cis-flupenthixol, fluphenazine, FK506, gallopamil, GF120918, hydrocortisone, ivermectin, loperamide, methylbenone trinone, methadone trinone, methadone trinone, methadone trinone, methadone trinone, methadone trinate -6-glucoronide, nicardipine, ondansetron, phenazine, phenoxazine, phenytoin, prazosin, progesterone, quinidine, R hodamid 123, S9788, SDB-ethylenediamine, spiperdone, tacrolimus, tamoxifen, terfenadine, tetraphenylphosphonium bromide, thioridazine, topotectan, trifluorperazine, triflupromazine, Triton X-100, valinomycin, verapamil, vindolin, epinolinolinoxinolubin, yohinobinoxin, yohinobinoxin , Erythromycin, etoposide, isosafrol, midazolam, nifedipine, phenobarbital, puromycin, reserpine, rifampicin, taxol and vincristine. The diagnosis can be made, for example, in the context of the following diseases: AIDS (HIV infection, Speck et al., 2002), Parkinson's disease (Furuno et al. 2002), Alzheimer's disease (Vogelsang et al. 2002) and / or cardiomyopathy (Meissner et al, 2002). For all of these diseases and conditions, the present haplotype or the haplotype pair can enable an improved and more accurate diagnosis and thus an improved therapy or prevention. The invention is therefore not limited to the digoxin presented here by way of example.

A method of the present invention is further preferred, the disease comprising a cancer, in particular colon cancer.

According to the method of the present invention, the SNPs according to the invention can be determined by means of sequencing, "mini-sequencing", hybridization, restriction fragment analysis, oligonucleotide ligation assay or allele-specific PCR. Applicable techniques include DNA sequencing, including mini-sequencing, "primer extension", hybridization with allele-specific oligonucleotides (ASO), oligonucleotide ligation assays (OLA), PCR using allele-specific primers (ARMS), "dot blot" analysis, "Flap probe cleavage" approaches, restriction fragment length polymorphisms (RFLP), kinetic PCR, and PCR-SSCP, fluorescence in situ hybridization (FISH), pulse field gel electrophoresis (PFGE) analysis, Southern blot analysis, single strand conformation analysis (SSCA), denaturing gradient Gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), denaturing HPLC (DHPLC), MALDI-TOF analysis, multiplex sequencing and RNAse protection assays, but are not limited to this. All of these techniques are currently known to those skilled in the art and are described in more detail below.

The nucleic acid that forms part of the method according to the present invention can be DNA, genomic DNA, RNA, cDNA, hnRNA or mRNA.

For a known polymorphism, the direct determination of the respective genotype is usually the method of choice. Prior art approaches for industrial high-throughput genotyping are based on one of four different mechanisms: allele-specific primer extension, allele-specific hybridization, allele-specific oligonucleotide ligation and allele-specific cleavage of a flap probe (Kwok, Pharmacogenomics 1, 95 (2000)) The sequencing or mini-sequencing protocols are part of the primer extension procedure, eg genomic DNA sequencing, either manually or by automated means and can detect sequence variations of the MDRI gene (Nucleic Acids Res 25, 2032-2034 (1997). The mini-sequencing (primer extension) technology is based on determining the sequence on a specific base by allowing the extension of a primer by one base directly at the variant site (Landegren et al., Genome Res. 8: 769-76 (1998)). Short sequencing reactions coupled with an alternative detection method are the basis of the Real time pyrophosphate sequencing (Nyren et al., Science 281: 363 (1998)).

Allele-specific hybridization protocols are based on probes that recognize one or more of the variants present at the SNP position. Various techniques have been developed for the detection of a hybridization event. In the 5 'nuclease test and in In the molecular "beacon assay", the hybridization probes are fluorescently labeled and the probe binding is demonstrated by changes in the behavior of the fluorescent marker (Livak, Genet. Anal. 14, 143 (1999); Tyagi et al, Nαt. Biotechnol. 16, 49 (1998 Hybridization events can take place in a liquid matrix or occur with either the probe or the target bound to a solid phase, so hybridization is also used when arrays (arrays or microchips or chips) are used for genotyping. Such a chip typically exists from thousands of distinct nucleotide probes, which are arranged in an arrangement on a silicon chip. The nucleic acid to be analyzed is / is fluorescently labeled (in our case a sample which contains the MDRI gene or a part thereof that spans the position to be compared SEQ ID No. 1 to SEQ ID No. 6) and hybridized to the probes on the chip allows the parallel processing of thousands of samples and probes at the same time and can significantly speed up the present analysis. The use of this method is described in various publications (Hacia et al., Nature Genetics 14, 441 (1996); Shoemaker et al., Nature Genetics 14, 450 (1996); Chee et al., Science 274, 610 (1996) ; DeRisi et al., Nature Genetics 14, 457 (1996), Fan et al., Genome Res, 10, 853 (2000)).

In a preferred embodiment of the method of the present invention, the SΝPs are thus analyzed in a “high-throughput format”, in particular by means of a DNA or RNA chip.

Allele-specific oligonucleotide ligation assays are highly specific. Oligonucleotides that differ in the allele-specific base at the 5 'or 3' end are only processed by a ligation reaction if they are perfectly bound to the template at the respective oligonucleotide end. This method was coupled with fluorescence resonance energy transfer (FRET) labeling to create a homogeneous test system (Chen et al. Genome Res. 8, 549 (1998)). Allele-specific cleavage of a flap probe uses the properties of the recently discovered flap endonucleases (cleavases) to cleave structures formed by two overlapping oligonucleotides. In this approach, two overlapping oligonucleotides are bound to the polymorphic site. The cleavage reaction then shows which oligo is in perfect agreement with the target sequence (Lyamichev et al, Nat. Biotechnol. 17: 292 (1999)). Other methods that detect specific base variations usually only allow a lower throughput of samples, such as, for example, allele-specific oligonucleotide (ASO) hybridization. For allele-specific PCR, primers are used which hybridize at their 3 'ends to one of the specific MDRI base variations according to the invention. A respective PCR product is only observed for existing variants (Ruano and Kidd, Nucleic Acids Res 17, 8392 (1989)). A specificity-increasing modification of the allele-specific PCR is the amplification refractory mutation system, as described by EP 0 332 435 and in Newton et al., Nucleic Acids Res 17, 2503 (1989). If the variations lead to changes in the specific recognition sites of nucleic acid processing enzymes, methodologies such as restriction fragment length polymorphism (RFLP) probes or PCR-RFLP methods can also be used to detect these variations.

Other approaches only demonstrate the changes that exist with respect to the reference sequence. Many of these methods are based on the formation of mismatches if both variants are present in the same sample. A recently very popular method is the use of denaturing high performance liquid chromatography to distinguish heteroduplex from homoduplex molecules (DHPLC; Oefner, PJ et al. Am J Hum Genet 57 (Suppl.), A266 (1995)). Another method is denaturing gradient gel electrophoresis (DGGE) (Wartell et al., Nucleic Acids Res 18, 2699, (1990); Sheffield et al., Proc Natl Acad Sei USA 86, 232 (1989)). Using DGGE, variations in the DNA can be detected by different migration rates of allelic variants in a denaturing gradient gel. A variation is the "clamped" denaturing gradient gel electrophoresis (CDGE; Sheffield et al, Am J Hum Genet 49, 699 (1991)), heteroduplex analysis (HA; White et al., Genomics 4, 560 (1992)) and chemical Mismatch cleavage (CMC; Grompe et al. Proc Natl Acad Sei USA 86, 5888 (1989)) The use of proteins that recognize nucleotide mismatches, such as the E. coli mutS protein, can be used in the detection of mismatch DNA molecules (Modrich, Ann. Rev. Genetics, 25, 229 (1991)). In the mutS assay, the protein only binds to sequences that have a nucleotide mismatch in a heteroduplex between mutants and wild-type sequences. RNase protection assays are different Option (Finkelstein et al., Genomics 1, 167 (1990)). The RNAse Protection Assay involves cleaving the mutant fragment into two or more small fragments. Another way is Use of the single-stranded conformation polymorphism assay (SSCP; Orita et al., Proc Natl Acad Sei USA 86, 2766 (1989)). Variations in the DNA sequence of the MDRI gene from the reference sequence are detected due to an altered mobility of the corresponding DNA fragments in SSCP gels. SSCP detects bands that migrate differently because the variation causes a difference in the single-strand intra-molecule base pairing. Other methods detect specific types of mutations, such as deletions, duplications or insertions, for example a protein truncation assay or the asymmetric test. However, these tests will not detect any "missense" mutations.

Indirect methods, as described above, for the detection of sequence variations would be particularly useful for screening relatives for the presence of a sequence variation occurring in an affected family member and thus for the haplotype.

Other approaches for the detection of small sequence variations known to those skilled in the art can also be used.

Detection of the polymorphisms / point mutations can be achieved by amplification, for example by PCR, from genomic or cDNA and sequencing of the amplified nucleic acid or by cloning the MDRI allele and sequencing the variants using well known techniques.

In a preferred embodiment of the present invention, at least one of the nucleotide changes in a sample is detected by a mammal by hybridizing an MDR1 gene probe that hybridizes specifically to the alternative forms of the polymorphism / variant nucleic acids containing at least one of the changes and detecting a hybridization product , the presence of the product indicating the presence or absence of change in the sample.

In the present context, the MDRI gene probes, for example oligomeric DNA sequences with a length of between 15 to 50 bases, are synthesized with at least one, preferably two, bases and are hybridized individually under stringent conditions, which is a distinction between a single base allows. Suitable stringent Conditions are to be determined by a person skilled in the art without inventive step and are determined, inter alia, taking buffer strengths, temperature and length of the oligomers into account. The oligomers of SEQ ID No. are particularly preferred. 1 to SEQ ID No. 6. Alternatively, under less stringent conditions, a combination (set) of MDRI probes from 15 to 50 bases in length, which contains all four different bases at the polymorphic position of the DNA strands to be analyzed, for typing by hybridization, can be used. The results obtained in this case from all hybridization experiments with different proportions / levels of base complementarity must be analyzed by an algorithm in order to predict the final nucleotide configuration at the variant site.

In a preferred embodiment of the invention, a nucleotide change is detected by amplifying all or part of an MDRI gene in the sample using a set of conserved primers for the MDRI gene to be amplified to produce amplified MDRI nucleic acid, then Sequencing the amplified MDRI nucleic acid and detecting the presence of the nucleotide change.

Preferred is a method according to the present invention in which a) at least five SNPs according to the present invention are amplified by amplifying all or part of the MDRI nucleic acid in the sample using a set of MDRI specific primers to amplify MDRIs To produce nucleic acids, b) subsequent sequencing, for example Mini-sequencing, the amplified MDR1 nucleic acids and c) detecting the presence of the at least five SNP and thereby the presence of the nucleotide changes in the sample.

In the context of the present invention, the combination of the 5 variants is used synonymously for the haplotype, formed from these 5 variants.

Another aspect of the present invention thus relates to the determination of the combination of five nucleotide sequences on each chromosome, which essentially consist of the continuous nucleotides of each of SEQ ID No. 1 to SEQ ID No. 6 exist, and where the haplotype, or the haplotype pair for the diagnosis of mass transport and / or a genetic predisposition for a disease related to the specific Constellations related to the genetic variability of the MDRI gene in a mammal is suitable.

Another aspect of the present invention relates to a combination of five isolated oligonucleotides or polynucleotides, which essentially consist of the continuous nucleotides of each of SEQ ID No. 1 to SEQ ID No. 6, and where the SNP variants are suitable for the diagnosis of mass transport and / or a genetic predisposition for a disease which is related to the specific constellations of the genetic variability of the MDRI gene in a mammal. Preferably, the isolated oligonucleotide or polynucleotide can also contain a detectable marker, e.g. have a radionuclide, fluorophore, peptide, enzyme, antigen, antibody, vitamin or steroid. A combination of isolated polynucleotides, consisting of five individual isolated polynucleotides, is essential for the improved accuracy of the analysis. However, other oligonucleotides or polynucleotides can also be used for the analysis.

Thus, a combination according to the invention is particularly preferred in which the oligo- or polynucleotides further comprise a detectable marker, e.g. B. a radionuclide, fluorophore, peptide, enzyme, antigen, antibody, vitamin or steroid. These labeled probes can then be z. B in one of the above Use procedure.

In a preferred embodiment of the present invention, the mammal to be examined is a human.

Another aspect of the present invention relates to a method in which a combination of SNP variants is detected, which consists of five SNP variants. It is known that such haplotype determination in which the haplotype is characterized by individual specific SNPs. ie the determination of the combination of the specific sequence variants on a chromosome can be carried out both by molecular genetic and by theoretical methods. The molecular genetic methods are extremely complex and expensive and so far hardly feasible over large sequence areas. Standard methods are allele-specific PCR (AS-PCR), peptide nucleic acid (PNA) -mediated PCR "clamping" or cloning methods, the use of MALDI-TOF is also possible under certain conditions. For this reason, the theoretical methods that estimate the haplotypes from the genotypes of a sample are still the most common methods. The first known theoretical method for determining the haplotype pair that corresponds to a genotype was developed by Clark et al., (1990) and is based on the reliably determinable haplotypes that occur in a sample. Haplotypes can always be reliably determined from genotypes if at most one sequence variant occurs in the genotype in heterozygous form. The disadvantage of this method is that it only provides a possible result via an iterative process, but it does not exhaust the available information from the composition of the entire sample using statistical methods.

Computer programs for the determination of haplotypes such as EH (Terwilliger and Ott, 1994), HAPLO (Hawley and Kidd, 1995), Arlequin (Excoffier and Slatkin, 1995) and the method of Long et al. (1995) serve to estimate the haplotype frequencies in a population and generally use EM algorithms to generate maximum likelihood estimates of the haplotype frequencies. An improved method that leads to higher computing speed and usually allows the inclusion of more than 30 biallelic variants is the method by Rohde and Fürst (2001). For the analysis of genotype-phenotype relationships, it is preferable to use algorithms that assign each pair of genotypes to a sample its haplotype pair. Newer methods and computer programs have been developed for this, e.g. the algorithm by Zhang et al. (2001, personal communication), by Stephens et al, (2001, PHASE) or e.g. the module SAS / Genetics ™ / PROC HAPLOTYP as a commercial product.

The analysis of the haplotypes or the haplotype pairs enables the improvement according to the invention in the accuracy of the diagnosis. In a preferred embodiment of the present invention, the analysis of the genotype / haplotype-phenotype relationship enables the determination of at least one haplotype or a haplotype pair which has a dependency (association) with a statistical significance of at least 0.05 on the phenotype parameter under consideration. As phenotype parameters e.g. the presence of a disease, the severity of a disease, side effects of therapy, parameters for mass transport, such as AUC, Cmax, etc. in question.

Methods for finding relationships between the haplotype or haplotype pair and the diagnostic parameter are special methods for genotype-phenotype analysis and can be carried out by means of statistical parametric methods such as correlation, regression, variance or covariance analyzes, by means of non-parametric methods such as, for example, contingency table analyzes, Mann-Whitney U test or Kruskal-Wallis test, by means of classification methods such as cluster analyzes, methods of artificial intelligence such as Neural networks, genetic algorithms, fuzzy methods, algebraic methods such as combinatorics, graphic methods or all possible other methods of data mining, in particular also by a suitable combination of these methods.

Another aspect of the present invention relates to the use of the combination of the isolated oligonucleotides or polynucleotides of the present invention for the diagnosis of mass transport and / or a genetic predisposition for a disease in a mammal that is related to the specific constellations of the genetic variability of the MDRI gene Is related. The haplotype according to the invention can also be expanded to include these new variants by adding further specific sequence variants that exist in nature, so that the quality of the diagnosis and analysis can be further increased by considering these expanded haplotypes or pairs of haplotypes.

In a preferred embodiment of the present invention, the combination of isolated oligonucleotides or polynucleotides essentially consists of the continuous nucleotide sequences of the at least five SNP variants according to SEQ ID NO 1 to 6.

Another aspect of the present invention relates to the use of a combination of isolated oligo- or polynucleotides according to the present invention for the diagnosis of mass transport and / or a genetic predisposition for a disease in a mammal, which is related to the specific constellations of the genetic variability of the MDRI gene related. The diagnosis can be carried out using the methods of the present invention, e.g. as stated above. In addition, the combination of isolated oligonucleotides or polynucleotides according to the invention can be used for diagnosis and analysis in combination with further SNP variants.

Another aspect of the present invention relates to a diagnostic kit, the kit comprising means for detecting the at least five SNPs according to SEQ ID No. 1 to SEQ ID No. 6, together with other components and / or auxiliary substances. Such means are preferably at least one probe for the detection of at least one SNP according to SEQ ID No. 1 to SEQ ID No. 6. The kit may also contain other components and / or enzymes for performing the methods of the present invention, for example as indicated above. The kit preferably contains the combination of oligo- or polynucleotides according to the invention, together with further components and / or auxiliaries.

Finally, a further aspect of the present invention relates to a method for the treatment or prevention of a modified mass transport and / or a disease in a mammal, which has a genetic predisposition to a disease which is related to the specific constellations of the genetic variability of the MDRI gene , The method comprises the steps of a) determining the haplotype, comprising analysis of at least the SNPs according to SEQ ID No. 1 to 6 of the MDRI gene by a method according to the present invention, and b) administering to the mammal an effective dose of a pharmaceutical composition which is suitable for delaying, reducing and / or preventing the modified mass transport and / or the disease.

In the case of a modified mass transfer, such pharmaceutical compositions preferably contain such an amount of active ingredient that compensates for the changed mass transfer. However, other drug-active substances can also be administered, which are removed less quickly from the organism, in order to improve the therapy. Preferred substances are those known to be transported by MDRI, such as e.g. Digoxin, antibiotics such as vinblastine and cyclosporin A and / or antineoplastic drugs for cancer therapy. This compensation of the change in the mass transport can also be used in the context of cancer therapy or prevention of such a disease. The composition of pharmaceuticals for the above Purposes are well known to those skilled in cancer therapy and are easy to determine and formulate.

The invention will be explained in more detail using the following examples with reference to the attached figure and the sequence listing. It shows

SEQ ID No. 1: the region of the sequence of the MDRI gene around SNP exon 6 + 139: C-> T,

5 '-GAG AC AAAATTCCTTCTAAGC AGCAA-C / T-AATGTCGTGTGC ATCCTTTTGT-3'

SEQ ID No. 2: the region of the sequence of the MDRI gene around SNP cDNA 1236: C-> T, 5'-CGAAAAGAAGTTAAGATCTTGAAGGG-C / T-CTGAACCTGAAGGTGCAGAGTG-

3 '

SEQ ID No. 3: the region of the sequence of the MDRI gene around SNP Exon17-76: T-> A,

5'-TACAATTCTTACATACGCACAAAAATT-T / A-ATATCCTATCCTTATTCCTTATC-

3 '

SEQ ID No. 4: the region of the sequence of the MDRI gene around SNP cDNA 2677: G-> T,

5'-TGAAAGATAAGAAAGAACTAGAAGGT-G / T-CTGGGAAGATCGCTACTGAAGC-

3 '

SEQ ID No. 5: the region of the sequence of the MDRI gene around SNP cDNA 2677: G-> A,

5'-TGAAAGATAAGAAAGAACTAGAAGGT-G / A-CTGGGAAGATCGCTACTGAAGC-

3 '

SEQ ID No. 6: the region of the sequence of the MDRI gene around SNP cDNA 3435: C-> T,

5 '-AGCCGGGTGGTGTC AC AGGAAGAGAT-C / T-GTGAGGGC AGC AAAGGAGGCC A-

3 '

SEQ ID No. 7: the cDNA sequence of MDRI (NM_000927),

SEQ ID No. 8: Primer MDR-11 (5'-TGTTTTCAGCTGCTTGATGG-3 ') from Example 1,

SEQ ID No. 9: Primer MDR-12 (5'-AAGGCATGTATGTTGGCCTC-3 ') from Example 1,

SEQ ID No. 10: probe (A) from example 1 (5'-LC-Red640-GGAAGAGATCGTGAGGGCAG-p),

SEQ ID No. 11: probe (B) from example 1 (5'-GACAACAGCCGGGTGGTGTCA-Flu),

SEQ ID No. 12: Primer MDR-9 (5'-TGCAGGCTATAGGTTCCAGG-3 ') from Example 1,

SEQ ID No. 13: Primer MDR-10a (5'-TTTAGTTTGACTCACCTTCCCG-3 ') from Example 1,

SEQ ID No. 14: Primer MDR-10 (5'-GTTTGACTCACCTTCCCAG-3 ') from Example 1,

SEQ ID No. 15: Primer MDRI 3 (5'-AGGTTTCATTTTGGTGCCTG-3 ') from Example 1,

SEQ ID No. 16: reverse primer MDR-14 (5 ^* -GAACAAAAGGATGCACACGACAAT-

3 ') from example 1,

SEQ ID No. 17: Primer MDR-15 (5'-TATCCTGTGTCTGTGAATTGCC-3 ') from Example 1,

SEQ ID No. 18: Primer MDR-16 (5'-CCTGACTCACCACACCAATG-3 ') from Example 1,

SEQ ID No. 19: Primer MDR-20 (5'-TTGTCAACATTTTTTTGAAGC-3 ') from Example 1,

SEQ ID No. 20: Primer MDR-21 (5'-TATTATTGCAAATGCTTGC-3 ') from Example 1,

SEQ ID No. 21: Primer LC-1, 5'-AGCCAAGTATTGACAGCTATTCG-3 ') from Example 1,

SEQ ID No. 22: Primer LC-2, 5'-AGTCTAGCTCGCATGGGTCAT-3 ') from Example 1,

SEQ ID No. 23: hybridization probe HS-1; 5'-LightCycler Red640-

TTCAGGTTCAGACCCTTCAAGATCT-P from Example 1 and SEQ ID No. 24: HS-2; 5'-GCCACCGTCTGCCCACTCTGCAC-Flu from Example 1.

Figure 1: shows the schematic structure of the genomic DNA of the MDRI gene according to Chen et al., 1990. The start and stop codon is marked in bold. In addition, the SNP positions are also shown in bold.

Example 1: Identification of a risk of developing colon cancer using the genotypes or haplotypes of the MDRI gene

A group of 289 colon cancer patients, 138 men and 151 women, as well as 275 control patients, 135 men and 140 women who had not developed colon cancer by the time of the examination (hereinafter referred to as controls) were admitted to five hospitals in the European part of Russia (Voronezh Regional Oncological Dipensary, Voronezh Clinical Hospital, Voronezh Central Railway Clinic, Lipetsk Clinical Hospital and Lipetsk Regional Oncological Dipensary) between September 1999 and May 2000. All patients were Caucasians of Russian origin, people of other origins were excluded from the study. Only cases with histologically verified colorectal cancer were included. Among the cases were 190 (65.7%) incidence cases and 99 prevalent cases with earlier tumor resection. For the prevalent cases, the mean time since diagnosis was 13 months. Colorectal cancer was classified according to the international classification for oncological diseases on histological type and tumor phase. The control group was adapted to the cancer group in sex and age. The controls were hospitalized patients with a variety of clinical diagnoses but no malignancy, based on medical history and routine examinations. The main diagnoses were eye diseases, pulmonary and cardiovascular diseases, surgical cases, trauma and neurological diseases. The individual data and information about the status as a smoker, alcohol consumption and meat consumption were given. Before the examination, all patients gave their written informed informed consent. The study was approved by the Moscow Central Ethics Committee in charge.

The subjects were genotyped as follows: 10 ml of venous blood was obtained from each person examined. The leukocytes were isolated in the Clinical Pharmacology Department of the Voronezh Burdenko State Mediacal Academy and at -20 ° C stored. The samples were transported to the Institute for Clinical Pharmacology at the Charite in Berlin for further processing. The DNA was extracted manually by standard phenol / chloroform procedures.

In the case of Exon 26 C3435T, all samples were genotyped using a polymerase chain reaction (PCR) based restriction fragment length polymorphism (RFLP) test and a LightCycler test. For the LightCycler test, the samples were amplified with the primers MDR-11 (5'-TGTTTTCAGCTGCTTGATGG, SEQ ID No. 8) and MDR-12 (5'-AAGGCATGTATGTTGGCCTC, SEQ ID No. 9) and the fluorescent detection was carried out with the Probes (A) 5'-LC-Red640-GGAAGAGATCGTGAGGGCAG-ph (SEQ ID No. 10) and (B) 5'-GACAACAGCCGGGTGGTGTCA-Flu (SEQ ID No. 11) (Tib Molbiol, Berlin). For the RFLP test, the DNA was also amplified with the primers and digested with Sau3AI (New England Biolabs).

In the case of exon 21 G2677T / A, the determination of the two possible nucleotide substitutions (T or A) at position 2677 in exon 21 was carried out using PCR / RFLP using mismatch primers (Cascorbi, 2001). The mutation G2677T was detected after amplification of DNA with primer MDR-9 (5'-TGCAGGCTATAGGTTCCAGG, SEQ ID No. 12) and MDR-lOa (5'-TTTAGTTTGACTCACCTTCCCG, SEQ ID No. 13) and digestion with BanI. For the detection of G2677A, the DNA was amplified with the primers MDR-9 and MDR-10 (5'-GTTTGACTCACCTTCCCAG, SEQ ID No. 14) and digested with BsrI.

In the case of intron 6 (position exon 6 +139), a 299 bp fragment containing the polymorphic site was generated with the forward primer MDRl 3 (5'-AGGTTTCATTTTGGTGCCTG, SEQ ID No. 15) and reverse primer MDR-14 (5'-GAACAAAAGGATGCACACGACAAT, SEQ ID No. 16). 25 µl of master mix, consisting of 1 x BioTherm buffer, 2mM MgCl ₂ , 0.2mM dNTPs, 0.2nM of each primer, 0.75 units of BioTherm DNA polymerase and 60ng DNA, was subjected to an initial denaturation at 94 ° C for 2 minutes, 35 cycles at 94 ° C, 30 seconds, 60 ° C for 1 minute, 72 ° C for 1 minute and a final elongation at 72 ° C for 7 minutes. The PCR product was digested with the restriction enzyme Sspl (Fermentas) at 37 ° C. overnight. The variant samples gave 275 and 24 bp fragments, the wild-type alleles had a fragment of 299 bp in length.

For the detection of the exon 12 C1236T polymorphism, a 366 bp fragment with the primers MDR-15 (5'-TATCCTGTGTCTGTGAATTGCC, SEQ ID No. 17) and MDR-16 (5'-CCTGACTCACCACACCAATG, SEQ ID No. 18) amplified. The master mix and conditions for amplification were as given above for intron 6. Digestion of the PCR product with the restriction enzyme BsuRI (MBI Fermentas) gave 269, 62 and 35 bp fragments in the case of the wild-type allele and 269 and 97 bp fragments in the case of the variant allele, which were based on a 3rd , 5% agarose gel were analyzed.

For the detection of the intron 16 T-> A (position exon 17 -76) polymorphism, a PCR with the primers MDR-20 (5'-TTGTCAACATTTTTTTGAAGC, SEQ ID No. 19) and MDR-21 (5'-TATTATTGCAAATGCTTGC, SEQ ID No. 20), which resulted in a 315-bp fragment. The master mix and conditions for amplification were as given above for intron 6. The PCR product was digested with the restriction enzyme XapI (MBI Fermentas) and analyzed on a 3.5% agarose gel. Wild-type alleles gave 231 and 84 bp fragments, variant allele fragments 120, 111 and 84 bp in length.

LightCycler genotyping. The PCR for the detection of the 1236 C-> T polymorphism in exon 12 was carried out in a LightCycler (Röche, Germany) using hybridization probes. The master mix contained 5 mM MgCl ₂ , 0.1 mM deoxynucleotide diphosphates, 0.2 μmoles each of the primers LC-1, 5'-AGCCAAGTATTGACAGCTATTCG, SEQ ID No. 21 and primer LC-2, 5'- AGTCTAGCTCGCATGGGTCAT, SEQ ID No. 22, 0.1 mM each of the hybridization probes HS-1; 5'-LightCycler Red640-TTCAGGTTCAGACCCTTCAAGATCT-P, SEQ ID No. 23 and HS-2; 5'-GCCACCGTCTGCCCACTCTGCAC-Flu, SEQ ID No. 24 (TIB Molbiol, Berlin), 0.6 µg BSA and 0.5 units BioTherm DNA polymerase in a total volume of 20 µl. After denaturation at 95 ° C for 2 minutes, 45 cycles with denaturation at 95 ° C, 0 seconds , 65 ° C for 15 seconds and an elongation at 75 ° C for 15 seconds. Data from the melting curve was obtained by slowly heating from 40 ° C to 90 ° C with a ramp of 0.2 ° C / s and was recorded continuously. The variant allele snaps at 68 ° C, the wild-type allele at 63 ° C. The SNP positions investigated in this invention relate to the MDRI cDNA (SEQ ID No. 7) by way of example, the first base of the ATG start codon initially being set to 1. The position numbering can, however, be shifted due to mutations, eg deletions and / or insertions. SNPs located in an intron are given as exon + n (downstream nucleotides), or -n (upstream nucleotides) of the exons that have been defined. Furthermore, the specified sequences around the variant locations may differ slightly due to errors in the sequences in the database. The identified SNPs are summarized in Table 1.

Number Position Mutation SEQ ID No

1 exon 6 + 139 C-> T 1

2 cDNA 1236 C-> T 2

3 exon 17 -76 T-> A 3

4 cDNA 2677 G-> T or G-> A 4, 5

5 Exon 26 C3435T C-> T 6

Table 1: Identified SNPs of the present invention

The genotypes and haplotypes are derived from the variants exon 6 + 139: C-> T, cDNA 1236: C-> T, Exonl7 -76: T-> A, cDNA 2677: G-> T or G-> A and cDNA 3435: C-> T shown below so that in the genotypes the number 1 represents the non-mutated state of the reference sequence and the number 2 symbolizes the mutated state that arises from the fact that one chromosome is mutated at the site and the other chromosome corresponds to the reference sequence, and number 3 corresponds to the mutated state on both chromosomes. The number 0 symbolizes a position that could not be clearly determined. In the representation of the haplotypes, the number 1 symbolizes the unmutated state of the reference sequence and the number 2 symbolizes the mutated state.

In the study, 12 controls (4 male and 8 female) and 16 cancer patients (5 male and 11 female) carrying the rare A nucleotide at position 2677 were observed. These 28 subjects were not included in the further investigations. In the remaining 564 individuals, 32 different genotypes and 3 further genotypes, which were not completely determined at all positions, were observed (see Table 1). The 6 most common haplotypes with frequencies between 2% and 39% were predicted for these genotypes using the program ithap-cgi (Rohde et al., 2001) (see Table 2). The remaining haplotypes, which make up approximately 2.4% of all haplotypes, were determined on the basis of the calculated frequent haplotypes using the method of Clark (1990). At least 6 other haplotypes are necessary to describe all genotypes. (see table 3).

It was found by a corresponding haplotype analysis that colon cancer patients carry the haplotype 22111 significantly more frequently if the second haplotype is not mutated, particularly in the variant exon 6 + 139 (P = 0.01 1; odds ratio = 4, with the confidence interval [1.3; 12.2] see Table 4). The genotypes, which consist of haplotype 22111 and the haplotypes just mentioned with non-mutated variant exon 6 + 139, are very rare in the Caucasian population. In a separate study describing the variability of the MDRI gene in the Caucasian population, in which complete genotypes were available for 382 individuals, a frequency of 0.8% was observed for genotypes 11211 x 22111. In this study, a frequency of 0.6% was observed in the control group, whereas this genotype was found in 4.4% of cancer patients. The 11111 x 22111 genotype occurred once among cancer patients, but was not observed in the Caucasian population. The 11212 x 221111 genotype had a frequency of 0.26% in the Caucasian population. This genotype was found among cancer patients with a frequency of 1.14%. The last two genotypes were not even observed in the control group. This observation suggests that rare genotypes containing 22111 as haplotypes have accumulated in the group of cancer patients. The 22111 x 22122 genotype occurs in the Caucasian population with 1.3%, in the controls with 3% and among the patients with 1.5%. It can be assumed that in this genotype as in the 22111 x 22121 genotype, the haplotype 22122 is expressed earlier than the haplotype 22111, but in connection with a haplotype that is not mutated in the position exon 6 + 139 and 1236, rather an expression of 22111 occurs.

In the study, four previously healthy volunteers were observed who have a genotype postulated for the development of colon cancer. Among the four healthy subjects to date, there are three who are 51 years and younger, which means that they can still develop cancer in later years, especially since the average age of the patients 62 years and only 16% of the patients were younger than 52 years old. The colon cancer in 6% of all patients seems to be mainly due to the appearance of these specific haplotype pairs of the MDRI gene.

Table 2: Common haplotypes

Table 4: Number of haplotype pairs containing haplotype 22111 controls

patients

Example 2: Prediction of the individual transport capacity of the PGP for important drugs using the example of digoxin

Digoxin proved to be a good active ingredient in evaluating the transport activity of PGP (Greiner et al .; 1999; Johne et al .; 1999; Fromm et al., 1999), mainly because its kinetics do not depend on the oxidative metabolism of active ingredients (Lacarelle B et al., 1991). A low-dose digoxin regimen was chosen, as is common in patients with congestive heart failure (Haji et al. 2000). In this low-dose range, differences in P-glycoprotein activity can have a greater effect on the digoxin plasma concentration.

43 healthy Caucasian subjects, 24 men and 19 women were examined for their digoxin absorption capacity. The health status of the subjects was examined by medical examination, electrocardiogram and routine laboratory parameters. The subjects were non-smokers and were tested for cannabinoids, amphetamines, cocaine, opioids, benzodiazepines, barbiturates, alcohol and cotinine to provide data for the Determine risk profile. The study was approved by the Ethics Committee of the Charite University Hospital, Humboldt University Berlin. All volunteers gave their written informed consent form before entering the study. For the examination, the subjects received an initial oral dose of 0.25 mg digoxin (Dilanacin ™, Arzneimittelwerk Dresden GmbH, Radebeul) in the morning and evening of the first two study days and a single dose of 0.25 mg digoxin in the morning on study days 3 to 5 Collection of venous blood samples for pharmacokinetic analysis started on day 5 after an overnight fast. Blood was drawn with syringes containing ethylenediaminetetraacetic acid (EDTA) immediately before and at 0.25, 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12 and 24 hours after digoxin administration Samples were centrifuged and plasma was immediately stored in polypropylene tubes at -22 ° C. A light standard meal was administered 4 hours after medication. Alcohol, coffee, tea, cola drinks, smoking and drugs were not allowed during the study.

The digoxin plasma levels were determined on day 5 and kinetic parameters were analyzed for the genotype-phenotype and haplotype-phenotype relationships. Digoxin plasma concentrations were determined using a microparticle enzyme immunoassay (IMx® Digoxin Assay, Abbott Laboratories; USA). The lower limit of quantification was 0.3 ng / 1. Mean values of the double measurements were used for the further calculations. The absorption of digoxin was characterized by the peak concentration in plasma (Cmax) and the area under the plasma concentration-time curve from 0 to 4 hours, AUC (0-4). Steady-state digoxin kinetics were characterized by concentrations in plasma at the end of a dosing interval (Cmin), range below the plasma concentration-time curve from 0 to 24 hours, AUC (0-24). It was assumed that AUC (0-24) over a dosing interval at steady state was equivalent to AUC (0- ° o'clock) for a single dose. Cmin and Cmax were derived directly from the original measurements. AUCs were calculated using the linear trapezoidal rule using WinNonlin ™ (professional edition; version 1.5, Pharsight Corporation, Mountain View, CA, USA). In addition to the areas under the plasma concentration-time curve for 4 hours (hereinafter referred to as AUC (0-4)) and 24 hours (hereinafter referred to as AUC (0-24)), the maximum plasma concentration Cmax and the pharmacokinetic parameters were also determined Cmin is watching. The values were normalized to the ideal weight. The genotyping was carried out as indicated above. 16 different genotypes were observed among the 43 subjects (see Table 5). To Calculations with the program ithap-cgi (Rohde, Fuerst, 2001) make up these genotypes from 11 haplotypes, of which three haplotypes are common: the haplotype 11111, which corresponds to the reference sequence, with about 14%, the haplotype 11211, the only carries a mutation at position Exonl7 -76, with approx. 27% and the haplotype 22122, which is mutated to position Exonl7 -76 in all other four positions compared to the reference sequence, with approx. 29%. Frequencies between 1% and 9% are calculated for all other haplotypes (see Table 6).

Table 5: Table of genotypes

For the three most common haplotypes, the genetic influence of MDRI on digoxin absorption behavior could be examined in this study. Subjects who carry the haplotype 22122 differ in terms of the three investigated pharmacokinetic parameters AUC (0-4), AUC (0-24) and Cmax statistically significantly from the subjects who do not carry these haplotypes on at least one chromosome, the parameter Cmin shows a trend in this direction. The p-values calculated in the Mann-Whitney U test are between 0.0176 and 0.0267, for Cmin at 0.0574, whereby subjects who carry these haplotypes on both chromosomes show particularly high AUC values. Table 7 shows the influence of haplotype 22122 on the parameters observed.

Table 7: Mean values and standard deviations for pharmacokinetic parameters of groups of volunteers who either do not carry the haplotype 22122 or who carry one or both chromosomes

Subjects with the common haplotypes 11111 and 11211 were below the average values of the population with regard to AUC values. The rarer haplotypes also show differences in the parameters examined, but these could not be statistically evaluated on this sample because too few test subjects with these properties have been examined so far. For example, carriers of haplotypes such as 22222 were notable for their low AUC values. If the haplotype pair of a subject is composed of two different haplotypes, the corresponding pharmacokinetic parameters for the subject also seemed to assume a value that lies between the influence of both haplotypes. Subjects who had two identical haplotypes with particularly low or high values showed particularly clear effects, as also shown in Table 7 for haplotype 22122. credentials

Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I, Gottesman MM. Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu Rev Pharmacol Toxicol 1999; 39: 361-98.

Juliano RL, Ling V. A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim BiophysActa 1976; 455 (1): 152-62.

Seelig A. A general pattern for Substrate recognition by P-glycoprotein. Eur J Biochem 1998: 251 (l-2): 252-61.

Kerb R, Hoffmeyer S, Brinkmann U. ABC drug transporters: hereditary polymorphisms and pharmacological impact in MDRI, MRP1 and MRP2. P / 7a / -macogenom / 'CS2001; 2 (l): 51-64.

Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Nat! Acad Sei USA 1987: 84 (21): 7735-8.

Cordon-Cardo C, O'Brien JP, Casals D, Rittman-Grauer L, Biedler JL, Melamed MR, et al. Multidrug-resistance gene (P-glycoprotein) is expressed by endothelial cells at blood-brain barrier sites. Proc Natl Acad Sei USA 1989; 86 (2): 695-8.

Benet LZ, Izumi T, Zhang Y, Silverman JA, Wacher VJ. Intestinal MDR transport proteins and P-450 enzymes as barriers to oral drug delivery. J Controlled Release 1999; 62 (l-2): 25-31.

Greiner B, Eichelbaum M, Fritz P, Kreichgauer HP, by Richter 0, Zundler J, et al. The role of intestinal P-glycoprotein in the interaction of digoxin and rifampin. J Clin Invest 1999; 104 (2): 147-53.

Johne A, Brockmoller J, Bauer S, Maurer A, Langheinrich M, Roots I. Pharmacokinetic interaction of digoxin with an herbal extract from St John's wort (Hypericum perforatum). Clin Pharmacol Ther 1999; 66 (4): 338-45. Fromm MF, Kirn RB, Stein CM, Wilkinson GR, Roden DM. Inhibition of P-glycoprotein-mediated drug transport: A unifying mechanism to explain the interaction between digoxin and quinidine. Circulation 1999; 99 (4): 552-7.

Schinkel AH, Wagenaar E, van Deemter L, Mol CA, Borst P. Absence of the mdrla P- glycoprotein in mice affects tissue distribution and pharmacokinetics of dexamethasone, digoxin, and cyclosporin A. J Clin / wesl995; 96 (4): 1698 -705.

Kim RB, Fromm MF, Wandel C, Leake B, Wood AJ, Roden DM, et al. The drug transporter P-glycoprotein limits oral absorption and brain entry of HIV-1 protease inhibitors. J Clin Invest 1998; 101 (2): 289-94.

Hoffrneyer S, Burk O, by Richter O, Arnold HP, Brockmoller J, Johne A, et al. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sei USA 2000; 97 (7): 3473-8.

Cascorbi I, GerloffT, Johne A, Meisel C, Hoffrneyer S, Schwab M, et al. Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDRI gene in white subjeets. Clin Pharmacol Ther 2001: 69: 169-74.

Chen CJ, dark D, Ueda K, Pastan I, Gottesman MM, Roninson IB. Genomic organization of the human multidrug resistance (MDRI) gene and origin of P-glycoproteins. J Biol Chem 1990: 265 (1): 506-14.

Terwillinger J, Ott J. Handbook of Human Genetic Linkage. Baltimore: Johns Hopkins University Press, 1994.

Awni WM, Hussein Z, Cavanaugh JH, Granneman GR, Dube LM. Assessment of the pharmacokinetic interaction between cileuton and digoxin in humans. Clin Pharmacokinet 1995; 29 (Suppl2): 92-7. Mooradian AD. Digitalis. An update of clinical pharmacokinetics, therapeutic monitoring techniques and treatment recommendations. Clin Pharmacokinet ^« \ 988; 15 (3): 165-79.

Kim RB, Leake BF, Choo EF, Dresser GK, Kubba SV, Schwarz UI, et al. Identification of functionally variant MDRI alleles among European Americans and African Americans. Clin Pharmacol Ther 2001; 70 (2): 189-99.

Lacarelle B, Rahmani R, de Sousa G, Durand A, Placid! M, Cano JP. Metabolism of digoxin, digoxigenin digitoxosides and digoxigenin in human hepatocytes and liver microsomes. Fundam Clin Pharmacol 1991; 5 (7): 567-82.

Haji SA, Movahed A. Update on digoxin therapy in congestive heart failure. Am Fern Physician 2000; 62 (2): 409-16.

Riaz K, Forker AD. Digoxin use in congestive heart failure. Current status. Drugs 1998; 55 (6): 747-58.

Chiou WL, Chung SM, Wu TC, Ma C. A comprehensive account on the role of efflux transporters in the gastrointestinal absorption of 13 commonly used Substrate drugs in humans. Int J Clin Pharmacol Ther 2001; 39: 93-101.

Notch R, Aynacioglu AS, Brockmoller J, Schlagenhaufer R, Bauer S, Szekeres T, et al. The predictive value of drug uptake and metabolism for phenytoin plasma levels: a combined analysis of MDRI, cytochrome P450 2C9 and 2C19 polymorphisms. Pharmacogenomics J 2001; 1 (3): 204-10.

Hitzl M, Drescher S, van der Kuip H, Schaffeier E, Fischer J, Schwab M, et al. The C3435T mutation in the human MDRI gene is associated with altered efflux of the P-glycoprotein substrates rhodamine 123 from CD56 + natural killer cells. Pharmacogenetics 2001; 11 (4): 293-8.

Becquemont L, Verstuyft C, Kerb R, Brinkmann U, Lebot M, Jaillon P, et al. Effect of grapefruit juice on digoxin pharmacokinetics in humans. Clin Pharmacol Ther 2001; 70 (4): 311-6. GerloffT, Schafer M, Johne A, Oselin K, Meisel C, Cascorbi I, et al. MDRl genotypes do not discriminate between absorptive pharmacokinetic parameters of a single oral dose of 1 mg digoxin in healthy white volunteers. BrJ Clin Pharmacol 2002: in press.

Sakaeda T, Nakamura T, Horinouchi M, Kakumoto M, Ohmoto N, Sakai T, et al. MDRI genotype-related pharmacokinetics of digoxin after single oral administration in healthy Japanese subjects. Pharm Res 2001; 18 (10): 1400-4.

Shon J, Chun H, Kirn K, Kirn E, Yoon Y, Jang I, et al. The PK and PD of fexofenadine in relation to MDRI genetic polymorphism in Korean healthy subjects. Clin Pharmacol Ther 2002; 71 (2): P71.

Drescher S, Schaeffeler E, Hitzl M, Hofmann U, Schwab M, Brinkmann U, et al. MDRI gene polymorphisms and disposition of the P-glycoprotein substrates fexofenadine. BrJ Clin Pharmacol 2002; 53 (5): 526-534.

Drysdale CM, McGraw DW, Stack CB, Stephens JC, Judson RS, Nandabalan K, et al. Complex promoter and coding region beta 2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness. Proc Nat! Acad Sei USA 2000: 97 (19); 10483-8.

Hoehe MR, Kopke K, Wendel B, Rohde K, Flachmeier C, Kidd KK, et al. Sequence variability and candidate gene analysis in complex disease: association of mu opioid receptor gene variation with substance dependence. Hum Mol Genet 2000: 9 (19): 2895-908.

Rohde K, Fuerst R- Haplotyping and estimation of haplotype frequencies for closely linked biallelic multilocus genetic phenotypes including nuclear family Information. Hum Mutat. 2001 Apr; 17 (4): 289-95.

Clark AG, Interference of haplotypes from PCR-amplified samples of diploid populations Mol. Biol. Evol. 1990 7 (2): 111-122 Stephens M, et al., A new statistical method for haplotype reconstruction from population data. At the. J. Hum. Genet. 2001 Apr; 68 (4): 978-89

Pauli-Magnus C, DeYoung J, Herskowitz I, Giacomini KM, Clark AG, Kroetz DL Ethnic Variation in MDRl haplotype structure. Clin. Pharmacol. Ther. 2002; 71: P35

Kim RB et al. Identification of functionally variant MDRI alleles among European Americans and African Americans. Clin. Pharmacol. Ther. 2001; 70: 189-99

Claims

claims

1. A method of diagnosing mass transfer and / or a genetic predisposition to a disease related to the specific constellations of genetic variability of the MDRI gene in a mammal, comprising:

Determining the haplotype pair of the MDRI gene, comprising analyzing at least five "single nucleotide polymorphisms" (SNP) in an MDRI genomic locus-derived nucleic acid or a fragment thereof obtained from the mammal, the analyzed SNPs from the specific combination of at least 1) exon 6 + 139: C-> T, 2) cDNA 1236: C-> T, 3) exon 17 -76: T-> A, 4) cDNA 2677: G-> T or G-> A, and cDNA 3435: C-> T exist.

2. The method of claim 1, further comprising comparing the haplotype pair found in the mammal with the risk profiles for the substrate transport examined and / or the genetic predisposition for the disease.

3. The method according to claim 1 or 2, wherein the substrate transport, the transport of digoxin, HIV protease inhibitors, vinblastine and cyclosporin A and antineoplastic (antineoplastic) drugs for cancer therapy, in particular through the blood-brain barrier, placental barrier and / or the excretion of xenobiotics and drugs in bile and urine.

4. The method according to claim 1 or 2, wherein the disease comprises a cancer, in particular colon cancer.

5. The method according to any one of claims 1 to 4, wherein the determination by means of sequencing, "mini-sequencing", hybridization, MALDI-TOF, multiplex sequencing, immunoassays, restriction fragment analysis, oligonucleotide ligation assay or allele-specific PCR.

6. The method according to any one of claims 1 to 5, wherein the nucleic acid is a DNA, genomic DNA, RNA, cDNA, hnRNA, or mRNA.

7. The method according to any one of claims 1 to 6, wherein the mammal is a human.

8. The method according to any one of claims 1 to 7, wherein the analysis of the SNPs is carried out in a "high-throughput format", in particular by means of a DNA or RNA chip.

9. The method according to any one of claims 1 to 8, wherein the analysis of the haplotypes comprises a molecular genetic and / or theoretical method.

10. Use of a haplotype or haplotype pair determined according to one of claims 1 to 9 for the diagnosis of substrate transport and / or a genetic predisposition for a disease which is related to the specific constellations of the genetic variability of the MDRI gene in a mammal.

11. Combination of isolated oligo- or polynucleotides, consisting essentially of the continuous nucleotide sequences of the at least five SNP variants according to SEQ ID NO 1 to 6.

12. The combination of claim 11, wherein the oligo- or polynucleotides further comprise a detectable marker, e.g. B. a radionuclide, fluorophore, peptide, enzyme, antigen, antibody, vitamin or steroid.

13. Use of a combination of isolated oligo- or polynucleotides according to claim 11 or 12 for the diagnosis of mass transport and / or a genetic predisposition for a disease which is related to the specific constellations of the genetic variability of the MDRI gene in a mammal.

14. Use of a combination of isolated oligo- or polynucleotides according to claim 13 in combination with further SNP variants.

15. Diagnostic kit, comprising means for detecting the at least five SNPs according to SEQ ID NOs 1 to 6, together with further components and / or auxiliary substances.

16. Diagnostic kit according to claim 15, comprising a combination of oligo- or polynucleotides according to claim 11 or 12, together with further components and or auxiliary substances.

17. A method for the treatment or prevention of a modified mass transport and / or a disease in a mammal which has a genetic predisposition to a disease which is related to the specific constellations of the genetic variability of the MDRI gene

Determining the haplotype of the MDRI gene according to any one of claims 1 to 10 and administering to the mammal an effective dose of a pharmaceutical composition suitable for delaying, reducing and / or preventing the modified mass transfer and / or the disease.

18The method of claim 17, wherein the pharmaceutical composition digoxin, antibiotics such as vinblastine and cyclosporin A and / or antineoplastic (antineoplastic) medications for cancer therapy or aldosterone, amprenavir, bilirubin, cimetidine, diltiazem, indinavir, itaconazole, loperamide, veclflazinone, sparfloxonium , Cisplatin, clozapine, CP 117227, flunitrazepam, haloperidol, methotrexate, pararosaniline, prenylamine, promazin, quinacrin 2HC1, a-factor pheromone, aldosterone, amiodarone, azidopine, bepredil, BIBW22BS, cantefefantazinin, cath , Cinchomidine, CP 100356, dexamethasone, dexniguldipin, dibucain, dilitazem, dipyrdiamol, domperidon, emetin, S-farnesylcysteine methyl ester, cis-flupenthixol, fluphenazine, FK506, gallopamil, GF120918, hydrocortisone trolone, methanodinone tranolate, mitpatin, mitpatone, mitpaton, Ipatin , Monensin, morphine, morphine-6-glucoronide, Νicardipine, ondansetron, perphenazine, phenoxaz in, phenytoin, prazosin, progesterone, quinidine, rhodamide 123, S9788, SDB-ethylenediamine, spiperdone, tacrolimus, tamoxifen, terfenadine,

Tetraphenylphosphonium bromide, thioridazine, topotectan, trifluorperazine,

Triflupromazine, Triton X-100, Valinomycin, Verapamil, Vindolin, Yohmbin, Clomitrazol, Colchicin, Daunorubicin, Doxorubicin, Epothilon A, Erythromycin, Etoposid, Isosafrol, Midazolam, Νifedipin, Phenobampicininolin, Purin. Driving according to claim 17 or 18, wherein the disease is AIDS (HIV infection), Parkinson's, Alzheimer's and / or cardiomyopathy.