WO2004041818A1 - Anti-infective agents - Google Patents

Anti-infective agents Download PDF

Info

Publication number
WO2004041818A1
WO2004041818A1 PCT/US2003/034707 US0334707W WO2004041818A1 WO 2004041818 A1 WO2004041818 A1 WO 2004041818A1 US 0334707 W US0334707 W US 0334707W WO 2004041818 A1 WO2004041818 A1 WO 2004041818A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
group
heteroaryl
heterocycle
alkenyl
Prior art date
Application number
PCT/US2003/034707
Other languages
French (fr)
Inventor
John K. Pratt
David A. Betebenner
Pamela L. Donner
Brian E. Green
Dale J. Kempf
Keith F. Mcdaniel
Clarence J. Maring
Vincent S. Stoll
Rong Zhang
Original Assignee
Abbott Laboratories
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/285,714 external-priority patent/US20040097492A1/en
Priority claimed from US10/625,121 external-priority patent/US20040162285A1/en
Priority claimed from US10/679,881 external-priority patent/US20050075331A1/en
Priority to DK03768559.1T priority Critical patent/DK1560827T3/en
Priority to DE60335564T priority patent/DE60335564D1/en
Priority to BRPI0315897-7A priority patent/BR0315897A/en
Application filed by Abbott Laboratories filed Critical Abbott Laboratories
Priority to AU2003291670A priority patent/AU2003291670A1/en
Priority to SI200331953T priority patent/SI1560827T1/en
Priority to CA2504385A priority patent/CA2504385C/en
Priority to JP2005502238A priority patent/JP4738172B2/en
Priority to AT03768559T priority patent/ATE493408T1/en
Priority to EP03768559A priority patent/EP1560827B1/en
Priority to MXPA05004670A priority patent/MXPA05004670A/en
Publication of WO2004041818A1 publication Critical patent/WO2004041818A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/62—Oxygen or sulfur atoms
    • C07D213/69—Two or more oxygen atoms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/20—Oxygen atoms
    • C07D215/22—Oxygen atoms attached in position 2 or 4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems

Definitions

  • the present invention provides novel anti-infective agents. Specifically, the present invention provides an HCV polymerase inhibiting compound, and a composition comprising a therapeutically effective amount of said compound. The present invention also provides a method for inhibiting hepatitis C virus (HCV) polymerase, a method for inhibiting HCV viral replication, and a method for treating or preventing HCV infection. Processes for making said compounds, and synthetic intermediates employed in said processes, are also provided.
  • HCV hepatitis C virus
  • HCV hepatitis C virus
  • the present invention provides novel anti-infective agents which are HCV polymerase inhibitors.
  • the present invention provides a compound of formula (I)
  • A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl,
  • R and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(O)-, -SR a , -S(O)R a , -S(O) 2 R a andR a C(O)-; wherein R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R N-, N 3 -, R e S-, wherein R 4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and -COOH;
  • R is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(O)-, R a S-, R a (O)S-,
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, ijlkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(O)R a , -C(O)OR a and -C(O)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(O)NR f R h , -SO 2 NR f R h , -C(O)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, hal
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl,- heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • R 4 is alkoxy, aryloxy, hydroxy or R e S-
  • R 5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, R a R b N-, R a C(O)-, R a S-, R a (O)S-, R a (O) 2 S-, R a SO 2 N(R f )-, R a R b NC(O)-, R k OC(O)-, R a R b NSO 2 - or -OR k
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(O)R a , -S(O) 2 R a , -SR
  • R 4 is hydroxy or R e S-
  • R 5 is hydrogen, unsubstituted alkyl, halo or -OR k
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(O)R a , -C(O)OR a and -C(O)NR a R b , then R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl
  • the present invention also provides the processes of making a compound of the present invention and intermediates employed in the processes.
  • the present invention further provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of the compound or combination of compounds of the present invention or a pharmaceutically acceptable salt form thereof, and a pharmaceutically acceptable carrier.
  • the present mvention also provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment the pharmaceutical composition of the present invention.
  • the present invention still further provides a method of inhibiting the replication of an RNA-containing virus comprising contacting said virus with a therapeuctially effective amount of a compound or combination of compounds of the present invention or a pharmaceutically acceptable salt thereof.
  • the present invention yet further provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment the pharmaceutical composition of the present invention.
  • alkyl refers to a group derived from a straight or branched chain saturated hydrocarbon containing 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms. Examples of alkyl groups include butyl, methyl, 2-methylbutyl, and the like.
  • alkenyl refers to a straight or branched chain group of 2,
  • alkenyl groups include allyl, propenyl, 3-methyl-2-butenyl, and the like.
  • alkynyl refers to a straight or branched chain hydrocarbon of 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms containing at least one carbon-carbon triple bond.
  • alkynyl groups include ethynyl, 2-methyl-3-butynyl, 3-pentynyl, and the like.
  • alkoxy refers to an alkyl group attached to the parent molecular moiety through an oxygen atom.
  • alkoxy groups include tert-butoxy, methoxy, isopropoxy, and the like.
  • alkoxy alkoxy means an alkoxy group, as defined herein, appended to the parent molecular moiety through another alkoxy group, as defined herein.
  • alkoxyalkoxy include, but are not limited to, tert-butoxymethoxy, 2-ethoxyethoxy, 2-methoxyethoxy, and methoxymethoxy.
  • alkoxyalkoxyalkyl as used herein, means an alkoxyalkoxy group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein.
  • Representative examples of alkoxyalkoxyalkyl include, but are not limited to, tert- butoxymethoxymethyl, ethoxymethoxymethyl, (2-methoxyethoxy)methyl, and 2-(2- methoxyethoxy)ethyl .
  • alkoxyalkyl refers to an alkyl group substituted by at least one alkoxy group.
  • alkoxycarbonyl refers to an alkoxy group attached to the parent molecular moiety through a carbonyl group.
  • alkoxycarbonyl groups include tert-butoxycarbonyl, ethoxycarbonyl, methoxycarbonyl, and the like.
  • alkoxycarbonylalkyl refers to an alkoxycarbonyl group attached to the parent molecular moiety through an alkyl group.
  • alkylcarbonyl refers to an alkyl group attached to the parent molecular moiety through a carbonyl group.
  • alkylcarbonyl groups include acyl, butanoyl, 2,2-dimethylpropanoyl, and the like.
  • alkylcarbonylalkyl means an alkylcarbonyl group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein.
  • Representative examples of alkylcarbonylalkyl include, but are not limited to, 2- oxopropyl, 3,3-dimethyl-2-oxopropyl, 3-oxobutyl, and 3-oxopentyl.
  • alkylsulfanyl refers to an alkyl group attached to the parent molecular moiety through a sulfur atom. Examples of alkylsulfanyl groups include methylsulfanyl, (l-methylethyl)sulfanyl, (2-methylpro ⁇ yl)sulfanyl, and the like.
  • alkylsulfanylalkyl refers to an alkylsulfanyl group attached to the parent molecular moiety through an alkyl group.
  • alkylsulfinyl refers to an alkyl group attached to the parent molecular moiety through a -S(O)- group.
  • alkylsulfinylalkyl refers to an alkylsulfinyl group attached to the parent molecular moiety through an alkyl group.
  • alkylsulfonyl refers to an alkyl group attached to the parent molecular moiety through a -S(O) 2 - group.
  • alkylsulfonylalkyl refers to an alkylsulfonyl group attached to the parent molecular moiety through an alkyl group.
  • aryl refers to a phenyl group, or a bicyclic or tricyclic hydrocarbon fused ring systems wherein one or more of the rings is a phenyl group.
  • Bicyclic fused ring systems have a phenyl group fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or another phenyl group.
  • Tricyclic fused ring systems are exemplified by a bicyclic fused ring system fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or another phenyl group.
  • aryl groups include anthracenyl, azulenyl, fluorenyl, indanyl, indenyl, naphthyl, phenyl, tetrahydronaphthyl, and the like.
  • the aryl groups of the present invention can be connected to the parent molecular moiety through any substitutable carbon atom of the group.
  • the aryl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a , -OC(O)R a , -OC(O)OR a , -OC(O)NR a R b , -OSO 2 R a , -OSO 2 NR a R b , -SR a , -SOR a , -SO 2 R a , -SO 2 OR a , -SO 2 NR a R b , -NR a R b , -N(R e )C(O)R a , -N(R e )C(O)OR a , -N(R e )C(O)NR a R b , -N(R e
  • arylalkenyl refers to an aryl group attached to the parent molecular moiety through an alkenyl group.
  • arylalkoxy refers to an arylalkyl group attached to the parent molecular moiety through an oxygen atom.
  • arylalkyl refers to an aryl group attached to the parent molecular moiety through an alkyl group.
  • arylcarbonyl refers to an aryl group attached to the parent molecular moiety through a carbonyl group.
  • arylcarbonylalkyl as used herein, means an arylcarbonyl group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein.
  • aryloxy refers to an aryl group attached to the parent molecular moiety through an oxygen atom.
  • aryloxyalkyl refers to an aryloxy group attached to the parent molecular moiety through an alkyl atom.
  • arylsulfanyl refers to an aryl group attached to the parent molecular moiety through a sulfur atom.
  • arylsulfanylalkyl refers to an arylsulfanyl group attached to the parent molecular moiety through an alkyl group.
  • arylsulfonyl refers to an aryl group attached to the parent molecular moiety through a sulfonyl group.
  • arylsulfonylalkyl refers to an arylsulfonyl group attached to the parent molecular moiety through an alkyl group.
  • carboxyalkyl refers to a carboxy group attached to the parent molecular moiety through an alkyl group.
  • cyano refers to -CN.
  • cyanoalkyl refers to a cyano group attached to the parent molecular moiety through an alkyl group.
  • cycloalkenyl refers to a non-aromatic, partially unsaturated, monocyclic, bicyclic or tricyclic ring system, having three to fourteen carbon atoms and zero heteroatom.
  • Examples of cycloalkenyl groups include cyclohexenyl, octahydronaphthalenyl, norbornylenyl, and the like.
  • the cycloalkenyl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a , -OC(O)R a , -OC(O)OR a , -OC(O)NR a R b , -OSO 2 R a , -OSO 2 NR a R b , -SR., -SOR a , -SO 2 R a , -SO 2 OR a , -SO 2 NR a R b , -NR a R b , -N(R e )C(O)R a , -N(R e )C(O)OR a , -N(R e )C(O)NR a R b , -N(R
  • cycloalkenylalkyl refers to a cycloalkenyl group attached to the parent molecular moiety through an alkyl group.
  • cycloalkyl refers to a saturated monocyclic, bicyclic, or tricyclic hydrocarbon ring system having three to fourteen carbon atoms and zero heteroatom.
  • cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[3.1.1]heptyl, 6,6-dimethylbcyclo[3.1.1]heptyl, adamantyl, and the like.
  • the cycloalkyl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a , -OC(O)R a , -OC(O)OR a , -OC(O)NR a R b , -OSO 2 R a , -OSO 2 NR a R b , -SR a , -SOR a , -SO 2 R a , -SO 2 OR a , -SO 2 NR a R b , -NR a R b , -N(R e )C(O)R a , -N(R e )C(O)OR a , -N(R e )C(O)NR a R b , -N(
  • cycloalkylalkenyl refers to a cycloalkyl group attached to the parent molecular moiety through an alkenyl group.
  • cycloalkylalkyl refers to a cycloalkyl group attached to the parent molecular moiety through an alkyl group.
  • formylalkyl refers to a formyl group attached to the parent molecular moiety through an alkyl group.
  • haloalkoxy refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom.
  • haloalkoxy alkyl refers to a haloalkoxy group attached to the parent molecular moiety through an alkyl group.
  • haloalkyl refers to an alkyl group substituted by one, two, three, or four halogen atoms.
  • heteroaryl refers to an aromatic five- or six-membered ring where at least one atom is selected from the group consisting of N, O, and S, and the remaining atoms are carbon.
  • heteroaryl also includes bicyclic systems where a heteroaryl ring is fused to a phenyl group, a monocyclic cycloalkyl group, as defined herein, a heterocycle group, as defined herein, or an additional heteroaryl group.
  • heteroaryl also includes tricyclic systems where a bicyclic system is fused to a phenyl group, a monocyclic cycloalkyl group, as defined herein, a heterocycle group, as defined herein, or an additional heteroaryl group.
  • the heteroaryl groups are connected to the parent molecular moiety through any substitutable carbon or nitrogen atom in the groups.
  • heteroaryl groups include benzothienyl, benzoxazolyl, benzimidazolyl, benzoxadiazolyl, dibenzofuranyl, dihydrobenzothiazolyl, furanyl, imidazolyl, indazolyl, indolyl, isoindolyl, isoxazolyl, isoquinolinyl, isothiazolyl, oxadiazolyl, oxazolyl, thiazolyl, thienopyridinyl, thienyl, triazolyl, thiadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl pyrrolyl, quinolinyl, tetrahydroquinolinyl, tetrahydropyranyl, triazinyl, and the like.
  • heteroaryl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a , -OC(O)R a , -OC(O)OR a , -OC(O)NR a R b , -OSO 2 R a , -OSO 2 NR a R b , -SR a , -SOR a , -SO 2 R a , -SO 2 OR a , -SO 2 NR a R b , -NR a R b , -N(R e )C(O)R a , -N(R e )C(O)OR a , -N(R e )C(O)NR a R b , -N(R e
  • the nitrogen heteroatoms can be optionally quaternized or oxidized to the N- oxide.
  • the nitrogen containing rings can be optionally N-protected.
  • heteroarylalkenyl refers to a heteroaryl group attached to the parent molecular moiety through an alkenyl group.
  • heteroarylalkyl refers to a heteroaryl group attached to the parent molecular moiety through an alkyl group.
  • heteroarylsulfonyl refers to a heteroaryl group attached to the parent molecular moiety through a sulfonyl group.
  • heteroarylsulfonylalkyl refers to a heteroarylsulfonyl group attached to the parent molecular moiety through a alkyl group.
  • heterocycle refers to cyclic, non-aromatic, saturated or partially unsaturated, three, four, five-, six-, or seven-membered rings containing at least one atom selected from the group consisting of oxygen, nitrogen, and sulfur.
  • heterocycle also includes bicyclic systems where a heterocycle ring is fused to a phenyl group, a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or an additional monocyclic heterocycle group.
  • heterocycle also includes tricyclic systems where a bicyclic system is fused to a phenyl group, a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, ot an additional monocyclic heterocycle group.
  • the heterocycle groups of the invention are connected to the parent molecular moiety through any substitutable carbon or nitrogen atom in the group.
  • heterocycle groups include benzoxazinyl, dihydroindolyl, dihydropyridinyl, 1,3-dioxanyl, 1,4-dioxanyl, 1 ,3-dioxolanyl, isoindolinyl, morpholinyl, piperazinyl, pyrrolidinyl, tetrahydropy ⁇ dmyl, piperidinyl, thiomorpholinyl, tetrahydropyranyl, and the like.
  • heterocycle groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -OR a , -OC(O)R a , -OC(O)OR a , -OC(O)NR a R b , -OS0 2 R a , -OSO 2 NR a R b , -SR a , -SOR a , -SO 2 R a , -SO 2 OR a , -SO 2 NR a R b , -NR a R b , -N(R e )C(O)R a , -N(R e )C(O)OR a , -N(R e )C(O)NR a R b , -N(R e )
  • heterocyclealkenyl refers to a heterocycle group attached to the parent molecular moiety through an alkenyl group.
  • heterocyclealkyl refers to a heterocycle group attached to the parent molecular moiety through an alkyl group.
  • heterocyclecarbonyl means a heterocycle, as defined herein, appended to the parent molecular moiety through a carbonyl group, as defined herein.
  • Representative examples of heterocyclecarbonyl include, but are not limited to, pyrrolidinylcarbonyl and piperazin-1-ylcarbonyl.
  • hydroxy refers to -OH.
  • hydroxyalkyl refers to an alkyl group substituted by at least one hydroxy group.
  • nitro refers to -NO 2 .
  • nitroalkyl refers to an alkyl group substituted by at least one nitro group.
  • sulfonyl refers to -SO 2 -.
  • the present invention provides a compound of formula (I)
  • A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R 2 and R 3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, . alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(O)-, -SR a , -S(O)R a , -S(0) 2 R a and R a C(O ; wherein R 2 and R 3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(O)-, R a S-, R a (O)S-, R a (O) 2 S-, R a R b Nalkyl-, R a (O)SN(R f )-, R a SO 2 N(R f )-, R a (O)SN(R f )alkyl-, R a S0 2 N(R f )alkyl
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(O)R a , -C(O)OR a and -C(O)NR a R b ; wherein each R ⁇ is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalke'nyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R k Oalkyl-, R c R d Nalkyl-, R c R d NC(O)alkyl-, R c S0 2 -, R c SO 2 alkyl-, R c C(O)-, R c C(O)alkyl-, R c OC(0)-, R 0 OC(O)alkyl-, R c R d NalkylC(O)-, R c R d NC(O)-, R c R d NC(O)Oalkyl-, RcR d NC(O)N(R e )alkyl-, wherein R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroary
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • R 4 is alkoxy, aryloxy, hydroxy or R e S-
  • R 5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, ' aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, R a R b N-, R a C(0)-, RaS-, R a (O)S-, R a (O) 2 S-, R a SO 2 N(R f )-, R a R b NC(O)-, R k OC(O)-, R a R b NSO 2 - or -OR k
  • R 6 is hydrogen 1 , alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR,, -S(O)R a , -S(O) 2 R a , -OR k
  • R 4 is hydroxy or R e S-
  • R 5 is hydrogen, unsubstituted alkyl, halo or -OR
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(O)Ra, -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(O)Ra, -C(0)OR a and -C(O)NR a R b , then R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle
  • the present invention provides a compound of formula (I) wherein A is a monocyclic ring selected from the group consisting of aryl and heteroaryl.
  • the present invention provides a compound of formula (I) wherein A is a bicyclic ring selected from the group consisting of heterocycle and heteroaryl.
  • A is selected from the group consisting of naphthyl, indolizinyl, indolyl, isoindolyl, benzofuranyl, benzothienyl, indazolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzoisothiazolyl, benzoisoxazolyl, benzoxazinyl, benzothiadiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl and naphthyridinyl, cinnolinyl and pteridinyl.
  • the present invention provides a compound of formula (I) wherin R 2 and
  • R 3 together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of thienyl, furanyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxadiazolyl, triazolyl, thiadiazolyl, tetrazolyl, phenyl, pyridyl, pyridazinyl and pyrimidinyl.
  • the present invention provides a compound of formula (I) wherein R 2 and R 3 together with the carbon atoms to which they are attached form a cycloalkyl ring.
  • the present invention provides a compound of formula (I) wherein R 2 and R 3 together with the carbon atoms to which they are attached form a cyclopentyl or cyclohexyl ring.
  • the present invention provides a compound of formula (I) wherein R 2 and R 3 ar independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(O)-, -SR a , -S(0)R a , -S(0) 2 R a and R a C(0)-; wherein R 2 and R 3 are independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b
  • the present invention provides a compound of formula (I) wherein R 4 is hydroxy, halo, -NH 2 ,-NH(alkyl), -N(alkyl) 2 , -N(H)NH 2 , -N 3 , -N(H)(hydroxyalkyl), or R c S-.
  • the present invention provides a compound of formula (I) wherein A is aryl and R 2 and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
  • the present invention provides a compound of formula (I) wherein A is phenyl and R" and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
  • the present invention provides a compound of formula (I) wherein A is phenyl and R 2 and R 3 , together with the carbon atoms to which they are attached is pyridyl.
  • the present invention provides a compound of formula (I) wherein A is phenyl and R 2 and R 3 , together with the carbon atoms to which they are attached is thienyl.
  • the present invention provides a compound of formula (I) wherein A is heteroaryl and R 2 and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
  • the present invention provides a compound of formula (I) wherein A is thienyl and R 2 and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
  • the present invention provides a compound of formula (I) wherein A is thienyl, and R and R together with the carbon atoms to which they are attached form a phenyl ring.
  • the present invention provides a compound of formula (I) wherein A is thienyl, ahd R 2 and R 3 , together with the carbon atoms to which they are attached is pyridyl.
  • the present invention provides a compound of formula (I) wherein A is pyridyl, and R and R , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
  • the present invention provides a compound of formula (I) wherein A is pyridyl, and R and R together with the carbon atoms to which they are attached form a pyridyl ring.
  • the present invention provides a compound of formula (I) wherein A is phenyl, thienyl, pyridyl, imidazolyl, benzoxazolyl, benzoxazinyl, or benzimidazolyl, and R 2 and R 3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(O)-, -SR a , -S(O)R a , -S(O) 2 R a andR a C(O)-; wherein R 2 and R 3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkyl,
  • the present invention provides a compound of formula (I) wherein R 2 and R 3 together with the carbon atoms to which they are attached form a five- or six- membered ring selected from the group consisting of thienyl, furanyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxadiazolyl, triazolyl, thiadiazolyl, tetrazolyl, phenyl, pyridyl, pyridazinyl and pyrimidinyl, and R 4 is hydroxy.
  • the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzoxazolyl, benzimidazolyl or benzoxazinyl, R 2 and R 3 together with the carbon atoms to which they are attached form a five- or six- membered ring selected from phenyl, thienyl, pyrazolyl, pyridyl, pyrimidinyl or pyridazinyl, and R 4 is hydroxy.
  • the present invention provides a compound of formula (I) wherein A is pyridyl; R 2 and R 3 , together with the carbon atoms to which they are attached, form a pyridyl ring; and R is hydroxyl.
  • the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzoxazolyl, benzimidazolyl or benzoxazinyl, R 2 and R 3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(O)-, -SR a , -S(O)R a , -S(O) 2 R a and R a C(O)-; wherein R 2 and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, R
  • the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzimidazolyl, benzoxazolyl or benzoxazinyl, R 2 and R 3 together with the carbon atoms to which they are attached form five- or six-membered ring selected from the group consisting of phenyl, pyridyl, thienyl, pyrimidinyl, pyrazolyl, pyridazinyl, cyclohexyl or cyclopentyl, R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloal
  • Examplary compounds of the first embodiment of the present invention of formula (I) include, but not limited to, the following: l-[2-(l-cyclohexen-l-yl)ethyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one; ethyl [3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8- naphthyridin-l(2H)-yl]acetate;
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroary
  • R a R b NC(O)NR c alkyl-, R f R g C N- and R O-, wherein R 1 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, ⁇ xo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR c ), -(alkyl)(NR c R e ), -SR C , -S(O)R c , -S(O) 2 R c , -ORc, -N(Rc)(Re), -C(O)R c , -C(O)OR c and -C(O)NR c R e ;
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R N-, N 3 -, R e S-, wherein R 4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and -COOH;
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(
  • R k Oalkyl-, R a R b NS0 2 -, R a R b NSO 2 alkyl-, (R b O)(R a )P(O)0- and -OR k , wherein each R 5 is independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR c ), -(alkyl)(NR c R d ), -SR C , -S(0)R c , -S(O) 2 R c , -OR c , -N(R c )(R d ), -C(O)R
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(0)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R k Oalkyl-, R c R d Nalkyl-, R c R d NC(0)alkyl-, R c S0 2 -, R c SO 2 alkyl-, R c C(O)-, R c C(O)alkyl-, R c OC(O)-, R c OC(O)alkyl-, R c R d NalkylC(0)-, R c R d NC(O)-, R c R d NC(O)Oalkyl-, R c R d NC(0)N(R e )alkyl-, wherein R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalky
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(O)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • Rf, R g and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH 2
  • R f and R g together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and R h together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3
  • the present invention provides a compound of formula (II) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (II) wherein R 4 is hydroxy and R 1 is selected from the group consisting of, C3 alkyl, C4 alkyl, C5 alkyl, C3 alkenyl, C4 alkenyl, C5 alkenyl, C3 alkynyl, C4 alkynyl, C5 alkynyl, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, (C3-C7
  • R 1 is substituted with 0, 1, 2, or 3 substituents selected from the group consisting of alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, phenyl, piperazinyl, morphilinyl, carboxy, -C(0)0(alkyl), -NH 2 , -NH(alkyl), -N(alkyl) 2 , -Oalkyl, -O-phenyl.
  • the present invention provides a compound of formula (II) wherein R 4 is hydroxy and R 1 is selected from the group consisting of ((l-isopropyl)butyl)N(H)-, ((2- chloro-1 ,3-thiazol-5-yl)methyl)N(H)-, ((2-methyl-l ,3-thiazol-4-yl)methyl)N(H)-, ((3- methylthien-2-yl)methyl)N(H)-, ((3-trifluoromethyl)cyclohexyl)N(H)-, ((5-chlorothien-2- yl)methyl)N(H)-, ((pyridin-3-yl)methyl)N(H)-, (l,2,3,4-tetrahydronaphthalen-2-yl)N(H)-, (l,3-thiazol-2-ylmethyl)N(H)-, (l,3-thiazol-5-ylmethyl)N(H)
  • l]hept-2-yl)methyl (6-ethoxy-2-pyridinyl)methyl, (6-methyl-2-pyridinyl)methyl, (cyclopropylmethyl)N(H)-, (pyridin-2-ylmethyl)N(H)-, (pyridin-3-ylmethyl)N(H)-, (pyridin-4-ylmethyl)N(H)-, (tetrahydro-2H-pyran-4-yl)N(H)-, (thien-2-ylmethyl)N(H)-, (thien-3-ylmethyl)N(H)-, 1,1 ' -biphenyl -4-ylmethyl, 1 ,3-thiazol-4-ylmethyl, 1-adamantylmethyl, l-benzothien-2- ylmethyl, 1-ethylpropyl, 1-naphth ylmethyl, 1-neopentyl, 1-phenylethyl, 2-(l,3-dioxo
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroary
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and - COOH;
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-,
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl) (OR k ), -(alkyl)(NR a R b ), -SR a , -S(Q)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(O)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R N-, R k O-.
  • R k Oalkyl- 5 R c R d Nalkyl-, R c R d NC(0)alkyl-, R c S0 2 -, R c S0 2 alkyl-, R c C(0)-, R c C(0)alkyl-, R c OC(O)-, R c OC(0)alkyl-, R c R d NalkylC(0)-, R c R d NC(O)-, R c R d NC(0)Oalkyl-, R c R d NC(0)N(R e )alkyl-, wherein R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl heteroarylalkyl, alkoxyalkoxy
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -S0 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(0)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(O)R a , -C(O)OR a and -C(0)NR a R b , then R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocycleal
  • the present invention provides a compound of formula (III) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (HI) wherein R 4 is hydroxy and R 1 is selected from the group consisting of ((l-isopropyl)butyl)N(H)-, ((2- chloro-l,3-thiazol-5-yl)methyl)N(H)-, ((2-methyl-l, 3-thiazol-4-yl)methyl)N(H)-, ((3- methylthien-2-yl)methyl)N(H)-, ((3-trifluoromethyl)cyclohexyl)N(H)-, ((5-chlorothien-2- yl)methyl)N(H)-, ((pyridin-3-yl)methyl)N(H)-, (l,2,3,4-tetrahydronaphthalen-2-yl)N(H)-, (l,3-thiazol-2-ylmethyl)N(H)-, (l,3-thiazol-5-ylmethyl)N(H)-, ((l
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, halo alkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and - COOH;
  • B is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (0)SN(R f )-, R a SO 2 N(R f )-, R a (O)SN(R f )alkyl-, R a SO 2 N(R f )alkyl-, R a R
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -S0 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • R f and R g together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, R f and R h together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of
  • R k is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, R a R b Nalkyl
  • the present invention provides a compound of formula (IV) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (Va)
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroary
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (O)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (O)SN(R f )-, R a S0 2 N(R f )-, R a (O)SN(R f )alkyl-, R a S0 2 N(R f )alkyl-,
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b ; wherein each R ⁇ is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R O-.
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a compound of formula (Va) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (Va) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of C1-C7 alkyl, phenyl-Cl- C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((C3-C6 cycloalkyl) C1-C2 alkyl)-, (C1-C7 alkyl)0-, (C3- C7 cycloalkyl)O-, phenyl-Cl-C2 alkyl-O-, -NH 2 , (C1-C7 alkyl)N(H)-, (C3-C7 cycloalkyf)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (heterocycle)N(H)-, (heteroarylalkyl)N(H)-,(arylalkyl)N(H)-.
  • the present invention provides a compound of formula (Va) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, thienylmethyl, cyclobutylmethyl, cyclopropylethyl, -NH 2 , (isopropyl)N(H)-, (isobutyl)N(H)-, (3-methylbutyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-; wherein the phenylmethyl and the thienylmethyl are independently unsubstituted or substituted with 1, 2 or 3 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH 2 , -N(H)alkyl, — N
  • the present invention provides a compound of formula (Vb)
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R k Oalkyl-, R a R b NS0 2 -, R a R b NS0 2 alkyl-, (R b O)(R a )P(0)0- and -OR k , wherein each R 5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR c ), -(alkylXNRcRd), -SR C , -S(O)R c , -S(0) 2 R c , -OR c , -N(R c )(R d ), -C(0)R c , -C(0)OR
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(0)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(O)R a , -C(O)OR a and -C(0)NR a R b ; wherein each R 5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -S0 2 R f , -C(0)NR f R h , -SO 2 NR f R h , -C(O)OR , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of C1-C7 alkyl, phenyl-Cl- C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((C3-C6 cycloalkyl) C1-C2 alkyl)-,(Cl-C7 alkyl)0-, (C3- C7 cycloalkyl)0-, phenyl-Cl-C2 alkyl-O-, -NH 2 , (C1-C7 alkyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (heterocycle)N(H)-, (heteroarylalkyl)N(H)-,(arylalkyl)N(H)-.
  • the present invention provides a compound of formula (Vb) wherein R 4 is hydroxy and wherein R 1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, thienylmethyl, cyclobutylmethyl, cyclopropylethyl, -NH 2 , (isopropyl)N(H)-, (isobutyl)N(H)-, (3-methylbutyl)N(H)-, (cyclobutyl)N(H)- and (cycloprq ylmethyl)N(H)-; wherein the phenylmethyl and the thienylmethyl are independently unsubstituted or substituted with 1, 2 or 3 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH 2 , -N(H)alkyl,
  • the present invention provides a compound of formula (Via)
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, hetero
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and - COOH;
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(O)-, R a S-, R a (0)S-, R a (O) 2 S-, R a R b Nalkyl-, R a (O)SN(R f )-, R a S0 2 N(R f )-, R a (0)SN(R f )alkyl-, R a SO 2 N(R f )alkyl-,
  • R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyan
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(O)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a comound of formula (Via) wherein R 4 is hydroxy.
  • the present invention provides a compound of formula (Via) wherein R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5-C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 cycloalkyl, phenyl-Cl-C2 alkyl-, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl
  • the present invention provides a comound of formula (Via) wherein R 4 is hydroxy and R 1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-chloro- thien-2-yl)methyl- (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-.
  • R 4 is hydroxy and R 1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-ch
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroary
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and - COOH;
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(O>, R a S-, R a (0)S-,
  • R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR ), -(alkyl)(NR a R b ), -SRa, -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(Rb), -C(O)R a , -C(0)OR a and -C(O)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -S0 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R is independently substituted with 0, 1, 2, or 3 substituehts independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a compound of formula (VIb) wherein R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5-C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 : cycloalkyl, phenyl-Cl-C2 alkyl-, furyl(Cl-C2 alkyl)-, thiehyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothien
  • the present invention provides a comound of formula (VIb) wherein R 4 is hydroxy and R 1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-chloro- thien-2-yl)methyl- (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-.
  • R 4 is hydroxy and R 1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-chlor
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroary
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and - COOH;
  • R is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (0)SN(R f )-, R a S0 2 N(R f )-, R a (0)SN(R f )alkyl-, R a S0 2 N(R f )alkyl-, R a R
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl) heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the- group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl,
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(0)NR f R h , -S0 2 NR R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R b at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a compound of formula (VII) wherein R 4 is hydroxy.
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, R a R b N-, R a R b Nalkyl-, R a R b NC(0)alkyl-, R f R
  • the present invention provides a compound of formula (VII) wherein R 4 is hydroxy and R 1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5- C6 cycloalkenyl)(Cl-C2 alkyl)--
  • the present invention provides a compound of formula (VII) wherein R 4 is hydroxy and R 1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, (5-chloro-thien-2-yl)methyl-, -NH 2 , (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cyclo ⁇ ropylmethyl)N(H)-.
  • R 4 is hydroxy and R 1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, (5-chloro-thien-2-yl)methyl-, -NH 2 , (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (O)SN(R f )-, R a SO 2 N(R f )-, R a (0)SN(R f )alkyl-, R a S0 2 N(R f )alkyl-, R a
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(0)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano,
  • R 7 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (0)SN(R f )-, R a SO 2 N(R f )-, R a (0)SN(R f )alkyl-, R a S0 2 N(R f )alkyl-, R a R
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R k Oalkyl-, R c R Nalkyl-, R c R d NC(p)alkyl-, R c SO 2 -, R c SO 2 alkyl-, R c C(O)-, R c C(0)alkyl-, R c OC(O)-, R c OC(O)alkyl-, RcR d NalkylC(O)-, R c R d NC(0)-, R c R d NC(0)Oalkyl-, R c R d NC(0)N(R e )alkyl-, wherein R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyal
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo., oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • the present invention provides a compound of formula (VIII) wherein R 2 and R 3 , together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R 6 ) m .
  • the present invention provides a compound of formula (VTII) wherein
  • R 2 and R 3 together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl.
  • the present invention provides a compound of formula (VIII) wherein R 2 and R 3 , together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl and R 4 is hydroxy.
  • the present invention provides a compound of formula (VIII) wherein R 2 and R 3 , together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R 4 is hydroxy, and R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroary
  • the present invention provides a compound of formula (VIII) wherein R and R , together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R 4 is hydroxy, and R 1 is selected from the group consisting of C1-C7 alkyl, (C3-C6 cycloalkyl)Cl-C2 alkyl)-, phenyl-Cl-C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((phenyl)Cl-C2 alkyl)O-, (C3-C7 alkyl)O-, (C3-C6 cycloalkyl)0-, ((phen;yl)Cl-C2 alkyl)N(H
  • R 2 and R 3 together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R 4 is hydroxy, and R 1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, phenylethyl, (5- chloro-thien-2-yl)methyl, cyclobutylmethyl, cyclopropylmethyl, cyclopropylethyl,
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more host immune modulators, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IH), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (VII) or (NTH), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (IH), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (in), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising, a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (SL), (IV), (Va), (Vb), (Via), (VIb), (VII) or (Vffl), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (in), (IV), (Va), (Vb), (Via), (VIb), (VE) or (V ⁇ i), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an anti
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (IH), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha,. egylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha,. egylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), ( ⁇ i), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), ( ⁇ ), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIH), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (VH) or (Vffl), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of O 2004/041818
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (YU) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine,
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (ffl), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (Va), (Vb), (Via), (VIb), (VII) or (VIH), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokin
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (Va), (Vb), (Via), (VIb), (NH) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically O 2004/041818
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (in), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents th ⁇ t treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IH), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pha ⁇ naceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HCV hepatitis B
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HCV hepatitis B
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HBV hepatitis B
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, inter
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-
  • the agent that treat patients for disease caused by hepatitis B(HBV) infection in the above mentioned pharmaceutical compositions can be selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenfovir.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HTV) infection, and a pharmaceutically acceptable carrier.
  • HTV human immunodeficiency virus
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof,.
  • HAV human immunodeficiency virus
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents th&t treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine compris
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • HAV human immunodeficiency virus
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HI
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • HCV human immunodeficiency virus
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (IT), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta,
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HTV) infection, and a pharmaceutically acceptable carrier.
  • HTV human immunodeficiency virus
  • the agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection in the above-mentioned pharmaceutical compositions may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L- 870812, S-1360, enfuvirtide (T-20) or T-1249, or any combination thereof.
  • HIV human immunodeficiency virus
  • the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment any one of the pharmaceutical compositions disclosed hereinabove.
  • the present invention provides a method of inhibiting the replication of an RNA-containing virus comprising contacting said virus with a therapeuctially effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt thereof.
  • the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or pharmaceutically acceptable salt thereof.
  • the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) or a pharmaceutically acceptable salt thereof wherein theRNA-containing virus is hepatitis C virus.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more host immune modulators.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated- interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated- interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) and one or more second antiviral agents.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) one or more host immune modulators, and one or more second antiviral agents.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), ( ⁇ i), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering fo a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gam
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II),, (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in
  • the present invention provides a method of treating or preventing infection ⁇ caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I)' (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha,
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, peg
  • the present invention a method of treating or preventing
  • -84- infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HBV hepatitis B
  • the present invention a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of sikch treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HBV hepatitis B
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a : pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HBV hepatitis
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI) or a pharmaceutically acceptable salt form thereof
  • one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication
  • the present invention provides a method of treating or preventing
  • -85- infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HCV hepatitis B
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds ⁇ formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable earner.
  • a compound or combination of compounds ⁇ formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HBV hepatitis B
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HCV hepatitis B
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group
  • interferon-alpha consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
  • HCV hepatitis B
  • An agent that treats patients for disease caused by hepatitis B (HBV) infection may be, for example but not limited thereto, L-deoxythymidine, adefovir, lamivudine or tenfovir, or any combination thereof.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (TV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof one or more host immune modulators, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • HCV human immunodeficiency virus
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV)
  • HAV human immunodeficiency virus
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a compound or combination of compounds of formula (I), (H), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) or a pharmaceutically acceptable salt form thereof
  • one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IS), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • a compound or combination of compounds of formula (I), (E), (IS), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutical
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-be
  • the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (Q, (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically
  • one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant
  • second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication
  • agents that treat patients for disease caused by human immunodeficiency virus (HIV) and a
  • the present invention provides a method of treating or preventing infection paused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I),'(E), ( l), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
  • host immune modulators selected from the group consisting of interferon-al
  • An agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) orT-1249, or any combination thereof.
  • HIV human immunodeficiency virus
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, to prepare a medicament for treating or preventing infection caused by an RNA-containing virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, to prepare a medicament for treating or preventing infection caused by an RNA-containing virus in a patient, wherein the RNA-containing virus is hepatitis C virus.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, and one or more host immune modulators, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a therapeutically acceptable salt thereof, and one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Nb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, and one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, and one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators, arid one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from
  • interferon-alpha the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an anti
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral
  • -91- replication and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents th ⁇ t treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (H), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokin
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, inter
  • the present invention provides a use of a compound or combination of compounds of formula (I), (IT), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a
  • -92- pharmaceutically acceptable salt form thereof one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins
  • the present invention a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • the present invention a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by hepatitis B
  • -93- (HBV) infection to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HCV hepatitis B
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-be
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by
  • -94- targeting proteins of the viral genome and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HBV hepatitis B
  • An agent that treats patients for disease caused by hepatitis B (HBV) infection may be, for example but not limited thereto, L-deoxythymidine, adefovir, lamivudine or tenfovir, or any combination thereof.
  • the present invention provides a use of a compound or combination of compounds of formula (I), (S), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HIV human immunodeficiency virus
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, and one or more agents that .treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HCV human immunodeficiency virus
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat patients for disease caused by human immunodeficiency virus (FEV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine compris
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HIV human immunodeficiency virus
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HIV human immunodeficiency virus
  • the present invention provides a use of compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • HCV human immunodeficiency virus
  • the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokin
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
  • host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-be
  • the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by
  • HIV human immunodeficiency virus
  • An agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapiiie, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) orT-1249, or anycombination thereof.
  • HIV human immunodeficiency virus
  • the present invention provides a process for the preparation of a compou
  • A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R 2 and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(0)-, -SR a , -S(0)R a , -S(0) 2 R a and R a C(0)-;
  • R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(O)OR a and -C(0)NR a R b ; alternatively, R 2 and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, cyclo
  • R 4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH 2 , and -COOH;
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-, R a (0) 2 S-, R a R b Nalkyl-, R a (0)SN(R f )-, R a S0 2 N(R f )-, R a (0)SN(R f )alkyl-, R a S0 2 N(R f )alkyl-, R a
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R k Oalkyl-, R c R d Nalkyl-, R c R d NC(O)alkyl-, R c S0 2 -, R 0 SO 2 alkyl-, R c C(0)-, R c C(0)alkyl-, R c OC(0)-, R c OC(0)alkyl-,
  • R a and R b are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NR c R d ), -SR C , -S(0)R c , -S(0) 2 Rc, -ORc, -N(R c )(R d ), -C(0)Rc, -C(0)OR c
  • R c and R are independently selected from the group consisting of hydrogen, -NR f R h , -OR f , -CO(R f ), -SR f , -SOR , -S0 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(O)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyan
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl,
  • R is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, R a R b Nalkyl-, R a Oalkyl-, R a R b NC(0)-, R a R b NC(0)alkyl, R a S-, R a S(0)-, R a S0 2 -, R a Salkyl-, R a (O)Salkyl-, R a SO 2 alkyl-, R a OC(0)-, R a OC(0)alkyl-, R a C(0)-, R a C(0)alkyl-, wherein each R k is substituted
  • R 4 is alkoxy, aryloxy, hydroxy or R e S-
  • R 5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, R a R b N-, R a C(0)-, R a S-, Ra(O)S-, Ra(O) 2 S-, R a SO 2 N(R f )-, R a R b NC(O)-, R k OC(0)-, R a R b NS0 2 - or -OR k
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(0)R a , -S(O) 2 Ra, -OR k , -N(Ra)
  • R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle
  • A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl,
  • R 2 and R 3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(0)-, -SR a , -S(0)R a , -S(0) 2 R a and R a C(0)-;
  • R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(0)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(O)NR a R b ; alternatively, R 2 and R 3 , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl
  • R is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, R a R b N-, N 3 -, R e S-, wherein R 4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH,
  • R 5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, R a R b N-, R a C(0)-, R a S-, R a (0)S-,
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(O) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(O)OR a and -C(0)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl
  • R a and R b are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, R c R d N-, R k O-.
  • R c and R d are independently selected from the group consisting of hydrogen, -NR f R h , -0R f , -CO(R f ), -SR f , -SOR f , -S0 2 R f , -C(0)NR f R h , -S0 2 NR f R h , -C(0)OR f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo
  • R e is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl
  • R f , R g and R h at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl),
  • substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH 2 , -N(H)(alkyl), -N(alkyl) 2 , -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH 2 , -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS0 2 alkyl, -alkylN(alkyl) 2 , -N(H)C
  • R k is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, R a R b Nalkyl-, R a Oalkyl-, R a R b NC(0)-, R a R b NC(0)alkyl, R a S-, R a S(0>, R a S0 2 -, R a Salkyl-, R a (0)Salkyl-, R a S0 2 alkyl-, R a OC(0)-, R a OC(0)alkyl-, R a C(O)-, R a C(O)alkyl-, wherein
  • R 4 is alkoxy, aryloxy, hydroxy or R e S-
  • R 5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, R a R b N-, R a C(0)-, R a S-, R a (O)S-, R a (0) 2 S-, R a S0 2 N(R f )-, R a R b NC(0)-, R k OC(0)-, R a R b NS0 2 - or -OR k
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, • -SR a , -S(O)R a , -S(0) 2 R a , -OR k ,
  • R 4 is hydroxy or R e S-
  • R 5 is hydrogen, unsubstituted alkyl, halo or -OR k
  • R 6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyaiio, nitro, aryl, heteroaryl, heterocyclealkyl, -SR a , -S(0)R a , -S(0) 2 R a , -OR k , -N(R a )(R b ), -C(0)R a , -C(0)OR a and -C(0)NR a R b , then R 1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl,
  • R 1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl
  • R 1 is independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR c ), -(alkyl)(NR c R e ), -SR C , -S(O)R c , -S(O)
  • R 2 and R 3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(R a )(R b ), R a R b NC(0)-, -SR a , -S(0)R a , -S(0) 2 R a and R a C(O)-; wherein R 2 and R 3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of R a , alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SRa, -S(O)R a ,
  • R 6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR k ), -(alkyl)(NR a R b ), -SR a , -S(O)R a , -S(0) 2 R a , -OR k , -N(R a )(Rb), -C(0)R a , -C(O)OR a and -C(O)NR a R b ; wherein each R 6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl,
  • heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR c ), -(alkyl)(NR c R d ), -alkylS0 2 NR c R d , -alkylC(0)NR c R d , -SR C , -S(0)R c , -S(O) 2 R c , -OR c , -N(R c )(Rd), -C(0)R c , -C(0)OR c and -C(0)NR c R d ;
  • R c and R d are independently selected from the group consisting of hydrogen, -NR R h , -OR f , -CO(R f ), -SR f , -SOR f , -SO 2 R f , -C(O)NR f R h , -S0 2 NR f R h , -C(0)0R f , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each R c and R d is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo,
  • R f , R g and R h are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each R f , R g and R h is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH 2 , -N(H)(alkyl), -N(alkyl) 2 , -
  • R f and R h together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH 2 , -N(H)(alkyl), -N(alkyl) 2 , -S(alkyl), -S(alkyl) -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkyl
  • Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, R a R b Nalkyl-, R a Oalkyl-, R a R b NC(0)-, R a R b NC(0)alkyl, R a S-, R a S(0)-, R a SO 2 -, R a Salkyl-, R a (O)Salkyl-, R a SO 2 alkyl-, R a OC(O)-, R a OC(O)alkyl-, R a C(O)-, R a C(O)alkyl-, where
  • R and R are independently selected from the group consisting of alkyl, alkenyl and alkynyl.
  • Exemplary compounds of the sixty-first embodiment of the present invention of formula (IX), or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof include, but not limited to, the following: l-benzyl-3-(bis(methylthio)methylene)-lH-quinoline-2,4(lH,3H)-dione;
  • the compounds of the invention can comprise asymmetrically substituted carbon
  • substantially free is meant greater than about 80% free of other enantiomers or diastereomers of the compound, more preferably greater than about 90% free of other enantiomers or diastereomers of the compound, even more preferably greater than about 95% free of other enantiomers or diastereomers of the compound, even more highly preferably greater than about 98% free of other enantiomers or diastereomers of the compound and most preferably greater than about 99% free of other enantiomers or diastereomers of the compound.
  • Individual stereoisomers of the compounds of this invention can be prepared by any one of a number of methods which are within the knowledge of one of ordinary skill in the art. These methods include stereospecific synthesis, chromatographic separation of diastereomers, chromatographic resolution of enantiomers, conversion of enantiomers in an enantiomeric mixture to diastereomers and then chromatographically separating the diastereomers and regeneration of the individual enantiomers, enzymatic resolution and the like.
  • Stereospecific synthesis involves the use of appropriate chiral starting materials and synthetic reactions which do not cause racemization or inversion of stereochemistry at the chiral centers.
  • Diastereomeric mixtures of compounds resulting from a synthetic reaction can often be separated by chromatographic techniques which are well-known to those of ordinary skill in the art.
  • Chromatographic resolution of enantiomers can be accomplished on chiral chromatography resins. Chromatography columns containing chiral resins are commercially available. In practice, the racemate is placed in solution and loaded onto the column containing the chiral stationary phase. The enantiomers are then separated by HPLC.
  • Resolution of enantiomers can also be accomplished by converting the enantiomers in the mixture to diastereomers by reaction with chiral auxiliaries.
  • the resulting diastereomers can then be separated by column chromatography. This technique is especially useful when the compounds to be separated contain a carboxyl, amino or hydroxyl group that will form a salt or covalent bond with the chiral auxiliary. Chirally pure amino acids, organic carboxylic acids or organosulfonic acids are especially useful as chiral auxiliaries.
  • Enzymes such as esterases, phosphatases and lipases, can be useful for resolution of derivatives of the enantiomers in an enantiomeric mixture. For example, an ester derivative of a carboxyl group in the compounds to be separated can be prepared. Certain enzymes will selectively hydrolyze only one of the enantiomers in the mixture. Then the resulting enantiomerically pure acid can be separated from the unhydrolyzed ester.
  • the present compounds may exhibit the phenomena of tautomerism or structural isomerisrh.
  • drawings within this specification can only represent one possible tautomeric or structural isomeric form, it should be understood that the invention encompasses any tautomeric or structural isomeric form; or mixtures thereof, which possess the ability to inhibit hepatitis C, and is not limited to any one tautomeric or structural isomeric form utilized within the drawings.
  • solvates and hydrates of the compounds of the invention are meant to be included in this invention.
  • any variable for example R 1 , R 2 , R 3 , m, n, etc.
  • its definition on each occurrence is independent of its definition at every other occurrence.
  • combinations of substituents are permissible only if such combinations result in stable compounds.
  • Stable compounds are compounds which can be isolated in a useful degree of purity from a reaction mixture.
  • the compounds of the present invention can exist as pharmaceutically acceptable salts.
  • pharmaceutically acceptable salt represents acid or base salts or zwitterionic forms of the compounds of the present invention which are water or oil- soluble or dispersible, which are suitable for treatment of diseases without undue toxicity, irritation, and allergic response; which are commensurate with a reasonable benefit/risk ratio, and which are effective for their intended use.
  • the salts can be prepared during the final isolation and purification of the compounds or separately by reacting a basic group (for example, a nitrogen containing group) with a suitable acid.
  • Representative acid addition salts include acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethansulfonate, lactate, maleate, mesitylenesulfonate, methanesulfonate, naphthylenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, picrate, pivalate, propionate, succinate, tartrate, trichloroacetate,trifluoroacetate, phosphate, glutamate, bi
  • acids which can be employed to form pharmaceutically acceptable addition salts include inorganic acids such as hydrochloric, hydrobromic, sulfuric, and phosphoric, and organic acids such as oxalic, maleic, succinic, and citric.
  • Basic addition salts can be prepared during the final isolation and purification of the compounds by reacting an acidic group (for example, a carboxy group or an enol) with a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation or with ammonia or an organic primary, secondary, or tertiary amine.
  • an acidic group for example, a carboxy group or an enol
  • a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation or with ammonia or an organic primary, secondary, or tertiary amine.
  • the cations of pharmaceutically acceptable salts include lithium, sodium, potassium, calcium, magnesium, and aluminum, as well as nontoxic quaternary amine cations such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N- methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N- dibenzylphenethylamine, 1-ephenamine, and N,N'-dibenzylethylenediamine.
  • Other ' representative organic amines useful for the formation of basic addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, and piperazine.
  • Preferred salts of the compounds of the present invention include monosodium, disodium, triethylamine salt, trifluoroacetate and hydrochloride.
  • the present compounds can also exist as pharmaceutically acceptable prodrugs.
  • pharmaceutically acceptable prodrug refers to those prodrugs or zwitterions which are suitable for use in contact with the tissues of patients without undue toxicity, irritation, and allergic response, are commensurate with a reasonable benefit/risk ratio, and are effective for their intended use.
  • Prodrugs are considered to be any covalently bonded carriers which release the active parent drug of formula (I), (II), (III), (IV), (V), (Va), (Vb), (Via), (VIb), ': (VII) or (VIII) in vivo when such prodrugs is administered to a mammalian subject.
  • Prodrugs of the compounds of formula (I), (H), (HI), (IV), (V), (Va), (Vb), (Via), (VIb), (VII) or (VIII) are prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compounds respectively.
  • Prodrugs include compounds wherein hydroxy, amine, carboxy, or sulfhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxyl, amino, carboxy, or sulfhydryl group, respectively.
  • Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of the hydroxy, carboxy and amine functional groups in the compounds of formula (I), (II), (HI), (IV), (V), (Va), (Vb), (Via), (VIb), (VH) and (VHI); and the like.
  • the compounds can be administered alone or in combination with other antiviral agents.
  • the specific pharmaceutically effective dose level for any particular patient will depend upon factors such as the disorder being treated and the severity of the disorder; the activity of the particular compound used; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration; the route of administration; the rate of excretion of the compound employed; the duration of treatment; and drugs used in combination with or coincidently with the compound used.
  • the compounds can be administered orally, parenterally, osmotically (nasal spipays), rectally, vaginally, or topically in unit dosage formulations containing carriers, adjuvants, diluents, vehicles, or combinations thereof.
  • parenteral includes infusion as well as subcutaneous, intravenous, intramuscular, and intrasternal injection.
  • Parenterally administered aqueous or oleaginous suspensions of the compounds can be formulated with dispersing, wetting, or suspending agents.
  • the injectable preparation can also be an injectable solution or suspension in a diluent or solvent.
  • acceptable diluents or solvents employed are water, saline, Ringer's solution, buffers, monoglycerides, diglycerides, fatty acids such as oleic acid, and fixed oils such as monoglycerides or diglycerides.
  • the antiviral effect of parenterally administered compounds can be prolonged by slowing their absorption.
  • One way to slow the absorption of a particular compound is administering injectable depot forms comprising suspensions of crystalline, amorphous, or otherwise water-insoluble forms of the compound.
  • the rate of absorption of the compound is dependent on its rate of dissolution which is, in turn, dependent on its physical state.
  • Another way to slow absorption of a particular compound is administering injectable depot forms comprising the compound as an oleaginous solution or suspension.
  • injectable depot forms comprising microcapsule matrices of the compound trapped within liposomes, microemulsions, or biodegradable polymers such as polylactide-polyglycolide, polyorthoesters or polyanhydrides.
  • biodegradable polymers such as polylactide-polyglycolide, polyorthoesters or polyanhydrides.
  • the rate of drug release can be controlled.
  • Transdermal patches can also provide controlled delivery of the compounds.
  • the rate of absorption can be slowed by using rate controlling membranes or by trapping the compound within a polymer matrix or gel.
  • absorption enhancers can be used to increase absorption.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
  • the active compound can optionally comprise diluents such as sucrose, lactose, starch, talc, silicic acid, aluminum hydroxide, calcium silicates, polyamide powder, tableting lubricants, and tableting aids such as magnesium stearate or microcrystalline cellulose.
  • diluents such as sucrose, lactose, starch, talc, silicic acid, aluminum hydroxide, calcium silicates, polyamide powder, tableting lubricants, and tableting aids such as magnesium stearate or microcrystalline cellulose.
  • Capsules, tablets and pills can also comprise buffering
  • -113- agents, and tablets and pills can be prepared with enteric coatings or other release-controlling coatings.
  • Powders and sprays can also contain excipients such as talc, silicic acid, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures thereof. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons or substitutes therefore.
  • Liquid dosage forms for oral administration include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs comprising inert diluents such as water. These compositions can also comprise adjuvants such as wetting, emulsifying, suspending, sweetening, flavoring, and perfuming agents.
  • Topical dosage forms include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and transdermal patches.
  • the compound is mixed under sterile conditions with a carrier and any needed preservatives or buffers.
  • These dosage forms can also include excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Suppositories for rectal or vaginal administration can be prepared by mixing the compounds with a suitable non-irritating excipient such as cocoa butter or polyethylene glycol, each of which is solid at ordinary temperature but fluid in the rectum or vagina.
  • a suitable non-irritating excipient such as cocoa butter or polyethylene glycol, each of which is solid at ordinary temperature but fluid in the rectum or vagina.
  • Ophthalmic formulations comprising eye drops, eye ointments, powders, and solutions are also contemplated as being within the scope of this invention.
  • the compounds of the invention inhibit HCV RNA dependent RNA polymerase an enzyme essential for HCV viral replication. They can be administered as the sole active pharmaceutical agent, or they can also be used in combination with one or more agents to treat hepatitis C infections or the symptoms associated with HCV infection. Other agents to be administered in combination with a compound of the present invention include therapies for disease caused by HCV infection that suppresses HCV viral replication by direct or ⁇ indirect mechanisms.
  • agents such as host immune modulators, for example, interferon-alpha, pegylated interferon-alpha, CpG oligonucleotides and the like, or antiviral compounds that inhibit host cellular functions such as inosine monophosphate dehydrogenase, for example, ribavirin and the like.
  • cytokines that modulate immune function.
  • vaccines comprising HCV antigens or antigen adjuvant combinations directed against HCV.
  • IRS internal ribosome entry site
  • Other agents to be administered in combination with a compound of the present mvention include any agent or combination of agents that inhibit the replication of HCV by targeting proteins of the viral genome involved in the viral replication. These agents include but are not limited to other inhibitors of HCV
  • RNA dependent RNA polymerase such as, for example, nucleoside type polymerase inhibitors described in WO0190121(A2), or US6348587Bl or O0160315 or WO0132153 or non-nucleoside inhibitors such as, for example, benzimidazole polymerase inhibitors described in EP1162196A1 or WO0204425 or inhibitors of HCV protease such as, for example, peptidomimetic type inhibitors such as BILN2061 and the like or inhibitors of HCV helicase.
  • agents to be administered in combination with a compound of the present or combination of agents that inhibit the replication of other viruses for co-infected individuals include but are not limited to therapies for disease caused by hepatitis B (HBV) infection such as, for example, adefovir, lamivudine, LdT (L-deoxythymidine) and tenofovir or therapies for disease caused by human immunodeficiency virus (HIV) infection such as, for example, protease inhibitors: ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir; reverse transcriptase inhibitors: zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavir
  • agents to be administered in combination with a compound of the present invention include any agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.
  • the therapeutic agents can be formulated as separate compositions which are given at the same time or within a predetermined period of time, or the therapeutic agents can be given as a single unit dosage form.
  • the total daily dose of the compounds administered to a host in single or divided doses can be in amounts from about 0.1 to about 200 mg kg body weight or preferably from about 0.25 to about 100 mg/kg body weight.
  • Single dose compositions can contain these amounts or submultiples thereof to make up the daily dose. Determination of Biological Activity
  • HCV polymerase inhibition assay biochemical ICsn: Either two-fold serial dilutions (fractional inhibition assay) or a narrower range of dilutions spanning the IC50 of the inhibitor (tight binding assay) of the inhibitors were incubated with 20 mM Tris-Cl pH 7.5, 5 mM MgCl 2 , 50 mM NaCI, 1 mM dithiothreitol, 1 mM ethylene diamine tetraacetic acid (EDTA), 300 ⁇ M GTP and 150 to 300 nM NS5B (HCV Strain IB (J4, Genbank accession number AF054247, or H77, Genbank accession number AF011751)) for 15 minutes at room temperature.
  • HCV Strain IB J4, Genbank accession number AF054247, or H77, Genbank accession number AF011751
  • reaction was initiated by the addition of 20 ⁇ M CTP, 20 ⁇ M ATP, 1 ⁇ M 3H-UTP (10 mCi/umol), 150 nM template RNA and 0.4 U/ ⁇ l RNase inhibitor (RNasin, Promega), and allowed to proceed for 2 to 4 hours at room temperature. Reaction volume was 50 ⁇ l. The reaction was terminated by the addition
  • IC50 values were calculated by a two-variable nonlinear regression equation using an uninhibited control and a fully inhabited control sample to determine the minimum and maximum for the curve. Tight- binding assays were performed on those compounds exhibiting IC50 values less than 0.15 ⁇ M in the fractional inhibition assay in order to more precisely measure the IC50 values. Retained cpm were plotted vs. inhibitor concentration and fit to equation 1 using non-linear regression (ref. 1) to obtain the IC50 values.
  • Retained cpm A[sqrt ⁇ (IC 50 + It - Et) 2 + 4IC 50 Et ⁇ - (IC 50 + It - Et)] eqn 1.
  • sequence of the template RNA used was: 5'GGGCGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGG AUAUCUGCAGAAUUCGCCCUUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAG CUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCU CUGCAGAUCAAGUC-3'
  • the compounds of the present invention inhibit HCV polymerase IB with IC50's in the range of 0.002 ⁇ M to 500 ⁇ M.
  • Replicon cells were plated at 3xl0 3 cells per well in 96-well plate in DMEM medium containing 5% fetal calf serum. At day 1, culture medium was removed and replaced with fresh medium containing eight serial 2-fold dilutions of compound. The final concentration of DMSO in medium was 0.5%. The untreated control culture was treated in an identical manner except no inhibitor was added to the medium. Plates were incubated in a CO2 incubator at 37°C. On Day 4, 100 ⁇ l lysis buffer (RTL) (Qiagen) was added to each well
  • RNA was purified according to manufacturer's recommendations (Qiagen RNAeasy) and eluted in 200 ⁇ l of water.
  • the HCV RNA level was quantified from a portion (5 ⁇ l out of 200 ⁇ l) of the purified RNA by real-time RT-PCR method.
  • the primers and probe are derived from specific sequence in the 5 'UTR region.
  • RT-PCR reaction was performed at 48°C for 30 min, followed by 40 cycles set to 95°C, 15 s; 54°C, 30 s; and 72°C, 40 s.
  • the percentage reduction of HCV RNA in the presence of compound was calculated and the 50% inhibitory concentration (IC50) was calculated by nonlinear regression analysis using the Prism program.
  • the compounds of the present invention inhibit replicon production with EC50's in the range of 0.002 ⁇ M to >100 ⁇ M.
  • Cytotoxicity assays were performed in replicon cells. Briefly, HCV replicon cells were plated at SxlO" cells per well in 96-well plate in DMEM medium containing 5% FCS. At day 1, culture medium was removed and replaced with fresh medium containing eight serial 2-fold dilutions of compound. The final concentration of DMSO in medium was 0.5%. All experiments were performed in duplicate. The untreated control culture was treated in an identical manner except no inhibitor was added to the medium. Plates were incubated in a CO2 incubator at 37°C. On day 4, stock solution of the tetrazolium salt, MTT (4 mg ml in
  • the compounds of the present invention When tested by the above method, the compounds of the present invention exhibited CPE reduction with TC50's in the range of 6.6 ⁇ M to >100 ⁇ M.
  • hepatitis C Cell culture assays for agents targeted toward hepatitis C are not yet available because of the inability to produce infectious virus in a sustained cell line.
  • the hepatitis C virus genome encodes a large polyprotein, which after processing produces the necessary functional components to synthesize progeny RNA.
  • Selectable cell lines that produce high and sustained levels of subgenomic HCV RNA have been derived from human hepatoma cells (Huh7) as described in the references above.
  • the mechanism of RNA ' replication in these cell lines is considered to be identical to the replication of full length HCV RNA in infected hepatocytes.
  • the compounds and methods of this invention are inhibitors of HCV RNA replication in the replicon assay systems described above. This forms the basis of the claim for their potential as therapies in treating disease resulting from
  • DMF is N,N-dimethylformamide
  • DMSO is dimethylsulfoxide
  • THF is tetrahydrofuran.
  • This invention is intended to encompass compounds having formula (I) when prepared by synthetic processes or by metabolic processes. Preparation of the compounds of the invention by metabolic processes include those occurring in the human or animal body (in vivo) or processes occurring in vitro.
  • compounds of formula (2) can be reacted with compounds of formula (3) in the presence of phosphorous oxychloride under heating conditions to provide compounds of formula (4).
  • Compounds of formula (4) can be reacted with a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, and the like in solvent such as but not limited to dimethylacetamide, dimethylformamide, THF, and the like, followed by the addition of R'-X, (wherein R 1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl,
  • R 1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsul
  • Compounds of formula (8) can be treated with reagents including but not limited to phosgene, diphosgene, triphosgene in solvents such as but not limited to 1,2-dichloroethane, carbon tetrachloride, 1,4-dioxane or mixtures thereof, under heating conditions to provide compounds of formula (5).
  • reagents including but not limited to phosgene, diphosgene, triphosgene in solvents such as but not limited to 1,2-dichloroethane, carbon tetrachloride, 1,4-dioxane or mixtures thereof, under heating conditions to provide compounds of formula (5).
  • compounds of formula (9) can also be reacted with reagents including but not limited to phosgene, diphosgene, triphosgene, carbon yldiimidazole, ethyl chloroformate and the like in the presence of a base such as potassium hydroxide, pyridine, lithium hydroxide, and the like in solvents such as but not limited to water, toluene, benzene, and the like under heating conditions to provide compounds of formula (5).
  • reagents including but not limited to phosgene, diphosgene, triphosgene, carbon yldiimidazole, ethyl chloroformate and the like in the presence of a base such as potassium hydroxide, pyridine, lithium hydroxide, and the like in solvents such as but not limited to water, toluene, benzene, and the like under heating conditions to provide compounds of formula (5).
  • Compounds of formula (5) can be treated with compounds of formula (10) in the presence of a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, and the like in a solvent such as but not limited to THF, diethyl ether, methyl tert-butyl ether followed by the treatment with an acid such as acetic acid, dichloroacetic acid or sulfuric acid to provide compounds of formula (11) which are representative of a compound of formula (I), where R 4 is hydroxy.
  • a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, and the like
  • a solvent such as but not limited to THF, diethyl ether, methyl tert-butyl ether
  • an acid such as acetic acid, dichloroacetic acid or sulfuric acid
  • Compounds of formula (5) can be reacted with diethyl malonate that has been pretreated with a base such as sodium hydride, potassium hydride, and the like in solvents such as dimethylacetamide, dimethylformamide, THF, and the like under heated conditions to provide compounds of formula (12).
  • a base such as sodium hydride, potassium hydride, and the like in solvents such as dimethylacetamide, dimethylformamide, THF, and the like under heated conditions to provide compounds of formula (12).
  • Compounds of formula (12) can be treated with compounds of formula (13) in solvents such as toluene, mesitylene, benzene, and the like under heated conditions to provides compounds of formula (14).
  • Compounds of formula (14) can be treated with a base such as sodium hydroxide, potassium hydroxide, lithium
  • compounds of formula (8) can be treated with ethyl chloromalonate in the presence of a base such as triethylamine, diisopropylethylamine, pyridine, and the like in solvents such as dichloromethane, chloroform, carbon tetrachloride to provide compounds of formula (15).
  • compounds of the formula (8) can be treated with ethyl chloromalonate in solvents such as benzene, toluene under heating conditions to provide compounds of formula (15).
  • Compounds of formula (15) can be treated with sodium ethoxide in ethanol to provide compounds of formula (12).
  • Scheme 7 shows the preparation of compounds of formula (I)) where R 4 is halo.
  • Compounds of formula (11) can be treated with reagents known to those skilled in the art which are commonly used to convert alcohols to chlorides.
  • compounds of formula (11) can be treated with reagents including but not limited to PCI 5 , PC1 3 , POCl 3 , or thionyl chloride, with or without solvents such as but not limited to dichloromethane, chloroform and benzene, to provide compounds of formula (I) which are representative of compounds where R 4 is chlorine.
  • Similar transformations are possible using PBr 3 or DAST to convert the said alcohol to the corresponding compound of formula (I) where R 4 is bromide and fluoride, respectively.
  • compound of formula (I) wherein R 4 is iodo can be prepared by (a), reacting compound of formula (11) with a mesylating reagent
  • -121- such as methanesulfonyl chloride or methanesulfonyl anhydride in the presence of an amine base such as triethylamine, pyridine or diisopropylethylamine in solvents such as but not limited to dichloromethane, acetonitrile, carbon tetrachloride, chloroform, and (b) treatment of the mesylate thus formed with N-iodosuccinimide.
  • an amine base such as triethylamine, pyridine or diisopropylethylamine in solvents such as but not limited to dichloromethane, acetonitrile, carbon tetrachloride, chloroform
  • compounds of formula (16) can be converted to compounds of formula (17) which are representative of compounds of formula (I) where R 4 is R a R b N-, by freatment with an amine having the formula R a R b NH, (where R a and R b are as defined herein) in a polar solvent such as methanol, ethanol, and the like, under heating conditions to provide compounds of formula (17).
  • a polar solvent such as methanol, ethanol, and the like
  • R is alkoxyalkyl, alkoxycarbonyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfonylalkyl, aryl, arylalkyl, arylsulfanylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkyl,
  • Compounds of formula (21) can be treated with aqueous base such as but not limited to potassium hydroxide, sodium hydroxide and the like, to provide compounds of formula (22).
  • Compounds of formula (22) can be treated with a metal hydride base such as sodium hydride, an organolithium reagent (e.g.
  • compounds of formula (22) can be treated with aldehydes or ketones of structure R f R g C(0) without solvents or with solvents such as but not limited to dimethylacetamide, tetrahydrofuran, dioxane and the like under heated conditions to provide compounds of formula (24).
  • Reduction of compounds of formula (24) with hydrogen and a catalyst such as palladium and the like or a metal hydrides such as lithium borohydride, sodium cyanoborohydride and the like provide compounds of the formula (25).
  • Compounds of formula (12) can be reacted with aqueous base solutions such as potassium hydroxide and the like under heated conditions to provide compounds of formula (26).
  • Compounds of formula (26) can be reacted with a base in a solvent, or mixtures of solvents such as, but not limited to, N,N-dimethylformamide, tetrahydrofuran, diethyl ether, or methyl tert-butyl ether, and the like, followed by treatment with carbon disulfide at a temperature of about room temperature to about 70°C.
  • Examples of the base include, but not limited to, sodium hydride, potassium hydride, lithium diisopropylamide, sodium hexamethyldisilazide and lithium hexamethyldisilazide.
  • Subsequent treatment with a methylafing reagent at a temperature of about 25°C provides compounds of formula (27).
  • Examples of the methylating agent include, but not limited to, methyl iodide, methyl triflate, dimethylsulfate, and the like.
  • compounds of the formula (26) can be reacted with tris(methylthio)methyl methyl sulfate in the presence of a base in a solvent such as 1,4- dioxane or dimethylacetamide, and the like, at a temperature of about 25°C to about 150°C to give compounds of formula (27).
  • Examples of the base include, but are not limited to, organic amine bases such as imidazole, 1-methylimidazole, 2-methylimidazole, 2- isopropylimidazole, 4-methylimidazole, 4-nitroimidazole, pyridine, N,N- dimethylaminopyridine, 1,2,4-triazole, pyrrole, 3-methylpyrrole, triethylamine, diisopropylethylamine or N-methylmorpholine and the like.
  • organic amine bases such as imidazole, 1-methylimidazole, 2-methylimidazole, 2- isopropylimidazole, 4-methylimidazole, 4-nitroimidazole, pyridine, N,N- dimethylaminopyridine, 1,2,4-triazole, pyrrole, 3-methylpyrrole, triethylamine, diisopropylethylamine or N-methylmorpholine and the like.
  • Compounds of formula (27) can be treated with compounds such as (13) in a solvent or a mixture of solvents, such as but not limited to, toluene, benzene, dioxane or tetrahydrofuran, and the like, at a temperature of about 50°C to about 150°C to provide compounds of formula (11).
  • a solvent or a mixture of solvents such as but not limited to, toluene, benzene, dioxane or tetrahydrofuran, and the like, at a temperature of about 50°C to about 150°C to provide compounds of formula (11).
  • -125- aqueous alcoholic solvents such as methanol or ethanol under heated conditions provides compounds of the formula (35).
  • the reduction can also be achieved by treating compounds of formula (35) with iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heated conditions. Treatment of compounds of the formula (35) with an orthoester of the formula (36) under heating conditions to provide compounds of the formula (37).
  • Compounds of the formula (35) can be treated with cyanogen bromide under heating conditions to give compounds of the formula (38).
  • an amine base such as triethylamine, pyridine
  • an inorganic base such as cesium carbonate or : potassium carbonate in an appropriate solvent or a mixture of solvents selected from dimethylacetamide, N,N-dimethylformamide, methanol, dichloromethane, te
  • Compounds of formula (40) can be nitrated with ammonium nitrate or potassium nitrate in the presence of an acid such as sulfuric acid, or trifluoroacetic acid in trifluoroacetic anhydride, with or without additional solvent, under cooling conditions to give compounds of the formula (41).
  • Reduction of compounds of the formula (41) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heated conditions provides compounds of the formula (42).
  • the reduction of compounds of formula (42) can also be accomplished using iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heated conditions.
  • Compounds of the formula (42) can be converted to compounds of the formula (44) by (a) nitration and (b) reduction of the product of step (b), using the respective conditions as mentioned above.
  • Compounds of the formula (44) can be treated with an orthoester of the formula (36) under heating conditions to provide compounds of the formula (45).
  • Compounds of formula (42) can be sulfonylated with a sulfonyl chloride of formula R a S0 2 Cl in the presence of a base such as pyridine alone or an amine base such as triethylamine, diisopropylethylamine, and the like in a solvent or combination of solvents
  • a base such as pyridine alone or an amine base such as triethylamine, diisopropylethylamine, and the like in a solvent or combination of solvents
  • compounds of formula (42) can be sulfamoylated in the presence of an amine base such as but not limited to triethylamine, or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane, and the like, with compounds of formula (49) to give compounds of formula (47).
  • Compounds of formula (49) can be obtained by treating chlorosulfonyl isocyanate and 2-chloroethanol in conditions that are well known in the art.
  • Compounds of formula (47) can be treated further with an amine having the formula R a R b NH, (where R a and R b are as defined herein) in a solvent or combination of solvents such as dichloromethane, THF, or acetonitrile, and the like, under heating conditions to provide compounds of formula (48).
  • Compounds of formula (42) can be sulfamoylated in the presence of an amine base such as triethylamine, or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane, and the like, with compounds of formula (54) to give compounds of formula (48).
  • Compounds of formula (54) can be obtained by treating an amine of the formula R a RbNH with sulfuryl chloride or by (a) treating an amine of the formula R a R b NH with chlorosulfonic acid, and (b) contacting the product of step (a) with a chlorinating agent such as phosphorous pentachloride and the like in conditions that are well known in the art.
  • a chlorinating agent such as phosphorous pentachloride and the like in conditions that are well known in the art.
  • compounds of formula (11) wherein R 5 is -alkylNH 2 can be converted to compounds of formula (11) wherein R 5 is -alkylNHS0 2 NR a Rb using the conditions for the transformation of compounds of formula (42) to compounds of formula (48).
  • Compounds of formula (11) wherein R > 5 i •s -alkylNH 2 can be converted to compounds of formula (11) wherein R 5 is -alkylNHS0 2 R a can be achieved by employing the conditions for the transformation of compounds of formula (42) to compounds of formula (46).
  • Compounds of formula (42) can be sulfamoylated with a sulfamoyl chloride of formula R c OC(0)NHSO 2 Cl (50), in the presence of an amine base such as pyridine, triethylamine or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran, diethyl ether, benzene, or acetonitrile, and the like, to provide compounds of formula (51).
  • an amine base such as pyridine, triethylamine or diisopropylethylamine, and the like
  • solvent or combination of solvents such as dichloromethane, tetrahydrofuran, diethyl ether, benzene, or acetonitrile, and the like
  • Compounds of formula (50) can be prepared by treating an alcohol of formula R c OH with chlorosulfonyl isocyanate in a solvent or combination of solvents such as dichloromethane, carbon tetrachloride, diethyl ether, benzene, or toluene, and the like.
  • Compounds of formula (51) can be treated further with an alcohol having the formula R a OH in the presence of tri-rc-butylphosphine or triphenylphosphine, and the like, and diisopropylazodicarboxylate, l,l'-(azadicarbonyl)piperidine, or diethylazodicarboxylate, and the like, in a solvent or combination of solvents such as dichloromethane or tetrahydrofuran to provide compounds of formula (52).
  • an alcohol having the formula R a OH in the presence of tri-rc-butylphosphine or triphenylphosphine, and the like, and diisopropylazodicarboxylate, l,l'-(azadicarbonyl)piperidine, or diethylazodicarboxylate, and the like, in a solvent or combination of solvents such as dichloromethane or tetrahydrofuran to provide compounds of formula (52).
  • compounds of formula (52) wherein R a is methyl can be obtained by methylafing compounds of formula (51) with a methylating agent such as, but not limited to, methyl iodide, dimethyl sulfate, trimethysilyldiazomethane in conditions that are well known in the art. Transformation of compounds of formula (52) to compounds of formula (53) can be achieved by reaction with an acid such as trifluoroacetic acid or hydrochloric acid, or by hydrogenolysis conditions such as palladium on carbon under hydrogen gas.
  • a methylating agent such as, but not limited to, methyl iodide, dimethyl sulfate, trimethysilyldiazomethane in conditions that are well known in the art. Transformation of compounds of formula (52) to compounds of formula (53) can be achieved by reaction with an acid such as trifluoroacetic acid or hydrochloric acid, or by hydrogenolysis conditions such as palladium on carbon under hydrogen gas.
  • compounds of formula (11) wherein R 5 is -alkylNH 2 can be converted to compounds of formula (11) wherein R 5 is -alkylNHS0 2 NHCOOR c by the conditions for the
  • Example 1 20 l-butyl-3-(lJ-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-2(lH)- one
  • Example IA 2H-pyridor2,3-din,31oxazine-2,4(lH)-dione
  • the title compound was prepared from 2,3-pyridinecarboxylic anhydride (11.4 g, 76 25 mmol) and trimethylsilyl azide ( 11.0 mL, 80 mmol) according to the procedure described ih Synthesis, 1982, 972-973 as a white solid (7.27 g, 58%).
  • Example IC ethyl (1,1 -dioxido-4H-L2,4-benzothiadiazin-3-yl)acetate
  • the title compound was prepared as a white solid in two steps (46% yield) from 2- aminobe ⁇ zenesulfonamide according to the procedure described in Chemistry of Heterocyclic Compounds (English Translation), 1998, 34(7), 791-795.
  • Example IC (0.268 g, 1.0 mmol) in anhydrous THF (10 mL) under nitrogen at 0 °C was added sodium hydride (95%, 0.10 g, 4.0 mmol). The reaction was heated to reflux for 3 hours, cooled to 0 °C, and to it was added dropwise glacial acetic acid (2 mL). The resulting mixture was heated to reflux for 2 hours, cooled to ambient temperature, and diluted with aqueous hydrochloric acid (0.1 M, 10 mL). The resulting precipitate was collected by filtration, washed with water and diethyl ether and dried to give the title compound (0.130 g, 33%). MS (ESI-) m/z 397 (M-H) ⁇
  • Example 2B l-[(5-chloro-2-thienyl)methyll-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy- l,8-naphthyridin-2(lH)-one 5
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 2A for the product of Example IB (0.167 g, 58%).
  • MS (ESI-) m/z 471/473 (M-H) " .
  • Example 3A ethyl 2- r(2-ethylbutyl)amino "
  • the reaction mixture was 20 partitioned between dichloromethane and water.
  • the aqueous layer was extracted with dichloromethane (2 x 50 mL).
  • the organic layers were combined and dried over magnesium sulfate, filtered, and concentrated.
  • Example 3B l-(2-ethylbutyl)-2H-pyridor2.3-dl Tl ,31oxazine-2,4(lH)-dione
  • the product of Example 3A (0.664 g, 2.65 mmol) and diphosgene (1.57 g, 7.96 30 mmol) in 13 mL of 1,2-dichloroethane and 1.3 mL of 1,4 dioxane were reacted at 80 °C for 16 hours.
  • the reaction was concentrated under vacuum and the residue was purified by flash column chromatography on silica gel eluting with hexane/ethyl acetate (9:1) to provide the title compound (0.235 g, 36 %).
  • Example 4A l-r(5-bromo-2-thienyl)methvn-2H-pyridor2,3-diri.31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-bromo-5-chloromethylthiophene for n-butyl bromide (0.229 g, 55%).
  • Example 5 3-( l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methylbenzyl)-1.8- naphthyridin-2(lH)-one 35
  • Example 5A l-(3-methvIbenzyl)-2H-pyridor2,3-din,3]oxazine-2,4flH)-dione The title compound was prepared according to the procedure of Example IB
  • Example 5B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l -(3 -methylbenzyl)- 1 ,8- naphthyridin-2( lH)-one
  • Example ID The title compound was prepared according to the procedure of Example ID substituting the product of Example 5 A for the product of Example IB (0.112 g, 72%). MS (ESI-) m z 445 (M-H) " . The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 6A l-(3-nitrobenzyl)-2H-pyridor2,3-dl Tl ,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-nitrobenzyl bromide for n-butyl bromide (0.147 g, 28%).
  • MS (DCI) m/z 300 (M+H) + .
  • Example 6B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-nitrobenzyl)-1.8- naphth yridin-2 ( 1 H)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 6A for the product of Example IB (0.032 g, 42%).
  • MS (ESI-) m/z 476 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 7 3-(l,l-dioxio ⁇ 4H-l,2,4-benzo1 ⁇ a ⁇ azin-3-yl)-4-hydroxy-l-(3-thienylmethyI)-l,8- naphthyridin-2(lH)-one
  • Example 7A l-(3-thienylmethyl)-2H-Dyridor2,3-dirL31oxazine-2,4(lH)-dione
  • Example 7B 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3 -thienylmethyl)- 1,8- 5 naphthyridin-2(lH)-one
  • Example ID The title compound was prepared according to the procedure of Example ID substituting the product of Example 7A for the product of Example IB (0.135 g, 48%). MS (ESI-) m z 437 (M-H) " .
  • the sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 8A l-(3-chlorobenzyl)-2H-pyridor2,3-diri,31oxazme-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-chlorobenzyl bromide for n-butyl bromide (0.405 g, 77%).
  • MS (DCI) m/z 289 20 (M+H) + .
  • Example 8B l-(3-chlorobenzyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID 25 substituting the product of Example 8A for the product of Example IB (0.050 g, 45%).
  • Example 9B l-(3-bromobenzyl)-3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 9A for the product of Example IB (0.050 g, 45%).
  • MS (ESI-) m/z 465 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 10 l-r(2-chloro- 3-thiazol-5-yl)methvn-3-(lJ-dioxido-4H- 2 4-benzothiadiazin-3-yl)-4- hydroxy- 8-naphthyridin-2(lH)-one
  • Example 10A l-r(2-chloro- 3-thiazol-5-yl)methyll-2H-pyridor2.3-diri.31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-chloro-5-bromomethylthiazole for n-butyl bromide (0.360 g, 60%).
  • Example 10B l-r(2-chIoro-1.3-thiazol-5-yl)methvn-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 10A for the product of Example IB (0.136 g, 60%).
  • Example 11 3-(l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-l-(3-fluorobenzyl)-4-hvdroxy-L8- naphthyridin-2(lH)-one
  • Example IIA l-f3-fluorobenzyl)-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-fluorobenzyl bromide for n-butyl bromide (0.382 g, 76%).
  • MS (DCI) m/z 273 (M+H) + .
  • Example 11B
  • Example 12B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3-methylbutvD- 1.8- : naphthyridin-2(lH)-one
  • Example IC (0.247 g, 0.922 mmol) in anhydrous THF (7.5 mL) under nitrogen at 20°C was added sodium hydride (95%, 0.089 g, 3.7 mmol). The reaction was heated at reflux for 3 hours, cooled to 20°C, and added dropwise glacial acetic acid (2.4 mL). The resulting mixture was heated at reflux for 1 hour, cooled to 25°C, and diluted with aqueous hydrochloric acid (0.5 M, 35 mL). The resulting precipitate was collected by filtration, washed with water and dried.
  • Example 13 l-(cvclobutylmemyl)-3-(l,l-dioxido-4H-l,2,4-benzoi iadiazin-3-yl)-4-hvdroxy- 8- naphthyridin-2( lH)-one
  • Example 13A l-(cvclobutylmethyl)-2H- ⁇ yridor2.3-din,31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting bromomethyl-cyclobutane for n-butyl bromide (0.255 g, 60%). MS (DCI) m/z 233 (M+H) + .
  • Example 13B l-(cyclobutylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2 ( 1 H)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 13 A for the product of Example IB (0.120 g, 52%).
  • MS (ESI-) m/z 409 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 14 3-(l,l-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-4-hydroxy-l-r(5-methyl-2-thienyl)methyll- l,8-naphthyridin-2(lH)-one- '
  • Example 14A l-r(5-methyl-2-thienyl)methyll-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-5-methylthiophene for n-butyl bromide (0.181 g, 54%). !
  • Example 14B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydro ⁇ y-l-r(5-methyl-2-thienyl)methyll- l,8-naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 14A for the product of Example IB (0.172 g, 58%).
  • MS (ESI-) m/z 451 (M-H) " The sodium salt of the title compound was prepared according to the
  • Example 15 l-benzyl-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-L8-naphthyridm-2(lH)- one ' ,
  • Example 15 A l-benzyl-2H-pyridor2,3-d1 Tl ,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting benzyl bromide for n-butyl bromide (0.393 g, 51%).
  • MS (DCI) m/z 255 (M+H) + .
  • Example ID The title compound was prepared according to the procedure of Example ID substituting the product of Example 15A for the product of Example IB (0.217 g, 62%). MS (ESI-) m/z 431 (M-H) ' . The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 16 A l-r(5-methyl-3-pyridinyl)methyl1-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-chloromethyl-5-methylpyridine for n-butyl bromide (0.080 g, 24%).
  • Example 17B l-r(2-chloro-4-pyridinyl)methyll-3-(l l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-
  • Example 18B (5-bromo-3-pyridinyl)methylamine
  • the product of Example 18A (0.98 g, 2.53 mmol) was treated with trifluoroacetic acid and dichloromethane (1:1 v/v, 20 mL) for 2 hours at room temperature.
  • the solvent was removed by rotary evaporation and the resulting oil was chased with benzene/dichloromethane (3 times) to give a waxy solid.
  • the salt was dissolved in anhydrous methanol (20 mL) and stirred with Amberlite IRA-400(OH), resin (10 g) for 2 hrs. The resin was removed by vacuum filtration and thoroughly washed with dry methanol.
  • Example 18D l-r(5-bromo-3-pyridinyl)methvn-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example 3B substituting the product of Example 18C for the product of Example 3 A and purifying by flash column chromatography on silica gel eluting with 10% ethyl acetate/dichloromethane (0.057 g, 51%).
  • Example 19A l-(cyclohexylmethyl)-2H-pyridor2,3-diri.31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting (bromomethyl)cyclohexane for n-butyl bromide (0.05 g, 11%).
  • Example 19B l-(cyclohexylmethyl)-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lHVone
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 19A for the product of Example IB (0.025 g, 30 %).
  • MS 15 (ESI-) m/z 437 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • MS (ESI-) m/z 437 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • MS (ESI-) m/z 437 (M-H) " ; !
  • Example 20A ethyl 2-1 r(2S)-2-methylbuty ⁇ amino Inicotinate 25
  • the title compound was prepared according to the procedure of Example 3 A substituting (S)-(-)-2-methylbutylamine for 2-ethylbutylamine (1.6 g, 77%).
  • Example 20B l-r(2S)-2-methylbutyll-2H-pyridor2.3-dir 31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example 3B substituting the product of Example 20A for the product of Example 3A (0.400 g, 68%).
  • Example 20C 3-(l . l-dioxido-4H-l .2.4-benzothiadi azin-3-yl)-4-hydroxy- l-r(2S)-2-methylbutyl1-l ,8-
  • Example ID The title compound was prepared according to the procedure of Example ID substituting the product of Example 21A for the product of Example IB (0.099 g, 60%). MS (ESI-) m/z 445 (M-H) " .
  • the sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 22A l-r(5-nitro-2-furyl)methvn-2H-pyridor2.3-din.31oxazine-2.4(i -dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-5-nitrofuran for n-butyl bromide (0.120 g, 34%).
  • Example 23 l-(l-benzothien-2-ylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridm-2(lH)-one
  • Example 23A l-(l-benzothien-2-ylmethyl)-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-chloromethyl-benzo[b]thiophene for n-butyl bromide (0.160 g, 42%). !
  • Example 23B l-(l-benzothien-2-ylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 23A for the product of Example IB (0.148 g, 60%).
  • MS (ESI-) m/z 487 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 24B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methoxybenzyl)-l,8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 24A for the product of Example IB (0.086 g, 53%).
  • MS (ESI-) m/z 461 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 25 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-iodobenzyl)-l,8- naphthyridin-2( 1 H)-one
  • Example 25A l-(3-iodobenzyl)-2H-pyridor2.3-din.31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-iodobenzyl bromide for n-butyl bromide (0.614 g, 88%). MS (DCI) m/z 381 (M+H) + .
  • Example 25B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-iodobenzyl)-l,8- naphthyridin-2( 1 H)-one
  • Example 26 l-[(3,5-dimethyl-4-isoxazolyl)methyn-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4- hydroxy- 1 , 8-naphthyridin-2( lH)-one
  • Example 26A l-r(3.5-dimethyl-4-isoxazolyl)methvn-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 4-chloromethyl-3,5-dimethylisoxazole for n-butyl bromide (0.199 g, 60%).
  • Example 26B l-r(3,5-d ⁇ methyl-4-isoxazolyl)methyn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hvdroxy-1.8-naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 26A for the product of Example IB (0.187 g, 63%).
  • Example 27 3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r2-(3-thienyl)ethvn-l,8- naphthyridin-2( lH)-one
  • Example 27A l-r2-(3-thienyl)ethyll-2H-pyridor2,3-dirL31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-(2-bromoethyl)thiophene for n-butyl bromide (0.156 g, 46%).
  • Example 27B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r2-(3-thienyl)ethvn-1.8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 27 A for the product of Example IB (0.123 g, 48%).
  • MS (ESI-) m/z 451 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID. !
  • Example 28 3-(l J-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f4-pyridinylmethyI)-l ,8- naphthyridin-2(lH)-one
  • Example 28A 3-(l J-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f4-pyridinylmethyI)-l ,8- naphthyridin-2(lH)-one
  • Example 29A l-(4-bromobenzyl)-2H-pyridof2,3-d1 Tl ,31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 4-bromobenzyl bromide for n-butyl bromide (1.460 g, 72%).
  • MS (DCI) m/z 333 (M+H) + . :
  • Example 29B l-(4-bromobenzyl)-3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 29A for the product of Example IB (0.060 g, 59%).
  • MS (ESI-) m/z 509 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 30A ethyl 2-(neopentylamino)nicotinate
  • the title compound was prepared according to the procedure of Example 3 A substituting 2,2-dimethylpropylamine for 2-ethylbutylamine (0.407 g, 57 %).
  • Example 30C The title compound was prepared according to the procedure of Example 3B substituting the product of Example 30A for the product of Example 3A (0.182 g, 89 %).
  • Example 30C Example 30C
  • Example 31 l-i r(lS.2R.5S)-6.6-dimethylbicvclor3.1.11hept-2-vnmethyl)-3-(l.l-dioxido-4H- 2 1 4- benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)-one
  • Example 31A ethyl 2-(( r ⁇ S,2R,5S)-6,6-dimethylbicyclo
  • the title compound was prepared according to the procedure of Example 3A substituting (-)-cis-myrtanylamine for 2-ethylbutylamine (0.604 g, 40%).
  • Example 31C l- ⁇ r(i t S,2R.5S)-6.6-dimethylbicvclor3.1.nhept-2-yl1methyl)-3-(l.l-dioxido-4H-1.2.4- benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 31B for the product of Example IB (0.050 g, 21%).
  • MS (ESI-) m/z 477 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 32 3- ⁇ r3-(l.l-dioxido-4H-1.2,4-benzothiadiazm-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile
  • Example 32A 3- ⁇ r3-(l.l-dioxido-4H-1.2,4-benzothiadiazm-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile
  • Example 33 3-fl.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3- ⁇ yridinylmethyl)-1.8- naphthyridin-2(lH)-one
  • Example 33A 3-fl.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3- ⁇ yridinylmethyl)-1.8- naphthyridin-2(lH)-one
  • Example 33B 3-( I -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3 -pyridinylmethyl)- 1,8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 33A for the product of Example IB (0.098 g, 41%).
  • Example 34 l-(l-adamantylmethyl)-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-L8- naphthyridin-2(lH)-one
  • Example 34A 2-r(l-adamantylmethyl)amino1nicotinic acid
  • the title compound was prepared according to the procedure of Example 3 A substituting 2-chloronicotinic acid for ethyl 2-chloronicotinate and 1- adamantanemethylamine for 2-ethylbutylamine (0.185 g, 79 %).
  • Example 34B l-(l-adamantylmeth'yl)-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example 3B substituting the product of Example 34A for the product of Example 3A (0.025 g, 20 %).
  • Example 35 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r3-(trifluoromethyl)benzyll-l,8- naphthyridin-2(lH)-one 15
  • Example 35A l-r3-(trifluoromethyl)benzvn-2H-pyridol2.3-diri,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 3-(trifluoromethyl)benzyl bromide for n-butyl bromide (0.250 g, 42%).
  • Example 35B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -r3-(trifluoromethyl)benzyll -1,8- naphthyridin-2(lH)-one 25
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 35A for the product of Example IB (0.22 g, 57 %).
  • Example 36 3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f(2-methyl-l,3-thiazol-5- yl)methvn-1.8-naphthyridin-2(lH)-one
  • Example 36 A l-r(2-methyl-1.3-thiazol-5-yl)methvn-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-methyl-5-chloromethylthiazole for n-butyl bromide (0.300 g, 54%).
  • Example 36B
  • Example 37 l-(2-c ⁇ clohexylethyl)-3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2( lH)-one
  • Example 37A l-(2-cvclohexylethyl)-2H-pyridor2.3-dirL31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting l-bromo-2-cyclohexylethane for n-butyl bromide (0.196 g, 39%).
  • Example 37B l-(2-cyclohexylethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2( 1 H)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 37A for the product of Example IB (0.030 g, 18 % after column purification).
  • MS (ESI-) m/z 451 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 38 3-(l l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(4-methoxybenzyl)-l,8- naphthyridin-2( lH)-one
  • Example 38 A l-(4-methoxybenzyl)-2H-pyridor2,3-dir 31oxazine-2,4riH)-dione
  • Example 38B 3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methoxybenzyl)-l,8- naphthyridin-2( lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 38 A for the product of Example IB (0.098 g, 51%).
  • MS (ESI-) m/z 461 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 39 3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- l-(2-methylbenzyl)-l ,8- naphthyridin-2(lH)-one
  • Example 39A l-(2-methylbenzyl)-2H-pyridor2.3-d1 IT ,31oxazine-2.4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 2-methylbenzyl bromide for n-butyl bromide (0.353 g, 72%). MS (DCI) m/z 269 (M+H) + .
  • Example 39B 3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- l-(2-methylbenzyl)-l ,8- naphthyridin-2(lH)-one
  • Example 39A l-(2-methyl
  • Example 40 l-(cyclopropylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one
  • Example 40A l-(cvclopropylmethyl)-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione
  • 1H NMR 300 MHz, DMSO-d 6 ) ⁇ 0.46 (m, 4H), 1.27 (m, IH), 4.04 (d,
  • Example 41 A 1-(1 ,3-thiazol-4-ylmethyl)-2H-pyridor2,3-dl IT ,31oxazine-2,4(lH)-dione
  • the title compound was prepared according to the procedure of Example IB substituting 4-(chloromethyl)thiazole for n-butyl bromide (0.049 g, 15%).
  • Example ID The title compound was prepared according to the procedure of Example ID substituting the product of Example 41 A for the product of Example IB (0.046 g, 59%). MS (ESI-) m/z 438 (M-H) " .
  • the sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 4B The product of Example 4B (100 mg, 0.193 mmol), phenylboronic acid (49 mg, 0.387 mmol), 2M aqueous Na 2 CO 3 (0.45 mL), absolute ethanol (0.5 mL), and
  • Example 43 3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methyl-3-pentenyl)-l,8- naphthyridin-2(lH)-one
  • Example 43A 15 l-(4-methyl-3-pentenyl)-2H-pyridor2,3-din,31oxazine-2.4(lH)-dione
  • Example 43B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methyl-3-pentenyl)-L8- naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID 25 substituting the product of Example 43A for the product of Example IB (0.030 g, 20 % after recrystallization).
  • MS (ESI-) m/z 423 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 44 4-( r3-(l.l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdro ⁇ y-2-oxo-1.8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile
  • Example 44A 35 4-rr2.4-dioxo-2H-pyridor2.3-diri,31oxazin-l(4H)-yl)methyllbenzonitrile
  • Example 44B 4- ⁇ r3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile 5
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 44A for the product of Example IB (0.197 g, 60%).
  • MS (ESI-) m z 456 (M-H) " The sodium salt of the title compound was prepared according to the procedure of Example ID.
  • Example 45 1 - ⁇ 2-( 1 -c yclohexen- 1 - yl)eth yll -3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)-4-h ydroxy- l,8-naphthyridin-2(lH)-one 15
  • Example 45A ethyl 2- ⁇ r2-(l-cyclohexen-l-yl)ethv ⁇ amino)nicotinate
  • the title compound was prepared according to the procedure of Example 3 A substituting 2-(l-cyclohexenyl)ethylamine for 2-ethylbutylamine (2.2 g, 80%).
  • Example 45B l-r2-(l-cvclohexen-l-yl)ethyll-2H-pyridor2,3-din.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 45A for the product of Example 3A (0.493 g, 91%). MS (DCI) m/z 290 (M+NEU) + . 25
  • Example 45C l-r2-(l-cvclohexen-l-yl)ethyll-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-
  • Example ID 1 ,8-naphthyridin-2(lH)-one
  • the title compound was prepared according to the procedure of Example ID substituting the product of Example 45B for the product of Example IB (0.048 g, 14%).
  • the sodium salt of the title compound was prepared according to the procedure of Example ID.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides an HCV polymerase inhibiting compound having the formula (I) and a composition comprising a therapeutically effective amount of said compound. The present invention also provides a method for inhibiting hepatitis C virus (HCV) polymerase, a method for inhibiting HCV viral replication, and a method for treating or preventing HCV infection. Processes for making said compounds, and synthetic intermediates employed in said processes, are also provided.

Description

ANTI-INFECTIVE AGENTS
Technical Field
The present invention provides novel anti-infective agents. Specifically, the present invention provides an HCV polymerase inhibiting compound, and a composition comprising a therapeutically effective amount of said compound. The present invention also provides a method for inhibiting hepatitis C virus (HCV) polymerase, a method for inhibiting HCV viral replication, and a method for treating or preventing HCV infection. Processes for making said compounds, and synthetic intermediates employed in said processes, are also provided.
Background of the Invention
Infection with hepatitis C virus (HCV) is a major cause of human liver disease throughout the world. More than 85% of all infected individuals become chronically infected. Chronic HCV infection accounts for 30% of all cirrhosis, end-stage liver disease, and liver cancer in the United States. The CDC estimates that the number of deaths due to HCV will increase to 38,000/year by the year 2010.
While initially therapy consisted of interferon alone, the combination of interferon alpha-2b with ribavirin for either 24 or 48 weeks is currently the most efficacious approved therapy for the treatment of chronic HCV infection. However, there are many adverse side effects associated with this therapy (flu-like symptoms, leukopenia, thrombocytopenia, and depression from interferon, as well as anemia induced by ribavirin). Furthermore, this therapy is less effective against infections caused by HCV genotype 1 which constitutes about 75% of all HCV infections.
Based on the foregoing, there exists a significant need to identify compounds with the ability to inhibit HCV. The present invention provides novel anti-infective agents which are HCV polymerase inhibitors.
Summary of the Invention
The present invention provides a compound of formula (I)
Figure imgf000002_0001
(I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle; R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocy_cle,±eteiocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, R RgC=N- and R O-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(0)RCJ -C(O)ORc and -C(O)NRcRe;
R and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra andRaC(O)-; wherein R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; alternatively, R and R , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, ' heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaR N-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-,
Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyOCNRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, ijlkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. R Oalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached ' form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRdj -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2R0, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NR Rh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl,- heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)S lkyl-,. RaS02alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1 , 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; m is 0, 1, 2, 3, or 4; and n is b, 1, 2, 3, or 4; with the proviso that when A is a ring other than
Figure imgf000006_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that
Figure imgf000006_0002
and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
The present invention also provides the processes of making a compound of the present invention and intermediates employed in the processes.
The present invention further provides a pharmaceutical composition comprising a therapeutically effective amount of the compound or combination of compounds of the present invention or a pharmaceutically acceptable salt form thereof, and a pharmaceutically acceptable carrier.
The present mvention also provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment the pharmaceutical composition of the present invention. The present invention still further provides a method of inhibiting the replication of an RNA-containing virus comprising contacting said virus with a therapeuctially effective amount of a compound or combination of compounds of the present invention or a pharmaceutically acceptable salt thereof.
The present invention yet further provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment the pharmaceutical composition of the present invention.
Detailed Description of the Invention
As used in the present specification the following terms have the meanings indicated: As used herein, the singular forms "a", "an", and "the" may include plural reference unless the context clearly dictates otherwise.
The term "alkyl," as used herein, refers to a group derived from a straight or branched chain saturated hydrocarbon containing 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms. Examples of alkyl groups include butyl, methyl, 2-methylbutyl, and the like. The term "alkenyl," as used herein, refers to a straight or branched chain group of 2,
3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms containing at least one carbon-carbon double bond. Examples of alkenyl groups include allyl, propenyl, 3-methyl-2-butenyl, and the like.
The term "alkynyl," as used herein, refers to a straight or branched chain hydrocarbon of 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms containing at least one carbon-carbon triple bond. Examples of alkynyl groups include ethynyl, 2-methyl-3-butynyl, 3-pentynyl, and the like. '
The term "alkoxy," as used herein, refers to an alkyl group attached to the parent molecular moiety through an oxygen atom. Examples of alkoxy groups include tert-butoxy, methoxy, isopropoxy, and the like.
The term "alkoxy alkoxy" as used herein, means an alkoxy group, as defined herein, appended to the parent molecular moiety through another alkoxy group, as defined herein.
Representative examples of alkoxyalkoxy include, but are not limited to, tert-butoxymethoxy, 2-ethoxyethoxy, 2-methoxyethoxy, and methoxymethoxy.
The term "alkoxyalkoxyalkyl" as used herein, means an alkoxyalkoxy group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein. Representative examples of alkoxyalkoxyalkyl include, but are not limited to, tert- butoxymethoxymethyl, ethoxymethoxymethyl, (2-methoxyethoxy)methyl, and 2-(2- methoxyethoxy)ethyl . O 2004/041818
The term "alkoxyalkyl," as used herein, refers to an alkyl group substituted by at least one alkoxy group.
The term "alkoxycarbonyl," as used herein, refers to an alkoxy group attached to the parent molecular moiety through a carbonyl group. Examples of alkoxycarbonyl groups include tert-butoxycarbonyl, ethoxycarbonyl, methoxycarbonyl, and the like.
The term "alkoxycarbonylalkyl," as used herein, refers to an alkoxycarbonyl group attached to the parent molecular moiety through an alkyl group.
The term "alkylcarbonyl," as used herein, refers to an alkyl group attached to the parent molecular moiety through a carbonyl group. Examples of alkylcarbonyl groups include acyl, butanoyl, 2,2-dimethylpropanoyl, and the like.
The term "alkylcarbonylalkyl" as used herein, means an alkylcarbonyl group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein. Representative examples of alkylcarbonylalkyl include, but are not limited to, 2- oxopropyl, 3,3-dimethyl-2-oxopropyl, 3-oxobutyl, and 3-oxopentyl. The term "alkylsulfanyl," as used herein, refers to an alkyl group attached to the parent molecular moiety through a sulfur atom. Examples of alkylsulfanyl groups include methylsulfanyl, (l-methylethyl)sulfanyl, (2-methylproρyl)sulfanyl, and the like.
The term "alkylsulfanylalkyl," as used herein, refers to an alkylsulfanyl group attached to the parent molecular moiety through an alkyl group. The term "alkylsulfinyl," as used herein, refers to an alkyl group attached to the parent molecular moiety through a -S(O)- group.
The term "alkylsulfinylalkyl," as used herein, refers to an alkylsulfinyl group attached to the parent molecular moiety through an alkyl group.
The term "alkylsulfonyl," as used herein, refers to an alkyl group attached to the parent molecular moiety through a -S(O)2- group.
The term "alkylsulfonylalkyl," as used herein, refers to an alkylsulfonyl group attached to the parent molecular moiety through an alkyl group.
The term "aryl" as used herein, refers to a phenyl group, or a bicyclic or tricyclic hydrocarbon fused ring systems wherein one or more of the rings is a phenyl group. Bicyclic fused ring systems have a phenyl group fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or another phenyl group. Tricyclic fused ring systems are exemplified by a bicyclic fused ring system fused to a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or another phenyl group. Examples of aryl groups include anthracenyl, azulenyl, fluorenyl, indanyl, indenyl, naphthyl, phenyl, tetrahydronaphthyl, and the like. The aryl groups of the present invention can be connected to the parent molecular moiety through any substitutable carbon atom of the group. The aryl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, heterocycle, a second aryl group and heteroaryl; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the^roup consisting of cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -NS(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)S02Ra,
-N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, heterocycle, a second aryl group and heteroaryl; wherein Ra, Rb and Re are defined herein, and wherein the second aryl group, the heteroaryl, the cycloalkyl, the cycloalkenyl and the heterocycle can be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, -O(alkyl), alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, -NH2, -N(H)(alkyl), -N(alkyl)2, -C(O)OH, -C(O)O(alkyl), -C(O)NH2, -C(O)N(H)(alkyl), -C(O)N(alkyl)2 and oxo.
The term "arylalkenyl," as used herein, refers to an aryl group attached to the parent molecular moiety through an alkenyl group. The term "arylalkoxy," as used herein, refers to an arylalkyl group attached to the parent molecular moiety through an oxygen atom.
The term "arylalkyl," as used herein, refers to an aryl group attached to the parent molecular moiety through an alkyl group.
The term "arylcarbonyl," as used herein, refers to an aryl group attached to the parent molecular moiety through a carbonyl group.
The term "arylcarbonylalkyl" as used herein, means an arylcarbonyl group, as defined herein, appended to the parent molecular moiety through an alkyl group, as defined herein.
The term "aryloxy," as used herein, refers to an aryl group attached to the parent molecular moiety through an oxygen atom. The term "aryloxyalkyl," as used herein, refers to an aryloxy group attached to the parent molecular moiety through an alkyl atom.
The term "arylsulfanyl," as used herein, refers to an aryl group attached to the parent molecular moiety through a sulfur atom.
The term "arylsulfanylalkyl," as used herein, refers to an arylsulfanyl group attached to the parent molecular moiety through an alkyl group.
The term "arylsulfonyl," as used herein, refers to an aryl group attached to the parent molecular moiety through a sulfonyl group. The term "arylsulfonylalkyl," as used herein, refers to an arylsulfonyl group attached to the parent molecular moiety through an alkyl group.
The term "carboxy," as used herein, refers to -CO2H.
The term "carboxyalkyl," as used herein, refers to a carboxy group attached to the parent molecular moiety through an alkyl group.
The term "cyano," as used herein, refers to -CN.
The term "cyanoalkyl," as used herein, refers to a cyano group attached to the parent molecular moiety through an alkyl group.
The term "cycloalkenyl," as used herein, refers to a non-aromatic, partially unsaturated, monocyclic, bicyclic or tricyclic ring system, having three to fourteen carbon atoms and zero heteroatom. Examples of cycloalkenyl groups include cyclohexenyl, octahydronaphthalenyl, norbornylenyl, and the like. The cycloalkenyl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SR., -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb cycloalkyl, a second cycloalkenyl, heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -S02Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, a second cycloalkenyl, heterocycle, aryl and heteroaryl; wherein Ra, Rb and Re are defined herein, and wherein the cycloalkyl, the second cycloalkenyl, the heterocycle, the aryl and the heteroaryl can be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, -O(alkyl), alkyl, alkenyl, alkynyl, cyano, formyl, halo, oxo, haloalkoxy, haloalkyl, nitro, oxo, -NH2, -N(H)(alkyl), -N(alkyl)2, -C(O)OH, -C(O)O(alkyl), -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2.
The term "cycloalkenylalkyl," as used herein, refers to a cycloalkenyl group attached to the parent molecular moiety through an alkyl group.
The term "cycloalkyl," as used herein, refers to a saturated monocyclic, bicyclic, or tricyclic hydrocarbon ring system having three to fourteen carbon atoms and zero heteroatom. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[3.1.1]heptyl, 6,6-dimethylbcyclo[3.1.1]heptyl, adamantyl, and the like. The cycloalkyl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, a second cycloalkyl, cycloalkenyl, heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, a second cycloalkyl, cycloalkenyl, heterocycle, aryl and heteroaryl; wherein Ra, Rb and Re are defined herein, and wherein the second cycloalkyl, the cycloalkenyl, the heterocycle, the aryl and the heteroaryl can be substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, -O(alkyl), alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, oxo, -NH2, -N(H)(alkyl), -N(alkyl)2, -C(O)OH, -C(O)O(alkyl), -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2.
The term "cycloalkylalkenyl," as used herein, refers to a cycloalkyl group attached to the parent molecular moiety through an alkenyl group. The term "cycloalkylalkyl," as used herein, refers to a cycloalkyl group attached to the parent molecular moiety through an alkyl group.
The term "formyl," as used herein, refers to -CHO.
The term "formylalkyl," as used herein, refers to a formyl group attached to the parent molecular moiety through an alkyl group. The terms "halo," and "halogen," as used herein, refer to F, Cl, Br, and I. :
The term "haloalkoxy," as used herein, refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom.
The term "haloalkoxy alkyl," as used herein, refers to a haloalkoxy group attached to the parent molecular moiety through an alkyl group. The term "haloalkyl," as used herein, refers to an alkyl group substituted by one, two, three, or four halogen atoms.
The term "heteroaryl," as used herein, refers to an aromatic five- or six-membered ring where at least one atom is selected from the group consisting of N, O, and S, and the remaining atoms are carbon. The term "heteroaryl" also includes bicyclic systems where a heteroaryl ring is fused to a phenyl group, a monocyclic cycloalkyl group, as defined herein, a heterocycle group, as defined herein, or an additional heteroaryl group. The term "heteroaryl" also includes tricyclic systems where a bicyclic system is fused to a phenyl group, a monocyclic cycloalkyl group, as defined herein, a heterocycle group, as defined herein, or an additional heteroaryl group. The heteroaryl groups are connected to the parent molecular moiety through any substitutable carbon or nitrogen atom in the groups. Examples of heteroaryl groups include benzothienyl, benzoxazolyl, benzimidazolyl, benzoxadiazolyl, dibenzofuranyl, dihydrobenzothiazolyl, furanyl, imidazolyl, indazolyl, indolyl, isoindolyl, isoxazolyl, isoquinolinyl, isothiazolyl, oxadiazolyl, oxazolyl, thiazolyl, thienopyridinyl, thienyl, triazolyl, thiadiazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrazolyl pyrrolyl, quinolinyl, tetrahydroquinolinyl, tetrahydropyranyl, triazinyl, and the like. The heteroaryl groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)S02Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(0)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, heterocycle, aryl and a second heteroaryl group; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(0)ORa, -OC(0)NRaRb, -OSO2Ra, -OSO2NRaRb, -SRa, -SORa, -S02Ra, -S02ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, heterocycle, aryl and a second heteroaryl group; wherein Ra, Rb and Re are defined herein, and wherein the second heteroaryl group, the aryl, the cycloalkyl, the cycloalkenyl and the heterocycle can be independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, -O(alkyl), alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, -NH2, -N(H)(alkyl),
-N(alkyl)2, -C(O)OH, -C(0)O(alkyl), -C(O)NH2, -C(0)N(H)(alkyl), -C(O)N(alkyl)2 and oxo. In addition, The nitrogen heteroatoms can be optionally quaternized or oxidized to the N- oxide. Also, the nitrogen containing rings can be optionally N-protected.
The term "heteroarylalkenyl," as used herein, refers to a heteroaryl group attached to the parent molecular moiety through an alkenyl group.
The term "heteroarylalkyl," as used herein, refers to a heteroaryl group attached to the parent molecular moiety through an alkyl group.
The term "heteroarylsulfonyl," as used herein, refers to a heteroaryl group attached to the parent molecular moiety through a sulfonyl group. The term "heteroarylsulfonylalkyl," as used herein, refers to a heteroarylsulfonyl group attached to the parent molecular moiety through a alkyl group.
The term "heterocycle," as used herein, refers to cyclic, non-aromatic, saturated or partially unsaturated, three, four, five-, six-, or seven-membered rings containing at least one atom selected from the group consisting of oxygen, nitrogen, and sulfur. The term "heterocycle" also includes bicyclic systems where a heterocycle ring is fused to a phenyl group, a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, or an additional monocyclic heterocycle group. The term "heterocycle" also includes tricyclic systems where a bicyclic system is fused to a phenyl group, a monocyclic cycloalkenyl group, as defined herein, a monocyclic cycloalkyl group, as defined herein, ot an additional monocyclic heterocycle group. The heterocycle groups of the invention are connected to the parent molecular moiety through any substitutable carbon or nitrogen atom in the group. Examples of heterocycle groups include benzoxazinyl, dihydroindolyl, dihydropyridinyl, 1,3-dioxanyl, 1,4-dioxanyl, 1 ,3-dioxolanyl, isoindolinyl, morpholinyl, piperazinyl, pyrrolidinyl, tetrahydropyπdmyl, piperidinyl, thiomorpholinyl, tetrahydropyranyl, and the like. The heterocycle groups of the present invention can be substituted with 0, 1, 2, 3, 4 or 5 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(O)ORa, -OC(O)NRaRb, -OS02Ra, -OSO2NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)SO2NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, a second heterocycle, aryl, heteroaryl and ethylenedioxy; wherein each of the alkyl, alkenyl and alkynyl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of cyano, formyl, halo, nitro, oxo, -ORa, -OC(O)Ra, -OC(0)ORa, -OC(O)NRaRb, -OSO2Ra, -OS02NRaRb, -SRa, -SORa, -SO2Ra, -SO2ORa, -SO2NRaRb, -NRaRb, -N(Re)C(O)Ra, -N(Re)C(O)ORa, -N(Re)C(O)NRaRb, -N(Re)SO2Ra, -N(Re)S02NRaRb, -N(Re)SO2N(Re)C(O)ORa, -C(O)Ra, -C(O)ORa, -C(O)NRaRb, cycloalkyl, cycloalkenyl, a second heterocycle, aryl and heteroaryl; wherein Ra, Rb and Re are defined herein, and wherein the cycloalkyl, cycloalkenyl, the second heterocycle, the aryl and the heteroaryl can beindependently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of -OH, -O(alkyl), alkyl, alkenyl, alkynyl, cyano, formyl, halo, haloalkoxy, haloalkyl, nitro, oxo, -NH2, -N(H)(alkyl), -N(alkyl)2, -C(O)OH, -C(O)O(alkyl), -C(0)NH2, -C(0)N(H) (alkyl), and -C(O)N(alkyl)2. In addition, The nitrogen heteroatoms can be optionally quaternized or oxidized to the N-oxide. Also, the nitrogen containing heterocyclic rings can be optionally N-protected.
The term "heterocyclealkenyl," as used herein, refers to a heterocycle group attached to the parent molecular moiety through an alkenyl group. The term "heterocyclealkyl," as used herein, refers to a heterocycle group attached to the parent molecular moiety through an alkyl group.
The term "heterocyclecarbonyl" as used herein, means a heterocycle, as defined herein, appended to the parent molecular moiety through a carbonyl group, as defined herein. Representative examples of heterocyclecarbonyl include, but are not limited to, pyrrolidinylcarbonyl and piperazin-1-ylcarbonyl.
The term "hydroxy," as used herein, refers to -OH.
The term "hydroxyalkyl," as used herein, refers to an alkyl group substituted by at least one hydroxy group.
The term "nitro," as used herein, refers to -NO2.
The term "nitroalkyl," as used herein, refers to an alkyl group substituted by at least one nitro group. v The term "oxo," as used herein, refers to =O.
The term "sulfanyl," as used herein, refers to -S-.
The term "sulfinyl," as used herein, refers to -SO-.
The term "sulfonyl," as used herein, refers to -SO2-.
It is understood that alkenyl, alkoxy, alkoxyalkoxy, alkoxyalkoxyalkyl, alkoxyalkyl, alkoxycarbonyl, alkoxyc rbonylalkyl, alkyl, alkylcarbonyl, alkylcarbonyalkyl, alkynyl, alkylsulfanyl, alkylsulfanylalkyl, alkylsulfinyl, alkylsulfinylalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylalkenyl, arylalkoxy, arylalkyl, aryloxyalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenylalkyl, cycloalkenylalkenyl, cycloalkylalkyl, formylalkyl, haloalkoxy, haloalkoxyalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterosulfonylalkyl, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl and nitroalkyl may optionally be substituted.
In a first embodiment the present invention provides a compound of formula (I)
Figure imgf000014_0001
(I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRhN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaR NC(O)NRcalkyk RfRgC=N- and R O-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc>,-ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl,. alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(0)2Ra and RaC(O ; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(R )alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(0)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)RCl -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each Rδ is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalke'nyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcS02-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(0)-, R0OC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)R0, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -alkylSO2NRcRd, -alkylC(0)NRcRd, -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRhl and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl,^-alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O) (alkyl), -alkylSO alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), • -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; m is 0, 1, 2, 3, or 4; and n is O, 1, 2, 3, or 4; with the proviso that when A is a ring other than
Figure imgf000018_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl,' aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R6 is hydrogen1, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR,, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl,
(cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that
Figure imgf000018_0002
and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -OR , and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(0)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (I) wherein A is a monocyclic ring selected from the group consisting of aryl and heteroaryl.
For example, the present invention provides a compound of formula (I) wherein A is a bicyclic ring selected from the group consisting of heterocycle and heteroaryl. For example, the present invention provides a compound of formula (I) wherein A is selected from the group consisting of naphthyl, indolizinyl, indolyl, isoindolyl, benzofuranyl, benzothienyl, indazolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzoisothiazolyl, benzoisoxazolyl, benzoxazinyl, benzothiadiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl and naphthyridinyl, cinnolinyl and pteridinyl. For example, the present invention provides a compound of formula (I) wherin R2 and
R3, together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of thienyl, furanyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxadiazolyl, triazolyl, thiadiazolyl, tetrazolyl, phenyl, pyridyl, pyridazinyl and pyrimidinyl.
For example, the present invention provides a compound of formula (I) wherein R2 and R3 together with the carbon atoms to which they are attached form a cycloalkyl ring.
For example, the present invention provides a compound of formula (I) wherein R2 and R3 together with the carbon atoms to which they are attached form a cyclopentyl or cyclohexyl ring.
For example, the present invention provides a compound of formula (I) wherein R2 and R3 ar independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(0)Ra, -S(0)2Ra and RaC(0)-; wherein R2 and R3 are independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb. For example, the present invention provides a compound of formula (I) wherein R4 is hydroxy, halo, -NH2,-NH(alkyl), -N(alkyl)2, -N(H)NH2, -N3, -N(H)(hydroxyalkyl), or RcS-.
For example, the present invention provides a compound of formula (I) wherein A is aryl and R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
For example, the present invention provides a compound of formula (I) wherein A is phenyl and R" and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
For example, the present invention provides a compound of formula (I) wherein A is phenyl and R2 and R3, together with the carbon atoms to which they are attached is pyridyl.
For example, the present invention provides a compound of formula (I) wherein A is phenyl and R2 and R3, together with the carbon atoms to which they are attached is thienyl.
For example, the present invention provides a compound of formula (I) wherein A is heteroaryl and R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
For example, the present invention provides a compound of formula (I) wherein A is thienyl and R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
For example, the present invention provides a compound of formula (I) wherein A is thienyl, and R and R together with the carbon atoms to which they are attached form a phenyl ring.
For example, the present invention provides a compound of formula (I) wherein A is thienyl, ahd R2 and R3, together with the carbon atoms to which they are attached is pyridyl.
For example, the present invention provides a compound of formula (I) wherein A is pyridyl, and R and R , together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
For example, the present invention provides a compound of formula (I) wherein A is pyridyl, and R and R together with the carbon atoms to which they are attached form a pyridyl ring.
For example, the present invention provides a compound of formula (I) wherein A is phenyl, thienyl, pyridyl, imidazolyl, benzoxazolyl, benzoxazinyl, or benzimidazolyl, and R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra andRaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkylXOR , -(alkyl) (NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb. :
For example, the present invention provides a compound of formula (I) wherein R2 and R3 together with the carbon atoms to which they are attached form a five- or six- membered ring selected from the group consisting of thienyl, furanyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxadiazolyl, triazolyl, thiadiazolyl, tetrazolyl, phenyl, pyridyl, pyridazinyl and pyrimidinyl, and R4 is hydroxy. In an even more preferred embodiment, the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzoxazolyl, benzimidazolyl or benzoxazinyl, R2 and R3 together with the carbon atoms to which they are attached form a five- or six- membered ring selected from phenyl, thienyl, pyrazolyl, pyridyl, pyrimidinyl or pyridazinyl, and R4 is hydroxy.
For example, the present invention provides a compound of formula (I) wherein A is pyridyl; R2 and R3, together with the carbon atoms to which they are attached, form a pyridyl ring; and R is hydroxyl.
For example, the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzoxazolyl, benzimidazolyl or benzoxazinyl, R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra and RaC(O)-; wherein R2 and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl) (NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; and R4 is hydroxy.
For example, the present invention provides a compound of formula (I) wherein A is pyridyl, phenyl, thienyl, imidazolyl, benzimidazolyl, benzoxazolyl or benzoxazinyl, R2 and R3 together with the carbon atoms to which they are attached form five- or six-membered ring selected from the group consisting of phenyl, pyridyl, thienyl, pyrimidinyl, pyrazolyl, pyridazinyl, cyclohexyl or cyclopentyl, R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-.
Examplary compounds of the first embodiment of the present invention of formula (I) include, but not limited to, the following: l-[2-(l-cyclohexen-l-yl)ethyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one; ethyl [3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8- naphthyridin-l(2H)-yl]acetate;
1 -(3-anilinopropyl)-3-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l ,8- naphthyridin-2(lH)-one;
3-[3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin- l(2H)-yl]propanal; l-[3-(dimethylamino)propyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one;
1 - { 3 - [ [2-(dimethyl amino)ethyl] (methyl)amino]propyl } -3 - ( 1 , 1 -dioxido-4H- 1,2,4- benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)-one; l-(2-aJminoethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one; l-[3-(diethylamino)propyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one; l-(benzyloxy)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one;
1 -(benzyloxy)-3 -(1,1 -dioxido-4H- 1 ,2,4-benzothi adiazin-3 -yl)-4-hydroxy- 1,8- naphthyridin-2(lH)-one
3-( 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-4-hydroxy- 1 -isobutoxy- 1,8- naphthyridin-2(lH)-one; lτbenzyl-4-chloro-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin- 2(lH)-one;. l-butyl-4-chloro-3-(l , l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l ,8-naphthyridin-
2(lH)-one;
4-amino-l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin- 2(lH)-one; l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-(methylamino)-l,8- naphthyridin-2(lH)-one;
1 -butyl-4-(dimethylamino)-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-l ,8- naphthyridin-2(lH)-one; ■
1 -butyl-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydrazino-l , 8-naphthyridin- 2(lH)-one; 4-azido-l -butyl-3 -( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 ,8-naphthyridin-
2(lH)-one; l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(2-hydroxyethyl)amino]- 1 , 8-naphthyridin-2( lH)-one ;
N-[3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro- 1 ,8-naphthyridin-3-yl)- 1 , 1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-N'-(2-phenylethyl)sulfamide; benzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide;
N-[3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro[l ,8]naphthyridin-3-yl)- 1 , 1 -dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl] sulfamide; benzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-propyldiazathiane-l-carboxylate 2,2-dioxide;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l ,2-dihydro[l ,8]naphthyridin-3-yl)-l , 1-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-N'-propylsulf amide; methyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; allyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; 2-propynyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide;
2-cyanoethyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; 2-(trimethylsilyl)ethyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2- dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l- carboxylate 2,2-dioxide; bέnzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; methyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; benzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-methyldiazathiane-l-carboxylate 2,2-dioxide; N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-N-methylsulfamide;
2-aminoethyl 3 - [3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro[ 1 ,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide;
N-cyclopentyl-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] sulf amide; N-cyclobutyl-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide;
N- [3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro [ 1 , 8]naphthyridin-3 -yl)- 1 , 1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-N-(4-piperidinyl)sulfamide;
N-(2-hydroxyethyl)-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin- 3-yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide;
3-[({[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H- 1 ,2,4-benzothiadi azin-7 -yl] amino } sulf onyl)amino] propanamide ;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-l-azetidinesulfonamide; 3-hydroxy-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-azetidinesulfonamide;
3-amino-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-pyrrolidinesulfonamide;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-l-piperidinesulfonamide;
N-benzyl-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide; ethyl 3-[({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)amino]benzoate;
3-[({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)amino]benzoic acid; 3-[({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido-
4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)amino]benzamide;
N-(2-aminoethyl)-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3- yl)- 1 , 1 -dibxido-4H- 1 ,2,4-benzothiadiazin-7-yl] sulf amide; ethyl l-({ [3-(4-hydroxy-l-isopentyl-2-oxo-l ,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)-3-piperidinecarboxylate; methyl (25)-l-({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl]amino } sulfonyl)-2-pyrrolidinecarboxylate;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-l-pyrrolidinesulfonamide; 3-hydroxy-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl]- 1 -piperidinesulfonamide;
N-(2-furylmethyl)-3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin- 3-yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxamide 2,2-dioxide; 4-amino-6-(l,l-dioxido-4H-l,2,4-benzomiadiazin-3-yl)-7-hydroxythieno[3,2- b]pyridin-5(4H)-one;
6-(l,l-Dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- (isobutylamino)thieno[3,2-έ]pyridin-5(4H)-one;
6-(l , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ [(3S)-3- methylcyclopentyl] amino } thieno [3 ,2-b]pyridin-5 (4H)-one ; 4-{ [l-cyclopropylethyl]amino}-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(butylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3,2- b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(2-ethylbutyl)amino]-7- hydroxythieno[3,2-&]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(pentylamino)thieno[3,2- b]pyridin-5(4H)-one;
6-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- methylbutyl)amino]thieno [3 ,2- ?]pyridin-5 (4H)-one; 4-[(3,3-dimethylbutyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno [3 ,2-&]pyridin-5 (4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- methylbenzyl)amino]thieno[3,2-6]pyridin-5(4H)-one;
6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(2- methylbenzyl)amino]thieno[3,2-&]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(4- methylbenzyl)amino]thieno[3,2-b]pyridin-5(4H)-one; r
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3-methylbut-2- enyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
6r(l , l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(propylamino)thieno[3,2- b]pyridin-5(4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-4- ylmethyl)amino]thieno[3,2-£]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-3- ylmethyl) amino] thieno [3 ,2-&]pyridin-5 (4H)-one ;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-2- ylmethyl)amino]thieno[3,2-ft]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- methoxybenzyl)annrino]thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(3-furylmethyl)amino]-7- hydroxythieno [3 ,2-b]pyridin-5 (4H)-one; 3-({ [6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-5-oxothieno[3,2- b]pyridin-4(5H)-yl]amino}methyl)benzonitrile;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(thien-3- ylmethyl)amino]thieno[3,2-£]pyridin-5(4H)-one;
4-(cyclobutylamino)-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-Z?]pyridin-5(4H)-one;
4-(benzylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3,2- b]pyridin-5(4H)-one;
4-[(cyclohexylmethyl)amino]-6-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(l,3-thiazol-5- ylmethyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
4-[(3-bromobenzyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(cyclohexylamino)-6-(lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-&]pyridin-5(4H)-one;
4-(cyclopentylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydrσxythieno[3,2-£]pyridin-5(4H)-one; 4-(cycloheptylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-έ>]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ [(lR,35)-3- methylcyclohexyl]amino } thieno [3 ,2-έ]pyridin-5 (4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ [(lR,3R)-3- methylcyclohexyl]amino}thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(l-ethylpropyl)amino]-7- hydroxythieno [3 ,2-b] pyridin-5 (4H)-one ;
6-( 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-7-hydroxy-4- { [ 1 - phenylethyl]amino}thieno[3,2-b]pyridin-5(4H)-one;
6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- { [( 1R)- 1 - methylbutyl]amino}thieno[3,2-&]pyridin-5(4H)-one;
4-(cyclobutylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one; 4-[(cyclopropylmethyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-&]pyridin-5(4H)-one;
2-({3-[4-(cyclohexylamino)-7-hydroxy-5-oxo-4,5-dihydrothieno[3,2-b]pyridin-6-yl]- 1 , l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl } oxy)acetamide;
N-( { 3 - [ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3-quinolinyl]- 1 , 1 -dioxido- 4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl}methyl)urea;
1 -benzyl-4-hy droxy-3 - { 7 - [(methoxymethoxy)methyl] -1,1 -dioxido-4H-thieno[2,3 - e][l,2,4]thiadiazin-3-yl }quinolin-2(lH)-one;
1 -Benzyl-4-hydroxy-3-[7-(hydroxymethyl)-l , 1 -dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl]quinolin-2(lH)-one; 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-4H-thieno[2,3- e][l,2,4]thiadiazine-7-carboxylic acid 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-4H-thieno[2,3- e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-(2-hydroxyethyl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-2-hydroxy-l- (aminocarbonyl)ethyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
N-(2-amino-2-oxoethyl)-3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide; 3-( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)-Ν- [( 1 S)-2-hydroxy- 1 - methylethyl]-4Η-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N,N-bis(2-hydroxyethyl)- 4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[2-hydroxy-l- (hydroxymethyl)ethyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
1 -benzyl-4-hydroxy-3-(7- { [(3R)-3-hydroxypyrroli din- 1 -yl] carbonyl }- 1 , 1 -dioxido- 4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl)quinolin-2(lH)-one;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-(3-hydroxypropyl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3 T 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)-N- [(2S )-2,3- dihydroxypropyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide; 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-l-
(hydroxymethyl)propyl] -4H-thieno [2 ,3 -e] [ 1 ,2,4]thiadiazine-7-carboxamide 1 , 1 -dioxide ;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-l-(hydroxymethyl)- 2-methylpropyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)-N- [2-hydroxybutyl]-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3 -( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)-N- [2-hydroxy-2-(4- hydroxyphenyl)ethyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide; l-benzyl-3-[l,l-dioxido-7-(piperazin-l-ylcarbonyl)-4H-thieno[2,3- e] [1 ,2,4]thiadiazin-3-yl]-4-hydroxyquinolin-2(lH)-one; N-[5-(aminocarbonyl)pyridin-2-yl]-3-(l-benzyl-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl)-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thieno[2,3- e] [1 ,2,4]thiadiazin-7-yl]methyl carbamate;
[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-7-yl]methyl aminocarbonylcarbamate;
3-[7-(azidomethyl)-l,l-dioxido-4Η-thieno[2,3-e][l,2,4]thiadiazin-3-yl]-l-benzyl-4- hydroxyquinolin-2( 1 H)-one ;
3- [7-(aminomethyl)- 1 , 1 -dioxido-4H-thieno[2,3-e] [ 1 ,2,4]thiadiazin-3-yl]- 1 -benzyl-4- hydroxyquinolin-2(lH)-one; N-{[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H- thieno[2,3-e] [ 1 ,2,4]thiadiazin-7-yl]methyl }methanesulfonamide;
N-{[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H- thieno[2,3-e] [ 1 ,2,4]thiadiazin-7-yl]methyl }nicotinamide;
N-{ [3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-7-yl]methyl}mo holine-4-carboxamide;
N-{[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-7-yl]methyl}-2-hydroxyacetamide; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-{7-[(methoxymethoxy)methyl]-l,l- dioxido-4H-thieno[2,3-e] [1 ,2,4]thiadiazin-3-yl }quinolin-2(lH)-one; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-3-yl]quinolin-2(lH)-one; N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]methanesulfonamide;
N- [(3-{ 1 -[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl } - l,l-dioxfflo-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]ethanesulfonamide;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl } - 'v l,l-dioxido-4H-thieno[2,3-e] [l,2,4]thiadiazin-7-yl)methyl]propane-l-sulfonamide;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl } - 1 , 1 -dioxido-4H-thieno [2 ,3 -e] [ 1 ,2 ,4] thiadiazin-7-yl)methyl] propane-2-sulf onamide ;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl } - l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]benzenesulfonamide; N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]-l-phenylmethanesulfonamide; l-butyl-4-hydroxy-3-{7-[(methoxymethoxy)methyl]-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl}-l,8-naphthyridin-2(lH)-one; l-butyl-4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl]-l,8-naphthyridin-2(lH)-one; methyl 3-(l-benzyl-4-hydroxy-2-oxo-l ,2-dihydro-l ,8-naphthyridin-3-yl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxylate 1,1-dioxide;
4-hydroxy-3-{ 7-[(methoxymethoxy)methyl] -1,1 -dioxido-4H-thieno [2,3- e][l,2,4]thiadiazin-3-yl}-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one; 4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl]- l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one; l-benzyl-3-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(lΗ)- pyridinone; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6-dimethyl- 2(lH)-pyridinone; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-5- phenyl-2(lH)-pyridinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6-dimethyl-l-(3- methylbutyl)-2(lH)-pyridinone; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-5,6- dimethyl-2(lH)-pyridinone; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-phenyl-2(lH)- pyridinone; l,5-dibenzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl- 2(lH)-pyridinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-6-methyl- 5-phenyl-2(lH)-pyridinone; l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-2(lH)-pyridinone; N-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydropyridin-3-yl]-l,l-dioxido-4H- 1 ,2,4-beιteothiadiazin-7-yl Jmethanesulfonamide;
N- [3 -( l-benzyl-4-hydroxy-2-oxo- 1 ,2-dihydropyri din-3-yl)- 1 , 1 -dioxido-4H- 1 ,2,4- benzothiadiazin-7-yl]methanesulfonamide;
N- [3-(4-hydroxy-2-oxo- 1 ,2-dihydro-3-pyridinyl)- 1 , 1 -dioxido-4H- 1 ,2 ,4- benzothiadiazin-7-yl]methanesulfonamide;
N-[3-(4-hydroxy- 1 -isopentyl-5 ,6-dimethyl-2-oxo- 1 ,2-dihydro-3-pyridinyl)- 1,1- dioxido-4H-l,2,4-benzothiadiazin-7-yl]methanesulfonamide; benzyl 3-[3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro-3-pyridinyl)- 1 , 1 -dioxido-4H- l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro-3-pyridinyl)-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yl]sulfamide;
N-{3-[l-(cyclobutylmethyl)-4-hydroxy-2-oxo-l,2-dihydro-3-pyridinyl]-l,l-dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl Jmethanesulfonamide;
N-{3-[5-bromo-l-(cyclobutylmethyl)-4-hydroxy-2-oxo-l,2-dihydro-3-pyridinyl]-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl Jmethanesulfonamide;
N-[3-(4-hydroxy- 1 -isopentyl-2-oxo-5-vinyl- 1 ,2-dihydro-3-pyridinyl)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl]methanesulfonamide; and 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-propoxyquinolin-2(lH - one; or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof.
In a second embodiment the present invention provides a compound of formula (II)
Figure imgf000029_0001
cπ) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RJRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-,
RaRbNC(O)NRcalkyl-, RfRgC=N- and R O-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, øxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaR N-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH; R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(0)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-,
RkOalkyl-, RaRbNS02-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)0- and -ORk, wherein each R5 is independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and '
-C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(0)ORa, -C(0)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(0)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(O)NRcRd, -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rb), -C(0)Rf, -C(O)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(0)NR Rh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(O)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaS02alkyl-, RaOC(0)-, RaOC(O)alkyl-, RaC(0)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(0)S-, Ra(0)2S-, RaSO2N(Rf)-, RaRbNC(0)-, RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (II) wherein R4 is hydroxy.
For example, the present invention provides a compound of formula (II) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyh heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-. *
For example, the present invention provides a compound of formula (II) wherein R4 is hydroxy and R1 is selected from the group consisting of, C3 alkyl, C4 alkyl, C5 alkyl, C3 alkenyl, C4 alkenyl, C5 alkenyl, C3 alkynyl, C4 alkynyl, C5 alkynyl, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5-C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 cycloalkyl, (phenylalkyl)O-, (C1-C6 alkyl)O-, ((C3-C6 cycloalkyl)alkyl)O-, phenylCH=N-, NH2, (C1-C7 alkyl)N(H)-, (C1-C7 alkenyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)alkyl)N(H)-, (phenylalkyl)N(H)-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-,
(tetrahydrqpyran)N(H)-, (benzyl)N(H)-, (tetrahydronaphthalenyl)N(H)-, wherein each R1 is substituted with 0, 1, 2, or 3 substituents selected from the group consisting of alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, phenyl, piperazinyl, morphilinyl, carboxy, -C(0)0(alkyl), -NH2, -NH(alkyl), -N(alkyl)2, -Oalkyl, -O-phenyl. For example, the present invention provides a compound of formula (II) wherein R4 is hydroxy and R1 is selected from the group consisting of ((l-isopropyl)butyl)N(H)-, ((2- chloro-1 ,3-thiazol-5-yl)methyl)N(H)-, ((2-methyl-l ,3-thiazol-4-yl)methyl)N(H)-, ((3- methylthien-2-yl)methyl)N(H)-, ((3-trifluoromethyl)cyclohexyl)N(H)-, ((5-chlorothien-2- yl)methyl)N(H)-, ((pyridin-3-yl)methyl)N(H)-, (l,2,3,4-tetrahydronaphthalen-2-yl)N(H)-, (l,3-thiazol-2-ylmethyl)N(H)-, (l,3-thiazol-5-ylmethyl)N(H)-, (l-cyclohezen-l-yl)ethyl, (1- cyclopropylethyl)N(H)-, (l-ethylbutyl)N(H)-, (l-ethylpropyl)N(H)-, (l-methylbutyl)N(H)-, (l-phenylethyl)N(H)-, (l-propylbutyl)N(H)-, (l-thien-3-ylethyl)N(H)-, (2-(lH-indol-3- yl)ethyl, (2-(dimethylamino)ethyl)(methyl)aminopropyl, (2-bromobenzyl)N(H)-, (2-chloro- 1 ,3-thiazol-5-yl)methyl, (2-chloro-4-pyridinyl)methyl, (2-ethyl-3-methylbutyl)N(H)-, (2-ethylbutyl)N(H)-, (2-furylmethyl)N(H)-, (2-methyl-l, 2-thiazol-4-yl)methyl, (2-methyl- 1 ,3-thiazol-4-yl)methyl, (2-methyl-l ,3-thiazol-5-yl)methyl, ((2-methylphenyl)methyl)N(H)-, (3,3-dimethylbutyl)N(H)-, (3,5-dimethyl-4-isoxazolyl)methyl, (3,5- dimethylcyclohexyl)N(H)-, (3-bromobenzyl)N(H)-, (3-cyanobenzyl)N(H)-, (3-ethylcyclopentyl)N(H)-, (3-furylmethyl)N(H)-, ((3-methoxyphenyl)methyl)N(H)-, (3-methylbenzyl)N(H)-, (3-methylbut-2-enyl)N(H)-, (3-methylbutyl)N(H)-, (3-methylcyclohexyl)N(H)-, (3-methylcyclopentyl)N(H)-, (3-trifluoromethyl)benzyl, ((4-bromophenyl)methyl)N(H)-, (4-isopropylcyclohexyl)N(H)-,
((4-methoxyphenyl)methyl)N(H)-, ((4-methylphenyl)methyl)N(H)-, (5-bromo-2- thienyl)methyl, (5-bromo-3-pyridinyl)methyl, (5-carboxy-2-furyl)methyl, (5-chloro-2- thienyl)ώethyl, (5-ethoxycarbonyl-2-furyl)methyl, (5-methyl-2-thienyl)methyl, (5-methyl-3- isoxazolyl)methyl, (5-methyl-3-pyridinyl)methyl, (5-nitro-2-furyl)methyl, (5-phenyl-2- thienyl)methyl, (5-tert-butyl-2-thienyl)methyl, (6,6-dimethylbicyclo[3. l]hept-2-yl)methyl, (6-ethoxy-2-pyridinyl)methyl, (6-methyl-2-pyridinyl)methyl, (cyclopropylmethyl)N(H)-, (pyridin-2-ylmethyl)N(H)-, (pyridin-3-ylmethyl)N(H)-, (pyridin-4-ylmethyl)N(H)-, (tetrahydro-2H-pyran-4-yl)N(H)-, (thien-2-ylmethyl)N(H)-, (thien-3-ylmethyl)N(H)-, 1,1 ' -biphenyl -4-ylmethyl, 1 ,3-thiazol-4-ylmethyl, 1-adamantylmethyl, l-benzothien-2- ylmethyl, 1-ethylpropyl, 1-naphth ylmethyl, 1-neopentyl, 1-phenylethyl, 2-(l,3-dioxolan-2- yl)ethyl, 2-(3-thienyl)ethyl, 2,3-dihydroxypropyl, 2-aminoethyl, 2-cyanobenzyl, 2- cyclohexylethyl, (2-methylphenyl)methyl, 2-methylbutyl, 2-naphthylmethyl, 2-phenylethyl, 2-phenylpropyl, 2-pyridinylmethyl, 3-(4-methyl-l-piperazinyl)propyl, 3-(4- morpholinyl)propyl, 3-(diethylamino)propyl, 3-(dimethylamino)propyl, 3-anilinopropyl, 3- bromobenzyl, 3-butenyl, 3-chlorobenzyl, 3-cyanobenzyl, 3-ethylbutyl, 3-fluorobenzyl, 3- hydroxybutyl, 3-hydroxypropyl, 3-iodobenzyl, 3-methoxybenzyl, 3-methoxycarbonylbenzyl, 3-methyl-2-butenyl, 3-methylbenzyl, 3-methylbutyl; 3-nitrobenzyl, 3-phenoxybenzyl, 3- pyridinylmethyl, 3-thienylmethyl, 4-bromobenzyl, 4-cyanobenzyl, 4-methoxybenzyl, 4- methyl-3-pentenyl, 4-methylbenzyl, 4-methylpentyl, 4-pyridinylmethyl, 4-tert-butylbenzyl, -NH2, phenylmethyl, (phenylmethyl)N(H)-, benzyloxy, (butyl)N(H)-, (cyclobutyl)N(H)-, cyclobutylmethyl, cycloheptyl, (cycloheptyl)N(H)-, cyclohexyl, (cyclohexyl)N(H)-, cyclohexylmethyl, cyclopentyl, (cyclopentyl)N(H)-, cyclopropylmethyl, cyclopropylethyl, hydrogen, isobutoxy, (isobutyl)N(H)-, (isopropyl)N(H)-, n-butyl, pentyl, (pentyl)N(H)-, (phenylmethylene)N(H)-, prop-2-enyl, propan-3-al, propoxy and (propyl)N(H)-. In a third embodiment the present invention provides a compound of formula (HI):
Figure imgf000034_0001
(IH) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(D)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(0)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-,
Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(0>, RkOC(0)alkyl-, RfcOalkyl-, RaRbNS02-, RaRbNS02alkyl-7 (RbO)(Ra)P(0)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkylXNRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl) (ORk), -(alkyl)(NRaRb), -SRa, -S(Q)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(0)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcR N-, RkO-. RkOalkyl-5 RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcS02alkyl-, RcC(0)-, RcC(0)alkyl-, RcOC(O)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(O)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(0)NRcRd, -SR0, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR ), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(0)2R , -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(O)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, R and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS (O)-, RaS02-, RaSalkyl-, Ra(O)Salkyl-,: RaS02alkyl-, RaOC(0)-, RaOC(0)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; m is 0, 1, or 2; and n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaSO2N(Rf)-, RaRbNC(O)-,
RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (III) wherein R4 is hydroxy.
For example, the present invention provides a compound of formula (III) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-.
For example, the present invention provides a compound of formula (HI) wherein R4 is hydroxy and R1 is selected from the group consisting of ((l-isopropyl)butyl)N(H)-, ((2- chloro-l,3-thiazol-5-yl)methyl)N(H)-, ((2-methyl-l, 3-thiazol-4-yl)methyl)N(H)-, ((3- methylthien-2-yl)methyl)N(H)-, ((3-trifluoromethyl)cyclohexyl)N(H)-, ((5-chlorothien-2- yl)methyl)N(H)-, ((pyridin-3-yl)methyl)N(H)-, (l,2,3,4-tetrahydronaphthalen-2-yl)N(H)-, (l,3-thiazol-2-ylmethyl)N(H)-, (l,3-thiazol-5-ylmethyl)N(H)-, (l-cyclohezen-l-yl)ethyl, (1- cyclopropylethyl)N(H)-, (l-ethylbutyl)N(H)-, (l-ethylpropyl)N(H)-, (l-methylbutyl)N(H)-, (l-phenylethyl)N(H)-, (l-propylbutyl)N(H)-, (l-thien-3-ylethyl)N(H)-, (2-(lH-indol-3- yl)ethyl, (2-(dimethylamino)ethyl)(methyl)aminopropyl, ((2-bromophenyl)methyl)N(H)-, (2-chloro-l ,3-thiazol-5-yl)methyl, (2-chloro-4-pyridinyl)methyl, (2-ethyl-3- methylbutyl)N(H)-, (2-ethylbutyl)N(H)-, (2-furylmethyl)N(H)-, (2-methyl-l, 2-thiazol-4- yl)methyl, (2-methyl-l,3-thiazol-4-yl)methyl, (2-methyl-l, 3-thiazol-5-yl)methyl, (2_methylbenzyl)N(H , (3,3-dimethylbutyl)N(H)-, (3,5-dimethyl-4-isoxazolyl)methyl, (3,5- dimethylcyclohexyl)N(H)-, (3-bromobenzyl)N(H)-, (3-cyanobenzyl)N(H)-, (3-ethylcyclopentyl)N(H)-, (3-furylmethyl)N(H)-, (3-methoxybenzyl)N(H)-, (3-methylbenzyl)N(H)-, (3-methylbut-2-enyl)N(H)-, (3-methylbutyl)N(H)-, (3-methylcyclohexyl)N(H)-, (3-methylcyclopentyl)N(H)-, (3-trifluoromethyl)benzyl, ((4-bromophenyl)methyl)N(H)-, (4-isopropylcyclohexyl)N(H)-,
((4-methoxyphenyl)methyl)N(H)-, ((4-methylphenyl)methyl)N(H)-, (5-bromo-2- thienyl)methyl, (5-bromo-3-pyridinyl)methyl, (5-carboxy-2-furyl)methyl, (5-chloro-2- thienyl)methyl, (5-ethoxycarbonyl-2-furyl)methyl, (5-methyl-2-thienyl)methyl, (5-methyl-3- isoxazolyl)methyl, (5-methyl-3-pyridinyl)methyl, (5-nitro-2-furyl)methyl, (5-phenyl-2- thienyl)methyl, (5-tert-butyl-2-thienyl)methyl, (6,6-dimethylbicyclo[3.1.1]hept-2-yl)methyl, (6-ethoxy-2-pyridinyl)methyl, (6-methyl-2-pyridinyl)methyl, (cyclopropylmethyl)N(H)-, (pyridin-2-ylmethyl)N(H)-, (pyridin-3-ylmethyl)N(H)-, (pyridin-4-ylmethyl)N(H)-, (tetrahydro-2H-pyran-4-yl)N(H)-, (thien-2-ylmethyl)N(H)-, (thien-3-ylmethyl)N(H)-, 1,1'- biphenyl-4-ylmethyl, l,3-thiazol-4-ylmethyl, 1-adamantylmethyl, l-benzothien-2-ylmethyl, 1-ethylpropyl, 1-naphth ylmethyl, 1-neopentyl, 1-phenylethyl, 2-(l,3-dioxolan-2-yl)ethyl, 2-(3-thienyl)ethyl, 2,3-dihydroxypropyl, 2-aminoethyl, (2-cyanophenyl)methyl, 2- cyclohexylethyl, (2-methylphenyl)methyl, 2-methylbutyl, 2-naphthylmethyl, 2-phenylethyl, 2-phenylpropyl, 2-pyridinylmethyl, 3-(4-methyl-l-piperazinyl)propyl, 3-(4- morpholinyl)propyl, 3-(diethylamino)propyl, 3-(dimethylamino)propyl, 3-anilinopropyl, (3- bromophέnyl)methyl, 3-butenyl, (3-chlorophenyl)methyl, (3-cyanophenyl)methyl, 3- ethyϊbutyl, (3-fluorophenyl)methyl, 3-hydroxybutyl, 3 -hydroxypropyl, (3-iodophenyl)methyl, (3-methoxyphenyl)methyl, (3-methoxycarbonylphenyl)methyl, 3-methyl-2-butenyl, (3-methylphenyl)methyl, 3-methylbutyl, (3-nitrophenyl)methyl, 3-phenoxybenzyl, 3-pyridinylmethyl, 3-thienylmethyl, (4-bromophenyl)methyl, (4-cyanophenyl)methyl, (4-methoxyphenyl)methyl, 4-methyl-3-pentenyl, (4-methylphenyl)methyl, 4-methylpentyl, 4-pyridinylmethyl, (4-tert-butylphenyl)methyl, -NH2, phenylmethyl, (phenylmethyl)N(H)-, (phenylethyl)N(H)-, benzyloxy, (butyl)N(H)-, (cyclobutyl)N(H)-, cyclobutylmethyl, cycloheptyl, (cycloheptyl)N(H)-, cyclohexyl, (cyclohexyl)N(H)-, cyclohexylmethyl, cyclopentyl, (cyclopentyl)N(H)-, cyclopropylethyl, cyclopropylmethyl, isobutoxy, (isobutyl)N(H)-, (isopropyl)N(H)-, n-butyl, pentyl, (pentyl)N(H)-, (phenylmethylene)N(H)-, prop-2-enyl, propan-3-al, propoxy and (propyl)N(H)-.
In a fourth embodiment the present invention provides a compound of formula (IV)
Figure imgf000039_0001
(IV) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, halo alkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (OR.), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(0)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
B is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(0)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02alkyl-, (RbO)(Ra)P(O)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyaU oxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(0)NRcRd; R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(0)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcS02alkyl-, RcC(0 , RcC(0)alkyl-, RcOC(O)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NR};Rd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherem the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(0Rf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(0)2Rft -ORf, -N(Rf)(Rh), -C(0)Rf, -C(O)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, όyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(O)OH, -C(0)0(alkyl), -C(O)alkyl, -C(0)NH2) -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0)-, RaS02-, RaSalkyl-, Ra(O)Salkyl-, RaS02alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; m is 0, 1, 2, 3, or 4; and i n is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(0)2S-, RaS02N(Rf)-, RaRbNC(O)-, RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (IV) wherein R4 is hydroxy.
For example, the present invention provides a compound of formula (IV) wherein R4 is hydroxy and R1 is selected from the group consisting of RaRhN-, RfRgC=N- and RkO-.
For example, the present invention provides a compound of formula (IV) wherein R4 is hydroxy and R1 is selected from the group consisting of alkylO-, (cycloalkyl)O-, (arylalkyl)O-, arylCH=N-, -NH2, alkylN(H)-, alkenylN(H)-, cycloalkylN(H)-, (cycloalkylalkyl)N(H)-, (heteroarylalkyl)N(H)-, (arylalkyl)N(H)- and (heterocycle)N(H)-.
For example, the present invention provides a compound of formula (IV) wherein R is hydroxy and R1 is selected from the group consisting of (C3-C7 alkyl)0-, (C3-C6 cycloalkyl)0-, (phenylalkyl)O-, phenylCH=N-, (C3-C7 alkyl)N(H)-, (C3-C7 alkenyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (tetranaphthalenyl)N(H)-, (tetrahydropyranyl)N(H)- and (phenylalkyl)N(H)-, wherein the phenyl, thienyl, thiazolyl, furyl and pyridinyl of (phenylalkyl)O-, phenylCH=N-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, and (phenylalkyl)N(H)- are each independently substituted with 0, 1 or 2 susbstituents selected from the group consisting of nitro, cyano, hydroxyl, alkoxy, -NH2, -N(H)(alkyl), -N(alkyl)2, alkyl, halo, haloalkyl, carboxy, acetyl, and alkyoxycarbonyl.
For example, the present invention provides a compound of formula (IV) wherein R4 is hydroxy and R1 is selected from the group consisting of (phenylmethyl)N(H)-, (1- phenylethyl)N(H)-, (cycloproylmethyl)N(H)-, (cyclohexylmethyl)N(H)-, (l-cyclopropylethyl)N(H)-, phenylCH=N-, propylO-, (l-propylbutyl)N(H)-, (isobutyl)N(H)-, (isopropyl)N(H)-, (l-ethylpropyl)N(H)-, (l-ethylbutyl)N(H)-, (2-ethylbutyl)N(H)-, (l-isopropylbutyl)N(H)-, (l-methylbutyl)N(H)-, (3-methylbutyl)N(H)-, (3,3- dimethylbutyl)N(H)-, (propyl)N(H)-, (butyl)N(H)-, (pentyl)N(H)-, (2-ethyl-3- methylbutyl)N(H)-, (3-methylbut-2-enyl)N(H)-, (cyclobutyl)N(H)-, (cyclopentyl)N(H)-, (cyclohexyl)N(H)-, (cycloheptyl)N(H)-, (thienylmethyl)N(H)-, (furylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (tetrahydronaphthalenyl)N(H)-, and (tetrahydropyranyl)N(H)-, wherein the phenyl, thienyl, thiazolyl, furyl and pyridinyl of (phenylmethyl)O-, phenylCH=N-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (phenylmethyl)N(H)- and (1- phenylethyl)N(H)- are each independently substituted with 0, 1 or 2 susbstituents selected from the group consisting of nitro, cyano, hydroxyl, methoxy, -NH , -N(H)(alkyl), -N(alkyl)2, methyl, halo, halomethyl, carboxy, acetyl, and alkyoxycarbonyl. Exemplary compounds of the fourth embodiment of the present invention of formula
(IV) include, but not limited to, the following:
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [(lE)- phenylmethylene] amino } -2( 1 H)-quinolinone ; l-amino-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(lH)- quinolinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-propoxyquinolin-2(lH)- one; l-(benzylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin- 2(lH)-one;
1 -amino-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin-2( 1H)- one; 3-(l,'l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(l- propylbutyl)amino]quinolin-2(lH)-one;
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(isobutylamino)quinolin- 2(lH)-oιie;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-[(l-ethylpropyl)amino]-4- hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(pentylamino)quinolin- 2(lH)-one; l-(cyclohexylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[(2-methyl-l,3-thiazol-
4-yl)methyl]amino}quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l- (isopropylamino)qumolin-2(lH)-one;
1 -(cyclobutylamino)-3 -(1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one; l-(cyclopentylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( 1 H)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [3- methylcyclopentyl]amino}quinolin-2(lH)-one; 3-(l , l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(tetrahydro-2H-pyran-4- ylamino)quinolin-2(lH)-one;
3 -( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)- 1 - { [ 1 -ethylbutyl] amino } -4- hydroxyquinolin-2( lH)-one ;
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1- { [(3R)-3 - methylcyclohexyl]amino}quinolin-2(lH)-one; l-(cycloheptylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one ;
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)- 1 - { [3-ethylcyclopentyl] amino } -4- hydroxyquinolin-2( 1 H)-one ; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [l- isopropylbutyl] amino } quinolin-2( lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[l- phenylethyl] amino } quinolin-2( lH)-one;
3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1-{ [ l-thien-3- ylethyl] amino } quinolin-2( lH)-one; l-{ [3,5-dimethylcyclohexyl]amino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)- 4-hydroxyquinolin-2(lH)-one;
3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(4- isopropylcyclohexyl)amino]quinolin-2(lH)-one;
3>( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1-[1 ,2,3 ,4- tetrahydroηaphthalen-2-ylamino]quinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[3-
(trifluoromethyl)cyclohexyl]amino}quinolin-2(lH)-one; l-(butylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin- 2(lH)-one;
3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1-[(3- methylbutyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-[(3-furylmethyl)amino]-4- hydroxyquinolin-2( lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-[(2-furylmethyl)amino]-4- hydroxyquinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(thien-2- ylmethyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(l,3-thiazol-2- ylmethyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-{ [(2R)-2-ethyl-3- methylbutyl] amino } -4-hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(4- methylbenzyl)amino] quinolin-2( lH)-one;
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -[(3- methylbenzyl)amino]quinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(2- methylbenzyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[(3-methylthien-2- yl)methyl]amino}quinolin-2(lH)-one;
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -[(4- methoxybenzyl) amino] quinolin-2(lH)-one ; l-{ [(5-chlorothien-2-yl)methyl]amino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)-4-hydroxyquinolin-2(lH)-one; l-{ [(2-chloro-l ,3-thiazol-5-yl)methyl]amino } -3-( 1 , 1 -dioxido-4H-l ,2,4- benzothiadiazin-3-yl)-4-hydroxyquinolin-2(lH)-one;
1 - [(3-bromobenzyl)amino] -3 -( 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-4- hydroxyquinolin-2(lH)-one; l-[(4-bromobenzyl)amino]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one ; l-[(2-bromobenzyl)amino]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-
Figure imgf000046_0001
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(pyridin-3- ylmethyl)amino]quinolin-2(lH)-one;
3-({[3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxoquinolin-l(2H)- yl] amino } methyl)benzonitrile;
2-({3-[l-(cyclobutylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl } oxy)acetamide; 2-( { 3 -[ 1 -(cyclopentylamino)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl] - 1 , 1 - dioxido-4H-l,2,4-benzothiadiazin-7-yl}oxy)acetamide;
2-({ 3-[ 1 -(cyclohexylamino)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl }oxy)acetamide;
2- [(3 - { 1 - [(cyclopropylmethyl)amino] -4-hydroxy- 2-oχo- 1 ,2-dihydroquinolin-3 -yl } - 1,1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl)oxy] acetamide ;
2-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido- 4H- 1 ,2-benzothiazin-7-yl } oxy)acetamide;
2-({3-[l-(butylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl } oxy)acetamide; 2-[(3- { 4-hydroxy- 1 - [(3-methylbutyl)amino]-2-oxo- 1 ,2-dihydroquinolin-3-yl } - 1 , 1 - dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]acetamide;
3-(8-amino-7-hydroxy-l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - (isobutylamino)quinolin-2(lH)-one;
2-( { 8 -amino-3 - [4-hydroxy- 1 -(isobutyl amino)-2-oxo- 1 ,2-dihydroquinolin-3 -yl] - 1 , 1 - dioxido-4Η- 1 ,2,4-benzothiadiazin-7-yl }oxy)acetamide;
2-( { 3-[4-hydroxy-2-oxo- 1 -(propyla ino)- 1 ,2-dihydroquinolin-3-yl]- 1 , l-dioxido-4H- l,2,4-benzothiadiazin-7-yl}oxy)acetamide;
2-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}oxy)propan amide; 2-( { 3- [4-hydroxy- 1 -(isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxido-
4H-1 ,2,4-benzothiadiazin-7-yl }oxy)butanamide;
8-amino-3-[4-hydroxy-l-(isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl methanesulfonate;
1 - [(cyclopropylmethyl)amino] -4-hydroxy-3-(7-hydroxy-8-nitro- 1 , 1 -dioxido-4H- l,2,4-benzothiadiazin-3-yl)quinolin-2(lH)-one;
3-(7- { 2- [(35)-3 -aminopyrrolidin-1 -yl] -2-oxoethoxy } - 1 , 1 -dioxido-4H- 1 ,2,4- benzothiadiazin-3-yl)-l-[(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one;
2-[(3-{ l- [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl } - l,l-dioxido-4Η-l,2,4-benzothiadiazin-7-yl)oxy]-N-ethylacetamide;
[(S - { 1 - [(cyclopropylmethyl)amino] -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl } - 1 , 1 - dioxido-4H-l ,2,4-benzothiadiazin-7-yl)oxy]acetic acid; 3-{7-[2-(3-aminopyrrolidin-l-yl)-2-oxoethoxy]-l,l-dioxido-4H-l,2,4- benzothiadiazin-3-yl}-l-[(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one;
3-(8-amino-7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one;
2-[(8-amino-3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin- 3-yl}-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-y])oxy]acetamide;
[(8-amino-3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl }-l , l-dioxido-4Η-l ,2,4-benzothiadiazin-7-yl)oxy] acetonitrile; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-[7-(2-hydroxyethoxy)-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl] quinolin-2( lH)-one ; l-[(cyclopropylmethyl)arrιino]-4-hydroxy-3-[7-(lH-imidazol-2-ylmethoxy)-l,l- dioxido-4H-l,2,4-benzothiadiazin-3-yl]quinolin-2(lH)-one; l-[(cyclopropylmethyl)amino]-3-[l,l-dioxido-7-(l,3-thiazol-2-ylmethoxy)-4H-l,2,4- benzothiadiazin-3-yl]-4-hydroxyquinolin-2(lH)-one; l-[(cyclopropylmethyl)amino]-3-[7-(4,5-dihydro-lH-imidazol-2-ylmethoxy)-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl]-4-hydroxyquinolin-2(lH)-one;
2-{ [(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]methyl}-l,3-thiazole-4-carbonitrile;
3-[7-(2-aminoethoxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl]-l- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one; N-{2-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl } - 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl)oxy] ethyl } methanesulf onamide;
3- { 7- [(5-bromopyridin-2-yl)oxy]- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl } -4- hydroxy- 1 -(isobutylamino)quinolin-2( lH)-one;
4-hydroxy-l-(isobutylamino)-3-{7-[(3-nitropyridin-2-yl)oxy]-l,l-dioxido-4H-l,2,4- benzothiadiazin-3-yl }quinolin-2(lH)-one; tert-butyl 3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl } - 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-ylcarbamate; 3-(7-amino-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one; methyl 2-chloro-6-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3- yl]-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl}oxy)isonicotinate; N- { 3 - [ 1 -(cyclobutyl amino)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl] - 1 , 1 -dioxido-
4H-1 ,2,4-benzothiadiazin-7-yl }methanesulfonamide;
N-(3-{l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxiMo-4H-l,2,4-benzothiadiazin-7-yl)methanesulfonamide;
N-(3- { 1 -[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo- 1 ,2-dihydro-3-quinolinyl } - l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)methanesulfonamide;
2-{ [3-(l-amino-4-hydroxy-2-oxo-l,2-dihydro-3-quinolinyl)-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yl]oxy}acetamide;
N- { 3-[ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] - 1 , 1-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}ethanesulfonamide; benzyl 3- { 3-[ l-(cyclobutylamino)-4-hydroxy-2-oxo-l ,2-dihydro-3-quinolinyl] - 1,1- dioxido-4H-l ,2,4-benzothiadiazin-7-yl }diazathiane-l-carboxylate 2,2-dioxide;
N- { 3 - [ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] -1,1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yl }-N'-methylsulf amide; and
N- { 3 - [ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl]- 1 , 1 -dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl } sulfamide; or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof.
In a fifth embodiment the present invention provides a compound of formula (Va)
Figure imgf000048_0001
(Va) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaR Ν-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(0)NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH; ,\
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(0)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaS02N(Rf)-, Ra(O)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(0)alkyl-, RicOalkyl-, RaRbNS02-, RaRbNS02alkyl-, (RbO)(Ra)P(O)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each Rδ is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(0)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, R O-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcS02alkyl-, RcC(0)-, RcC(O)alkyl-, RcOC(0)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(O)O(alkyl), -C(0)alkyl, -C(O)NH2, -C(0)NH2l -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, R and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 orγ3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(O)alkyl, -C(0)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0)-, RaS02-, RaSalkyl-, Ra(0)Salkyl-, RaS02alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(O)NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaS02N(Rf)-, RaRbNC(O)-, RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (Va) wherein R4 is hydroxy.
For example, the present invention provides a compound of formula (Va) wherein R is hydroxy and wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-.
For example, the present invention provides a compound of formula (Va) wherein R4 is hydroxy and wherein R1 is selected from the group consisting of C1-C7 alkyl, phenyl-Cl- C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((C3-C6 cycloalkyl) C1-C2 alkyl)-, (C1-C7 alkyl)0-, (C3- C7 cycloalkyl)O-, phenyl-Cl-C2 alkyl-O-, -NH2, (C1-C7 alkyl)N(H)-, (C3-C7 cycloalkyf)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (heterocycle)N(H)-, (heteroarylalkyl)N(H)-,(arylalkyl)N(H)-. For example, the present invention provides a compound of formula (Va) wherein R4 is hydroxy and wherein R1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, thienylmethyl, cyclobutylmethyl, cyclopropylethyl, -NH2, (isopropyl)N(H)-, (isobutyl)N(H)-, (3-methylbutyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-; wherein the phenylmethyl and the thienylmethyl are independently unsubstituted or substituted with 1, 2 or 3 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH2, -N(H)alkyl, — N(alkyl)2, hydroxy and alkoxy.
In a sixth embodiment the present invention provides a compound of formula (Vb)
Figure imgf000052_0001
(Vb) ■: or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(O)ORc and -C(0)NRcRe; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH; R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyaϊkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(O)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(0)-, RkOC(O)alkyl-;
RkOalkyl-, RaRbNS02-, RaRbNS02alkyl-, (RbO)(Ra)P(0)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkylXNRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(0)NRaRb; wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(0)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, R O-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcS02-, RcS02alkyl-, RcC(0)-, RcC(0)alkyl-, RcOC(0)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl) (NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(0)NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -SO2NRfRh, -C(O)OR , alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(0)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(O)O(alkyl), -C(O)alkyl, -C(0)NH2, -C(0)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(aJkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(O)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaS02alkyl-, RaOC(0)-, RaOC(0)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (Vb) wherein R4 is hydroxy.
For example, the present invention provides a compound of formula (Vb) wherein R4 is hydroxyl and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-. For example, the present invention provides a compound of formula (Vb) wherein R4 is hydroxy and wherein R1 is selected from the group consisting of C1-C7 alkyl, phenyl-Cl- C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((C3-C6 cycloalkyl) C1-C2 alkyl)-,(Cl-C7 alkyl)0-, (C3- C7 cycloalkyl)0-, phenyl-Cl-C2 alkyl-O-, -NH2, (C1-C7 alkyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (heterocycle)N(H)-, (heteroarylalkyl)N(H)-,(arylalkyl)N(H)-.
For example, the present invention provides a compound of formula (Vb) wherein R4 is hydroxy and wherein R1 is selected from the group consisting of isopropyl, 3-methylbutyl, butyl, isobutyl, phenylmethyl, thienylmethyl, cyclobutylmethyl, cyclopropylethyl, -NH2, (isopropyl)N(H)-, (isobutyl)N(H)-, (3-methylbutyl)N(H)-, (cyclobutyl)N(H)- and (cycloprq ylmethyl)N(H)-; wherein the phenylmethyl and the thienylmethyl are independently unsubstituted or substituted with 1, 2 or 3 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, haloalkyl, halo, cyano, nitro, -NH2, -N(H)alkyl, ~N(alkyl)2, hydroxy and alkoxy.
In a seventh embodiment the present invention provides a compound of formula (Via)
Figure imgf000056_0001
(Via) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, , heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(0)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(0)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(0)-, RkOC(0)-, RkOC(0)alkyl-, RkOalkyl-, RaRbNS02-, RaRbNS02alkyl-, (RbO)(Ra)P(O)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and
Figure imgf000057_0001
R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcS02alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(O)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)RC) -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N'CRfXRh), -C(0)Rf, -C(O)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), : -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(O)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(O)alkyl, RaS-, RaS(0)-, RaS02-, RaSalkyl-, Ra(0)Salkyl-, RaS02al yi-, RaOC(O)-, RaOC(0)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; and m is O, 1, 2, 3, or 4; with the proviso that R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaS02N(Rf)-, RaRbNC(0)-, RkOC(0)-, RaRbNS0 - or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa> -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a comound of formula (Via) wherein R4 is hydroxy.
For example, the present invention provides a comound of formula (Via) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-.
For example, the present invention provides a compound of formula (Via) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5-C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 cycloalkyl, phenyl-Cl-C2 alkyl-, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, phenylN(H)(Cl- C6 alkyl)-, (C1-C7 alkyl)0-, (C3-C6 cycloalkyl)0-, ((phenyl)Cl-C2 alkyl)0-, phenylCH=N-, NH2, (C1-C7 alkyl)N(H)-, (C1-C7 alkenyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, ((phenyl)Cl-C2 alkyl)N(H)-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (tetrahydropyran)N(H)-, (benzyl)N(H)-, (tetrahydronaphthalenyl)N(H)-, wherein each R1 is substituted with 0, 1, 2, or 3 substituents selected from the group consisting of alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, hydroxyl, alkoxy, haloalkoxy, phenyl, piperazinyl, morphilinyl, carboxy, -C(0)0(alkyl), -NH2, -NH(alkyl), -N(alkyl)2, -Oalkyl, -O-phenyi.
For example, the present invention provides a comound of formula (Via) wherein R4 is hydroxy and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-chloro- thien-2-yl)methyl- (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-.
In an eighth embodiment the the present invention provides a compound of formula
Figure imgf000060_0001
(VIb) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(0) Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)0Rc and -C(0)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O>, RaS-, Ra(0)S-,
Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(O)-, RkOC(0)-, RkOC(0)alkyl-, RkOalkyl}-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(0)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkylXNRcRd), -SRc, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(O)NRcRd;
R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(OR ), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(0)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)OR., -C(O)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcR Nalkyl-; RcRdNC(0)alkyl-, RcS02-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(0)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(O)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo,. halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SR0, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and R is independently substituted with 0, 1, 2, or 3 substituehts independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(O)ORf, -C(O)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(O)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(O)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaS02-, RaSalkyl-, Ra(0)Salkyl-, RaS02alkyl-, RaOC(0)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(0)2RG, -ORc, -N(Rc)(Rd), -C(O)R0, -C(0)ORc and -C(O)NRcRd; and m is 0, 1, 2, 3, or 4; with the proviso that when R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (VIb) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5-C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 : cycloalkyl, phenyl-Cl-C2 alkyl-, furyl(Cl-C2 alkyl)-, thiehyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, phenylN(H)(Cl- C6 alkyl)-, (C1-C7 alkyl)O-, (C3-C6 cycloalkyl)0-, ((phenyl)Cl-C2 alkyl)0-, phenylCH=N-, NH2, (C1-C7 alkyl)N(H)-, (C1-C7 alkenyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, ((phenyl)Cl-C2 alkyl)N(H)-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (tetrahydropyran)N(H)-, (benzyl)N(H)-, (tetrahydronaphthalenyl)N(H)-, wherein each R1 is substituted with 0, 1, 2, or 3 substituents selected from the group consisting of alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, hydroxyl, alkoxy, haloalkoxy, phenyl, piperazinyl, morphilinyl, carboxy, -C(0)0(alkyl), -NH2, -NH( alkyl), -N(alkyl)2, -Oalkyl, -O-phenyl. For example, the present invention provides a comound of formula (VIb) wherein R4 is hydroxy and R1 is selected from the group consisting of phenylmethyl, phenylethyl, C3 alkyl, C4 alkyl, C5 alkyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, (5-chloro- thien-2-yl)methyl- (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cyclopropylmethyl)N(H)-.
In a ninth embo und of formula (VII)
Figure imgf000064_0001
(VII) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(0)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(0)-, RkOC(0)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNS02alkyl-, (RbO)(Ra)P(0)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl) heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the- group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcR NC(0)alkyl-, RcSO2-, RcSO2alkyl-, RcC(0)-, R0C(O)alkyl-, RcOC(0)-, RcOC(0)alkyl-, RcRdNalkylC(0)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(0)NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(0)NRfRh, -S02NR Rh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(0)ORf, -C(0)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(0)OH, -C(O)0 (alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached foπn a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2; Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(0)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaS02alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; m}is 0, 1, 2, 3, or 4; and n is O, 1, 2, 3 or 4; with the proviso that when R is alkoxy, aryloxy, hydroxy or ReS-, and R is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaS02N(Rf)-, RaRbNC(O)-, RkOC(0)-, RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
For example, the present invention provides a compound of formula (VII) wherein R4 is hydroxy. For example, the present invention provides a compound of formula (VII) wherein R is hydroxy and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and : RkO-.
For example, the present invention provides a compound of formula (VII) wherein R4 is hydroxy and R1 is selected from the group consisting of hydrogen, C1-C7 alkyl, C1-C6 alkenyl, furyl(Cl-C2 alkyl)-, thienyl(Cl-C2 alkyl)-, phenyl(Cl-C2 alkyl)-, pyridinyl(Cl-C2 alkyl)-, thiazolyl(Cl-C2 alkyl)-, isoxazolyl(Cl-C2alkyl)-, naphthyl(Cl-C2 alkyl), benzothienyl(Cl-C2 alkyl)-, indolyl(Cl-C2 alkyl)-, (C3-C7 cycloalkyl)(Cl-C2 alkyl)-, (C5- C6 cycloalkenyl)(Cl-C2 alkyl)-, C3-C7 cycloalkyl, phenylN(H)(Cl-C6 alkyl)-, (phenylalkyl)O-, (C1-C7 alkyl)O-, (C3-C6 cycloalkyl)0-, phenylCH=N-, NH2, (C1-C7 alkyl)N(H)-, (C1-C7 alkenyl)N(H)-, (C3-C7 cycloalkyl)N(H)-, ((C3-C7 cycloalkyl)Cl-C2 alkyl)N(H)-, (thienylmethyl)N(H)-, (thiazolylmethyl)N(H)-, (furylmethyl)N(H)-, (pyridinylmethyl)N(H)-, (tetrahydropyran)N(H)-, (phenylalkyl)N(H)-, (tetrahydronaphthalenyl)N(H)-, wherein each R1 is substituted with 0, 1, 2, or 3 substituents selected from the group consisting of alkyl, hydroxy, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, phenyl, piperazinyl, morphilinyl, carboxy, -C(0)0(alkyl), -NH2, -NH(alkyl), -N(alkyl)2, -Oalkyl, -O-phenyl.
For example, the present invention provides a compound of formula (VII) wherein R4 is hydroxy and R1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, (5-chloro-thien-2-yl)methyl-, -NH2, (C3 alkyl)N(H)-, (C4 alkyl)N(H)-, (C5 alkyl)N(H)-, (cyclobutyl)N(H)- and (cycloρropylmethyl)N(H)-.
Irf a tenth embodiment the present invention provides a compound of formula (VIII)
Figure imgf000068_0001
(vm) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: X is NH, N(alkyl), O or S;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, - hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SR0, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)RC; -C(0)ORc and -C(0)NRcRe; R and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(0)-, -SRa, -S(0)Ra, -S(0)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R )m; R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaR NS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(0>, RkOC(O)alkyl-, RkOalkyl-, RaRbNS02-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(O)NRaRb and -NC(0)Ra;
R7 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaSO2N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-, RkOC(O)-, RkOC(0)alkyl-, RicOalkyl-, RaRbNS02-, RaRbNS02alkyl-, (RbO)(Ra)P(0)0- and -ORk, wherein each R7 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcR Nalkyl-, RcRdNC(p)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(0)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(0)NRcRd, -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(0)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(0)ORf, -C(O)NRfRh, -C(0)N(H)NRfRb, -N(Re)C(0)ORf, -N(Re)S02NR Rh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR ), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo., oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(O)OH, -C(0)0(alkyl), -C(O)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(O)NH2, -C(O)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; : Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0>, RaS02-, RaSalkyl-, Ra(0)Salkyl-, RaS02alkyl-, RaOC(0)-, RaOC(0)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)RC, -C(0)ORc and -C(0)NRcRd; m is 0, 1, 2, 3, or 4; and n is 0, 1 or 2. For example, the present invention provides a compound of formula (VIII) wherein R2 and R3, together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m. For example, the present invention provides a compound of formula (VTII) wherein
R2 and R3, together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl.
For example, the present invention provides a compound of formula (VIII) wherein R2 and R3, together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl and R4 is hydroxy.
For example, the present invention provides a compound of formula (VIII) wherein R2 and R3, together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R4 is hydroxy, and R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RfRgC=N- and RkO-.
For example, the present invention provides a compound of formula (VIII) wherein R and R , together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R4 is hydroxy, and R1 is selected from the group consisting of C1-C7 alkyl, (C3-C6 cycloalkyl)Cl-C2 alkyl)-, phenyl-Cl-C2 alkyl-, heteroaryl-Cl-C2 alkyl-, ((phenyl)Cl-C2 alkyl)O-, (C3-C7 alkyl)O-, (C3-C6 cycloalkyl)0-, ((phen;yl)Cl-C2 alkyl)N(H)-, (C3-C6 cycloalkyl)N(H)-, ((C3-C6 cycloalkyl)Cl-C2 alkyl)N(H)- and (C1-C7 alkyl)N(H)-. For example, the present invention provides a compound of formula (VIII) wherein
R2 and R3, together with the carbon atoms to which they are attached, form a five- or six- membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazolyl, cyclopentyl, cyclohexyl and thienyl, R4 is hydroxy, and R1 is selected from the group consisting of C3 alkyl, C4 alkyl, C5 alkyl, phenylmethyl, phenylethyl, (5- chloro-thien-2-yl)methyl, cyclobutylmethyl, cyclopropylmethyl, cyclopropylethyl,
(cyclopropylmethyl)N(H)-, (cyclobutyl)N(H)-, (cyclopentyl)N(H)-, (cyclohexyl)N(H)-, (phenylmethyl)N(H)-, (C3 alkyl)N(H)-, (C4 alkyl)N(H)- and (C5 alkyl)N(H)-. Exemplary compounds of the tenth embodiment of the present invention of formula (VIII) include, but not limited to, the following:
3-(l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl)-4-hydroxy-l- (isobutylamino)quinolin-2(lH)-one; 3-[8-(chloromethyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl]-
4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-{3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-4H- [l,3]oxaiolo[5,4-h][l,2,4]benzothiadiazin-8-yl}propanoic acid;
3-(8-{[(2-aminoethyl)amino]methyl}-l,l-dioxido-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl)-4-hydroxy-l-(isobutylamino)quinolm-2(lH)-one; methyl {3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-8-yl}acetate;
4-hydroxy-3-(8-{[(3R)-3-hydroxypyrrolidin-l-yl]methyl}-l,l-dioxido-4H- [l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl)-l-(isobutylamino)quinolin-2(lH)-one; 3-[l ,l-dioxido-8-(pyridinium-l-ylmethyl)-4H-[l,3]oxazolo[5,4- h] [ 1 ,2,4]benzothiadiazin-3-yl] - 1 -(isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-4-olate;
3-[l,l-dioxido-8-(pyrrolidin-l-ylmethyl)-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl]-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-[8-(3-aminophenyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3- yl]-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-[8-(aminomethyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl]- 4-hydroxy- 1 -(isobutylamino)quinolin-2(lH)-one;
4-hydroxy-3-[8-(hydroxymethyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl]-l-(isobutylamino)quinolin-2(lH)-one; 3-{8-[(butylamino)methyl]-l,l-dioxido-4H-[l,3]oxazolo[5,4- ' h] [ 1 ,2 ,4]benzothiadiazin-3 -yl } -4-hydroxy- 1 -(isobutylamino)quinolin-2( lH)-one;
3-[9-(butylanaino)-l,l-dioxido-4H,8H-[l,4]oxazino[2,3-h][l,2,4]benzothiadiazin-3- yl]-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
4-hydroxy-l-(3-methylbutyl)-3-(8-methyl-l , l-dioxido-4H-[l ,3]oxazolo[5 ,4- h][l,2,4]benzothiadiazin-3-yl)-l,8-naρhthyridin-2(lH)-one;
3-[l,l-dioxido-8-(trifluoromethyl)-4J-dihydroirrjidazo[4,5-h][l,2,4]benzothiadiazin- 3-yl]-4-hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
4-hydroxy-3-(8-hydroxy-l,l-dioxido-4J-dihydroimidazo[4,5- h][l,2,4]benzothiadiazin-3-yl)-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one; 4-hydroxy-l-(3-methylbutyl)-3-(8-methyl-l,l-dioxido-4J-dihydroimidazo[4,5- h] [ 1 ,2,4jbenzothiadiazin-3-yl)- 1 , 8-naphthyridin-2(lH)-one;
3-[l , l-dioxido-8-(pentafluoroethyl)-4J-dihydroimidazo[4,5- h][l,2,4]benzothiadiazin-3-yl]-4-hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
3-[8-(chloromethyl)-l,l-dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-3- yl]-4-hydroxy- 1 -(3-methylbutyl)- 1 ,8-naphthyridin-2( lff one;
{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yl]-l,l- dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-8-yl} acetonitrile; methyl { 3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yl]- • 1 , l-dioxido-4,7-dihydroimidazo[4,5-h] [1 ,2,4]benzothiadiazin-8-yl } acetate;
3 X9,9-dioxido-6H-[l ,2,5]thiadiazolo[3 ,4-h] [ 1 ,2,4]benzothiadiazin-7-yl)-4-hydroxy-l - (3-methylbutyl)-l,8-naphthyridin-2(lH)-one; 3-(8-amino-l,l-dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-3-yl)-4- hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lΗ)-one; and
4-hydroxy-3-[8-(hydroxymethyl)-l,l-dioxido-4,9-dihydroimidazo[4,5- h] [ 1 ,2,4]benzothiadiazin-3-yl]- 1 -(3-methylbutyl)- 1 , 8-naphthyridin-2( lH)-one, or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof. In an eleventh embodiment the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, and a pharmaceutically acceptable carrier.
In a twelfth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more host immune modulators, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (V), (VI), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and a pharmaceutically acceptable carrier.
In a thirteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IH), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (VII) or (NTH), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and a pharmaceutically acceptable carrier. For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (IH), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, with one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and a pharmaceutically acceptable carrier.
In a fourteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (in), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising, a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (SL), (IV), (Va), (Vb), (Via), (VIb), (VII) or (Vffl), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and a pharmaceutically acceptable carrier. For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (in), (IV), (Va), (Vb), (Via), (VIb), (VE) or (Vπi), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and a pharmaceutically acceptable carrier.
In a fifteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (IH), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha,. egylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a sixteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (πi), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (π), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIH), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (VH) or (Vffl), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a seventeenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of O 2004/041818
compounds of formula (I), (II), (IH), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (HI), (IV), (Va), (Vb), (Via), (VIb), (YU) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier. In an eighteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (ffl), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (Va), (Vb), (Via), (VIb), (VII) or (VIH), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a nineteenth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (Va), (Vb), (Via), (VIb), (NH) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically O 2004/041818
acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (in), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents thέt treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier. In a twentieth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IH), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a phaπnaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier. In a twenty-first embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier. For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier. For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
Preferably, the agent that treat patients for disease caused by hepatitis B(HBV) infection in the above mentioned pharmaceutical compositions can be selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenfovir.
In a twenty-second embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HTV) infection, and a pharmaceutically acceptable carrier.
In a twenty-third embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof,. one or more host immune modulators, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents th&t treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier. In a twenty-fourth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier. In a twenty-fifth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier. For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (IT), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
In a twenty-sixth embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), and a pharmaceutically acceptable carrier.
For example, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HTV) infection, and a pharmaceutically acceptable carrier.
The agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection in the above-mentioned pharmaceutical compositions may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L- 870812, S-1360, enfuvirtide (T-20) or T-1249, or any combination thereof.
In a twenty-seventh embodiment, the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment any one of the pharmaceutical compositions disclosed hereinabove.
In a twenty-eighth embodiment, the present invention provides a method of inhibiting the replication of an RNA-containing virus comprising contacting said virus with a therapeuctially effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt thereof.
In a twenty-ninth embodiment, the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or pharmaceutically acceptable salt thereof.
For example, the present invention provides a method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) or a pharmaceutically acceptable salt thereof wherein theRNA-containing virus is hepatitis C virus. In a thirtieth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more host immune modulators. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated- interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant.
In a thirty-first embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) and one or more second antiviral agents.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication. , l Λ OΛ O O 2004/041818
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome. In a thirty-second embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) one or more host immune modulators, and one or more second antiviral agents.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VH) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatment a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome.
In a thirty-third embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a thirty-fourth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (πi), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a thirty-fifth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering fo a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a thirty-fourth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II),, (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI) or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a thirty-fifth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in
-83- need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection^caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I)' (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, and a pharmaceutically acceptable carrier.
In a thirty-sixth embodiment, the present invention a method of treating or preventing
-84- infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
In a thirty-seventh embodiment, the present invention a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of sikch treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
In a thirty-eighth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a : pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing
-85- infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
In a thirty-ninth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds ^ formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable earner.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
_ For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group
-86- consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, and a pharmaceutically acceptable carrier.
An agent that treats patients for disease caused by hepatitis B (HBV) infection may be, for example but not limited thereto, L-deoxythymidine, adefovir, lamivudine or tenfovir, or any combination thereof.
In a. fortieth embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (III), (TV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
In a forty-first embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
In a forty-second embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIII), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV)
-87- infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen comprising a therapeutically effective amount of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (H), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
In a forty-third embodiment, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IS), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier. For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection caused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (Q, (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically
-88- acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), and a pharmaceutically acceptable carrier.
For example, the present invention provides a method of treating or preventing infection paused by an hepatitis C virus comprising administering to a patient in need of such treatmen a therapeutically effective amount of a compound or combination of compounds of formula (I),'(E), ( l), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VHI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, and a pharmaceutically acceptable carrier.
An agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) orT-1249, or any combination thereof.
In a forty-fourth embodiment the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, to prepare a medicament for treating or preventing infection caused by an RNA-containing virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, to prepare a medicament for treating or preventing infection caused by an RNA-containing virus in a patient, wherein the RNA-containing virus is hepatitis C virus.
In a forty-fifth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, and one or more host immune modulators, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of
-89- compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, and one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a forty-sixth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a therapeutically acceptable salt thereof, and one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Nb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, and one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, and one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a forty-seventh embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators, arid one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from
-90- the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by inhibiting host cellular functions associated with viral replication, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a therapeutically acceptable salt thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more second antiviral agents which inhibit replication of HCV by targeting proteins of the viral genome, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a forty-eighth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a therapeutically acceptable salt thereof, one or more host immune modulators, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. For example, the present invention provides provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a forty-ninth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral
-91- replication, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents thέt treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a fiftieth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (H), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In another preferred embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon- alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (IT), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a
-92- pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. lit, a fifty-first embodiment, the present invention a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a fifty-second embodiment, the present invention a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a fifty-third embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by hepatitis B
-93- (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. In a fifty-fourth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by
-94- targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by hepatitis B (HBV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
An agent that treats patients for disease caused by hepatitis B (HBV) infection may be, for example but not limited thereto, L-deoxythymidine, adefovir, lamivudine or tenfovir, or any combination thereof.
In a fifty-fifth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (S), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. In a fifty-sixth embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, and one or more agents that .treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, and one or more agents that treat patients for disease caused by human immunodeficiency virus (FEV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. -
In a fifty-seventh embodiment, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing
-95- infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more second antiviral agents which inhibit the replication of HCV by targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
In a fifty-eighth embodiment, the present invention provides a use of compound or combination of compounds of formula (I), (II), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. For example, the present invention provides a use of a compound or combination of compounds of formula (I), (II), (III), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (El), (IV), (Va), (Vb), (Via), (VIb), (VII) or (VIE), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which inhibit the replication of HCV by inhibiting host cellular functions associated with viral replication, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV), to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient. For example, the present invention provides a use of a compound or combination of compounds of formula (I), (E), (IE), (IV), (Va), (Vb), (Via), (VIb), (VE) or (VEI), or a pharmaceutically acceptable salt form thereof, one or more host immune modulators selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant, one or more second antiviral agents which which inhibit the replication of HCV by
-96- targeting proteins of the viral genome, and one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection, to prepare a medicament for treating or preventing infection caused by an hepatitis C virus in a patient.
An agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection may be, for example but not limited thereto, ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapiiie, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) orT-1249, or anycombination thereof.
In a fifty-ninth embodiment, the present invention provides a process for the preparation of a compou
Figure imgf000099_0001
(I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-; RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(0)NRcRe;
R2 and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(0)-, -SRa, -S(0)Ra, -S(0)2Ra and RaC(0)-;
-97- wherein R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(O)ORa and -C(0)NRaRb; alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optional!!' substituted with (R6)m;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-, Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaS02N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(0)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)0- and -OR , wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd; R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl) (ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(O)ORa, -C(0)NRaRb and -NC(0)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcS02-, R0SO2alkyl-, RcC(0)-, RcC(0)alkyl-, RcOC(0)-, RcOC(0)alkyl-,
-98- RcRdNalkylC(O)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocyώle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(0)NRcRd, -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and R , at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SOR , -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(0)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(0)NRfRb; alternatively, Rc and R , together with the nitrogen atom to which they are attached ' form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl,
-99- cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(O)NH2, -C(O)N(H) (alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(O)O(alkyl), -C(O)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2;
R is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0)-, RaS02-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(0)-, RaOC(0)alkyl-, RaC(0)-, RaC(0)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; m is 0, 1, 2, 3, or 4; and n is O, 1, 2, 3, or 4; with the proviso that when A is ring other than
Figure imgf000102_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(0)NRaRb, then R1 is
-100- not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that
Figure imgf000103_0001
and R4 or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is
Figure imgf000103_0002
hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl ; comprising:
(a) contacting a compound of
Figure imgf000103_0003
(26) with carbon disulfide and a methylating agent in the presence of a base to provide a compound of formula (27)
Figure imgf000103_0004
(27); and
(b) contacting the compound a compound of formula (13)
Figure imgf000103_0005
(13). In a sixtieth embodiment the present invention provides a process for the preparation of a compound having formula (I),
-101-
Figure imgf000104_0001
v (I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein: A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- and Rk0-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independent! y_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)R0, -S(0)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(0)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(0)-, -SRa, -S(0)Ra, -S(0)2Ra and RaC(0)-;
9 ^ wherein R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(0)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(O)NRaRb; alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (Rδ)m;
R is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH,
-102- -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(0)S-,
Ra(0)2S-, RaRbNalkyl-, Ra(0)SN(Rf)-, RaSO2N(Rf)-, Ra(0)SN(Rf)alkyl-, RaS02N(Rf)alkyl-, RaRbNS02N(Rf)-, RaRbNS02N(Rf)alkyl-, RaRbNC(0)-: RkOC(0)-, RkOC(0)alkyl-, RkOalkyfe, RaRbNSO2-, RaRbNS02alkyl-, (RbO)(Ra)P(O)0- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(0)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(O)ORa and -C(0)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcSO2-, RcS02alkyl-, R0C(O)-, RcC(O)alkyl-, RcOC(0)-, R0OC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(0)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(0)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)OR0 and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, ' oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl) (NRcRd), -alkylS02NRcRd,
-103- -alkylC(0)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -0Rf, -CO(Rf), -SRf, -SORf, -S02Rf, -C(0)NRfRh, -S02NRfRh, -C(0)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(O)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)S02NRfRh, and -alkylN(Re)C(O)NRfRh; alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2R , -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl; Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, ' -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2) -C(0)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with
-104- 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylS02alkyl, -alkylN(alkyl)2, -N(H)C(0)NH2, -C(0)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(O)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0>, RaS02-, RaSalkyl-, Ra(0)Salkyl-, RaS02alkyl-, RaOC(0)-, RaOC(0)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxp, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(0)NRcRd; m is O, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; with the proviso that when A is ring other than
Figure imgf000107_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(0)2S-, RaS02N(Rf)-, RaRbNC(0)-, RkOC(0)-, RaRbNS02- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, • -SRa, -S(O)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl,. arylalkenyl, arylalkyl, cycloalkyl,
(cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that when A is
Figure imgf000107_0002
and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyaiio, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(0)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(0)ORa and -C(0)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl,
-105- (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; comprising:
(a) contacting a compound of
Figure imgf000108_0001
with tris(methylthio)methyl methyl sulfate in the presence of a base to provide a compound of formula (27)
Figure imgf000108_0002
(27); and
(b) contacting the compound of formula (27) with a compound of formula (13)
Figure imgf000108_0003
(13). In a sixty-first embodiment, the present invention provides a compound having formula (IX)
Figure imgf000108_0004
or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl,
-106- hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(0)N calkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(0)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(0)-, -SRa, -S(0)Ra, -S(0)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(O)ORa and -C(O)NRaRb; alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(0)2Ra, -ORk, -N(Ra)(Rb), -C(0)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -S02Ra, -C(0)ORa, -C(0)NRaRb and -NC(0)Ra; Ra and Rb, at each occurrence, are independently selected from the group consistin of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(0)alkyl-, RcS02-, RcS02alkyl-, RcC(0)-, RcC(0)alkyl-\ RcOC(0)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(0)Oalkyl-, RcRdNC(0)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and
-107- heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylS02NRcRd, -alkylC(0)NRcRd, -SRC, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NR Rh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -S02NRfRh, -C(0)0Rf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)R , -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf, -C(0)NRfRh, -C(0)N(H)NRfRh, -N(Re)C(0)ORf, -N(Re)S02NRfRh, -N(Re)C(0)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(0)NRfRh; alternatively, R0 and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(0)Rf, -S(0)2Rf, -ORf, -N(Rf)(Rh), -C(0)Rf, -C(0)ORf and -C(0)NRfRh; , Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -S02alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(0)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(0)0(alkyl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(O)N(alkyl)2; alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl,
-108- cycloalkenyl and heterocycle; alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl) -S(0)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(0)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(0)OH, -C(0)0(alkVl), -C(0)alkyl, -C(0)NH2, -C(0)NH2, -C(0)N(H)(alkyl), and -C(0)N(alkyl)2; '
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(0)-, RaRbNC(0)alkyl, RaS-, RaS(0)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(0)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(0)ORc and -C(0)NRcRd; m is 0, 1, 2, 3, or 4; and
R and R are independently selected from the group consisting of alkyl, alkenyl and alkynyl.
Exemplary compounds of the sixty-first embodiment of the present invention of formula (IX), or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, include, but not limited to, the following: l-benzyl-3-(bis(methylthio)methylene)-lH-quinoline-2,4(lH,3H)-dione;
3 - [bis(methylthio)methylene] - 1 -butyl- 1 , 8 -naphthyridine-2 ,4( lH,3H)-dione ;
3-[bis(methylthio)methylene]-l-(l,3-dioxo-l,3-dihydro-2H-isoindol-2-yl)quinoline- 2,4(lH,3H)-dione; 3-[bis(methylthio)methylene]-l-[(cyclopropylmethyl)amino]quinoline-2,4(lH,3Η)- dione;
3-[bis(methylthio)methylene]-l-(3-methylbutyl)pyridine-2,4(lH,3H)-dione; l-benzyl-3-[bis(methylthio)methylene]pyridine-2,4(lH,3H)-dione;
3-[bis(methylthio)methylene]-l-(cyclobutylamino)quinoline-2,4(lH,3H)-dione; and 3-[bis(methylthio)methylene]-l-(cyclobutylmethyl)pyridine-2,4(lH,3H)- dione.
The compounds of the invention can comprise asymmetrically substituted carbon
-109- atoms. As a result, all stereoisomers of the compounds of the invention are meant to be included in the invention, including racemic mixtures, mixtures of diastereomers, mixtures of enantiomers, as well as individual optical isomers, including, enantiomers and single diastereomers of the compounds of the invention substantially free from their enantiomers or other diastereomers. By "substantially free" is meant greater than about 80% free of other enantiomers or diastereomers of the compound, more preferably greater than about 90% free of other enantiomers or diastereomers of the compound, even more preferably greater than about 95% free of other enantiomers or diastereomers of the compound, even more highly preferably greater than about 98% free of other enantiomers or diastereomers of the compound and most preferably greater than about 99% free of other enantiomers or diastereomers of the compound.
In addition, compounds comprising the possible geometric isomers of carbon-carbon double bonds and carbon-nitrogen double are also meant to be included in this invention.
Individual stereoisomers of the compounds of this invention can be prepared by any one of a number of methods which are within the knowledge of one of ordinary skill in the art. These methods include stereospecific synthesis, chromatographic separation of diastereomers, chromatographic resolution of enantiomers, conversion of enantiomers in an enantiomeric mixture to diastereomers and then chromatographically separating the diastereomers and regeneration of the individual enantiomers, enzymatic resolution and the like.
Stereospecific synthesis involves the use of appropriate chiral starting materials and synthetic reactions which do not cause racemization or inversion of stereochemistry at the chiral centers.
Diastereomeric mixtures of compounds resulting from a synthetic reaction can often be separated by chromatographic techniques which are well-known to those of ordinary skill in the art.
Chromatographic resolution of enantiomers can be accomplished on chiral chromatography resins. Chromatography columns containing chiral resins are commercially available. In practice, the racemate is placed in solution and loaded onto the column containing the chiral stationary phase. The enantiomers are then separated by HPLC.
Resolution of enantiomers can also be accomplished by converting the enantiomers in the mixture to diastereomers by reaction with chiral auxiliaries. The resulting diastereomers can then be separated by column chromatography. This technique is especially useful when the compounds to be separated contain a carboxyl, amino or hydroxyl group that will form a salt or covalent bond with the chiral auxiliary. Chirally pure amino acids, organic carboxylic acids or organosulfonic acids are especially useful as chiral auxiliaries. Once the diastereomers have been separated by chromatography, the individual enantiomers can be
-110- regenerated. Frequently, the chiral auxiliary can be recovered and used again.
Enzymes, such as esterases, phosphatases and lipases, can be useful for resolution of derivatives of the enantiomers in an enantiomeric mixture. For example, an ester derivative of a carboxyl group in the compounds to be separated can be prepared. Certain enzymes will selectively hydrolyze only one of the enantiomers in the mixture. Then the resulting enantiomerically pure acid can be separated from the unhydrolyzed ester.
The present compounds may exhibit the phenomena of tautomerism or structural isomerisrh. As the drawings within this specification can only represent one possible tautomeric or structural isomeric form, it should be understood that the invention encompasses any tautomeric or structural isomeric form; or mixtures thereof, which possess the ability to inhibit hepatitis C, and is not limited to any one tautomeric or structural isomeric form utilized within the drawings.
In addition, solvates and hydrates of the compounds of the invention are meant to be included in this invention. When any variable (for example R1, R2, R3, m, n, etc.) occurs more than one time in any substituent or in the compound of the invention or any other formula herein, its definition on each occurrence is independent of its definition at every other occurrence. In addition, combinations of substituents are permissible only if such combinations result in stable compounds. Stable compounds are compounds which can be isolated in a useful degree of purity from a reaction mixture.
The compounds of the present invention can exist as pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt," as used herein, represents acid or base salts or zwitterionic forms of the compounds of the present invention which are water or oil- soluble or dispersible, which are suitable for treatment of diseases without undue toxicity, irritation, and allergic response; which are commensurate with a reasonable benefit/risk ratio, and which are effective for their intended use. The salts can be prepared during the final isolation and purification of the compounds or separately by reacting a basic group (for example, a nitrogen containing group) with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethansulfonate, lactate, maleate, mesitylenesulfonate, methanesulfonate, naphthylenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, picrate, pivalate, propionate, succinate, tartrate, trichloroacetate,trifluoroacetate, phosphate, glutamate, bicarbonate, para-toluenesulfonate, and undecanoate. Also, amino groups in the compounds of the present invention can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dimethyl,
-111- diethyl, dibutyl, and diamyl sulfates; decyl, lauryl, myristyl, and steryl chlorides, bromides, and iodides; and benzyl and phenethyl bromides. Examples of acids which can be employed to form pharmaceutically acceptable addition salts include inorganic acids such as hydrochloric, hydrobromic, sulfuric, and phosphoric, and organic acids such as oxalic, maleic, succinic, and citric.
Basic addition salts can be prepared during the final isolation and purification of the compounds by reacting an acidic group (for example, a carboxy group or an enol) with a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation or with ammonia or an organic primary, secondary, or tertiary amine. The cations of pharmaceutically acceptable salts include lithium, sodium, potassium, calcium, magnesium, and aluminum, as well as nontoxic quaternary amine cations such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N- methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N- dibenzylphenethylamine, 1-ephenamine, and N,N'-dibenzylethylenediamine. Other ' representative organic amines useful for the formation of basic addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, and piperazine.
Preferred salts of the compounds of the present invention include monosodium, disodium, triethylamine salt, trifluoroacetate and hydrochloride. The present compounds can also exist as pharmaceutically acceptable prodrugs. The term "pharmaceutically acceptable prodrug," refers to those prodrugs or zwitterions which are suitable for use in contact with the tissues of patients without undue toxicity, irritation, and allergic response, are commensurate with a reasonable benefit/risk ratio, and are effective for their intended use. "Prodrugs" are considered to be any covalently bonded carriers which release the active parent drug of formula (I), (II), (III), (IV), (V), (Va), (Vb), (Via), (VIb), ': (VII) or (VIII) in vivo when such prodrugs is administered to a mammalian subject. Prodrugs of the compounds of formula (I), (H), (HI), (IV), (V), (Va), (Vb), (Via), (VIb), (VII) or (VIII) are prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compounds respectively. Prodrugs include compounds wherein hydroxy, amine, carboxy, or sulfhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxyl, amino, carboxy, or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of the hydroxy, carboxy and amine functional groups in the compounds of formula (I), (II), (HI), (IV), (V), (Va), (Vb), (Via), (VIb), (VH) and (VHI); and the like.
In accordance with methods of treatment and pharmaceutical compositions of the invention, the compounds can be administered alone or in combination with other antiviral
-112- agents. When using the compounds, the specific pharmaceutically effective dose level for any particular patient will depend upon factors such as the disorder being treated and the severity of the disorder; the activity of the particular compound used; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration; the route of administration; the rate of excretion of the compound employed; the duration of treatment; and drugs used in combination with or coincidently with the compound used. The compounds can be administered orally, parenterally, osmotically (nasal spipays), rectally, vaginally, or topically in unit dosage formulations containing carriers, adjuvants, diluents, vehicles, or combinations thereof. The term "parenteral" includes infusion as well as subcutaneous, intravenous, intramuscular, and intrasternal injection.
Parenterally administered aqueous or oleaginous suspensions of the compounds can be formulated with dispersing, wetting, or suspending agents. The injectable preparation can also be an injectable solution or suspension in a diluent or solvent. Among the acceptable diluents or solvents employed are water, saline, Ringer's solution, buffers, monoglycerides, diglycerides, fatty acids such as oleic acid, and fixed oils such as monoglycerides or diglycerides.
The antiviral effect of parenterally administered compounds can be prolonged by slowing their absorption. One way to slow the absorption of a particular compound is administering injectable depot forms comprising suspensions of crystalline, amorphous, or otherwise water-insoluble forms of the compound. The rate of absorption of the compound is dependent on its rate of dissolution which is, in turn, dependent on its physical state. Another way to slow absorption of a particular compound is administering injectable depot forms comprising the compound as an oleaginous solution or suspension. Yet another way to slow absorption of a particular compound is administering injectable depot forms comprising microcapsule matrices of the compound trapped within liposomes, microemulsions, or biodegradable polymers such as polylactide-polyglycolide, polyorthoesters or polyanhydrides. Depending on the ratio of drug to polymer and the composition of the polymer, the rate of drug release can be controlled.
Transdermal patches can also provide controlled delivery of the compounds. The rate of absorption can be slowed by using rate controlling membranes or by trapping the compound within a polymer matrix or gel. Conversely, absorption enhancers can be used to increase absorption.
Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound can optionally comprise diluents such as sucrose, lactose, starch, talc, silicic acid, aluminum hydroxide, calcium silicates, polyamide powder, tableting lubricants, and tableting aids such as magnesium stearate or microcrystalline cellulose. Capsules, tablets and pills can also comprise buffering
-113- agents, and tablets and pills can be prepared with enteric coatings or other release-controlling coatings. Powders and sprays can also contain excipients such as talc, silicic acid, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures thereof. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons or substitutes therefore. Liquid dosage forms for oral administration include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs comprising inert diluents such as water. These compositions can also comprise adjuvants such as wetting, emulsifying, suspending, sweetening, flavoring, and perfuming agents.
Topical dosage forms include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and transdermal patches. The compound is mixed under sterile conditions with a carrier and any needed preservatives or buffers. These dosage forms can also include excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof. Suppositories for rectal or vaginal administration can be prepared by mixing the compounds with a suitable non-irritating excipient such as cocoa butter or polyethylene glycol, each of which is solid at ordinary temperature but fluid in the rectum or vagina. Ophthalmic formulations comprising eye drops, eye ointments, powders, and solutions are also contemplated as being within the scope of this invention.
The compounds of the invention inhibit HCV RNA dependent RNA polymerase an enzyme essential for HCV viral replication. They can be administered as the sole active pharmaceutical agent, or they can also be used in combination with one or more agents to treat hepatitis C infections or the symptoms associated with HCV infection. Other agents to be administered in combination with a compound of the present invention include therapies for disease caused by HCV infection that suppresses HCV viral replication by direct or ^ indirect mechanisms. These include agents such as host immune modulators, for example, interferon-alpha, pegylated interferon-alpha, CpG oligonucleotides and the like, or antiviral compounds that inhibit host cellular functions such as inosine monophosphate dehydrogenase, for example, ribavirin and the like. Also included are cytokines that modulate immune function. Also included are vaccines comprising HCV antigens or antigen adjuvant combinations directed against HCV. Also included are agents that interact with host cellular components to block viral protein synthesis by inhibiting the internal ribosome entry site (IRES) initiated translation step of HCV viral replication or to block viral particle maturation and release with agents targeted toward the viroporin family of membrane proteins such as, for example, HCV P7 and the like. Other agents to be administered in combination with a compound of the present mvention include any agent or combination of agents that inhibit the replication of HCV by targeting proteins of the viral genome involved in the viral replication. These agents include but are not limited to other inhibitors of HCV
-114- RNA dependent RNA polymerase such as, for example, nucleoside type polymerase inhibitors described in WO0190121(A2), or US6348587Bl or O0160315 or WO0132153 or non-nucleoside inhibitors such as, for example, benzimidazole polymerase inhibitors described in EP1162196A1 or WO0204425 or inhibitors of HCV protease such as, for example, peptidomimetic type inhibitors such as BILN2061 and the like or inhibitors of HCV helicase.
Other agents to be administered in combination with a compound of the present
Figure imgf000117_0001
or combination of agents that inhibit the replication of other viruses for co-infected individuals. These agent include but are not limited to therapies for disease caused by hepatitis B (HBV) infection such as, for example, adefovir, lamivudine, LdT (L-deoxythymidine) and tenofovir or therapies for disease caused by human immunodeficiency virus (HIV) infection such as, for example, protease inhibitors: ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir; reverse transcriptase inhibitors: zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125; integrase inhibitors: L-870812, S-1360, or entry inhibitors: enfuvirtide (T-20), T-1249. Other agents to be administered in combination with a compound of the present invention include any agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver. When administered as a combination, the therapeutic agents can be formulated as separate compositions which are given at the same time or within a predetermined period of time, or the therapeutic agents can be given as a single unit dosage form.
The total daily dose of the compounds administered to a host in single or divided doses can be in amounts from about 0.1 to about 200 mg kg body weight or preferably from about 0.25 to about 100 mg/kg body weight. Single dose compositions can contain these amounts or submultiples thereof to make up the daily dose. Determination of Biological Activity
HCV polymerase inhibition assay: biochemical ICsn: Either two-fold serial dilutions (fractional inhibition assay) or a narrower range of dilutions spanning the IC50 of the inhibitor (tight binding assay) of the inhibitors were incubated with 20 mM Tris-Cl pH 7.5, 5 mM MgCl2, 50 mM NaCI, 1 mM dithiothreitol, 1 mM ethylene diamine tetraacetic acid (EDTA), 300 μM GTP and 150 to 300 nM NS5B (HCV Strain IB (J4, Genbank accession number AF054247, or H77, Genbank accession number AF011751)) for 15 minutes at room temperature. The reaction was initiated by the addition of 20 μM CTP, 20 μM ATP, 1 μM 3H-UTP (10 mCi/umol), 150 nM template RNA and 0.4 U/μl RNase inhibitor (RNasin, Promega), and allowed to proceed for 2 to 4 hours at room temperature. Reaction volume was 50 μl. The reaction was terminated by the addition
-115- of 1 volume of 4 mM spermine in 10 mM Tris-Cl pH 8.0, 1 mM EDTA. After incubation for at least 15 minutes at room temperature, the precipitated RNA was captured by filtering through a GF/B filter (Millipore) in a 96 well format. The filter plate was washed three times with 200 μl each of 2 mM spermine, 10 mM Tris-Cl pH 8.0, 1 mM EDTA, and 2 times with ethanol. After air drying, 30 μl of Microscint 20 scintillation cocktail (Packard) was added to each well, and the retained cpm were determined by scintillation counting. IC50 values were calculated by a two-variable nonlinear regression equation using an uninhibited control and a fully inhabited control sample to determine the minimum and maximum for the curve. Tight- binding assays were performed on those compounds exhibiting IC50 values less than 0.15 μM in the fractional inhibition assay in order to more precisely measure the IC50 values. Retained cpm were plotted vs. inhibitor concentration and fit to equation 1 using non-linear regression (ref. 1) to obtain the IC50 values.
Retained cpm = A[sqrt{ (IC50 + It - Et)2 + 4IC50Et} - (IC50 + It - Et)] eqn 1. where A = Vmax [S]/2(Km + [S]); It = total inhibitor concentration and Et= total active concentration of enzyme.
Ref. 1: Morrison, J. F. and S. R. Stone. 1985. Approaches to the study and analysis of the inhibition of enzymes by slow- and tight-binding inhibitors. Comments Mol. Cell. Biophys. 2: 347-368.
The sequence of the template RNA used was: 5'GGGCGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUGAUGG AUAUCUGCAGAAUUCGCCCUUGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAG CUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCU CUGCAGAUCAAGUC-3'
When tested by the above method, the compounds of the present invention inhibit HCV polymerase IB with IC50's in the range of 0.002 μM to 500 μM.
Evaluation of the HCV inhibitors in HCV replicon: cell culture ECsn The cell lines and assays were conducted according to the methods described by Ikeda M, Yi M, Li K, Lemon SM., J Virol 2002 Mar;76(6):2997-3006, and Blight K. J, Kolykhalov A., Rice C. M„ Science 2000 Dec, 290:1972-1974) with the following modifications: RNA assay
Replicon cells were plated at 3xl03 cells per well in 96-well plate in DMEM medium containing 5% fetal calf serum. At day 1, culture medium was removed and replaced with fresh medium containing eight serial 2-fold dilutions of compound. The final concentration of DMSO in medium was 0.5%. The untreated control culture was treated in an identical manner except no inhibitor was added to the medium. Plates were incubated in a CO2 incubator at 37°C. On Day 4, 100 μl lysis buffer (RTL) (Qiagen) was added to each well
-116- after removal of culture medium. RNA was purified according to manufacturer's recommendations (Qiagen RNAeasy) and eluted in 200 μl of water. The HCV RNA level was quantified from a portion (5 μl out of 200 μl) of the purified RNA by real-time RT-PCR method. The primers and probe are derived from specific sequence in the 5 'UTR region. RT-PCR reaction was performed at 48°C for 30 min, followed by 40 cycles set to 95°C, 15 s; 54°C, 30 s; and 72°C, 40 s. The percentage reduction of HCV RNA in the presence of compound was calculated and the 50% inhibitory concentration (IC50) was calculated by nonlinear regression analysis using the Prism program.
When tested by the above method, the compounds of the present invention inhibit replicon production with EC50's in the range of 0.002 μM to >100 μM.
Cvtotoxitv assays Cytotoxicity assays were performed in replicon cells. Briefly, HCV replicon cells were plated at SxlO" cells per well in 96-well plate in DMEM medium containing 5% FCS. At day 1, culture medium was removed and replaced with fresh medium containing eight serial 2-fold dilutions of compound. The final concentration of DMSO in medium was 0.5%. All experiments were performed in duplicate. The untreated control culture was treated in an identical manner except no inhibitor was added to the medium. Plates were incubated in a CO2 incubator at 37°C. On day 4, stock solution of the tetrazolium salt, MTT (4 mg ml in
PBS, Sigma cat.# M 2128) was added to each well at 25 μl per well. Plates were further incubated for 4 hours, treated with 20% SDS plus 0.02 N HCl at 50 μl per well to lyse the cells. After an overnight incubation, optical density was measured by reading the plates at 570/650 nm wavelengths. The percent reduction of formazan blue color formed relative to control was calculated and the cytopathic effect was described as a 50% toxicity concentration (TC50) was calculated by non-linear regression analysis using the Prism program.
When tested by the above method, the compounds of the present invention exhibited CPE reduction with TC50's in the range of 6.6 μM to >100 μM.
Cell culture assays for agents targeted toward hepatitis C are not yet available because of the inability to produce infectious virus in a sustained cell line. The hepatitis C virus genome encodes a large polyprotein, which after processing produces the necessary functional components to synthesize progeny RNA. Selectable cell lines that produce high and sustained levels of subgenomic HCV RNA (replicons) have been derived from human hepatoma cells (Huh7) as described in the references above. The mechanism of RNA ' replication in these cell lines is considered to be identical to the replication of full length HCV RNA in infected hepatocytes. The compounds and methods of this invention are inhibitors of HCV RNA replication in the replicon assay systems described above. This forms the basis of the claim for their potential as therapies in treating disease resulting from
-117- hepatitis C viral infection.
Synthetic Methods
Abbreviations which have been used in the descriptions of the scheme and the examples that follow are: DMF is N,N-dimethylformamide, DMSO is dimethylsulfoxide, and THF is tetrahydrofuran.
The compounds and processes of the present invention will be better understood in connection with the following synthetic schemes which illustrate the methods by which the compounds of the invention may be prepared. Starting materials can be obtained from commerciaf sources or prepared by well-established literature methods known to those of ordinary skill in the art. The groups A, R1, R2, R3, R4, R5, and n are as defined above unless - otherwise noted below.
This invention is intended to encompass compounds having formula (I) when prepared by synthetic processes or by metabolic processes. Preparation of the compounds of the invention by metabolic processes include those occurring in the human or animal body (in vivo) or processes occurring in vitro.
Figure imgf000120_0001
As shown in Scheme 1, compounds of formula (2) can be reacted with compounds of formula (3) in the presence of phosphorous oxychloride under heating conditions to provide compounds of formula (4). Compounds of formula (4) can be reacted with a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, and the like in solvent such as but not limited to dimethylacetamide, dimethylformamide, THF, and the like, followed by the addition of R'-X, (wherein R1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, haloalkoxyalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbNalkyl-, RaRbNC(0)alkyl-, RaRbNC(0)Oalkyl- or RaRbNC(O)NRcalkyl-, and wherein X is Br, Cl, I, CF3S(0)2-, CH3S(0)2-, or tosyl) to provide compounds of formula (5).
-118- Scheme 2
Figure imgf000121_0001
(6) (7) (8) (5)
Alternatively, compounds of formula (6) can be treated with compounds of formula (7) (wherei R1 is alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(0)NRcalkyl-, RfRgC=N- or RkO-), under heating conditions optionally in the presence of a base such as potassium carbonate and a catalyst such as copper bromide, to provide compounds of formula (8). Compounds of formula (8) can be treated with reagents including but not limited to phosgene, diphosgene, triphosgene in solvents such as but not limited to 1,2-dichloroethane, carbon tetrachloride, 1,4-dioxane or mixtures thereof, under heating conditions to provide compounds of formula (5).
Figure imgf000121_0002
In addition, compounds of formula (9) can also be reacted with reagents including but not limited to phosgene, diphosgene, triphosgene, carbon yldiimidazole, ethyl chloroformate and the like in the presence of a base such as potassium hydroxide, pyridine, lithium hydroxide, and the like in solvents such as but not limited to water, toluene, benzene, and the like under heating conditions to provide compounds of formula (5).
Scheme 4
-119-
Figure imgf000122_0001
Compounds of formula (5) can be treated with compounds of formula (10) in the presence of a base such as sodium hydride, potassium hydride, lithium hexamethyldisilazide, and the like in a solvent such as but not limited to THF, diethyl ether, methyl tert-butyl ether followed by the treatment with an acid such as acetic acid, dichloroacetic acid or sulfuric acid to provide compounds of formula (11) which are representative of a compound of formula (I), where R4 is hydroxy.
Figure imgf000122_0002
Compounds of formula (5) can be reacted with diethyl malonate that has been pretreated with a base such as sodium hydride, potassium hydride, and the like in solvents such as dimethylacetamide, dimethylformamide, THF, and the like under heated conditions to provide compounds of formula (12). Compounds of formula (12) can be treated with compounds of formula (13) in solvents such as toluene, mesitylene, benzene, and the like under heated conditions to provides compounds of formula (14). Compounds of formula (14) can be treated with a base such as sodium hydroxide, potassium hydroxide, lithium
-120- hydroxide, and the like in water under heated conditions to provide compounds of formula (11).
Figure imgf000123_0001
Alternatively, compounds of formula (8) can be treated with ethyl chloromalonate in the presence of a base such as triethylamine, diisopropylethylamine, pyridine, and the like in solvents such as dichloromethane, chloroform, carbon tetrachloride to provide compounds of formula (15). Alternatively, compounds of the formula (8) can be treated with ethyl chloromalonate in solvents such as benzene, toluene under heating conditions to provide compounds of formula (15). Compounds of formula (15) can be treated with sodium ethoxide in ethanol to provide compounds of formula (12).
Scheme 7
Figure imgf000123_0002
Scheme 7 shows the preparation of compounds of formula (I)) where R4 is halo. Compounds of formula (11) can be treated with reagents known to those skilled in the art which are commonly used to convert alcohols to chlorides. For example, compounds of formula (11) can be treated with reagents including but not limited to PCI5, PC13, POCl3, or thionyl chloride, with or without solvents such as but not limited to dichloromethane, chloroform and benzene, to provide compounds of formula (I) which are representative of compounds where R4 is chlorine. Similar transformations are possible using PBr3 or DAST to convert the said alcohol to the corresponding compound of formula (I) where R4 is bromide and fluoride, respectively. Alternatively, compound of formula (I) wherein R4 is iodo can be prepared by (a), reacting compound of formula (11) with a mesylating reagent
-121- such as methanesulfonyl chloride or methanesulfonyl anhydride in the presence of an amine base such as triethylamine, pyridine or diisopropylethylamine in solvents such as but not limited to dichloromethane, acetonitrile, carbon tetrachloride, chloroform, and (b) treatment of the mesylate thus formed with N-iodosuccinimide.
Figure imgf000124_0001
As shown in Scheme 8, compounds of formula (16) can be converted to compounds of formula (17) which are representative of compounds of formula (I) where R4 is RaRbN-, by freatment with an amine having the formula RaRbNH, (where Ra and Rb are as defined herein) in a polar solvent such as methanol, ethanol, and the like, under heating conditions to provide compounds of formula (17).
Figure imgf000124_0002
Compounds of formula (18) (which are representative of compounds of formula (I) where R1 is 0-Si(isopropyl)3 or some other easily removed ether protecting group) can be treated with a fluoride containing reagent to provide compounds of formula (19). The hydroxyl amine portion of compounds of formula (19) can be treated with a base such as sodium hydride in solvents such as dimethylformamide, or lithium hexamethyldisilazide in solvents such as but not limited to THF, dioxane and the like, followed by the addition of R - X (wherein R is alkoxyalkyl, alkoxycarbonyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfonylalkyl, aryl, arylalkyl, arylsulfanylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RcRdNalkyl- or RcRdNC(0)alkyl, and wherein X
-122- is Br, Cl, I, CF3S(0)2-, CH3S(0)2-, or tosyl) to provide compounds of formula (20) which are representative of compounds of formula (I) where R is defined as RkO-.
Figure imgf000125_0001
Compounds of formula (21) can be treated with aqueous base such as but not limited to potassium hydroxide, sodium hydroxide and the like, to provide compounds of formula (22). Compounds of formula (22) can be treated with a metal hydride base such as sodium hydride, an organolithium reagent (e.g. t-BuLi, n-BuLi, or s-BuLi), or lithium hexamethyldisilazide in an appropriate solvent or a mixture of solvents selected from THF, DMSO, DMF, dioxane, ether, dichloromethane, and the like, followed by the addition of RaX wherein X is Br, Cl, I, CF3S(O)2-, CH3S(0)2-, or tosyl to provide compounds of formula (23) which are representative of compounds of formula (I) wherein R1 is -NHRa.
Scheme 11
Figure imgf000125_0002
Alternatively, compounds of formula (22) can be treated with aldehydes or ketones of structure RfRgC(0) without solvents or with solvents such as but not limited to dimethylacetamide, tetrahydrofuran, dioxane and the like under heated conditions to provide compounds of formula (24). Reduction of compounds of formula (24) with hydrogen and a catalyst such as palladium and the like or a metal hydrides such as lithium borohydride, sodium cyanoborohydride and the like provide compounds of the formula (25).
Scheme 12
-123-
Figure imgf000126_0001
(12) (26) (27)
Figure imgf000126_0002
(11) (28)
Compounds of formula (12) can be reacted with aqueous base solutions such as potassium hydroxide and the like under heated conditions to provide compounds of formula (26). Compounds of formula (26) can be reacted with a base in a solvent, or mixtures of solvents such as, but not limited to, N,N-dimethylformamide, tetrahydrofuran, diethyl ether, or methyl tert-butyl ether, and the like, followed by treatment with carbon disulfide at a temperature of about room temperature to about 70°C. Examples of the base include, but not limited to, sodium hydride, potassium hydride, lithium diisopropylamide, sodium hexamethyldisilazide and lithium hexamethyldisilazide. Subsequent treatment with a methylafing reagent at a temperature of about 25°C provides compounds of formula (27). Examples of the methylating agent include, but not limited to, methyl iodide, methyl triflate, dimethylsulfate, and the like.
Alternatively, compounds of the formula (26) can be reacted with tris(methylthio)methyl methyl sulfate in the presence of a base in a solvent such as 1,4- dioxane or dimethylacetamide, and the like, at a temperature of about 25°C to about 150°C to give compounds of formula (27). Examples of the base include, but are not limited to, organic amine bases such as imidazole, 1-methylimidazole, 2-methylimidazole, 2- isopropylimidazole, 4-methylimidazole, 4-nitroimidazole, pyridine, N,N- dimethylaminopyridine, 1,2,4-triazole, pyrrole, 3-methylpyrrole, triethylamine, diisopropylethylamine or N-methylmorpholine and the like.
Compounds of formula (27) can be treated with compounds such as (13) in a solvent or a mixture of solvents, such as but not limited to, toluene, benzene, dioxane or tetrahydrofuran, and the like, at a temperature of about 50°C to about 150°C to provide compounds of formula (11).
-124-
Figure imgf000127_0001
(29) (30)
Figure imgf000127_0002
(32) (13)
(31)
Compounds of the formula (29) wherein X is I, Br, Cl or F can be treated with alkyl thiols such as benzene methylthiol in the presence of a base such as sodium carbonate in solvents such as ethanol and the like under heated conditions to give compounds of the formula (30). Treatment of (30) with chlorine gas in hydrochloric acid or acetic acid provides compounds of the formula (31). Compounds of the formula (31) in solvents such as but not limited to dichloromethane, tetrahydrofuran or dioxane can be treated with ammonia or ammonium hydroxide to give compounds of the formula (32). Reduction of compounds of the formula (32) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heated conditions optionally with iron powder in acetic acid under heated conditions to provide compounds of the formula (13).
Figure imgf000127_0003
Compounds of the formula (33) can be treated with ammonium nitrate in the presence of a sulfuric acid as solvent under cooling conditions to give compounds of the formula (34). Reduction of compounds of the formula (34) with iron powder and ammonium chloride in
-125- aqueous alcoholic solvents such as methanol or ethanol under heated conditions provides compounds of the formula (35). Alternatively, the reduction can also be achieved by treating compounds of formula (35) with iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heated conditions. Treatment of compounds of the formula (35) with an orthoester of the formula (36) under heating conditions to provide compounds of the formula (37).
Figure imgf000128_0001
Compounds of the formula (35) can be treated with cyanogen bromide under heating conditions to give compounds of the formula (38). Treatment of compounds of the formula (38) with R8X wherein X is Br, Cl, or I, R8CO2Cl, or R8SO2Cl in the presence of an amine base such as triethylamine, pyridine, or an inorganic base such as cesium carbonate or : potassium carbonate in an appropriate solvent or a mixture of solvents selected from dimethylacetamide, N,N-dimethylformamide, methanol, dichloromethane, tetrahydrofuran', or acetonitrile and the like to provide compounds of the formula (39).
Scheme 16
-126-
Figure imgf000129_0001
Compounds of formula (40) can be nitrated with ammonium nitrate or potassium nitrate in the presence of an acid such as sulfuric acid, or trifluoroacetic acid in trifluoroacetic anhydride, with or without additional solvent, under cooling conditions to give compounds of the formula (41). Reduction of compounds of the formula (41) with iron powder and ammonium chloride in aqueous alcoholic solvents such as methanol or ethanol under heated conditions provides compounds of the formula (42). Alternatively, the reduction of compounds of formula (42) can also be accomplished using iron powder in acids such as but not limited to acetic acid or dilute hydrochloric acid under heated conditions. Compounds of the formula (42) can be converted to compounds of the formula (44) by (a) nitration and (b) reduction of the product of step (b), using the respective conditions as mentioned above. Compounds of the formula (44) can be treated with an orthoester of the formula (36) under heating conditions to provide compounds of the formula (45).
Scheme 17
Figure imgf000129_0002
Compounds of formula (42) can be sulfonylated with a sulfonyl chloride of formula RaS02Cl in the presence of a base such as pyridine alone or an amine base such as triethylamine, diisopropylethylamine, and the like in a solvent or combination of solvents
-127- such as dichloromethane, tetrahydrofuran, or dioxane, to provide compounds of formula (46). Alternatively, compounds of formula (42) can be sulfamoylated in the presence of an amine base such as but not limited to triethylamine, or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane, and the like, with compounds of formula (49) to give compounds of formula (47). Compounds of formula (49) can be obtained by treating chlorosulfonyl isocyanate and 2-chloroethanol in conditions that are well known in the art. Compounds of formula (47) can be treated further with an amine having the formula RaRbNH, (where Ra and Rb are as defined herein) in a solvent or combination of solvents such as dichloromethane, THF, or acetonitrile, and the like, under heating conditions to provide compounds of formula (48). Compounds of formula (42) can be sulfamoylated in the presence of an amine base such as triethylamine, or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran or dioxane, and the like, with compounds of formula (54) to give compounds of formula (48). Compounds of formula (54) can be obtained by treating an amine of the formula RaRbNH with sulfuryl chloride or by (a) treating an amine of the formula RaRbNH with chlorosulfonic acid, and (b) contacting the product of step (a) with a chlorinating agent such as phosphorous pentachloride and the like in conditions that are well known in the art.
Similarly, compounds of formula (11) wherein R5 is -alkylNH2 can be converted to compounds of formula (11) wherein R5 is -alkylNHS02NRaRb using the conditions for the transformation of compounds of formula (42) to compounds of formula (48). Compounds of formula (11) wherein R > 5 i •s -alkylNH2 can be converted to compounds of formula (11) wherein R5 is -alkylNHS02Ra can be achieved by employing the conditions for the transformation of compounds of formula (42) to compounds of formula (46).
-128- Scheme 18
Figure imgf000131_0001
Figure imgf000131_0002
Compounds of formula (42) can be sulfamoylated with a sulfamoyl chloride of formula RcOC(0)NHSO2Cl (50), in the presence of an amine base such as pyridine, triethylamine or diisopropylethylamine, and the like, in a solvent or combination of solvents such as dichloromethane, tetrahydrofuran, diethyl ether, benzene, or acetonitrile, and the like, to provide compounds of formula (51). Compounds of formula (50) can be prepared by treating an alcohol of formula RcOH with chlorosulfonyl isocyanate in a solvent or combination of solvents such as dichloromethane, carbon tetrachloride, diethyl ether, benzene, or toluene, and the like. Compounds of formula (51) can be treated further with an alcohol having the formula RaOH in the presence of tri-rc-butylphosphine or triphenylphosphine, and the like, and diisopropylazodicarboxylate, l,l'-(azadicarbonyl)piperidine, or diethylazodicarboxylate, and the like, in a solvent or combination of solvents such as dichloromethane or tetrahydrofuran to provide compounds of formula (52). Alternatively, compounds of formula (52) wherein Ra is methyl can be obtained by methylafing compounds of formula (51) with a methylating agent such as, but not limited to, methyl iodide, dimethyl sulfate, trimethysilyldiazomethane in conditions that are well known in the art. Transformation of compounds of formula (52) to compounds of formula (53) can be achieved by reaction with an acid such as trifluoroacetic acid or hydrochloric acid, or by hydrogenolysis conditions such as palladium on carbon under hydrogen gas.
Similarly, compounds of formula (11) wherein R5 is -alkylNH2 can be converted to compounds of formula (11) wherein R5 is -alkylNHS02NHCOORc by the conditions for the
-129- transformation of compounds of formula (42) to compounds of formula (51).
Compounds of formula (11) wherein R5 is -alkylNH2 can be converted to compounds of formula (11) wherein R5 is -alkylNHS02N(Ra)COORc by the conditions employed for the conversion of (51) to (52). 5 Compounds of formula (11) wherein R5 is -alkylNH2 can be converted to compounds of formula (11) wherein R5 is -alkylNHS02NRaR by the conditions employed for the conversion of (52) to (53).
The present invention will now be described in connection with certain preferred embodiments which are not intended to limit its scope. On the contrary, the present lό invention covers all alternatives, modifications, and equivalents as can be included within the scope of the claims. Thus, the following examples, which include preferred embodiments, will illustrate the preferred practice of the present invention, it being understood that the examples are for the purpose of illustration of certain preferred embodiments and are presented to provide what is believed to be the most useful and readily understood 15 description of its procedures and conceptual aspects.
Compounds of the invention were named by ACD/ChemSketch version 5.0 (developed by Advanced Chemistry Development, Inc., Toronto, ON, Canada) or were given names consistent with ACD nomenclature.
Example 1 20 l-butyl-3-(lJ-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-2(lH)- one Example IA 2H-pyridor2,3-din,31oxazine-2,4(lH)-dione The title compound was prepared from 2,3-pyridinecarboxylic anhydride (11.4 g, 76 25 mmol) and trimethylsilyl azide ( 11.0 mL, 80 mmol) according to the procedure described ih Synthesis, 1982, 972-973 as a white solid (7.27 g, 58%). 1H NMR (300 MHz, DMSO-d6) δ 7.31 (dd, 7=7.72, 4.78 Hz, IH), 8.31 (dd, 7=7.72, 1.84 Hz, IH), 8.66 (dd, 7=4.78, 1.84 Hz, IH), 12.27 (s, IH).
Example IB 30 l-bιιtyl-2H-pyridor2,3-din,31oxazine-2,4(lH)-dione
A suspension of sodium hydride (95%, 0.96 g, 40 mmol) in dimethylacetamide (60 mL) at 10 °C under nitrogen was reacted with the product of Example IA (5.7 g, 34.7 mmol) with stirring for 1 hour then treated with n-butylbromide (5.2 g, 38 mmol) and stirred for an additional 16 hours. The reaction was partitioned between ethyl acetate and water. The 35 organic layer was washed with water and brine, dried over sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by flash column chromatography with silica gel eluting with hexane and ethyl acetate (3:1) to give the title
-130- compound as a white solid, (2.5 g, 33% yield). 1H NMR (300 MHz, DMSO-d6) δ 0.92 (t, 7=7.35 Hz, 3H), 1.36 (m, 2H), 1.65 (m, 2H), 4.13 (m, 2H), 7.38 (dd, 7=7.72, 4.78 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.77 (dd, 7=5.15, 1.84 Hz, IH).
Example IC ethyl (1,1 -dioxido-4H-L2,4-benzothiadiazin-3-yl)acetate The title compound was prepared as a white solid in two steps (46% yield) from 2- aminobeάzenesulfonamide according to the procedure described in Chemistry of Heterocyclic Compounds (English Translation), 1998, 34(7), 791-795. 1H NMR (300 MHz, DMSO-d6) δ 1.21 (t, 7=7.17 Hz, 3H), 4.16 (q, 7=7.23 Hz, 2H), 7.32 (d, 7=7.35 Hz, IH), 7.47 ( , IH), 7.69 (m, IH), 7.82 (dd, 7=7.91, 1.29 Hz, IH), 12.27 (s, IH).
Example ID l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)- one To a solution of the product of Example IB (0.220 g, 1.0 mmol) and the product of
Example IC (0.268 g, 1.0 mmol) in anhydrous THF (10 mL) under nitrogen at 0 °C was added sodium hydride (95%, 0.10 g, 4.0 mmol). The reaction was heated to reflux for 3 hours, cooled to 0 °C, and to it was added dropwise glacial acetic acid (2 mL). The resulting mixture was heated to reflux for 2 hours, cooled to ambient temperature, and diluted with aqueous hydrochloric acid (0.1 M, 10 mL). The resulting precipitate was collected by filtration, washed with water and diethyl ether and dried to give the title compound (0.130 g, 33%). MS (ESI-) m/z 397 (M-H)\
A stirred suspension of the title compound (0.130 g, 0.326 mmol) in acetonitrile and water (1:1, 4 mL) was reacted with aqueous sodium hydroxide (1 M, 0.326 mL, 0.326 mmol), for approximately 30 minutes when a clear solution was observed. The solution was lyophilized to give the sodium salt. !H NMR (300 MHz, DMSO-d6) δ 0.92 (t, 7=7.35 Hz, 3H), 1.35 (m, 2H), 1.58 (m, 2H), 4.28 (t, 7=7.35 Hz, 2H), 7.13 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 2H), 7.55 (m, IH), 7.66 (dd, 7=7.72, 1.47 Hz, IH), 8.37 (dd, 7=7.72, 1.84 Hz, IH), 8.53 (dd, 7=4.60, 2.02 Hz, IH), 15.92 (s, IH). Example 2 l-r(5-chloro-2-thienyl)methvn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-
L8-naphthyridin-2(lH)-one Example 2A l-r(5-chloro-2-thιenyl)methvn-2H-pyridor2,3-diri,31oxazine-2.4(lHVdione The title compound was prepared according to the procedure of Example IB substituting 2-chloro-5-chloromethylthiophene for n-butyl bromide (0.195 g, 52%). !H NMR (300 MHz, DMSO-d6) δ 5.38 (s, 2H), 6.98 (d, 7=4.04 Hz, IH), 7.08 (d, 7=3.68 Hz, IH), 7.43
-131- (dd, 7=7.72, 4.78 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH).
Example 2B l-[(5-chloro-2-thienyl)methyll-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy- l,8-naphthyridin-2(lH)-one 5 The title compound was prepared according to the procedure of Example ID substituting the product of Example 2A for the product of Example IB (0.167 g, 58%). MS (ESI-) m/z 471/473 (M-H)".
The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.53 (s, 2H), 6.89 (d, 7=3.68 Hz, IH), 7.00 lό (d, 7=3.68 Hz, IH), 7.20 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (t, 7=7.72 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.40 (dd, 7=7.72, 1.84 Hz, IH), 8.58 (dd, 7=4.78, 1.84 Hz, IH), 15.73 (s, IH).
Example 3 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-l,8-naτ)hthyridin- 15 2(lH)-one
Example 3A ethyl 2- r(2-ethylbutyl)amino"|nicotinate Ethyl 2-chloronicotinate (0.646 g, 3.48 mmol) and 2-ethylbutylamine (0J4 g, 7.31 mmol) were reacted in a sealed tube at 130 °C for 2 hours. The reaction mixture was 20 partitioned between dichloromethane and water. The aqueous layer was extracted with dichloromethane (2 x 50 mL). The organic layers were combined and dried over magnesium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel eluting with hexane/ethyl acetate (19:1) to provide the title compound (0.665 g, 76%). MS (ESI+) m/z 251.1 (M+H)+; 1H NMR (300 MHz, CDC13) δ 0.93 (t, 7=7.54 Hz, 25 6H), 1.41 (m, 7H), 1.55 (m, IH), 3.46 (m, 2H), 4.32 (q, 7=6.99 Hz, 2H), 6.48 (dd, 7=7.72, : 4J8 Hz, IH), 7.99 (s, IH), 8.11 (dd, 7=7.72, 2.21 Hz, IH), 8.27 (dd, 7=4.78, 1.84 Hz, IH).
Example 3B l-(2-ethylbutyl)-2H-pyridor2.3-dl Tl ,31oxazine-2,4(lH)-dione The product of Example 3A (0.664 g, 2.65 mmol) and diphosgene (1.57 g, 7.96 30 mmol) in 13 mL of 1,2-dichloroethane and 1.3 mL of 1,4 dioxane were reacted at 80 °C for 16 hours. The reaction was concentrated under vacuum and the residue was purified by flash column chromatography on silica gel eluting with hexane/ethyl acetate (9:1) to provide the title compound (0.235 g, 36 %). 1H NMR (300 MHz, CDC13) δ 0.95 (m, 6H), 1.40 (m, 4H), 1.52 (m, 2H), 4.21 (m, IH), 7.25 (m, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.70 (dd, 7=4.78, 35 1.84 Hz, IH).
Example 3C 3-d -dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hvdroxy-l,8-naphthyridin-
-132- 2( HP-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 3B for the product of Example IB (0.041 g, 38 %). MS (ESI+) m z 427.1 (M+H)\ (ESI-) m/z 425.1 (M-H)~; !H NMR (300 MHz, DMSO-de) δ 0.87 5 (t, 7=7.54 Hz, 6H), 1.30 (m, 4H), 1.99 (m, IH), 4.44 (d, 7=7.35 Hz, 2H), 7.49 (dd, 7=7.72, 4J8 Hz, IH), 7.55 (t, 7=7.35 Hz, IH), 7.68 (d, 7=8.09 Hz, IH), 7.77 (t, 7=7.17 Hz, IH), 7.92 (d, 7=8.09 Hz, IH), 8.57 (dd, 7=7.72, 1.84 Hz, IH), 8.86 (d, 7=4.78 Hz, IH). The sodium salt of thi title compound was prepared according to the procedure of Example ID. MS (ESI+) m/z 427.1 (M+H)+, (ESI-) m/z 425.1 (M-H)"; H NMR (300 MHz, DMSO-d6) δ 0.86 lό (t, 7=7.35 Hz, 6H), 1.28 (m, 4H), 1.91 (m, IH), 4.25 (d, 7=7.35 Hz, 2H), 7.12 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 2H), 7.55 (m, IH), 7.67 (dd, 7=8.09, 1.47 Hz, IH), 8.37 (dd, 7=7.72, 1.84 Hz, IH), 8.50 (dd, 7=4.60, 2.02 Hz, IH), 15.97 (s, IH).
Example 4 l-r(5-bromo-2-thienyl)methyl1-3-(l , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 15 L8-naphthyridin-2( lH)-one
Example 4A l-r(5-bromo-2-thienyl)methvn-2H-pyridor2,3-diri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-bromo-5-chloromethylthiophene for n-butyl bromide (0.229 g, 55%). 1H NMR 20 (300 MHz, DMSO-d6) δ 5.40 (s, 2H), 7.06 (m, 2H), 7.43 (dd, 7=7.72, 4.78 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH).
Example 4B l-r(5-bromo-2-thienyl)methyll-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-
1 ,8-naphthyridin-2(lH)-one 25 The title compound was prepared according to the procedure of Example ID substituting the product of Example 4A for the product of Example IB (0.208 g, 60%). MS (ESI-) m/z 515/517 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 5.55 (s, 2H), 6.97 (d, 7=3.68 Hz, IH), 7.00 (d, 7=3.68 Hz, IH), 7.20 (dd, 7=7.73, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 30 (m, IH), 7.68 (d, 7=7.72 Hz, IH), 8.40 (dd, 7=7.72, 2.21 Hz, IH), 8.58 (dd, 7=4.78, 2.20 Hz, IH), 15.73 (s, IH).
Example 5 3-( l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methylbenzyl)-1.8- naphthyridin-2(lH)-one 35 Example 5A l-(3-methvIbenzyl)-2H-pyridor2,3-din,3]oxazine-2,4flH)-dione The title compound was prepared according to the procedure of Example IB
-133- substituting 3-methylbenzyl bromide for n-butyl bromide (0.305 g, 62%). MS (DCI) m/z 269 (M+H)+.
Example 5B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l -(3 -methylbenzyl)- 1 ,8- naphthyridin-2( lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 5 A for the product of Example IB (0.112 g, 72%). MS (ESI-) m z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 2.23 (s, 3H), 5.48 (s, 2H), 7.01 (m, 3H), 7.14 (t, 7=7.35 Hz, 2H), 7.28 (m, 2H), 7.56 (td, 7=7.72, 1.47 Hz, IH), 7.67 (dd, 7=7.72, 1.47 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.84 Hz, IH), 15.86 (s, IH).
Example 6 3-( l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-nitrobenzyl)-l ,8- naphthyridin-2(lH)-one
Example 6A l-(3-nitrobenzyl)-2H-pyridor2,3-dl Tl ,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-nitrobenzyl bromide for n-butyl bromide (0.147 g, 28%). MS (DCI) m/z 300 (M+H)+.
Example 6B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-nitrobenzyl)-1.8- naphth yridin-2 ( 1 H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 6A for the product of Example IB (0.032 g, 42%). MS (ESI-) m/z 476 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dg) δ 5.62 (s, 2H), 7.19 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (td, 7=8.36, 1.29 Hz, 2H), 7.56 (t, 7=8.46 Hz, IH), 7.58 (t, 7=7.72 Hz, IH), 7.67 (d, 7=8.09 Hz, IH), 7.74 (d, 7=8.09 Hz, IH), 8.08 (m, 2H), 8.43 (dd, 7=7.54, 2.02 Hz, IH), 8.50 (dd, 7=4.60, 2.02 Hz, IH), 15.76 (s, IH).
Example 7 3-(l,l-dioxio^4H-l,2,4-benzo1^aά^azin-3-yl)-4-hydroxy-l-(3-thienylmethyI)-l,8- naphthyridin-2(lH)-one Example 7A l-(3-thienylmethyl)-2H-Dyridor2,3-dirL31oxazine-2,4(lH)-dione
The title compound was prepared according to the procedure of Example IB substituting 3-(bromomethyl)thiophene for n-butyl bromide (0.170 g, 52%). Η NMR (300
-134- MHz, DMSO-de) δ 5.32 (s, 2H), 7.15 (m, IH), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 7.48 (m, 2H), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.76 (dd, 7=4.78, 1.84 Hz, IH).
Example 7B 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3 -thienylmethyl)- 1,8- 5 naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 7A for the product of Example IB (0.135 g, 48%). MS (ESI-) m z 437 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dg) δ 5.48 (s, 2H), 7.09 (d, 7=4.04 lό Hz, IH), 7.16 (dd, 7=7.72, 4.78 Hz, IH), 7.27 (m, 3H), 7.38 (dd, 7=4.96, 3.13 Hz, IH), 7.56 (t, 7=7.72 Hz, IH), 7.67 (d, 7=8.09 Hz, IH), 8.39 (dd, 7=7.72, 1.66 Hz, IH), 8.53 (dd, 7=4.78, 1.66 Hz, IH), 15.85 (s, IH).
Example 8 l-(3-chlorobenzyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8- 15 naphthyridin-2( lH)-one
Example 8A l-(3-chlorobenzyl)-2H-pyridor2,3-diri,31oxazme-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-chlorobenzyl bromide for n-butyl bromide (0.405 g, 77%). MS (DCI) m/z 289 20 (M+H)+.
Example 8B l-(3-chlorobenzyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID 25 substituting the product of Example 8A for the product of Example IB (0.050 g, 45%).
MS (ESI-) m/z 465 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-d6) δ 5.50 (s, 2 H), 7.18 (dd, 7=7.72, 4.78 Hz, 1 H), 7.27 (m, 6 H), 7.56 (td, 7=7.91, 1.47 Hz, 1 H), 7.67 (d, 7=7.72 Hz, 1 H), 8.42 (dd, 7=7.72, 1.84 Hz, 1 H), 8.49 (dd, 7=4.78, 2.21 Hz, 1 H), 15.78 (s, 1 H). 30 Example 9
1 -(3-bromobenzyl)-3 -( 1 , 1 -dioxido-4H- 1 ,2.4-benzothiadiazin-3-yl)-4-hydroxy- L 8- naphthyridin-2(lH)-one Example 9 A 1 -(3-bromobenzyl)-2H-pyrido |"2,3-dl \ 1 ,31 oxazine-2,4(lH)-dione 35 The title compound was prepared according to the procedure of Example IB substituting 3-bromobenzyl bromide for n-butyl bromide (0.500 g, 82%). MS (DCI) m/z 333 (M+H)+.
-135- O 2004/041818
Example 9B l-(3-bromobenzyl)-3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 9A for the product of Example IB (0.050 g, 45%). MS (ESI-) m/z 465 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.50 (s, 2H), 7.18 (dd, 7=7.72, 4.78 Hz. IH), 7.27 (m, 6H), 7.56 (td, 7=7.91, 1.47 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.78, 2.21 Hz, IH), 15.78 (s, IH). Example 10 l-r(2-chloro- 3-thiazol-5-yl)methvn-3-(lJ-dioxido-4H- 2 4-benzothiadiazin-3-yl)-4- hydroxy- 8-naphthyridin-2(lH)-one Example 10A l-r(2-chloro- 3-thiazol-5-yl)methyll-2H-pyridor2.3-diri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-chloro-5-bromomethylthiazole for n-butyl bromide (0.360 g, 60%). MS (APCI) m/z 296 (M+H)+; ]H NMR (300 MHz, DMSO-dg) δ 5.45 (s, 2H), 7.44 (dd, 7=7.72, 4J8 Hz, IH), 7J6 (s, IH), 8.42 (dd, 7=7.91, 1.65 Hz, IH), 8.82 (dd, 7=4.78, 1.84 Hz, IH).
Example 10B l-r(2-chIoro-1.3-thiazol-5-yl)methvn-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy-l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 10A for the product of Example IB (0.136 g, 60%). MS (ESI-) m/z 477 (M-H)"; 1H NMR (300 MHz, DMSO-ds) δ 5J6 (s, 2H), 7.56 (m, 2H), 7.65 (d, 7=7.35 Hz, IH), 7.77 (s, IH), 7.78 (m, IH), 7.92 (d, 7=8.09 Hz, IH), 8.59 (dd, 7=8.09, 1.84 Hz, IH), 8.92 (dd, 7=4.78, 1.84 Hz, IH), 13.72 (s, IH).
Example 11 3-(l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-l-(3-fluorobenzyl)-4-hvdroxy-L8- naphthyridin-2(lH)-one Example IIA l-f3-fluorobenzyl)-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-fluorobenzyl bromide for n-butyl bromide (0.382 g, 76%). MS (DCI) m/z 273 (M+H)+. Example 11B
3-(lJ-dioxido-4H-L2,4-benzothiadiazin-3-yl)-l-(3-fluorobenzyl)-4-hvdroxy- 8- naphthyridin-2(lH)-one
-136- The title compound was prepared according to the procedure of Example ID substituting the product of Example I IA for the product of Example IB (0.040 g, 37%). MS
(ESI-) m z 449 ,(M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-d6) δ 5.52 (s, 2H), 7.02 (m, 2H), 7.08 (d, 7=7.72 Hz, IH), 7.17 (dd, 7=7.72, 4.41 Hz, IH), 7.29 (m, 3H), 7.56 (td, 7=7.91, 1.47
Hz, IH), 7.67 (d, 7=8.09 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.78, 1.84 Hz,
IH), 15.79 (s, IH).
^ Example 12
3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-methylbutyl)-L8- v naphthyridin-2(lH)-one
Example 12A l-(3-methylbutyl)-2H-pyridor2,3-dirL31oxazine-2.4(lH)-dione
A suspension of sodium hydride (95%, 0.048 g, 2.0 mmol) in dimethylacetamide (2 mL) at 20°C under nitrogen was reacted with the product of Example IA (0.3 g, 1.83 mmol). The reaction mixture was stirred for 1/2 hour then treated with l-bromo-3-methylbutane (0.3 g, 2.0 mmol) and stirred for an additional 16 hours. The reaction was partitioned between ethyl acetate and water. The organic layer was washed with water and brine, dried over sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by flash column chromatography on silica gel eluting with hexanes and ethyl acetate (3:1) to give the title compound as a white solid (0.218 g, 51%). MS (ESI-) m/z 233 (M-H)". H
NMR (300 MHz, DMSO-d6) δ 0.93 (s, 3H), 0.96 (s, 3H), 1.55 (m, 2H), 1.66 (m, IH), 4.14 (t,
7=7.72 Hz, 2H), 7.37 (dd, 7=7.91, 4.96 Hz, IH), 8.38 (dd, 7=7.72, 1.84 Hz, IH), 8.78 (dd,
7=4.78, 1.84 Hz, IH).
Example 12B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3-methylbutvD- 1.8- : naphthyridin-2(lH)-one
To a solution of the product of Example 12A (0.216 g, 0.92 mmol) and the product of
Example IC (0.247 g, 0.922 mmol) in anhydrous THF (7.5 mL) under nitrogen at 20°C was added sodium hydride (95%, 0.089 g, 3.7 mmol). The reaction was heated at reflux for 3 hours, cooled to 20°C, and added dropwise glacial acetic acid (2.4 mL). The resulting mixture was heated at reflux for 1 hour, cooled to 25°C, and diluted with aqueous hydrochloric acid (0.5 M, 35 mL). The resulting precipitate was collected by filtration, washed with water and dried. The crude product was purified by flash column chromatography on silica gel eluting with hexanes and ethyl acetate (3:1) to give the title compound as a white solid (0.031 g, 20%). MS (ESI-) m/z 411 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z
411 (M-H)". H NMR (300 MHz, DMSO-d6) δ 0.95 (s, 3H), 0.98 (s, 3H), 1.47 (m, 2H), 1.64
-137- (m, IH), 4.30 (t, 7=7.72 Hz, 2H), 7.13 (dd, 7=7.72, 4.78 Hz, IH), 7.26 (d, 7=8.09 Hz, IH), 7.30 (d, 7=7.72 Hz, IH), 7.55 (t, 7=7.72 Hz, IH), 7.66 (d, 7=8.09 Hz, IH), 8.37 (dd, 7=7.72, 1.84 Hz, IH), 8.53 (dd, 7=4.78, 2.21 Hz, IH), 15.94 (s, IH).
Example 13 l-(cvclobutylmemyl)-3-(l,l-dioxido-4H-l,2,4-benzoi iadiazin-3-yl)-4-hvdroxy- 8- naphthyridin-2( lH)-one Example 13A l-(cvclobutylmethyl)-2H-ρyridor2.3-din,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting bromomethyl-cyclobutane for n-butyl bromide (0.255 g, 60%). MS (DCI) m/z 233 (M+H)+.
Example 13B l-(cyclobutylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2 ( 1 H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 13 A for the product of Example IB (0.120 g, 52%). MS (ESI-) m/z 409 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 1.83 (m, 6H), 2.79 (m, IH), 4.38 (d, 7=6.99 Hz, 2H), 7.13 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (t, 7=7.54 Hz, 2H), 7.55 (t, 7=7.72 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.36 (dd, 7=7.72, 2.21 Hz, IH), 8.51 (dd, 7=4.78, 1.84 Hz, IH), 15.92 (s, IH).
Example 14 3-(l,l-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-4-hydroxy-l-r(5-methyl-2-thienyl)methyll- l,8-naphthyridin-2(lH)-one- ' Example 14A : l-r(5-methyl-2-thienyl)methyll-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-5-methylthiophene for n-butyl bromide (0.181 g, 54%). !H NMR (300 MHz, DMSO-d6) δ 2.36 (s, 3H), 5.38 (s, 2H), 6.63 (m, IH), 6.98 (d, 7=3.68 Hz, IH), 7.42 (dd, 7=7.72, 4.78 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.82 (dd, 7=4.78, 1.84 Hz, IH).
Example 14B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroχy-l-r(5-methyl-2-thienyl)methyll- l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 14A for the product of Example IB (0.172 g, 58%). MS (ESI-) m/z 451 (M-H)". The sodium salt of the title compound was prepared according to the
-138- procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 2.32 (s, 3H), 5.54 (s, 2H), 6.56 (d, IH), 6.88 (d, 7=3.31 Hz, IH), 7.17 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 2H), 7.56 (t, 7=7.72 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.38 (dd, 7=7.72, 1.84 Hz, IH), 8.56 (dd, 7=4.78, 1.84 Hz, IH), 15.81 (s, IH). Example 15 l-benzyl-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-L8-naphthyridm-2(lH)- one ', Example 15 A l-benzyl-2H-pyridor2,3-d1 Tl ,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting benzyl bromide for n-butyl bromide (0.393 g, 51%). MS (DCI) m/z 255 (M+H)+.
Example 15B l-benzyl-3-(l.l-dioxido-4H-l,2.4-benzothiadiazm-3-yl)-4-hydroxy-L8-naphthyridin-2(lH)- one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 15A for the product of Example IB (0.217 g, 62%). MS (ESI-) m/z 431 (M-H)'. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.52 (s, 2H), 7.16 (m, 2H), 7.25 (d, 7=4.41 Hz, 4H), 7.29 (m, 2H), 7.56 (td, 7=7.91, 1.47 Hz, IH), 7.67 (dd, 7=7.91, 1.65 Hz, IH), 8.41 (dd, 7=7.54, 2.02 Hz, IH), 8.48 (dd, 7=4.78, 2.21 Hz, IH), 15.84 (s, IH).
Example 16 3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r(5-methyl-3-pyridinyl)methvn-
1.8-naphthyridin-2(lH)-one Example 16 A l-r(5-methyl-3-pyridinyl)methyl1-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-chloromethyl-5-methylpyridine for n-butyl bromide (0.080 g, 24%). XH NMR (300 MHz, DMSO-d6) δ 2.25 (s, 3H), 5.34 (s, 2H), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 7.63 (br s, IH), 8.30 (br s, IH), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.46 (br s, IH), 8J3 (dd, 7=4.78, 1.84 Hz, IH).
Example 16B 3-(l,l-dioxido-4H-l,2 4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(5-methyl-3-pyridinyl)methyll-
1 , 8 -naphthyridin-2( 1 H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 16A for the product of Example IB (0.013 g, 13%). MS (ESI-) m/z 446 (M-H)". The sodium salt of the title compound was prepared according to the
-139- procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.22 (s, 3H), 5.49 (s, 2H), 7.18 . (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.44 (s, IH), 7.56 (m, IH), 7.67 (d, 7=8.09 Hz, IH), 8.23 (d, 7=1.47 Hz, IH), 8.36 (d, 7=1.47 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.51 (dd, 7=4.78, 1.84 Hz, IH), 15.80 (s, IH). Example 17 l-r(2-chloro-4-pyridinyl)methvn-3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-
1 ,8-naphthyridin-2(lH)-one ' λ,
Example 17 A l-r(2-chloro-4-pyridinyl)methyl1-2H-ρyridor2,3-diri,31oxazine-2.4(lH)-dione
The title compound was prepared according to the procedure of Example IB substituting 4-bromomethyl-2-chloropyridine for n-butyl bromide (0.219 g, 62%). *H NMR • (300 MHz, DMSO-d6) δ 5.37 (s, 2H), 7.40 (m, IH), 7.48 (s, IH), 7.60 (s, IH), 8.34 (dd, 7=4.60, 2.39 Hz, IH), 8.45 (m, IH), 8.68 (m, IH). Example 17B l-r(2-chloro-4-pyridinyl)methyll-3-(l l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-
1 ,8-naphthyridin-2(lH)-one , The title compound was prepared according to the procedure of Example ID substituting the product of Example 17A for the product of Example IB (0.255 g, 73%). MS (ESI-) m/z 466/468 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dβ) δ 5.52 (s, 2H), 7.19 (m, 2H), 7.30 (m, 3H), 7.56 (t, 7=7.54 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.27 (d, 7=5.15 Hz, IH), 8.46 (m, 2H), 15.72 (s, IH).
Example 18 l-[(5-bromo-3-pyridinyl)methyll-3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-
1 ,8-naphthyridin-2(lH)-one Example 18A di-tert-butyl (5-bromo-3 -pyridinvDmethylimidodicarbonate A solution of 5-bromo-3-chloromethylpyridinium hydrochloride (716 mg, 4.189 mmol) in anhydrous DMF (15 mL) under nitrogen at 0 °C was treated with triethylamine (0.65 mL, 4.61 mmol), tetrabutylammonium bromide (273 mg, 0.838 mmol), and potassium di-tert-butyl imidodicarbonate (1.284 g, 5.027 mmol). The reaction was heated to 50 °C-55 °C for 3.5 hours, then cooled to room temperature, diluted with ethyl acetate (150 mL), and washed with water (2x50 mL) and saturated aqueous sodium chloride. The combined extracts were dried over anhydrous Na2S0 , filtered, and concentrated by rotary evaporation. The residue was purified by flash column chromatography on silica gel with 6% ethyl acetate/dichloromethane to give the title compound as a colorless oil (0.980 g, 60%). MS
-140- (ESI+) m/z 387/389 (M+H)+; Η NMR (300 MHz, CDC13) δ 1.49 (s, 18H), 4.75 (s, 2H), 7.83 (t, 7=2.02 Hz, IH), 8.50 (d, 7=1.84 Hz, IH), 8.58 (d, 7=2.21 Hz, IH).
Example 18B (5-bromo-3-pyridinyl)methylamine The product of Example 18A (0.98 g, 2.53 mmol) was treated with trifluoroacetic acid and dichloromethane (1:1 v/v, 20 mL) for 2 hours at room temperature. The solvent was removed by rotary evaporation and the resulting oil was chased with benzene/dichloromethane (3 times) to give a waxy solid. The salt was dissolved in anhydrous methanol (20 mL) and stirred with Amberlite IRA-400(OH), resin (10 g) for 2 hrs. The resin was removed by vacuum filtration and thoroughly washed with dry methanol. The filtrate was concentrated by rotary evaporation to give the title compound (0.415 g, 88%). MS (DCL/NH3) m/z 187/189 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 3.73 (s, 2H), 8.02 (t, 7=2.02 Hz, IH), 8.50 (d, 7=1.47 Hz, IH), 8.53 (d, 7=2.21 Hz, IH).
Example 18C ethyl 2-{ r(5-bromo-3-pyridinyl)methyllamino|nicotinate
The title compound was prepared according to the procedure of Example 3A substituting the product of Example 18B for 2-ethylbutylamine (0.116 g, 68%). MS (DCI7NH3) m/z 336/338 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.32 (t, 7=6.99 Hz, 3H), 4.31 (q, 7=7.23 Hz, 2H), 4.71 (d, 7=5.88 Hz, 2H), 6.67 (dd, 7=7.72, 4.78 Hz, IH), 7.97 (t, 7=2.02 Hz, IH), 8.12 (dd, 7=7.72, 2.21 Hz, IH), 8.26 (dd, 7=4.78, 1.84 Hz, IH), 8.45 (t, 7=6.07 Hz, IH), 8.55 (m, 2H).
Example 18D l-r(5-bromo-3-pyridinyl)methvn-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 18C for the product of Example 3 A and purifying by flash column chromatography on silica gel eluting with 10% ethyl acetate/dichloromethane (0.057 g, 51%). 1HNMR (300 MHz, DMSO-d6) δ 5.38 (s, 2H), 7.41 (dd, 7=7.72, 5.15 Hz, IH), 8.10 (t, 7=2.02 Hz, IH), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.60 (d, 7=2.21 Hz, IH), 8.66 (d, 7=1.84 Hz, IH), 8.72 (dd, 7=5.15, 1.84 Hz, IH). Example 18E l-r(5-bromo-3-pyridinyl)methvn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-
118-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 18D for the product of Example IB (0.037 g, 43%). MS (ESI-) m/z 510/512 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dβ) δ 5.52 (s, 2H), 7.20 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (t, 7=7.54 Hz, IH), 7.68 (d, 7=7.35 Hz, IH), 7.89
-141- (br s, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.52 (dd, 7=4.78, 1.84 Hz, IH), 8.55 (br s, 2H), 15.73 (s, IH).
Example 19 l-(cyclohexylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- 5 naphthyridfn-2( lH)-one
Example 19A l-(cyclohexylmethyl)-2H-pyridor2,3-diri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting (bromomethyl)cyclohexane for n-butyl bromide (0.05 g, 11%). lό Example 19B l-(cyclohexylmethyl)-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lHVone The title compound was prepared according to the procedure of Example ID substituting the product of Example 19A for the product of Example IB (0.025 g, 30 %). MS 15 (ESI-) m/z 437 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 437 (M-H)"; !H NMR (300 MHz, DMSO-d6/TFA) δ 0.99 (m, 5H), 1.50 (m, 5H), 1.87 ( , IH), 4.32 (d, 7=7.35 Hz, 2H), 7.23 (dd, 7=8.09, 4.78 Hz, IH), 7.38 (m, 2H), 7.57 (m, IH), 7.78 (d, 7=8.09 Hz, IH), 8.40 (dd, 7=8.09, 1.84 Hz, IH), 8.66 (dd, 7=4.78, 1.84 Hz, IH). 20 Example 20
3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(2S)-2-methylbutyll-1.8- naphthyridin-2(lH)-one Example 20A ethyl 2-1 r(2S)-2-methylbutyπamino Inicotinate 25 The title compound was prepared according to the procedure of Example 3 A substituting (S)-(-)-2-methylbutylamine for 2-ethylbutylamine (1.6 g, 77%). 1HNMR (300 MHz, DMSO-d6) δ 0.89 (t, 7=7.23, 3H), 0.91 (d, 7=6.62 Hz, 3H), 1.18 (m, IH), 1.31 (t, 7=6.99 Hz, 3H), 1.42 (m, IH), 1.66 (m, IH), 3.35 (m, 2H), 4.29 (q, 7=7.23 Hz, 2H), 6.59 (dd, 7=7.72, 4.78 Hz, IH), 8.01 (t, 7=5.52 Hz, IH), 8.08 (dd, 7=7.72, 1.84 Hz, IH), 8.27 (dd, 30 7=4.60, 2.02 Hz, IH).
Example 20B l-r(2S)-2-methylbutyll-2H-pyridor2.3-dir 31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 20A for the product of Example 3A (0.400 g, 68%). MS 35 (DCI) m/z 252 (M+NB ) ".
Example 20C 3-(l . l-dioxido-4H-l .2.4-benzothiadi azin-3-yl)-4-hydroxy- l-r(2S)-2-methylbutyl1-l ,8-
-142- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 20B for the product of Example IB (0.116 g, 43%). MS (ESI-) m/z 411 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d5) δ 0.80 (d, 7=6.99 Hz, 3H), 0.87 (t, 7=7.54 Hz, 3H), 1.15 (m, IH), 1.37 (m, IH), 2.02 (m, IH), 4.20 (d, 7=7.35 Hz, 2H), 7.12 (dd, 7=7.72, 4J8 Hz, IH), 7.27 (m, 2H), 7.55 (m, IH), 7.66 (d, 7=7.72 Hz, IH), 8.37 (dd, 7=7.72, Ϊ2Λ21 Hz, IH), 8.51 (dd, 7=4.60, 2.02 Hz, IH), 15.95 (s, IH).
Example 21
3-(l J-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroχy-l-(4-methylbenzyl)-L8- naphthyridin-2( lH)-one Example 21 A l-(4-methylbenzyl)-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-methylbenzyl bromide for n-butyl bromide (0.402 g, 82%). MS (DCI) m/z 269 (M+H)+.
Example 2 IB 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methylbenzyl)-1.8- naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 21A for the product of Example IB (0.099 g, 60%). MS (ESI-) m/z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d6) δ 2.22 (s, 3H), 5.47 (s, 2H), 7.04 (d, 7=7.72 Hz, 2H), 7.14 (m, 3H), 7.29 (t, 7=7.35 Hz, 2H), 7.55 (t, 7=7.72 Hz, IH), 7.67 (d; 7=7.72 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.84 Hz, IH), 15.85 (s, IH).
Example 22 3-(lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(5-nitro-2-furyl)methyll-L8- naphthyridin-2(lH)-one
Example 22A l-r(5-nitro-2-furyl)methvn-2H-pyridor2.3-din.31oxazine-2.4(i -dione The title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-5-nitrofuran for n-butyl bromide (0.120 g, 34%). 1H NMR (300 MHz, DMSO-de) δ 5.45 (s, 2H), 6.90 (d, 7=3.68 Hz, IH), 7.44 (dd, 7=7.72, 5.15 Hz, IH), 7.65 (d, 7=3.68 Hz, IH), 8.45 (m, IH), 8.77 (m, IH).
Example 22B
-143- 3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(5-nitro-2-furyl)methyl1- 8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 21A for the product of Example IB (0.040 g, 21%). MS (DCI/NH3) m/z 468 (M+H)+. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.60 (s, 2H), 6.54 (d, 7=3.68 Hz, IH), 7.22 (dd, 7=7.72, 4J8 Hz, IH), 7.29 (m, 2H), 7.56 (m, IH), 7.58 (d, 7=3.68 Hz, 1H)N.67 (d, 7=8.09 Hz, IH), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.53 (dd, 7=4.78, 1.84 Hz, IH), 15.68 (s, IH). Example 23 l-(l-benzothien-2-ylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridm-2(lH)-one Example 23A l-(l-benzothien-2-ylmethyl)-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-chloromethyl-benzo[b]thiophene for n-butyl bromide (0.160 g, 42%). !H NMR (300 MHz, DMSO-d6) δ 5.58 (s, 2H), 7.33 (m, 2H), 7.44 (dd, 7=7.72, 4J8 Hz, IH), 7.51 (s, IH), 7.77 (m, IH), 7.90 (m, IH), 8.44 (dd, 7=7.72, 1.84 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH). Example 23B l-(l-benzothien-2-ylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 23A for the product of Example IB (0.148 g, 60%). MS (ESI-) m/z 487 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.74 (s, 2H), 7.20 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 4H), 7.36 (s, IH), 7.56 (m, IH), 7.68 (dd, 7=7.72, 1.47 Hz, IH), 7.75 (m, IH), 7.82 (dd, 7=7.72, 1.47 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.58 (dd, 7=4.78, 1.84 Hz, IH), 15.77 (s, IH). Example 24
3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methoxybenzyl)-l,8- naphthyridin-2(lH)-one
Example 24A l-(3-methoxybenzyl)-2H-pyridor2.3-din.31oxazine-2.4riH dione
The title compound was prepared according to the procedure of Example IB substituting 3-methoxybenzyl bromide for n-butyl bromide (0.446 g, 86%). MS (DCI) m/z
-144- 285 (M+H)+.
Example 24B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methoxybenzyl)-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 24A for the product of Example IB (0.086 g, 53%). MS (ESI-) m/z 461 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-ds) δ 3.69 (s, 3H), 5.49 (s, 2H), 6.75 (m, 3H), 7.15 (m, 2H), 7.29 (td, 7=8.46, 1.84 Hz, 2H), 7.56 (td, 7=7.72, 1.47 Hz, IH), 7.66 (d, 7=7.72 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.84 Hz, IH), 15.82 (s, IH).
Example 25 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-iodobenzyl)-l,8- naphthyridin-2( 1 H)-one Example 25A l-(3-iodobenzyl)-2H-pyridor2.3-din.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-iodobenzyl bromide for n-butyl bromide (0.614 g, 88%). MS (DCI) m/z 381 (M+H)+. Example 25B
3-(l.l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-iodobenzyl)-1.8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 25 A for the product of Example IB (0.176 g, 60%). MS (ESI-) m/z 557 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. JH NMR (300 MHz, DMSO-d6) δ 5.47 (s, 2H), 7.07 (t, 7=7.72 Hz, IH), 7.17 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 3H), 7.55 (m, 2H), 7.66 (m, 2H), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.78, 1.84 Hz, IH), 15.79 (s, IH).
Example 26 l-[(3,5-dimethyl-4-isoxazolyl)methyn-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4- hydroxy- 1 , 8-naphthyridin-2( lH)-one Example 26A l-r(3.5-dimethyl-4-isoxazolyl)methvn-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-chloromethyl-3,5-dimethylisoxazole for n-butyl bromide (0.199 g, 60%). 1H NMR (300 MHz, DMSO-d6) δ 2.20 (s, 3H), 2.45 (s, 3H), 5.10 (s, 2H), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 8.40 (dd, 7=7.72, 1.84 Hz, IH), 8.80 (dd, 7=4.78, 1.84 Hz, IH).
-145- Example 26B l-r(3,5-dιmethyl-4-isoxazolyl)methyn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hvdroxy-1.8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 26A for the product of Example IB (0.187 g, 63%). MS (DCL/NH3) m/z 452 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 2.20 (s, 3H), 2.38 (s, 3H), 5.44 (s, 2H), 7.51 (dd, 7=7.90, 4.60 Hz, IH), 7.55 (t, 7=7.17 Hz, IH), 7.64 (d, 7=7.72 Hz, IH), 7.77.(t, 7=7.17 Hz, IH), 7.92 (d, 7=7.72 Hz, IH), 8.58 (dd, 7=7.90, 1.66 Hz, IH), 8.88 (dd, 7=4.60, 1.66 Hz, IH), 13.95 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.17 (s, 3H), 2.29 (s, 3H), 5.26 (s, 2H), 7.17 (dd, 7=7.73, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (t, 7=7.72 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.53 (dd, 7=4.78, 1.84 Hz, IH), 15.78 (s, IH).
Example 27 3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r2-(3-thienyl)ethvn-l,8- naphthyridin-2( lH)-one Example 27A l-r2-(3-thienyl)ethyll-2H-pyridor2,3-dirL31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-(2-bromoethyl)thiophene for n-butyl bromide (0.156 g, 46%). 1H NMR (300 MHz, DMSO-d6) δ 2.98 (t, 2H), 4.36 (t, 2H), 7.07 (d, 7=5.15 Hz, IH), 7.31 (m, IH), 7.39 (dd, 7=7.72, 5.15 Hz, IH), 7.49 (m, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.78 (dd, 7=4.78, 1.84 Hz, IH).
Example 27B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r2-(3-thienyl)ethvn-1.8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 27 A for the product of Example IB (0.123 g, 48%). MS (ESI-) m/z 451 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 2.90 (t, 7=7.90 Hz, 2H), 4.51 (t, 7=7.90 Hz, 2H), 7.10 (d, 7=4.78 Hz, IH), 7.16 (dd, 7=7.72, 4.78 Hz, IH), 7.29 ( , 3H), 7.49 (dd, 7=4.78, 2.94 Hz, IH), 7.56 (m, IH), 7.68 (d, 7=7.72 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.55 (dd, 7=4.78, 1.84 Hz, IH), 15.89 (s, IH).
Example 28 3-(l J-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f4-pyridinylmethyI)-l ,8- naphthyridin-2(lH)-one Example 28A
-146- l-(4-pyridinylmethyl)-2H-pyridor2,3-d]ri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-(chloromethyl)pyridine for n-butyl bromide (0.089 g, 29%). Η NMR (300 MHz, DMSO-d6) δ 5.37 (s, 2H), 7.41 (m, 3H), 8.45 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (m, 2H), 8.69 (dd, 7=4.78, 1.84 Hz, IH).
Example 28B 3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-pyridinylmethyl)-l,8- .} naphthyridin-2 ( lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 28A for the product of Example IB (0.034 g, 19%). MS (DCJ7NH3) m z 434 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 5.83 (s, 2H), 7.52 (m, 2H), 7.60 (d, 7=7.72 Hz, IH), 7.69 (d, 7=6.25 Hz, 2H), 7.73 (m, IH), 7.91 (d, 7=6.99 Hz, IH), 8.62 (dd, 7=7.72, 1.84 Hz, IH), 8.68 (d, 7=6.25 Hz, 2H), 8.75 (dd, 7=4.78, 1.84 Hz, IH), 13.98 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d6) δ 5.56 (s, 2H), 7.22 (m, 3H), 7.33 (m, 2H), 7.59 (m, IH), 7.71 (m, IH), 8.45 (m, 3H), 8.50 (dd, 7=4.78, 1.83 Hz, IH), 15.54 (s, IH).
Example 29 l-(4-bromobenzyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one
Example 29A l-(4-bromobenzyl)-2H-pyridof2,3-d1 Tl ,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-bromobenzyl bromide for n-butyl bromide (1.460 g, 72%). MS (DCI) m/z 333 (M+H)+. :
Example 29B l-(4-bromobenzyl)-3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 29A for the product of Example IB (0.060 g, 59%). MS (ESI-) m/z 509 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.47 (s, 2H), 7.16 (dd, 7=7.72, 4.78 Hz, IH), 7.22 (d, 7=8.46 Hz, 2H), 7.27 (t, 7=7.72 Hz, 2H), 7.44 (d, 7=8.46 Hz, 2H), 7.56 (td, 7=7.72, 1.47 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.84 Hz, IH), 15.80 (s, IH).
Example 30 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yI)-4-hydroxy-l-neopentyl-l,8-naphthyridin-
-147- 2( HP-one Example 30A ethyl 2-(neopentylamino)nicotinate The title compound was prepared according to the procedure of Example 3 A substituting 2,2-dimethylpropylamine for 2-ethylbutylamine (0.407 g, 57 %). MS (ESI+) 237 (M+H)+; 1H NMR (300 MHz, CDC13) δ 1.02 (s, 9H), 1.38 (t, 7=7.17 Hz, 3H), 3.36 (d, 7=5.52 Hz, 2H), 4.33 (q, 7=7.35 Hz, 2H), 6.48 (dd, 7=7.91, 4.60 Hz, IH), 8.12 (dd, 7=7.72, 2.21 Hz^H), 8.16 (s, IH), 8.26 (dd, 7=4.78, 2.21 Hz, IH).
Example 30B l-neopentyl-2H-pyridor2,3-dir 31oxazine-2,4(lH)-dione
The title compound was prepared according to the procedure of Example 3B substituting the product of Example 30A for the product of Example 3A (0.182 g, 89 %). lR NMR (300 MHz, CDC13) δ 1.12 (s, 9H), 4.28 (s, 2H), 7.25 (dd, 7=6.99, 4.04 Hz, IH), 8.41 (dd, 7=7.91, 2.02 Hz, IH), 8.69 (dd, 7=4.78, 1.84 Hz, IH). Example 30C
3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l-neopentyl-l,8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 30B for the product of Example IB (0.070 g, 22 %). MS (ESI+) m/z 413 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 0.96 (s, 9H), 4.52 (s, 2H), 7.49 (dd, 7=8.09, 4.41 Hz, IH), 7.56 (t, 7=7.54 Hz, IH), 7.68 (d, 7=8.09 Hz, IH), 7.78 (m, IH), 7.94 (d, 7=6.99 Hz, IH), 8.57 (dd, 7=8.09, 1.84 Hz, IH), 8.85 (dd, 7=4.41, 1.84 Hz, IH), 14.11 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI+) m/z 413 (M+H)+; !H NMR (300 MHz, DMSO-d6) δ 0.91 (s, 9H), 4.34 (s, 2H), 7.11 (dd, 7=7.72, 4.78 Hz, IH), 7.27 (m, 2H), 7.55 (m, IH), 7.66' (m, IH), 8.36 (dd, 7=7.54, 2.02 Hz, IH), 8.48 (dd, 7=4.60, 2.02 Hz, IH), 15.95 (s, IH).
Example 31 l-i r(lS.2R.5S)-6.6-dimethylbicvclor3.1.11hept-2-vnmethyl)-3-(l.l-dioxido-4H- 214- benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)-one Example 31A ethyl 2-(( rαS,2R,5S)-6,6-dimethylbicyclo|"3.1. llhept-2-yllmethyl } amino)nicotinate The title compound was prepared according to the procedure of Example 3A substituting (-)-cis-myrtanylamine for 2-ethylbutylamine (0.604 g, 40%). MS (ESI+) m/z 303 (M+H)+. Example 3 IB l-( r(lS.2R.5SV6.6-dimethylbicvclor3.1.nhept-2-yl1methyl)-2H-pyridor2.3-din.31oxazine-
2.4(lH)-dione
-148- The title compound was prepared according to the procedure of Example 3B substituting the product of Example 31A for the product of Example 3A (0.570 g, 95%). !H NMR (300 MHz, DMSO-d6) δ 0.79 (d, 7=9.56 Hz, IH), 1.14 (s, 3H), 1.22 (s, 3H), 1.62 (m, IH), 1.87 (m, 5H), 2.26 (m, IH), 2.53 (m, IH), 4.04 (dd, 7=13.05, 6.07 Hz, IH), 4.28 (dd, 7=13.24, 9.19 Hz, IH), 7.37 (dd, 7=7.72, 4.78 Hz, IH), 8.38 (dd, 7=7.72, 1.84 Hz, IH), 8.76 (dd, 7=4.78, 1.84 Hz, IH).
Example 31C l-{ r(itS,2R.5S)-6.6-dimethylbicvclor3.1.nhept-2-yl1methyl)-3-(l.l-dioxido-4H-1.2.4- benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 31B for the product of Example IB (0.050 g, 21%). MS (ESI-) m/z 477 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.78 (d, 7=9.56 Hz, IH), 1.15 (m, 3H), 1.30 (s, 3H), 1.80 (m, 6H), 2.24 (m, IH), 2.54 (m, IH), 4.37 (m, 2H), 7.12 (dd, 7=7.54, 4.60 Hz, IH), 7.27 (m, 2H), 7.55 (m, IH), 7.67 (dd, 7=7.72, 1.47 Hz, IH), 8.36 (dd, 7=7.54, 2.02 Hz, IH), 8.50 (dd, 7=4.60, 2.02 Hz, IH), 15.95 (s, IH).
Example 32 3-{r3-(l.l-dioxido-4H-1.2,4-benzothiadiazm-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile Example 32A
3-r(2.4-dioxo-2H-ρyridor2.3-diri.31oxazin-l(4H)-yl)methvnbenzonitrile The title compound was prepared according to the procedure of Example IB substituting 3-cyanobenzyl bromide for n-butyl bromide (0.363 g, 71%). MS (DCI) m/z 280 (M+H)+. Example 32B :
3- f f3-( 1.1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-L8-naphthyridin- 1 (2H)- yll methyl Ibenzonitrile The title compound was prepared according to the procedure of Example ID substituting the product of Example 32A for the product of Example IB (0.024 g, 22%). MS (ESI-) m/z 456 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. lH NMR (300 MHz, DMSO-d6) δ 5.54 (s, 2H), 7.18 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.48 (t, 7=7.72 Hz, IH), 7.56 (td, 7=7.91, 1.47 Hz, 2H), 7.68 (m, 3H), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.60, 2.02 Hz, IH), 15.77 (s, IH).
Example 33 3-fl.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-ρyridinylmethyl)-1.8- naphthyridin-2(lH)-one Example 33A
-149- l-(3-pyridinylmethylV2H-pyridor2,3-dl rL31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-(bromomethyl)pyridine for n-butyl bromide (0.153 g, 49%). 1H NMR (300 MHz, DMSO-d6) δ 5.38 (s, 2H), 7.34 (dd, 7=7.72, 4.78 Hz, IH), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 7.82 (m, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.47 (dd, 7=4.78, 1.10 Hz, 1H)| 8.66 (d, 7=1.84 Hz, IH), 8.74 (dd, 7=5.15, 1.84 Hz, IH).
Example 33B 3-( I -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(3 -pyridinylmethyl)- 1,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 33A for the product of Example IB (0.098 g, 41%). MS (DCI/NH3) m/z 434 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 5.72 (s, 2H), 7.41 (dd, 7=7.72, 4.78 Hz, IH), 7.50 (m, 2H), 7.61 (d, 7=8.09 Hz, IH), 7.74 (m, IH), 7.84 (d, 7=7.72 Hz, IH), 7.89 (d, 7=8.09 Hz, IH), 8.50 (d, 7=4.04 Hz, IH), 8.58 (dd, 7=7.73, 1.84 Hz, IH), 8.67 (s, IH), 8.80 (dd, 7=4.78, 1.84 Hz, IH), 14.15 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 5.53 (s, 2H), 7.18 (dd, 7=7.72, 4.41 Hz, IH), 7.29 (m, 3H), 7.56 (m, IH), 7.65 (m, 2H), 8.40 (m, 2H), 8.51 (dd, 7=4.60, 2.02 Hz, IH), 8.57 (d, 7=1.47 Hz, IH), 15.78 (s, IH). Example 34 l-(l-adamantylmethyl)-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-L8- naphthyridin-2(lH)-one Example 34A 2-r(l-adamantylmethyl)amino1nicotinic acid The title compound was prepared according to the procedure of Example 3 A substituting 2-chloronicotinic acid for ethyl 2-chloronicotinate and 1- adamantanemethylamine for 2-ethylbutylamine (0.185 g, 79 %). MS (ESI+) m/z 287.1 (M+H)+; 1H NMR (300 MHz, DMSO-cL) δ 1.74 (m, 12H), 2.00 (s, 3H), 3.31 (m, 2H), 6.60 (dd, 7=7.35, 5.52 Hz, IH), 7.96 (dd, 7=5.33, 2.02 Hz, IH), 8.26 (dd, 7=7.35, 1.84 Hz, IH). Example 34B l-(l-adamantylmeth'yl)-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 34A for the product of Example 3A (0.025 g, 20 %). !H NMR (300 MHz, CDC13) δ 1.74 (m, 12H), 2.04 (s, 3H), 3.65 (d, 7=5.88 Hz, 2H), 6.91 (dd, 7=7.72, 5.52 Hz, IH), 8.51 (d, 7=4.78 Hz, IH), 8.77 (d, 7=7.72 Hz, IH).
Example 34C l-(l-adamantylmethyl)-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8-
-150- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 34B for the product of Example IB (0.018 g, 47 %). MS (ESI+) m/z 491.1 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.59 (s, 12H), 1.90 (m, 3H), 5 4.41 (br s, 2H), 7.48 (m, IH), 7.56 (t, 7=7.54 Hz, IH), 7.69 (m, IH), 7.77 (m, IH), 7.94 (d, 7=7.72 Hz, IH), 8.56 (dd, 7=8.09, 1.84 Hz, IH), 8.85 (dd, 7=4.60, 1.65 Hz, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI ) m/z 491.1 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.56 (m, 12H), 1.87 (s, 3H), 4.21 (br s, 2H), 7.10 (dd, 7=7.72, 4J8 Hz, IH), 7.28 (m, 2H), 7.55 (m, IH), 7.66 (dd, lό 7=7.72, 1.47 Hz, IH), 8.35 (dd, 7=772, 1.84 Hz, IH), 8.48 (dd, 7=4.60, 2.02 Hz, IH), 15.97 (br s, IH).
Example 35 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r3-(trifluoromethyl)benzyll-l,8- naphthyridin-2(lH)-one 15 Example 35A l-r3-(trifluoromethyl)benzvn-2H-pyridol2.3-diri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-(trifluoromethyl)benzyl bromide for n-butyl bromide (0.250 g, 42%). 1H NMR (300 MHz, DMSO-de) δ 5.43 (s, 2H), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 7.55 (m, IH), 7.64 (m, 20 IH), 7.73 (d, 7=7.72 Hz, IH), 7.81 (s, IH), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.72 (dd, 7=4.78, 1.84 Hz, IH).
Example 35B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -r3-(trifluoromethyl)benzyll -1,8- naphthyridin-2(lH)-one 25 The title compound was prepared according to the procedure of Example ID substituting the product of Example 35A for the product of Example IB (0.22 g, 57 %). MS (ESI-) m/z 499 (M-H)"; 1H NMR (300 MHz, DMSO-de) δ 5.77 (s, 2H), 7.54 (m, 6H), 7.66 (d, 7=7.72 Hz, IH), 7.76 (m, 2H), 7.92 (d, 7=8.09 Hz, IH), 8.61 (dd, 7=8.09, 1.84 Hz, IH), 8.83 (dd, 7=4.41, 1.84 Hz, IH), 13.91 (br s, IH). The sodium salt of the title compound was 30 prepared according to the procedure of Example ID. MS (ESI-) m/z 499 (M-H)"; 1H NMR (300 MHz, DMSO-ds) δ 5.58 (s, 2H), 7.18 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.54 (m, 4H), 7.66 (m, 2H), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.60, 2.02 Hz, IH), 15.78 (m, IH).
Example 36 35 3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f(2-methyl-l,3-thiazol-5- yl)methvn-1.8-naphthyridin-2(lH)-one
-151- Example 36 A l-r(2-methyl-1.3-thiazol-5-yl)methvn-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-methyl-5-chloromethylthiazole for n-butyl bromide (0.300 g, 54%). Example 36B
3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yI)-4-hydroxy-l-r(2-methyl-l,3-thiazol-5- yl)methyl1-l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 36A for the product of Example IB (0.123 g, 25%). MS (ESI-) m/z 452 (M-H)"; 1H NMR (300 MHz, DMSO-d6) δ 2.54 (s, 3H), 5.76 (s, IH), 7.53 (m, IH), 7.52 (d, 7=7.72 Hz, IH), 7.65 (m, 2H), 7.76 (t, 7=7.72 Hz, IH), 7.91 (d, 7=7.72 Hz, IH), 8.57 (d, 7=7.72 Hz, IH), 8.90 (d, 7=4.04 Hz, IH), 13.92 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 37 l-(2-cγclohexylethyl)-3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2( lH)-one Example 37A l-(2-cvclohexylethyl)-2H-pyridor2.3-dirL31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting l-bromo-2-cyclohexylethane for n-butyl bromide (0.196 g, 39%).
Example 37B l-(2-cyclohexylethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2( 1 H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 37A for the product of Example IB (0.030 g, 18 % after column purification). MS (ESI-) m/z 451 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 451 (M-H)"; 1H NMR (300 MHz, DMSO-d6/TFA) δ 0.78 (m, 2H), 0.98 (m, 3H), 1.18 (m, IH), 1.40 (m, 5H), 1.59 (d, 7=12.50 Hz, 2H), 4.33 (m, 2H), 7.23 (m, 3H), 7.47 (t, 7=7.54 Hz, IH), 7.67 (d, 7=7.72 Hz, IH), 8.43 (m, IH), 8.57 (dd, 7=4.78, 1.47 Hz, IH).
Example 38 3-(l l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(4-methoxybenzyl)-l,8- naphthyridin-2( lH)-one Example 38 A l-(4-methoxybenzyl)-2H-pyridor2,3-dir 31oxazine-2,4riH)-dione
The title compound was prepared according to the procedure of Example IB substituting 4-methoxybenzyl chloride for n-butyl bromide (0.364 g, 70%). MS (DCI) m/z
-152- 285 (M+H)+.
Example 38B 3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methoxybenzyl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 38 A for the product of Example IB (0.098 g, 51%). MS (ESI-) m/z 461 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 3.68 (s, 3H), 5.45 (s, 2H), 6.80 (dt, 7=8.82, 2.21 Hz, 2H), 7.15 (dd, 7=7.72, 4.78 Hz, IH), 7.26 (m, 4H), 7.55 (td, 7=7.72, 1.47 Hz, IH), 7.67 (dd, 7=7.91, 1.65 Hz, IH), 8.39 (dd, 7=7.72, 2.21 Hz, IH), 8.50 (dd, 7=4.78, 1.84 Hz, IH), 15.86 (s, IH).
Example 39 3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- l-(2-methylbenzyl)-l ,8- naphthyridin-2(lH)-one Example 39A l-(2-methylbenzyl)-2H-pyridor2.3-d1 IT ,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-methylbenzyl bromide for n-butyl bromide (0.353 g, 72%). MS (DCI) m/z 269 (M+H)+. Example 39B
3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(2-methylbenzyl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 39A for the product of Example IB (0.165 g, 62%). MS (ESI-) m/z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.44 (s, 3H), 5.45 (s, 2H), 6.59 (d, 7=7.35 Hz, IH), 6.96 (t, 7=7.17 Hz, IH), 7.06 (t, 7=6.80 Hz, IH), 7.16 (m, 2H), 7.29 (t, 7=7.54 Hz, 2H), 7.56 (td, 7=7.72, 1.47 Hz, IH), 7.66 (d, 7=7.72 Hz, IH), 8.43 (d, 7=6.25 Hz, 2H), 15.84 (s, IH). Example 40 l-(cyclopropylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one Example 40A l-(cvclopropylmethyl)-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting (bromomethyl)cyclopropane for n-butyl bromide (0.278 g, 70%). MS (APCI+) m/z 219 (M+H). 1H NMR (300 MHz, DMSO-d6) δ 0.46 (m, 4H), 1.27 (m, IH), 4.04 (d,
-153- 7=6.99 Hz, 2H), 7.39 (dd, 7=7.91, 4.96 Hz, IH), 8.40 (dd, 7=7.72, 1.84 Hz, IH), 8.78 (dd, 7=4.78, 1.84 Hz, IH).
Example 40B l-(cvclopropylmethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8- 5 naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 40A for the product of Example IB (0.06 g, 20 % after column purification). MS (ESI-) m/z 395 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 395 (M-H)"; 1H NMR lό (300 MHz, DMSO-d6) δ 0.40 (m, 4H), 1.32 (m, IH), 4.19 (d, 7=6.99 Hz, 2H), 7.14 (dd,
7=7.54, 4.60 Hz, IH), 7.28 (m, 2H), 7.55 (t, 7=7.35 Hz, IH), 7.67 (dd, 7=7.72, 1.10 Hz, IH), 8.38 (dd, 7=7.72, 1.84 Hz, IH), 8.52 (dd, 7=4.60, 2.02 Hz, IH), 15.93 (s, IH).
Example 41 3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(L3-thiazol-4-ylmethyl)-l,8- 15 naphthyridin-2(lH)-one
Example 41 A 1-(1 ,3-thiazol-4-ylmethyl)-2H-pyridor2,3-dl IT ,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-(chloromethyl)thiazole for n-butyl bromide (0.049 g, 15%). 1H NMR (300 20 MHz, DMSO-d6) δ 5.48 (s, 2H), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 7.66 (s, IH), 8.45 (dd, 7=7.72, 1.84 Hz, IH), 8.72 (dd, 7=4.78, 1.84 Hz, IH), 9.06 (d, 7=2.21 Hz, IH).
Example 41B 3-(l.l-dioxido-4H-L2.4-benzothiadiazin-3-vI)-4-hydroxy-l-(1.3-thiazol-4-ylmethyl)-1.8- 25 naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 41 A for the product of Example IB (0.046 g, 59%). MS (ESI-) m/z 438 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. H NMR (300 MHz, DMSO-d6) δ 5.65 (s, 2H), 7.04 (d, 7=2.21 30 Hz, IH), 7.16 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (m, IH), 7.66 (d, 7=7.35 Hz, IH), 8.42 (dd, 7=7.72, 2.21 Hz, IH), 8.46 (dd, 7=4.78, 2.20 Hz, IH), 8.98 (d, 7=1.84 Hz, IH), 15.85 (s, IH).
Example 42 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(5-phenyl-2-thienyl)methyl1- 35 L8-naphthyridin-2(lH)-one
The product of Example 4B (100 mg, 0.193 mmol), phenylboronic acid (49 mg, 0.387 mmol), 2M aqueous Na2CO3 (0.45 mL), absolute ethanol (0.5 mL), and
-154- tetrakis(triphenylphosphine)palladium (14 mg, 0.012 mmol) in N2-sparged DMF (2 mL) was heated to reflux for 2.5 hours, cooled to 0 °C, diluted with H20 (15 mL), adjusted to pH 3 with IN HCl, and extracted with ethyl acetate (3 x 25 mL). The combined extracts were washed with saturated NaCI, dried over anhydrous Na2S04, filtered, and concentrated. The 5 residue was purified by flash column chromatography on silica gel with 3% ethyl acetate/dichloromethane to give the title compound (0.039 g, 40%). MS (ESI-) m/z 513 (M- H)". The sodium salt of the title compound was prepared according to the procedure of Example lD. 1H NMR (300 MHz, DMSO-d6) δ 5.64 (s, 2H), 7.12 (d, 7=3.68 Hz, IH), 7.20 (dd, 7=7.72, 4.78 Hz, IH), 7.31 (m, 6H), 7.57 (m, 3H), 7.68 (d, 7=7.72 Hz, IH), 8.41 (dd, lό 7=7.72, 1.84 Hz, IH), 8.60 (dd, 7=4.78, 1.84 Hz, IH), 15.80 (s, IH).
Example 43 3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methyl-3-pentenyl)-l,8- naphthyridin-2(lH)-one Example 43A 15 l-(4-methyl-3-pentenyl)-2H-pyridor2,3-din,31oxazine-2.4(lH)-dione
The title compound was prepared according to the procedure of Example IB substituting 5-bromo-2-methyl-2-pentene for n-butyl bromide (0.157 g, 35%). MS (DCI+) m/z 247 (M+H)+; XH NMR (300 MHz, DMSO-de) δ 1.59 (s, 3H), 1.66 (s, 3H), 2.35 (m, 2H), 4.09 (m, 2H), 5.18 (t, 7=7.54 Hz, IH), 7.39 (dd, 7=7.72, 5.15 Hz, IH), 8.40 (dd, 7=7.72, 20 1.84 Hz, IH), 8J9 (dd, 7=5.15, 1.84 Hz, IH).
Example 43B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(4-methyl-3-pentenyl)-L8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID 25 substituting the product of Example 43A for the product of Example IB (0.030 g, 20 % after recrystallization). MS (ESI-) m/z 423 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 423 (M-H)"; *H NMR (300 MHz, DMSO-de) δ 1.63 (s, 3H), 1.67 (s, 3H), 2.26 (m, 2H), 4.23 (m, 2H), 5.21 (m, IH), 7.14 (dd, 7=7.72, 4J8 Hz, IH), 7.28 (m, 2H), 7.55 (t, 7=7.35 Hz, IH), 7.67 (d, 7=7.72 Hz, 30 IH), 8.37 (dd, 7=7.72, 2.21 Hz, IH), 8.53 (dd, 7=4.60, 2.02 Hz, IH), 15.92 (s, IH).
Example 44 4-( r3-(l.l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdroχy-2-oxo-1.8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile Example 44A 35 4-rr2.4-dioxo-2H-pyridor2.3-diri,31oxazin-l(4H)-yl)methyllbenzonitrile
The title compound was prepared according to the procedure of Example IB substituting 4-cyanobenzyl bromide for n-butyl bromide (1.02 g, 60%). MS (DCI) m/z 280
-155- (M+H)+.
Example 44B 4-{ r3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile 5 The title compound was prepared according to the procedure of Example ID substituting the product of Example 44A for the product of Example IB (0.197 g, 60%). MS (ESI-) m z 456 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.58 (s, 2H), 7.18 (dd, 7=7.54, 4.60 Hz, IH), 7.29 (td, 7=8.46, 1.84 Hz, 2H), 7.41 (d, 7=8.46 Hz, 2H), 7.56 (td, 7=7.81, 1.65 lό Hz, IH), 7.67 (dd, 7=7.91, 1.29 Hz, IH), 7.72 (d, 7=8.46 Hz, 2H), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.46 (dd, 7=4.60, 2.02 Hz, IH), 15.77 (s, IH).
Example 45 1 - \2-( 1 -c yclohexen- 1 - yl)eth yll -3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)-4-h ydroxy- l,8-naphthyridin-2(lH)-one 15 Example 45A ethyl 2-{ r2-(l-cyclohexen-l-yl)ethvπamino)nicotinate The title compound was prepared according to the procedure of Example 3 A substituting 2-(l-cyclohexenyl)ethylamine for 2-ethylbutylamine (2.2 g, 80%). MS (DCI) m/z 275 (M+H)+. 20 Example 45B l-r2-(l-cvclohexen-l-yl)ethyll-2H-pyridor2,3-din.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 45A for the product of Example 3A (0.493 g, 91%). MS (DCI) m/z 290 (M+NEU)+. 25 Example 45C l-r2-(l-cvclohexen-l-yl)ethyll-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-
1 ,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 45B for the product of Example IB (0.048 g, 14%). MS 30 (ESI-) m/z 449 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 1.53 (m, 4H), 1.90 (m, 2H), 2.05 (m, 2H), 2.18 (t, 7=7.54 Hz, 2H), 4.36 (m, 2H), 5.38 (s, IH), 7.13 (dd, 7=7.72, 4.78 Hz, IH), 7.28 (m, 2H), 7.55 (td, 7=7.72, 1.47 Hz, IH), 7.66 (dd, 7=7.72, 1.47 Hz, IH), 8.37 (dd, 7=7.54, 2.02 Hz, IH), 8.52 (dd, 7=4.60, 2.02 Hz, IH), 15.91 (s, IH). 35 Example 46
3-( 1 , 1 -dioxido-4H-l ,2.4-benzothiadiazin-3 -yl)-4-hydroxy- 1 - r(2-methyl-1.3-thiazol-4- yl)methyl1-L8-naphthyridin-2(lH)-one
-156- Example 46A l-rf2-methyl-l,3-thiazol-4-yl)methvn-2H-pyridor2.3-diri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-chloromethyl-2-methylthiazole for n-butyl bromide (0.087 g, 26%). 1H NMR (300 MHz, DMSO-de) δ 2.63 (s, 3H), 5.37 (d, 7=1.47 Hz, 2H), 7.39 (s, IH), 7.40 (dd, 7=7.72, 4.78 Hz, IH), 8.44 (dd, 7=7.72, 1.84 Hz, IH), 8.72 (dd, 7=4.78, 1.84 Hz, IH).
Example 46B 3-(LI-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r(2-methyl-l,3-thiazol-4- yl)methyl]-L8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 46A for the product of Example IB (0.078 g, 56%). MS (DCI/NH ) m z 454 (M+H)+. The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 2.61 (s, 3H), 5.55 (s, 2H), 6.74 (s, IH), 7.16 (dd, 7=7.73, 4.78 Hz, IH), 7.29 (m, 2H), 7.55 (m, IH), 7.67 (d, 7=7.72 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.47 (dd, 7=4.78, 2.21 Hz, IH), 15.85 (s, IH).
Example 47 2-i r3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yll methyl Ibenzonitrile Example 47 A
2-r(2,4-dioxo-2H-pyridor2,3-diri,31oxazin-l(4H)-yl)methyl1benzonitrile The title compound was prepared according to the procedure of Example IB substituting 2-cyanobenzyl bromide for n-butyl bromide (0.332 g, 65%). MS (DCI) m/z 280 (M+H)+. Example 47B
2-{ r3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yllmethyl Ibenzonitrile The title compound was prepared according to the procedure of Example ID substituting the product of Example 47A for the product of Example IB (0.183 g, 66%). MS (ESI-) m/z 456 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d6) δ 5.68 (s, 2H), 7.00 (d, 7=8.09 Hz, IH), 7.19 (dd, 7=7.35, 4.78 Hz, IH), 7.30 (t, 7=8.09 Hz, 2H), 7.39 (t, 7=7.54 Hz, IH), 7.56 (t, 7=7.85 Hz, 2H), 7.67 (d, 7=7.72 Hz, IH), 7.84 (d, 7=7.72 Hz, IH), 8.44 (m, 2H), 15.75 (s, IH). Example 48
3-(l.l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-rr5-methyl-3- isoxazolvDmethyl]-l,8-naphthyridin-2(lH)-one
-157- Example 48A l-r(5-methyl-3-isoxazolyl)methyl1-2H-pyridor2.3-din,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 3-chloromethyl-5-methylisoxazole for n-butyl bromide (0.047 g, 15%). 1H NMR (300 MHz, DMSO-de) δ 2.34 (s, 3H), 5.35 (s, 2H), 6.26 (d, 7=1.10 Hz, IH), 7.42 (dd, 7=7.72, 4.78 Hz, IH), 8.44 (dd, 7=7.72, 1.84 Hz, IH), 8.75 (dd, 7=5.15, 1.84 Hz, IH).
Example 48B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r(5-methyl-3- isoxazolyl)methyl]-l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 48A for the product of Example IB (0.051 g, 67%). MS (ESI-) m/z 436 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.29 (s, 3H), 5.50 (s, 2H), 5.94 (s, IH), 7.18 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (t, 7=8.09 Hz, IH), 7.67 (d, 7=8.09 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.78, 2.21 Hz, IH), 15.76 (s, IH).
Example 49 3-( 1, 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 -( 1 -naphthylmethyl)- 1 , 8- naphthyridin-2(lH)-one Example 49 A l-(2-naphthylmethyl)-2H-pyridor2,3-d]ri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting l-(bromomethyl)naphthalene for n-butyl bromide (0.391 g, 71%). MS (DCI) m/z 305 (M+H)+. Example 49B /
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -( 1 -naphth ylmethyl)-l ,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 49A for the product of Example IB (0.087 g, 60%). MS (ESI-) m/z 481 (M-H)'; 1H NMR (300 MHz, DMSO-d6) δ 5.88 (s, 2H), 7.45 (m, 2H), 7.54 (t, 7=7.72 Hz, 3H), 7.65 (d, 7=7.72 Hz, IH), 7.75 (m, 2H), 7.81 (dd, 7=6.07, 3.49 Hz, IH), 7.86 (d, 7=8.46 Hz, 2H), 7.93 (d, 7=7.35 Hz, IH), 8.63 (dd, 7=7.72, 1.84 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH), 14.04 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.69 (s, 2H), 7.16 (dd, 7=7.54, 4.60 Hz, IH), 7.29 (t, 7=7.72 Hz, 2H), 7.43 (m, 2H), 7.49 (dd, 7=8.64, 1.65 Hz, IH), 7.56 (td, 7=7.72, 1.47 Hz, IH), 7 67 (d, 7=7.35 Hz, 2H), 7.83 (m, 3H), 8.42 (dd, 7=7.54, 2.02 Hz, IH), 8.48 (dd, 7=4.60, 2.02 Hz, IH), 15.86 (s, IH).
-158- ■Example 50 3-(Ll-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l-(2-pyridinylmethyl)-l,8- naphthyridin-2( lH)-one Example 50A l-(2-pyridinylmethyl)-2H-pyridor2.3-diri.31oxazine-2.4(lH)-dione
The title compound was prepared according to the procedure of Example IB substituting 2-(bromomethyl)ρyridine for n-butyl bromide (0.060 g, 19%). XH NMR (300 MHz, DivϊSO-d6) δ 5.45 (s, 2H), 7.26 (m, IH), 7.39 (dd, 7=7.72, 4.78 Hz, IH), 7.45 (d, 7=8.09 Hz, IH), 7.73 (m, IH), 8.46 (dd, 7=7.72, 1.84 Hz, IH), 8.47 (m, IH), 8.68 (dd, 7=4.78, 1.47 Hz, IH).
Example 50B 3-(l J-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(2-pyridinylmethyl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 50A for the product of Example IB (0.072 g, 72%). MS (ESI-) m/z 432 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.62 (s, 2H), 6.97 (d, 7=8.09 Hz, IH), 7.18 (m, 2H), 7.31 (m, 2H), 7.62 (m, 3H), 8.44 (d, 7=6.62 Hz, 3H), 15.71 (s, IH).
Example 51 l-(4-tert-butylbenzyl)-3-( 1, l-dioxido-4H- 112,4-benzothiadiazin-3-yl)-4-hydroxy-l ,8- naphthyridin-2( lH)-one Example 5 IA l-(4-tert-butylbenzyl)-2H-pyridor2,3-dl \ 1.31oxazme-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 4-(tert-butyl)benzyl bromide for n-butyl bromide (0.410 g, 72%). MS (DCI) m z 311 (M+H)+.
Example 5 IB 1 -(4-tert-butylbenzyl)-3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 51A for the product of Example IB (0.109 g, 70%). MS (ESI-) m/z 487 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dβ) δ 1.23 (s, 9H), 5.49 (s, 2H), 7.16 (m, 3H), 7.28 (m, 4H), 7.55 (td, 7=7.91, 1.47 Hz, IH), 7.66 (d, 7=6.25 Hz, IH), 8.40 (dd,. 7=7.72, 2.21 Hz, IH), 8.49 (dd, 7=4.60, 2.02 Hz, IH), 15.84 (s, IH).
Example 52 ethyl [3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin-
-159- K2H)-yl1acetate
Example 52A ethyl (2.4-dioxo-2H-pyridor2.3-din,31oxazin-l(4H)-yl)acetate The title compound was prepared according to the procedure of Example IB substituting ethyl bromoacetate for n-butyl bromide (0.174 g, 43%). 1H NMR (300 MHz,
DMSO-d6) δ 1.21 (t, 7=7.17 Hz, 3H), 4.18 (q, 7=7.11 Hz, 2H), 4.92 (s, 2H), 7.45 (dd,
7=7.72, '478 Hz, IH), 8.47 (dd, 7=7.91, 1.65 Hz, IH), 8.77 (dd, 7=4.78, 1.84 Hz, IH).
Example 52B v ethyl r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-1.8-naphthyridin- l(2H)-yll acetate
The title compound was prepared according to the procedure of Example ID substituting the product of Example 52A for the product of Example IB (0.200 g, 52 %). MS
(ESI-) m/z 427 (M-H)"; XH NMR (300 MHz, DMSO-αyCF3COOD) δ 1.26 (t, 7=6.99 Hz, 3H), 4.22 (q, 7=7.11 Hz, 2H), 5.34 (s, 2H), 7.44 (dd, 7=7.91, 4.60 Hz, IH), 7.54 (m, 2H),
7.74 (m, IH), 7.96 (m, IH), 8.63 (dd, 7=8.09, 1.84 Hz, IH), 8.79 (dd, 7=4.78, 1.84 Hz, IH).
Example 53 r3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-1.8-naphthyridin-l(2H)- yll acetic acid To a suspension of the product of Example 52B in 1: 1 THF:methanol (6 mL) was added 0.5 N aqueous lithium hydroxide (6 mL). The mixture was stirred at room temperature for 2 hours, adjusted to pH 3 with 1.0 N HCl, and filtered. The filter cake was washed with water and dried to give the title compound (0.133 g, 86%). MS (ESI-) m/z 399 (M-H)"; 1H
NMR (300 MHz, DMSO-d6) δ 5.16 (s, 2H), 7.54 (m, 2H), 7.67 (d, 7=7.72 Hz, IH), 7.77 (t, 7=7.72 Hz, IH), 7.92 (d, 7=7.72 Hz, IH), 8.60 (dd, 7=8.09, 1.84 Hz, IH), 8.84 (dd, 7=4.60;
1,65 Hz, IH), 13.11 (br s, IH), 13.79 (br s, IH).
Example 54
3-(l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-phenoxybenzyl)- 8- naphthyridin-2( lH)-one Example 54A l-(3-phenoxybenzyl)-2H-pyrido[2,3-diri,31oxazine-2,4(lH)-dione
The title compound was prepared, according to the procedure of Example IB substituting 3-phenoxybenzyl chloride for n-butyl bromide (0.190 g, 31%). MS (DCI) m/z
347 (M+H)+. Example 54B .
3-(l l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-phenoxybenzyl)- 8- naphthyridin-2( lH)-one
' -160- The title compound was prepared according to the procedure of Example ID substituting the product of Example 54A for the product of Example IB (0.063 g, 52%). MS (ESI-) m/z 523 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.51 (s, 2H), 6.77 (dd, 7=8.09, 5 1.47 Hz, IH), 6.91 (s, IH), 6.99 (t, 7=8.46 Hz, 2H), 7.10 (t, 7=7.35 Hz, IH), 7.19 (m, IH), 7.31 (m, 6H), 7.57 (t, 7=7.72 Hz, IH), 7.68 (d, 7=7.72 Hz, IH), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (d, 7=2.94 Hz, IH), 15.74 (s, IH). ->
Example 55 lό 1 -allyl-3- , 1 -dioxido-4H-l .2,4-benzothiadiazin-3-yl)-4-hvdroxy-l ,8-naphthyridin-2(lH)- one
Example 55A l-allyl-2H-pyridol2,3-dπi,31oxazine-2,4(lH)-dione 15 The title compound was prepared according to the procedure of Example IB substituting allyl bromide for n-butyl bromide (5.12 g, 82%). MS (DCI/NH3) m/z 205 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 4.75 ( , 2H), 5.14 (dd, 7=10.66, 1.47 Hz, IH), 5.27 (dd, 7=17.28, 1.47 Hz, IH), 5.92 (m, IH), 7.39 (dd, 7=7.72, 4.78 Hz, IH), 8.40 (dd, 7=7.91, 2.02 Hz, IH), 8.75 (dd, 7=4.78, 1.84 Hz, IH). 20 Example 55B l-allyl-3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)- one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 55 A for the product of Example IB (1.4g, 34.5%). MS 25 (DCI H3) m/z 383 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 5.03 (m, IH), 5.11-5.15 (m, 3H), 5.93-6.07 (m, IH), 7.45-7.60 (m, 2H), 7.65-7.72 (m, 7=8.46 Hz, IH), 7.73-7.80 (t, 7=7.72 Hz, IH), 7.92 (d, 7=7.35 Hz, IH), 8.58 (dd, 7=8.09, 1.84 Hz, IH), 8.85 (dd, 7=4.60, 1.65 Hz, IH).
Example 56 30 3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(2-naphthylmethyl)-l,8- naphthyridin-2(lH)-one Example 56A l-(2-naphthylmethyl)-2H-pyridor2,3-diri,31oxazine-2.4flHVdione The title compound was prepared according to the procedure of Example IB 35 substituting 2-(bromomethyl)naphthalene for n-butyl bromide (0.417 g, 75%). MS (DCI) m/z 305 (M+H)+.
Example 56B
-161- 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vI)-4-hydroxy-l-(2-naphthylmethyl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 56A for the product of Example IB (0.022 g, 42%). MS (ESI-) m/z 481 (M-H)"; 1H NMR (300 MHz, DMSO-d6) 5 6.18 (s, 2H), 6.83 (d, 7=6.62 Hz, IH), 7.28 (m, IH), 7.53 (t, 7=7.54 Hz, 2H), 7.68 (m, 4H), 7.81 (d, 7=8.09 Hz, IH), 7.92 (d, 7=7.35 Hz, IH), 8.00 (d, 7=8.09 Hz, IH), 8.32 (d, 7=8.46 Hz, IH), 8.66 (dd, 7=8.09, 1.84 Hz, lW), .74 (dd, 7=4.78, 1.84 Hz, IH), 14.04 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d5) δ 6.00 (s, 2H), 6J6 (d, 7=6.25 Hz, IH), 7.18 (dd, 7=7.54, 4.96 Hz, IH), 7.30 (m, 3H), 7.63 (m, 4H), 7.75 (d, 7=8.09 Hz, IH), 7.97 (d, 7=6.99 Hz, IH), 8.31 (d, 7=8.46 Hz, IH), 8.40 (d, 7=3.68 Hz, IH), 8.47 (dd, 7=7.72, 1.84 Hz, IH), 15.78 (s, IH).
Example 57 3-(l,l-dioxido-4H-L2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(lR)-l-phenylethyll-l,8- naphthyridin-2(lH)-one
Example 57A ethyl 2-{ r(lR)-l-ρhenylethyllaminolnicotinate The title compound was prepared according to the procedure of Example 3 A substituting (R)-(+)-α-methylbenzylamine for 2-ethylbutylamine (2.23 g, 82%). MS (DCI) m/z 271 (M+H)+.
Example 57B l-r(lR)-l-phenylethyn-2H-pyridor2.3-din.31oxazine-2.4(lHVdione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 57A for the product of Example 3A (0.250 g, 62%). 1H NMR (300 MHz, DMSO-d6) δ 1.86 (d, 7=6.99 Hz, 3H), 6.65 (q, 7=6.99 Hz, IH), 7.27 (m, • 3H), 7.40 (m, 3H), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.73 (dd, 7=4.96, 2.02 Hz, IH).
Example 57C 3-( 1.1 -dioxido-4H- 1.2.4-benzothiadiazin-3-yl)-4-hydroxy- 1 - \( 1R)- 1 -phenylethyll-1 ,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 57B for the product of Example IB (0.080 g, 36%). MS (ESI-) m z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.90 (d, 7=7.35 Hz, 3H), 6.87 (m, IH), 7.12 (m, 2H), 7.25 (m, 6H), 7.55 (m, IH), 7.65 (d, 7=7.72 Hz, IH), 8.40 (d, 7=6.25 Hz, 2H), 15.92 (s, IH).
Example 58 l-rf5-tert-butyl-2-thienyl)methyll-3-(l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hydfoxy-
-162- 1 ,8-naphthyridin-2(lH)-one Example 58 A l-r(5-tert-butyl-2-thienyl)methvn-2H-pyridor2,3-diri.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB 5 substituting 2-bromomethyl-5-tert-butylthiophene for n-butyl bromide (0.098 g, 25%). !H NMR (300 MHz, DMSO-d6) δ 1.28 (s, 9H), 5.39 (s, 2H), 6.71 (d, 7=3.68 Hz, IH), 7.00 (d, 7=3.68 Hz, IH), 7.42 (dd, 7=7.72, 4.78 Hz, IH), 8.40 (dd, 7=7.72, 1.47 Hz, IH), 8.83 (dd, 7=4.78, i\84 Hz, IH).
Example 58B lό l-r(5-tert-butyl-2-thienyl)methyl1-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy- l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 58A for the product of Example IB (0.082 g, 54%). MS (ESI-) m/z 493 (M-H)". The sodium salt of the title compound was prepared according to the 15 procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.25 (s, 9H), 5.55 (s, 2H), 6.63 (d, 7=3.31 Hz, IH), 6.89 (d, 7=3.31 Hz, IH), 7.18 (dd, 7=7.72, 4J8 Hz, IH), 7.28 (m, 2H), 7.56 (m, IH), 7.67 (d, 7=7.72 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.57 (dd, 7=4.78, 1.84 Hz, IH), 15.83 (s, IH).
Example 59 20 l-(l.l -biphenyl-4-ylmethyl)-3-(iα-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one Example 59A l-(l.l -biphenyl-4-ylmethyl)-2H-pyridor2.3-diri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB 5 substituting 4-phenylbenzyl chloride for n-butyl bromide (0.119 g, 20%). MS (DCI) m/z 331 (M+H)+.
Example 59B l-(l,r-biphenyl-4-ylmethyl)-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one 30 The title compound was prepared according to the procedure of Example ID substituting the product of Example 59A for the product of Example IB (0.061 g, 50%). MS (ESI-) m/z 507 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.57 (s, 2H), 7.17 (dd, 7=7.72, 4.78 Hz, IH), 7.31 (m, 5H), 7.42 (t, 7=7.54 Hz, 2H), 7.57 (m, 5H), 7.67 (d, 7=8.09 Hz, IH), 35 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.50 (dd, 7=4.60, 2.02 Hz, IH), 15.84 (s, IH).
Example 60 3-ri.l-dioxido-4H-1.2,4-benzothiadiazin-3-vIV4-hvdroxy-l-r2-riH-indol-3-yl)ethvn-l,8-
-163- naphthyridin-2(lH)-one Example 60A ethyl 2-1 r2-(lH-indol-3-yl)ethyll amino jnicotinate The title compound was prepared according to the procedure of Example 3 A substituting tryptamine for 2-ethylbutylamine (1.24 g, 80%). MS (DCI) m/z 310 (M+H)+.
Example 60B l-r2-(lH-indol-3-yl)ethyll-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dione TJae- title compound was prepared according to the procedure of Example 3B substituting the product of Example 60A for the product of Example 3A (0.164 g, 53%). MS (DCI) m/z 25 (M+NB )+.
Example 60C 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r2-(lH-indol-3-yl)ethyll-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 60B for the product of Example IB (0.140 g, 54%). MS (ESI-) m/z 484 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 3.09 (m, 2H), 4J5 (m, 2H), 7.08 (m, 2H), 7.27 (d, 7=2.57 Hz, IH), 7.36 (d, 7=6.99 Hz, IH), 7.54 (m, 2H), 7.77 (m, 3H), 7.94 (d, 7=7.72 Hz, IH), 8.60 (dd, 7=8.09, 1.84 Hz, IH), 8.95 (dd, 7=4.78, 1.84 Hz, IH), 10.88 (s, IH).
Example 61 3-( 1.1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3-yD- 1 - 1" (6-ethoxy-2-pyridinyl)methyU -4-hydroxy-
- l,8-naphthyridin-2(lH)-one Example 61 A 1 - r(6-chloro-2-pyridinyl)methyll -2H-pyrido f2,3-dl T 1.31oxazine-2.4( lHVdione :
The title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-6-chloropyridine for n-butyl bromide (0.159 g, 45%). 1H NMR (300 MHz, DMSO-d6) δ 5.40 (s, 2H), 7.41 (m, 2H), 7.49 (d, 7=7.72 Hz, IH), 7.80 (t, 7=7.72 Hz, IH), 8.46 (dd, 7=7.72, 1.84 Hz, IH), 8.68 (dd, 7=5.15, 1.84 Hz, IH). Example 6 IB
3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(6-ethoxy-2-pyridinyl)methvn-4-hydroxy-
1 , 8-naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 61 A for the product of Example IB (0.109 g, 42%). MS (ESI-) m/z 476 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.19 (t, 7=6.99 Hz, 3H), 4.17 (q, 7=6.99 Hz, 2H), 5.52 (s, 2H), 6.45 (d, 7=7.35 Hz, IH), 6.54 (d, 7=7.72 Hz, IH), 7.15 (m,
-164- IH), 7.29 (t, 7=7.72 Hz, 2H), 7.54 (m, 2H), 7.66 (d, 7=8.09 Hz, IH), 8.42 ( , 2H), 15.83 (s, IH).
Example 62 l-benzyl-S-dT-dioxido^H-l^^-benzothiadiazin-S-vD^-hydroxy^-methyl-LS- naphthyridin-2(lH)-one
Example 62A phenylmethanaminium 2-(benzylamino)-6-methylnicotinate The title compound was prepared as a benzylamine salt according to the procedure of Example 3A substituting 2-chloro-6-methyl-nicotinic acid for 2-chloro-nicotinic acid ethyl ester and benzyl amine for 2-ethylbutylamine (0.480 g, 46 %). MS (ESI+) m/z 243.03 (M+H)+; 1H NMR (300 MHz, CDC13) δ 2.35 (s, 3H), 3.67 (s, 2H), 4.65 (s, 2H), 5J3 (br s, 3H), 6.16 (d, 7=7.72 Hz, IH), 7.17 (m, 10H), 7.76 (d, 7=7.35 Hz, IH), 8.66 (br s, IH).
Example 62B l-benzyl-7-methyl-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 62A for the product of Example 3A (0.150 g, 50 %). H NMR (300 MHz, CDC13) δ 2.66 (s, 3H), 5.47 (s, 2H), 7.10 (d, 7=8.09 Hz, IH), 7.31 (m, 3H), 7.55 (dd, 7=7.54, 1.65 Hz, 2H), 8.26 (d, 7=8.09 Hz, IH).
Example 62C l-benzyl-S-dJ-dioxido^H-l^ -benzothiadiazin-S-yD^-hvdroxyT-methyl- δ- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 62B for the product of Example IB (0..53 g, 51 %). *H NMR (300 MHz, DMSO-d6) δ 2.61 (s, 3H), 5.69 (s, 2H), 7.30 (m, 6H), 7.53 (m, IH), 7.64 (m, 7=7.35 Hz, IH), 7.74 (t, 7=7.54 Hz, IH), 7.90 (d, 7=8.82 Hz, IH), 8.46 (d, 7=8.46 Hz,' IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI+) m/z 447.0 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 2.48 (s, 3H), 5.50 (s, 2H), 7.25 (m, 7H), 7.54 (m, IH), 7.66 (d, 7=6.25 Hz, IH), 8.28 (d, 7=7.72 Hz, IH), 15.95 (s, IH). Example 63
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(6-methyl-2-pyridinyl)methyn- l,8-naphthyridin-2(lH)-one Example 63A l-r(6-methyl-2-pyridinyl)methvn-2H-pyridor2.3-diri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-bromomethyl-6-methylpyridine for n-butyl bromide (0.088 g, 27%). !H NMR (300 MHz, DMSO-d6) δ 2.42 (s, 3H), 5.38 (s, 2H), 7.19 (d, 7=7.72 Hz, IH), 7.37 (m, 2H),
-165- 7.58 (t, 7=7.72 Hz, IH), 8.45 (dd, 7=7.72, 1.84 Hz, IH), 8.67 (dd, 7=4.78, 1.84 Hz, IH).
Example 63B 3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - r(6-methyl-2-pyridinyl)methvI1 -
L8-naphthyridin-2(lH)-one 5 The title compound was prepared according to the procedure of Example ID substituting the product of Example 63 A for the product of Example IB (0.081 g, 40%). MS (ESI-) m/z 446 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.45 (s, 3H), 5.54 (s, 2H), 6.57 (d, 7=7.72 Hz, IH), 7.04 (d, 7=7.35 Hz, IH), 7.16 (dd, 7=7.17, 4.96 Hz, IH), 7.29 (t, 7=7.72 lό Hz, 2H), 7.47 (t, 7=7.72 Hz, IH), 7.56 (m, IH), 7.66 (d, 7=7.72 Hz, IH), 8.43 (m, 2H), 15.82 (s, IH).
Example 64 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-vD- 1 -( 1 -ethylpropyl)-4-hydroxy- 1,8- naphthyridin-2(lH)-one 15 Example 64A ethyl 2- \( 1 -ethylpropyDaminolnicotinate The title compound was prepared according to the procedure of Example 3 A substituting 2-ethyl-propyllamine for 2-ethylbutylamine (1.45 g, 88 %). MS (ESI+) 237.1 (M+H)+. 1H NMR (300 MHz, CDC13) δ 0.93 (t, 7=7.35 Hz, 6H), 1.38 (t, 7=7.17 Hz, 3H), 20 1.60 (m, 4H), 4.17 (m, IH), 4.32 (q, 7=7.11 Hz, 2H), 6.45 (dd, 7=7.72, 4J8 Hz, IH), 7.89 (br d, 7=8.09 Hz, IH), 8.10 (dd, 7=7.72, 1.84 Hz, IH), 8.24 (dd, 7=4.78, 2.21 Hz, IH).
Example 64B l-(l-ethylpropyl)-2H-pyridor2.3-diri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B 25 substituting the product of Example 64A for the product of Example 3 A (0.120 g, 57 %). MS (ESI+) m/z 223.1 (M+H)+; 1H NMR (300 MHz, CDC13) δ 0.87 (t, 7=7.54 Hz, 6H), 1.88 (m, 2H), 2.21 (s, 2H), 5.43 (s, IH), 7.24 (dd, 7=6.99, 4.04 Hz, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.68 (dd, 7=4.78, 1.84 Hz, IH).
Example 64C 30 . 3-(l ,l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-l-(l-ethylpropyl)-4-hydroxy-l ,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 64B for the product of Example IB (0.030 g, 15 %). MS (ESI+) m/z 413.04 (M+H)+; 1H NMR (300 MHz, DMSO-dg) δ 0J6 (t, 7=7.54 Hz, 6H), 1.90 35 (m, 2H), 2.29 (m, 2H), 5.37 (m, 0.5H), 5.92 (m, 0.5H), 7.50 (m, IH), 7.56 (t, 7=7.54 Hz, IH), 7.69 (m, IH), 7.78 (t; 7=7.17 Hz, IH), 7.93 (d, 7=7.35 Hz, IH), 8.58 (d, 7=8.09 Hz, IH), 8.84 (m, IH), 14.11 (s, IH). The sodium salt of the title compound was prepared according
-166- to the procedure of Example ID. MS (ESI+) m/z 413.07 (M+H-Na)+; 1H NMR (300 MHz, DMSO-de) δ 0.74 (t, 7=7.35 Hz, 6H), 1.88 (br s, 2H), 2.30 (br s, 2H), 5.35 (br s, 0.5H), 5.78 (br s, 0.5H), 7.28 (br s, IH), 7.42 (m, 7=7.35 Hz, 2H), 7.66 (m, IH), 7.79 (br d, 7=7.35 Hz, IH), 8.47 (br d, 7=7.35 Hz, IH), 8.64 (br s, IH). Example 65
3-(l.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hydroxy-l-[(lS)-l-phenylethvn-l,8- naphthyridin-2( lH)-one ',\ Example 65A ethyl 2-{ r(lS)-l-phenylethynamino}nicotinate The title compound was prepared according to the procedure of Example 3 A substituting (S)-(-)-α-methylbenzylamine for 2-ethylbutylamine (2.2 g, 81%). MS (DCI) m/z 271 (M+H)+.
Example 65B l-r(lS)-l-phenylethyl1-2H-pyridor2,3-diri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 65 A for the product of Example 3A (0.320 g, 80%). 1H NMR (300 MHz, DMSO-d6) δ 1.86 (d, 7=6.99 Hz, 3H), 6.65 (q, 7=6.99 Hz, IH), 7.27 (m, 3H), 7.40 (m, 3H), 8.43 (dd, 7=7.72, 1.84 Hz, IH), 8.73 (dd, 7=4.96, 2.02 Hz, IH).
Example 65 C 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(lS)-l-phenylethyll-1.8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 65B for the product of Example IB (0.122 g, 36%). MS (ESI-) m/z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 1.90 (d, 7=7.35 Hz, 3H), 6.87 (m, IH), 7.12 (m, 2H), 7.25 (m, 6H), 7.55 (m, IH), 7.65 (d, 7=7.72 Hz, IH), 8.40 (d, 7=6.25 Hz, 2H), 15.92 (s, IH).
Example 66 2-|2-r3-(lT-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin- 1 (2H)- yllethyl } - lH-isoindole- 1 ,3 (2H)-dione .
Example 66A l-r2-(1.3-dioxo-1.3-dihvdro-2H-isoindol-2-yl)ethvn-2H-pyrido[2.3-din.31oxazine-2.4(lH)- dione The title compound was prepared according to the procedure of Example IB substituting N-(2-bromoethyl)phthalimide for n-butyl bromide (0.121 g, 20%). 1H NMR (300 MHz, DMSO-de) δ 4.00 (t, 7=5.52 Hz, 2H), 4.46 (t, 7=5.52 Hz, 2H), 7.28 (dd, 7=7.72, 4.78 Hz, IH), 7.80 (s, 4H), 8.38 (dd, 7=7.72, 1.84 Hz, IH), 8.53 (dd, 7=4.78, 1.84 Hz, IH).
-167- Example 66B 2-{2-r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin- l(2H)-yllethyl}-lH-isoindole-L3(2H)-dione The title compound was prepared according to the procedure of Example ID substituting the product of Example 65B for the product of Example IB (0.085 g, 46 %). MS (ESI-) m/z 514 (M-H)"; 1H NMR (300 MHz, DMSO-d6/TFA) δ 4.09 (t, 7=5.15 Hz, 2H), 4.87 (m, 2H), 7.11 (dd, 7=7.91, 4.60 Hz, IH), 7.19 (d, 7=8.09 Hz, IH), 7.44 (t, 7=7.72 Hz, IH), 7.58 (m,"SH), 7.84 (d, 7=8.09 Hz, IH), 8.34 (dd, 7=4.41, 1.84 Hz, IH), 8.42 (dd, 7=7.91, 1.65 Hz, IH). Example 67
3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-hydroxypropyl)-l,8- naphthyridin-2( lH)-one A solution of the product of Example 73 in THF (5 mL) was reacted with sodium borohydride (0.022 g, 0.58 mmol) at 0 °C for 30 minutes. The solution was poured into water and extracted with ethyl acetate. The extract was dried over sodium sulfate, filtered, concentrated and purified by preparative HPLC on a Waters Symmetry C8 column (40mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/0.1% aqueous TFA - over 12minutes (15 minute run time) at a flow rate of 70mL/min to produce the title compound. MS (DCI NH3) m/z 401 (M+H)+; 1H NMR (300 MHz, DMSO-de) δ 1.87 (m, 2H), 3.54 (t, 7=6.43 Hz, 2H), 4.55 (m, 2H), 7.52 (dd, 7=8.09, 4.78 Hz, IH), 7.56 (m, IH), 7.71 (d, 7=8.09 Hz, IH), 7.79 (m, IH), 7.94 (d, 7=8.09 Hz, IH), 8.58 (dd, 7=8.09, 1.84 Hz, IH), 8.90 (dd, 7=4.60, 1.65 Hz, IH), 14.13 (s, IH).
Example 68 l-cvclopentyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin- 2(lH)-one
Example 68A ethyl 2-(cyclopentylamino)nicotinate The title compound was prepared according to the procedure of Example 3 A substituting cyclopentylamine for 2-ethylbutylamine (0.231 g, 67 %). MS (ESI+) m/z 235.1 (M+H)+; !H NMR (300 MHz, CDC13) δ 1.37 (t, 7=7.17 Hz, 3H), 1.64 (m, 6H), 2.08 (m, 2H), 4.31 (q, 7=7.23 Hz, 2H), 4.45 (m, IH), 6.48 (dd, 7=7.72, 4.78 Hz, IH), 8.02 (d, 7=5.88 Hz, IH), 8.10 (dd, 7=7.91, 2.02 Hz, IH), 8.28 (dd, 7=4.78, 1.84 Hz, IH).
Example 68B l-cyclopentyl-2H-pyridor2,3-diri,31oxazine-2,4(lH)-dioήe The title compound was prepared according to the procedure of Example 3B substituting the product of Example 68A for the product of Example 3A (0.130 g, 56 %). MS (ESI+) m/z 221.08 (M+H)+; 1H NMR (300 MHz, CDC13) δ 1.66 (m, IH), 1.99 (m, 4H), 2.21
-168- (m, 2H), 5.79 (m, IH), 7.25 (dd, 7=8.09, 4.78 Hz, IH), 8.42 (dd, 7=7.72, 2.21 Hz, IH), 8.70 (dd, 7=4.78, 1.84 Hz, IH).
Example 68C l-cyclopentyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-1.8-naphthyridin- 2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 68B for the product of Example IB (0.133 g, 60 %). MS (ESI+) m/z 433.06 (M+H)+; !H NMR (300 MHz, DMSO-d6) δ 1.70 (m, 2H), .85 (m, 2H), 2.07 (s, 2H), 2.28 (m, 2H), 6.17 (m, 7=8.64, 8.64 Hz, IH), 7.52 (m, 2H), 7.65 (d, 7=7.72 Hz, IH), 7.77 (m, IH), 7.93 (d, 7=6.99 Hz, IH), 8.57 (dd, 7=7.91, 2.02 Hz, IH), 8.86 (dd,
7=4.78, 1.84 Hz, IH), 14.05 (br s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 1.63 (m, 2H), 1.79 (br s, 2H), 2.04 (m, 2H), 2.23 (m, 2H), 6.08 (m, IH), 7.31 (br s, IH), 7.43 (br s, 2H), 7.65 (d, 7=6.25 Hz, IH), 7.80 (br s, IH), 8.48 (d, 7=7.72 Hz, IH), 8.69 (br s, IH). Example 69
3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-l-r2-(l,3-dioxolan-2-yl)ethyll-4-hydroxy-l,8- naphthyridin-2(lH)-one Example 69A . l-r2-(1.3-dioxolan-2-yl)ethyl1-2H-pyridor2,3-dπi.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting 2-(2-bromomethyl)-l,3-dioxolane for n-butyl bromide (0.86 g, 53%). MS (DCI NH3) m/z 265 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.98 (m, 2H), 3.83 (m, 4H), 4.25 (m, 2H), 4.92 (m, IH), 7.38 (m, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.78 (dd, 7=4.96, 2.02 Hz, IH). Example 69B
3-(l.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-l-r2-(L3-dioxolan-2-yl)ethyll-4-hvdroxy-L8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 69A for the product of Example IB (0.89 g, 62%). MS (DCI NH3) m/z 443 (M+H)+; lB NMR (300 MHz, DMSO-d6) δ 2.03 (m, 2H), 2.50 (m, 2H), 3.84 (m, 2H), 4.59 (m, 2H), 4.97 (t, 7=4.60 Hz, IH), 7.51 (dd, 7=7.91,.4.60 Hz, IH), 7.56 (m, IH), 7.77 (m, 2H), 7.94 (m, IH), 8.56 (dd, 7=8.09, 1.84 Hz, IH), 8.89 (dd, 7=4.78, 1.84 Hz, IH), 14.09 (s, IH).
Example 70 l-(2.3-dihvdroxypropyl)-3-(l.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hydroxy-1.8- naphthyridin-2(lH)-one The product of Example 55B (1.08g, 0.028 mol) was reacted with osmium tetroxide
-169- (0.0007mol) and N-methylmorpholine N-oxide (4.96g, 0.043 mol) in a 1:1 mixture of water and THF (50 mL) at room temperature for 18 hours. The reaction mixture was treated with sodium bisulfite and diluted with water. The product precipitated from the aqueous mixture and was collected by vacuum filtration to give the title compound as a a white solid (1.09g, 93%). MS (DC17NH3) m/z 417 (M+H)+; ]H NMR (300 MHz, DMSO-d6) δ 3.33 (m, 2H), 3.87 (m, IH), 4.37 (m, 2H), 4.52 (t, 7=6.07 Hz, IH), 4.78 (d, 7=5.52 Hz, IH), 7.17 (dd, 7=7.72, 4.78 Hz, IH), 7.29 (m, 2H), 7.56 (m, IH), 7.67 (d, 7=6.99 Hz, IH), 8.40 (dd, 7=7.72, 1.84 Hz,"lH), 8.53 (dd, 7=4.78, 1.84 Hz, IH), 15.80 (m, IH).
Example 71 l-cvcloheptyl-S-d.l-dioxido^H-l^^-benzothiadiazin-S-yD^-hvdroxy-LS-naphthyridin-
2(lH)-one Example 71 A ethyl 2-(cvcloheptylamino)nicotinate The title compound was prepared according to the procedure of Example 3 A substituting cycloheptylamine for 2-ethylbutylamine (1.01 g, 83 %). MS (ESI+) m/z 263.1 (M+H)+. 1H NMR (300 MHz, CDC13) δ 1.37 (t, 7=7.17 Hz, 3H), 1.62 (m, 10H), 2.02 (m, 2H), 4.29 (m, IH), 4.31 (q, 7=7.35 Hz, 2H), 6.45 (dd, 7=7.72, 4.78 Hz, IH), 8.05 (d, 7=6.99 Hz, IH), 8.10 (dd, 7=7.91, 2.02 Hz, IH), 8.26 (dd, 7=4.78, 1.84 Hz, IH).
Example 7 IB l-cvcloheptyl-2H-pyridor2.3-din,31oxazine-2.4(lH)-dione
The title compound was prepared according to the procedure of Example 3B substituting the product of Example 71A for the product of Example 3A (0.205 g, 55 %). MS (ESI+) m/z 249.1 (M+H)+; 1H NMR (300 MHz, CDC13) δ 1.63 (m, 6H), 1.84 (m, 4H), 2.43 (m, 2H), 5.39 (s, IH), 7.24 (dd, 7=7.72, 4.78 Hz, IH), 8.40 (m, IH), 8.71 (dd, 7=4.78, 1.84 Hz, IH). •
Example 71C l-cycloheptyl-3-(l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hydroxy-1.8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 7 IB for the product of Example IB (0.041 g, 15 %). MS (ESI+) m/z 439.07 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 1.23 (m, 6H), 1.58 (m, 4H), 1.79 (m, 2H), 5.90 (m, IH), 7.45 (m, IH), 7.53 (m, IH), 7.66 (m, 7=9.56 Hz, IH), 7.74 (d, 7=7.72 Hz, IH), 7.90 (d, 7=6.25 Hz, IH), 8.54 (d, 7=7.35 Hz, IH), 8.85 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-de) δ 1.61 (m, 8H), 1.77 (m, 4H), 1.94 (m, 2H), 5.60 (m, IH), 7.10 (dd, 7=7.54, 4.60 Hz, IH), 7.54 (m, IH), 7.66 (dd, 7=7.72, 1.47 Hz, IH), 8.36 (dd, 7=7.72, 2.21 Hz, IH), 8.51 (dd, 7=4.78, 2.21 Hz, IH), 15.99 (s, IH).
-170- Example 72 l-(3-anilinopropyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one A solution of the product of Example 73 (0.090 g, 0.23 mmol) and aniline (0.15 mL, 5 0.23 mmol) in THF (6 mL) was treated with sodium triacetoxyborohydride (0.08 g, 0.38 mmol) and glacial acetic acid (0.025 mL, 0.43 mmol) at ambient temperature for 24 hours. The solvent was removed under vacuum and the resulting solid was purified by preparative HPLC oή\ a Waters Symmetry C8 column (40mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/0.1% aqueous TFA over 12 minutes (15 minutes run lό time) at a flow rate of 70mL/min to give the title compound. MS (DCIJNH3) m/z 476
(M+H)+. The title compound was dissolved in 1,4-dioxane (6 mL) and 4M HCl in dioxane (2 mL). After stirring at room temperature for 3 hours, the mixture was filtered and the filter cake was dried to yield the hydrochloride salt. 1H NMR (300 MHz, DMSO-d6) δ 2.11 (m, 2H), 3.32 (m, 2H), 4.59 (t, 7=6.80 Hz, 2H), 7.18 (s, 3H), 7.34 (d, 7=7.35 Hz, 2H), 7.52 (m, 15 IH), 7.57 (m, IH), 7.67 (d, 7=7.35 Hz, IH), 7.80 (m, IH), 7.94 (d, 7=7.72 Hz, IH), 8.59 (dd, 7=7.72, 1.84 Hz, IH), 8.89 (dd, 7=4.78, 1.84 Hz, IH), 13.96 (s, IH).
Example 73 3-r3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-1.8-naphthyridin-l(2H)- yllpropanal 20 A stirred suspension of the product of Example 69B (0.65 g, 0.15 mmol) in water (3 mL) and glacial acetic acid (12 mL) at ambient temperature was treated dropwise with sulfuric acid (1 mL). The mixture was heated to 60 °C for 1 hour, and then diluted with water. The mixture was filtered and the filter cake was washed with water and dried to produce the title compound (0.455 g, 78%). MS (DCI/NEL) m/z 399 (M+H)+; 1H NMR (300 25 MHz, DMSO-d6) δ 2.72 (m, 2H), 4.59 (t, 7=6.62 Hz, 2H), 7.17 (dd, 7=7.72, 4.78 Hz, IH), " 7.28 (m, IH), 7.55 (m, IH), 7.67 (d, 7=7.72 Hz, IH), 8.39 (dd, 7=7.72, 1.84 Hz, IH), 8.52 (dd, 7=4.78, 1.84 Hz, IH), 9.76 (t, 7=2.21 Hz, IH), 9.76 (t, 7=2.21 Hz, IH).
Example 74 methyl 4-{ r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l, 8- 30 naphthyridin- 1 (2H)-yl1methyl jbenzoate
Example 74A methyl 4-r(2,4-dioxo-2H-pyridor2,3-d1 \1 ,31oxazin-l(4H)-yl)methyllbenzoate The title compound was prepared according to the procedure of Example IB substituting methyl 4-(bromomethyl)benzoate for n-butyl bromide (1.5 g, 75%). MS (DCI) 35 m/z 313 (M+H)+.
Example 74B methyl 4- ( \3-( 1 , 1 -dioxido-4H- 1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo- 1.8-
-171- naphthyridin-1 (2H)-yl1methyl Ibenzoate The title compound was prepared according to the procedure of Example ID substituting the product of Example 74A for the product of Example IB (0.130 g, 37%). MS (ESI-) m/z 489 (M-H)'; 1H NMR (300 MHz, DMSO-d6) δ 3.82 (s, 3H), .76 (s, 2H), 7.42 (d, 5 7=8.09 Hz, 2H), 7.50 (m, 2H), 7.63 (d, 7=7.72 Hz, IH), 7.74 (t, 7=7.72 Hz, IH), 7.88 (d, 7=8.46 Hz, 2H), 7.93 (m, IH), 8.60 (dd, 7=8.09, 1.84 Hz, IH), 8.78 (d, 7=3.31 Hz, IH), 14.12 (br s, IH).
, Example 75 ethyl 5-{ r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin- lό l(2H)-yllmethyl)-2-furoate
Example 75A ethyl 5-r(2,4-dioxo-2H-pyridor2.3-dlll.31oxazin-l(4H)-yl)methyll-2-furoate The title compound was prepared according to the procedure of Example IB substituting ethyl 5-chloromethyl-2-furancarboxylate for n-butyl bromide (0.073 g, 19%). 1H 15 NMR (300 MHz, DMSO-d6) δ 1.34 (t, 7=7.17 Hz, 3H), 4.32 (q, 7=7.35 Hz, 2H), 5.56 (s, 2H), 6.49 (d, 7=3.68 Hz, IH), 7.09 (d, 7=3.31 Hz, IH), 7.31 (dd, 7=7.72, 4.78 Hz, IH), 8.44 (dd, 7=7.72, 1.84 Hz, IH), 8.76 (dd, 7=4.78, 1.84 Hz, IH).
Example 75B ethyl 5-i r3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-l,8-naphthyridin- 20 1 (2H)-yl1methyl 1 -2-furoate
The title compound was prepared according to the procedure of Example ID substituting the product of Example 75A for the product of Example IB (0.074 g, 69%). MS (DCJ7NH3) m/z 495 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 1.26 (t, 7=7.17 Hz, 3H), 4.26 (q, 7=7.23 Hz, 2H), 5.73 (s, 2H), 6.45 (d, 7=3.68 Hz, IH), 7.19 (d, 7=3.68 Hz, IH), 7.55 25 (m, 2H), 7.75 (m, 2H), 7.93 (d, 7=7.72 Hz, IH), 8.60 (dd, 7=7.91, 1.83 Hz, IH), 8.86 (dd, : 7=4.78, 1.84 Hz, IH), 13.80 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.27 (t, 7=7.17 Hz, 3H), 4.25 (q, 7=7.23 Hz, 2H), 5.55 (s, 2H), 6.22 (d, 7=3.31 Hz, IH), 7.14 (d, 7=3.31 Hz, IH), 7.20 (dd, 7=7.72, 4.60 Hz, IH), 7.29 (m, 2H), 7.56 (m, IH), 7.67 (d, 7=8.09 30 Hz, IH), 8.42 (dd, 7=7.72, 2.20 Hz, IH), 8.52 (dd, 7=4.60, 2.21 Hz, IH), 15.73 (s, IH).
Example 76 l-[3-(dimethylamino)propyn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-1.8- naphth yridin-2( lH)-one
A solution of the product of Example 73 (0.085 g, 0.21 mmol) and dimethylamine 35 (2.0 M in THF, 0.110 mL, 0.22 mmol) in tetrahyrofuran (4 mL) was reacted with sodium triacetoxyborohydride (0.06 g, 0.28 mmol) at room temperature for 1 hour. The solvent was removed under vacuum and the resulting solid was triturated with methanol and
-172- dimethylsulfoxide (1 : 1), filtered, and dried to product the title compound (0.56 g, 61%). (DCI NH3) m/z 428 (M+H)+.
The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.72 (m, 2H), 2.15 (s, 6H), 2.29 (t, 7=7.17 Hz, 2H), 4.28 (m, 2H), 7.14 (dd, 7=7.72, 4J8 Hz, IH), 7.27 (m, 2H), 7.55 (ddd, 7=8.27, 7.17, 1.47 Hz, IH), 7.67 (dd, 7=8.09, 1.47 Hz, IH), 8.37 (dd, 7=7.54, 2.02 Hz, IH), 8.53 (dd, 7=4.78, 1.84 Hz, IH), 15.93 (s, IH).
,} Example 77 l-{3-rr2-(dimethylamino)ethyl1(methyl)amino1propyl}-3-(l l-dioxido-4H-l,2,4- benzothiadiazin-3-yl)-4-hydroxy-1.8-naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example 72 substituting N,N,N-trimethylethylenediamine for aniline. MS (DCI/NH3) m/z 485 (M+H)+. The dihydrochloride salt of the title compound was prepared according to the procedure of Example 72. 1H NMR (300 MHz, DMSO-d6) δ 2.20 (s, 2H), 2.84 (m, 7=4.41 Hz, 6H), 3.50 (m, 9H), 4.54 (m, 2H), 7.54 (m, 3H), 7.77 (m, IH), 7.91 (d, 7=8.09 Hz, IH), 8.59 (dd, 7=8.09, 1.84 Hz, IH), 8.85 (dd, 7=4.60, 1.65 Hz, IH), 10.43 (s, IH), 14.25 (s, IH).
Example 78 3-(l,l-dioxido-4H-L2.4-benzothiadiazin-3-yl)-4-hydroxy-l-r3-(4-methyl-l- piperazinvDpropyll - 1.8-naphthyridin-2( lHVone The title compound was prepared according to the procedure of Example 72 substituting 4-methylpiperazine for aniline. MS (ESI-) m/z 450 (M-H)". The dihydrochloride salt of the title compound was prepared according to the procedure of Example 72. H NMR (300 MHz, DMSO-d6) δ 2.03 (m, 2H), 3.10 (m, 4H), 3.69 (m, 4H), 3.90 (m, 2H), 4.39 (s, 2H), 7.20 (dd, 7=7.72, 4.41 Hz, IH), 7.30 (m, 2H), 7.58 (m, IH), 7.68 (d, 7=7.72 Hz, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.55 (dd, 7=4.41, 1.84 Hz, IH), 15.71 (s, IH).
Example 79 - l-(2-aminoethyl)-3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8- naphthyridin-2(lH)-one A solution of Example 66 (45.0 mg, 0.087 mmol) in a mixture of absolute ethanol (1.5 mL), N,N-dimethylformamide (0.8 mL) and dimethyl sulfoxide (1.0 mL) was treated with hydrazine monohydrate (13.42 mg, 0.261 mmol) at room temperature. The mixture was then heated to reflux at 80 °C for 5 hours, cooled to room temperature, and concentrated. The concentrate was purified by a C8 HPLC column eluting with 20% to 80% acetonitrile in water with 1% trifluoroacetic acid to give the TFA salt of the title compound (0.010 g, 23%). MS (APCI+) m/z 386 (M+H)"; 1H NMR (300 MHz, DMSO-d6) δ 3.20 (dd, 7=11.95, 6.80 Hz, 2H), 4.62 (t, 7=5.52 Hz, 2H), 7.27 (m, IH), 7.39 (m, 2H), 7.65 (t, 7=7.35 Hz, IH), 7.75 (d, 7=7.72 Hz, IH), 7.82 (br s, 3H), 8.42 (d, 7=9.56 Hz, IH), 8.61 (d, 7=3.31 Hz, IH), 15.18 (br
-173- s, IH).
Example 80 l-r3-(diethylamino)propyn-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- 5 naphthyridin-2( lH)-one
The title compound was prepared according to the procedure of Example 72 substituting diethylamine for aniline. MS (DCI/NH3) m/z 456 (M+H)+. The hydrochloride salt of thό title compound was prepared according to the procedure of Example 72. !H NMR (300 MHz, DMSO-d6) δ 1.19 (t, 7=7.17 Hz, 6H), 2.15 (m, 2H), 3.12 (m, 6H), 4.55 (t, 7=6.62 lό Hz, 2H), 7.57 (m, 2H), 7.66 (m, IH), 7.80 (m, IH), 7.95 (d, 7=8.09 Hz, IH), 8.61 (dd, 7=7.72, 1.84 Hz, IH), 8.90 (dd, 7=4.60, 1.65 Hz, IH), 10.05 (s, IH), 13.92 (s, IH).
Example 81 1 -cyclohexyl-3 -( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 ,8-naphthyridin-
2(lH)-one 15
Example 81 A ethyl 2-(cyclohexylamino)nicotinate The title compound was prepared according to the procedure of Example 3 A substituting cyclohexylamine for 2-ethylbutylamine (1.92 g, 61 %). MS (ESI+) m/z 249.1 20 (M+H)+; 1H NMR (300 MHz, CDC13) δ 1.38 (m, 7H), 1.61 (m, 2H), 1.75 ( , 2H), 2.02 (m, 2H), 4.08 (m, IH), 4.31 (q, 7=7.11 Hz, 2H), 6.46 (dd, 7=7.72, 4.78 Hz, IH), 7.99 (d, 7=7.72 Hz, IH), 8.10 (dd, 7=7.72, 2.21 Hz, IH), 8.25 (dd, 7=4.78, 1.84 Hz, IH).
Example 8 IB 25 l-cvclohexyl-2H-pyridor2,3-diri,31oxazine-2.4(lH)-dione
The title compound was prepared according to the procedure of Example 3B substituting the product of Example 81 A for the product of Example 3 A (0.171 g, 35 %). 1H NMR (300 MHz, CDC13) δ 1.37 (m, 4H), 1.73 (m, 2H), 1.91 (m, 2H), 2.47 (ddd, 7=24.82, 12.32, 3.31 Hz, 2H), 5.28 (tt, 7=12.27, 3.72 Hz, IH), 7.24 (dd, 7=6.99, 4.04 Hz, IH), 8.41 30 (dd, 7=7.72, 2.21 Hz, IH), 8.70 (dd, 7=4.78, 2.21 Hz, IH).
Example 81C 1 -cyclohexyl-3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 ,8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example ID 35 substituting the product of Example 8 IB for the product of Example IB (0.073 g, 26 %). MS (ESI+) m/z 425.04 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.25 (m, 4H), 1.76 (m, 4H), 1.91 (s, 2H), 5.64 (s, IH), 7.48 (dd, 7=8.09, 4.78 Hz, IH), 7.55 (t, 7=7.54 Hz, IH), 7.69 (m,
-174- 7=8.09 Hz, IH), 7.77 (m, IH), 7.92 (d, 7=8.09 Hz, IH), 8.56 (dd, 7=8.09, 1.84 Hz, IH), 8.86 (d, 7=2.21 Hz, IH), 14.12 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI+) m/z 425.04 (M+H)+, 447.1 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 1.31 (m, 4H), 1.52 (d, 7=10.66 Hz, 2H), 1.63 (m, 2H), 1.83 (m, 7=12.50 Hz, 2H), 5.41 (t, 7=11.03 Hz, IH), 7.11 (dd, 7=7.72, 4.78 Hz, IH), 7.27 (m, 2H), 7.55 (m, IH), 7.66 (d, 7=6.62 Hz, IH), 8.37 (dd, 7=7.72, 2.21 Hz, IH), 8.50 (dd, 7=4.60, 2.02 Hz, IH), 15.94 (s, IH).
,^ Example 82
3-(lJ-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r3-(4-morpholinyl)propyl1-l,8- naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example 72 substituting morpholine for aniline (0.053 g 60%). MS (ESI-) m/z 450 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 2H NMR (300 MHz, DMSO-d6) δ 2.03 (m, 2H), 3.10 (m, 4H), 3.69 (m, 4H), 3.90 (m, 2H), 4.39 (s, 2H), 7.20 (dd, 7=7.72, 4.41 Hz, IH), 7.30 (m, 2H), 7.58 (m, IH), 7.68 (d, 7=7.72 Hz, IH), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.55 (dd, 7=4.41, 1.84 Hz, IH), 15.71 (s, IH).
Example 83 5-{ r3-(Ll-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxo-L8-naphthyridin-l(2H)- yl"lmethyl ,-2-furoic acid A solution of the product of Example 75B (23 mg, 0.046 mmol) in THF (1 mL) was treated with IN NaOH (0.2 mL) at room temperature. After 3 hours, the mixture was treated with H20 (5 mL), adjusted to pH 4 with IN HCl, and extracted with ethyl acetate (2 x 25 mL). The extracts were washed with saturated NaCI, dried over anhydrous Na2S0 , filtered, and concentrated. The resulting solid was purified by preparative HPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/0.1% aqueous TFA over 8 minutes (10 minute run time) at a flow rate of 40mIJmin to give the title compound (0.039 g, 83%). MS (ESI-) m/z 465 (M-H)"; 1H NMR (300 MHz, DMSO-de) δ 5.72 (s, 2H), 6.42 (d, 7=3.68 Hz, IH), 7.11 (d, 7=3.31 Hz, IH), 7.53 (m, 2H), 7.68 (d, 7=7.72 Hz, IH), 7.76 (m, IH), 7.92 (d, 7=7.72 Hz, IH), 8.60 (dd, 7=8.09, 1.84 Hz, IH), 8.86 (dd, 7=4.78, 1.84 Hz, IH), 13.90 (s, IH).
Example 84 l-benzyl-3-(7-bromo-l,l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8- naphthyridin-2(lH)-one
Example 84A
2-amino-5-bromobenzenesulfonamide The title compound was prepared from 4-bromoaniline using the procedure described
-175- in JCS Perkin 1, 1979, 1043.
Example 84B ethyl l-benzyl-4-hydroxy-2-oxo-l,2-dihydro-l,8-naphthyridine-3-carboxylate To a slurry of sodium hydride (60%, 0.118 g, 2.95 mmol) in anhydrous dimethylacetamide (6 mL) at 0 °C under N2 was added diethyl malonate (0.472 g, 2.95 mmol) dropwise over 5 minutes. The mixture was stirred at ambient temperature for 1 hour, reacted with the product of Example. 15A (0.50 g, 1.97 mmol), and heated at 120 °C for 3 hours. The mixture was cooled to ambient temperature and partitioned between ethyl acetate and cold water, and adjusted to pH to 5 with 1 M HCl. The aqueous layer was extracted with ethyl acetate (2 x 100 mL) and the combined extracts were washed with brine, dried over magnesium sulfate, filtered, and concentrated under vacuum. The residue was recrystallized from methanol to give the title compound as a white solid (0.439 g, 68 %). MS (ESI+) m/z 325.0 (M+H)+, 347.0 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 1.30 (t, 7=7.17 Hz, 3H), 4.32 (q, 7=7.23 Hz, 2H), 5.55 (s, 2H), 7.23 (m, 5H), 7.37 (dd, 7=7.91, 4.60 Hz, IH), 8.45 (dd, 7=7.91, 2.02 Hz, IH), 8.71 (dd, 7=4.78, 1.84 Hz, IH), 13.00 (s, IH).
Example 84C N-f2-(aminosulfonyl)-4-bromophenyll-l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-L8- naphthyridine-3-carboxamide The product of Example 84B (0.065 g, 0.20 mmol) was reacted with the product of Example 84A (0.050 g, 0.20 mmol) in toluene (4 mL) at reflux for 3 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give to give the title compound as an off-white solid (0.074 g, 70 %). MS (ESI+) m/z 528.9 (M+H)+, 530.9 (M+H)+, 551.1 (M+Na)+, 552.9 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 5.67 (s, 2H), 7.23 (m, 2H), 7.29 (m, 3H), 7.48 (dd, 7=8.09, 4.78 Hz, IH), 7.69 (s, 2H), 7.87 (dd, 7=8.82, 2.21 Hz, IH), 7.97 (m, IH), 8.01 (d, 7=2.21 Hz, IH), 8.55 (dd, 7=7.91, 1.65 Hz, IH), 8.82 ' (dd, 7=4.60, 1.65 Hz, IH), 12.44 (s, IH), 16.45 (s, IH).
Example 84D l-benzyl-3-(7-bromo-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one A mixture of the product of Example 84C (0.074 g, 0.14 mmol) in aqueous potassium hydroxide (10%, 5 mL) was heated to reflux for 16 hours, cooled to room temperature and adjusted to pH 3 with 6 M HCl. The mixture was filtered and the filter cake was washed with water, triturated with tetrahydrofuran/water, filtered, and dried under vacuum to give the title compound (0.060 g, 84 %). MS (ESI+) m/z 511.0 (M+H)+, 512.9 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 5.62 (s, 2H), 7.21 (m, IH), 7.27 (m, 7=4.41 Hz, 5H), 7.36 (m, IH), 7.50 (d, 7=8.82 Hz, IH), 7.84 (dd, 7=8.82, 1.84 Hz, IH), 7.95 (s, IH), 8.51 (dd, 7=7.91, 1.65 Hz, IH), 8.68 (m, IH). The sodium salt of the title compound was prepared according to the
-176- procedure of Example ID. MS (ESI+) m/z 511.0 (M+H-Na)+, 512.9 (M+H-Na)+; JH NMR (300 MHz, DMSO-d6) δ 5.52 (s, 2H), 7.17 (m, 2H), 7.24 (m, 5H), 7.71 (m, IH), 7.76 (d, 7=2.21 Hz, IH), 8.40 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.60, 2.02 Hz, IH), 16.09 (s, IH). Example 85 l-benzyl-3-(l,l-dioxido-7-phenyl-2H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one <) Example 85A
N-13-(aminosulfonyI)-l , 1 -biphenyl-4-yn-l-benzyl-4-hydroxy-2-oxo-l ,2-dihydro-l,8- naphthyridine-3-carboxamide
The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-phenylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.084 g, 79 %). MS (ESI+) m z 527.1 (M+H)+, 549.1 (M+Na)+; !H NMR (300 MHz, DMSO-d6) δ 5.68 (s, 2H), 7.2-7.8 (m, 13H), 7.98 (s, IH), 8.09 (s, IH), 8.17 (s, IH), 8.54 (s, IH), 8.81 (s, IH), 12.49 (s, IH), 16.67 (s, IH).
Example 85B l-benzyl-3-(l,l-dioxido-7-phenyl-2H-L2,4-benzothiadiazin-3-yl)-4-hydroxy- 8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 85 A for the product of Example 84C (0.055 g, 69 %). MS (ESI+) m/z 509.1 (M+H)+; 1H NMR (300 MHz, DMSO-dg) δ 5.71 (s, 2H), 7.24 (m, IH), 7.30 (m, 3H), 7.49 (m, 4H), 7.79 (m, 7=7.35 Hz, 3H), 8.07 (m, 7=11.03, 2.21 Hz, 2H), 8.60 (dd, 7=7.91, 1.65 Hz, IH), 8.81 (m, 7=3.68 Hz, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI+) m/z 531.0 (M+), 509.1 (M-Na+H)+; !H NMR (300 MHz, DMSO-d6) δ 5.53 (s, 2H), 7.17 (m, 2H), 7.25 (m, 7=4.41 Hz, 4H), 7.39 (m, 2H), 7.49 (t, 7=7.54 Hz, 2H), 7.71 (d, 7=6.99 Hz, 2H), 7.89 (m, 2H), 8.42 (dd, 7=7.72, 1.84 Hz, IH), 8.49 (dd, 7=4.60, 2.02 Hz, IH), 15.99 (s, IH).
Example 86 l-benzyl-3-(7-cyclohexyl-l J-dioxido^H-l^^-benzothiadiazin-S-vD^-hydroxy-LS- naphthyridin-2(lH)-one Example 86A 2-amino-5-cvclohexylbenzenesulfonamide A solution of 4-cyclohexylaniline (0.877 g, 5.0 mmol, 1.0 eq) in nitroethane (5 mL) was cooled to -40 °C, treated dropwise with chlorosulfonyl isocyanate (0.87 g, (0.523 mL, 6.15 mmol, 1.23 eq), warmed to 0 °C, treated with aluminum trichloride (0.85 g, 6.35 mmol, 1.27 eq), heated in a 110 °C oil bath for 30 minutes, cooled to ambient temperature, and
-177- poured into 200 mL of ice water. The mixture was filtered and the filter cake was rinsed with cold water, dissolved in 50% H2S04 (25 mL), heated to reflux for 4 hours, cooled to ambient temperature, poured into 200 mL of ice water, and carefully neutralized to pH 7 with 40% NaOH. The reaction mixture was extracted with ethyl acetate (3 x 100 mL) and the combined extracts were washed with brine, dried (MgSO ), filtered, and concentrated to give 0.40 g of the desired product (31% yield). MS (ESI+) m/z 255.0 (M+H)+, 272.1 (M+H2O)+, 277.0 (M+Na)+; Η NMR (300 MHz, DMSO-d ) δ 1.32 (m 4H), 1.71 (m, 6H), 2.36 (m, IH), 5.64 (s, 2H), 6.72 (d, 7=8.09 Hz, IH), 7.11 (dd, 7=8.46, 2.21 Hz, IH), 7.16 (s, 2H), 7.38 (d, 7=2.21 Hz, IH). Example 86B
N-[2-(aminosulfonyl)-4-cvclohexylphenyll-l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdro-l,8- naphthyridine-3 -c arboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 86A for 2-amino-5-bromobenzenesulfonamide (0.081 g, 76 %). MS (ESI+) m/z 533.1 (M+H)+, 555.2 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 1.27 (m, IH), 1.45 (m, 4H), -1.72 (m, IH), 1.85 (m, 4H), 2.61 (m, IH), 5.68 (s, 2H), 7.26 (m, 4H), 7.50 (m, 4H), 7.76 (d, 7=1.84 Hz, IH), 7.86 (d, 7=8.46 Hz, 2H), 8.54 (dd, 7=8.09, 1.47 Hz, IH), 8.80 (s, IH), 12.31 (s, IH), 16.78 (s, IH).
Example 86C l-benzyl-3-(7-cvclohexyl-l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-L8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 86B for the product of Example 84C (0.040 g, 53 %). MS (ESI+) m/z 533.1 (M+H+H20)+, 555.1 (M+H20+Na)+, 515.1 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.34 (m, 5H), 1.77 (m, 5H), 2.60 (m, IH), 5.66 (s, 2H), 7.25 (m, 4H),
7.51 (m, 7=9.56 Hz, 4H), 7.88 (s, IH), 8.54 (s, IH), 8.80 (s, IH), 12.31 (s, IH), 16.78 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.41 (m, 5H), 1.70 (m, 5H), 3.79 (m, IH),
5.52 (s, 2H), 7.12 (dd, 7=7.54, 4.60 Hz, IH), 7.17 (m, IH), 7.23 (m, 4H), 7.41 (dd, 7=8.64, 2.02 Hz, IH), 7.67 (d, 7=2.21 Hz, IH), 8.33 (d, 7=8.46 Hz, IH), 8.38 (dd, 7=7.72, 1.84 Hz,
IH), 8.43 (dd, 7=4.60, 2.02 Hz, IH), 11.15 (s, IH).
Example 87 l-benzyl-3-(7-tert-butyl-l.l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hydroxy-L8- naphthyridin-2(lH)-one Example 87A
N-r2-(aminosulfonyl)-4-tert-butylphenvn-l-benzyl-4-hydroxy-2-oxo-l,2-dihydro-1.8- naphth yridine-3 -c arboxamide
-178- The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-tert-butylbenzenesulfonamide for 2-amino-5- bromobenzenesulfonamide (0.072 g, 79 %). MS (ESI+) m/z 507.12 (M+H)+, 524.2 (M+H20)+, 529.1 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 1.33 (s, 9H), 5.68 (s, 2H), 7.22 (m, IH), 7.29 (m, 7=3.68 Hz, 4H), 7.47 (m, 3H), 7.70 (dd, 7=8.64, 2.39 Hz, IH), 7.88 (d, 7=8.82 Hz, IH), 7.91 (d, 7=2.21 Hz, IH), 8.54 (dd, 7=8.09, 1.84 Hz, IH), 8.81 (dd, 7=4.60, 1.65 Hz, IH), 12.33 (s, IH), 16.79 (s, IH).
^ Example 87B l-benzyl-3-(7-tert-butyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy- 8- naphthyridin-2(lH)-one
The title compound was prepared according to the procedure of Example 84D substituting the product of Example 87A for the product of Example 84C (0.040 g, 100 %). MS (ESI+) m/z 489.1 (M+H)+, 511.1 (M+Na)+; 1H NMR (300 MHz, DMSO-d6) δ 1.34 (s, 9H), 5J0 (s; 2H), 7.22 (m, IH), 7.29 (m, 7=4.41 Hz, 4H), 7.48 (m, IH), 7.59 (d, 7=8.82 Hz, IH), 7.75 (s, IH), 7.81 (d, 7=10.66 Hz, lH), 8.58 (d, 7=6.62 Hz, IH), 8.79 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.32 (s, 9H), 5.53 (s, 2H), 7.18 (m, 2H), 7.25 (m, 7=4.41 Hz, 5H), 7.59 (s, IH), 7.65 (m, IH), 8.42 (d, 7=7.35 Hz, IH), 8.50 (m, 7=3.86, 2.02 Hz, IH).
Example 88
1 -benzyl-4-hydroxy-3 -(7 -methyl- 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3-vD- 1,8- naphthyridin-2(lH)-one Example 88A N- r2-(aminosulf on yl)-4-methylphen yll - 1 -benzyl-4-hydrox v-2-oxo- 1 ,2-dihydro- 1.8- naphthyridine-3-c arboxamide
The title compound was prepared according to the procedure of Example 84C substituting 2-amino-5-methylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.075 g, 90 %). MS (ESI+) m/z 465.1 (M+H)+, 482.0 (M+H20)+, 487.1 (M+Na)+. 1H NMR (300 MHz, DMSO-de) δ 2.39 (s, 3H), 5.68 (s, 2H), 7.23 (m, IH), 7.29 (m, 4H), 7.47 (m, 4H), 7.73 (d, 7=1.47 Hz, IH), 7.84 (d, 7=8.09 Hz, IH), 8.54 (dd, 7=7.72, 1.84 Hz, IH), 8.81 (dd, 7=4.60, 1.65 Hz, IH), 12.30 (s, IH), 16.78 (s, IH).
Example 88B l-benzyl-4-hvdroxy-3-(7-methyl-Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 88 A for the product of Example 84C (0.031 g, 42 %). MS (ESI+) m/z 447.0 (M+H)+, 469.1 (M+Na)+. 1H NMR (300 MHz, DMSO-de) δ 2.41 (s,
-179- 3H), 5.65 (s, 2H), 7.24 (m, 5H), 7.45 (m, 3H), 7.66 (s, IH), 8.54 (d, 7=7.72 Hz, IH), 8.72 (s, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.37 (s, 3H), 5.55 (s, 2H), 7.21 (m, 7H), 7.41 (d, 7=8.46 Hz, IH), 7.51 (s, IH), 8.43 (d, 7=8.09 Hz, IH), 8.53 (s, IH). 5
Example 89 l-butyl-3-(6-chloro-l,l-dioxido-4H-L2,4-benzothιadιazm-3-yl)-4-hvdroxy-L8-naphthyridin- 2(lH)-one
lό Example 89A ethyl l-butyl-4-hydroxy-2-oxo-l,2-dihydro-l,8-naphthyridine-3-carboxylate To a slurry of NaH (95%, 0.44 g, 18.2 mmol) in 15 mL anhydrous DMA at 10 °C under N2 was added diethyl malonate (2.9 g, 18.2 mmol) dropwise over 10 minutes. The mixture was stirred at ambient temperature for 30 minutes, treated with the product of
15 Example IB (2.0 g, 9.1 mmol) and heated at 120 °C for 3 hours. The mixture was cooled to ambient temperature and partitioned between ethyl acetate and cold water adjusting the pH to 5 with 1 M HCl. The organic layer was washed 2 x 100 mL with water, 2 x 100 mL with saturated brine, dried (Na2S04), filtered and the filtrate was concentrated under vacuum. The residue was recrystallized from hexane/ethyl acetate to give the desired compound as a
20 white solid (1.84 g, 70% yield). MS (APCI+) m/z 291 (M+H)+.
Example 89B N-r2-(aminosulfonyl)-4-chlorophenyll-l-butyl-4-hydroxy-2-oxo-1.2-dihydro-l,8- naphthyridine-3-carboxamide 25 A mixture of the product of Example 89A (87 mg, 0.3 mmol) and 2-amino-4- chlorobenzenesulfonamide (62 mg, 0.3 mmol) in toluene (5 mL) was refluxed for 16 hours, cooled, and the resulting precipitate was collected by filtration and dried to give the desired amide as an off-white solid (80 mg, 59% yield). MS (APCI+) m/z 451 (M+H)+. 30
Example 89C ethyl l-butyl-4-hydroxy-2-oxo-l,2-dihvdro-l,8-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 84C substituting the product of Example 89B for the product of Example 84B (0.037 g, 53%). 35 MS (ESI-) m/z 431 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ 0.93 (t, 7=7.17 Hz, 3H), 1.34 ( , 2H), 1.58 (m, 2H), 4.27 (m, 2H), 7.14 (dd, 7=7.72, 4J8 Hz, IH), 7.32 (dd, 7=8.27,
-180- 2.02 Hz, IH), 7.42 (d, 7=1.84 Hz, IH), 7.68 (d, 7=8.46 Hz, IH), 8.37 (dd, 7=7.54, 2.02 Hz, IH), 8.54 (dd, 7=4.78, 1.84 Hz, IH), 16.09 (s, IH).
Example 90 1 -benzyl-3-(8-bromo-5-methyl- 1 , 1 -dioxido-4H- 1 ^Λ-benzothiadiazin-S -yl)-4-hydroxy- 1,8- naphthyridin-2( lH)-one
>• Example 90A
N-[2-(aminosulfonyl)-3-bromo-6-methylphenyl]-l-benzyl-4-hydroxy-2-oxo-l,2-dihydro-l,8- naphthyridine-3-carboxamide
The title compound was prepared according to the procedure of Example 84C substituting 2-amino-6-bromo-3-methylbenzenesulfonamide for 2-amino-5- bromobenzenesulfonamide to give the crude title compound (0.1 g, 98%).
Example 90B l-benzvI-3-(8-bromo-5-methyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 90A for the product of Example 84C. The crude product was purified by column chromatography with silica gel eluting with dichloromethane and methanol (98:2) to give the title compound as a white solid, (0.03 g, 31% yield). MS (ESI-) m/z 525 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ 16.0 (br s, IH), 8.49 (dd, 7=4.8, 1.8 Hz, IH), 8.44 (dd, 7=7.7, 1.8 Hz, IH), 7.45 (br s, IH), 7.37 (m, IH), 7.23 (m, 3H), 7.16 (dd, 7=4.8, 3.3 Hz, IH), 7.01 (m, IH), 6.85 (d, 7=7.7 Hz, IH), 5.53 (br s, 2H), 2.43 (s,* 3H).
Example 91 l-benzyl-3-(8-fluoro-5-methyl-l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one
Example 91 A N-r2-(aminosulfonyl)-3-fluoro-6-methylphenyll-l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-1.8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-6-fluoro-3-methylbenzenesulfonamide for 2-amino-5- bromobenzenesulfonamide to give the crude title compound (0.120 g, 100%).
-181- Example 9 IB l-benzyl-S-fδ-fluoro-S-methyl-l.l-dioxido^H-l^ -benzothiadiazin-S-yD^-hydroxy-l.δ- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 91 A for the product of Example 84C. The crude product was purified by column chromatography with silica gel eluting with dichloromethane and methanol 98:2) as a white solid, (0.05 g, 44% yield). MS (ESI-) m/z 463 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 16.1 (br s, IH), 8.49 (dd, 7=4.6, 2.0 Hz, IH), 8.44 (dd, 7=7.7, 1.8 Hz, IH), 7.59 (m, IH), 7.47 (dd, 7=7.3, 5.8 Hz, IH), 7.38 (m, IH), 7.21 (m, 3H), 7.16 (dd, 7=7.7, 5.8 Hz, IH), 6.99 (t, 7=8.8 Hz, IH), 5.53 (s, 2H), 2.42 (s, 3H).
Example 92 l-benzyl-4-hvdroxy-3-(5-isopropyl-l,l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-1.8- naphthyridin-2(lH)-one
Example 92A N-r2-(aminosulfonyl)-6-isopropylphenyll-l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-1.8- naphthyridine-3-carboxamide
The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-isopropylbenzenesulfonamide for 2-amino-5- bromobenzenesulfonamide (0.050 g, 55 %) after chromatrography on silica gel (eluting with 4:1 hexane/ethyl acetate). 1H ΝMR (300 MHz, DMSO-d5) δ H ΝMR (300 MHz, DMSO- d6) δ 1.12 (d, 7=6.62 Hz, 3H), 1.26 (d, 7=6.99 Hz, 3H), 3.06 (m, IH), 5.69 (m, 2H), 7.27 (m, 5H), 7.39 (s, 2H), 7.48 (dd, 7=7.72, 4J8 Hz, IH), 7.55 (t, 7=7.72 Hz, IH), 7.71 (d, 7=8.09 Hz, IH), 7.80 (dd, 7=7.72, 1.10 Hz, IH), 8.53 (dd, 7=7.91, 1.65 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH), 11.75 (s, IH), 16.83 (s, IH).
Example 92B l-benzyl-4-hvdroxy-3-(5-isopropyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8- naphthyridm-2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 92a for the product of Example 84C (0.038 g, 75 %). MS (ESI+) m/z 475.1 (M+H)+, 492.1 (M+H2O)+, 497.1 (M+Νa)+. JH NMR (300 MHz, DMSO-de) δ 1.34 (d, 7=6.62 Hz, 6H), 3.30 (m, IH), 5.73 (s, 2H), 7.27 (m, 5H), 7.54 (m, 2H), 7.78 (m, 7=16.18, 7.72 Hz, 2H), 8.62 (dd, 7=7.91, 1.65 Hz, IH), 8.84 (s, IH), 14.64 (s,
-182- IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.32 (d, 7=6.62 Hz, 6H), 3.42 (m, IH), 5.53 (s, 2H), 7.15 (m, 2H), 7.25 (m, 7=4.41 Hz, 4H), 7.29 (m, IH), 7.53 (m, 7=7.72, 1.84 Hz, 2H), 8.46 (m, 2H), 16.06 (s, IH).
Example 93 1 -benzyl-4-hydroxy-3-(5 -methyl- 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)- 1,8- ^ naphthyridin-2( lH)-one
Example 93A
N-r2-(aminosulf onyl)-6 -methylphen yll - 1 -benz yl-4-hydrox v-2-oxo- 1 ,2-dihydro- 1,8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-methylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.059 g, 100 %). 1H ΝMR (300 MHz, DMSO-d6) δ 2.27 (s, 3 H) 5.68 (m, 2 H) 7.24 (m, 5 H) 7.46 (m, 4 H) 7.59 (d, 7=6.99 Hz, 1 H) 7.79 (d, 7=7.72 Hz, 1 H) 8.54 (dd, 7=8.09, 1.84 Hz, 1 H) 8.83 (dd, 7=4.78, 1.84 Hz, 1 H) 11.90 (s, 1 H) 16.79 (s, 1 H).
Example 93B l-benzyl-4-hydroxy-3-(5-methyI-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-L8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 93A for the product of Example 84C (0.015 g, 25 %) after silica gel chromatography (eluting with 98:2 dichloromethane/methanol). MS (ESI+) m/z 447.0 (M+H)+, 469.1 (M+Νa)+. 1H NMR (300 MHz, -d6) δ 2.52 (m, 3 H) 5.75 (m, 2 H) 7.23 (m, 1 H) 7.30 (m, 4 H) 7.47 (t, 7=7.72 Hz, 1 H) 7.53 (dd, 7=8.09, 4.78 Hz, 1 H) 7.69 (d, 7=7.35 Hz, 1 H) 7.79 (d, 7=8.09 Hz, 1 H) 8.63 (dd, 7=7.72, 1.84 Hz, 1 H) 8.85 (dd, 7=4.78, 1.84 Hz, 1 H) 14.41 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ld. 1H NMR (300 MHz, DMSO-d6) δ 2.48 (s, 3 H) 5.56 (s, 2 H) 7.21 (m, 6 H) 7.49 (d, 7=7.35 Hz, 1 H) 7.56 (d, 7=7.35 Hz, 1 H) 8.47 (d, 7=7.72 Hz, 1 H) 8.53 (s, 1 H) 11.98 (s, 1 H).
Example 94 l-benzyl-3-(5-bromo-l ,l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l ,8- naphthyridin-2(lH)-one
Example 94A
-183- N-r2-(aminosulfonyl)-6-bromophenyn-l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-l,8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-methylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.080 g, 25 %) after silica gel chromatography (eluting with 2:1 hexane/ethyl acetate). MS (ESI+) m/z 529.0 (M+H)+, 530.9 (M+H)+. 1H ΝMR (300 MHz, DMSO-d6) δ 5.71 (m, 2 H) 7.23 (m, 1 H) 7.32 (m, 4 H) 7.50 (m, 2 H) 7.62 (s, 2 H) 7.96 (dd, 7=7.91, 1.29 Hz, 1 H) 8.02 (dd, 7=7.91, 1.29 Hz, 1 H) 8.55 (dd, 7=7.91, 1.65 Hz, 1 H) 8.85 (dd, 7=4.78, 1.84 Hz, 1 H) 11.95 (s, I H) 16.51 (s, 1 H).
Example 94B 1 -benzyl-3-(5-bromo- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 94A for the product of Example 84C (0.040 g, 54 %). MS (ESI+) m/z 510.9 (M+H)+, 512.9 (M+H)+. 1H ΝMR (300 MHz, DMSO-d6) δ 5.56 (s, 2 H) 7.23 (m, 8 H) 7J6 (d, 7=8.46 Hz, 1 H) 7.94 (d, 7=8.09 Hz, 1 H) 8.46 (dd, 7=7.72, 1.84 Hz, 1 H) 8.55 (m, 1 H) 16.17 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ld. 1H ΝMR (300 MHz, DMSO-d6) δ 5.53 (s, 2 H) 7.17 (m, 2 H) 7.25 (m, 5 H) 7.71 (d, 7=6.99 Hz, 1 H) 7.90 (m, 1 H) 8.43 (dd, 7=7.72, 1.84 Hz, 1 H) 8.49 (dd, 7=4.60, 2.02 Hz, 1 H) 16.38 (s, 1 H).
Example 95 l-benzyl-3-(l,l-dioxido-5-propyl-2H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one
Example 95A N-r2-(aminosulfonyl)-6-propylphenyl1-l-benzyl-4-hydroxy-2-oxo-L2-dihvdro-l,8- naphthyridine-3 -c arboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-propylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.062 g, 59%). MS (DCI/ΝH3) m/z 493 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 0.83 and 0.93 (two t, 7=7.35 Hz, 3H), 1.57 (m, 2H), 2.57 (m, 2H), 5.66 (m, 2H), 7.28 (m, 5H), 7.41 (s, 2H), 7.48 (m, 2H), 7.61 (m, IH), 7.81 (dd, 7=7.72, 1.47 Hz, IH), 8.53 (dd, 7=7.91, 1.65 Hz, IH), 8.83 (dd, 7=4.78, 1.84 Hz, IH), 11.82 (s, IH), 16.80 (s, IH).
Example 95B
-184- l-benzyl-3-(Ll-dioxido-5-propyl-2H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-1.8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 95 A for the product of Example 84C (0.029 g, 50%). MS (ESI-) m/z 473 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dβ) δ 1.03 (t, 7=7.17 Hz, 3H), 1.68 (m, 2H), 2.83 (t, 7=7.72 Hz, 2H), 5.53 (s, 2H), 7.19 (m, 7H), 7.44 (d, 7=6.25 Hz, IH), 7.53 (d, 7=7.35 Hz, IH), 8.43 (dd, 7=7.54, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.84 Hz, IH), 16.02 (s, IH).
Example 96 1 -benzyl-3-(5-ethyl- 1.1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 , 8-naphthyridin-
2(lH)-one
Example 96A
N-r2-(aminosulfonyl)-6-ethylphenyll-l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-l,8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 2-amino-3-ethylbenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.070 g, 74%). MS (ESI-) m/z 479 (M+H)+. 1H ΝMR (300 MHz, DMSO-d6) δ 1.17 (t,
7=7.54 Hz, 3H), 2.61 (q, 7=7.60 Hz, 2H), 5J0 (m, 2H), 7.27 (m, 5H), 7.42 (s, 2H), 7.49 (m, 2H), 7.63 (m, IH), 7.81 (dd, 7=7.91, 1.29 Hz, IH), 8.53 (dd, 7=7.91, 1.65 Hz, IH), 8.83 (dd, 7=4.41, 1.84 Hz, IH), 11.82 (s, IH), 16.80 (s, IH).
Example 96B l-benzyl-3-(5-ethyl-l.l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 96A for the product of Example 84C (0.060 g, 93%). MS (ESI-) m/z 459 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ 1.30 (t, 7=7.54 Hz, 3H), 2.86 (q, 7=7.35 Hz, 2H), 5.53 (s, 2H), 7.14 (dd, 7=7.72, 4.78 Hz, IH), 7.22 (m, 6H), 7.46 (d, 7=7.72 Hz, IH), 7.53 (d, 7=7.72 Hz, IH), 8.44 (dd, 7=7.72, 1.84 Hz, IH), 8.48 (dd, 7=4.78, 1.83 Hz, IH), 15.98 (s, IH).
Example 97 3-(l-benzyl-4-hydroxy-2-oxo-1.2-dihvdro-l,8-naphthyridin-3-yl)-2H-l,2,4-benzothiadiazine-
-185- 5-carbonitrile 1,1-dioxide The product of Example 94B (0.329 g, 0.643 mmol) and CuCN (0.29 g, 3.21 mmol) in anhydrous DMF (5 mL) were heated under N2 at 145° for 22 hrs. The reaction was cooled to room temperature, diluted with CH2C12 (50 mL) and IN aq HCl (10 mL), and vigorously stirred for 15 minutes. The layers were separated and the aqueous phase extracted with CH C12 (2x50 mL). The organic extracts were washed with IN aqueous HCl (20 mL) and saturated aqueous NaCI, then dried over anhydrous Na2S0 . After filtration and concentration by rotary evaporation, the residue was purified by silica gel flash chromatography (2.5x14 cm, 5% EtOAc/CH2Cl2) to give the title compound (0.136 g, 46%). MS (ESI-) rn/z 456 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 5.69 (s, 2 H) 7.26 (m, 5 H) 7.47 (dd, 7=7.91, 4.60 Hz, 1 H) 7.62 (t, 7=7.91 Hz, 1 H) 8.25 (m, 2 H) 8.59 (dd, 7=7.91, 2.02 Hz, 1 H) 8.80 (dd, 7=4.60, 1.65 Hz, 1 H) 15.67 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO- de) δ 5.53 (s, 2 H) 7.20 (m, 6 H) 7.41 (t, 7=7.91 Hz, 1 H) 8.00 (d, 7=7.35 Hz, 1 H) 8.07 (d, 7=7.72 Hz, 1 H) 8.43 (dd, 7=7.54, 1.65 Hz, 1 H) 8.51 (dd, 7=4.60, 1.65 Hz, 1 H) 17.35 (s, 1 H).
Example 98 l-butyl-3-(l,l-dioxido-4H-pyridor3.2-ein.2,41thiadiazin-3-yl)-4-hydroxy-2(lH)-quinolinone
Example 98 A 3-nitropyridine-2-thiol 2-mercapto-3-nitropyridine was prepared by treating 3-nitro-2-chloro-pyridine (50g, 0.0317 mol) with thiourea (24g, 0.0317mol) in 200 mL of ethanol at reflux for several hours. After the reaction mixture was allowed to cool, 7.19 mL solution of KOH (42.8g in 115 mL of water) was added and the resulting mixture was heated at reflux for 3 hours. The crude reaction mixture was cooled to room temperature and then concentrated to 50% of its volume in vacuo. After diluting with 300 mL of water, the product was isolated by vacuum filtration as an orange solid that was used without further purification. MS (DCI/NH3) m/z 157 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 5.76 (m, IH), 7.67 (dd, 7=8.46, 4.78 Hz, IH), 8.63 (dd, 7=8.46, 1.47 Hz, IH), 8.73 (dd, 7=4.60, 1.65 Hz, IH).
Example 98B 3-aminopyridine-2-sulfonamide The title compound, (3-aminopyrid-2-yl)sulfonamide was prepared in 3 steps (80% . yield) from 2-mercapto-3-nitropyridine according to the procedure of R. Lejeune and co- workers as described in J. pharm. Belg., 39, 217-224, 1984. MS (DCI/NH3) m/z 174 (M+H)+.
-186- XH NMR (300 MHz, DMSO-d6) δ 6.00 (s, 2H), 7.25 (m, 2H), 7.34 (s, 2H), 7.82 (dd, 7=4.04, 1.47 Hz, IH).
Example 98C 5 N-r2-(aminosulfonyl)pyridin-3-yll-l-butyl-4-hvdroxy-2-oxo-L2-dihvdroquinoline-3- carboxamide The title compound was prepared according to the procedure of Example 89B substituting 3-amino-pyridine-2-sulfonamide for 2-amino-4-chlorobenzenesulfonamide.
lό Example 98D l-butyl-3-(l.l-dioxido-4H-pyridor3,2-eiri,2,4]thiadiazin-3-yl)-4-hvdroxy-2(lH)-quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 98C for the product of Example 84C .as a white solid
(0.065 g, 22%). MS (ESI-) m/z 397 (M-H)"; 1H ΝMR (300 MHz, DMSO-dβ) δ 0.96 (t, 15 7=7.35 Hz, 3H), 1.46 (m, 2H), 1.66 (m, 2H), 4.34 (m, 2H), 7.46 (t, 7=7.54 Hz, IH), 7.82 (m,
3H), 8.23 (d, 7=6.99 Hz, IH), 8.26 (d, 7=7.72 Hz, IH), 8.70 (d, 7=3.68 Hz, IH), 14.38 (s,
IH), 15.12 (s, IH).
Example 99 20 l-benzyl-3-(l . l-dioxido-4H-pyridor3.2-el IT ,2,41thiadiazin-3-yl)-4-hydroxy-2(lH)- quinolinone
Example 99A ethyl l-benzyl-4-hydroxy-2-oxo-L2-dihydroquinoline-3-carboxylate 25 The title compound was prepared according to the procedure of Example 84B substituting l-benzyl-lH-benzo[d][l,3]oxazine-2,4-dione for the product of Example 15A.
Example 99B N-r2-(aminosulfonyl)pyridin-3-yn-l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdroquinoline-3- 30 carboxamide
The title compound was prepared according to the procedure of Example 84C substituting the product of Example 99A for the product of Example 84B and substituting (3- amino-pyrid-2-yl)sulfonamide for 2-amino-5-bromobenzenesulfonamide to give the crude product as an off white solid.
35
Example 99C l-benzyl-3-(l,l-dioxido-4H-pyridol3,2-eir 2,41thiadiazin-3-ylV4-hvdroxy-2(lH)-
-187- quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 99B for the product of Example 84C (0.076 g, 38%). XH NMR (300 MHz, DMSO-d6) δ 5.64 (s, 2H), 7.29 (m, 5H), 7.43 (m, 7=7.72, 7.72 Hz, IH), 7.54 (d, 7=8.46 Hz, IH), 7.80 (m, 2H), 8.23 (m, 2H), 8.69 (d, 7=3.31 Hz, IH).
Example 100 l-benzyl-3-(Ll-dioxido-4H-pyridor3,2-eiri.2.41thiadiazin-3-yl)-4-hvdroxy-l,8- naphthyridin-2(lH)-one
Example 100A N- 12-(aminosulf onyl)pyridin-3 -yll - 1 -benzyl-4-hydrox v-2-oxo- 1 ,2-dihydro- 1.8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting 3-amino-pyridine-2-sulfonamide for 2-amino-5-bromobenzenesulfonamide. MS (ESI-) m/z 452 (M+H)+. 1H ΝMR (300 MHz, DMSO-d6) δ 5.66 (s, 2H), 7.22 (m, IH), 7.28 (m, 3H), 7.43 (m, IH), 7J0 (m, 3H), 8.52 (m, 2H), 8J7 (s, 3H), 12.56 (s, IH), 16.34 (s, IH).
Example 100B l-benzyl-3-(l,l-dioxido-4H-pyridor3,2-ein.2.41thiadiazin-3-yl)-4-hvdroxy- 8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 100A for the product of Example 84C to give after purification by reverse phase HPLC (water/acetonitrile/0.1%ΝH4θAc gradient) the title compound as a white solid (0.053 g, 10%). MS (ESI-) m/z 432 (M-H)'; 1H NMR (300 MHz, DMSO-d6) δ 5.70 (m, 2H), 7.25 (m, 7H), 7.50 (dd, 7=7.91, 4.60 Hz, IH), 7.80 (dd, 7=8.46, 4.41 Hz, IH), 8.17 (d, 7=8.46 Hz, IH), 8.60 (m, 7=5.79, 1.88, 1.88 Hz, IH), 8.68 (dd, 7=4.41, 1.10 Hz, IH), 8.82 (dd, 7=4.78, 1.84 Hz, IH).
Example 101
5-chloro-3-(l.l-dioxido-4H-Pyridor3.2-eiri.2.41thiadiazin-3-yl)-4-hvdroxy-l-(3- methyIbutyl)-2( lH)-quinolinone
Example 101A
5-chloro-2H-3,l-benzoxazine-2,4(lH -dione A solution of potassium hydroxide (1.68 g, 30 mmol) and 2-amino-6-chlorobenzoic acid (3.43 g, 20 mmol) in water (25 mL) at 0 °C was treated dropwise with 20% phosgene in toluene (16.8 mL, 32 mmol) resulting in a precipitate. The mixture was stirred for 1 hour and
-188- the solid was collected by filtration, washed with water and dried to give the title compound (3.6 g, 91%). 1H NMR (300 MHz, DMSO-d6) δ 7.11 (d, 7=7.35 Hz, IH), 7.31 (d, 7=6.99 Hz, IH), 7.66 (t, 7=8.09 Hz, IH), 11.83 (s, IH).
Example 101B
5-chloro-l-(3-methylbutyl)-2H-3,l-benzoxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting l-bromo-3-methylbutane for n-butyl bromide and substituting the product of Example 101 A for the product of Example IA (0.610 g, 45%). MS (DCI) m/z 285 (M+NILjO
Example 10 IC ethyl 5-chloro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinoline-3-carboxylate The title compound was prepared according to the procedure of Example 89A substituting the product of Example 101B for the product of Example IB (0.600 g, 80%).
1H NMR (300 MHz, DMSO-d6) δ 0.96 (d, 7=6.62 Hz, 6H), 1.32 (t, 7=7.17 Hz, 3H), 1.44 (m, 2H), 1.70 (m, 7=13.24, 6.62 Hz, IH), 4.18 (m, 2H), 4.35 (q, 7=6.99 Hz, 2H), 7.35 (d, 7=6.99 IH), 7.48 (d, 7=8.09 Hz, IH), 7.67 (m, IH), 13.88 (s, IH).
Example 10 ID
N-12-(aminosulfonyl)pyridin-3-yll-5-chloro-4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2- dihvdroquinoline-3-carboxamide The product of Example 101C (0.170 g, 0.50 mmol) was reacted with the product of Example 98A (0.086 g, 0.50 mmol) in toluene (6 mL) at reflux for 16 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give the title compound (0.200 g, 86%). MS (DCI) m/z 465 (M+H)+. 1 1H ΝMR (300 MHz, DMSO-d6) δ 0.99 (d, 7=6.62 Hz, 6H), 1.51 (m, 2H), 1.76 (m, IH), 4.32 (m, 2H), 7.45 (d, 7=7.35 Hz, IH), 7.61 (d, 7=8.82 Hz, IH), 7.71 (s, 2H), 7.77 (m, 2H), 8.45 (dd, 7=8.46, 1.47 Hz, IH), 8.53 (dd, 7=4.60, 1.29 Hz, IH), 12.84 (s, IH), 17.22 (s, IH).
Example 101E 5-chloro-3-(L l-dioxido-4H-pyridor3,2-el n .2,41thiadiazin-3-yl)-4-hvdroxy-l-(3- methylbutyl)-2(lH)-quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 101D for the product of Example 84C (0.200 g, 98%). MS (ESI-) m/z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.62 Hz, 6H),
-189- 1.45 (m, 2H), 1.71 (m, IH), 4.11 (m, 2H), 7.08 (d, 7=7.35 Hz, IH), 7.23 (d, 7=8.09 Hz, IH), 7.43 (t, 7=8.27 Hz, IH), 7.57 (dd, 7=8.46, 4.41 Hz, IH), 7.78 (d, 7=8.09 Hz, IH), 8.45 (d, 7=4.41 Hz, IH), 15.77 (s, IH).
Example 102 l-benzyl-3-(Ll-dioxido-4H-pyridor3,2-eiri,2,41thiadiazin-3-yl)-4-hvdroxy-5-methyl-2(lH)- quinolinone
Example 102A l-Benzyl-(4-methyl)benzor2,3-diri,31oxazine-2,4-dione
The title compound was prepared according to the procedure of Example IB substituting benzyl bromide for n-butyl bromide and substituting (4-methyl)benzo[2,3- d][l,3]oxazine-2,4-dione for the product of Example IA (0.67 g, 60%). MS (DCI+) m/z 268 (M+H)"; 1H NMR (300 MHz, DMSO-d6) δ 2.66 (s, 3H), 5.28 (s, 2H), 7.07 (d, 7=8.48 Hz, IH), 7.14 (d, 7=7.80 Hz, IH), 7.33 (m, 5H), 7.57 (t, 7=7.46 Hz, IH).
Example 102B ethyl l-benzyl-4-hvdroxy-5-methyl-2-oxo-l,2-dihydroquinoline-3-carboxylate The title compound was prepared according to the procedure of Example 84A substituting the product of Example 102A for the product of Example 15 A (0.71 g, 89%).
MS (DCI+) m/z 338 (M+H)"; 1H NMR (300 MHz, DMSO-d6) δ 1.33 (t, 7=7.17 Hz, 3H), 2.77 (s, 3H), 4.39 (q, 7=7.23 Hz, 2H), 5.47 (s, 2H), 7.05 (d, 7=7.35 Hz, IH), 7.20 (m, 4H), 7.31 (m, 2H), 7.47 (t, 7=8.09 Hz, IH), 14.43 (s, IH).
Example 102C
N-r2-(aminosulfonyl)pyridin-3-yl1-l-benzyl-4-hvdroxy-5-methyl-2-oxo-l,2- dihydroquinoline-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 102B for the product of Example 84B and substituting the product of Example 98A for 2-amino-5-bromobenzenesulfonamide (0.163 g, 41%), MS (ESI+) m/z 465 (M+H)"; 1H ΝMR (300 MHz, DMSO-d6) δ 2.82 (s, 3H), 5.59 (s, 2H), 7.15 (d, 7=7.35 Hz, IH), 7.24 (m, 3H), 7.33 (m, 3H), 7.56 (t, 7=7.91 Hz, IH), 7.72 (m, 3H), 8.51 ( , IH), 8.53 (s, IH), 12.93 (s, IH), 17.16 (m, IH).
Example 102D l-benzyl-3-( 1, l-dioxido-4H-pyridor3.2-el Tl .2,41thiadiazin-3-ylV4-hvdroxy-5-methyl-2(lH)- quinolinone
-190- The title compound was prepared according to the procedure of Example 84D substituting the product of Example 102C for the product of Example 84C (0.064 g, 41%).
MS (ESI+) m/z 447 (M+H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 445 (M-H)"; 1H NMR (300 MHz, DMSO-
5 d6) δ 2.81 (s, 3H), 5.37 (dd, 7=6.07, 2.02 Hz, 2H), 6.80 (d, 7=7.35 Hz, IH), 6.95 (d, 7=8.09
Hz, IH), 7.20 (m, 4H), 7.29 (m, 2H), 7.57 (dd, 7=8.46, 4.41 Hz, IH), 7.75 (dd, 7=8.46, 1.47
Hz, IH), 8.44 (dd, 7=4.41, 1.47 Hz, IH), 16.29 (s, IH). '\
Example 103 lό 3-(l,l-dioxido-4H-pyridor3.2-eiri.2.41thiadiazin-3-yl)-4-hydroxy-l-r(2-methyl-1.3-thiazol-
5-yl)methyll-2(lH)-quinolinone
Example 103A l-r(2-methyl-1.3-thiazol-5-yl)methyll-2H-3.1-benzoxazine-2.4(17r)-dione 15 The title compound was prepared according to the procedure of Example IB substituting isatoic anhydride for the product of Example IA and 2-methyl-5- chloromethylthiazole for n-butyl bromide to give (0.410 g, 73%).
Example 103B 20 ethyl l-[(2-methyl-l,3-thiazol-5-yl)methyl1-2,4-dioxo-l,2,3,4-tetrahydroquin line-3- carboxylate The title compound was prepared according to the procedure of Example 84A substituting the product of Example 103A for the product of Example 15B (0.132 g, 25%). MS (ESI-) m/z 343 (M-Η)"; 1H NMR (300 MHz, CDC13) δ. 1.49 (t, 7=6.99 Hz, 3H), 2.61 (s, 25 3H), 4.53 (q, 7=7.23 Hz, 2H), 5.54 (s, 2H), 7.27 (t, 7=8.09 Hz, IH), 7.41 (d, 7=8.46 Hz, IH), 7.62 (s, IH), 7.67 (m, IH), 8.21 (dd, 7=8.09, 1.47 Hz, IH), 14.32 (s, IH).
Example 103C N-r2-(aminosulfonyl)ρyridin-3-yll-l-r(2-methyl-l,3-thiazol-5-yI)methyl1-2,4-dioxo-l,2,3,4- 30 tetrahydroquinoline-3-carboxamide
The title compound was prepared as described in the procedure of Example 84C substituting the product of Example 99A for the product of Example 84B and substituting 3- amino-pyridine-2-sulfonamide for 2-amino-5-bromobenzenesulfonamide (0.148 g, 79%). MS (APCI) m/z 472 (M+H)+. XH ΝMR (300 MHz, DMSO-d6) δ. 2.55 (s, 3H), 5.69 (s, 2H), 35 7.25 (m, IH), 7.35 (s, IH), 7.42 (t, 7=6.62 Hz, IH), 7.81 (m, 4H), 8.17 (d, 7=7.72 Hz, IH), 8.52 (d, 7=2.57 Hz, IH), 8.54 (s, IH), 12.67 (s, IH), 16.28 (s, IH).
-191- Example 103D 3-(l,l-dioxido-4H-pyridor3,2-eiri.2,4]thiadiazin-3-yl)-4-hydroxy-l-r(2-methyl-l,3-thiazol-
5-yl)methyl1-2(lH)-quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 103C for the product of Example 84C (0.033 g, 68%). MS (APCI) m/z 454 (M+H)+. 1H NMR (300 MHz, DMSO-dg) δ 2.56 (s, 3H), 5.74 (s, 2H), 7.48 (t, 7=6.80 Hz, IH), 7.82 (s, IH), 7.88 (m, 4H), 8.24 (m, 2H), 8.71 (dd, 7=4.41, 1.47 Hz, IH), 14.01, v (s, IH).
Example 104 l-benzyl-4-hvdroxy-3-(7-methyl-l,l-dioxido-4H-pyridor2,3-eiπ.2,41thiadiazin-3-yl)-2(lH)- quinolinone
Example 104A
(2-Amino-5-methylpyrid-3-yl)sulfonyl chloride (2-Amino-5-methylpyrid-3-yl)sulfonyl chloride was prepared from 2-amino-5- picoline by the method described by Weller, H.N. in US 5,378,704. 1H NMR (300 MHz, DMSO-d6) δ 2.20 (s, 3H), 7.70 (br. s., 2H), 7.85 (d, 7=5.52 Hz, IH), 8.07 (d, 7=2.21 Hz, IH).
Example 104B 2-amino-5-methylpyridine-3-sulfonamide The product of Example 104A was reacted with concentrated ammonium hydroxide at ambient temperature overnight. The reaction mixture was concentrated to give the title compound as a light yellow solid in quantitative yield.' MS (DCI/NH3) m/z 188 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 2.17 (m, 3H), 6.28 (s, 2H), 7.43 (s, 2H), 7.70 (d, 7=1.84 Hz, IH), 8.00 (d, 7=2.21 Hz, IH).
Example 104C
N-r3-(aminosulfonyl)-5-methylpyridin-2-yll-l-benzyl-4-hydroxy-2-oxo-l,2- dihvdroquinoline-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting product of Example 104B for 2-amino-5-bromobenzenesulfonamide.
Example 104D l-benzyl-4-hvdroxy-3-(7-methyl-l,l-dioxido-4H-pyridof2.3-eiri.2,41thiadiazin-3-yl)-2(lH)-
-192- quinolinone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 104C for the product of Example 84C (0.20 g, 35%). JH NMR (300 MHz, DMSO-d6) δ 3.32 (m, 3H), 5.45 (s, 2H), 5.97 (s, IH), 7.22 (m, 9H), 7.50 (m, IH), 7.91 (dd, 7=7.91, 1.65 Hz, IH), 11.50 (m, IH). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 2.37 (m, 3H), 5.39 (m, 2H), 7.07 (m, IH), 7.24 (m, 6H), 7.39 (m, IH), 7.94 (d, 7=1.47 Hz, IH), 8.13 (dd, 7=7.91, 1.65 Hz, IH), 8.43 (d, 7=1.84 Hz, IH), 16.49 (m, IH)
Example 105 l-butyl-4-hvdroxy-3-(7-methyl-l.l-dioxido-4H-pyridor2.3-eiri.2.41thiadiazin-3-yl)-1.8- naphthyridin-2(lH)-one
Example 105A ethyl 3-i r3-(aminosulfonyl)-5-methylpyridin-2-yllamino|-3-oxopropanoate
The product of Example 104B (1.0 g, 0.0053 mol) in 10 mL of THF containing 5 mL of pyridine was treated with ethyl 3-chloro-3-oxopropionate (0.97 g, 0.0064 mol) at ambient temperature for several hours. The reaction mixture was concentrated to half its original volume and then diluted with water. The resulting precipitate was collected by filtration and washed with water and dried under vacuum to give the title compound as an off white solid (1.19 g, 75% yield). MS (ESI) m/z 300 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.19 (t, 7=7.17 Hz, 3H), 2.35 (s, 3H), 3.65 (s, 2H), 4.11 (q, 7=7.23 Hz, 2H), 7.60 (s, 2H), 8.06 (d, 7=1.47 Hz, IH), 8.41 (d, 7=1.84 Hz, IH), 9J9 (s, IH).
Example 105C ethyl (7-methyl-l,l-dioxido-4H-pyridor2,3-e1FL2,41thiadiazin-3-yl)acetate The product of Example 105A (0.363 g, 0.0012 mol) in 20 mL of ethanol was reacted with sodium carbonate (0.350 g, 0.0033 mol). The reaction mixture was heated at reflux for 2 hours. After cooling, the reaction mixture was diluted with dichloromethane, filtered to remove the excess sodium carbonate, and concentrated. The residue was purified chromatography on silica gel with ethyl acetate in hexanes (1:1) followed by 4% methanol in dichloromethane as the mobile phase to give the title compound as a white solid (0.296 g, 87% yield). MS (ESI) m/z 282 (M-Η)"; Η NMR (300 MHz, DMSO-d6) δ 1.21 (t, 7=6.99 Hz, 3H), 2.40 (s, 3H), 3.73 (s, 2H), 4.15 (q, 7=7.11 Hz, 2H), 8.20 (s, IH), 8.58 (d, 7=1.84 Hz, IH), 12.79 (s, IH).
Example 105D
-193- l-butyl-4-hydroxy-3-(7-methyl-l.l-dioxido-4H-pyridor2.3-eiri.2,41thiadiazin-3-yl)-1.8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 105C for the product of Example IC (0.065 g, 58% 5 yield). 1H NMR (300 MHz, DMSO-d5) δ 0.94 (t, 7=7.35 Hz, 3H), 1.40 (m, 2H), 1.67 (m, 2H), 2.44 (m, 3H), 4.46 (dd, 7=7.91, 7.17 Hz, 2H), 7.48 (dd, 7=8.09, 4.78 Hz, IH), 8.29 (s, IH), 8.56 (dd, 7=7.91, 1.65 Hz, IH), 8.64 (d, 7=1.47 Hz, IH), 8.87 (d, 7=5.52 Hz, IH). The sodium sό.lt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-d6) δ 0.93 (t, 7=7.35 Hz, 3H), 1.34 (m, 2H), 1.58 (m, 2H), 2.36 lό (s, 3H), 4.26 (d, 7=7.72 Hz, IH), 4.29 (d, 7=6.99 Hz, IH), 7.13 (dd, 7=7.72, 4.78 Hz, IH), 7.95 (s, IH), 8.37 (dd, 7=7.72, 2.21 Hz, IH), 8.42 (d, 7=1.84 Hz, IH), 8.53 (dd, 7=4,60, 2.02 Hz, IH), 16.11 (s, IH).
Example 106 15 3-( 1 , 1 -dioxido-4H- 1 ,2.4-benzothiadiazin-3 -yl)-4-h ydroxy- 1 -(2-thienylmethyl)- 1,8- naphthyridin-2(lH)-one
Example 106A l-(thien-2-ylmethyl)-2H-pyridof 2,3-Jl Tl ,31oxazine-2,4QH)-dione 20 The title compound was prepared according to the procedure of Example IB substituting 2-(bromomethyl)-thiophene for n-butyl bromide (0.165 g, 51%). *Η NMR (300 MHz, DMSO-d6) δ 5.48 (s, 2H), 6.97 (dd, 7=5.15, 3.31 Hz, IH), 7,21 (d, 7=3.31 Hz, IH), 7.43 (m, 2H), 8.41 (dd, 7=7.72, 1.84 Hz, IH), 8.83 (dd, 7=5.15, 1.84 Hz, IH).
25 Example 106B
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(2-thienylmethyl)-1.8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 106A for the product of Example IB (0.162 g, 60%). 30 MS (ESI-) m/z 437 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.64 (s, 2H), 6.90 (m, 7=5.15, 3.68 Hz, IH), 7.11 (m, 7=3.49, 0.92 Hz, IH), 7.18 (dd, 7=7.72, 4J8 Hz, IH), 7.29 (m, 3H), 7.56 (m, IH), 7.67 (dd, 7=7.72, 1.10 Hz, IH), 8.39 (dd, 7=7.72, 2.21 Hz, IH), 8.57 (dd, 7=4.78, 1.84 Hz, IH), 15.80 (s, IH).
35
Example 107 l-(benzyloxy)-3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8-naphthyridin-
-194- 2(TH)-one Example 107 A ethyl 2-[Ybenzyloxy)amino1nicotinate 2-Chloro-nicotinic acid ethyl ester (4.55 g, 24.6 mmol), 0-benzylhydroxyamine hydrochloride (7.85 g, 49.2 mmol) and N,N-diisopropylethylamine (6.36 g, 49.2 mmol) in 10 mL 1,4-dioxane were reacted in a sealed tube at 120 °C for 48 hours. The reaction mixture was partitioned between ethyl acetate, and 5% aqueous sodium bicarbonate. The aqueous layer was} re-extracted with ethyl acetate (2 x 50 mL). The organic layers were combined and dried over sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel eluting with hexane and ethyl acetate (9:1) to provide the title compound (3.5 g, 53%). MS (DCI) m/z 273 (M+H)+.
Example 107B ethyl 2-r(benzyloxy)(3-ethoxy-3-oxopropanoyl)amino1nicotinate A solution of the product of Example 107a ( 1.2 g, 4.4 mmol) and triethylamine (0.49 g, 4.8 mmol) in dichloromethane (25 mL) was treated dropwise with ethyl chloromalonate (0.73 g, 4.8 mmol), stirred for 2 hr and partitioned between ethyl acetate and water and the layers were separated. The ethyl acetate layer was washed with brine, dried (Na2S04), and concentrated. The residue was purified by column chromatography on silica gel eluting with hexane and ethyl acetate (3:1) to provide the title compound (1.1 g, 65%). MS (DCI) m/z 387 (M+H)+.
Example 107C ethyl l-(benzyloxy)-4-hydroxy-2-oxo-l,2-dihydro-l,8-naphthyridine-3-carboxylate A solution of the product of Example 107b ( 0.386 g, 1.0 mmol) in ethanol (5 mL) was treated with 21% sodium ethoxide in ethanol (0.324 g, 1.0 mmol), stirred for 30 minutes and partitioned between ethyl acetate and 5% aqueous HCl and the layers were separated. The ethyl acetate layer was washed with brine, dried (Na2S04), and concentrated to provide the title compound (0.28 g, 82%). MS (DCI) m/z 341(M+H)+.
Example 107D N- r2-(aminosulfonyl)phenyll - 1 -(benzyloxy)-4-hydroxy-2-oxo- 1 ,2-dihydro- 1,8- naphthyridine-3-c arboxamide
A mixture of the product of Example 107c (340 mg, 0.82 mmol) and 2- aminobenzenesulfonamide (141 mg, 0.82 mmol) in toluene (10 mL) was refluxed for 16 hours, cooled, and the resulting precipitate was collected by filtration and dried to give the title compound (340 mg, 89%). MS (DCI) m/z 467 (M+H)+. -
Example 107E 1 -(benzyl oxy)-3-(l , l-dioxido-4H- 2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 ,8-naphthyridin-
-195- 2(lH)-one The title compound was prepared according to the procedure of Example 84d substituting the product of Example 107d for the product of Example 84c to give the title compound (0.082 g, 87%). MS (ESI-) m/z 447 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ld. 1Η NMR (300 MHz, DMSO-d6) δ 5.12 (s, 2 H) 7.22 (dd, 7=7.72, 4.78 Hz, 1 H) 7.30 (m, 2 H) 7.44 (m, 3 H) 7.57 (m, 1 H) 7J0 (m, 3 H) 8.41 (dd, 7=7.72, 1.84 Hz, 1 H) 8.61 (dd, 7=4.78, 1.84 Hz, 1 H) 15.70 (s, l H)T
Example 108
6-(l.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-8-(2-ethylbutyl)-5-hvdroxy-2- (methylsulfanyl)pyridor2,3-dlpyrimidin-7(8H)-one
Example 108A methyl 4-r(2-ethylbutyl)aminol-2-(methylthio)pyrimidine-5-carboxylate
Ethyl 4-chloro-2-methylthio-5-pyrimidinecarboxylate (0.40 g, 1.72 mmol) was reacted with l-amino-2-ethyl butane (0.175 g, 1.72 mmol) and triethylamine (0.60 mL, 4.32 mmol) at ambient temperature for 18 hours. The reaction was partitioned between water and dichloromethane. The organic layer was dried over sodium sulfate, filtered, and the concentrated to give the title compound (0.50 g, 98%).
Example 108B 4-r(2-ethylbutyl)aminol-2-(methylthio)pyrimidine-5-carboxylic acid The product of Example 108A (0.50 g, 1.68 mmol) ) in water and ethanol (1:2) was reacted with sodium hydroxide (0.22 g, 5.50 mmol) at ambient temperature for 3 hours. The reaction was concentrated under vacuum to remove the ethanol and neutralized with aqueous hydrochloric acid (1 M). The resulting precipitate was collected by filtration and dried to yield the title compound (0.41 g, 91%). MS (DCI/NH3) m/z 270 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 0.88 (t, 7=7.54 Hz, 6H), 1.31 (dt, 7=14.25, 7.03 Hz, 4H), 1.53 (m, IH), 2.47 (s, 3H), 3.46 (t, 7=6.07 Hz, 2H), 8.50 (s, IH), 13.22 (s, IH).
Example 108C l-(2-ethvIbutyl)-7-(methylthio)-2H-pyrimidor4.5-Jiri,31oxazine-2,4(lH)-dione The product of Example 108B (0.41 g, 1.52 mmol) was reacted with ethyl chloroformate (0.445 mL, 4.65 mmol) and pyridine (0.405 mL, 5.56 mmol) in toluene (8 ML) at 90°C for 24 hours. The reaction was concentrated under vacuum. The residue was extracted with ethyl acetate and filtered. Concentration of the filtrate gave the title
-196- compound (0.394 g, 88%).
Example 108D 6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-8-(2-ethylbutyl)-5-hydroxy-2- (methylsulfanyl)pyridor2,3-dlpyrimidin-7(8H)-one 5 The title compound was prepared according to the procedure of Example ID substituting the product of Example 108C for the product of Example IB (0.153 g, 24%). MS (ESI-) m/z 472 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. H NMR (300 MHz, DMSO-d6) δ 0.87 (t, 7=7.54 Hz, 6H), 1.28 (m, 4H), 1.87 (ddd, 7=13.05, 6.80, 6.62 Hz, IH), 2.56 (s, 3H), 4.15 (d, 7=7.35 Hz, 2H), lό 7.26 (d, 7=8.46 Hz, IH), 7.31 (m, IH), 7.56 (ddd, 7=8.27, 7.17, 1.47 Hz, IH), 7.67 (dd, 7=7.72, 1.47 Hz, IH), 8.89 (s, IH), 15.52 (s, IH).
Example 109 6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-8-(2-ethylbutyl)-5-hydroxypyridor2,3- 15 ( d1pyrimidin-7(8H)-one
The product of Example 108D (0.15 g, 0.30 mmol) was reacted with an excess of Raney nickel (slurry in water, 2 mL) in ethanol (5 mL) and heated at 60 °C for 1 hour. The mixture was filtered through celite, rinsed with ethanol, and the filtrate concentrated under vacuum to yield the title compound. MS (ESI-) m/z 448 (M-H)"; 1H NMR (300 MHz, 20 DMSO-d6) δ 0.86 (t, 7=7.35 Hz, 6H), 1.28 (m, 4H), 1.87 (m, IH), 4.18 (d, 7=7.35 Hz, 2H), 7.30 (m, 2H), 7.57 (ddd, 7=8.27, 7.17, 1.47 Hz, IH), 7.68 (dd, 7=7.91, 1.29 Hz, IH), 8.94 (s, IH), 9.09 (s, IH), 15.43 (s, IH).
Example 110 25 4-benzyl-6-(l,l-dioxido-4H-l,214-benzothiadiazin-3-yl)-7-hvdroxythienor3,2-b1pyridin-'
5(4H)-one
Example 110A 2H-thienor3,2-Jin.31oxazine-2,4(lH -dione 30 The title compound was prepared according to the procedure of Fabis, and co-workers as described in Tetrahedron, 1998, 54, 10789-10800. MS (DCI/NΗ3) m/z 186.9 (M+NE *; JH NMR (300 MHz, DMSO-d6) δ 6.95 (d, J=6 Hz, 1 H) 8.25 (d, J=6 Hz, 1 H) 12.22 (brs, 1 H).
35 Example HOB l-benzyl-2H-thienor3.2-Jiri31oxazine-2.4αH)-dione The product of Example 110A (0.137 g, 0.81mmol) was reacted with benzyl bromide
-197- (0.10 mL, 0.85 mmol), and potassium carbonate (0.134 g, 0.97 mmol) in dimethylformamide (5 mL) at ambient temperature for 20 hours. The reaction mixture was diluted with water and the resulting precipitate was collecte by filtration, and dried to give the title compound (0.165 g, 80%). MS (DCI/NH3) m/z 277 (M+NH )+; 1H NMR (300 MHz, DMSO-dg) δ 5.21 (s, 2 H) 7.25 (d, 7=5.52 Hz, 1 H) 7.35 (m, 5 H) 8.28 (d, 7=5.52 Hz, 1 H).
Example HOC 4-benzVl-6-( 1 , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxythienor3 ,2-blpyridin-
5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 110B for the product of Example IB (0.137 g, 49%). MS (ESI-) m/z 438 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 5.26 (s, 2 H) 7.03 (d, 7=5.52 Hz, 1 H) 7.21 (m, 2 H) 7.28 (m, 5 H) 7.54 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.65 (dd, 7=7.91, 1.29 Hz, 1 H) 7J3 (d, 7=5.52 Hz, 1 H) 15.89 (s, 1 H).
Example 111 4-butyl-6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hydroxythienor3,2-b1pyridin-5(4H)- one
Example ll lA 1 -butyl-2H-thienor3 ,2-d] f 1.31 oxazine-2,4( lHVdione The title compound was prepared according to the procedure of Example 110B substituting n-butyl bromide for benzyl bromide (0.059 g, 22%). MS (DCI) m/z 226 (M+Η)+; 1H NMR (300 MHz, DMSO-de) δ 0.91 (t, 7=7.17 Hz, 3 H) 1.36 (dt, 7=22.70, 7.22 Hz, 2 H) 1.62 (m, 2 H) 3.94 (m, 2 H) 7.39 (d, 7=5.52 Hz, 1 H) 8.34 (d, 7=5.15 Hz, 1 H).
Example 11 IB 4-butyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythienor3,2-b1pyridin-5(4H)- one
The title compound was prepared according to the procedure of Example ID substituting the product of Example lllA for the product of Example IB (0.050 g, 47%). MS (DCI/NH3) m/z 404 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 0.93 ( , 3 H) 1.40 (td, 7=14.98, 7.17 Hz, 2 H) 1.67 (m, 2 H) 4.27 (m, 2 H) 7.54 (m, 1 H) 7.60 (d, 7=5.52 Hz, 1 H) 7.67 (d, 7=7.72 Hz, 1 H) 7.77 (ddd, 7=8.36, 7.08, 1.47 Hz, 1 H) 7.92 (d, 7=7.72 Hz, 1 H) 8.39 (d, 7=5.52 Hz, 1 H) 14.46 (s, 1 H) 14.90 (s, 1 H).
-198- Example 112 6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(4-pyridinylmethyl)thienor3,2- blpyridin-5(4H)-one
Example 112A l-(pyridin-4-ylmethyl)-2H-thienor3.2-cπri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 4- bromomethyl pyridine hydrobromide for n-butyl bromide (0.205 g, 80%).
Example 112B 6-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(4-pyridinylmethyl)thienor3,2- blpyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 112A for the product of Example IB (0.155 g, 45%). • MS (DCI NH3) m/z 439 (M+H)+; 1H NMR (300 MHz, DMSO-d6) δ 5.78 (s, 2 H) 7.49 (d, 7=5.52 Hz, 1 H) 7.55 (t, 7=7.54 Hz, 1 H) 7.62 (d, 7=7.35 Hz, 1 H) 7.76 (m, 4 H) 7.93 (d, 7=7.72 Hz, 1 H) 8.38 (d, 7=5.52 Hz, 1 H) 8.75 (d, 7=6.25 Hz, 1 H) 14.06 (s, 1 H).
Example 113 l-(3-bromobenzyl)-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6J,8- tetrahydro-2( lH)-quinolinone
Example 113 A
5,6,7, 8-tetrahydro-2H-3.1-benzoxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting ethyl 2-aminocyclohex-l-ene-l-carboxylate for the product of Example 3 A (0.960 g, 97%). MS (ESI-) m/z 166 (M-Η)+. Example 113B l-(3-bromobenzyl)-5,6J,8-tetrahydro-2H-3,l-benzoxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 113A for the product of Example IA and substituting 3- bromobenzyl bromide for n-butyl bromide (0.049 g, 46%). MS (ESI-) m/z 334 (M-Η)+.
Example 113C l-(3-bromobenzyl)-3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-5,6J,8-
-199- tetrahydro-2( lH)-quinohnone The title compound was prepared according to the procedure of Example ID substituting the product of Example 113B for the product of Example IB (0.021 g, 34%). MS (ESI-) m/z 514 (M-H)+; 1H NMR (300 MHz, DMSO-d6) δ 1.68 (m, 4 H), 2.51 (m, 2 H), 5 2.67 (m, 2 H), 5.40 (s, 2 H), 7.13 (d, 7=7.72 Hz, 1 H), 7.30 (t, 7=7.91 Hz, 1 H), 7.51 (m, 3 H), 7.61 (d, 7=8.09 Hz, 1 H), 7.73 (t, 7=7.17 Hz, 1 H), 7.90 (d, 7=8.46 Hz, 1 H), 14.40 (s, 1 H), 14.56 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.59 (m, 4 H), 2.33 (t, 7=5.70 Hz, 2 H), 2,41 (m, 2 H), 5.14 (s, 2 H), 7.11 (d, 7=8.09 Hz, 1 H), 7.18 (d, 7=8.09 Hz, 1 H), lό 7.25 (m, 3 H), 7.41 (d, 7=7.72 Hz, 1 H), 7.50 (td, 7=7.72, 1.47 Hz, 1 H), 7.62 (dd, 7=7.72, 1.47 Hz, 1 H), 17.13 (s, 1 H).
Example 114 5-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-7-(4-pyridinylmethyl)thienor2,3- 15 blpyridin-6(7H)-one
Example 114A 2H-thienor2,3-Jiri.31oxazine-2,4(lH)-dione The title compound was prepared by the method of Fabis, and coworkers in 20 Tetrahedron 1998 54 10789-10800. MS (DCI/NΗ3) m/z 187 (M+NEU)+; 1H NMR (300 MHz, DMSO-d6) δ 7.17 (d, J=16.8 Hz, 1 H) 7.21 (d, J=16.8 Hz 1 H) 12.56 (brs, 1 H).
Example 114B l-(pyridin-4-ylmethyl)-2H-thienor2,3-Jiri.31oxazine-2.4nH)-dione 5 The title compound was prepared according to the procedure of Example IB substituting the product of Example 114A for the product of Example IA and substituting 4- bromomethyl pyridine hydrobromide for n-butyl bromide (0.22 g, 95%).
Example 114C 30 5-(Ll-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-7-(4-pyridinylmethyl)thienor2,3- b1pyridin-6(7H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 114B for the product of Example IB (0.047 g, 13%). MS (DCI/NH3) m z 439 (M+H)+; Η NMR (300 MHz, DMSO- d6) δ 5.62 (s, 2 H) 7.48 (m, 2 35 H) 7.55 (t, 7=7.54 Hz, 1 H) 7.62 (d, 7=7.72 Hz, 1 H) 7.68 (d, 7=6.25 Hz, 1 H) 7.76 (ddd,
7=8.55, 7.26, 1.47 Hz, 1 H) 7.93 (d, 7=8.09 Hz, 1 H) 8.71 (d, 7=6.62 Hz, 1 H) 13.87 (s, 1 H).
-200- Example 115 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(3-pyridinylmethyl)thienor3,2- blpyridin-5 (4H)-one
5 Example 115A l-(pyridin-3-ylmethyl)-2H-thienor3.2-Jiri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 3- bromomethyl pyridine hydrobromide for n-butyl bromide (0.28 g, 90%). MS (DCI/NΗ3) lό m/z 261 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 5.24 (s, 2 H) 7.34 (d, 7=5.52 Hz, 1 H) 7.38 (m, 1 H) 7.81 (dt, 7=8.00, 1.88 Hz, 1 H) 8.30 (d, 7=5.15 Hz, 1 H) 8.51 (dd, 7=4.78, 1.47 Hz, 1 H) 8.67 (d, 7=1.84 Hz, 1 H).
Example 115B 15 6-( 1 ,1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(3-pyridinylmethyl)thieno \3 ,2- bl pyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 115A for the product of Example IB (0.237 g, 50%). MS (DCI/NH3) m z 439 (M+H)+. The sodium salt of the title compound was prepared 20 according to the procedure of Example ID. XH NMR (300 MHz, DMSO-d6) δ 5.49 (s, 2 H) 7.34 (dd, 7=7.91, 4.60 Hz, 1 H) 7.45 (m, 3 H) 7.68 (m, 2 H) 7.83 (d, 7=8.09 Hz, 1 H) 8.16 (s, 1 H) 8.47 (d, 7=3.68 Hz, 1 H) 8.62 (s, 1 H) 14.83 (brs, 1 H).
Example 116 25 7-benzyl-5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxythienor2,3-blpyridin-'
6(7H)-one
Example 116 A 30 l-benzyl-2H-thienor2,3-Jl \ 1 ,31oxazine-2,4(lH)-dione
The title compound was prepared according to the procedure of Example HOB substituting the. product of Example 114A.for the product of Example 110A (0.26g, 100%).
Example 116B 35 7-benzyl-5-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-4-hvdroxythienor2,3-blpyridin-
6(7H)-one The title compound was prepared according to the procedure of Example ID
-201- substituting the product of Example 116A for the product of Example IB (0.144 g, 38%). MS (ESI-) m/z 436 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 436 (M-H"); δ 1H NMR (300 MHz, DMSO-d6) δ 5.14 (s, 2 H) 6.90 (d, 7=5.52 Hz, 1 H) 7.20 (m, 2 H) 7.30 (m, 6 H) 7.54 (m, 1 H) 7.65 (dd, 7=7.72, 1.47 Hz, 1 H) 16.25 (s, 1 H).
Example 117 4-(cvclopropylmethyl)-6-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxythienor3,2- blpyridin-5 (4H)-one
Example 117A l-(cyclopropylmethyl)-2H-thienor3,2-ιJiri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example 1 A and substituting bromomethyl cyclopropane for n-butyl bromide (0.23g, 87%). MS (DCI/NΗ3) m z 241 (M+NHO4"; 1H NMR (300 MHz, DMSO-c^) δ 0.47 (m, 4 H) 1.21 (m, 1 H) 3.89 (d, 7=6.99 Hz, 2 H) 7.45 (d, 7=5.15 Hz, 1 H) 8.35 (d, 7=5.15 Hz, 1 H).
Example 117B 4-(cyclopropylmethyl)-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3 ,2- b1pyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 117 A for the product of Example IB (0.252 g, 60%). MS (ESI-) m/z 400 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 0.41 (m, 4 H) 1.20 (m, 1 H) 3.92 (d, 7=6.99 Hz, 2 H) 7.19 (m, 2 H) 7.26 (t, 7=7.54 Hz, 1 H) 7.53 (m, 1 H) 7.64 (d, 7=6.62 Hz, 1 H) 7.79 (d, 7=5.52 Hz, 1 H) 15.97 (s, 1 H).
Example 118 5-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-7-(3-methylbutyl)thieno [2,3 - blpyridin-6(7H)-one
Example 118A l-(3-methylbutyl)-2H-thienor2,3-Jiri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 114A for the product of Example IA and substituting isobutyl bromide for n-butyl bromide (0.074 g, 35%).
-202- Example 118B 5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-7-f3-methylbutyl)thienor2,3- b1pyridin-6(7H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 118A for the product of Example IB (0.063 g, 49%). MS (ESI-) m/z 416 (M-H)" The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.96 (s, 3 H) 0.98 (s, 3 H) 1.53 (m, 2 H) 1.66 (m, 1 H) 3.87 (m, 2 H) 6.95 (d, 7=5.52 Hz, 1 H) 7.19 (m, 2 H) 7.25 (m, 1 H) 7.52 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.64 (dd, 7=7.72, 1.47 Hz, 1 H) 16.30 (s, 1 H).
Example 119 4-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-2-phenylthienor3,2- bl pyridin-5 (4H)-one
Example 119 A 6-phenyl-2H-thienor3,2-^iπ,31oxazine-2,4(lH)-dione Methyl-3-amino-5-phenylthiophene-2-carboxylate (0.25 g, 1.07 mmol) in water (6 mL) was reacted with potassium hydroxide (0.12 g, 2.14 mmol) at 90 °C for 24 hours. The reaction was cooled to 0 °C and phosgene (1.9M in toluene, 0.70 mL, 1.40 mmol) was added dropwise. After stirring at room temperature for 1 hour, the resulting solid was collected by filtration, washed with excess water and dried to give the title compound as a tan sohd (0.175 g, 65%).
Example 119B l-benzyl-6-phenyl-2H-thieno[3,2-Jl[l,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 119A for the product of Example 1 A (0.19g, 80%). MS (DCI/NΗ3) m/z 353 (M+NE )+; 1H NMR (300 MHz, DMSO-d6) δ 5.26 (s, 2 H) 7.43 (m, 8 H) 7.82 (m, 3 H).
Example 119C 4-benzyl-6-(lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-2-phenylthienor3,2- blpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 119B for the product of Example IB (0.062 g, 22%).
MS (ESI-) m/z 512 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.34 (s, 2 H) 7.24 (m, 2 H)
-203- 7.33 (m, 5 H) 7.43 (m, 4 H) 7.56 (t, 7=7.35 Hz, 1 H) 7.71 (m, 3 H) 15.82 (m, 1 H).
Example 120 4-benzyl-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxy-3-methylthieno [3.2- blpyridm-5 (4H)-one
Example 120 A "> 7-methyl-2H-thieno[3.2-rfl[l,31oxazine-2,4(lH)-dione
The title compound was prepared according to the procedure of Example 119A substituting methyl-3-amino-4-methylthiophene-2-carboxylate for methyl-3-amino-5- phenylthiophene-2-carboxylate .
Example 120B 1 -benzyl-7-methyl-2H-thieno 3,2-d] [ 1.31oxazine-2.4( lH)-dione The title compound was prepared according to the procedure of Example 110B substituting the product of Example 120A for the product of Example 110A (0.22g, 73%). MS (DCI/NΗ3) m/z 291 (M+NH4)+
Example 120C 4-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-3-methylthieno[3,2- b1pyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 120B for the product of Example IB (0.110 g, 30%). MS (ESI-) m/z 450 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.21 (s, 3 H) 5.47 (s, 2 H) 7.05 (m, 1 H) 7.25 (m, 6 H) 7.37 (d, 7=0.74 Hz, 1 H) 7.54 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.64 (dd, 7=7.91, 1.29 Hz, 1 H) 15.92 (s, 1 H).
Example 121 l-benzyl-3-(ia-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5.6J,8-tetrahvdro-2(lH)- quinolinone
Example 121 A l-benzyI-5 ,6,7 ,8-tetrahydro-2H-3 , 1 -benzoxazine-2,4( lHVdione The title compound was prepared according to the procedure of Example IB substituting the product of Example 113 A for the product of Example 1 A and substituting benzyl bromide for n-butyl bromide (0.620 g, 67%). MS (ESI-) m/z 256 (M-ΗV.
-204- Example 121B l-benzyl-3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-5.6J.8-tetrahvdro-2(lBD- quinolinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 121 A for the product of Example IB (0.039 g, 37%). MS (ESI-) m/z 434 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID: 1H NMR (300 MHz, DMSO-de) δ 1.54 (m, 4 H), 2.33 (t, 7=5.88 Hz,.2 H), 2.42 (m, 2 H), 5.15 (s, 2 H), 7.10 (d, 7=6.99 Hz, 2 H), 7.20 (m, 3 H), 7.30 (t, 7=7.35 Hz, 2 H), 7.50 (td, 7=7.72, 1.47 Hz, 1 H), 7.61 (dd, 7=7.72, 1.10 Hz, 1 H), 17.20 (s, 1 H).
Example 122 l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(lH)-pyridinone
Example 122A 2H-1 ,3-oxazine-2,6(3H)-dione The title compound was prepared by the method described by Warren, and coworkers in Journal of Organic Chemistry 1975 40(6) 743-746. MS (DCI/NΗ3) m/z 131 (M+NH0+; 1H NMR (300 MHz, DMSO-d6) δ 5.61 (d, 7=7.72 Hz, 1 H) 7.65 (d, 7=7.35 Hz, 1 H) 11.55 (s, I H).
Example 122B 3-benzyl-2H-l,3-oxazine-2,6(3H)-dione The title compound was prepared according to the procedure of Example 110B substituting the product of Example 122A for the product of Example 110A (0.156 g, 25%). MS (DCL/NΗ3) m/z 221 (M+NKL^; 1H NMR (300 MHz, DMSO-d6) δ 4.89 (s, 2 H) 5.78 (d, 7=7.72 Hz, 1 H) 7.37 (m, 5 H) 7.97 (d, 7=8.09 Hz, 1 H).
Example 122C l-benzyl-3-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hydroxy-2(lH)-pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 122B for the product of Example IB (0.13 g, 5%). MS (ESI-) m/z 380 (M-H)"; 1H NMR (300 MHz, DMSO-d6) δ 4.89 (s, 2 H) 5.53 (d, 7=7.35 Hz, 1 H) 7.11 (d, 7=7.72 Hz, 1 H) 7.28 (m, 6 H) 7.39 (d, 7=7.72 Hz, 1 H) 7.50 (m, 1 H) 7.61 (dd, 7=7.72, 1.10 Hz, 1 H) 16.83 (s, 1 H).
-205- Example 123 l-benzyl-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-5,6-dimethyl-2(lH)- pyridinone
Example 123 A
4,5-dimethyl-2H-l,3-oxazine-2,6(3H)-dione The title compound was prepared by the method described by.Washburne, et. al. Tetrahedron Letters 197617(4) 243-246. MS (DCI/NΗ3) m/z 204 (M+H)+
Example 123B
3-benzyl-4,5-dimethyl-2H- 1 ,3-oxazine-2,6(3H)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 123 A for the product of Example 1 A and substituting benzyl bromide for n-butyl bromide (0.109 g, 27%). MS (DCiyNΗs) m/z 249 (M+NEL^; 1H NMR (300 MHz, DMSO-d6) δ 1.86 (s, 3 H) 2.14 (s, 3 H) 5.09 (s, 2 H) 7.32 (m, 5 H).
Example 123C l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6-dimethyl-2(lH)- pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 123B for the product of Example IB (0.070 g, 36%). MS (ESI-) m/z 408 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 1.88 (s, 3 H) 2.10 (s, 3 H) 5.20 (s, 2 H) 7.13 (m, 2 H) 7.21 (m, 2 H) 7.31 (m, 7=7.17, 7.17 Hz, 3 H) 7.50 (m, 1 H) 7.62 (dd, 7=7.91, 1.29 Hz, 1 H) 17.28 (s, 1 H). :
Example 124 7-benzyl-5-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-3-methylthienor2,3- b1pyridin-6(7H)-one
Example 124A 5-methyl-2H-thienor2,3-dl[1.31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Fabis, and co-workers as described in Tetrahedron, 1998, 54, 10789-10800. MS (ESI-) m/z 182 (M-Η)".
Example 124B l-benzyl-5-methyl-2H-thienor2.3-Jiri.31oxazine-2,4(lH)-dione
-206- The title compound was prepared according to the procedure of Example IB substituting the product of Example 124A for the product of Example IA and substituting benzyl bromide for n-butyl bromide (0.075 g, 50%). MS (DCI/NH3) m/z 291 (M+NH .
Example 124C
7-benzyl-5-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-3-methylthienor2,3- b1pyridin-6(7H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 124B for the product of Example IB (0.025 g, 23%). MS (ESI-) m z 450 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO- d6) δ 2.46 (s, 3 H), 5.12 (s, 2 H), 6.47 (d, 7=1.10 Hz, 1 H), 7.28 (m, 7 H), 7.52 (td, 7=7.72, 1.47 Hz, 1 H), 7.64 (dd, 7=7.72, 1.47 Hz, 1 H), 16.31 (s, 1 H).
Example 125
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(3-methylbutyl)thienor3,2- bl p yridin-5 (4H)-one
Example 125A 1 -(3-methylbutyl)-2H-thienor3 ,2-Jl r 1 ,31 oxazine-2,4( lHVdione
The title compound was prepared according to the procedure of Example IB substituting the product of Example ΗOA for the product of Example IA and substituting 1- bromo-3-methyl butane for n-butyl bromide (0.246 g, 68%).
Example 125B :
6-(l,l-dioxido-'4Η-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(3-methylbutyl)thienor3,2- blpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 125 A for the product of Example IB (0.223 g, 52%). MS (ESI-) m/z 416 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.96 (d, 1=6.90 Hz, 6 H) 1.45 (m, 2 H) 1.67 (m, 1 H) 3.99 (m, 2 H) 7.09 (d, 7=5.52 Hz, 1 H) 7.19 (d, 7=7.72 Hz, 1 H) 7.26 (m, 1 H) 7.53 (ddd, 7=8.55, 7.26, 1.47 Hz, 1 H) 7.64 (dd, 7=7.72, 1.47 Hz, 1 H) 7.80 (d, 7=5.52 Hz, I H) 15.95 (s, 1 H).
Example 126 6-α.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-(2-ethylbutyl)-7-hvdroxythienor3.2-
-207- blpyridin-5(4H)-one
Example 126 A l-(2-ethylbutyl)-2H-thieno[3,2-Jiri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example 1 A and substituting 1- bromo-2-ethyl butane for n-butyl bromide (0.116 g, 31%). MS (DCI/NΗ3) m/z 271 (M+NIL^.
Example 126B
6-(l,l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-(2-ethylbutyI)-7-hydroxythienor3,2- blpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 126A for the product of Example IB (0.052 g, 26%). MS (ESI-) m/z 430 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.87 (t, 7=7.35 Hz, 6 H) 1.29 (m, 4 H) 1.73 (m, 7=13.24, 6.99 Hz, 1 H) 3.91 (d, 7=7.35 Hz, 2 H) 7.08 (d, 7=5.52 Hz, 1 H) 7.18 (d, 7=8.09 Hz, 1 H) 7.25 (m, 7=7.54, 7.54 Hz, 1 H) 7.53 (ddd, 7=8.55, 7.26, 1.47 Hz, 1 H) 7.64 (dd, 7=7.72, 1.47 Hz, 1 H) 7.78 (d, 7=5.15 Hz, 1 H) 15.99 (s, 1 H).
Example 127 l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-5-phenyl-
2(lH)-pyridinone
Example 127A
4-methyl-5-phenyl-2H-l,3-oxazine-2,6(3H)-dione Ethyl 2-phenylacetoacetate (1.0 g, 4.85 mmol) and urethane (0.43 g, 4.85 mmol) were heated, neat, with Phosphorous oxychloride (3 mL) at 90 °C for 3 hours. The excess reagents were removed under vacuum and the resulting residue was triturated with benzene and filtered. This sohd was triturated with diethyl ether, filtered, and dried to yield 0.818 g (83%). MS (DCI/NΗ3) m/z 204 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 1.98 (s, 3 H) 7.28 (m, 2 H) 7.39 (m, 3 H) 11.65 (s, 1 H).
Example 127B 3-benzyl-4-methyl-5-phenyl-2H-l,3-oxazine-2.6(3H -dione
The title compound was prepared according to the procedure of Example IB
-208- substituting the product of Example 127 A for the product of Example 1 A and substituting benzyl bromide for n-butyl bromide (0.257 g, 71%). MS (DCI NH3) m/z 311 (M+NEL ; 1H NMR (300 MHz, DMSO-d6) δ 2.03 (s, 3 H) 5.16 (s, 2 H) 7.34 (m, 10 H).
Example 127C l-benzyl-3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-vI)-4-hvdroxy-6-methyl-5-phenyl-
2(lH)-pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 127B for the product of Example IB (0.022 g, 5%). MS (ESI-) m/z 470 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 1.92 (s, 3 H) 5.24 (s, 2 H) 7.19 (m, 10 H) 7.33 (m, 2 H) 7.46 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.61 (dd, 7=7.91, 1.29 • Hz, 1 H) 16.97 (s, 1 H).
Example 128
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-5 ,6-dimethyl- l-(3-methylbutyl)-
2( lH)-p yridinone
Example 128 A 4.5-dimethyl-3-(3-methylbutyl)-2H-l,3-oxazine-2,6(3H)-dione
The title compound was prepared according to the procedure of Example IB substituting the product of Example 123 A for the product of Example IA and substituting 1- bromo-3-methyl butane for n-butyl bromide (0.224 g, 60%). MS (DCI/NΗ3) m/z 255 (M+NH +; 1H NMR (300 MHz, DMSO- d6) δ 0.92 (d, 7=6.62 Hz, 6 H) 1.46 (m, 2 H) 1.59 (dt, 7=13.14, 6.48 Hz, 1 H) 1.85 (s, 3 H) 2.26 (s, 3 H) 3.77 (m, 2 H). :
" Example 128B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-5,6-dimethyl-l-(3-methylbutyl)-
2(lH)-pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 128A for the product of Example IB (0.132 g, 32%). MS (ESI-) m/z 388 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.94 (d, J=2.5 Hz, 6H) 1.87 (s, 3H) 2.24 (s, 3H) 3.84 (m, 2H) 7.16 (m, IH) 7.21 (m, IH) 7.49 (m, IH) 7.61 (m, IH) 17.41 (s, IH).
Example 129
-209- 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 -(2-ethylbutyl)-4-hydroxy- ,6-dimethyl-
2(lH)-pyridinone
Example 129A 3-(2-ethylbutyl)-4,5-dimethyl-2H-l,3-oxazine-2,6(3H)-dione
The title compound was prepared according to the procedure of Example IB substituting the product of Example 123 A for the product of Example IA and substituting 1- bromo-2^ thyl-butane for n-butyl bromide (0.181 g, 45%). 1H NMR (300 MHz, DMSO- d6) δ 0.85 (t, 7=7.35 Hz, 6 H) 1.29 (m, 4 H) 1.65 (m, 1 H) 1.86 (s, 3 H) 2.25 (s, 3 H) 3J3 (d, 7=7.35 Hz, 2 H).
Example 129B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-5,6-dimethyl-
2(lH)-pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 129A for the product of Example IB (0.027 g, 9%). MS (ESI-) m/z 402 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.85 (t, 7=7.35 Hz, 6 H) 1.25 (m, 4 H) 1.62 (m, 1 H) 1.88 (s, 3 H) 2.22 (s, 3 H) 3.82 (m, 2 H) 7.14 (d, 7=7.72 Hz, 1 H) 7.21 (m, 1 H) 7.48 (ddd, 7=8.46, 7.17, 1.65 Hz, 1 H) 7.60 (dd, 7=7.91, 1.29 Hz, 1 H) 17.42 (s, I H).
Example 130 l-benzyl-3-( l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-6-phenyl-2(lH)- pyridinone
Example 130A 4-phenyl-2H-l,3-oxazine-2,6(3H)-dione The title compound was prepared according to the procedure of Example 127A, substituting ethyl benzoylacetate for ethyl 2-phenylacetoacetate to yield the desired product (0.99 g, 47%). MS (DCI/NΗ3) m/z 188 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 6.03 (s, 1 H) 7.56 (m, 3 H) 7J9 (m, 2 H) 11.80 (s, 1 H).
Example 13QB 3-benzyl-4-phenyl-2H- 1 ,3-oxazine-2,6(3H)-dione
The title compound was prepared according to the procedure of Example IB substituting the product of Example 130A for the product of Example IA and benzyl bromide
-210- for n-butyl bromide (0.223 g, 78%).
Example 130C l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-phenyl-2(lH)- 5 , pyridinone
The title compound was prepared according to the procedure of Example ID substituting the product of Example 130B for the product of Example IB (0.021 g, 6%). MS (ESP) m/z 456 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO- d6) δ 4.89 (s, 2 H) 5.44 (s, 1 H) lό 6.87 (d, 7=6.99 Hz, 1 H) 7.20 (m, 9 H) 7.35 (m, 2 H) 7.52 (ddd, 7=8.55, 7.26, 1.47 Hz, 1 H) 7.63 (dd, 7=7.72, 1.47 Hz, 1 H) 16.78 (s, 1 H) .
Example 131 5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-7-(3-methyl-2-butenyl)thienor2,3- 15 blpyridin-6(7H)-one
Example 131 A l-(3-methylbut-2-enyl)-2H-thienor2,3-Jiπ,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB 20 substituting the product of Example 114A for the product of Example IA and substituting 1- bromo-3-methyl-but-2-ene for n-butyl bromide (0.23 g, 82%). MS (DCI/NΗ3) m/z 255 (M+NH ; 1H NMR (300 MHz, DMSO- d6) δ 1.72 (d, 7=1.10 Hz, 3 H) 1.79 (d, 7=0.74 Hz, 3 H) 4.50 (d, 7=6.62 Hz, 2 H) 5.23 (m, 1 H) 7.28 (d, 7=1.10 Hz, 2 H).
25 Example BIB
5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-7-(3-methyl-2-butenyl)thienor2,3- b1pyridin-6(7H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 131A for the product of Example IB (0.178 g, 44%). 30 MS (ESI-) m/z 414 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. ]H NMR (300 MHz, DMSO- d6) δ 1.69 (s, 3 H) 1.82 (s, 3 H) 4.51 (d, 7=6.62 Hz, 2 H) 5.13 (m, 1 H) 6.94 (d, 7=5.52 Hz, 1 H) 7.20 (m, 2 H) 7.25 (m, 1 H) 7.53 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.64 (dd, 7=7.72, 1.47 Hz, 1 H) 16.30 (s, 1 H).
35 Example 132 l,5-dibenzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-2(lH)- pyridinone
-211- Example 132 A 5-benzyl-4-methyl-2H-l,3-oxazine-2,6(3H)-dione The title compound was prepared according to the procedure of in Example 127A, 5 substituting ethyl 2-benzyl-3-oxo-butyric acid ethyl ester for ethyl 2-phenylacetoacetate to yield the desired product. MS (DCIZNΗ3) m/z 218 (M+H)+ -
Example 132B
3,5-dibenzyl-4-methyl-2H-l,3-oxazine-2,6(3H)-dione lό The title compound was prepared according to the procedure of Example IB substituting the product of Example 132A for the product of Example IA and benzyl bromide for n-butyl bromide (0.215 g, 76%).
Example 132C 15 l,5-dibenzyl-3-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-2(lΗ)- pyridinone The title compound was prepared according to the procedure of Example ID substituting the product of Example 132B for the product of Example IB (0.051 g, 15%). MS (ESI-) m/z 484 (M-H)". The sodium salt of the title compound was prepared according to 20 the procedure of Example ID. 1H NMR (300 MHz, DMSO- dβ) δ 2.05 (s, 3 H) 3.84 (s, 2 H) 5.21 (s, 2 H) 7.21 (m, 12 H) 7.49 (m, 1 H) 7.62 (dd, 7=7.91, 1.29 Hz, 1 H) 17.10 (s, 1 H).
Example 133 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hvdroxy-6-methyl-5- 25 phenyl-2(lH)-pyridinone
Example 133A 3-(2-ethylbutyl)-4-methyl-5-phenyl-2H-l,3-oxazine-2,6(37 )-dione 30 The title compound was prepared according to the procedure of Example IB substituting the product of Example 127 A for the product of Example IA and substituting 1- bromo-2-ethyl butane for n-butyl bromide (0.145 g, 41%). MS (DCI NΗ3) m/z 288 (M+H)+
Example 133B 35 3-α.l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hvdroxy-6-methyl-5- phenyl-2( lH)-pyridinone
-212- The title compound was prepared according to the procedure of Example ID substituting the product of Example 133 A for the product of Example IB (0.019 g, 8%). MS (ESI-) m/z 464 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- de) δ 0.88 (t, 7=7.35 Hz, 6 H) 1.30 (m, 4 H) 1.71 (m, 1 H) 2.03 (s, 3 H) 3.83 (m, 2 H) 7.10 (m, 3 H) 7.22 (m, 2 H) 7.34 (t, 7=7.17 Hz, 2 H) 7.45 (ddd, 7=8.27, 7.17, 1.47 Hz, 1 H) 7.60 (dd, 7=7.91, 1.29 Hz, 1 H) 17.10
(s, 1 H).
"
Example 134 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-pentylthienor3,2-blpyridin-
5(4H)-one
Example 134A l-pentyl-2H-thieno \32-d] f 1 ,31 oxazine-2,4( lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example 1 A and substituting n- pentyl bromide for n-butyl bromide (0.205 g, 72%).
Example 134B 6-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-pentylthienor3,2-blpyridin-
5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 134A for the product of Example IB (0.189 g, 53%). MS (ESI-) m/z 416 (M-H)" The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.88 (m, 3 H) 1.33 (m, 4 H) 1.57 (m, 2 H) 3.97 (m, 2 H) 7.14 (d, 7=5.52 Hz, 1 H) 7.18 (d, 7=8.09 Hz, 1 H) 7.25 (m, 1 H) 7.53 (m, 1 H) 7.64 (dd, 7=7.91, 1.29 Hz, 1 H) 7.79 (d, 7=5.52 Hz, 1 H) 15.96 (s, 1 H).
Example 135 5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-3-methyl-7-(3- methylbutyl)thienoF2,3-b"lpyridin-6(7H)-one Example 135A 5-methyl-2H-thienor2,3-Jiπ,31oxazine-2,4(lH)-dione The title compound was prepared from 2-amino-4-methyl-thiophene-3-carboxylic acid ethyl ester according to the procedure of Fabis, and co-workers as described in
Tetrahedron, 1998, 54, 10789-10800MS (ESI) m/z 182 (M-Η)"; 1H NMR (300 MHz, DMSO-
-213- D6) δ ppm 2.30 (d, 7=1.47 Hz, 3 H), 6.78 (s, 1 H), 12.51 (s, 1 H).
Example 135B 5-methyl-l-(3-methylbutyl)-2H-thienor2,3-Jiri,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 135A for the product of Example IA and substituting isopentyl bromide for n-butyl bromide (0.048 g, 30%). MS (Dd/NΗ3) m/z 254 (M+H)+. 1H NMR (3C0 MHz, DMSO-d6) δ 0.94 (d, 7=6.25 Hz, 6 H), 1.61 (m, 3 H), 2.33 (d, 7=1.10 Hz, 3 Ft), 3.83 (m, 2 H), 6.92 (d, 7=1.10 Hz, 1 H).
Example 135C 5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl.)-4-hydroxy-3-methyl-7-(3- methylbutyl)thienor2,3-b1pyridin-6(7H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 135B for the product of Example IB (0.043 g, 52%). MS (DCI NH3) m/z 430 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 0.98 (d, 7=6.25 Hz, 6 H), 1.67 (m, 3 H), 2.50 (s, 3 H), 4.13 (m, 2 H), 7.08 (s, 1 H), 7.55 (t, 7=7.54 Hz, 1 H), 7.68 (d, 7=8.46 Hz, 1 H), 7.77 (t, 7=7.17 Hz, 1 H), 7.92 (d, 7=7.35 Hz, 1 H), 14.30 (s, 1 H), 15.22 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.97 (d, 7=6.62 Hz, 6 H), 1.56 (m, 3 H), 3.89 (m, 2 H), 7.53 (m, 5 H), 16.37 (brs, 1 H).
Example 136 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(4-methylpentyl)thienor3,2- blpyridin-5(4H)-one
Example 136A l-(4-methylpentyl)-2H-thienor32-dl [ 1 ,31oxazine-2,4( lHl-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 1- bromo-4-methyl-pentane for n-butyl bromide (0.110 g, 61%)..
Example 136B 6-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(4-methylpentyl)thieno[3,2- blpyridin-5(4H)-one
The title compound was prepared according to the procedure of Example ID
-214- substituting the product of Example 136A for the product of Example IB (0.064 g, 34%). MS (ESI-) m/z 430 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.86 (s, 3 H) 0.88 (s, 3 H) 1.24 (m, 7=15.81, 6.99 Hz, 2 H) 1.56 (m, 3 H) 3.96 (d, 7=6.99 Hz, 2 H) 7.16 (m, 1 H) 7.26 (t, 7=7.35 Hz, 1 H) 7.53 (t, 7=7.72 Hz, 1 H) 7.64 (d, 7=7.72 Hz, 1 H) 7.80 (d, 7=5.15 Hz, 1 H) 15.96 (s, l H).
v Example 137
4-(3-butenyl)-6-(Ll-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-7-hydroxythienor3,2-b1pyridin- 5(4H)-one
Example 137 A l-but-3-enyl-2H-thienor3,2-- iri,31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example 1 A and substituting 4- bromo-but-1-ene for n-butyl bromide (0.09 g, 56%).
Example 137B 4-(3-butenyl)-6-(l,l-dioxido-4Η-1.2.4-benzothiadiazin-3-yl)-7-hydroxythienor3,2-blpyridin- 5(4H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 137A for the product of Example IB (0.062 g, 38%). MS (ESI-) m/z 399.9 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz; DMSO- d6) δ 2.34 (q, 7=7.23 Hz, 2 H) 4.04 ( , 2 H) 5.05 (m, 2 H) 5.87 (m, 1 H) 7.18 (m, 2 H) 7.25 (t, 7=7.17 Hz, 1 H) 7.53 (m, 1 H) 7.64 (d, 7=6.62 Hz, 1 H) 7.79 (d, 7=5.52 Hz, 1 H) 15.93 (s, 1 H).
Example 138 7-benzyl-5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-phenyl-l,7-dihydro- 6H-pyrazolor3,4-b]pyridin-6-one
Example 138 A ethyl 5-(benzylamino)-l-phenyl-lH-pyrazole-4-carboxylate The title compound was prepared according to the procedure of Example IB substituting ethyl 5-amino-l-phenyl-4-pyrazole-carboxylate for the product of Example IA and substituting benzyl bromide for n-butyl bromide (0.990g, 83%). MS (ESI-) m/z 320(M-
-215- H)".
Example 138B ethyl 5-lbenzyl(3-ethoxy-3-oxopropanoyl)amino1-l-phenyl-lH-pyrazole-4-carboxylate 5 The title compound was prepared (51% yield) from the product of Example 138A and ethyl malonyl chloride according to the procedure of Rowley, and co-workers as described in 7. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m z 434 (M-Η)+. '>
Example 138C lό methyl 7-benzyl-4-hvdroxy-6-oxo-l-phenyl-6J-dihvdro-lH-pyrazolor3,4-b1pyridine-5- carboxylate The title compound was prepared from the product of Example 138B and sodium methoxide according to the procedure of Rowley, and co-workers as described in 7. Med. Chem., 1993, 36, 3386-3396. MS (ESI-) m/z 374 (M-Η)". 15
Example 138D
N-r2-(aminosulfonyl)phenyn-7-benzyl-4-hydroxy-6-oxo-l-phenyl-6,7-dihydro-lH- pyrazolor3,4-blpyridine-5-carboxamide
The title compound was prepared according to the procedure of Example 84C
20 substituting the product of Example 138C for the product of Example 84B and 2- aminobenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.014 g, 61%). MS (ESI+) m/z 516 (M+Η)+.
Example 138E 5 7-benzyl-5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yI)-4-hydroxy-l-phenyl-l,7-dihydro-
6H-pyrazolor3.4-b1pyridin-6-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 138D for the product of Example 84C (0.061 g, 84%). MS (ESI-) m/z 496 (M-H)". The sodium salt of the title compound was prepared according to 30 the procedure of Example ID. ]H ΝMR (300 MHz, DMSO- d6) δ 4.92 (s, 2 H), 6.53 (m, 2 H), 7.21 (m, 9 H), 7.43 (t, 7=7.35 Hz, 1 H), 7.54 (td, 7=7.81, 1.65 Hz, 1 H), 7.64 (dd, 7=7.91, 1.29 Hz, 1 H), 7.88 (s, 1 H), 16.05 (s, 1 H).
Example 139 35 4-benzyl-6-(Ll-dioxido-4H-1.2.4-benzothiadiazin-3-ylV2J-dihvdroxyri,31thiazolor4.5- blpyridin-5(4H)-one
-216- Example 139A methyl 4-(benzylamino)-2-(methylthio)- 1 ,3-thiazole-5-carboxylate The title compound was prepared according to the procedure of Example IB substituting 4-amino-2-methylthio-5-thiazolecarboxylic acid methyl ester for the product of Example IA and substituting benzyl bromide for n-butyl bromide (0.411 g, 57%). MS (ESI+) m/z 295 (M+H)+.
" Example 139B methyl 4-rbenzyl(3-ethoxy-3-oxopropanoyl)amino1-2-(methylthio)-l,3-thiazole-5- carboxylate
The title compound was prepared according to the procedure of Example 138B substituting the product of Example 139A for the product of Example 138A (0.147 g, 30%). MS (ESI+) m/z 409 (M+H)+.
Example 139C ethyl 4-benzyl-7-hvdroxy-2-(methylthio)-5-oxo-4,5-dihvdrori,31thiazolor4.5-blpyridine-6- carboxylate The title compound was prepared according to the procedure of Example 138C substituting the product of Example 139B for the product of Example 138B (0.11 lg, 82%). MS (ESI-) m/z 375 (M-H)".
Example 139D N-f2-(aminosulfonyl)phenyll-4-benzyl-7-hydroxy-2-(methylthio)-5-oxo-4,5- dihvdrori,31thiazolor4,5-blpyridine-6-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 139C for the product of Example 84B and 2- aminobenzenesulfonamide for 2-amino-5-bromobenzenesulfonamide (0.114 g, 75%). MS (ESI-) m/z 501 (M-H)".
Example 139E 4-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-ylV2,7-dihvdroxyn,31thiazolor4,5- blpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 139D for the product of Example 84C (0.108 g, 60%). MS (ESI-) m/z 453 (M-H)". 1H NMR (300 MHz, DMSO- d6) δ 5.37 (s, 2 H), 7.29 (m, 5 H),
-217- 7.44 (t, 7=7.72 Hz, 1 H), 7.50 (d, 7=7.72 Hz, 1 H), 7.67 (td, 7=7.72, 1.47 Hz, 1 H), 7.82 (d, 7=7.72 Hz, 1 H), 14.01 (s, 1 H), 14.32 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 5.13 (s, 2 H), 7.04 (d, 7=8.09 Hz, 1 H), 7.20 (m, 6 H), 7.45 (t, 7=7.35 Hz, 1 H), 7.56 (d, 7=7.72 Hz, 1 H), 17.25 (s, 1 H).
> Example 140
4-r(2-chloro-l,3-thiazol-5-yl)methvn-6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-blpyridin-5(4H)-one
Example 140 A l-r(2-chloro-l,3-thiazol-5-yl)methyll-2H-thienor3,2-eπn,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 104A for the product of Example 1 A and substituting 2- chloro-5-bromomethylthiazole for n-butyl bromide (0.341g, 75%). MS (DCI/NΗ3) m/z 301 (M+H)+. 1H NMR (300 MHz, DMSO- d6) δ 5.35 (s, 2 H), 7.60 (d, J=5.15 Hz, 1 H), 7.89 (s, 1 H); 8.38 (d, J=5.52 Hz, 1 H),
Example 140B
4-r(2-chloro-1.3-thiazol-5-yl)methyl1-6-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl -7- hvdroxythienor3,2-b1pyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 140A for the product of Example IB (0.134 g, 40%). MS (ESI-) m/z 477 (M-H)". 1H NMR (300 MHz, DMSO- d6) δ 5.64 (s, 2 H), 7.55 (t, 7=7.17 Hz, 1 H), 7.67 (d, 7=7.72 Hz, 1 H), 7J8 (t, 7=7.17 Hz, 1 H), 7.86 (d, 7=5.52 Hz, 1 H), 7.93 (d, 7=7.72 Hz, 1 H),7.95 (s, 1 H),8.43 (d, 7=5.52 Hz, 1 H), 14.10 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 141
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(5-methyl-3- pyridinyl)methyllthienoF3,2-b1pyridm-5(4H)-one
Example 141 A 1 - r(5-methylpyridin-3 -yl)methvn-2H-thieno [32-d] IT ,31 oxazine-2,4( 17/)-dione
The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 3-
-218- methyl-5-chloromethylpyridine for n-butyl bromide (0.255g, 38%). MS (DCI/NH3) m/z 275 (M+H)+. 1H NMR (300 MHz, DMSO- d6) δ 2.27 (s, 3 H), 5.21 (s, 2 H), 7.31 (d, 7=5.52 Hz, 1 H), 7.63 (s, 1 H), 8.29 (d, 7=5.15 Hz, 1 H), 8.34 (d, 7=1.47 Hz, 1 H), 8.47 (d, 7=1.84 Hz, 1 H).
Example 14 IB 6-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(5-methyl-3- ,} pyridinyl)methyllthienor3,2-b1pyridin-5(4H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 141A for the product of Example' IB (0.175 g, 43%). MS (ESI-) m/z 451 (M-H)". 1H NMR (300 MHz, DMSO- d6) δ 2.25 (s, 3 H), 5.54 (s, 2 H), 7.53 (m, 3 H), 7.64 (d, 7=7.72 Hz, 1 H), 7.75 (td, 7=7.72, 1.47 Hz, 1 H), 7.92 (d, 7=7.35 Hz, 1 H), 8.34 (d, 7=5.15 Hz, 1 H),8.34 (s, 1 H), 8.45 (d, 7=1.47 Hz, 1 H), 14.30 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 142
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(2-methyl-L3-thiazol-5- yl)methyl1thienor3,2-b1pyridin-5(4H)-one
Example 142A l-r(2-methyl-l,3-thiazol-5-vI)methyl1-2H-thienor3.2- iri.31oxazine-2.4(17 )-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example 1 A and substituting 2- methyl-5-chloromethylthiazole for n-butyl bromide (0.308g, 55%). MS (DCI NΗ3) m/z 281 (M+H)+. 1H NMR (300 MHz, DMSO- d6) δ 2.59 (s, 3 H), 5.34 (s, 2 H), 7.58 (d, 7=5.52 Hz', 1 H), 7.81 (s, 1 H), 8.37 (d, 7=5.52 Hz, 1 H).
Example 142B 6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- r(2-methyl-l ,3-thiazol-5- yl)methyllthienor3,2-blpyridin-5(4H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 142A for the product of Example IB (0.151 g, 40%). MS (DCI/NH3) m/z 459 (M+H)+. 1H NMR (300 MHz, DMSO- de) δ 2.56 (s, 3 H), 5.65 (s, 2 H), 7.56 (t, 7=7.17 Hz, 1 H), 7.68 (d, 7=7.72 Hz, 1 H), 7J9 (m, 3 H), 7.93 (d, 7=7.72 Hz, 1 H), 8.42 (d, 7=5.52 Hz, 1 H), 14.18 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID.
-219- Example 143
4-r(5-chloro-2-thienyl)methyl1-6-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hvdroxythienor3,2-blpyridin-5(4H)-one
Example 143A l-r(5-chlorothien-2-yl)methyll-2H-thienor3.2-Jiri.31oxazine-2.4(lH)-dione The title compound was prepared according to the procedure of Example IB substitutihg the product of Example 110A for the product of Example IA and substituting 2- chloro-5-chloromethylthiophene for n-butyl bromide (0.601g, 100%).
Example 143B 4-r(5-chloro-2-thienyl)methyll-6-(l,l-dioxido-4Η-L2,4-benzothiadiazin-3-yl)-7- hvdroxythienor3,2-b1pyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 143 A for the product of Example IB (0.115 g, 12%). MS (APCI) m/z 478 (M+H)+. 1H NMR (300 MHz, DMSO-D d6) δ 5.59 (s, 2 H), 6.99 (d, 7=3.68 Hz, 1 H), 7.23 (d, 7=4.04 Hz, 1 H), 7.56 (t, 7=7.72 Hz, 1 H), 7.68 (d, 7=7.72 Hz, 1 H), 7.78 (m, 1 H), 7.80 (d, 7=5.88 Hz, 1 H), 7.93 (d, 7=8.09 Hz, 1 H), 8.41 (d, 7=5.52 Hz, 1 H), . 14.18 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 144 6-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(2-methyl-l ,3-thiazol-4- yl)methvnthieno|"3,2-blpyridin-5(4H)-one
Example 144 A l-r(2-methyl-l,3-thiazol-4-yl)methyl1-2H-thienor3,2-Jiri,31oxazine-2.4(17D-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 2- methyl-4-chloromethylthiazole hydrochloride for n-butyl bromide (0.200g, 36%). •
Example 144B 6-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(2-methyl-l,3-thiazol-4- yl)methvnthienor3,2-b1pyridin-5(4H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 144A for the product of Example IB (0.127 g, 38%).
-220- MS (ESI+) m/z 459 (M+H)+. 1H NMR (300 MHz, DMSO- d6) δ 2.60 (s, 3 H), 5.55 (s, 2 H), 7.54 (t, 7=6.99 Hz, 1 H), 7.54 (d, 7=5.52 Hz, 1 H), 7.65 (d, 7=7.72 Hz, 1 H), 7J6 (m, 1 H), 7.92 (d, 7=6.62 Hz, 1 H), 8.34 (d, 7=5.51 Hz, 1 H), 14.30 (s, 1 H),
5 Example 145
4-benzvI-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-2- (methylsulfanvI)ll,31thiazolor4,5-b]pyridin-5(4H)-one
Example 145A lό 4-benzyl-2-(methylthio)-5H-ri.31thiazolor4,5-Jin.31oxazine-5,7(4H)-dione
The title compound was prepared according to the procedure of Example 3B substituting the product of Example 139 A for the product of Example 3 A (0.048 g, 92%). MS (DCI NΗ3) m/z 324 (M+NH0+.
15 Example 145B
4-benzyl-6-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-2- (methylsulfanyl)rL31thiazolor4,5-b1pyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 145 A for the product of Example IB (0.037 g, 51%). 20 MS (ESI) m/z 485 (M+H)+. The sodium salt of the title compound was prepared according to the procedure of Example ID. lH NMR (300 MHz, DMSO- d6) δ 2.73 (s, 3 H), 5.31 (s, 2 H), 7.25 (m, 7 H), 7.53 (td, 7=7.72, 1.47 Hz, 1 H), 7.64 (dd, 7=7.91, 1.29 Hz, 1 H), 15.52 (s, I H).
25 Example 146
4-benzyl-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxy-2- (methylsulfonyl)ll,31thiazolo[4,5-blpyridin-5(4H)-one The title compound was prepared as a white solid from the product of Example 145B and 3-chloroperoxybenzoic acid according to the procedure of Leysen, and co-workers 30 described in 7. Heterocyclic Chem., 1984, 21, 401-406. MS (ESI) m z 515 (M-H)"; !H NMR (300 MHz, DMSO-dδ) δ 3.59 (s, 3 H), 5.51 (s, 2 H), 7.32 (m, 5 H), 7.51 (m, 2 H), 7.69 (m, 1 H), 7.85 (d, 7=7.72 Hz, 1 H), 13.95 (s, 1 H).
Example 147 35 2-amino-4-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxyri.31thiazolor4.5-b1pyridin-5(4H)-one The product of Example 146 (0.011 g, 0.02 mmol) was reacted with ammonia (0.5 M
-221- in dioxane, 1.3 mL, 0.64 mmol) in a pressure tube at 70°C for 17 hours. The reaction was cooled and the resulting precipitate was collected by filtration and dried to give the title compound as a white solid (0.009 g, 100%). MS (ESI) m/z 452 (M-H)"; JH NMR (300 MHz, DMSO-de) δ 5.43 (s, 2 H), 6.91 (s, 1 H), 7.07 (s, 1 H), 7.30 (m, 4 H), 7.52 (dd, 7=24.27, 8.82 Hz, 2 H), 7.69 (t, 7=7.54 Hz, 1 H), 7.85 (d, 7=8.82 Hz, 1 H), 9.03 (br s, 1 H), 14.57 (brs, 1 H).
Example 148
4-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxyri,31thiazolor4,5- bl pyridin-5 (4H)-one
The product of Example 147 (0.0085 g, 0.019 mmol) was reacted with terf-butyl nitrite (5 DL, 0.037 mmol) in DMF (0.3 mL) at 60°C for 1 hour. The reaction was cooled, and the crude mixture was purified by column chromatography with silica gel eluting with hexane and ethyl acetate (1:1) to give the title compound as a yellow solid (0.0045 g, 54%). MS (ESI) m/z 437 (M-H)"; 1H NMR (300 MHz, DMSO-d6) δ 5.53 (s, 2 H), 7.25 (m, 1 H), 7.31 (m, 4 H), 7.43 m, 2 H), 7.66 (m, 1 H), 7.80 (d, 7=8.46 Hz, 1 H), 9.48 (s, 1 H), 14.56 (br s, 1 H).
759163 Example 149 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(2-phenylpropyl)-1.8- naphthyridin-2( lH)-one
Example 149 A ethyl 2-r(2-phenylpropyl)aminolnicotinate The title compound was prepared according to the procedure of Example 3 A substituting (+ )-beta-methylphenethylamine for 2-ethyl-butylamine (0.44 g, 58%). MS (DCI+) m/z 285 (M+H)-; 1H NMR (300 MHz, DMSO-d6) δ 1.25 (m, 6H), 3.07 (m, IH), 3.64 (m, 3H), 4.22 (q, J=6.99 Hz, IH), 6.61 (dd, 1=7.72, 4J8 Hz, IH), 7.21 (m, IH), 7.30 (m, 4H), 7.87 (t, J=5.52 Hz, IH), 8.05 (m, IH), 8.29 (m, IH).
Example 149B l-(2-phenylpropyl)-2H-pyridor2.3--fin.31oxazine-2.4(lJJ)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 149A for the product of Example 3 A (0.44 g, 99%). MS (DCI+) m/z 283 (M+Η)-; 1H NMR (300 MHz, DMSO-d6) δ 1.26 (d, J=6.99 Hz, 3H), 3.37 (m, IH), 4.21 (dd, J=13.24, 6.25 Hz, IH), 4.36 (m, IH), 7.21 (m, IH), 7.29 (m, 4H), 7.38 (dd, J=7.72, 4.78 Hz, IH), 8.39 (dd, J=7.72, 1.84 Hz, IH), 8.77 (dd, J=4.78, 1.84 Hz, IH).
-222- Example 149C 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(2-phenylpropyl)-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 149B for the product of Example IB (0.045 g, 62%). MS (ESI-) m z 459 (M-H)"; 1H NMR (300 MHz, DMSO-D6) δ 1.23 (d, J=7.35 Hz, 3H), 3.47 (m, 1H),' .59 (dd, J=12.50, 6.62 Hz, IH), 4.75 (m, IH), 7.16.(m, IH), 7.28 (m, 4H), 7.45 (dd, 1=7.91, 4.60 Hz, IH), 7.56 (t, J=7.54 Hz, IH), 7.69 (m, IH), 7.78 (m, IH), 7.93 (d, J=8.09 Hz, IH), 8.53 (dd, J=8.09, 1.84 Hz, IH), 8.80 (dd, J=4.60, 1.65 Hz, IH), 14.13 (brs, IH). The sodium salt of the title compound was prepared according to the procedure of Example ld. 1H NMR (300 MHz, DMSO-D6) δ 1.12 (d, J=6.99 Hz, 3H), 3.42 (m, IH), 4.30 (dd, J=12.50, 5.52 Hz, IH), 4.67 (dd, J=12.32, 9.74 Hz, IH), 7.12 (dd, J=7.72, 4.78 Hz, IH), 7.18 (m, IH), 7.30 (m, 6H), 7.56 (m, IH), 7.67 (d, J=7.72 Hz, IH), 8.36 (dd, J=7.54, 2.02 Hz, IH), 8.50 (dd, J=4.78, 1.84 Hz, IH), 15.92 (s, IH).
Example 150 8-benzyl-6-( 1 , 1 -dioxido-4H-L2,4-benzothiadiazin-3-yl)-5-hydroxy-2- (methylsulfanyl)pyridor2,3-d1pyrimidin-7(8H)-one
Example 150 A ethyl 4-(benzylamino)-2-(methvIthio)pyrimidine-5-carboχylate The title compound was prepared according to the procedure of Example 108 A substituting benzyl amine for l-amino-2-ethyl-butane (0.97 g, 92%). MS (DCI/NH3) m/z 304 (M+H)+ 1H NMR (300 MHz, DMSO- d6) δ 1.32 (q, 7=7.48 Hz, 3 H) 2.41 (s, 3 H) 4.30 • (q, 7=7.11 Hz, 2 H) 4.73 (d, 7=5.88 Hz, 2 H) 7.30 (m, 5 H) 8.58 (s, 1 H) 8.89 (t, 7=5.70 Hz, 1 H)
Example 150B 4-(benzylamino)-2-(methylthio)pyrimidine-5-carboxylic acid
The title compound was prepared according to the procedure of Example 108B substituting the product of Example 150A for the product of Example 108A. (0.185 g, 78%).
Example 150C l-benzyl-7-(methylthio)-2H-pyrimido[4,5-Jiri,31oxazine-2.4diJ)-dione
The title compound was prepared according to the procedure of Example 108C substituting the product of Example 150B for the product of Example 108B (0.145 g, 72%).
-223- MS (DCI/NH3) m/z 302 (M+H)+
Example 150D 8-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-5-hydroxy-2- 5 (methylsulfanyl)pyrido[2,3-dlpyrimidin-7(8H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 150C for the product of Example IB (0.042 g, 18%). MS (ESP) m/z 478 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 2.48 (s, 3 H) 5.41 (s, 2 H) lό 7.26 (m,7H) 7.57 (m, 1 H) 7.67 (dd, 7=7.54, 0.92 Hz, 1 H) 8.91 (s, 1 H) 15.42 (s, 1 H).
Example 151 8-benzyl-6-(l,l-dioxido-4H-L2,4-benzothiadiazm-3-yl)-5-hydroxypyridor2,3-dlpyrimidin-
7(8H)-one 15 The title compound was prepared according to the procedure of Example 109 substituting the product of Example 151D for the product of Example 108D (0.019 g, 58%). MS (ESI-) m/z 432 (M-H)"; 1H NMR (300 MHz, DMSO- d6) δ 5.44 (s, 2 H) 7.20 (m, 1 H) 7.30 ( , 7 H) 7.57 (m, 1 H) 7.68 (d, 7=8.09 Hz, 1 H) 8.94 (s, 1 H) 9.12 (s, 1 H) 15.32 (s, 1 H). 20
Example 152 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3-hydroxybutyl)-2(lH)- quinolinone A solution of the product of Example 73 (0.12 g, 0.30 mmol) in tetrahydrofuran (6 25 mL) was treated with 3.0 M methyl magnesium bromide (0.11 mL, 0.33 mmol) at -50 °C, then stirred at room temperature for 1 hour. The solution was diluted with IN HCl and water then filtered. The resulting solid was triturated with dichloromethane and filtered. The filtrate was concentrated to give the title compound (0.050 g, 40%). MS (DCI/NH3) m/z 415 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 1.14 (d, 7=6.25 Hz, 3 H) 1.75 (dd, 7=9.19, 5.52 30 Hz, 2 H) 3.78 (m, 1 H) 4.57 (m, 2 H) 7.54 ( , 2 H) 7.77 (m, 2 H) 7.94 (d, 7=7.35 Hz, 1 H) 8.58 (dd, 7=7.91, 2.02 Hz, 1 H) 8.90 (dd, 7=4.78, 1.84 Hz, 1 H) 14.12 (s, 1 H).
Example 153 l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxythienor3,4-b1pyridin- 5 ' 2(lH)-one
Example 153 A
-224- 4H-thienor3;4-Jiπ,31oxazine-2,4(lH)-dione The title compound was prepared according to procedure of Example 119A substituting ethyl 3-aminothiophene-5-carboxylate hydrochloride for methyl 3-amino-5- phenylthiophene-carboxylate (0.86 g, 50%). MS (DCI/NΗ3) m/z 187 (M+NELf; 1HNMR (300 MHz, DMSO-de) δ 6.90 (d, J=9.93 Hz, 1 H) 8.65 (d, 1=9.93 Hz, 1 H) 11.57 (brs, 1 H).
Example 153B ' l-benzyl-4H-thienor3,4-Jl Tl .31oxazine-2,4(lH)-dione
The. title compound was prepared according to the procedure of Example IB substituting the product of Example 153 A for the product of Example 1 A and substituting benzyl bromide for n-butyl bromide (0.33g, 91%).
Example 153C l-benzyl-3-(l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-4-hydroxythienor3,4-blpyridin- 2(lH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 153B for the product of Example IB (0.028 g, 5%). MS (ESI-) m/z 436 (M-H)"; 1H NMR (300 MHz, DMSO- d5) δ 5.13 (s, 2 H) 6.68 (d, 7=3.31 Hz, 1 H) 7.21 (m, 2 H) 7.28 (m, 5 H) 7.54 (m, 1 H) 7.64 (m, 1 H) 7.99 (d, 7=3.31 Hz, 1 H) 15.83 (s, l H).
Example 154 4- r(5 -bromo-2-thienyl)methyll -6-( 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadi azin-3 -yl)-7- hydroxythienor3,2-b1pyridin-5(4H)-one
Example 154A l-r(5-bromothien-2-yl)methvn-2H-thienor3,2-Jin,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 110A for the product of Example IA and substituting 2- bromo-5-bromomethyl -thiophene for n-butyl bromide (0.25g, 82%).
Example 154B 4-l(5-bromo-2-thienyl)methyl1-6-(l.l-dioxido-4Η-l,2.4-benzothiadiazin-3-yl)-7- hydroxythieno \3 ,2-blpyri din-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 154A for the product of Example IB (0.219 g, 58%). MS (ESI-) m/z 521 (M-H)". The sodium salt of the title compound was prepared according to
-225- the procedure of Example ID. lR NMR (300 MHz, DMSO- d6) δ 5.28 (s, 2 H) 7.02 (d, 7=3.68 Hz, 1 H) 7.09 (d, 7=3.68 Hz, 1 H) 7.20 (d, 7=8.09 Hz, 1 H) 7.27 (m, 1 H) 7.37 (d, 7=5.15 Hz, 1 H) 7.54 (ddd, 7=8.55, 7.26, 1.47 Hz, 1 H) 7.66 (dd, 7=7.72, 1.47 Hz, 1 H) 7.81 (d, 7=5.15 Hz, 1 H) 15.80 (s, 1 H).
Example 155 l-butyl-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-2(lH)-pyridinone
Example 155 A l-butyl-2-oxo-l,2-dihvdropyridine-3-carboxylic acid
To a solution of 2-hydroxy-nicotinic acid (0.50 g, 3.59 mmol) and potassium hydroxide (0.40 g, 7.13 mmol) in 4: 1 methanol: water (6 mL) at room temperature, was added 1-iodobutane (0.74 mL, 6.42 mmol). This solution was heated at 60 °C for 30 minutes, then cooled to room temperature and diluted with water and IN HCl. The resulting solid was filtered and dried to give the title compound (0.27 g, 39%). MS (DCI/NH3) m/z 196
(M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 0.91 (m, 3 H) 1.30 (m, 2 H) 1.69 (m, 2 H) 4.10 (m, 2 H) 6.73 (m, 1 H) 8.27 (dd, 7=6.62, 1.84 Hz, 1 H) 8.38 (dd, 7=7.35, 2.21 Hz, 1 H) 14.68 (s, 1 H).
Example 155B
N- |"2-(aminosulf onyDphenyll- 1 -butyl-2-oxo- 1 ,2-dihydropyridine-3-carboxamide A solution of the product of Example 155A and 2-aminobenzene sulfonamide (0.24 g, 1.39 mmol) in tetrahydrofuran (8 mL) at room temperature and treated with TBTU (0-(lH- benzotriazol-l-yl)-Ν,Ν,Ν',Ν'-tetramethyluronium tetrafluoroborate) and triethylamine (0.58 mL, 4.15 mmol). After 18 hours, the mixture was poured into water, extracted with ethyl acetate, dried over sodium sulfate, filtered and the filtrate evaporated under vacuum and purified by preparative HPLC on a Waters Symmetry C8 column (40mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 12min (15min run time) at a flow rate of 70mL/min to yield the title compound.
Example 155C l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-2(lH)-pyridinone The title compound was prepared according to the procedure of Example 84D and purified by preparative HPLC on a Waters Symmetry C8 column (40mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 12min (15min run time) at a flow rate of 70mL/min. MS DCI/NH3) m/z 332 (M+H)+. The sodium salt of the title compound was prepared
-226- according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d5) δ 0.93 (t, 7=7.35 Hz, 3 H) 1.34 (td, 7=14.89, 7.35 Hz, 2 H) 1.73 (ddd, 7=14.89, 7.72, 7.54 Hz, 2 H) 4.13 (m, 2 H) 6.73 (dd, 7=7.35, 6.62 Hz, 1 H) 7.50 (m, 1 H) 7.59 (d, 7=7.35 Hz, 1 H) 7.71 (m, 1 H) 7.85 (dd, 7=7.91, 1.29 Hz, 1 H) 8.30 (dd, 7=6.43, 2.02 Hz, 1 H) 8.62 (dd, 7=7.54, 2.02 Hz, 1 H) 13.76 (s, 1 H).
Example 156 ^3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-l,8-naphthyridine-2,4-diol The product of Example 73 (0.12 g, 0.30 mmol) in tetrahydrofuran (6 mL) was reacted with 3.0 M methyl magnesium bromide (0.11 mL, 0.33 mmol) at -50 °C, and then stirred at room temperature for 1 hour. The solution was diluted with IN HCl and filtered. The resulting solid was triturated with dichloromethane and filtered to yield the product. MS (DCI/NH3) m/z 343 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 7.46 (dd, 7=7.91, 4.60 Hz, 1 H) 7.57 (m, 1 H) 7.64 (d, 7=7.72 Hz, 1 H) 7.79 (ddd, 7=8.36, 7.26, 1.29 Hz, 1 H) 7.94 (d, 7=7.35 Hz, 1 H) 8.49 (dd, 7=8.09, 1.84 Hz, 1 H) 8.80 (dd, 7=4.60, 1.65 Hz, 1 H) 12.92 (s, 1 H) 14.28 (s, 1 H).
Example 157 1 -(benz yloxy)-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)-4-hydroxy- 1 , 8 -naphthyridin- 2(lH)-one
Example 157 A ethyl 2-r(benzyloxy)aminolnicotinate 2-Chloro-nicotinic acid ethyl ester (4.55 g, 24.6 mmol), O-benzylhydroxyamine hydrochloride (7.85 g, 49.2 mmol) and N,N-diisopropylethylamine (6.36 g, 49.2 mmol) in 10 mL 1,4-dioxane were reacted in a sealed tube at 120 °C for 48 hours. The reaction mix was partitioned between ethyl acetate and 5% aqueous sodium bicarbonate. The aqueous layer was re-extracted with ethyl acetate (2 x 50 mL). The organic layers were combined and dried over sodium sulfate, filtered, and concentrated. The residue was purified by column chromatography on silica gel eluting with hexane and ethyl acetate (9:1) to provide the title compound (3.5 g, 53%). MS (DCI) m/z 273 (M+H)+.
Example 157B ethyl 2-r(benzyloxy)(3-ethoxy-3-oxopropanoyl)aminolnicotinate A solution of the product of Example 157A (1.2 g, 4.4 mmol) and triethylamine (0.49 g, 4.8 mmol) in dichloromethane (25 mL) was treated dropwise with ethyl chloromalonate (0.73 g, 4.8 mmol), stirred for 2 hr and partitioned between ethyl acetate and water and the
-227- layers were separated. The ethyl acetate layer was washed with brine, dried (Na2SO ), and concentrated. The residue was purified by column chromatography on silica gel eluting with hexane and ethyl acetate (3:1) to provide the title compound (1.1 g, 65%). MS (DCI) m/z 387 (M+H)+.
Example 157C ethyl 1 -(benzyloxy)-4-hydroxy-2-oxo-l ,2-dihydro- 1 ,8-n'aphthyridine-3 -carboxylate Absolution of the product of Example 157B ( 0.386 g, 1.0 mmol) in ethanol (5 mL) was treated with 21% sodium ethoxide in ethanol (0.324 g, 1.0 mmol), stirred for 30 minutes and partitioned between ethyl acetate and 5% aqueous HCl and the layers were separated. The ethyl acetate layer was washed with brine, dried (Na2SO ), and concentrated to provide the title compound (0.28 g, 82%). MS (DCI) m/z 341(M+H)+.
Example 157D N-r2-(aminosulfonyl)phenyll-l-(benzyloxy)-4-hvdroxy-2-oxo-l,2-dihydro-l,8- naphthyridine-3-carboxamide
The title compound was prepared according to the procedure of Example 84C substituting the product of Example 157C for the product of Example 84B and substituting 2- aminosulfonamide for the product of Example 84A (340 mg, 89% yield). MS (DCI) m/z 467 (M+H)+.
Example 157E l-(benzyloxy)-3-(Ll-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-
2(lHVone The title compound was prepared according to the procedure of Example 84D substituting the product of Example 157D for the product of Example 84C (0.082 g, 87%). MS (ESI-) m/z 447 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO- d6) δ 5.12 (s, 2 H) 7.22 (dd, 7=7.72, 4.78 Hz, 1 H) 7.30 (m, 2 H) 7.44 (m, 3 H) 7.57 (m, 1 H) 7.70 (m, 3 H) 8.41 (dd, 7=7.72, 1.84 Hz, 1 H) 8.61 (dd, 7=4.78, 1.84 Hz, 1 H) 15.70 (s, 1 H).
Example 158 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-isobutoxy-l,8-naphthyridin-
2(lH)-one
Example 158A ethyl 2-(isobutoxyamino)nicotinate
-228- The title compound was prepared according to the procedure of Example 157A substituting O-isobutylhydroxylamine hydrochloride for 0-benzylhydroxya ine hydrochloride (0.372 g, 34%). MS (DCI) m/z 239 (M+H)+.
Example 158B ethyl 2-r(3-ethoxy-3-oxopropanoyl)(isobutoxy)amino1nicotinate
The title compound was prepared according to the procedure of Example 157B substituting the product of Example 158A for the product of Example 157A (0.230 g, 42%).
MS (DCI) m/z 353 (M+H)+.
Example 158C ethyl 4-hvdroxy-l-isobutoxy-2-oxo-l,2-dihvdro-l,8-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 157C substituting the product of Example 158B for the product of 157B (0.200 g, 99%). MS (DCI) m/z 307 (M+H)+.
Example 158D N- r2-(aminosulf onvDphenyll -4-hydroxy- 1 -isobutox v-2-oxo- 1 ,2-dihvdro- 1 , 8 -naphthyridine-
3-carboxa ide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 158C for the product of Example 84B and substituting 2- aminosulfonamide for the product of Example 84A (0.225 g, 86%). MS (DCI) m/z 433 (M+H)+.
Example 158E
3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-isobutoxy-l,8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 158D for the product of Example 84C (0.200 g, 93%). MS (ESI-) m/z 413 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ld. IH ΝMR (300 MHz, DMSO- d6) δ 1.05 (d, 7=6.62 Hz, 6 H) 2.08 (m, 1 H) 3.88 (d, 7=6.62 Hz, 2 H) 7.18 (dd, 7=7.72, 4.78 Hz, 1 H) 7.29 (m, 2 H) 7.55 (m, 1 H) 7,67 (d, 7=7.72 Hz, 1 H) 8.37 (dd, 7=7.72, 1.84 Hz, 1 H) 8.55 (dd, 7=4.78, 1.84 Hz, 1 H) 15.72 (s, 1 H). Example 159 l-butyl-3-(l,l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hVdroxy-L5-naphthyridin-2(lH)- one
-229- Example 159 A 2H-pyridor3.2-.il IT ,31oxazme-2,4(lH)-dione The title compound was prepared as a minor bi-product (0.50 g, 4 %) from 2,3- pyridinecarboxylic anhydride (11.4 g, 76 mmol) and trimethylsilyl azide (11.0 mL, 80 mmol) according to the procedure of Le Count, D.J. and co-workers described in Synthesis, 1982, 972-973. 1H NMR (300 MHz, DMSO- dδ) δ 7.56 (dd, 7=8.46, 1.47 Hz, 1 H) 7.71 (dd, 7=8.46, 4341 Hz, 1 H) 8.51 (dd, 7=4.41, 1.47 Hz, 1 H) 11.78 (s, 1 H).
Example 159B l-butyl-2H-pyridor3.2-Jiri.31oxazine-2,4(17D-dιone The title compound was prepared according to the procedure of Example IB substituting the product of Example 159A for the product of Example IA (0.12 g, 35%). 1H NMR (300 MHz, DMSO- d6) δ 0.92 (t, 7=7.35 Hz, 3 H) 1.40 (m, 7=15.26, 7.17 Hz, 2 H) 1.60 (m, 2 H) 3.98 (m, 2 H) 7.81 (dd, 7=8.82, 4.41 Hz, 1 H) 7.97 (dd, 7=8.64, 1.29 Hz, 1 H) 8.55 (dd, 7=4.23, 1.29 Hz, 1 H).
Example 159C l-butyl-3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 ,5-naphthyridin-2(lH)- one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 159B for the product of Example IB (0.053 g, 25%). MS (ESI-) m/z 397 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 0.94 (t, 7=7.17 Hz, 3 H) 1.39 (m, 2 H) 1.54 (m, 2 H) 4.07 (t, 7=7J2>Hz, 2 H) 7.28 (m, 2 H) 7.56 (m, 2 H) 7.68 (dd, ' 7=7.91, 1.29 Hz, 1 H) 7.77 (d, 7=8.46 Hz, 1 H) 8.39 (d, 7=4.04 Hz, 1 H) 16.15 (s, 1 H).
Example 160 1 -benzyl-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 ,5-naphthyridin-2(lH)- one
Example 160A 1 -benzyl-2H-pyridor3.2-Jl f 1 ,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example IB substituting the product of Example 159A for the product of Example IA and substituting benzyl bromide for n-butyl bromide (0.92 g, 60%). 1H NMR (300 MHz, DMSO- d6) δ 5.28 (s, 2 H) 7.33 (m, 3 H) 7.43 (m, 2 H) 7.70 (m, 2 H) 8.54 (dd, 7=3.86, 1.65 Hz, 1 H).
-230- Example 160B ethyl l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdro-l,5-naphthyridine-3-carboxylate The title compound was prepared according to the procedure of Example 89A substituting the product of Example 160A for the product of Example IB (0.110 g, 23%). MS (DCI) m/z 325 (M+H)+.
Example 160C N-12-(aiαinosulfonyl)phenyl1-l-benzyl-4-hydroxy-2-oxo-l,2-dihydro-l,5-naphthyridine-3- carboxamide The title compound was prepared according to the procedure of Example 89B substituting the product of Example.160B for the product of Example 89A and 2- aminobenzenesulfonamide for 2-amino-4-chlorobenzenesulfonamide (0.12 g, 86%). MS (ESI-) m/z 449 (M-H)".
Example 160D l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,5-naphthyridin-2(lH)- one The title compound was prepared according to the procedure of Example 84C substituting the product of Example 160C for the product of Example 84B (0.120 g, 99%). MS (ESI-) m/z 431 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO- de) δ 5.39 (s, 2 H) 7.25 (m, 7 H) 7.40 (dd, 7=8.46, 4.41 Hz, 1 H) 7.57 (m, 2 H) 7.68 (d, 7=8.09 Hz, 1 H) 8.35 (d, 7=4.04 Hz, 1 H) 16.11 (s, 1 H).
Example 161 l-benzyl-4-chloro-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)- one The title compound was prepared from the product of Example 15B and phosphoryl chloride according to the procedure of Stadlbauer, W. and co-workers described in Journal of Heterocyclic Chemistry, 35, 1998, 627-636 (2.07 g, 88%). MS (ESI-) m/z 449 (M-H)"; *H ΝMR (300 MHz, DMSO- d6) δ 5.68 (s, 2 H) 7.29 (m, 6 H) 7.57 (m, 2 H) 7.75 (m, 1 H) 7.92 (dd, 7=7.91, 1.29 Hz, 1 H) 8.56 (dd, 7=8.09, 1.47 Hz, 1 H) 8.87 (dd, 7=4.60, 1.65 Hz, 1 H) 12.73 (s, 1 H).
Example 162
3-( 1.1 -dioxido-4H- 1.2.4-benzothiadiazin-3-yl)-4-hvdroxy- 1 - 1 f ( 1EV phenylmethylenel amino ) -2( lH)-quinolinone
-231- Example 162A 2-r(2E)-2-benzylidenehydrazinolbenzoic acid The title compound was prepared from 2-hydrazinobenzoic acid hydrochloride (1.89 g, 10.0 mmol) and benzaldehyde (1.06 g, 10.0 mmol) according to the procedure of Fischer, E. and co-workers described in Chem. Ber., 35, 1902, 2318 (2.4 g, quantitative yield). MS (DCI) m/z 241 (M+H)+.
Example 162B 1 - { r(lE)-phenylmethylenelamino I -2H-3 , 1 -benzoxazine-2,4( lHVdione
A solution of the product of Example 162A (1.2 g, 5.0 mmol) and potassium hydroxide ( 0.336 g, 6.0 mmol) in 15 ml of water at 0 °C was treated dropwise with 20% phosgene in toluene (3.5 ml, 6.5 mmol), stirred for 1 hour, treated with IM NaOΗ to reach a pΗ of 10 and extracted 3 X 30 mL with ethyl acetate. The ethyl acetate extracts were combined, washed with brine, dried (Na2S04), and concentrated to provide the title compound (0.32 g, 24%). MS (DCI) m/z 267 (M+Η)+.
Example 162C 3-( 1 , l-dioxido-4H 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 - { \( 1E)- phenylmeth ylenel amino 1-2(1 HVquinolinone
The title compound was prepared according to the procedure of Example ID substituting the product of Example 162B for the product of Example IB (0.110 g, 49%). MS (ESI-) m/z 443 (M-H)". The sodium salt of the title compound was prepared according ' to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 7.16 (m, 1 H) 7.30 (m, 2 H) 7.54 (m, 6 H) 7.67 (dd, 7=8.09, 1.47 Hz, 1 H) 7.99 (m, 2 H) 8.13 (dd, 7=7.91, 1.29 Hz, H) 9.04 (s, 1 H) 16.09 (s, 1 H).
Example 163 l-amino-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-2(lH)-qumolinone A solution of the product of Example 162C (0.075 g, 0.17 mmol) in 10% aqueous potassium hydroxide (5 mL) was refluxed for 2 hours, cooled, treated with 12 M HCl to pH 3 which produced a precipitate. The solid was collected by filtration, washed repeatedly with water and dried to constant mass to give the desired product (0.050 g, 83%). MS (ESI-) m/z 355 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 5.31 (s, 2 H) 7.05 (t, 7=8.09 Hz, 1 H) . 7.27 (m, 2 H) 7.53 (m, 2 H) 7.67 (m, 2 H) 8.07 (dd, 7=8.09, 1.47 Hz, 1 H) 16.38 (s, 1 H).
-232- Example 164 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(2-phenylethyl)-l,8- naphthyridin-2( lH)-one
Example 164A ethyl 2-r(2-phenylethyl)aminolnicotinate The title compound was prepared according to the procedure of Example 3A substituting phenethylamine for 2-ethyl-butylamine (1.98 g, 73%). MS (DCI) m/z 271 (M+H)+.
Example 164B l-(2-phenylethyl)-2H-pyridor2.3-J] ϊ 1 ,31oxazine-2,4(lH)-dione The title compound was prepared according to the procedure of Example 3B substituting the product of 164A for the product of Example 3 A (0.53 g, 99%). MS (DCI) m/z 269 (M+Η)+.
Example 164C 3-( 1 , 1 -dioxido-4H-L2.4-benzothiadiazm-3-yl)-4-hvdroxy- l-(2-phenylethyl)- 1,8- - naphthyridin-2 ( 1 H)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 164B for the product of Example IB (0.132 g, 59%). MS (ESI-) m/z 445 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. H NMR (300 MHz, DMSO- d6) δ 2.87 (m, 2 H) 4.47 (m, 2 H) 7.16 (dd, 7=7.72, 4.78 Hz, 1 H) 7.29 (m, 7 H) 7.57 (m, 1 H) 7.67 (d, 7=7.72 Hz, 1 H) 8.4θ (dd, 7=7.72, 1.84 Hz, 1 H) 8.57 (dd, 7=4.78, 1.84 Hz, 1 H) 15.90 (s, 1 H).
Example 165 l-butyl-4-chloro-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 161 substituting the product of Example ID for the product of Example 15B.
Example 166 4-amino-l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one A solution of the product of Example 165 (0.10 g, 0.24 mmol) and ammonia (2 ml of a 2 M solution in methanol, 4.0 mmol) was stirred in a sealed tube at 100°C for 2 hours, allowed to cool to room temperature. The resulting solid collected by filtration and washed
-233- with methanol (2 ml) to give the title compound as a brown solid (0.019 g, 20%). MS (ESI-) m/z 396 (M-H)-; lH NMR (300 MHz, DMSO- d6) δ 0.94 (t, J=7.35 Hz, 3H), 1.38 (m, 2H), 1.66 (m, 2H), 4.44 (t, J=7.35 Hz, 2H), 7.48 (m, 2H), 7.55 (d, J=8.09 Hz, IH), 7.70 (t, 1=8.46 Hz, IH), 7.84 (dd, J=7.72, 1.10 Hz, IH), 8.77 (d, 1=8.09 Hz, IH), 8.82 (dd, J=4.78, 1.47 Hz, IH), 9.84 (brs, IH).
Example 167 l-butyl-5-(l,l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-(methylamino)-l,8-naphthyridin-
2(lH)-one The title compound was prepared according to the procedure of Example 166 substituting methylamine (2 M solution in methanol) for ammonia (2 M solution in methanol) as a brown solid (0.023 g, 23%). MS (ESI-) m/z 410 (M-H)-; XH NMR (300
MHz, DMSO- d6) δ 0.91 (t, 1=7.17 Hz, 3H), 1.34 (m, 2H), 1.60 (m, 2H), 2.95 (d, J=5.15 Hz,
3H), 4.31 (m, J=7.36 Hz, 2H), 7.36 (dd, J=8.09, 4.78 Hz, IH), 7.40 (d, J=8.46 Hz, IH), 7.49 (t, J=8.09 Hz, IH), 7.71 (m, 2H), 7.85 (dd, 1=7.91, 1.29 Hz, IH), 8.56 (dd, 1=8.27, 1.29 Hz,
IH), 8.69 (dd, J=4.60, 1.29 Hz, IH), 12.44 (brs, IH).
Example 168 l-butyl-4-(dimethylamino)-3-( 1. l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)- 1 ,8-naphthyridin- ' 2(lH)-one
The title compound was prepared according to the procedure of Example 166 substituting dimethylamine (2 M solution in methanol) for ammonia (2 M solution in methanol) as a brown solid (0.015 g, 15%). MS (ESI-) m/z 424 (M-H)-; 1H NMR (300 MHz, DMSO- d6) δ 0.93 (t, J=7.35 Hz, 3H), 1.36 (m, 2H), 1.63 (m, 2H), 2.99 (s, 6H), 4.36 (t, 1=7.72 Hz, 2H), 7.38 (m, 2H), 7.51 (m, IH), 7.73 (m, IH), 7.88 (dd, J=8.09, 1.47 Hz, IH), 8.36 (dd, J=8.09, 1.47 Hz, IH), 8.71 (dd, J=4.78, 1.84 Hz, IH), 12.45 (s, IH).
Example 169 l-butyl-3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydrazino-l ,8-naphthyridin-2(lH)- one
The title compound was prepared according to the procedure of Example 166 substituting hydrazine for ammonia (2 M solution in methanol) as a brown solid (0.026 g, 26%). MS (ESI-) m/z 411 (M-H)-; !H NMR (300 MHz, DMSO- d6) δ 0.94 (t, 1=7.35 Hz, 3H), 1.39 ( , 2H), 1.64 (m, 2H), 3.35 (brs, 3H), 4.41 (t, J=7J2 Hz, 2H), 7.04 (t, J=7.54 Hz, IH), 7.42 (dd, J=7J2, 4.78 Hz, IH), 7.57 (m, IH), 7.83 (dd, J=7.91, 1.65 Hz, IH), 8.49 (dd, J=7J2, 1.84 Hz, IH), 8.64 (d, J=8.46 Hz, IH), 8.68 (dd, J=4.78, 1.84 Hz, IH), 9.65 (s, IH).
-234- Example 170 4-azido-l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one A solution of the product of Example 165 (0.1 g, 0.24 mmol) and sodium azide (0.037 g, 0.571 mmol) in dimethylformamide (2.5 ml) was stirred at 80°C for 1.5 hours, allowed to cool to room temperature and concentrated under reduced pressure. The crude residue was purified by a C8 HPLC column eluting with 20% to 80% acetonitrile in water with 1% trifluoroabetic acid to give the title compound (0.025 g, 26% after column purification). MS (ESI-) m/z 422 (M-H)-; 1H NMR (300 MHz, DMSO- de) δ 0.94 (t, J=7.35 Hz, 3H), 1.38 (m, 2H), 1.67 (m, 2H), 4.42 (t, 1=7.54 Hz, 2H), 7.41 (d, J=7.72 Hz, IH), 7.46 (dd, J=7.91, 4.60 Hz, IH), 7.56 (m, IH), 7J6 (m, IH), 7.91 (dd, J=8.09, 1.10 Hz, IH), 8.41 (dd, J=8.09, 1.84 Hz, IH), 8.84 (dd, J=4.41, 1.84 Hz, IH), 12.74 (s, IH).
Example 171 l-butyl-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-l(2-hvdroxyethyl)aminol-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 166 substituting ethanolamine (0.25 g, 4.0 mmol) and anhydrous methanol (2 ml) for ammonia (2 M solution in methanol) (0.02 g, 19%). MS (ESI-) m/z 440 (M-H)-; 1H NMR (300 MHz, DMSO- d6) δ 0.92 (t, J=7.35 Hz, 3H), 1.35 (m, 2H), 1.61 (m, 2H), 2.71 (m, IH), 3.40 (m, IH), 3.47 (m, 2H), 3.57 (m, 2H), 4.32 (t, 1=7.36 Hz, 2H), 7.35 (m, IH), 7.39 (d, J=6.99 Hz, IH), 7.44 (t, 1=7.72 Hz, IH), 7.51 (brs, IH), 7.67 (m, IH), 7.81 (dd, J=7.91, 1.29 Hz, IH), 8.66 (dd, 1=8.09, 1.47 Hz, IH), 8.69 (dd, 1=4.78, 1.47 Hz, IH).
Example 172 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-propoxyquinolin-2(lH)-one"
Example 172A ethyl 2-(hydroxyamino)benzoate The title compound is prepared from ethyl-2-nitrobenzoate according to the procedure of Entwistle and Gilkerson described in Tetrahedron, 34, 1978, 213-215.
Example 172B ethyl 2-(propoxyamino)benzoate The title compound is prepared according to the procedure of Example IB substituting the product of Example 172A for the product of Example 1 A and substituting n- propyl bromide for n-butyl bromide.
-235- Example 172C ethyl 2-r(3-ethoxy-3-oxopropanoyl)(propoxy)amino1benzoate The title compound is prepared according to the procedure of Example 157B
5 substituting the product of Example 172B for the product of Example 157 A.
Example 172D ,} ethyl 4-hydroxy-2-oxo-l -propoxy-1 ,2-dihvdroquinoline-3-carboxylate The title compound is prepared according to the procedure of Example 157C lό substituting the product of Example 172C for the product of Example 157B.
Example 172E N-r2-(aminosulfonyl)phenyll-4-hydroxy-2-oxo-l-propoxy-l,2-dihydroquinoline-3- carboxamide 15 The title compound is prepared according to the procedure of Example 84C substituting the product of Example 172D for the product of Example 84B and substituting 2- aminosulfonamide for the product of Example 84 A.
; ' Example 172F
20 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-propOxyquinolin-2(lH)-one
The title compound is prepared according to the procedure of Example 84D substituting the product of Example 172E for the product of Example 84C. The sodium salt of the title compound is prepared according to the procedure of Example ID.
Example 173 25 7-benzyl-5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy.-3-(hydroxymethyl)-7,7'a- dihvdrothienor2,3-blpyridin-6(3aH)-one
Example 173A methyl 2-amino-4-(hydroxymethyl)thiophene-3-carboxylate
30 A solution of methyl cyanoacetate (1.18 mL, 13.28 mmol) and sodium sulfide nonahydrate (3.20 g, 13.28 mmol) in methanol (25 mL) at 0 °C was treated with l-acetoxy-3- chloroacetone (2.0 g, 13.28 mmol). The cold bath was removed and triethylamine (1.86 mL, 13.28 mmol) was added dropwise. The solution was stirred at room temperature for 20 hours then diluted with water and extracted into ethyl acetate. The organic layer was dried over
35 sodium sulfate, filtered, and the solvent removed under vacuum to provide the titled compound (1.25 g, 51%). MS (DCI/ΝΗ3) m/z 188 (M+H)+; !H NMR (300 MHz, DMSO- de) δ 3.68 (s, 3 H) 4.45 (dd, 7=5.52, 1.47 Hz, 2 H) 4.88 (t, 7=5.70 Hz, 1 H) 6.12 (s, 1 H) 7.28 (s,
-236- 2 H)
Example 173B methyl 2-amino-4-({ rtert-butyl(dimethyl)silylloxy }methyl)thiophene-3-carboxylate
A solution of the product of Example 173 A (1.25g, 6J0 mmol) and N,N- diisopropylethylamine (0.71 mL, 7.35 mmol) in dichloromethane at 0 °C was treated with t- butyldimέthylsilyl trifluoromethanesulfonate (0.85 mL, 6.70 mmol). After stirring at 0 °C for 1 hour, the solution was poured into water, extracted into dichloromethane, and dried over sodium sulfate. The solvent was removed under vacuum to provide the titled compound (0.87 g, 78%). MS (DCI/NH3) m/z 302 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 0.00 (m, 6 H) 0.84 (s, 9 H) 3.62 (s, 3 H) 4.59 (d, 7=1.47 Hz, 2 H) 6.03 (m, 1 H) 7.22 (s, 2 H).
( Example 173C methyl 2-(benzylamino)-4-({rtert-butyl(dimethyl)silylloxylmethyl)thiophene-3-carboxylate
A solution of the product of Example 173B (0.36 g, 1.20 mmol) and potassium carbonate (0.185 g, 1.30 mmol) in acetonitrile (5 mL) was treated with benzyl bromide (0.16 mL, 1.25 mmol) at 45 °C for 24 hours. The solution was poured into water and extracted into ethyl acetate (2X). The combined organic layers were concentrated and purified by flash chromatography eluting with dichloromethane to provide the titled compound (0.17 g, 36%). MS (DCr/NH3) m z 392 (M+H)+; 1H.NMR (300 MHz, DMSO- d6) δ 0.00 (m, 6 H) 0.84 (s, 9 H) 3.67 (m, 3 H) 4.38 (d, 7=5.88 Hz, 2 H) 4.62 (d, 7=1.47 Hz, 2 H) 6.12 (s, 1 H) 7.28 (m, 5 H) 8.16 (t, 7=6.07 Hz, I H).
Example 173D l-benzyl-5-((rtert-butyl(dimethyl)silyl1oxylmethyl)-2H-thienor2.3-rflll,31oxazine-2.4(lH)- dione The title compound was prepared according to the procedure of Example 3B substituting the product of Example 173C for the product of Example 3A (0.015 g, 83%). MS (DCI/NΗ3) m/z 404 (M+H)+
Example 173E 7-benzyl-5-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-3-(hydroxymethyl)-7JA- dihvdrothienor2,3-t lpyridin-6(3AH)-one
The title compound was prepared according to the procedure of Example ID substituting the product of Example 173D for the product of Example IB. (0.013 g, 8%). MS
-237- (DCI/NH3) m/z 468 (M+H)+; 1H NMR (300 MHz, DMSO- d6) δ 4.78 (s, 2 H) 5.42 (s, 2 H) 7.13 (s, 1 H) 7.32 (m, 5 H) 7.53 (t, 7=7.17 Hz, 1 H) 7.64 (d, 7=9.93 Hz, 1 H) 7.75 (m, 1 H) 7.91 (d, 7=6.99 Hz, I H).
Example 174 l-benzyl-3-(6-chloro-l,l-dioxido-4H-thieno[3.2-glfl.2,41thiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one
v Example 174A
3-amino-5-chlorothiophene-2-sulfonamide The title compound is prepared according to the procedure of Ηansen, J. and coworkers as described in J. of Medicinal Chemistry 2002, 45, 4171-4187.
Example 174B N- r2-(aminosulfonyl)-5 -chlorothien-3 -yll - 1 -benz yl-4-hydrox v-2-oxo- 1 ,2-dihydro- 1,8- naphthyridine-3-carboxamide
The title compound is prepared according to the procedure of Example 84C substituting the product of Example 174A for the product of Example 84 A and substituting 3-amino-5-chlorothiophene-2-sulfonamide for 2-amino-5-bromobenzenesulfonamide.
Example 174C l-benzyl-3-(6-chloro-l,l-dioxido-4H-thienor3,2-eiri,2,41thiadiazm-3-yl)-4-hydroxy-l,8- naphthyridin-2( lHVone The title compound is prepared according to the procedure of Example 84D substituting the product of Example 174B for the product of Example 84C. Example 175 l-benzyl-3-(6-chloro-l,l-dioxido-4H-thienor3,2-eiri,2,41thiadiazin-3-yl)-4-hydroxyquinoIin-
2(lH)-one
Example 175A N-r2-(aminosulfonyl)-5-chlorothien-3-yll-l-benzyl-4-hydroxy-2-oxo-L2-dihvdroquinoline-
3-carboxamide The title compound is prepared according to the procedure of Example 84C substituting the product of Example 174A for the product of Example 84A and substituting the product of Example 99 A for the product of example Example 84B.
Example 175B l-benzyl-3-(6-chloro-l,l-dioxido-4H-thienol3.2-giri,2,41thiadiazin-3-yl)-4-hvdroxyquinolin-
-238- 2(lH)-one The title compound is prepared according to the procedure of Example 84D substituting the product of Example 175A for the product of Example 84C.
Example 176
3-[5-(aminomethyl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yn-l-benzyl-4-hydroxy-l,8- naphthyridin-2( lH)-one he product of Example 97 (91.6 mg, 0.2002 mmol) and Raney-nickel (0.94 g) in tetrahydrofuran (92 mL) and triethylamine (4.5 mL) was hydrogenated at 60 psi Η2 pressure at 50° for 2 days, with additional Raney-nickel (0.94 g) being added after 24 hrs. The reaction was cooled to room temperature, filtered, and concentrated by rotary evaporation to a greenish-yellow solid. The residue was purified by preparative HPLC on a Waters Symmetry C8 column (40mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 12min (15min run time) at a flow rate of 70mI7min to give the title compound as a white solid (11 mg, 12%). MS (ESI-)" m/z 460 (M-H)"; Η NMR (300 MHz, DMSO- de) δ 4.31 (s, 2 H) 5.64 (s, 2 H) 7.28 (m, 6 H) 7.49 (m, 1 H) 7.74 (d, 7=7.35 Hz, 1 H) 7.85 (d, 7=7.72 Hz, 1 H) 8.48 (m, 3 H) 8.68 (m, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. lH NMR (300 MHz, DMSO- d6) δ 4.16 (s, 2 H) 5.54 (s, 2 H) 7.24 (m, 7 H) 7.65 (d, 7=7.72 Hz, 2 H) 8.43 (dd, 7=7.54, 1.65 Hz, 1 H) 8.50 (dd, 7=4.41, 1.84 Hz, 1 H).
Example 177 8-benzyl-3-chloro-6-(l,l-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-5-hydroxypyridor2,3- e1pyridazin-7(8H)-one
Example 177 A
3-(benzylamino)-6-chloropyridazine-4-carbόxylic acid 2,5-Dichloro-pyridizine-3-carboxylate (0.40 g, 2.07 mmol) in toluene (8 mL) was reacted with triethylamine (0.72 mL, 5.20 mmol) and benzyl amine (0.23 mL, 2.07 mmol) at 90 °C for 8 hours. The solution was partitioned between water and ethyl acetate. The organic layer was dried over sodium sulfate, filtered, and concentrated to yield the title compound (0.257 g, 47%). MS (DCI/NΗ3) m/z 264 (M+HT.
Example 177B 8-benzyl-3-chloro-5H-pyridazino \3 Λ-dl \ 1 ,31 oxazine-5 ,7(8H)-dione The title compound is prepared according to the procedure of Example 108C substituting the product of Example 177A for the product of Example 108B.
-239- Example 177C 8-benzyl-3-chloro-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-5-hydroxypyridor2,3- c1pyridazin-7(8H)-one The title compound is prepared according to the procedure of Example ID substituting the product of Example 177B for the product of Example IB.
Example 178 , 8-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-5-hydroxy-3- (methylthio)pyridor2.3-clpyridazin-7(8/7T)-one The product of Example 177 is reacted with methanethiol in toluene at elevated temperatures the reaction was concentrated give the title compound.
Example 179 8-benzyl-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-5-hvdroxypyridor2,3-clpyridazin- 7(8H)-one
The title compound is produced by the procedure of Example 109 substituting the product of Example 178 for the product of Example ,108D.
Example 180 1 -benzyl-3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)-4-hydroxy- 1 ,6-naphthyridin-2( 17/)- one
Example 180A methyl 4-(benzylamino)nicotinate The title compound is prepared from 3-carbomethoxy-4-chloropyridine and benzylamine according to the procedure of Winn, et.al. as described in 7 Med. Chem., 36, 1993, 2676-2688.
Example 180B l-benzyl-2H-pyridor4,3-Jiπ,31oxazine-2,4(li )-dione The title compound is prepared according to the procedure of Example 3B substituting the product of Example 180A for the product of Example 3 A.
Example 180C l-benzyl-3-(lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,6-naphthyridin-2(lH)- one
The title compound is prepared according to the procedure of Example ID substituting the product of Example 180B for the product of Example IB.
-240- Example 181 l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,7-naphthyridin-2(lH)- one
Example 181 A
2H-pyridor3.4-JI IT .31oxazine-2,4(lH)-dione The title compound is prepared according to the procedure of Example ΗOA from 3- aminoisoJiicotinic acid.
Example 18 IB l-benzyl-2H-pyridor3,4--flll,31oxazine-2,4(lH -dione The title compound is prepared according to the procedure of Example IB substituting the product of Example 181A for the product of Example IA, substituting DMF for DMA, and substituting benzyl bromide for n-butyl bromide, respectively.
Example 18 IC l-benzyl-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,7-naphthyridin-2(l/J)- one The title compound is prepared according to the procedure of Example ID substituting the product of Example 18 IC for the product of Example IB .
Example 182 1 -(benzylamino)-3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin-2( 1H)- one A slurry of the product of Example 162 (0.133 g, 0.3 mmol) and 10% palladium on ' carbon (0.02 g, catalytic amount) in TΗF (25 mL) was hydrogenated under 1 atmosphere of hydrogen for 4 hours, filtered through Celite and the filtrate was concentrated. The residue was slurried in 1 mL DMSO / 5 mL MeOΗ for 15 minutes and the solid was collected by filtration and dried under vacuum to give the title compound (0.08 g, 60%). MS (ESI-) m/z 445 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO- d6) δ 3.93 (s, 2 H) 6.09 (t, 7=6.99 Hz, 1 H) 7.09 (t, 7=7.35 Hz, 1 H) 7.35 (m, 5 H) 7.54 (m, 4 H) 7.69 (t, 7=8.82 Hz, 2 H) 8.10 (dd, 7=7.91, 1.29 Hz, 1 H) 16.28 (s, 1 H).
Example 183 A 2-amino-5-methoxybenzenesulfonamide
-241- The title compound was prepared from 4-methoxyaniline using the procedure described in Journal of the Chemical Society, Perkin 1, 1979, 1043.
Example 183B Ethyl (7-methoxy- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)acetate
To a solution of the product of Example 183A (0.534 g, 2.64 mmol) and triethylamine (0.44 mL, 3.17 mmol) in anhydrous dichloromethane (8 mL) under nitrogen at 0°C was added drdpwise ethyl malonyl chloride (0.39 mL, 3.04 mmol). The resulting mixture was stirred at 25°C for 6 hours. The reaction mixture was diluted with 1 N ΗC1 (30 mL), and the aqueous layer was exfracted with ethyl acetate (2 X 30 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate and filtered. The filtrate was concentrated and the resulting brown solid was recrystallized from dichloromethane/methanol to give a pink solid (420 mg). The solid was treated with anhydrous sodium carbonate (700 mg, 6.65 mmol) in anhydrous ethanol (15 mL) and heated at reflux for 7 hours. The solid was filtered off, and the filtrate was concentrated to give the title compound as a white solid (420 mg, total yield for two steps 50%). MS (ESI) m/z 297 (M-Η)". 1H NMR (300 MHz, DMSO-d5) δ ppm 1.19 (t, 7=7.17 Hz, 3 H) 3.23 (s, 2 H) 3.75 (s, 3 H) 4.07 (q, 7=6.99 Hz, 2 H) 6.99 (m, 3 H).
Example 183C
4-hydroxy-3-(7-methoxy- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-vD- l-(3-methylbutyl)- 1,8- naphthyridin-2(lH)-one To a solution of the product of Example 183B (0.5 g, 1.6 mmol) and the product of Example 12A (0.375 g, 1.6 mmol) in anhydrous TΗF (16 mL) under nitrogen at 0°C was added sodium hydride (95%, 0.162 g, 6.4 mmol). The reaction was heated at reflux for 4 hours, cooled to 0°C, and treated dropwise with glacial acetic acid (3 mL). The resulting mixture was heated at reflux for 2 hours, cooled to 25°, and diluted with ice water (150 mL). The resulting precipitate was collected by filtration, washed with water and recrystallized from dioxane/water to give the title compound (566 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 441 (M- Η)'. ]Η NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, 1=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 3.82 (s, 3 H) 4.29 (m, 2 H) 7.16 (m, 4 H) 8.36 (dd, J=7.54, 2.02 Hz, 1 H) 8.52 (dd, J=4.60, 2.02 Hz, 1 H) 15.86 (s, 1 H).
Example 184
4-hvdroxy-3-(7-hvdroxy-l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(3-methylbutyl)-l,8- naphthyridin-2( l/J)-one
^ -242- The product of Example 183C (0.027 g, 0.061 mmol) in dichloromethane (0.6 mL) was reacted with boron tribromide (1.0 M, 0.37mL, 0.37 mmol) in dichloromethane at 25°C for 18 hours. The reaction was quenched with methanol and stirred for 30 minutes at 25°C. The reaction was concentrated under reduced pressure to give the title compound as a solid (20.4 mg, 78%). The disodium salt of the title compound was prepared according to the procedure of Example ID using two equivalents of sodium hydroxide. MS (ESI-) m/z 427 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H)'4.29 (m, 2 H) 6.51 (m, 2 H) 6J8 (m, 1 H) 7.09 (dd, J=7J2, 4J8 Hz, 1 H) 8.34 (dd, J=7.35, 1.84 Hz, 1 H) 8.48 (dd, J=4.60, 2.02 Hz, 1 H) 15.23 (br s, 1 H).
Example 185 ((3-14-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yl1-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yl I oxy)acetonitrile The product of Example 184 (0.050 g, 0.12 mmol) in N,N-dimethylformamide (1 mL) was reacted with 2-bromoacetonitrile (14 μL, 0.2 mmol), potassium carbonate (0.029 g, 0.22 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 30 hours. The reaction mixture was diluted with water (50 mL) and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was triturated with hexanes and dichloromethane to give the title compound as a pale yellow solid (16.8 mg, 30%). The sodium salt of the title compound was prepared according to the procedure of Example ID. (ESI-) m/z 466 (M-Η)". 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 4.29 (m, 2 H) 5.27 (s, 2 H) 7.13 (dd, J=7.72, 4.78 Hz, 1 H) 7.31 (m, 3 H) 8.36 (dd, 1=7.72, 1.84 Hz, 1 H) 8.53 (dd, 1=4.78, 1.84 Hz, 1 H) 15.99 (s, 1 H).
Example 186 3-(lJ-dioxido-7-propoxy-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methylbutyl)-l,8- naphthyridin-2( lH)-one The product of Example 184 (0.030 g, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with 1-bromopropane (0.025mL, 0.28mmol), potassium carbonate (60 mg , 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane:hexanes to give the title compound (14 mg, 43%). The sodium salt of the
-243- title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 0.99 (t, J=7.35 Hz, 3 H) 1.48 (m, 2 H) 1.75 (m, 3 H) 3.98 (t, J=6.43 Hz, 2 H) 4.29 (m, 2 H) 7.16 (m, 4 H) 8.36 (dd, J=7.72, 1.84 Hz, 1 H) 8.52 (dd, J=4.60, 2.02 Hz, 1 H) 15.85 (s, 1 H), (ESI-) m/z 469 (M-H)".
Example 187 4-hvdroxy-3-r7-(methoxymethoxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-l-(3- v methylbutyl)- 1 , 8-naphthyridin-2( 1/D-one
The product of Example 184 (30mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with bromo(methoxy)methane (0.021 mL , 0.28 mmol), potassium carbonate (38 mg, 0.28 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 3:1 hexanes/ethyl acetate to give the title compound. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.98 (d, J=6.62 Hz, 6 H) 1.56 (m, 2 H) 1.70 (m, 1 H) 3.42 (s, 3 H) 4.47 (m, 2 H) 5.31 (s, 2 H) 7.44 (m, 3 H) 7.66 (m, 1 H) 8.54 (d, J=8.09 Hz, 1 H) 8.85 (s, 1 H). (ESI-) m/z 471 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 188 4-Hvdroxy- 1 -f 3-metfa γlbutyl)-3 - 17- IY2-meth ylρroρ-2-enyl)oxy1- 1.1 -dioxido-4H- 1 ,2,4- benzothiadiazin-3-yl )-l ,8-naphthyridin-2(lH)-one The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with 3-bromo-2-methylprop-l-ene (8 μL, 0.077 mmmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 24 hours. The reaction mixture was. diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized from dichloromethane:hexanes to give the title compound (17.4 mg, 50%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 ( , 1 H) 1.78 (s, 3 H) 4.29 (m, 2 H) 4.54 (s, 2 H) 4.98 (s, 1 H) 5.08 (s, 1 H) 7.12 (m, 2 H) 7.22 (m, 2 H) 8.36 (dd, J=7.54, 2.02 Hz, 1 H) 8.52 (dd, J=4.60, 2.02 Hz, 1 H) 15.86 (s, IH). (ESI-) m/z 481 (M-H)".
Example 189 tgrt-butyl ({3-r4-hydroxy-l-(3-methylbutvD-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yll-l,l-
-244- dioxido-4H-l,2,4-benzothiadiazin-7-yl}oxy)acetate The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with tgrt-butyl bromoacetate (0.04 mL , 0.28 mmol), potassium carbonate (0.04g, 0.28 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 24 hours. The reaction 5 mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 3:1 hexanes/ethyl acetate to give the title compound (20 mg, 53%). -1H NMR lό (300 MHz, DMSO-de) δ ppm 0.97 (d, J=6.62 Hz, 6 H) 1.43 (s, 9 H) 1.51 (m, 2 H) 1.66 (m, 1 H) 4.35 (m, 2 H) 4.77 (s, 2 H) 7.33 (m, 4 H) 8.42 (d, J=8.09 Hz, 1 H) 8.63 (s, 1 H). (ESI-) m/z 541 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 190 15 2-( { 3- f 4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydro- 1 , 8-naphthyridin-3 -yll-1,1 -dioxido-
4H- 1 ,2,4-benzothiadiazin-7-yl I oxy)acetamide The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with 2-bromoacetamide (16 mg, 0.12 mmol), potassium carbonate 24 mg, 0.17 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 48 hours. The reaction 20 mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was triturated with dichloromethane:hexanes to give the title compound. The sodium salt of the title compound 25 was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO- d6) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 4.29 (m, 2 H) 4.49 (s, 2 H) 7.13 ( , 2 H) 7.24 (m, 2 H) 7.40 (m, 1 H) 7.62 (m; 1 H) 8.36 (dd, J=7.54, 2.02 Hz, 1 H) 8.52 (dd, J=4.60, 2.02 Hz, 1 H) 15.89 (s, 1 H). (ESI-) m/z 484 (M-H)". ^
Example 191 30 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vn-4-hydroxy-l-(3-methylbutyl)- l,8-naphthyridin-2(lH)-one The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with (bromomethyl)benzene (0.0138 mL, 0.11 mmol), cesium carbonate (50 mg, 0.15 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction 35 mixture was diluted with water and acidified to pΗ 5 with concenfrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and
-245- concentrated under reduced pressure. The resulting residue was triturated with ethyl acetate to give the title compound (13 mg, 36%). The sodium salt of the title compound was prepared according to the procedure of Example ID. lH NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.25 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 4.29 (m, 2 H) 5.17 (s, 2 H) 7.12 (dd, 1=7.72, 4.78 Hz, 1 H) 7.23 (m, 3 H) 7.41 (m, 5 H) 8.36 (dd, J=7.35, 1.84 Hz, 1 H) 8.52 (dd, J=4.78, 1.84 Hz, 1 H) 15.87 (s, 1 H). (ESI-) m/z 517 (M-H)".
Example 192
3- r 1 , 1 -diOxido-7-(2-pyrrolidin- l-ylethoxy)-4H- 1 ,2,4-benzothiadiazin-3-yll-4-hydroxy- 1-(3- methylbutyl)- 1 , 8-naphthyridin-2( lH)-one
The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 L) was reacted with l-(2-chloroethyl)pyrrolidine hydrochloride (19 mg , 0.11 mmol), potassium carbonate (96 mg, 0.69 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 72 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 5% methanol/dichloromethane to give the title compound. The potassium salt of the title compound was prepared according to the procedure of Example ID substituting potassium hydroxide for sodium hydroxide. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 1.91 (m, 4 - H) 3.16 (m, 4 H) 3.47 (m, 1 H) 4.30 (m, 4 H) 7.13 (dd, 1=7.54, 4.60 Hz, 1 H) 7.24 (m, 3 H) 8.36 (dd, J=7.72, 1.84 Hz, 1 H) 8.53 (dd, 1=4.60, 2.02 Hz, 1 H) 15.90 (s, 1 H). (ESI-) m/z 524 (M-H)".
Example 193 3-ri,l-dioxido-7-(2-oxo-2-phenylethoxγ)-4H-l,2,4-benzothiadiazin-3-yll-4-hvdroxy-l-(3- methylbutyl)- 1 ,8-naphthyridin-2( lH)-one The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with 2-bromo-l-phenylethanone (30 mg, Q.15 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concenfrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with 0.2% methanol/dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. XΗ NMR
-246- (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.65 (m, 1 H) 4.31 (m, 2 H) 5.70 (s, 2 H) 7.14 (m, 1 H) 7.24 (d, J=9.93 Hz, 3 H) 7.59 (t, J=7.35 Hz, 2 H) 7.71 (t, 1=7.35 Hz, 1 H) 8.05 (m, 2 H) 8.38 (dd, J=7.91, 1.65 Hz, 1 H) 8.54 (m, 1 H) 15.85 (s, 1 H). (ESI-) m/z 545 (M-H)".
Example 194 3-r7-(allyloxy)-l.l-dioxido-4H-l,2.4-benzothiadiazm-3-yll-4-hvdroxy-l-(3-methylbutyl)- ,} 1 ,8-naphthyridin-2(lH)-one
The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide (1 mL) was reacted with 3-iodoprop-l-ene (0.007 mL , 0.077 mmol), potassium carbonate 60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted, with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was triturated with hexanes to give the title compound. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.98 (d, 1=6.25 Hz, 6 H) 1.55 (m, 2 H) 1.68 (m, 1 H) 4.42 (m, 2 H) 4.69 (d, 1=5.52 Hz, 2 H) 5.30 (dd, J=10.66, 1.47 Hz, 1 H) 5.43 (dd, J=17.28, 1.84 Hz, 1 H) 6.06 (m, 1 H) 7.29 (m, 3 H) 7.53 (m, 1 H) 8.49 (d, J=6.62 Hz, 1 H) 8.76 (m, 1 H) 15.29 (brs, IH). (ESI-) m/z 467 (M-H)".
Example 195 4-Hvdroxy-3-(7-isobutoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(3-methylbutyI)- l,8-naphthyridin-2(lH)-one The product of Example 184 (30 mg, 0.07 mmole) in N,N-dimethylformamide (1 mL) was reacted with l-bromo-2-methylpropane (0.034 mL, 0.3 mmol), potassium carbonate (60 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue recrystallized from hexanes: dichloromethane to give the title compound (10.5 mg, 31%). . The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.25 Hz, 6 H) 0.99 (d, 1=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 2.03 (m, 1 H) 3.80 (d, 1=6.62 Hz, 2 H) 4.29 (m, 2 H) 7.15 (m, 4 H) 8.36 (dd, J=7.72, 1.84 Hz, 1 H) 8.52 (dd, 1=4.78, 1.84 Hz, 1 H) 15.85 (s, 1 H). (ESI-) m/z 483 (M-H)".'
Example 196
-247- 4-(f 3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-1.2-dihvdro-l,8-naphthyridin-3-yll-l.l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl } oxy)butanenitrile The product of Example 184 (30 mg, 0.07 mmol) in N,N-dimethylformamide 1 mL) was reacted with 4-bromobutanenitrile (0.0154 mL , 0.15 mmol), potassium carbonate (60 5 mg, 0.42 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 96 hours. The reaction mixture was diluted with water and acidified to pΗ 5 with concentrated acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was recrystallized with lό hexanes: dichloromethane to give the title compound (21.8 mg, 62%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.62 (m, 1 H) 2.04 (m, 2 H) 2.68 (t, J=7.17 Hz, 2 H) 4.10 (t, J=5.88 Hz, 2 H) 4.29 (m, 2 H) 7.17 (m, 4 H) 8.36 (dd, J=7.91, 1.29 Hz, 1 H) 8.52 (dd, J=4.60, 1.65 Hz, 1 H) 15.88 (s, 1 H). (ESI-) m/z 494 (M-H)". 15
Example 197 ((3-ri-(3-methylbutyl)-4-oxido-2-oxo-1.2-dihvdro-l,8-naρhthyridin-3-vn-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yl )oxy)acetate The product of Example 189 (15 mg, 0,028 mmol) in a mixture of trifluoroacetic acid 20 (0.8 mL) and dichloromethane (0.2 mL) was stirred for two hours at 25°C. The solvents were removed under reduced pressure to give a yellow solid that was partitioned between ethyl acetate and water. The aqueous layer was extracted with ethyl acetate (2 X 20 mL). The aqueous layer was acidified to pΗ 2 with IN ΗC1 and extracted with ethyl acetate (3 X 20 mL). The combined organic extracts were washed with brine, dried over anhydrous 25 magnesium sulfate, filtered, and concentrated under reduced pressure to give the title compound as a white solid (8 mg, 62%). The disodium salt was prepared according to the procedure of Example ID using two equivalents of sodium hydroxide. 1H NMR (300 MHz, DMSO-de) δ ppm 0.99 (d, 1=6.62 Hz, 6 H) 1.58 (m, 2 H) 1.70 (m, 1 H) 3.17 (s, 1 H) 4.49 (m, 2 H) 4.88 (s, 2 H) 7.36 (m, 2 H) 7.49 (m, 1 H) 7.70 (d, J=9.56 Hz, 1 H) 8.56 (dd, J=7.91, 1.65 30 Hz, 1 H) 8.88 (d, 1=2.94 Hz, 1 H). (ESI-) m/z 485 (M-H)".
Example 198 3-r7-(2-aminoethoxy)-l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yll-4-hydroxy-l-(3- methylbutyl)-l,8-naphthyridin-2(lH)-one 35 A solution of the product of Example 185 (21.8 mg, 62%). in anhydrous . tetrahydrofuran (0.5 mL) was treated with LiBEU (10 mg, 0.46 mmol), stirred at ambient
-248- temperature for 16 hours, diluted with water (30 mL) and extracted with ethyl acetate (2 X 30 mL). The combined organic layers were washed with water, brine and dried over anhydrous magnesium sulfate. The slurry was filtered and the solvent removed under reduced pressure yielding the title compound as a yellow solid (10.1 mg, 97%). The sodium salt of the title 5 compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 2.82 (m, 2 H) 4.13 (t, 1=5.33 Hz, 2 H) 4.29 (m, 2 H) 5.40 (m, 2 H) 7.17 (m, 4 H) 8.36 (dd, J=7.72, 1.84 Hz, 1 H) 8.52 (dd',".fl=4.60, 2.02 Hz, 1 H) 15.88 (s, 1 H). (ESI-) m/z 470 (M-H)".
lό Example 199
2-( ( 3-14-hvdroχy-l-(3-methylbutyl)-2-oxo-l ,2-dihvdro-l ,8-naphthyridin-3-yll-l , 1-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}oxy)-N-methylacetamide A mixture of Example 197 (4J mg, 0.0097 mmol), l-(3-dimethylaminopropyl)-3- ethylcarbodiimide hydrochloride (1.4 mg, 0.01 mmol), methylamine in tetrahydrofuran (2.0 15 M, 10 μL, 0.02 mmol) and 1-hydroxybenzotriazole (1.4 mg, 0.01 mmol) in Ν,Ν- dimethylformamide (0.2 mL) was stirred at 25°C for 5 hours. The reaction mixture was diluted with ethyl acetate (40 mL), washed with saturated sodium bicarbonate, water and brine, and dried over anhydrous magnesium sulfate. The drying agent was removed by filtration and the solvent removed under reduced pressure to give the title compound as a pale 20 yellow solid (4 mg, 83%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm, 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 2.67 (d, J=4J8 Hz, 3 H) 4.30 (m, 2 H) 4.53 (s, 2 H) 7.18 (m, 4 H) 8.11 (m, 1 H) 8.36 (dd, J=7.54, 2.02 Hz, 1 H) 8.52 (dd, J=4.78, 1.84 Hz, 1 H) 15.90 (s, 1 H). (ESI-) m/z 498 (M-H)". 25
Example 200 3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yll-l,l-dioxido-4H-
L2,4-benzothiadiazin-7-yl acetate A mixture of Example 184 (30 mg, 0.07 mmol), triethylamine (12 μL, 0.084 mmol) 30 and acetic anhydride (8 μL, 0.084 mmol) in anhydrous dichloromethane (1 mL) was stirred at 25°C for 16 hours. The reaction mixture was diluted with ethyl acetate and water, acidified . to pH 5 with acetic acid and partitioned. The aqueous layer was extracted with ethyl acetate (2 x 20 mL). The combined organic extracts were washed with saturated sodium bicarbonate, water, brine, dried over anhydrous magnesium sulfate, filtered, and the solvent 35 removed under reduced pressure to give the title compound as a white solid (29.5 mg, 89%). JH NMR (300 MHz, DMSO-d6) δ ppm 0.98 (d, J=6.25 Hz, 6 H) 1.56 (m, 2 H) 1.69 (m, 1 H) 2.30 (s, 3 H) 4.46 (m, 2 H) 7.44 (m, 1 H) 7.52 (d, J=8.82 Hz, 1 H) 7.72 (m, 2 H) 8.53 (dd,
-249- J=7.72, 1.47 Hz, 1 H) 8.83 (s, 1 H). (ESI-) m/z 469 (M-H)".
Example 201 3-[l,l-dioxido-7-(pyridin-2-yloxy)-4H-l,2,4-benzothiadiazin-3-yll-4-hvdroxy-l-(3- methylbutyl)-l,8-naphthyridin-2(lH)-one
The product of Example 184 (10 mg, 0.023 mmol) was reacted with 2-bromopyridine (2.4 μL, 0.025 mmol), cesium carbonate (15 mg, 0.046 mmol) and copper metal (40 mg) in dimethyiέulfoxide (0.1 mL) at 110 C in a microwave reactor for 2 hours. The mixture was cooled to 25°C, poured into water (20 mL) and extracted with ethyl acetate (2 X 20 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered, and the solvent removed under reduced pressure leaving a tan solid. The solid was chromatographed on silica gel, eluting first with methylene chloride, then 1% methanol in methylene chloride gave the title compound as a light brown solid (5 mg, 42%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (s, 3 H) 0.98 (s, 3 H) 1.48 (m, 2 H) 1.65 (m, 1 H) 4.30 (t, J=7.50 Hz, 2 H) 7.14 (m, 3 H) 7.35 (s, 3 H) 7.89 (m, 1 H) 8.17 (m, 1 H) 8.38 (dd, J=7.72, 2.21 Hz, 1 H) 8.53 (dd, 1=4.78, 1.84 Hz, 1 H) 16.07 (s, 1 H). (ESI-) m/z 504 (M-H)".
Example 202
3-ri,l-dioxido-7-(pyrimidin-2-yloxy)-4H-l,2,4-benzothiadiazin-3-yll-4-hvdroxy-l-(3- methylbutyl)- 1 ,8-naphthyridin-2( lH)-one The product of Example 184 (10 mg, 0.023 mmole) was reacted with 2- bromopyrimidine (4.5 mg, 0.028 mmole), cesium carbonate (15 mg, 0.046 mmole) and tetrabutylammonium iodide (1 mg) in dimethylsulfoxide (0.1 mL) in a microwave reaction ' apparatus at 110 C for 1 hour. The mixture was cooled to 25°C, poured into water (20 mL) and extracted with ethyl acetate (2 X 50 mL). The combined organic extracts were washed with brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure leaving a tan solid. The solid was chromatographed on silica gel, eluting first with methylene chloride, followed by 2% methanol in methylene chloride, affording the title compound as a white solid (6 mg, 51%). The sodium salt of the title compound was prepared according to the procedure as described in Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.96 (s, 3 H) 0.98 (s, 3 H) 1.48 (m, 2 H) 1.65 (m, 1 H) 4.30 (t, J=7.50 Hz, 2H) 7.14 (dd, J=7.54, 4.60 Hz, 1 H) 7.30 (t, J=4.78 Hz, 1 H) 7.42 (m, 3 H) 8.38 (dd, J=7.72, 1.84 Hz, 1 H) 8.54 (dd, J=4.78, 1.84 Hz, 1 H) 8.67 (s, 1 H) 8.68 (s, 1 H) 16.10 (s, 1 H). (ESI- ) m/z 505 (M-H)".
-250- Example 203 2-((3-r4-hvdroχy-l-(3-methylbutyl)-2-oxo-1.2-dihydro-l,8-naphthyridin-3-yll-l,l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl } oxy)-NN-dimethylacetamide The title compound was prepared according to the procedure of Example 185 5 substituting 2-chloro-Ν,Ν-dimethylacetamide for 2-bromoacetonitrile. The compound was purified by trituration with methanol. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Ηk, 6 H) 1.47 (m, 2 H) 1.64 ( , 1 H) 2.86 (s, 3 H) 3.01 (s, 3 H) 4.30 (m, 2 H) 4.90 (s, 2 H) 7.16 (m, 4 H) 8.36 (dd, I=7J2, 1.84 Hz, 1 H) 8.52 (d, J=4.78 Hz, 1 H) 15.86 (s, 1 H). lό (ESI-) m/z 512 (M-H)".
Example 204 4-hvdroxy-l-(3-methylbutyl)-3-(7-nifro-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-L8- naphthyridin-2(liJ)-one 15 . The product of Example 12B (0.229g, 0.56 mmol) at 0°C was reacted with ammonium nitrate (0.058g, 0.72 mmol) in concentrated sulfuric acid (1.5 mL), stirred at 0°C for 30 minutes. The reaction mixture was poured onto crushed ice and the pΗ was adjusted to 9 with aqueous sodium hydroxide. The resulting solid was isolated by filtration to give the title compound (0.21 g, 81%). The sodium salt of the title compound was prepared according 20 to the procedure of Example ID. (ESI-) m/z 456 (M-Η)". 1H NMR (300 MHz, DMSO- de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 4.29 (m, 2 H) 7.14 (m, 1 H) 7.52 (m, 1 H) 8.40 (m, 3 H) 8.54 (m, 1 H) 16.77 (s, 1 H).
Example 205 RZ 25 3-(7-amino-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methylbutyl)-l,8- naρhthyridin-2(17?D-one A mixture of the product of Example 204 (0.198 g, 0.43 mmol), iron powder (0.121g, 2.16 mmol), and NΗUCl (0.031g, 0.58 mmol) in methanol:tetrahydrofuran:water (3:3:l,7mL) was stirred at reflux for nine hour. The reaction mixture was cooled to 25°C and the iron was 30 removed by filtration and washed with methanol. The filtrate was concentrated under reduced pressure, diluted with water and extracted with ethyl acetate. The organic layer was washed with water, brine and dried over anhydrous magnesium sulfatefiltered and concentrated under reduced pressure to give the title compound as a yellow solid (0.121 g, 66%). (ESI-) m/z 426 (M-Η)". !Η NMR (300 MHz, DMSO-de) δ ppm 0.98 (d, J=6.62 Hz, 6 35 H) 1.58 (m, 2 H) 1.69 (m, 1 H) 4.46 (m, 2 H) 5.86 (s, 2 H) 6.96 (m, 2 H) 7.46 (m, 2 H) 8.52 (d, 1=6.99 Hz, 1 H) 8.84 (m, 1 H) 13.90 (s, 1 H).
-251- Example 206 '({3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-L8-naphthyridin-3-yll-l.l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yl } amino)acetonitrile To the solution of the product from Example 205 (10 mg, 0.023 mmol) in N,N- 5 dimethylformamide (0.2 mL) was added bromoacetonitrile (2.5 μL, 0.035 mmol) and potassium carbonate (5 mg, 0.035 mmol). The mixture was stirred while heating at 100°C in a microwave reactor for 1 h. After cooling to 25°C, the orange solution was diluted with water and the pH of the aqueous layer was adjusted to pH 5 with acetic acid. The aqueous layer was extracted with ethyl acetate (3 x 20 mL). The combined organic layer was washed lό with water and brine, dried over magnesium sulfate, filtered, concentrated and purified by flash column chromatography on silica gel eluting with 1% methanol/dichloromethane to give the title compound as a yellow solid (6.0 mg, 55%). MS (ESI-) m/z 465 (M-H)". 1H NMR (300 MHz, DMSO-de) δ ppm 0.99 (d, 7=6.62 Hz, 6 H) 1.58 (m, 2 H) 1.68 (m, 1 H) 4.46 (m, 4 H) 6.92 (m, 1 H) 7.16 (m, 2 H) 7.49 (m, 1 H) 7.61 (d, 7=9.19 Hz, 1 H) 8.56 (dd, 15 7=7.90, 1.65 Hz, 1 H) 8.89 (m, 1 H) 14.00 (br s, 1 H) 15.39 (br s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 4.31 (m, 4 H) 6.49 (t, J=6.62 Hz, 1 H) 6.99 (m, 2 H) 7.13 (m, 2 H) 8.35 (dd, J=7J2, 1.84 Hz, 1 H) 8.51 (dd, J=4.41, 1.84 Hz, 1 H) 15.73 (s, 1 H). 20
Example 207 7-hydroxy-6-(7-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-(3- methylbutyl)thienor3,2-&lpyridin-5(47f)-one The title compound was prepared according to the procedure of Example ID 25 substituting the product of Example 125A for the product of Example IB and substituting the product of Example 183B for the product of Example IC. The sodium salt was prepared according to the procedure of example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.96 (d, 1=6.62 Hz, 6 H) 1.44 (m, 2 H) 1.66 (m, 1 H) 3.81 (s, 3 H) 3.99 (m, 2 H) 7.09 (m, 2 H) 7.16 (m, 2 H) 7.79 (d, J=5.15 Hz, 1 H) 15.87 (s, 1 H). (ESI-) m z 446 (M-H)". 30
Example 208 4-benzyl-7-hydroxy-6-(7-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)thienor3,2- frlpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID 35 substituting the product of Example HOB for the product of Example IB and substituting the product of Example 183B for the product of Example IC. The sodium salt was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 3.81 (s, 3
-252- H) 5.26 (s, 2 H) 7.02 (d, J=5.15 Hz, 1 H) 7.11 (m, 1 H) 7.17 (m, 2 H) 7.24 (m, 5 H) 7.71 (d, J=5.15 Hz, 1 H) 15.80 (s, 1 H). (ESI-) m/z 466 (M-H)".
Example 209A
,} 2-amino-6-methoxy-3-methylbenzenesulfonamide
The title compound was prepared from 3-methoxy-6-methyl-aniline using the \ procedure described in 7CS Perkin 1, 1979, 1043.
Example 209B N-r2-(aminosulfonyl)-3-methoxy-6-methylphenyn-l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdro- l,8-naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting the product of Example 209A for product of Example 84A to give the title compound (0.22 g, 100%).
Example 209C l-benzyl-3-(8-methoxy-5-methyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 209B for the product of Example 84C. The solution was then acidified with 6Ν aqueous HCl (10 mL), filtered and the solid washed with methanol (10 mL) to give the title compound as a white solid, (0.12 g, 56% yield). MS (ESI-) m/z 477 (M- H) . The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 2.37 (s, 3 H) 3.83 (s, 3H) 5.52 (s, 2 H) 6J6 (d, J=8.5 Hz, 1 H) 7.16 (m, 2 H) 7.23 (m, 4 H) 7.37 (d, J=8.9 Hz,' 1 H) 8.45 (m,2H), 15.67 (s, I H).
Example 210 l-benzyl-3-(8-hvdroxy-5-methyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l,8- naphthyridin-2(lH)-one A mixture of the product of Example 209C (20 mg, 0.042 mmol) and boron tribromide (l.OM in dichloromethane) (840 μL, 0.84 mmol) in dichloroethane (5 mL) was stirred at 70°C for 16 hrs. The reaction mixture was cooled to 25°C, quenched with water (10 mL) and extracted with ethyl acetate (20 mL). The resulting organic layer was dried over
-253- MgS0 , filtered, and concentrated under reduced pressure to provide the title compound as a white solid (0.019g, 98% yield). MS (ESI-) m/z 463 (M-H)'. The disodium salt of the title compound was prepared according to the procedure of Example ID using two equivalents of sodium hydroxide. 1H NMR (300 MHz, DMSO-de) δ 2.16 (s, 3 H) 5.52 (s, 2 H) 5.92 (d, J=8.8 Hz, 1 H) 6.79 (d, 1=8.8 Hz, IH) 7.11 (dd, J=7.8,4.8 Hz, IH) 7.17 (m, 1 H) 7.23 (m, 4 H) 8.42 (m,2H), 14.77 (s, 1 H).
Example 211
■f r3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yl)-5-methyl-l,l-dioxido- 4H- 1 ,2,4-benzothiadiazin-8-vnoxy I acetonitrile
A mixture of the product of Example 210 (23 mg, 0.050 mmol), bromoacetonitrile (14 μL, 0.2 mmol) and potassium carbonate (15 mg, 0.11 mmol) in N,N-dimethylformamide (1 mL) was stirred at 25°C for 3 days. The reaction mixture was concentrated under reduced pressure and the resulting oil was chromatographed on silica gel eluting with ethyl acetate to provide the title compound as a white solid (0.003g, 12% yield). MS (ESI-) m/z 500 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 2.38 (s, 3 H) 5.25 ( , 2H) 5.54 (s, 2 H) 6.93 (m, 1 H) 7.18 (m, 2 H) 7.23 (m, 4 H) 7.37 (m, 1 H) 8.46 (m, 2H).
Example 212 A 2-amino-3-methoxybenzenesulfonamide The title compound was prepared from 2-methoxyaniline using the procedure as described in Journal of the Chemical Society, Perkin 1, 1979, 1043.
Example 212B Ethyl (5-methoxy- 1.1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)acetate The title compound was prepared according to the procedure of Example IC substituting the product of Example 212A for 2-aminobenzenesulfonamide. MS (DCI) m/z 299 (M+Η)+.
Example 212C l-Benzyl-4-hvdroxy-3-(5-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure as described in Example
ID substituting the product of Example 15A for the product of Example IB and substituting the product of Example 212B for the product of Example IC (187 mg, 41 %). The sodium
-254- salt of the title compound was prepared according to the procedure of Example ID. (ESI-) m/z 461 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ ppm 3.98 (s, 3 H) 5.52 (s, 2 H) 7.18 (m, 9 H) 8.42 (dd, J=7.54, 2.02 Hz, 1 H) 8.47 (dd, J=4.78, 1.84 Hz, 1 H) 15.71 (s, 1 H).
Example 213 l-Benzyl-4-hvdroxy-3-(5-hydroxy-l , l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)- 1,8- naphthyridin-2(17 )-one The title compound was prepared according to the procedure as described in Example
184 substituting the product of Example 212C for the product of Example 183C. (ESI-) m/z 447 (M-Η)". The disodium salt of the title compound was prepared according to the procedure of Example ID using two equivalents of sodium hydroxide. !Η NMR (300 MHz, DMSO-d6) δ ppm 5.53 (s, 2 H) 6.25 (m, 2 H) 6.76 (t, J=7.91 Hz, 1 H) 7.17 (m, 6 H) 8.42 (dd, J=4.78, 1.84 Hz, 1 H) 8.48 (dd, J=7.54, 2.02 Hz, 1 H).
Example 214A
{ l~3-( 1 -benzyl-4-hvdroxy-2-oxo- 1 ,2-dihydro- 1 , 8-naphthyridin-3rVl)-l ,l-dioxido-4H- 1 ,2,4- benzothiadiazin-5-ylloxylacetonitrile The title compound was prepared according to the procedure as described in Example
185 substituting the product of Example 213 for the product of Example 184. (ESI-) m/z 486 (M-Η)". 1H NMR (300 MHz, DMSO-d6) δ ppm 5.51 (s, 2 H) 5.72 (s, 2 H) 7.24 (m, 1 H) 7.28 (s, 1 H) 7.31 (m, 5 H) 7.51 (dd, J=7.91, 4.60 Hz, 1 H) 7.61 (m, 1 H) 8.61 (dd, J=7.72, 1.84 Hz, 1 H) 8.83 (m, 1 H) 14.52 (s, 1 H).
Example 214B
3 - f 5-(2-aminoethoxy)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl] - 1 -benzyl-4-hydroxy- 1,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure as described in Example 198 substituting the product of Example 214A for the product of Example 185. (ESI-) m/z 490 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. lR NMR (300 MHz, DMSO-de) δ ppm 3.06 (s, br, 2 H) 4.30 (t, J=4.78 Hz, 2 H) 5.54 (s, 2 H) 5.72 (s, br, 2 H) 7.20 (m, 9 H) 8.50 (dd, J=4.78, 1.84 Hz, 1 H) 8.69 (dd, J=7.72, 2.21 Hz, 1 H) 16.05 (s, 1 H). .
Example 215 2-{r3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yl)-l,l-dioxido-4H-l,2,4-
-255- benzothiadiazin-5-ylloxylacetamide The title compound was prepared according to the procedure as described in Example 190 substituting the product of Example 213 for the product of Example 184. (ESI-) m/z 504 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.64 (s, 2 H) 5.53 (s, 2 H) 7.22 (m, 9 H) 7.88 (s, 1 H) 8.13 (s, 1 H) 8.46 (dd, J=7.72, 1.84 Hz, 1 H) 8.51 (dd, J=4.78, 1.84 Hz, I H) 16.15 (s, 1 H).
Example 216 l-benzyl-4-hvdroxy-3-{5-r(4-nitrobenzyl)oxyTl,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-
1 ,8-naphthyridin-2(lH)-one The title compound was prepared according to the procedure as described in Example 185 substituting the product of Example 213 for the product of Example 184 and substituting para-nitrobenzyl bromide for 2-bromoacetonitrile. (ESI-) m/z 582 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-d6) δ ppm 5.54 (s, 2 H) 5.55 (s, 2 H) 7.26 (m, 9 H) 8.08 (s, 1 H) 8.11 (s, 1 •H) 8.28 (s, 1 H) 8.31 (s, 1 H) 8.48 (q, 1=2.08 Hz, 1 H) 8.50 (s, 1 H) 16.01 (s, 1 H).
Example 217A
N-r2-(aminosulfonyl)phenyll-l-benzyl-6-chloro-4-hvdroxy-2-oxo-l,2-dihvdro-l,8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting ethyl l-benzyl-6-chloro-4-hydroxy-2-oxo-l,2-dihydro-l,8-naphthyridine-3- carboxylate for the product of Example 84B and substituting 2-amino-benzenesulfonamide for the product of Example 84A. 1H NMR (300 MHz, DMSO-d6) δ ppm 5.64 (s, 2 H) 7.25 (m, 5 H) 7.44 (t, 7=7.72 Hz, 1 H) 7.52 (s, 2 H) 7.67 (m, 1 H) 7.93 (m, 2 H) 8.56 (d, 7=2.57 Hz, 1 H) 8.87 (d, 7=2.57 Hz, 1 H) 12.34 (s, 1 H) 16.76 (s, 1 H).
Example 217B
1 -Benzyl-6-chloro-3-( 1.1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1,8- naphthyridin-2( lip-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 217A for the product of Example 84C. The sodium salt of the title compound was prepared according to the procedure as described in Example ID. MS (DCI/NΗ3) m/z 465 (M+H)+, 483 (M+NH3)+. 1H NMR (300 MHz, DMSO-de) δ ppm 5.49 (s, 2 H) 7.17 (m, 6 H) 7.48 (t, 7=7.35 Hz, 1 H) 7.83 (dd, 7=7.72, 1.47 Hz, 1 H) 8.32 (d,
-256- 7=2.57 Hz, 1 H) 8.46 (m, 2 H) 11.20 (s; 1 H).
Example 218A 5 N-r2-(aminosulfonyl)phenyn-l-benzyl-4-hydroxy-2-oxo-6-phenyl-l,2-dihydro-l,8- naphthyridine-3-carboxamide The title compound was prepared according to the procedure of Example 84C substituting ethyl 1 -benzyl-6-phenyl-4-hydroxy-2-oxo- 1 ,2-dihydro- 1 , 8 -naphthyridine-3 - carboxylat for the product of Example 84B and substituting 2-amino-benzenesulfonamide lό for the product of Example 84A. 1H ΝMR (300 MHz, DMSO-d6) δ ppm 5J2 (s, 2 H) 7.28 (m, 6 H) 7.44 (m, 2 H) 7.54 (m, 3 H) 7.67 (m, 1 H) 7.85 (d, 7=6.99 Hz, 2 H) 7.92 (dd, 7=8.09, 1.47 Hz, 1 H) 7.99 (d, 7=8.09 Hz, 1 H) 8J0 (d, 7=2.21 Hz, 1 H) 9.17 (d, 7=2.21 Hz, 1 H) 12.41 (s, 1 H) 16.80 (s, 1 H).
15 . Example 218B l-benzyl-3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-phen yl- 1,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example 84D substituting the product of Example 218A for the product of Example 84C. MS (ESI-) m/z 20 507 (M-Η)". The sodium salt of the title compound was prepared to the procedure as described in Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ ppm 5.53 (s, 2 H) 7.04 (m, 2 H) 7.26 (m, 7 H) 7.48 (t, 7=7.54 Hz, 2 H) 7.58 (d, 7=8.09 Hz, 1 H) 7.70 (d, 7=7.35 Hz, 2 H) 8.51 (d, 7=2.21 Hz, 1 H) 8.65 (d, 7=2.57 Hz, 1 H)
25
Example 219A 2-amino-4-methoxybenzenesulfonamide The title compound was prepared according to the procedure as described in Topliss et al, J. Med. Chem. 6, 1963, 122.
30
Example 219B Ethyl (6-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)acetate The title compound was prepared according to the procedure of Example IC substituting the product of Example 219A for 2-aminobenzenesulfonamide. MS (DCI) m z 35 299 (M+Η)+.
Example 219C
-257- l-benzyl-4-hvdroxy-3-(6-methoxy-l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure as described in Example ID substituting the product of Example 15A for the product of Example IB and substituting the product of Example 219B for the product of Example IC. The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 461 (M- Η)\ lU NMR (300 MHz, DMSO-d6) δ ppm 3.90 (m, 3 H) 5.72 (s, 2 H) 7.08 (dd, J=8.82, 2.21 Hz,"l H) 7.26 (m, 6 H) 7.51 (dd, J=8.09, 4.78 Hz, 1 H) 7.82 (d, J=9.19 Hz, 1 H) 8.61 (dd, J=8.09, 1.84 Hz, 1 H) 8.83 (dd, 1=4.60, 2.02 Hz, 1 H) 13.97 (s, 1 H).
Example 220A N-r3-amino-4-(aminosulfonyl)phenyllacetamide
The title compound was prepared according to the procedure as described in Topliss et al, J. Med. Chem. 6, 1963, 122. f
Example 220B Ethyl r6-(acetylamino)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yllacetate '
The title compound was prepared according to the procedure as described in Example IC substituting the product of Example 220A for 2-aminobenzenesulfonamide. MS (DCI) m/z 326 (M+Η)+.
Example 220C
N-r3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yl)-l.l-dioxido-4H-1.2.4- benzothiadiazin-6-yll acetamide The title compound was prepared according to the procedure as described in Example ID substituting the product of Example 15A for the product of Example IB and substituting the product of Example 220B for the product of Example IC. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-dδ) δ ppm 6.82 (d, J=1.84 Hz, 2 H) 6.95 (dd, 1=8.64, 2.02 Hz, 2 H) 7.29 (d, 1=4.04 Hz, 1 H) 7.44 (dd, J=8.09, 4.78 Hz, 2 H) 7.74 (m, 2 H) 8.47 (m, 1 H) 8.78 (m, 1 H) 10.81 (s, 1 H) 12.86 (s, 1 H) 14.06 (s, 1 H). MS (ESI-) m/z 447 (M-H)".
Example 221 l-benzyl-4-hydroxy-3-(6-hvdroxy- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-vD- 1 ,Σ
-258- naphthyridin-2(lH)-one A mixture of the product of Example 219C (20 mg, 0.043 mmole) and boron tribromide (1.0 M in dichloromethane, 20 equivalents) in 1,2 dichloroethane (5 mL) was stirred at reflux for 28 hours. The reaction mixture was cooled to 25°C, diluted with tetrahydrofuran and aqueous IN ΗC1, and refluxed for 2 hours. The resulting solid was collected by filtration and dried to give the title compound (11.3 mg). The disodium salt of the title compound was prepared according to the procedure of Example ID using two equivalents of sodium hydroxide. MS (ESI-) m/z 447 (M-Η)". 1H NMR (300 MHz, DMSO- de) δ ppm 6.82 (d, J=1.84 Hz, 2 H) 6,95 (dd, J=8.64, 2.02 Hz, 2 H) 7.29 (d, J=4.04 Hz, 1 H) 7.44 (dd, J=8.09, 4J8 Hz, 2 H) 7.74 (m, 2 H) 8.47 (m, 1 H) 8.78 (m, 1 H) 10:81 (s, 1 H) 12.86 (s, 1 H) 14.06 (s, 1 H).
Example 222A 2-amino-6-methylbenzenesulfonamide The title compound was prepared according to the procedure as described in Topliss et al, J. Med. Chem. 6, 1963, 122.
Example 222B Ethyl (8-methyl-l l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)acetate The title compound was prepared according to the procedure of Example IC substituting the product of Example 222A for 2-aminobenzenesulfonarήide.
Example 222C l-benzyl-4-hvdroxy-3-(8-methyl-l,l-dioxido-4Η-l,2,4-benzothiadiazin-3-yl)-l,8- naphthyridin-2( lH)-one The title compound was prepared according to the procedure as described in Example ID substituting the product of Example 15A for the product of Example IB and substituting the product of Example 222B for the product of Example IC. (35.8 mg, 10 %). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 446 (M-H)'. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.56 (s, 3 H) 5.52 (s, 2 H) 7.06 (dd, J=7.72, 3.31 Hz, 2 H) 7.13 (m, 2 H) 7.23 (m, 4 H) 7.41 (t, J=7.72 Hz, 2 H) 8.39 (d, J=1.84 Hz, 1 H) 8.48 (dd, J=4.60, 2.02 Hz, 1 H) 15.70 (s, 1 H).
Example 223
-259- 4-hydroxy-3-(5-methoxy-l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-l-(3-methylbutyl)-l,8- naphthyridin-2(lH)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 12A for the product of Example IB and substituting the product of Example 212B for the product of Example IC. The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 441 (M- Η)". 1H NMR (300 MHz, DMSO-de) δ ppm 0.95 (s, 3 H) 0.98 (s, 3 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 3.98} (s, 3 H) 4.29 (t, J = 7.50 Hz, 2 H) 7.11 (dd, J=7.72, 4.78 Hz, 1 H) 7.23 (m, 3 H) 8.38 (dd, J-7.35, 1.84 Hz, 1 H) 8.51 (dd, 1=4.41, 1.84 Hz, 1 H) 15.80 (s, 1 H). Example 224
7-hydroxy-6-(5-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-(3- methylbutvDthieno \3 ,2-frl pyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 125 A for the product of Example IB and substituting the product of Example 212B for the product of Example IC. The sodium salt of the title compound was prepared according to the procedure as described in Example ID. (ESI-) m/z 446 (M-Η)". 1H NMR (300 MHz, DMSO-d6) δ ppm 0.95 (s, 3 H) 0.97 (s, 3 H) 1.44 (m, 2 H) 1.67 (m, 1 H) 3.99 (m, 5 H) 7.08 (d, J=5.52 Hz, 1 H) 7.19 (m, 3 H) 7.79 (d, J=5.15 Hz, 1 H) 15.75 (s, 1 H).
Example 225 4-Benzyl-7-hydroxy-6-(5-methoxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)thienor3 ,2-blpyridin-5 (4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 110B for the product of Example IB and substituting the product of Example 212B for the product of Example IC. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.97 (s, 3 H) 5.26 (s, 2 H) 7.01 (d, J=5.52'Hz, 1 H) 7.25 (m, 8 H) 7.70 (d, J=5.52 Hz, 1 H) 15.69 (s, 1 H). MS (ESI-) m/z 466 (M-H)'.
Example 226A methyl 2-r2-benzylidenehydrazinolbenzoate
2-(N'-Benzylidene-hydrazino)-benzoic acid (5.0 g, 20.81 mmol) in 1:1 tetrahydrofuran and methanol (50 mL) was reacted with a solution of trimethylsilyl
-260- diazomethane in hexanes (2.0M, 12 mL, 25.0 mmol) at 0 C for 1 hour then stirred at 25°C for 48 hours. The solvent was removed under vacuum to give the title compound as a solid (6.00 g, 100%). 1H NMR (300 MHz, DMSO-d6) δ ppm 3.87 (s, 3 H) 6.84 (td, J=7.54, 1.10 Hz, 1 H) 7.41 (m, 3 H) 7.54 (m, 1 H) 7.74 (m, 3 H) 7.86 (dd, J=8.09, 1.47 Hz, 1 H) 8.21 (s, 1 H) 11.02 (s, l H).
Example 226B ymethyl 2-r2-benzylidene-l-(3-ethoxy-3-oxopropanoyl)hydrazinolbenzoate The product of Example 226A (5.29 g,> 20.81 mmol) in toluene (80 mL) was reacted with ethyl chloromalonate (2.68 mL, 25.0 mmol) at reflux for 4 hours. The reaction mixture was cooled to 25°C and concentrated under vacuum. The residue was triturated with diethyl ether and hexanes (3:1) to give the title compound (5.17.g, 70%). MS (DCI) m/z 355 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.32 (s, 2 H) 3.69 (s, 3 H) 3.73 (s, 3 H) 7.16 (s, 1 H) 7.32 (dd, 1=7.72, 1.10 Hz, 1 H) 7.40 (m, 3 H) 7.63 (m, 2 H) 7.70 (td, J=7.63, 1.29 Hz, 1 H) 7.85 (td, J=7.72, 1.47 Hz, 1 H) 8.10 (dd, J=7.72, 1.47 Hz, 1 H).
Example 226C Ethyl 4-hydroxy-2-oxo- 1 - 1 [phenylmeth ylenel amino } - 1 ,2-dihydroquinoline-3 -carboxylate The product of Example 226B (5.17 g, 14.59 mmol) in ethanol (100 mL) was reacted with sodium ethoxide (21% by weight in ethanol, 5.50 mL, 14.60 mmol) at 25°C then heated at 50°C for 1 hour. After cooling to 25°C, the reaction mixture was poured into water, acidified to pH 4 with IM hydrochloric acid and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent removed under vacuum to give the title compound (4.51 g, 96%). MS (DCI) m/z 323 (M+H)+. 1H NMR (300 MHz, DMSO-de) δ ppm 3.73 (s, 3 H) 7.21 (m, 1 H) 7.56 (m, 5 H) 7.95 (m, 2 H) 8.03 (d, J=7.72 Hz, 1 H) 9.08 (s, 1 H).
767087 Example 226D PKD l-amino-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin-2(lH)-one The product of Example 226C (4.51 g, 14.00 mmol) was reacted with 2-amino benzenesulfonamide (2.41 g, 14.00 mmol) in toluene (65 mL) at reflux for 6 hours. After cooling to 25°C, the solid (5.52 g) was collected by filtration and reacted further with aqueous 10% potassium hydroxide (100 mL) for 8 hours at 130°C. After cooling to 25°C, the reaction was poured into ice and acidified to pΗ 2 with IM hydrochloric acid. The resulting solid was isolated by filtration and dried to give the title compound (3.50 g, 71%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 5.31 (s, 2 H) 7.05 (t, 7=8.09 Hz, 1 H) 7.27 (m, 2 H)
-261- 7.53 (m, 2 H) 7.67 (m, 2 H) 8.07 (dd, 7=8.09, 1.47 Hz, 1 H) 16.38 (s, 1 H).
Example 227A 3-(Ll-Dioxido-4H-l,2;4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(l- Y propylbutylidene)a inolquinolin-2(lH)-one
The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 4-heptanone lό (0.63 mL, 4.49 mmol) in N,N-dimethylacetamide (1 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound as a solid (0.032 g, 32%). MS (ESI-) m/z 453 (M-Η)".
15 Example 227B l-( 1 -propyl-butylamino)-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin-
2(17fl-one The product of Example 227A (0.032 g, 0.07 mmol) in tetrahydrofuran (2 mL) and methanol (0.010 mL, 0.14 mmol) at 0°C was treated with dropwise addition of a 2.0M 0 solution of lithium borohydride in tetrahydrofuran (0.055 mL, 0.11 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was suspended in tetrahydrofuran (2 mL) and adsorbed onto approximately 0.5g of silica gel and evaporated. A slurry of the crude product and silica in
25 dichloromethane was loaded onto a 2 g Alltech Sep-pack and eluted with dichloromethane. ' Product containing fractions were combined and concentrated under vacuum to give the title compound (0.013 g, 40%). MS (ESI-) m/z 453 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.85 (m, 6 H) 1.33 (m, 8 H) 3.13 (m, 1 H) 5.66 (d, 7=4.04 Hz, 1 H) 7.05 (m, 1 H) 7.28
30 - (m, 2 H) 7.51 (m, 2 H) 7.68 (m, 2 H) 8.06 (dd, 7=7.72, 1.47 Hz, 1 H) 16.32 (s, 1 H).
Example 228A 35 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-( r2- methylpropylidenel amino 1 quinolin-2( lH)-one The product of Example 226D (0.178 g, 0.50 mmol) was reacted with 2-
-262- methylpropanal (0.9 mL, 10.0 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 228B 3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(isobutylamino)quinolin-2(17/)- ^. one
The product of Example 228A (0.132 g, 0.32 mmol) in tetrahydrofuran (6 mL) and methanol (0.026 mL, 0.64 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.24 mL, 0.48 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (12 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with 1:1 ethyl acetate:hexane (10 ml) and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 1.03 (d, J=6.62 Hz, 6 H) 1.86 (m, 1 H) 2.73 (m, 2 H) 5.94 (t, 1=7.35 Hz, 1 H) 7.07 (t, 1=7.35 Hz, 1 H) 7.27 (m, 2 H) 7.54 (m, 2 H) 7.60 (d, J=6.99 Hz, 1 H) 7.66 (d, 1=6.99 Hz, 1 H) 8.08 (d, J=8.09 Hz, 1 H) 16.27 (s, 1 H). MS (ESI-) (M-H)' m/z 411.
Example 229A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(l-ethylpropylidene)amino1-4- hydroxyquinolin-2( 17T)-one
The product of Example 226D (0.178 g, 0.5 mmol) was reacted with pentan-3-one (0.53 mL, 5.0 mmol) in N,N-dimethylacetamide (4 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 229B 3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(l-ethylpropyl)aminol-4-hydroxyquinolin-
2(lH)-one ' The product of Example 229A (0.122 g, 0.287 mmol) in tetrahydrofuran (8 mL) and methanol (0.023 mL, 0.57 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.215 mL, 0.43 mmol). The reaction was stirred at 25 °C for 2 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4,
-263- diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.83 (s, 3 H) 0.98 (s, 3 H) 1.31 (m, 2 H) 1.48 (m, 2 H) 2.99 (m, 1 H) 5.70 (d, J=4.04 Hz, 1 H) 7.05 (t, J=7.17 Hz, 1 H) 7.28 (m, 2 H) 7.51 (m, 2 H) 7.66 (d, J=8.09 Hz, 1 H) 7.72 (d, J=8.09 Hz, 1 H) 8.06 (d, 1=7.72 Hz, 1 H) 16.32 (s, 1 H). MS (ESI-) (M-H)' m/z 425.
Example 230A 3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-rpentylideneaminolquinolin-
2(lH)-one The product of Example 226D (0.05 g, 0.14 mmol) was reacted with pentanal (0.015 mL, 1.4 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 230B 3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(pentylamino)quinolin-2(lH)- one The product of Example 230A (0.034 g, 0.08 mmol) in tetrahydrofuran (2 mL) and methanol (0.0064 mL, 0.16 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.06 mL, 0.12 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.90 (t, J=6.99 Hz, 3 H) 1.37 (m, 4 H) 1.55 (m, 2 H) 2J3 (m, 2 H) 5.90 (t, J=6.80 Hz, 1 H) 7.07 (t, J=7.72 Hz, 1 H) 7.26 (m, 2 H) 7.52 (m, 2 H) 7.60 (d, J=8.09 Hz, 1 H) 7.66 (d, J=8.09 Hz, 1 H) 8.09 (d, J=8.09 Hz, 1 H) 16.27 (s, 1 H). MS (ESI-) (M-H)" m/z 425.
Example 231 A 1 -(cyclohexylideneamino)-3 -( 1.1 -dioxido-4H- 1 ,2,4-benzothi adiazin-3 -yl)-4-
-264- hydroxyquinolin-2( lH)-one The product of Example 226D (0.155 g, 0.60 mmol) was reacted with cyclohexanone
(20 mole equivalents) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25 °C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 23 IB 1 -(cycfohexylamino)-3-( 1. l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin-
2(lH)-one The product of Example 231 A (0.087 g, 0.2 mmol) in tetrahydrofuran (4 mL) and methanol (0.016 mL, 0.4 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5 mL), and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.13 (m, 6 H) 1.58 (m, 2 H) 1.75 (m, 2 H) 2.97 (m, 1 H) 5.68 (d, J=3.68 Hz, 1 H) 7.05 (t, J=7.54 Hz, 1 H) 7.27 (d, J=8.09 Hz, 1 H) 7.30 (d, 1=8.09 Hz, 1 H) 7.49 (t, J=7.72 Hz, 1 H) 7.55 (t, J=7J2 Hz, 1 H) 7.67 (d, J=8.09 Hz, 1 H) 7J6 (d, J=8.46 Hz, 1 H) 8.06 (d, J=7J2 Hz, 1 H) 16.30 (s, 1 H). MS (ESI-) (M-H)" m/z 437.
Example 232A 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - { [Y2-methyl- 1 ,3-thiazol-4- yPmethylenel amino }quinolin-2( lH)-one The product of Example 226D (0.119 g, 0.33 mmol) was reacted with 2-methyl-l, 3- thiazole-4-carbaldehyde 5 mol equivalents) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concenfrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 232B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{ r(2-methyl-L3-thiazol-4- yPmethyfl amino 1 quinolin-2( lH)-one
The product of Example 232A (0.097 g, 0.208 mmol) in tetrahydrofuran (5 mL) and methanol (0.016 mL, 0.40 mmol) at 0 C was treated with dropwise addition of a 2.0M
-265- solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.3 mmol). The reaction was stirred at 25°C for 3 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on C-18 reverse phase column eluting with water: acetonitrile 90:10 - 0:100 to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 2.68 (s, 3 H) 3.24 (m, 2 H) 6.33 ( , 1 H) 7.10 (m, 1 H) 7.31 ( , 2 H) 7.43 (s, 1 H) ^61 (m, 4 H) 8.08 (d, J=7.72 Hz, 1 H) 16.24 (s, 1 H). MS (ESI-) (M-H)" m z 466.
Example 233A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(l- methylethylidene)amino1quinolin-2(lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with acetone (0.34 mL,' 4.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 125°C for 25 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 233B
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -(isopropylamino)quinolin-
2(17f)-one The product of Example 233 A (0.044 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran 0.085mL, 0.17 mmol). The reaction was" stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.99 (m, 6 H) 3.94 (m, 1 H) 5.65 (d, J=4.41 Hz, 1 H) 7.04 (t, J=7.35 Hz, 1 H) 7.28 (m, 2 H) 7.51 (m, 2 H) 7.66 (d, J=7.72 Hz, 1 H) 7.75 (d, 1=8.46 Hz, 1 H) 8.06 (dd, J=8.09, 1.47 Hz, 1 H) 16.28 (s, 1 H). (ESI-) m/z 397' (M- H)".
Example 234A
-266- l-(cyclobutylideneamino)-3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin-
2(TH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with cyclobutanone (0.50 mL, 7.10 mmol) in N,N-dimethylacetamide (0.50 mL) in a sealed tube at 125°C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Λ Example 234B
1 -(cyclobutylamino)-3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin- 2(177)-one
The product of Example 234A (0.032 g, 0.078 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.025 mL, 0.050 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 1.54 (m, 1 H) 1.98 (m, 4 H) 3.61 (m, 2 H) 6.09 (d, 1=6.25 Hz, 1 H) 7.06 (td, J=7.35, 1.10 Hz, 1 H) 7.27 (m, 2 H) 7.53 (m, 2 H) 7.65 (m, 2 H) 8.06 (dd, J=7.91, 1.65 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 409 (M-H)".
Example 235A 1 -(cyclopentylideneamino)-3-( 1 , 1 -dioxido-4H- 1 ,2;4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one The product of Example 226D (0.079 g, 0.22 mmol) was reacted with cyclopentanone (0.195 mL, 2.22 mmol) in N,N-dimethylacetamide (1.50 mL) in a sealed tube at 130°C for 30 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 235B l-(cyclopentylamino)-3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin-
2(lH)-one The product of Example 235 A (0.030 g, 0.071 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.060 mL, 0.12 mmol). The reaction was
-267- stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-d6) δ ppm 1.61 (m, 8 H) 3.70 (m, 1 H) 5.68 (d, J=4.41 Hz, 1 H) 7.05 (t, J=7.35 Hz, 1 H) 7.28 (t, J=8.27 Hz, 2 H) 7.54 (m, 2 H) 7.69 (dd, J=15.81, 8.09 Hz, 2 H) 8.06 (dd, J=8.09, 1.47 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 423 (M-H)". Example 236A
3-(l.l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l-ir3- methylcyclopentylidenel amino I quinolin-2( lH)-one
The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3- methylcyclopentanone (0.50 mL, 5.09 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135°C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 236B 3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hvdroxy-l-{r3- methylc yclopentyll amino I quinolin-2( 17Z)-one The product of Example 236A (0.068 g, 0.16 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.100 mL, 0.20 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.03 (m, 3 H) 1.35 (m, 1 H) 1.78 (m, 4 H) 2.56 (m, J=5.52 Hz, 2 H) 3.69 (m, 1 H) 5J8 (m, 1 H) 7.05 (m, 1 H) 7.27 (m, 2 H) 7.52 (m, 2 H) 7.69 (m, 2 H) 8.06 (dd, 1=7.72, 1.47 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 437 (M-H)".
Example 237A 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 -(tetrahydro-4H-p yran-4- ylideneamino)quinolin-2(lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with tetrahydro-4H-
-268- pyran-4-one (0.215 mL, 2.33 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 130 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 237B 3-( 1 , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(tetrahvdro-2H-pyran-4- ^ yIamino)quinolin-2(lH)-one
The. product of Example 237A (0.082g, 0.19 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.140 mL, 0.28 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and , and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethaneto give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.86 (m, 1 H) 1.24 (m, 2 H) 1.48 (m, 2 H) 3.20 (m, J=18.02, 10.66 Hz, 2 H) 3.81 (m, 2 H) 5.82 (d, J=4.04 Hz, 1 H) 7.04 (m, J=7.72 Hz, 1 H) 7.27 ( , 1=8.46, 8.46 Hz, 2 H) 7.52 (m, 2 H) 7.66 (d, J=7.72 Hz, 1 H) 7.76 (d, J=8.09 Hz, 1 H) 8.04 (d, 1=1.47 Hz, 1 H). MS (ESI-) m/z 439 (M-H)".
Example 238 A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-{ri-ethylbutylidene1amino}-4- hydroxyquinolin-2 ( 1 H)-one
The product of Example 226D (0.085 g, 0.24 mmol) was reacted with hexan-3-one (0.55 mL, 4.48 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 140°C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 238B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-i ri-ethylbutynamino|-4-hydroxyquinolin-
2(lH)-one The product of Example 238A (0.049 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.152 mL, 0.30 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4,
-269- diluted with water,and the resulting precipitate was collected by filtration and dried to give the title compound. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. H NMR (300 MHz, DMSO-d6) δ ppm 0.88 (m, 6 H) 1.37 (m, 6 H) 3.05 (m; 1 H) 5.68 (m, 1 H) 7.05 (m, 1 H) 7.28 (m, 2 H) 7.52 (m, 2 H) 7.66 (d, J=7.72 Hz, 1 H) 7.71 (m, 1 H) 8.06 (dd, J=7.72, 1.47 Hz, 1 H) 16.32 (s, 1 H). MS (ESI-) m/z 439 (M-H)".
Example 239A 3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f r(3R)-3- methylcyclohexylidenelamino)quinolin-2(l D-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with (3R)-3- methylcyclohexanone 0.275 mL, 2.25 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 130 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 239B
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{r( 3R)-3- methylcyclohexyl1amino}quinolin-2(lH)-one The product of Example 239A (0.045 g, 0.10 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.28 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.075 mL, 0.15 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried to give the title compound. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.83 (m, 3 H) 1.22 (m, 3 H) 1.73 (m, 3 H) 2.99 (m, 1 H) 5.67 (d, J=4.04 Hz, 1 H) 7.04 (t, J=6.99 Hz, 1 H) 7.28 (t, J=8.27 Hz, 2 H) 7.53 (m, 2 H) 7.66 (d, 1=7.72 Hz, 1 H) 7.74 (d, J=8.09 Hz, 1 H) 8.06 (m, 1 H). MS (ESI-) m/z 451 (M-H)".
-270- Example 240A 2-(2-cycloheptylidenehydrazino)benzoic acid The title compound was prepared according to the prodecure as described in Example 162A, substituting cycloheptanone for benzaldehyde.
Example 240B l-(cycloheptylideneamino)-2H-3,l-benzoxazine-2,4(lH)-dione The title compound was prepared according to the procedure as described in Example
162B, substituting the product of Example 240A for the product of Example 162A.
Λ
Example 240C l-(cvcloheptylideneamino)-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lHVone The title compound was prepared according to the procedure as described in Example ID, substituting the product of Example 240B for the product of Example IB.
Example 240D l-(cycloheptylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin-
2(lH)-one The product of Example 240C (0.099 g, 0.22 mmol) in tetrahydrofuran (4.0 mL)
(0.099 g, 0.22 mmol) in tetrahydrofuran (4.0 mL) and methanol (0.020 mL, 0.49 mmol) at
0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.16 mL, 0.32 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 1.43 (m, 11 H) 1.87 (m, 1 H) 3.25 (m, 1 H) 5.53 (d, J=3.68 Hz,
1 H) 7.04 (m, 1 H) 7.28 (m, 2 H) 7.51 (m, 2 H) 7.66 (d, J=7.72 Hz, 1 H) 7.73 (d, 1=8.46 Hz, 1 H) 8.05 (dd, 1=7.72, 1.47 Hz, 1 H) 16.30 (s, 1 H). MS (ESI-) m/z 451 (M-H)".
Example 241A 3-( 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 - yl)-l - { \3 -ethylcyclopentylidenel amino } -4- hydroxyquinolin-2( 17f)-one
The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3- ethylcyclopentanone (0.380 mL, 3.30 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed
-271- tube at 135 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 241B
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-{r3-ethylcyclopentyllamino)-4- hydroxyquinolin-2(lH)-one The product of Example 241 A (0.031 g, 0.068 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.055 mL, 0.11 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.85 (m, 3 H) 1.56 (m, 8 H) 3.65 (m, 2 H) 5.75 (m, 1 H) 7.05 (t, J=6.99 Hz, 1 H) 7.28 (m, 2 H) 7.52 (m, 2 H) 7.69 (m, 2 H) 8.06 (dd, J=7.90, 1.65 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 451 (M-H)".
Example 242A 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - f [ 1 - isopropylbutylidenel amino 1 quinolin-2( lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 2-methylhexan- 3-one (0.620 mL, 4.48 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 °C for 60 min then at 145°C for 60 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 242B
3-(l,l-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-4-hydroxy-l-{|T- isopropylbutyll amino } quinolin-2( lHVone The product of Example 242A (0.049 g, 0.11 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.085 mL, 0.17 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The
-272- crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.68 (m, 1 H) 1.18 (m, 9 H) 2.49 (m, 4 H) 3.00 (m, J=44.49 Hz, 1 H) 5.73 (d, 1=20.22 Hz, 1 H) 7.04 (m, 1 H) 7.27 (m, 2 H) 7.52 (m, 2 H) 7.71 (m, 2 H) 8.06 (dd, J=8.09, 1.47 Hz, 1 H) 16.33 (s, 1 H). MS (ESI-) m z 453 (M-H)".
Example 243A
3-( 1. l-dioxido-4H- 1.2,4-benzothiadiazin-3-yl)-4-hvdroxy- 1 - U 1 - phenylethylidene"! amino } quinolin-2( lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 1- phenylethanone (0.49 mL, 4.20 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 243B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-4-hydroxy-l-f ri- phenylethyllamino}quinolin-2(lH)-one The product of Example 243A (0.093 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.152 mL, 0.30 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.31 (m, 3 H) 4.41 (d, J=68.76 Hz, 1 H) 5.85 (m, 1 H) 7.28 (m, J=7.54, 7.54 Hz, 7 H) 7.59 (m, 4 H) 8.07 (m, 2 H) 16.30 (s, 1 H). MS (ESI-) m/z 459 (M-H)".
Example 244A
3-( 1 , 1 -dioxido-4H- 1 ,2.4-benzothiadiazin-3-yl)-4-hydroxy- 1-111 -thien-3- yleth ylidenel amino } quinolin-2( lH)-one
-273- The product of Example 226D (0.080 g, 0.22 mmol) was reacted with l-thien-3- ylethanone (0.14 g, 1.11 mmol) in N,N-dimethylacetamide (0.50 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 244B 3-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f ll-thien-3- ylethyll amino } quinolin-2( 1 H)-one The product of Example 244A (0.070 g, 0.15 mmol) tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.090 mL, 0.18 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.26 (m, 3 H) 4.58 (m, 1 H) 5.74 (s, 1 H) 7.07 (m, 1 H) 7.18 (m, 1 H) 7.28 (m, 3 H) 7.37 (s, 1 H) 7.55 (m, 2 H) 7.66 (m, 1 H) 7.96 (d, 1=6.62 Hz, 1 H) 8.07 (s, 1 H) 16.30 (s, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 245A l-{ r3,5-dimethylcvclohexylidenelaminol-3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one
The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3,5- dimethylcyclohexanone (0.57 g, 4.52 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 °C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 245B 1 - { [3 ,5-dimethylc yclohexyll amino } -3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one The product of Example 245 A (0.064 g, 0.14 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.100 mL, 0.20 mmol). The reaction was
-274- stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichlrormethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.55 (m, 2 H) 0.87 (m, 6 H) 1.67 (m, 6 H) 3.05 (m, 1 H) 5.66 (dd, 1=5.70, 3.86 Hz, 1 H) 7.05 (m, 1 H) 7.28 (t, 1=8.27 Hz, 2 H) 7.51 (m, 2 H) 7.66 (d, J=7.72 Hz, 1 H) 7.73 (t, J=7.54 Hz, 1 H) 8.06 (dd, J=7.91, 1.29 Hz, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 246A ' 3-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - { \4- isopropylcyclohexylidenelaminojquinolin-2(17 )-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 4- isopropylcyclohexanone (0.63 mL, 4.11 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound. '
Example 246B 3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l-r(4- isopropylcvclohexyl)amino1quinolin-2(17f)-one The product of Example 246A (0.095 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.30 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.86 (m, 6 H) 1.43 (m, 7 H) 1.87 (m, 1 H) 2.94 (m, 1 H>3.14 ( , 1 H) 5.71 (m, 1 H) 7.04 (t, J=7.54 Hz, 1 H) 7.28 (t, J=8.46 Hz, 2 H) 7.50 (m, 2 H) 7.70 (m, 2 H) 8.06 (m, 1 H) 16.30 (s, 1 H). MS (ESI-) m/z 479 (M-H)".
Example 247A l-r3,4-dihydronaphthalen-2(lH)-ylideneaminol-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-
-275- yl)-4-hydroxyquinolin-2( lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3,4- dihydronaphthalen-2(lH)-one (0.60 mL, 4.54 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
",} Example 247B
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -I" 1 ,2,3 ,4-tetrahydronaphthalen-2- v ylaminol quinolin-2( lHTone
The product of Example 247A (0.070 g, 0.14 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.010 mL, 0.25 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.110 mL, 0.22 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dg) δ ppm 2.73 (s, 2 H) 3.27 (d, J=12.50 Hz, 4 H) 5.93 (d, J=3.68 Hz, 1 H) 7.07 (m, 6 H) 7.28 (t, J=7.54 Hz, 3 H) 7.55 (m, 2 H) 7.66 (d, J=7J2 Hz, 1 H) 8.07 (dd, J=7.72, 1.47 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 485 (M-H)".
Example 248A 3-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{r3-
(trifluoromethyl)cyclohexylidenel amino 1 quinolin-2( lH)-one The product of Example 226D (0.080 g, 0.22 mmol) was reacted with 3- (trifluoromethyl)cyclohexanone (0J5 mL, 4.54 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 40 minutes in a microwave reactor. The reaction mixture was cooled to 25 °C and concentrated. The resulting residue was triturated with diethyl ether and filtered to give the title compound.
Example 248B 3-(l.l-dioxido-4H-T2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-i r3- (frifluoromethyl)cyclohexyll amino } quinolin-2( lH)-one
The product of Example 248 A (0.103 g, 0.20 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.015 mL, 0.42 mmol) at 0°C was freated with dropwise addition of a 2.0M
-276- solution of lithium borohydride in tetrahydrofuran (0.15 mL, 0.30 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water, and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. lR NMR (300 MHz, DMSO-d6) δ ppm 1.21 (m, 4 H) 1.76 (m, 2 H) 2.31 (m, 1 H) 3.11 (m, 2 H) 3.97 (m, 1 H) 5.81 (d, J=19.85 Hz, 1 H) 7.05 (m, 1 H) 7.28 (m, 2 H) 7.53 (m, 2 H) 7.66 (d, J=8.09 Hz, 1 H) 7J5 (d, J=7.72 Hz, 1 H) 8.06 (dd, J=8.09, 1.47 Hz, 1 H). MS (ESI-) m/z 505 (M-H)".
Example 249A l-rbutylideneamino1-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin- 2(lH)-one '
The product of Example 226D (0.060 g, 0.168 mmol) was, reacted with butyraldehyde (0.135 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 1 IO C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 249B l-(butylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxyquinolin-2(lH)-one The product of Example 249A (0.040 g, 0.097 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.194 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.074 mL, 0.148 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and washed with water (2x5.0 ml) and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.93 (t, J=7.17 Hz, 3 H) 1.48 ( , 4 H) 2.77 (m, 2 H) 5.90 (t, J=6.99 Hz, 1 H) 7.07 (m, 1 H) 7.27 (m, 2 H) 7.58 (m, 3 H) 7.66 (d, 1=8.09 Hz, 1 H) 8.08 (dd, J=8.09, 1.47 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 411 (M-HV.
Example 250A
-277- 3-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-4-hydroxy-l-( r3- methylbutylidenel amino ) quinolin-2( lH)-one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 3- methylbutanal (0.161 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at HO C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 250B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-r(3-methylbutyl)a inolquinolin-
2(lH)-one The product of Example 250A (0.041 g, 0.097 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.194 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.074 mL, 0.148 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 0.92 (s, 3 H) 0.94 (s, 3 H) 1.45 (q, J=7.11 Hz, 2 H) 1.73 (m, 1 H) 2J9 (m, 2 H) 5.87 (t, J=6.80 Hz, 1 H) 7.07 (t, 1=7.35 Hz, 1 H) 7.28 (t, J=8.46 Hz, 2 H) 7.55 (m, 3 H) 7.66 (d, J=7.72 Hz, 1 H) 8.08 (dd, J=7.91, 1.29 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 425 (M-H)'.
Example 251 A 3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-l - f r3-furylmethylenel amino } -4- hydroxyquinolin-2(lH)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3-furaldehyde (0.147 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110°C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 25 IB 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(3-furylmethyl)aminol-4-hydroxyquinolin-
2(lH)-one The product of Example 251 A (0.028 g, 0.064 mmol) in tetrahydrofuran (1.3 mL) and
-278- methanol (0.005 mL, 0.128 mmol) at 0 C was freated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.050 mL, 0.100 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-d6) δ ppm 3.79 (m, 2 H) 6.03 (t, 1=6.80 Hz, 1 H) 6.65 (έ, 1 H) 7.08 (t, J=7.35 Hz, 1 H) 7.27 (m, 3 H) 7.54 (m, 2 H) 7.68 (m, 3 H) 8.08 (d, J=7.72 Hz,.l H) 16.26 (s, 1 H). MS (ESI-) m/z 435 (M-H)".
Example 252A 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 -{ r2-f urylmethylenel amino I -4- hydroxyquinolin-2(17f)-one
The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-furaldehyde (0.147 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110°C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give, the title compound.
Example 252B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(2-furylmethyl)aminol-4-hydroxyquinolin-
2(l/ττ)-one The product of Example 252A (0.058 g, 0.134 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.010 mL, 0.268 mmol) at 0°C was treated with dropwise addition of a 2.0M . solution of lithium borohydride in tetrahydrofuran (0.105 mL, 0.210 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (6.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example. ID. !Η NMR (300 MHz, DMSO-d6) δ ppm 4.03 (s, 2 H) 6.20 (t, 1=6.07 Hz, 1 H) 6.35 (m, 1 H) 7.05 (t, J=7.72 Hz, 1 H) 7.29 (t, J=7.72 Hz, 3 H) 7.46 (t, J=7.72 Hz, 1 H) 7.56 (m, 2 H) 7.67 (d, J=7.72 Hz, 2 H) 8.06 (d, J=8.09 Hz, 1 H) 16.24 (s, 1 H). MS (ESI-) m/z 435 (M-H)'.
-279- Example 253A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{rthien-2- ylmethylenel amino } quinolin-2( lH)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with thiophene-2- carbaldehyde (0.166 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at
110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 253B
3-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r(thien-2- ylmethyDaminol quinolin-2( lH)-one The product of Example 253A (0.025 g, 0.055 mmol) in tetrahydrofuran (1.2 mL) and methanol (0.005 mL, 0.110 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.044 mL, 0.088 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.18 (s, 2 H) 6.16 (t, J=6.62 Hz, 1 H) 7.01 (dd, J=5.15, 3.31 Hz, 1 H) 7.07 (d, J=7.72 Hz, 1 H) 7.12 (m, 1 H) 7.29 (t, J=7.54 Hz, 2 H) 7.53 (m, 3 H) 7.67 (d, J=7.72 Hz, 2 H) 8.08 (d, 1=8.09 Hz, 1 H) 16.24 (s, 1 H). MS (ESI-) . m z 451 (M-H)".
Example 254A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{π.3-thiazol-2- ylmethylenel amino ) q uinolin-2(lH)-one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 1,3-thiazole-
2-carbaldehyde (0.132 mL, 1.5 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concenfrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 254B 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-vD-4-hydroxy- l-TC ,3-thiazol-2-
-280- ylmethyl)aminolquinolin-2(lH)-one The product of Example 254A (0.030 g, 0.066 mmol) in tetrahydrofuran (1.3 mL) and methanol (0.005 mL, 0.132 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.050 mL, 0.100 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with diethyl ether and filtered to give the title compoun^. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300 MHz, DMSO-dg) δ ppm 4.36 (m, 2 H) 6.57 (t, J=6.62 Hz, 1 H) 7.09 (dd! 1=13.60, 6.62 Hz, 2 H) 7.29 (t, J=7.54 Hz, 2 H) 7.56 (m, 2 H) 7.68 (m, 2 H) 7.97 (d, J=8.46 Hz, 1 H) 8.08 (d, J=7.35 Hz, 1 H) 16.20 (s, 1 H). MS (ESI-) m/z 452 (M-H)".
Example 255A
3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)- 1 - 1 T(2-ethyl-3 -methylbutylidenel amino ) -4- hydroxyquinolin-2( lH)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-ethyl-3- methylbutanal (0.110 mL, 0.733 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 255B 3-(l , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-l-| r2-ethyl-3-methylbutyll amino } -4- hydroxyquinolin-2(lH)-one The product of Example 255A (0.031 g, 0.069 mmol) in tetrahydrofuran (1.5 mL) and methanol (0.006 mL, 0.138 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.054 mL, 0.108 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel eluted with 30% ethyl acetate/hexane to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.94 (m, 18 H) 1.36 (dd, J=11.58, 5.33 Hz, 2 H) 1.47 (m, 4 H) 1.91 (s, 2 H) 3.32 (s, 4 H) 5.87 (t, J=7.54 Hz, 2 H) 6.98 (t, J=7.54 Hz, 1 H) 7.08 (m, 2 H) 7.26 (m, 4 H) 7.38 (t, J=8.27 Hz, 1 H) 7.56 (m, 4 H) 7.66 (m, 2 H). MS (ESI-) m/z 453 (M-H)".
-281- Example 256A 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(r(4- methylphenyDmethylenel amino }quinolin-2(177τ)-one The product of Example 226D (0.070 g, 0, 196 mmol) was reacted with 4- methylbehzaldehyde (0.210 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 'v 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 256B 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-r(4- methylbenzyl)aminolquinolin-2(lH)-one
The product of Example 256A (0.065 g, 0.142 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.012 mL, 0.284 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.111 mL, 0.222 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (8.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1HNMR (300 MHz, DMSO-de) δ ppm 2.32 (s, 3 H) 3.87 (s, 2 H) 6.03 (s, 1 H) 7.10 (m, 1 H) 7.21 (d, J=7.72 Hz, 2 H) 7.30 (t, J=7.17 Hz, 2 H) 7.42 (d, . J=7.72 Hz, 2 H) 7.56 (t, J=8.64 Hz, 2 H) 7.70 (t, J=9.38 Hz, 2 H) 8.10 (d, J=7.72 Hz, 1 H) : 16.28 ( , 1 H). MS (ESI-) m/z 459 (M-H)".
Example 257 A
3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(r(3- methylphenyl)methylene1amino)quinolin-2(17 )-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3- methylbenzaldehyde (0.210 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
-282- Example 257B 3-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- l-f(3- methylbenzyl)amino1quinolin-2(l.H)-one The product of Example 257 A (0.038 g, 0.083 mmol) in tetrahydrofuran (1.7 mL) and methanol (0.007 mL, 0.166 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.065 mL, 0.130 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. ]Η NMR (300 MHz, DMSO-d6) δ ppm 2.35 (s, 3 H) 3.87 (s, 2 H) 6.05 (t, J=6.62 Hz, 1 H) 7.12 (m, 2 H) 7.31 (m, 5 H) 7.56 (t, 1=7.54 Hz, 2 H) 7.70 (dd, J=11.95, 7.91 Hz, 2 H) 8.10 (d, J=7J2 Hz, 1 H) 16.28 (s, 1 H). MS (ESI-) m/z 459 (M-H)'.
Example 258A 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{r(2- methylphenyl)methylenelamino)quinolin-2(lH)-one
The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2- methylbenzaldehyde (0.206 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 258B 3-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-f(2- methylbenzyl)amino1quinolin-2(lH)-one The product of Example 258A (0.026 g, 0.057 mmol) in tetrahydrofuran (1.2 mL) and methanol (0.005 mL, 0.114 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.045 mL, 0.090 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration, washed with water and .dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. JΗ NMR (300 MHz, DMSO-d6) δ ppm
-283- 3.29 (s, 3 H) 3.97 (s, 2 H) 6.02 (t, J=6.62 Hz, 1 H) 7.08 (t, 1=7.35 Hz, 1 H) 7.23 (s, 3 H) 7.29 (t, 1=7.54 Hz, 2 H) 7.47 (m, 1 H) 7.55 (d, J=7.72 Hz, 2 H) 7.67 (m, 2 H) 8.10 (d, J=7.72 Hz, 1 H) 16.31 (s, 1 H). MS (ESI-) m/z 459 (M-H)".
Example 259A
3-'Cl,l-dioxido-4H-l,2,4-benzothiadiazin-3-vI)-4-hvdroxy-l-{ r(3-methylthien-2- yl)methyl1amino}quinolin-2(li7)-one I The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 3- methylthiophene-2-carbaldehyde (0.180 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 135 C for 45 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 259B
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{ r(3-methylthien-2- yl)methyllamino}quinohn-2(lH)-one
The product of Example 259A (0.020 g, 0.043 mmol) in tetrahydrofuran (1.0 mL) and methanol (0.004 mL, 0.086 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.033 mL, 0.065 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately
2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to ' the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.42 (s, 3 H) 4.10 (brs,
2 H) 7.09 (d, J=5.15 Hz, 1 H) 7.19 (brs, 1 H) 7.37 (m, 3 H) 7.58 (m, 2 H) 7J2 (m, 2 H) 8.04
(m, 1 H) 8.14 (d, J=8.09 Hz, 1 H) 16.10 (brs, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 260A 3-(l.l-dioxido-4H-l,2,4-benzothiadiazm-3-yl)-4-hydroxy-l-{f(4- methoxyphenyl)methylene1amino|quinolin-2(lH)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 4- methoxybenzaldehyde (0.217 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled
-284- to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 260B 3-( 1 , 1 -dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -\(4- methoxybenzyl)aminolquinolin-2(lH)-one The product of Example 260A (0.045 g, 0.095 mmol) in tetrahydrofuran (2.0 mL) and methanofr(0.008 mL, 0.19 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.074 mL, 0.148 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with methanol/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-d6) δ ppm 3.77 (s, 3 H) 3.82 (s, 2 H) 5.98 (s, 1 H) 6.95 (d, J=8.46 Hz, 2 H) 7.10 (t, J=7.54 Hz, 1 H) 7.30 (m, 2 H) 7.45 (d, 1=8.46 Hz, 2 H) 7.56 (s, 2 H) 7.70 (t, J=9.38 Hz, 2 H) 8.10 (d, J=7.72 Hz, 1 H) 16.29 (m, 1 H). MS (ESI-) m/z 475 (M-H)".
Example 261 A l-{ r(5-chlorothien-2-yl)methylenelamino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lHVone The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 5- chlorothiophene-2-carbaldehyde (0.160 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 261B l-{r(5-chlorothien-2-yl)methyl1amino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one The product of Example 261A (0.048 g, 0.099 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.198 mmol) at 0°C was freated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.074 mL, 0.149 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (6.0 mL), and the resulting precipitate was collected by filtration and
-285- dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. lH NMR (300 MHz, DMSO-d6) δ ppm 4.10 (s, 2 H) 6.24 (t, J=6.43 Hz, 1 H) 7.19 (m, 1 H) 7.30 (m, 3 H) 7.43 (d, J=8.46 Hz, 1 H) 7.56 (m, 3 H) 7.67 (d, J=8.09 Hz, 1 H) 8.12 (d, J=7.72 Hz, 1 H) 15.95 (s, 1 H). MS (ESI-) m/z 485 (M-H)".
Example 262A 1- f l(2-chloro- 1 ,3-thiazol-5-yl)methylene1amino } -3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-
3-yl)-4-hydroχyquinolin-2(17r)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 2-chloro-l,3- thiazole-5-carbaldehyde (0.157 mL, 1.06 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 262B l-{r(2-chloro-l,3-thiazol-5-yl)methynamino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)-4-hvdroxyqumolin-2(17f)-one
The product of Example 262A (0.040 g, 0.082 mmol) in tetrahydrofuran (1.7 mL) and methanol (0.007 mL, 0.164 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.064 mL, 0.128 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (5.0 mL), and the resulting precipitate was'coUected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d5) δ ppm 4.22 ( , 2 H) 6.38 (t, J=6.25 Hz, 1 H) 7.07 (t, 1=7.54 Hz, 1 H) 7.28 (t, J=8.09 Hz, 2 H) 7.59 (m, 5 H) 8.08 (dd, J=8.09, 1.47 Hz, 1 H) 16.19 (s, 1 H). MS (ESI-) m/z 486 (M-H)".
Example 263A l-(r(3-bromophenyl)methylenelamino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- h ydrox vquinolin-2 ( lH)-one The product of Example 226D (0.059 g, 0.165 mmol) was reacted with 3-
-286- bromobenzaldehyde (0.175 mL, 1.5 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 110°C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 263B l-r(3-bromobenzyl)aminol-3-(Ll-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4- >} hvdroxyquinolin-2( lH)-one
The. product of Example 263 A (0.048 g, 0.091 mmol) in tetrahydrofuran (2.0 mL) and
\ o methanol (0.008 mL, 0.182 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.130 mL, 0.260 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (8.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.93 (brs, 2 H) 6.17 (t, J=6.99 Hz, 1 H) 7.09 (t, J=7.54 Hz, 1 H) 7.28 (d, 1=8.09 Hz, 2 H) 7.37 (d, J=7J2 Hz, 1 H) 7.54 (m, 4 H) 7.68 (m, 2 H) 7.74 (t, J=1.65 Hz, 1 H) 8.09 (dd, 1=7.91, 1.29 Hz, 1 H) 16.26 (s, 1 H). MS (ESI-) m/z 524 (M-H)".
Example 264A l-{[(4-bromophenyl)methylenelamino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyqumolin-2(lH)-one
The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 4- bromobenzaldehyde (0.278 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 264B l-r(4-bromobenzyl)amino1-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one The product of Example 264A (0.049 g, 0.094 mmol) in tetrahydrofuran (2.0 mL) and methanol (0.008 mL, 0.188 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.134 mL, 0.268 mmol). The reaction
-287- was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.92 (brs, 2 H) 7.09 (t, J=6.99 Hz, 1 H) 7.28 (m, 3 H) 7.54 (m, 5 H) 7.68 (d, J=8.09 Hz, 2 H) 8.09 (dd, J=8.09, 1.47 Hz, 1 H) 16.25 (brs, 1 H). MS (ESI-) m/z 524 (M-H)'.
Example 265A l-{r(2-bromophenyl)methylene1aminoj-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( 1 H)-one The product of Example 226D (0.060 g, 0.168 mmol) was reacted with 2- bromobenzaldehyde (0.175 mL, 1.50 mmol) in N,N-dimethylacetamide (1.0 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 265B l-r(2-bromobenzyl)amino1-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one The product of Example 265A (0.068 g, 0.129 mmol) in tetrahydrofuran (3.0 mL) and methanol (0.011 mL, 0.258 mmol) at 0°C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.184 mL, 0.368 mmol). The reaction " was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (8.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-de) δ ppm 4.11 (brs, 2 H) 6.24 (t, J=6.80 Hz, 1 H) 7.06 (t, J=7.54 Hz, 1 H) 7.28 (m, 3 H) 7.56 (m, 3 H) 7.67 (m, 4 H) 8.08 (dd, J=7.91, 1.29 Hz, 1 H) 16.27 (s, 1 H). (ESI-) m/z 524 (M-H)".
Example 266A 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-{ rpyridin-3-
-288- O 2004/041818
ylmethylene1amino}quinolin-2(lH)-one The product of Example 226D (0.070 g, 0.196 mmol) was reacted with nicotinaldehyde (0.168 mL, 1.78 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110°C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
> Example 266B
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - r(pyridin-3- ylmethyl)aminolquinolin-2(lH)-one
The product of Example 266A (0.062 g, 0.14 mmol) in tetrahydrofuran (2.5 mL) and methanol (0.012 mL, 0.280 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.105 mL, 0.210 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (8.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with methanol/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID.1 1HNMR (300 MHz, DMSO-d6) δ ppm 3.99 (s, 2 H) 6.22 (t, J=6.62 Hz, 1 H) 7.08 (t, J=7.35 Hz, 1 H) 7.27 (m, 2 H) 7.40 (dd, J=7.54, 4.96 Hz, 1 H) 7.54 (m, 2 H) 7.68 (d, J=8.09 Hz, 2 H) 7.93 (m, 1 H) 8.08 (dd, J=7.72, 1.47 Hz, 1 H) 8.51 (dd, J=4.78, 1.47 Hz). (ESI-) m z 446 (M-H)"
Example 267 A :
3-({ r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vI)-4-hvdroxy-2-oxoquinolin-l(2H)- vnimino ImethyDbenzonitrile The product of Example 226D (0.070 g, 0.196 mmol) was reacted with 3- formylbenzonitrile (0.080 mL, 0.610 mmol) in N,N-dimethylacetamide (1.2 mL) in a sealed tube at 110 C for 35 minutes in a microwave reactor. The reaction mixture was cooled to 25°C and concentrated. The resulting residue was triturated with ethyl acetate and filtered to give the title compound.
Example 267B 3-({ r3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-2-oxoquinolin-l(27J)- yllamino ImethyDbenzonitrile The product of Example 267A (0.055 g, 0.117 mmol) in tetrahydrofuran (2.0 mL),and
-289- methanol (0.010 mL, 0.234 mmol) at 0 C was treated with dropwise addition of a 2.0M solution of lithium borohydride in tetrahydrofuran (0.088 mL, 0.176 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water (6.0 mL), and the resulting precipitate was collected by filtration and dried. The crude product was triturated with dichloromethane/diethyl ether and filtered to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.01 (s, 2 H) 6.25 (t, J=6.80 H , 1 H) 7.08 (t, J=7.35 Hz, 1 H) 7.28 (m, 2 H) 7.56 (m, 3 H) 7.68 (dd, J=8.09, 2.21 Hz, 2 H) 7J9 (d, J=8.09 Hz, 1 H) 7.86 (d, J=7.72 Hz, 1 H) 7.99 (s, 1 H) 8.09 (dd, J=7.91, 1.29 Hz, 1 H). (ESI-) m/z 470 (M-H)".
Example 268A methyl 3-r(27i)-2-benzylidenehvdrazinolthiophene-2-carboxylate A solution of methyl 3-hydrazinothiophene-2-carboxylate (Maybridge technical grade, 2.0 g, 0.11 mol) in ethanol (250 mL) at 25°C was reacted with a solution of benzaldehyde (12.32 g, 0.11 mol) in ethanol (100 mL). The mixture was stirred at 25°C for 1.5 hours and concentrated to yield 30g of a white solid. HPLC/MS show a single peak with retention time of 2.35 min. and a M+l peak of 261. !H NMR (300 MHz, CDC13) δ ppm 3.85 (s, 3 H) 7.35 (m, 4 H) 7.64 (dd, 7=8.09, 1.47 Hz, 2 H) 7.77 (s, 1 H) 10.10 (s, 1 H).
Example 268B '■ Methyl 3-r2-benzylidene-l-(3-ethoxy-3-oxopropanoyl)hydrazino1thiophene-2-carboxylate The product of Example 185A (26.4g, 0.101 mol) was reacted with ethyl chloromalonate (18.3 g, 0.121 mol) in toluene (400 mL), stirred at reflux for 4 hours, allowing HCl gas to bubble out of the condenser. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was chromatographed on silica gel eluting with 3:1 hexanes/ethyl acetate to give the title compound (37.1 g, 98%).
Example 268C Ethyl 7-hydroxy-5-oxo-4-{ rphenylmethylenelamino }-4,5-dihydrothienor372-blpyridine-6- carboxylate A solution of the product of Example 268B (37.8 g, 0.101 mol) in ethanol (0.5 L) under nitrogen was reacted with sodium ethoxide in ethanol (21% by weight, 32.8 g, 0.104
-290- mol) at room temperature. The mixture was slowly warmed to 50°C and stirred for 1 hour at 40-50°C, cooled to 25°C, partitioned between ethyl acetate and water, and acidified to pH 4 with IM hydrochloric acid. The ethyl acetate layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to give the title compound (12.0 g, 35%). 1HNMR (300 MHz, CDC13) δ ppm 1.47 (t, 7=7.17 Hz, 3 H) 4.52 (q, 7=7.23 Hz, 2 H) 7.33 (d, 7=5.15 Hz, 1 H) 7.50 (m, 3 H) 7.75 (d, 7=5.52 Hz, 1 H) 7.88 (dd, 7=7.72, 1.84 Hz, 2 ' H) 9.44 (s, I H) 14.16 (s, 1 H).
Example 268D 4-amino-6-(l.l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-7-hvdroxythienor3,2- ?1pyridin-
5(4H)-one The product of Example 268C (2.29 g, 6.69 mmol) was reacted with 2- aminobenzenesulfonamide (1.15 g, 6.69 mmol) in toluene (60 mL), and stirred at reflux for 5 hours. The reaction was cooled to 25 °C and the resulting precipitate was collected by filtration and dried (1.95g, 62%). The resulting solid (1.95 g, 4.2 mmol) was reacted with 10% aqueous KOΗ (60 mL) at reflux for 24 hours, cooled to 25°C and acidified with concentrated hydrochloric acid to pΗ 2. The resulting solid was collected by filtration, washed repeatedly with water and dried to provide the title compound (1.5 g, 98%). (Any sodium salt made?) 1H NMR (300 MHz, DMSO-de) δ ppm 6.12 (s, 2 H) 7.49 (d, 7=5.52 Hz, 1 H) 7.57 (m, 2 H) 7J9 (t, 7=7.17 Hz, 1 H) 7.93 (d, 7=7.72 Hz, 1 H) 8.34 (d, 7=5.52 Hz, 1 H) 14.33 (s, 1 H) 14.68 (s, 1 H).
Example 269A
6-(Ll-dioxido-4H-1.2.4-benzothiadiazin-3-yl)-7-hydroxy-4-|f2- meth ylprop ylidenel amino I thieno ["3 ,2-fr lpyridin-5 (4H)-one
The product of Example 268D (0.10g, 0.27 mmol) was reacted with 2-methyl- propionaldehyde (0.20g, 2.77 mmol) in N,N-dimethylacetamιde (3 mL) in a sealed tube at
135 C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with a mixture of 25% ethyl acetate in hexanes and filtered to give the title compound as a solid (0.073 g, 65%). MS (APCI+) m/z 417 (M+Η)+.
Example 269B 6-(l.l-Dioxιdo-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(isobutylamino)thienor3,2-
-291- b1pyridin-5(ΛH)-one The product of Example 269A (0.073 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.20 mL, 0.40 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was suspended in tetrahydrofuran (10 mL) and adsorbed onto approximately 5g of silica gel and evaporated. The product was eluted with methanol in chloroform. Product containing fractions were combined and evaporated under vacuum to give the title compound (0.032 g, 42%). MS (ESI-) m/z 417 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *Η NMR (300 MHz, DMSO-d6) δ ppm 1.01 (d, 7=6.62 Hz, 6 H) 1.88 (m, 1 H) 2.83 (s, 2 H) 6.60 (s, 1 H) 7.41 (d, 7=4.04 Hz, 1 H) 7.55 (t, 7=7.54 Hz, 1 H) 7.65 (d, 7=8.46 Hz, 1 H) 7.77 (t, 7=7.91 Hz, 1 H) 7.93 (d, 7=7.72 Hz, 1 H) 8.35 (d, 7=4.78 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H).
Example 270A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-ir(3S)-3- methylcvclopentylidenelamino}thienor3,2-blpyridin-5(4H)-one
The product of Example 268D (0.065 g, 0.18 mmol) was reacted with (3S)-3- methylcyclopentanone (0.54 g, 5.6 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135 C for 90 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with ethyl acetate/hexane (2:1) and filtered to give the title compound.
Example 270B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{r(35)-3- methylcvclopentvnamino|thienor3,2- >lpyridin-5(4H)-one The product of Example 269A (0.060 g, 0.14 mmol) in tetrahydrofuran (4 mL) and methanol (0.012 mL, 0.3 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25°C for 2 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to dichloromethane/methanol (99:1). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.01 (m, 3 H) 1.69 (m, 7 H) 3.76 (m, 1
-292- H) 5.75 (s, 1 H) 7.19 (m, 3 H) 7.54 (m, 1 H) 7.65 (d, 1=7.72 Hz, 1 H) 7J4 (d, J=6.25 Hz, 1 H) 15.91 (s, 1 H). MS (ESI-) m/z 443 (M-H)".
Example 271 A
4-{ ri-cvclopropylethylidenelamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-b1pyridin-5(4H)-one The product of Example 268D (0.065 g, 0.18 mmol) was reacted with 1- cyclopropylethanone (0.54 g, 6.4 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 120 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with ethyl acetate/hexane (2:1) and filtered to give the title compound.
Example 27 IB 4-iri-cyclopropylethyllamino}-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hvdroxythienor3,2- ?1pyridin-5(4H)-one The product of Example 269A (0.058 g, 0.14 mmol) in tetrahydrofuran (4 mL) and methanol (0.012 mL, 0.3 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25°C for 2 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with dichloromethane to dichloromethane/methanol (99:1) to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. ]Η NMR (300 MHz, DMSO-d6) δ ppm 1.05 (m, 8 H) 2.44 (m, 1 H) 5.81 (d, J=2.57 Hz, 1 H) 7.23 (m, 3 H) 7.53 (m, 1 H) 7.64 (d, 1=7.72 Hz', 1 H) 7.74 (s, br, 1 H) 15.95 (s, 1 H). MS (ESI-) m/z 429 (M-H)".
Example 272A
4-r(butylideneamino1-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxythienor3,2- blpyridin-5 (4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with butyraldehyde (0.5 g, 6.9 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130°C for 40 minutes in a microwave reactor. The reaction was cooled to 25 °C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.075g, 65%).
-293- Example 272B 4-(butylamino)-6-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hvdroxythieno |"3 ,2-
&]pyridin-5(4H)-one The product of Example 269A (0.075 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.029 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 0.90 (t, J=7.17 Hz, 3 H) 1.39 (dd, J=15.08, 7.35 Hz, 2 H) 1.50 (m, 2 H) 3.02 (t, 1=6.43 Hz, 2 H) 6.65 (s, 1 H) 7.43 (d, J=5.15 Hz, 1 H) 7.55 (t, J=7.72 Hz, 1 H) 7.64 (d, J=8.09 Hz, 1 H) 7.77 (t, J=7.72 Hz, 1 H) 7.92 (d, J=8.09 Hz, 1 H) 8.34 (d, J=5.15 Hz, 1 H) 14.21 (s, 1 H) 14.83 (s, 1 H). MS (ESI-)m/z 417 (M-H)".
Example 273A
6-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4- { r2-ethylbutylidenel amino } -7- hvdroxythienor3,2-i7"|pyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2-ethylbutanal (0.5 g, 5.2 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130 C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.082g, 68%).
Example 273B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-r(2-ethylbutyl)aminol-7-hydroxythienor3,2- b1pyridin-5(4H)-one The product of Example 269A (0.82 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title
-294- compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. IH NMR (300 MHz, DMSO-d6) δ ppm 0.90 (t, 1=7.17 Hz, 6 H) 1.45 (m, 5 H) 2.94 (m, J=4.78 Hz, 2 H) 6.53 (s, 1 H) 7.38 (d, J=5.52 Hz, 1 H) 7.55 (t, J=7.54 Hz, 1 H) 7.65 (d, J=8.09 Hz, 1 H) 7.77 (t, J=8.46 Hz, 1 H) 7.92 (d, J=7.72 Hz, 1 H) 8.36 (d, J=5.52 Hz, 1 H) 14.19 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m/z 445(M-H)".
Example 274A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-rpentylideneamino1thienor3,2- blpyridin-5 (47/)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with pentanal (0.5 g, 5.0 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130 C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.08 lg, 70%).
Example 274B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(pentylamino)thienor3,2- b] p yridin-5 (4i7)-one
The product of Example 269A (0.081 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 0.88 (t, J=6.99 Hz, 3 H) 1.34 (m, 4 H) 1.53 (m, 2 H) 3.01 (t, J=6.62 Hz, 2 H) 6.64 (s, 1 H) 7.43 (d, J=5.15 Hz, 1 H) 7.55 (t, J=7.72 Hz, 1 H) 7.64 (d, J=8.09 Hz, 1 H) 7.78 (t, J=7.91 Hz, 1 H) 7.93 (d, 1=8.09 Hz, 1 H) 8.35 (d, J=5.52 Hz, 1 H) 14.21 (s, 1 H) 14.81 (s, 1 H). MS (ESI-) m/z 431 (M-H)".
Example 275A
6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4- { F3- methylbutylidenelamino}thienor3,2-&lpyridin-5(4J7)-one
-295- The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methylbutanal (0.5 g, 5.8 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130°C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.083g, 71%).
Example 275B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-r(3- methylbutyl)aminolthieno[3,2-b1pyridin-5(4H)-one The product of Example 269A (0.083 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 0.90 (d, 1=6.62 Hz, 6 H) 1.44 (q, J=7.11 Hz, 2 H) 1.70 (m, 1 H) 3.03 (t, J=6.99 Hz, 2 H) 6.61 (s, 1 H) 7.43 (d, J=5.15 Hz, 1 H) 7.55 (t, J=7.54 Hz, 1 H) 7.65 (d, J=8.09 Hz, 1 H) 7.77 (t, J=7.72 Hz, 1 H) 7.92 (d, J=7.72 Hz, 1 H) 8.35 (d, J=5.52 Hz, 1 H) 14.20 (s, 1 H) 14.81 (s, 1 H). MS (ESI-) m/z 431 (M-H)".
Example 276A 4-{ r3,3-dimethylbutylidene1amino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3 ,3- dimethylbutanal (0.5 g, 5.0 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130 C for 40 minutes in a microwave reactor. The reaction was cooled to 25 °C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.072g, 77%).
Example 276B 4-r(3,3-dimethylbutyl)aminol-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hvdroxythienoF3,2-b1pyridin-5(47 )-one
The product of Example 269A (0.072 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium
-296- borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pH of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2%methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. IH NMR (300 MHz, DMSO-d6) δ ppm 0.89 (s, 9 H) 1.49 (dd, J=9.56, 6.99 Hz, 2 H) 3.03 (m, 2 H) 6.61 (s, 1 H) 7.43 (d, J=5.52 Hz, 1 H) 7.55 (t, J=7.54 Hz, 1 H) 7.66 (d, J=7.72 Hi, 1 H) 7.77 (m, 1 H) 7.92 (d, J=8.09 Hz, 1 H) 8.35 (d, J=5.52 Hz, 1 H) 14.19 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m/z 445 (M-H)".
Example 277 A 6-(l.l-dioxido-4H-1.2,4-benzothiadiazin-3-yl)-7-hydroxy-4-( r(3- methylphenvDmeth ylenel amino I thieno \3 ,2-b1pyridin-5(4H)-one
The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3- methylbenzaldehyde (0.5 g, 4.2 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130 C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and d' concenfrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.092, 73%).
Example 277B 6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(3- methylbenzyl)amino1thienor3,2-fc1pyridin-5(4H)-one The product of Example 269A (0.090 g, 0.2 mmol) in tetrahydrofuran (4 mL) and methanol (0.015 mL," 0.4 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 2.29 (s, 3 H) 4.15 (s, 2 H) 6.94 (s, 1 H) 7.22 (m, 4 H) 7.30 (d, J=5.15 Hz, 1 H) 7.56 (t, J=7.72 Hz, 1 H) 7.68 (d, J=8.46 Hz, 1 H) 7.79 (t, 1=6.99 Hz, 1 H) 7.94 (d, J=7.72 Hz, 1 H) 8.24 (d, J=5.15 Hz, 1 H) 14.26 (s, 1 H) 14.84 (s, 1 H). MS (ESI-) m/z 465(M-H)".
-297- Example 278A 6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-{ r(2- methylphenyl)methylenelamino}thieno[3,2-b1pyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2- methylbenzaldehyde (0.5 g, 4.2 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.072g, 57%).
Example 278B 6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- (2- methylbenzyl)aminolthienor3,2-blpyridin-5(4H)-one The product of Example 269A (0.072 g, 0.15 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 2.45 (s, 3 H) 4.21 (s, 2 H) 6.92 (s, 1 H) 7.15 (m, 5 H) 7.56 (t, J=7J2 Hz, 1 H) 7.67 (d, 1=8.09 Hz, 1 H) 7J9 (t, J=7J2 Hz,,l H) 7.94 (d, J=7.72 Hz, 1 H) 8.17 (d, J=5.52 Hz, 1 H) 14.22 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 279A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-f r(4- methylphenyl)methylenelamino)thienor3,2-Z>1pyridin-5(47D-one
The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 4- methylbenzaldehyde (0.5 g, 4.2 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.10 g, 81 %).
Example 279B
-298- 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yI)-7-hvdroxy-4-r(4- methylbenzyl)amino1thienor3,2- ?lpyridin-5(477r)-one The product of Example 269A (0.10 g, 0.22 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product v as chromatographed on silica gel with 2% methanol in chloroform to give the title compound.. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 2.27 (s, 3 H) 4.14 (s, 2 H) 6.92 (s, 1 H) 7.13 (d, J=8.09 Hz, 2 H) 7.28 (d, J=2.94 Hz, 1 H) 7.30 (d, J=5.88 Hz, 2 H) 7.56 (t, J=7.72 Hz, 1 H) 7.67 (d, J=8.46 Hz, 1 H) 7.79 (t, J=7.72 Hz, 1 H) 7.94 (d, J=7.72 Hz, 1 H) 8.22 (d, J=5.52 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 280A 6-(l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-lf3-methylbut-2- enylidenelamino)thienor3.2-Z?1pyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-methylbut-2- enal (0.5 g, 5.9 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 130°C for 40 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093g, 80%).
Example 280B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-r(3-methylbut-2- enyl)amino1thienor3,2-fc1pyridin-5(4JJ)-one The product of Example 269A (0.093 g, 0.22 mmol) in tefrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in choroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 1.51 (s, 3 H) 1.61 (s, 3 H) 3.64 (d, J=6.99 Hz, 2 H) 5.32 (t, 1=8.09 Hz, 1 H) 6.65 (s, 1 H) 7.43 (d, J=5.52 Hz, 1 H) 7.55 (t, J=7.54
-299- Hz, 1 H) 7.64 (d, J=8.46 Hz, 1 H) 7.78 (t, J=7.17 Hz, 1 H) 7.92 (d, J=7.72 Hz, 1 H) 8.32 (m, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 429 (M-H)".
Example 281 A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-rpropylideneaminolthienor3,2- >} ft1pyridin-5(4H)-one
The product of Example 268D (0.10 g, 0.27 mmol) was reacted with propionaldehyde (0.5 g, 8.6 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 120°C for 90 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.073g, 67%).
Example 28 IB
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-(propylamino)thienor3,2- b1pyridin-5(4H)-one The product of Example 269A (0.073 g, 0.18 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 0.95 (t, J=7.35 Hz, 3 H) 1.54 (m, 2 H) 2.99 (t, J=6.99 Hz, 2 H) 6.66 (s, 1 H) 7.44 (d, J=5.15 Hz, 1 H) 7.55 (t, J=7.54 Hz, 1 H) 7.64 (d, 1=8.09 Hz, 1 H) 7.78 (t, 1=7.17 Hz, 1 H) 7.93 (d, J=7.72 Hz, 1 H) 8.35 (d, J=5.15 Hz, 1 H) 14.20 (s, 1 H) 14.81 (s, 1 H). MS (ESI-) m/z 403 (M-H)".
Example 282A 6-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- { rpyridin-4- ylmethylenelamino)thienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with isonicotinaldehyde (0.5 g, 4.7 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and
-300- concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093g, 76%).
Example 282B 6-(lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-r(pyridin-4- yImethyl)amino1thieno|'3,2-blpyridin-5(4H)-one The product of Example 269A (0.093 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanoi^O.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 4.39 (s, 2 H) 7.34 (d, J=5.15 Hz, 1 H) 7.42 (s, 1 H) 7.56 (t, J=7J2 Hz, 1 H) 7.63 (d, J=8.09 Hz, 1 H) 7J9 (m, J=7.72, 7.72 Hz, 3 H) 7.94 (d, J=7J2 Hz, 1 H) 8.27 (d, J=5.15 Hz, 1 H) 8.52 (d, J=6.62 Hz, 2 H) 14.15 (s, 1 H) 14.87 (s, 1 H). MS (ESI-) m/z 452 (M-H)".
Example 283A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(rpyridin-3- ylmethylene1amino)thienor3,2-&1pyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with nicotinaldehyde (0.5 g, 4.7 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.102g, 84%).
Example 283B
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7"hydroxy-4-f(pyridin-3- ylmethyl)amino1thienor3,2-&lpyridin-5(47/)-one The product of Example 269 A (0.102 g, 0.23 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude
-301- product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. IH NMR (300 MHz, DMSO-d6) δ ppm 4.33 (s, 2 H) 7.28 (d, J=5.52 Hz, 1 H) 7.36 (s, 1 H) 7.61 (m, 3 H) 7.79 (t, J=7.17 Hz, 1 H) 7.94 (d, J=8.09 Hz, 1 H) 8.20 (d, J=11.03 Hz, 1 H) 8.27 (d, J=5.51 Hz, 1 H) 8.49 (d, J=5.51 Hz, 1 H) 8.64 (s, 1 H) 14.14 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m/z 452 (M-H)".
Example 284A
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-{ rpyridin-2- ylmethylenelamino|thienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 2- pyridinecarboxaldehyde (0.5 g, 4.7 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.071g, 58%).
Example 284B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(pyridin-2- ylmethyl)aminolthienor3,2-b1pyridin-5(4H)-one The product of Example 269A (0.071 g, 0.16 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water" (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 5% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID-. XΗ NMR (300 MHz, DMSO-dg) δ ppm 4.65 (s, 2 H) 7.25 (d, 7=5.15 Hz, 1 H) 7.45 (s, 1 H) 7.59 (m, 3 H) 7.78 (t, 7=7.91 Hz, 1 H) 7.93 (d, 7=7.72 Hz, 2 H) 8.16 (t,
7=7.72 Hz, 1 H) 8.24 (d, 7=5.15 Hz, 1 H) 8.72 (d, 7=5.51 Hz, 1 H) 14.-10 (s, 1 H) 14.87 (s, 1 H). MS (ESI-) m/z 452(M-H)".
Example 285A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-f lT3-
-302- methoxyphen vDmethylenel amino I thieno f3.2-b1pyridin-5 (4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3- methoxybenzaldehyde (0.5 g, 3.7 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.093g 72%).
' , Example 285B
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-r(3- methoxybenzyl)aminolthienor3,2-blpyridin-5(4H)-one
The product of Example 269 A (0.093 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-d6) δ ppm 3.73 (s, 3 H) 4.17 (s, 2 H) 6.84 (m, 1 H) 6.98 (m, 3 H) 7.22 (d, J=8.09 Hz, 1 H) 7.26 (d, J=5.15 Hz, 1 H) 7.56 (t, J=7.17 Hz, 1 H) 7.67 (d, J=8.09 Hz, 1 H) 7.79 (t, 1=8.46 Hz, 1 H) 7.94 (d, J=7.72 Hz, 1 H) 8.22 (d, J=5.15 Hz, 1 H) 14.21 (s, 1 H) 14.84 (s, 1 H). MS (ESI-) m z 481 (M-H)".
' Example 286A
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-( r3-furylmethylenelamino)-7- hvdroxythienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with 3-furaldehyde (0.5 g, 5.2 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concenfrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.103g, 87%).
Example 286B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-r(3-furylmethyl)aminol-7- hydroxythieno l"3 ,2-blpyridin-5 (4H)-one The product of Example 269A (0.103 g, 0.23 mmol) in tetrahydrofuran (4 mL) and
-303- methanol (0.030 mL, 0.8 mmol) at 0°C was freated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to pH of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.08 (s, 2 H) 6.59 (s, 1 H) 6.95 (s, 1 H) 7.32 (ft J=5.15 Hz, 1 H) 7.58 (m, 3 H) 7.66 (d, J=8.09 Hz, 1 H) 7J9 (t, J=8.46 Hz, 1 H) 7.93 (d, J=7J2 Hz, 1 H) 8.24 (d, J=5.52 Hz, 1 H) 14.21 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m/z 441 (M-H)".
Example 287A 3-({ r6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-5-oxothienor3,2-b1pyridin-
4(5H)-yl"]imino ImethvDbenzonitrile The product of Example 268D (0.100 g, 0.27 mmol) was reacted with 3- formylbenzonitrile (0.362 g, 2.75 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.088g, 69%).
Example 287B 3-(i r6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-5-oxothienor3,2-blpyridin- 4(5H)-yπ amino ImethvDbenzonitrile
The product of Example 269A (0.088 g, 0.19 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.26 (s, 2 H) 7.21 (s, 1 H) 7.29 (d, J=5.15 Hz, 1 H) 7.55 (m, 2 H) 7.65 (d, J=8.09 Hz, 1 H) 7J8 (m, 3 H) 7.94 (m, 2 H) 8.22 (d, J=5.52 Hz, 1 H) 14.19 (s, 1 H) 14.83 (s, 1 H). MS (ESI-) m/z 476(M-H)\
-304- Example 288 A 6-(Ll-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ rthien-3- ylmeth ylenel amino I thieno \ ,2-blp yridin-5 (4H)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with thiophene-3- carbaldehyde (0.5 g, 4.5 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concenfrated under vaέuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.077g, 63%). s
Example 288B 6-( 1 , l-dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-7-h vdroxy-4- \ (thien-3 - ylmethyl)aminolthienor3,2-blpyridin-5(47 )-one The product of Example 269A (0.077 g, 0.17 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.150 mL, 0.3 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to pΗ of approximately 2-4, diluted with water (25 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 2% methanol in chloroform to give the title compound. The sodium salt of the title compound wag prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-de) δ ppm 4.22 (s, 2 H) 7.01 (s, 1 H) 7.20 (dd, J=4.96, 1.29 Hz, 1 H) 7.23 (d, J=5.52 Hz, 1 H) 7.40 (d, J=1.84 Hz, 1 H) 7.48 (dd, J=4J8, 2.94 Hz, 1 H) 7.56 (t, J=7.17 Hz, 1 H) 7.67 (d, J=7.72 Hz, 1 H) 7.79 (t, J=7.72 Hz, 1 H) 7.94 (d, J=7.72 Hz, 1 H) 8.21 (d, J=5.15 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 457 (M-H)-. :
Example 289A 4-(cyclobutylideneamino)-6-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7- hvdroxythieno[3,2-blpyridin-5(47/)-one The product of Example 268D (0.10 g, 0.27 mmol) was reacted with cyclobutanone (1.0 g, 14.3 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction was cooled to 25 °C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.086g 77%).
-305- Example 289B 4-(cvclobutylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythienor3,2- b1pyridin-5(4H)-one The product of Example 269A (0.077 g, 0.21 mmol) in tetrahydrofuran (4 mL) and methanol (0.030 mL, 0.8 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid to pΗ of approximately 2-4, diluted with water (15 mL), andΛhe resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.81 (m, 6 H) 3.85 (m, 1 H) 6.84 (s, 1 H) 7.49 (d, J=5.15 Hz, 1 H) 7.55 (t, J=7.91 Hz, 1 H) 7.62 (d, J=8.09 Hz, 1 H) 7.78 (t, 1=7.91 Hz, 1 H) 7.93 (d, J=8.09 Hz, 1 H) 8.33 (d, J=5.15 Hz, 1 H) 14.21 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 415 (M-H)". ■
Example 290A 6-( 1 , 1 -dioxido-4H-L2,4-benzothiadiazin-3-yl)-7-hydroxy-4- {[phenylmethylenelaminolthieno|3,2-^lpyridin-5(4H)-one
The product of Example 268D (0.115 g, 0.30 mmol) was reacted with benzaldehyde (0.32 g, 3.0 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135 C for 50 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with 0.1 M ΗC1 (20 mL) and filtered to give the title compound.
Example 290B 4-(benzylamino)-6-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxythienor3,2- blpyridin-5(4H -one The product of Example 269A (0.116 g, 0.257 mmol) in tetrahydrofuran (5 mL) and methanol (0.021 mL, 0.514 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.19 mL, 0.386 mmol). The reaction was stirred at 25°C for 2 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 3.97 (d, J=5.54 Hz, 2 H) 6.17 (t, J=6.43 Hz, 1 H) 7.08 (d, J=5.52 Hz, 1 H) 7.21 (d, J=8.09 Hz, 1 H) 7.33 (m, 4 H) 7.47
-306- (d, J=6.62 Hz, 2 H) 7.55 (t, J=6.99 Hz, 1 H) 7.66 (d, J=7.35 Hz, 1 H) 7.73 (d, J=5.52 Hz, 1 H) 15.92 (s, 1 H). MS (ESI-) m/z 451 (M-H)".
Example 291 A 4-{ lcyclohexylmethylenel amino l-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hvdroxythienor3,2-b1pyridin-5(4H)-one
The, product of Example 268D (0.115 g, 0.30mmol) was reacted with cyclohexanecarbaldehyde (0.336 g, 3.0 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with 0.1 M ΗC1 (20 mL) and filtered to give the title compound.
Example 29 IB
4-r(cvclohexylmethyl)aminol-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-b1pyridin-5(4H)-one The product of Example 269A (0.12 g, 0.26 mmol) in tetrahydrofuran (5 mL) and methanol (0.021 mL, 0.52 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.195 mL, 0.39 mmol). The reaction was stirred at 25 °C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (15 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 97:3 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.04 (m, 2 H) 1.23 (m, 3 H) 1.52 (m, 1 H) 1.68 (m, 3 H) 1.87 (m, 2 H) 2.69 (m, 2 H) 5.95 (t, J=7.17 Hz, 1 H) 7.07 (d, 1=5.52 Hz, 1 H) 7.19 (d, J=8.09 Hz, 1 H) 7.26 (t, J=7.72 Hz, 1 H) 7.53 (t, 1=7.17 Hz, 1 H) 7.65 (d, J=6.99 Hz, 1 H) 7.78 (d, J=5.15 Hz, 1 H) 15.91 (s, 1 H). MS (APCf) m/z 459 (M+H)-1".
Example 292A 6-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ n,3-thiazol-5- ylmethylenel amino )thienor3,2-&1pyridin-5(4H)-one
The product of Example 268D (0.115 g, 0.30 mmol) was reacted with l,3-thiazole-5- carbaldehyde (0.35 g, 3.0 mmol) in N,N-dimethylacetamide (3 mL) in a sealed tube at 140°C
-307- for 80 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with 0.1 M HCl (20 mL) and filtered to give the title compound.
5 Example 292B
6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-[Y 1 ,3-thiazol-5- ylmethyl)amino1thienor3,2-b]pyridin-5(4i7)-one he product of Example 269A (0.137 g, 0.30 mmol) in tetrahydrofuran (7 mL) and methanol (0.025 mL, 0.6 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium lδ borohydride in tetrahydrofuran (0.225 mL, 0.45 mmol). The reaction was stirred at 25°C for 2 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 95:5 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the 15 procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.34 (m, 2 H) 6.45 (t, 1=5.52 Hz, 1 H) 6.97 (d, J=5.15 Hz, 1 H) 7.20 (d, J=8.09 Hz, 1 H)' 7.27 (t, J=7.54 Hz, 1 H) 7.54 (t, J=7.17 Hz, 1 H) 7.66 (d, J=7.72 Hz, 1 H) 7.70 (d, J=5.52 Hz, 1 H) 7.79 (s, 1 H) 9.02 • (s, 1 H) 15.87 (s, 1 H). MS (ESI-) m/z 458 (M-H)".
20
Example 293A 4-{r(3-bromophenyl)methylenelaminol-6-(l,l-dioxido-4H-l,2.4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-fr1pyridin-5(4H)-one 5 The product of Example 268D (0.115 g, 0.30 mmol) was reacted with 3- bromobenzaldehyde (0.555 g, 3.0 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135 C for 30 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with ethyl acetate (3 mL) and filtered to give the title compound. 0
Example 293B 4-r(3-bromobenzyl)amino1-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydrox ythieno r3 ,2-b]pyridin-5 (4H)-one The product of Example 269A (0.13 g, 0.245 mmol) in tetrahydrofuran (4 mL) and 5 methanol (0.015 mL, 0.36 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tefrahydrofuran (0.15 mL, 0.30 mmol). The reaction was stirred at 25°C for 2 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with
-308- water (15 mL), and the resulting precipitate was collected by filtration and dried to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.02 (m, 2 H) 6.27 (t, J=6.25 Hz, 1 H) 7.08 (d, J=5.1 Ηz, 1 H) 7.20 (d, 1=8.46 Hz, 1 H) 7.28 (t, J=7.72 Hz, 1 H) 7.32 (t, J=6.99 Hz, 1 H) 7.46 (d, J=7.72 Hz, 1 H) 7.54 (m, 2 H) 7.67 (m, 2 H) 7.73 (d, 1=5.15 Hz, 1 H) 15.90 (s, 1 H). MS (ESI-) m/z 529/531 (M-H)".
Example 294A
4-(c yclohexylideneamino)-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-^lpyridin-5(47J)-one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cyclohexanone (0.44 g, 4.5 mmol) in N,N-dimethylacetamide (1 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction was cooled to 25 °C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
Example 294B 4-(cyclohexylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxythienor3,2- blpyridin-5 (4H)-one The product of Example 269A (0.051 g, 0.115 mmol) in tetrahydrofuran (5 mL) and methanol (0.01 mL, 0.23 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.090 mL, 0.175 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 97:3 dichloromethane/methanolto give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.16 (m, 5 H) 1.59 (m, 5 H) 3.01 (m, 1 H) 5.75 (d, 1=3.31 Hz, 1 H) 7.15 (d, J=5.52 Hz, 1 H) 7.19 (d, J=7.72 Hz, 1 H) 7.26 (t, J=7.54 Hz, 1 H) 7.54 (m, 1 H) 7.65 (d, J=7.72 Hz, 1 H) 7.72 (d, J=5.52 Hz, 1 H) 15.93 (s, 1 H). MS (ESI-) m/z 443 (M-H)".
Example 295A 4-(cyclopentylideneamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-
-309- hvdroxythienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cyclopentanone (0.95 g, 11.3 mmol) in N,N-dimethylacetamide (1 mL) in a sealed tube at 135 C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
>} Example 295B
4-(cvclopentylamino)-6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hvdroxythieno [3 ,2- blpyridin-5 (4H)-one
The product of Example 269A (0.040 g, 0.09 mmol) in tetrahydrofuran (3 mL) and methanol (0.008 mL, 0.19 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.07 mL, 0.14 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-d6) δ ppm 1.54 (m, 6 H) 1.74 (m, 2 H) 3.75 (m, 1 H) 5.77 (d, J=3.68 Hz, 1 H) 7.12 (d, J=5.15 Hz, 1 H) 7.19 (d, J=7.72 Hz, 1 H) 7.26 (t, J=7.l7 Hz, 1 H) 7.54 (m, 1 H) 7.64 (d, J=7.72 Hz, 1 H) 7.74 (d, J=5.52 Hz, 1 H) 15.91 (s, 1 H). MS (ESI-) m/z 429 (M-H)".
Example 296A
4-(cycloheptylideneamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with cycloheptanone (0.84 g, 7.5 mmol) in N,N-dimethylacetamide (1 mL) in a sealed tube at 135°C for 45 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
Example 296B 4-(cvcloheptylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxythieno[3,2- fc1pyridin-5(4H)-one The product of Example 269A (0.06 g, 0.13 mmol) in tetrahydrofuran (4 mL) and
-310- methanol (0.011 mL, 0.26 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.10 mL, 0.2 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pH of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d5) δ ppm 1.35 (m, 4 H) 1.50 (m, 4 H) 1.64 (m, 3 H) 1.86 (m, 1 H) 2.56 (m, 1 H) 5.62 (d, 1=2.94 Hz, 1 H) 7.12 (d, J=5.52 Hz, 1 H) 7.19 (d, J=8.09 Hz, 1 H) 7.26 (t, J=7.54 Hz, 1 H) 7.53 (m, 1 H) 7.64 (d, J=7.72 Hz, 1 H) 7.72 (d, J=5.15 Hz, 1 H) 15.92 (s, 1 H). MS (ESI-) m/z 457 (M-H)".
Example 297A 6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- { \3- methylcvclohexyIidenelaminolthienor3,2-b1pyridin-5(4H)-one The product of Example 268D (0.054 g, 0.15 mmol) was reacted with 3- methylcyclohexanone (1.26 g, 11.25 mmol) in N,N-dimethylacetamide (1 mL) in a sealed tube at 135 C for 45 minutes in a microwave reactor. The reaction was cooled to 25°C and concenfrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
Example 297B 6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadi azin-3-yl)-7-hydrox v-4- { \3 - methylcyclohexyllamino}thienor3,2-b1pyridin-5(4H)-one
The product of Example 269A (0.060 g, 0.13 mmol) in tetrahydrofuran (4 mL) and methanol (0.011 mL, 0.26 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tefrahydrofuran (0.1 mL, 0.20 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.86 (m, 4 H) 1.08 (m, 1 H) 1.29 (m, 3 H) 1.60 ( , 3 H) 1.93 (m, 1 H) 3.04 (m, 1 H) 5.76 (d, J=3.31 Hz, 1 H) 7.14 (d, J=5.52 Hz, 1 H) 7.19 (d, J=8.46 Hz, 1 H) 7.26 (t, J=7.54 Hz, 1 H) 7.52 (dt, J=8.46, 1.47 Hz, 1 H) 7.65 (d, J=8.09 Hz, 1 H) 7.73 (t, J=5.15 Hz, 1 H) 15.93 (s, 1 H). MS (ESI-) m/z 457 (M- H)".
-311- Example 298A 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-ir(3R)-3- methylcyclohexylidene1amino|thienor3,2-blpyridin-5(4H)-one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with (3R)-3- methylcyblohexanone (1.12 g, 10.0 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135 C for 45 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
Example 298B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroxy-4-f r(3R)-3- methylcvclohexyl1amino|thienor3,2-blpyridin-5(4TD-one
The product of Example 269A (0.06 g, 0.13 mmol) in tetrahydrofuran (6 mL) and methanol (0.011 mL, 0.26 mmol) at 0°C was freated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.1 mL, 0.2 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.86 (m, 4 H) 1.08 (m, 1 H) 1.29 (m, 3 H) 1.60 (m, 3 H) 1.93 (m, 1 H) 3.04 (m, 1 H) 5.76 (d, J=3.31 Hz, 1 H) 7.14 (d, J=5.52 Hz, 1 H) 7.19 (d, J=8.46 Hz, 1 H) 7.26 (t, J=7.54 Hz, 1 H) 7.52 (dt, J=8.46, 1.47 Hz; 1 H) 7.65 ((d, J=8.09 Hz, 1 H) 7.73 (t, J=5.15 Hz, 1 H) 15.93 (s, 1 H). MS (ESI-) m/z 457 (M- H)".
Example 299A
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-r(l-ethylpropylidene)aminol-7- hydroxythienor3,2-frlpyridin-5(4H)-one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with pentan-3-one (0.86 g, 10.0 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 40 minutes in a microwave reactor. The reaction was cooled to 25 °C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
-312- Example 299B 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-r(l-ethylpropyl)amino1-7- hydroxythienor3,2-b1pyridin-5(4H)-one The product of Example 269A (0.08 g, 0.18 mmol) in tetrahydrofuran (7 mL) and methanol (0.015 mL, 0.36 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.135 mL, 0.27 mmol). The reaction was stiπed at 25 °C for! hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filfration and dried. The crude product was chromatographed on silica gel with 98:2 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.87 (m, 6 H) 1.29 (m, 4 H) 3.03 (m, 1 H) 5.76 (d, J=3.68 Hz, 1 H) 7.12 (d, J=5.52 Hz, 1 H) 7.19 (d, J=8.46 Hz, 1 H) 7.26 (t, J=6.99 Hz, 1 H) 7.54 (m, 1 H) 7.65 (d, J=7.72 Hz, 1 H) 7.74 (d, J=5.15 Hz, 1 H) 15.95 (s, 1 H). MS (ESI-) m/z 431 (M-H)".
Example 300A 6-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hvdroχy-4-iπ- phenylethylidenel amino I thieno [3 ,2-&1pyridin-5 (47Z)-one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with 1- phenylethanone (1.2 g, 10.0 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 75 minutes in a microwave" reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) ' and filtered to give the title compound.
Example 300B 6-(l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-f ri- phenylethyll amino I thieno \3 ,2-b1pyridin-5 (4H)-one
The product of Example 269A (0.046 g, 0.10 mmol) in tetrahydrofuran (5 mL) and methanol (0.005 mL, 0.12 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.06 mL, 0.12 mmol). The reaction was stiπed at 25°C for 3 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filfration and dried. The crude product was chromatographed on silica gel with 99:1 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the
-313- procedure of Example ID. 1H NMR (300 MHz, DMSO-dg) δ ppm 1.26 (m, 3 H) 4.49 (m, 1 H) 5.90 (m, 1 H) 7.20 (d, J=8.09 Hz, 1 H) 7.27 (t, J=8.46 Hz, 2 H) 7.30 (m, 5 H) 7.54 ( , 2 H) 7.66 (d, 1=8.09 Hz, 1 H) 15.93 (s, 1 H). MS (ESI-) m/z 465 (M-H)".
Example 301A ^ 6-(l.l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-| U- meth ylbutylidenel amino I thienor32-bΛ pyridin-5 (4i7)-one The product of Example 268D (0.073 g, 0.2 mmol) was reacted with pentan-2-one
(0.9 g, 10.4 mmol) in N,N-dimethylacetamide (2 mL) in a sealed tube at 135°C for 60 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether (3 mL) and filtered to give the title compound.
Example 301B 6-(l .1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- j IT - methylbutyll amino I thienoβ 2-hΛ pyridin-5 (4H)-one The product of Example 269A (0.070 g, 0.16 mmol) in tetrahydrofuran ( mL) and methanol (0.013 mL, 0.32 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.12 mL, 0.24 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IM hydrochloric acid a pΗ of approximately 2-4, diluted with water (10 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 99:1 dichloromethane/methanol to give the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.87 (m, 6 H) 1.30 (m, 4 H) 3.25 (m, 1 H) 5.74 (d, J=3.68 Hz, 1 H) 7.13 (d, J=5.15 Hz, 1 H) 7.19 (d, J=8.09 Hz, 1 H) 7.26 (t, J=7.54 Hz, 1 H) 7.54 (dd, J=8.09, 1.47 Hz, 1 H) 7.65 (d, 3=7.72 Hz, 1 H) 7.73 (d, J=5.52 Hz, 1 H) 15.94 (s, 1 H). MS (ESI-) m z 431 (M-H)".
Example 303A 4- { rcyclopropylmethylene! amino I -6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7- hydrox ythieno \3 ,2-blp yridin-5 (4/J)-one
The product of Example 268D (0.15 g, 0.41 mmol) was reacted with cyclopropanecarbaldehyde (1.0 g, 14 mmol) in N,N-dιmethylacetamide (3 mL) in a sealed
-314- tube at 120 C for 90 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under vacuum. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.104g, 60%).
Example 303B
4-r(cyclopropylmethyl)amino1-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythienor3,2-fc1pyridin-5(4H)-one The product of Example 269A (0.104 g, 0.25 mmol) in tetrahydrofuran (4 mL) and methanol (0.020 mL, 0.5 mmol) at 0°C was treated dropwise with a 2.0M solution of lithium borohydride in tetrahydrofuran (0.200 mL, 0.4 mmol). The reaction was stiπed at 25°C for 1 hour, acidified with IM hydrochloric, acid to pΗ of approximately 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filtration and dried. The crude product was chromatographed on silica gel with 1% methanol in chloroform to give, the title compound. The sodium salt of the title compound was prepared according to the procedure of Example ID. 1Η NMR (300 MHz, DMSO-de) δ ppm 0.06 (m, 2 H) 0.36 (m, 2 H) 0.96 (m, 1 H) 2.92 (d, J=6.99 Hz, 2 H) 6.75 (s, 1 H) 7.53 (d, J=5.52 Hz, 1 H) 7.55 (m, 1 H) 7.63 (d, J=8.09 Hz, 1 H) 7.77 (m, 1 H) 7.92 (d, J=7.72 Hz, 1 H) 8.33 (d, 1=5.52 Hz, 1 H) 14.19 (s, 1 H) 14.82 (s, 1 H). MS (ESI-) m/z 415 (M-H)".
Example 304A 4-(benzyloxy)-2-fluoro-l -nitrobenzene 3-Fluoro*-4-nifro-phenol (10 g, 0.064 mol) was reacted with benzyl bromide (8.3 ml,
0.070 mol), cesium carbonate (22.7 g, 0.07 mol), and tetrabutyl ammonium iodide (0.05 g) in N,N-dimethylformamide (100 mL) at 25°C for 18 hr. The reaction mixture was poured into distilled water (500 mL) and stirred for 10 minutes. The reaction mixture was extracted with ethyl acetate (3 X 200 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered and solvent removed under reduced pressure to give the title compound as a light yellow solid (15 g). 1H NMR (300 MHz, DMSO-d6) δ ppm 5.27 (s, 2 H) 7.06 (dd, 7=9.56, 2.57 Hz, 1 H) 7.29 (dd, 7=13.60, 2.57 Hz, 1 H) 7.44 (m, 5 H) 8.17 (t, 7=9.19 Hz, 1 H). ESI m/z (M+H)+: 248
Example 304B
4-(benzyloxy)-2-(benzylthio)-l-nitrobenzene A slurry of the product of Example 304A (15g, 0.061 mol) in ethanol (100 mL), was
-315- treated with sodium carbonate (6.41 g, 0.061 mol) and benzyl mercaptan (7.5 mL, 0.058 mol) in water (50 mL). The reaction mixture was refluxed for 5 hours, cooled to 25°C and poured into of distilled water (800 mL). The resulting slurry was stirred forl hour at 25°C and filtered. The resulting yellow solid was washed with water and dried in a vacuum oven at 50°C to give the title compound (20.53 g). 1H NMR (300 MHz, DMSO-d6) δ ppm 4.35 (s, 2 H) 5.27 (s, 2 H) 7.02 (dd, 7=9.19, 2.57 Hz, 1 H) 7.16 (d, 7=2.57 Hz, 1 H) 7.40 (m, 10 H) 8.24 (d, 7=9.19 Hz, 1 H). ESI m/z (M+H)+: 352
Example 304C 5-(benzyloxy)-2-nitrobenzenesulfonamide
A slurry of the product of Example 304B (5g, 0.014 mol) in glacial acetic acid (50 mL) and water (5.5 mL) at 0 C was bubbled with chlorine gas for 10 minutes, and stirred for an additional 30-45 minutes. The reaction mixture was poured into ice water (200 g), stirred for 30 minutes, and extracted with dichloromethane (2 X 100 mL). The combined dichloromethane extracts were cooled in an ice bath to approximately 5°C and concentrated aqueous ammonium hydroxide (40 mL) was added slowly resulting in foaming and bubbling as the ammonia was added. After 30 minutes, the bubbling subsided, and the organic layer was separated and the aqueous layer was extracted with dichloromethane (100 ml). The combined organic extracts were washed with IN phosphoric acid (50 mL), brine, dried over anhydrous magnesium sulfate, filtered and the solvent removed under reduced pressure to give the title compound as a white solid (3.85 g). 1H NMR (300 MHz, DMSO-d6) δ ppm 5.28 (s, 2 H) 7.44 (m, 6 H) 7.63 (d, 7=2.94 Hz, 1 H) 7.79 (s, 2 H) 8.01 (d, 7=8.82 Hz, 1 H). ESI m/z (M+H)+ 309.
Example 304D ' :
2-amino-5-(benzyloxy)benzenesulfonamide The product of Example 304C (3.85 g, 0.0125 mol) was treated with iron powder (4.3 g, 0.077 mol, 6.15 equivalent) and ammonium chloride (4.4 g, 0.082 mol) in methanol (100 mL) and water (50 mL), and stiπed at reflux for 1 hour. The hot reaction mixture was filtered through fluted filter paper and washed with hot methanol. The filtrate was concentrated under reduced pressure to a white semi-solid that was partitioned between ethyl acetate and water. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and the solvent removed under reduced pressure to give -the title compound as a off white solid (2.5 g). 1H NMR (300 MHz, DMSO-de) δ ppm 4.98 (s, 2 H) 5.46 (s, 2 H) 6.76 (d, 7=8.82 Hz, 1 H) 7.01 (dd, 7=8.82, 2.94 Hz, 1 H) 7.21 (d, 7=2.94 Hz, 1 H) 7.23 (s, 2 H) 7.37 (m, 5 H). ESI m/z (M+H)+ 279. ESI m/z (M-H)" 277.
-316- Example 304E l-amino-N-r2-(aminosulfonyl)-4-(benzyloxy)phenyll-4-hvdroxy-2-oxo-l,2- dihydroquinoline-3-carboxamide The products of Example 304D (4.0g, 14.37 mmol) and Example 226C (2.42 g, 7.20 mmol) in toluene (50 mL) were reacted at 118°C for 4 hours. The mixture was filtered while still warm and the solid dried to yield the title compound (3.13 g, 90%). MS (ESI-) m/z 479 (M-H)'. 1H NMR (300 MHz, DMSO-d6) δ ppm 5.20 (s, 2 H) 5.76 (s, 2 H) 7.40 (m, 10 H) 7.84 (m,"a H) 8.02 (d, 7=8.46 Hz, 1 H) 8.10 (dd, 7=8.09, 1.47 Hz, 1 H) 12.31 (s, 1 H) 16.41 (s, 1 H). .
Example 304F , l-amino-3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-4-hydroxyquinolin-
2(lH)-one The product of Example 304E (3.13 g, 6.51 mmol) was suspended in 10% potassium hydroxide solution (50 mL), heated at 125°C for 24 hours then at 140°C for 24 hours. The mixture was poured into ice and 1 M hydrochloric acid, filtered, and dried to give the title compound (2.03 g, 67%). MS (ESI-) m/z 461 (M-Η)'. JΗ NMR (300 MHz, DMSO-d6) δ ppm 5.18 (s, 2 H) 5.33 (s, 2 H) 7.06 (m, 1 H) 7.25 (m, 3 H) 7.43 (m, 6 H) 7.69 (d, 7=7.72 Hz, 1 H) 8.06 (d, 7=8.09 Hz, 1 H) 16.31 (s, 1 H).
Example 304G 3-r7-(benzyloxy)-l,l-dioxido-4H-L2,4-benzothiadiazin-3-vn-l-(cvclobutylideneamino)-4- hydroxyquinolin-2(lH)-one The product of Example 304F (0.285 g, 0.62 mmol) in N,N-dimethylacetamide (1.5 mL) was reacted with cyclobutanone (0.85 mL, 10.9 mmol) in a sealed tube in a microwave- reactor at 130°C for 45 minutes. The reaction was cooled to 25°C, concentrated under a stream of nitrogen warmed through a manifold heated to 165°C and the resulting residue was triturated with diethyl ether to give the title compound (0.178g, 56%).
■ Example 304Η
3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-l-(cyclobutylamino)-4- hydroxyquinolin-2(lH)-one
The product of Example 304G (0.178 g, 0.35 mmol) in tetrahydrofuran (3 mL) at 0°C was treated with methanol (0.025 mL, 0.70 mmol), followed by dropwise addition of a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.260 mL, 0.52 mmol), stiπed at 25°C for one hour, and diluted with 1 N ΗC1. The resulting precipitate was filtered and dried. The solid was dissolved in tetrahydrofuran and absorbed onto silica gel by evaporating to dryness.
-317- The resulting silica was loaded onto a 2g Alltech sep pack and eluted with dichloromethane to give the title compound (0.059 g, 33%). MS (ESI-) m/z 515 (M-H)". 1H NMR (300 MHz, DMSO-de) δ ppm 1.55 (m, 1 H) 1.71 (m, 1 H) 2.04 ( , 4 H) 3.77 (m, 1 H) 5.26 (s, 2 H) 6.57 (d, J=5.15 Hz, 1 H) 7.45 (m, 8 H) 7.64 (d, J=9.56 Hz, 1 H) 7.88 (m, 1 H) 8.05 (d, J=8.46 Hz, 1 H) 8.17 (m, 1 H).
Example 3041 l-(cyGlobutylamino)-4-hydroxy-3-(7-hydroxy-l , 1 -dioxido-4H-l ,2,4-benzothiadiazm-3- yl)quinolin-2( lH)-one The product of Example 304Η (0.059 g, 0.11 mmol) in tetrahydrofuran (4 mL) was reacted with platinum oxide (50 mg) under hydrogen atmosphere at 25°C for 20 hours. The catalyst was filtered off and the filtrate evaporated to give the title compound (0.048 g, 100%). MS (ESI-) m/z 425 (M-H)".
Example 304J
2-(|3-fl-(cvclobutylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yn-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yl 1 oxy)acetamide The product of Example 3041 (0.048 g, 0.11 mmol) in N,N-dimethylformamide (2 mL) was reacted with cesium carbonate (0.15 g, 0.45 mmol), bromoacetamide (0.026 mL, 0.18mmol), and a catalytic amount of tetrabutylammonium iodide at 25°C for 3 hours. The reaction was concentrated under a stream of nitrogen stream of nitrogen warmed through a manifold heated to 165°C and the resulting residue was triturated with water, filtered and dried. The resulting solid was triturated in hot ethyl acetate, filtered, and dried to give the title compound (0.020 g, 37%). MS (ESI-) m/z 482 (M-Η)". l_i NMR (300 MHz, DMSO- d6) δ ppm 1.59 (m, 2 H) 1.99 (m, 4 H) 3.60 (m, 1 H) 4.49 (s, 2 H) 6.08 (d, J=6.62 Hz, 1 H) : 7.05 (t, J=7.17 Hz, 1 H) 7.20 (m, 3 H) 7.40 (s, 1 H) 7.50 (m, 1 H) 7.65 (m, 2 H) 8.05 (d, J=7.72 Hz, 1 H) 16.25 (s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 1.59 (m, 1 H) 1.99 (m, 4 H) 3.61 (m, 2 H) 4.49 (s, 2 H) 6.08 (d, J=6.62 Hz, 1 H) 7.05 (m, 1 H) 7.21 (m, 2 H) 7.40 (s, 2 H) 7.50 (m, 1 H) 7.64 (m, 2 H) 8.06 (dd, J=7.91, 1.29 Hz, 1 H) 8.32 (s, 1 H).
Example 305A 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-l-(cyclopentylideneamino)-4-
-318- hydroxyquinolin-2( lH)-one The product of Example 304F (0.284 g, 0.61 mmol) and cyclopentanone (0.80 mL, 9.04 mmol) in N,N-dimethylacetamide (2 mL) were reacted at 130°C for 40 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.210 g, 65%). *Η NMR (300 MHz, DMSO-dg) δ ppm 1.72 (m, 2 H) 1.87 (m, 2 H) 2.16 (m, 2 H) 2.71 (m, 2 H) 5.18 (s, 2 H) 7.31 n, 11 H) 8.10 (d, 7=8.46 Hz, 1 H) 16.22 (s, 1 H).
\ Example 305B
3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-l-(cvclopentylamino)-4- hydroxyquinolin-2( lH)-one
The produce of Example 305A (0.21 g, 0.40 mmol) in tetrahydrofuran (3 mL) and methanol (0.030 mL) at 0°C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.30 mL, 0.60 mmol). The reaction was stiπed at 25°C for 1 hour then diluted with 1 M aqueous hydrochloric acid and filtered. The product was purified by dissolving in tetrahydrofuran, absorbing onto silica gel, loading onto a 2g Alltech Sep-pack and eluting with dicholomethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.124 g. 59%). 1H NMR (300 MHz, DMSO-d6) δ ppm 1.54 (m, 4 H) 1.79 (m, 2 H) 2.55 (m, 2 H) 3.94 (m, 1 H) 5.26 (s, 2 H) 6.23 (m, 7=6.99, 4.04
Hz, 1 H) 7.43 (m, 8 H) 7.69 (d, 7=6.99 Hz, 1 H) 7.87 (m, 1 H) 8.09 (d, 7=8.09 Hz, 1 H) 8.16
(d, 7=6.62 Hz, 1 H) 14.08 (s, 1 H) 15.18 (s, 1 H).
Example 305C l-(cvclopentylamino)-4-hydroxy-3-(7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)quinolin-2( 17J)-one The product of Example 305B (0.122 g, 0.23 mmol) in tetrahyrofuran (15 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon, and ammonium formate (0.080 g, 1.27 mmol) at 60°C for 2 hours. The warm reaction mixture was filtered through celite and the filtrate was evaporated under reduced pressure to give the title compound (0.10g, 100%). MS (ESI-) m/z 439 (M-Η)". XΗ NMR (300 MHz, DMSO-dQ) δ ppm 1.54 (m, 4 H) 1.78 (m, 7=2.94 Hz, 2 H) 2.58 (m, 2 H) 3.91 (m, 1 H) 6.25 (m, 1 H) 7.13 (m, 2 H) 7.45 (m, 1 H) 7.54 (d, 7=9.19 Hz, 1 H) 7.85 (m, 1 H) 8.12 (m, 2 H) 10.45 (s, 1 H) 14.00 (s, 1 H) 15.25 (s, 1 H).
Example 305D 2-( { 3-r 1 -(cyclopentylamino)-4-hvdrox V-2-OXO- 1 ,2-dihydroquinolin-3-vn- 1 , 1 -dioxido-4H-
-319- 1 ,2,4-benzothiadiazin-7-yl I oxy)acetamide The product of Example 305C (0.10 g, 0.23 mmol) was reacted with cesium carbonate (0.30 g, 0.92 mmol), 2-bromoacetamide (0.050 g, 0.37 mmol) and a catalytic amount of tetrabuylammonium iodide in N,N-dimethylformamide (5 mL) at 25 °C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting solution was diluted with water and the precipitate was collected by filfration and dried to give the title compound (0.095 g, 85%). MS (ESP) m/z 496 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (500 MHz, DMSO-d6) δ ppm 1.52 (m, 6 H) 1.76 (m, 2 H) 3.70 (m, 1 H) 4.47 (s, 2 H) 5.68 (d, 7=4.88 Hz, 1 H) 7.03 (t, 7=7.63 Hz, 1 H) 7.20 (m, 5 H) 7.46 (t, 7=7.32 Hz, 1 H) 7J0 (d, 7=8.54 Hz, 1 H) 8.06 (d, 7=7.32 Hz, 1 H) 16.15 (s, 1 H).
Example 306A 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl1-l-(cyclohexylideneamino)-4- hydroxyquinolin-2(lH)-one The title compound was prepared according to the procedure as described in Example 304G, substituting cyclohexanone for cyclobutanone.
Example 306B 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll-l-(cvclohexylamino)-4- hydroxyquinolin-2(lH)-one The title compound was prepared according to the procedure described in Example
304Η, substituting the product of Example 306 A for the product of Example 304G (0.11 g, 78%).
Example 306C l-(cvclohexylamino)-4-hvdroxy-3-(7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)quinolin-2( lHVone The title compound was prepared according to the procedure of Example 305C substituting the product of Example 306B for the product of Example 305B (39 mg, 42%).
Example 306D
2-({3-ri-(cvclohexylamino)-4-hvdroxy-2-oxo-1.2-dihvdroquinolin-3-vn-l.l-dioxido-4H- l,2,4-benzothiadiazin-7-ylloxy)acetamide
-320- The product of Example 306C (13 mg, 0.028 mmol) in N,N-dimethylformamide (5 mL) was reacted with cesium carbonate ( 0.0137g, 0.114 mol) and 2-bromoacetamide (0.008g, O.058mmol) according to the procedure as described in Example 304J to give the title compound. The sodium salt was prepared according to the procedure of Example ID (7 5 mg, 48%). Η NMR (300 MHz, DMSO-d6) δ ppm 1.36 (m, 10 H) 2.96 (bs, 1 H) 4.49 (s, 2 H) 5.67 (d, J=4.04 Hz, 1 H) 7.04 (t, J=7.54 Hz, 1 H) 7.20 (m, 3 H) 7.40 (s, 1 H) 7.47 (m, 1 H) 7.62 (s, 1 H) 7.74 (d, J=8.46 Hz, 1 H) 8.05 (d, J=6.62 Hz, 1 H) 16.26 (s, 1 H). (ESI-) m/z 510 (M-H)", m/z 532 (M+Na-H)".
lό Example 307
4-r(2-chloro-1.3-thiazol-5-yl)methvn-7-hvdroxy-6-(7-hvdroxy-l.l-dioxido-4H-1.2.4- benzothiadiazin-3-yl)thienor3,2-b1pyridin-5(4H)-one
Example 307A 15 Ethyl r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl1acetate
The title compound was prepared according to the procedure of Example IC substituting the product of Example 304D for 2-amino-benzenesulfonamide.
Example 307B 20 Ethyl (7-hvdroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yI)acetate
The product of Example 307A (1.42 g, 3.79 mmol) in tetrahydrofuran (60 mL) was reacted with 10% palladium on carbon (0.2 g) under hydrogen atmosphere for 16 hours at 25°C. The reaction mixture was filtered and concentrated under reduced pressure to an oil. The residue was purified on silica gel eluting with ethyl acetate to give the title compound as 25 of a white solid (0.8 g).
Example 307C Ethyl ( l,l-dioxido-7-r(triisopropylsilyl)oxy1-4H-1.2,4-benzothiadiazin-3-yl lacerate The product of Example 307B (0.1 g, 0.352 mmol) was reacted with 2,6-lutidine 30 (0.045 mL, 0.387 mmol) and triisopropyl trifluoromethanesulfonate (0.1 mL, 0.387 mmol) in dichloromethane (10 mL) at 5 C for 3 hours. The reaction was diluted with dichloromethane and exfracted with aqueous IN phosphoric acid. The organic layer was washed with brine and dried over anhydrous magnesium sulfate, filtered and concentrated under reduced pressure to give the title compound as a light yellow solid (0.13 g, 84%). 5
Example 307D 4- IY2-Chloro- 1 ,3-thiazol-5-yl)methyll -6- ( 1. l-dioxido-7- lϊtriisoprop ylsilyl)oxy1-4H-l ,2.4-
-321- benzothiadiazin-3-yll-7-hydroxythienor3,2-£'lpyridin-5(4H)-one The title compound was prepared according to the procedure of Example ID substituting the product of Example 140A for the product of Example IB and substituting the product of Example 307C for the product of Example IC (0.29 g, 66%). MS (ESI-) m/z 649 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ ppm 1.09 (d, 7=7.35 Hz, 18 H) 1.28 ( , 3 H) 5.63 (s, 2 H) 7.22 (d, 7=2.57 Hz, 1 H) 7.31 (dd, 7=8.82, 2.94 Hz, 1 H) 7.65 (d, 7=8.82 Hz, 1 H) 7.86 (d, 7=5.52 Hz, 1 H) 7.95 (s, 1 H) 8.42 (d, 7=5.52 Hz, 1 H) 14.05 (s, 1 H) 14.96 (s, 1 H). '
Example 307E
4-r(2-chloro-l,3-thiazol-5-yl)methvn-7-hvdroxy-6-(7-hydroxy-l,l-dioxido-4H-L2,4- benzothiadiazin-3-yl)tfrienoF3,2-blpyridin-5(4H)-one The product of Example 307D (0.235g 0.36mmol.) in tetrahydrofuran (lOmL) was reacted with tetrabutylamonium fluoride in tetrahydrofuran (IM, 0.43mL) at 25°C for 2 hours. The reaction mixture was diluted with water (50 mL) and adjusted to pΗ 2 with 1 M ΗC1 and extracted with ethyl acetate. The organic layer was concentrated under reduced pressure to give the title compound (0.15g, 84%). MS (ESI-) m/z 493 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *Η NMR (300 MHz, DMSO-d6) δ ppm 5.63 (s, 2 H) 7.17 (s, 1 H) 7.20 (d, 7=2.57 Hz, 1 H) 7.57 (d, 7=8.82 Hz, 1 H) 7.85 (d, 7=5.52 Hz, 1 H) 7.95 (s, 1 H) 8.42 (d, 7=5.15 Hz, 1 H) 10.42 (s, 1 H) 13.95 (s, 1 H) 15.10 (s, 1 H).
Example 308 2-r(3-{4-r(2-chloro-1.3-thiazol-5-yl)methyn-7-hvdroxy-5-oxo-4,5-dihvdrothienol3,2- b1pyridin-6-yl}-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxylacetamide
The product of Example 307E (0.065g, 0.13 mmol.) in N,N-dimethylformamide (5 mL) was reacted with cesium carbonate (0.171g, 0.53 mmol) and 2-bromoacetamide (0.036g, 0.26 mmol) at 25°C for 24 hrs. The reaction mixture was diluted with water and the resulting precipitate was collected by filtration to give the title compound (0.036 g, 50%). MS (ESI-) m/z 550 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. lK NMR (300 MHz, DMSO-de) δ ppm 4.60 (s, 2 H) 5.63 (s, 2 H) 7.38 (t, 7=2.21 Hz, 1 H) 7.42 (d, 7=2.94 Hz, 1 H) 7.44 (s, 1 H) 7.69 (d, 7=8.46 Hz, 1 H) 7.66 (s, 1 H) 7.85 (d, 7=5.52 Hz, 1 H) 7.95 (s, 1 H) 8.42 (d, 7=5.52 Hz, 1 H) 14.04 (s, 1 H) 14.99 (s, 1 H).
-322- Example 309A l-Benzyl-4-hydroxy-lH-quinolin-2-one The title compound was prepared according to the procedure as described in D. R. Buckle, B. C. Cantello, H. Smith, B. A. Spicer, Journal of Medicinal Chemistry, 1_8, 726- 732 (1975).
Example 309B l-Benzyl-3-(bis-methylsulfanyl-methylene)-lH-quinoline-2,4-dione A suspension of sodium hydride (0J5 g, 16 mmol.) in N,N-dimethylformamide (20 mL) at 0°C was added a solution of the product of Example 309A (2 g, 7.97 mmol) in N,N- di ethylformamide (30 mL) over 30 minutes. The red-orange mixture was warmed to 25°C and stirred for 30 minutes as a violet color developed. The reaction was then heated at 50°C for 2 hours and cooled to 25°C over 30 minutes. Carbon disulfide (1.13 mL, 16 mmol) was added to the mixture. The mixture was heated at 50°C for 2 hrs (red-brown color developed) and cooled to 25°C. Methyl iodide (1.2 mL, 16 mmol) was added and the reaction was stiπed at 25°C for 30 minutes. The reaction was quenched with phosphate buffer (10 mL, pH = 7) and the reaction was concentrated under reduced pressure. The residue was triturated with pH 7 phosphate buffer and ethyl acetate/hexanes (1:1), the resulting orange solids were collected by filtration, washed with hexanes and dried under reduced pressure to give the title compound (1.76 g, 62%). 1H NMR (300 MHz, CDC13) δ ppm 2.65 (s, 6 H) 5.43 (s, 2 H) 7.06 (d, 7=8.46 Hz, 1 H) 7.14 (m, 1 H) 7.28 (m, 5 H) 7.43 (m, 1 H) 8.24 (dd, 7=7.72, 1.47 Hz, 1 H).
Example 309C ; methyl 4-p enzylthio)-5-nitrothiophene-3-carboxylate The title compound was prepared according to the procedure as described in Stanetty, P. et. al, Journal of Heterocyclic Chemistry, 36, 761-765 (1999).
Example 309D r4-(benzylthio)-5-nitrothien-3-yl1methanol The product of Example 309C (5g, 16.2 mmol) in dichloromethane (150 mL) at -40°C was reacted with diisobutylaluminum hydride (1 M in dichloromethane, 36 mL, 2.2 equivalents) added dropwise. The reaction was stirred for 15 minutes after complete addition, quenched with 10% aqueous sodium potassium tartrate solution and stiπed at 25°C for 1 hour. The organic layer was separated, filtered through celite ® (diatomaceous earth) and the filtrate was concentrated under reduced pressure. The resulting oil was purified by
-323- flash chromatography on silica gel with a Biotage-40s column eluting with 2:98 methanol dichloromethane to give the title compound as an oil, (4.32 g, 95%). 1H NMR (300 MHz, CDC13) δ ppm 4.21 (s, 2 H), 4.39 (s, 2 H), 7.11 (m, 3 H), 7.23 (m, 2 H) 7.40 (s, 1 H).
Example 309E
3-(benzylthio)-4-r(methoxymethoxy)methyn-2-nitrothiophene The product of Example 309D (3.9g, 13.9 mmol) in dichloromethane (8 mL) was reacted With diisopropylethylamine (7.42 mL, 3 equivivalents) and methoxymethyl chloride (2.38 mL, 2.25 equivalents) at 25°C 16 hours. The reaction was concentrated under reduced pressure and the residue purified by flash chromatography on silica gel using a Biotage-40m column eluting with dichloromethane to give the title compound as a yellowish oil, (4.32 g, 94%). 1H NMR (300 MHz, CDC13) δ ppm 3.36 (s, 3 H), 4.20 (s, 2 H), 4.34 (s, 2 H), 4.62 (s, 2 H), 7.13 (m, 3 H), 7.21 (m, 2 H), 7.40 (s, 1 H).
Example 309F
4-r(methoxymethoxy)methyl1-2-nitrothiophene-3-sulfonamide The product of Example 309E (4g, 12.3 mmol) in dichloromethane (70 mL) and 1 N aqueous hydrochloric acid (35mL) at 0°C was reacted with chlorine gas bubbled in slowly over a period of 0.5 hour, then stirred for an additional 1 hour. The reaction mixture was purged with nitrogen gas to remove excess chlorine and treated with solid sodium bisulfite (Il g) added slowly to the mixture with stirring for 5 minutes. Dichloromethane (15 mL) and water (15 mL) were added, the organic layer was separated and eluted through 40g of 50:50 mixture of MgSO /Na2S04. The filtrate was concentrated under reduced pressure. A solution of the concentrate (4.7 g) in dichloromethane (100 mL) at -40°C was bubbled with ammonia gas over a period of 10 minutes. The reaction mixture was stiπed for an additional 15 minutes, purged with nitrogen gas to dispel the excess ammonia and concentrated under reduced pressure. The concentrate was purified by flash chromatography on silica gel using a Biotage-40s column eluting with 5:95 methanol/ dichloromethane to give the title compound as an oil (2.3 g, 66%). 1H NMR (300 MHz, CDC13) δ ppm 3.31 (m, 3 H), 4J0 (s, 2 H), 4.73 (s, 2 H), 7.85 (m, 2 H), 7.88 (s, 1 H).
Example 309G 2-amino-4-r(methoxymethoxy)methyllthiophene-3-sulfonamide The product of Example 309F (1.8 g, 6.4 mmol) was reacted with iron powder (1.43 g, 4 equivalents) in acetic acid (70 mL) at 50°C for 7.5 hours then concentrated under reduced pressure. A slurry of the residue in 5% methanol/dichloromethane (60mL) and water (6 mL) was filtered through silica gel (20 g) and further rinsed with 5%
-324- methanol/dichloromethane (300mL). The filtrate was concentrated under reduced pressure and the residue purified by flash chromatography on silica gel using a Biotage-12s column eluting with 2.5:97.5 methanol: dichloromethane to give the title compound (lg, 62%). ]H NMR (300 MHz, DMSO-d6) δ ppm 3.30 (s, 3 H), 4.53 (s, 2 H), 4.66 (s, 2 H), 6.28 (s, 1 H), 6.61 (s, 2 H), 6.94 (s, 2 H).
Example 309H 1 -Bfenzyl-4-hvdroxy-3- { 7- r(methoxymethoxy)methyll- 1 , 1 -dioxido-4H-thieno f2.3- eiri,2,41thiadiazin-3-yllquinolm-2(lH)-one The product of Example 309G (35 mg, 0.14 mmol) and the product of Example 309B
(50 mg, 0.14 mmol) were reacted in toluene (3 mL) at 100°C for 3 hours. The resulting precipitate was collected by filtration and washed with toluene and diethyl ether to give the title compound (52 mg, 73.3%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d5) δ ppm 3.26 (s, 3 H), 4.65 (s, 2 H), 4.72 (s, 2 H), 5.62 (s, 2 H), 7.28 (m, 7 H), 7.43 (s, 2 H), 7.51 (d, J=8.09 Hz, 1 H), 7.75 (m, 1 H), 8.22 (d, J=8.09 Hz, 1 H).
Example 310 l-Benzyl-4-hydroxy-3-r7-(hvdroxymethyl)-l , l-dioxido-4H-thienor2,3-el F 1 ,2,4]thiadiazin-3- vnquinolin-2(lH)-one
A suspension of the product of Example 309Η (46 mg, 0.09 mmol) in 6N aqueous hydrochloric acid (2.5 mL) and tetrahydrofuran (5 mL) was heated at 70°C for 4 hours, cooled to 25°C and let stand for 18 hours at room temperature. The resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound (39 mg, 92.8%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 4.63 (s, 2 H), 5.62 (s, 2 H), 7.31 (m, 6 H), 7.41 (t, J=7.72 Hz, 1 H), 7.53 (d, J=8.46 Hz, 1 H), 7J6 (t, J=7.91 Hz, 1 H), 8.22 (dd, J=8.09, 1.47 Hz, I H).
Example 3 HA
N-(tgrt-butyl)-5-chlorothiophene-2-suIfonamide The title compound was prepared according to the procedure as described in Unterhalt, B, Moghaddam, S. Pharmazie, 1994, 49, 115-117.
Example 31 IB
3-azido-N-(tgrt-butyl)-5-chlorothiophene-2-sulfonamide A solution of Example 311A (1.01 g, 3.99 mmol) in tetrahydrofuran (32 mL) at -78°C
-325- was treated with dropwise addition of sec-BuLi (1.4 M in hexane, 2.1 equivalents). The reaction was warmed to -20°C and stirred for 30 minutes, treated with a solution of tosyl azide (1.1 equivalent) in tetrahydrofuran (7 mL) at -20 C, stirred at 25°C for 18 hours. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concenfrated. The residue was purified by column chromatography on silica gel, eluting with a gradient of 30% dichloromethane in hexane to 100% dichloromethane to give approximately a 2:1 mixture of starting material to the title compound.
Example 3 llC
3-Amino-5-chloro-N-isopropylthiophene-2-sulfonamide A solution of the product of Example 1 IB (0.739 g) in toluene (20 mL) and hexadecyltributylphosphonium bromide (0.128 g, 0.25 mmol) at 0°C was treated dropwise with a solution of sodium borohydride (0.109 g, 2.9 mmol) in water (0.80 mL). The reaction was stiπed at 25°C for 18 hours and at 5 °C for 72 hours. The reaction was extracted with ethyl acetate. The organic layer was washed'with IN aqueous sodium hydroxide, water, and brine and dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by column chromatography on silica gel, eluting with a gradient of 1:1 hexanes/dichloromethane to 100 % dichloromethane to give the title compound (0.252 g, 23%). 1H ΝMR (300 MHz, CDC13) δ ppm 6.36 (s, 1 H) 4.93 (br s, 2 H) 4.60 (br s, 1 H) 1.30 (s, 9 H).
Example 3 HP 3-Amino-5-chloro-N-isopropylthiophene-2-sulfonamide, trifluoroacetate salt The product of Example 31 IC (0.0998 g) in trifluoroacetic acid (3.9 mL) was stiπed at 25°C for 18 hours. The reaction was concentrated under reduced pressure and azeotroped three times with ethyl acetate to give the title compound as a trifluoroacetate salt (0.160 g). 1H ΝMR (300 MHz, CDC13) δ ppm 6.41 (s, 1 H) 5.22 (br s, 2 H) 4.84 (br s, 2 H).
Example 3 HE l-Benzyl-3-(6-chloro-l,l-dioxido-4H-thienor3.2-gin.2.41thiadiazin-3-yl)-4- hydroxyquinolin-2( 1 H)-one The title compound was prepared according to the procedure of Example 309Η, substituting the product of Example 31 ID for the product of Example 309G, in the presence of diisopropylethylamine (3 equivalents). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H ΝMR (300 MHz, DMSO-d6) δ ppm 16.97 (s, 1 H) 8.11 (d, 7=8.09 Hz, 1 H) 7.20 (m, 9 H) 5.40 (s, 2 H).
• -326- Example 312A 5-Bromo-4-nitro-iH-imidazole 4-Bromo-lΗ-imidazole (2.0 g, 13.6 mmol) was reacted with concentrated nitric acid (0.947 mL, 14.96 mmol) in concentrated sulfuric acid (20 mL) at 110 °C for 1 hour. The reaction was cooled to 25°C and poured into 200 mL of ice water. The resulting white precipitate formed was collected by filtration to give the title compound (2.3 g, 87%). MS (ESI-) m/z 191 (M-H)-. IH NMR (300 MHz, DMSO-d6) δ ppm 7.99 (s, IH).
Example 312B l-Benzyl-5-bromo-4-nitro-lH-imidazole A solution of the product of Example 312A (2.3 g, 11.98 mmol) in anhydrous N,N- dimethylformamide (40 mL) at 25°C was reacted with sodium bicarbonate (2.0 g, 24 mmol) and dropwise addition of benzyl bromide (1.58 mL, 13.17 mmol). The reaction was stiπed for an additional 12 hours at 25°C. The reaction was concentrated under reduced pressure and the residue was partitioned between ethyl acetate and water. The organic layer was dried over MgSO , filtered, and concentrated under reduced pressure. The residue was purified by reverse phase column chromatography on a C18 column, eluting with a gradient of acetonitrile in water containing 0.1% trifluoroacetic acid (5:95 to 100) to give the title compound (1.63 g, 48%). MS (ESI+) m/z 284 (M+Η)+. IH NMR (300 MHz, DMSO-de) δ ppm 5.38 (s, 2H), 7.24-7.42 (m, 5H), 8.28 (s, IH).
Example 312C ammonium 1 -benzyl-4-nitro- lH-imidazole-5-thiolate
A solution of the product of Example 312B in 5N ammonium hydroxide (16 mL) and dioxane (10 mL) at 35° C was bubbled with hydrogen sulfide gas for 15 minutes. The reaction flask was then sealed and stirring was continued for 1 hour. The reaction was purged with nitrogen gas for 10 minutes and concentrated under reduced pressure to give the title compound.
Example 312D l-benzyl-4-nitro-lH-imidazole-5-sulfonyl chloride A solution of the product of Example 312C in IN ΗC1 (20 mL) and dioxane (10 mL) at 30° C was bubbled with chlorine gas for 15 minutes. The reaction flask was sealed and the reaction mixture stirred for 1 hour. The chlorine addition was repeated as above and the reaction mixture stiπed for an additional 1 hour. The reaction was cooled in an ice bath.
-327- Cold water was added to the reaction and the resulting precipitate was collected by filtration to give the title compound (1.51 g, 87% for 2 steps). IH NMR (300 MHz, DMSO-d6) δ ppm 5.57 (s, 2H), 7.27-7.40 (m, 5H), 7.74 (s, IH).
Example 312E l-benzyl-4-nitro-lH-imidazole-5-sulfonamide A solution of the product of Example 312D (1.5 g, 4.97 mmol) in dioxane (25 mL) at 25°C was/bubbled with ammonia gas for 10 minutes. The reaction flask was sealed and the reaction mixture was stiπed an additional 30 minutes. This above process was repeated. The reaction mixture was concentrated under reduced pressure and the residue was washed with cold water several times to give the title compound (1.27 g, 90%). MS (ESI-) m/z 281 (M- Η)\ XH NMR (300 MHz, DMSO-de) δ ppm 5.61 (s, 2H), 7.26-7.42 (m, 5H), 8.17 (s, IH).
Example 312F 4-amino-l-benzyl-lH-imidazole-5-sulfonamide
A solution of the product of Example 312E (434 mg, 1.54 mmol) in acetic acid (4.3 mL) and dioxane (4.3 mL) was reacted with iron powder (343 mg, 6.15 mmol) at 50°C for 3 hours. The reaction mixture was cooled to 25°C, filtered through a pad of celite® (diatomaceous earth) and the filtrate was concentrated under reduced pressure. The residue was dissolved in dichloromethane and washed with a saturated aqueous sodium bicarbonate solution. The aqueous layer was extracted with dichloromethane (2x) and the combined organic layers were dried over magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on silica gel using a gradient of methanol in dichloromethane (0-5%) to give the title compound (180 mg, 46%). MS (ESI+) m/z 253 (M+Η)+. 1H NMR (300 MHz, DMSO-de) δ ppm 5.24 (s, 2H), 7.22-7.39 (m, 5H), 7.43 (s, IH). '
Example 312G l-benzyl-3-(7-benzyl-l,l-dioxido-4,7-dihydroimidazor4,5-eiπ,2,41thiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one
The product of Example 312F (152 mg, 0.602 mmol) was reacted with the product of Example 309B (214 mg, 0.602 mmol) in toluene (8 mL) at 100°C for 3 hours. The reaction was allowed to cool to 25°C and diluted with hexanes. The resulting precipitate was collected by filfration. The residue was chromatographed on silica gel, eluting with gradient of 0 - 2% methanol in dichloromethane to give the title compound (155 mg, 50%). MS
(ESI+) m/z 512 (M+Η)+. IH NMR (300 MHz, DMSO-d6) δ ppm 5.42 (s, 2H), 5.63 (s, 2H), 7.22-7.44 (m, 11H), 7.53-7.56 (m, IH), 7.74-7.79 (m, IH), 8.20-8.23 (dd, 1=8.1, 1.5 Hz, IH),
-328- 8.32 (s, IH).
Example 313 l-benzyl-3-(l,l-dioxido-4J-dihydroimidazor4,5-eiri,2,41thiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one The product of Example 312 (19.35 mg, 0.0378 mmol) in anhydrous dimethyl sulfoxid©}(2.5 mL) was reacted with a solution of potassium tert-butoxide in tetrahydrofuran (IM, 0.265, mL, 0.265 mmol) at 25°C for 12 hours. The reaction was quenched by adding saturated aqueous ammonium chloride solution and extracted with dichloromethane. The aqueous layer was made basic with a sodium bicarbonate solution and extracted twice with dichloromethane. The combined organic layers were combined, dried over magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on a reverse phase C18 column eluting with 5% - 100% acetonitrile in water containing 0.1% trifluoroacetic acid to give the title compound (17 mg, 81%). MS (ESI-) m/z 420 (M-Η)". 1Η NMR (300 MHz, DMSO-d6)/CF3COOD) δ ppm 5.6 (s, 2H), 7.17-7.27 (m, 5H), 7.35- 7.40 (t, J=7.64 Hz, IH), 7.51-7.63 (d, J=8.3 Hz, IH), 7.69-7.73 (t, J=8.8 Hz, IH), 8.0-8.01 (m, IH), 8.18-8.20 (dd, J=8.3, 1.2 Hz, IH).
Example 314
N2-(3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yll-l,l-dioxido-
4H-1 ,2,4-benzothiadiaziri-7-yl I glycinamide A solution of the product of Example 206 (10.8 mg, 0.023 mmol) in concentrated sulfuric acid (0.6 mL) was treated with a slow addition of water (0.1 mL) and the yellow solution was stiπed at 25°C for 18 hours. The reaction mixture was poured onto ice, the pΗ was adjusted to pΗ 9 with 50% ΝaOΗ and aqueous sodium bicarbonate solution. The mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with water, brine, dried over magnesium sulfate and filtered. The filtrate concentrated under reduced pressure to give the title compound as a yellow solid (9.1 mg, 83%). MS (ESI-) m/z 483 (M-Η)". Η ΝMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, 7=6.62 Hz, 6 H) 1.49 (m, 2 H) 1.64 (m, 1 H) 3.63 (d, 7=5.52 Hz, 2 H) 4.30 (m, 2 H) 6.23 (br s, 1 H) 6.69 (s, 1 H) 6.87 (d, 7=7.35 Hz, 1 H) 7.12 (s, 3 H) 7.42 (s, 1 H) 8.36 (d, 7=7.35 Hz, 1 H) 8.52 (s, 1 H) 15.62 (br s, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H ΝMR (300 MHz, DMSO-d6) δ ppm 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 3.62 (d, J=5.88 Hz, 2 H) 4.29 (m, 2 H) 6.20 (m, 1 H) 6.68 (d, J=2.57 Hz, 1 H) 6.86 (m, 1 H) 7.41 (m, 3 H) 8.35 (dd, J=7J2, 1.84 Hz, 1 H) 8.50 (dd, J=4J8, 1.84 Hz, 1 H) 15.63 (s, 1 H).
-329- Example 315 A l-butyl-4-hydroxy-1.8-naphthyridin-2(lH)-one A sluπy of the product of Example 89 A (3.24 g, 11.16 mmol) in 2 N sodium hydroxidf (100 mL) was heated at reflux for 3 hours, cooled to 10°C and treated dropwise with concentrated hydrochloric acid to a constant pΗ of 3. The resulting white solid was collected by filtration, washed with water and dried to give the title compound (2.47 g, quantitative). MS (APCI+) m/z 219 (M+Η)+. IH NMR (300 MHz, DMSO-de) δ ppm 0.90 (t, 7=7.35 Hz, 3 H) 1.32 (m, 2 H) 1.57 (m, 2 H) 4.31 (m, 2 H) 5.89 (s, 1 H) 7.27 (dd, 7=7.72, 4.78 Hz, 1 H) 8.23 (dd, 7=7.72, 1.84 Hz, 1 H) 8.64 (dd, 7=4.78, 1.84 Hz, 1 H) 11.61 (s, 1 H).
Example 315B
3-[bis(methylthio)methylene1-l-butyl-l,8-naphthyridine-2,4(lH,3H)-dione The title compound was prepared according to the procedure of Example 309B substituting the product of Example 315A for the product of Example 309A . 1H NMR (300 MHz, CDCC13) δ ppm 0.97 (t, 7=7.35 Hz, 3 H) 1.44 (dd, 7=15.44, 7.35 Hz, 2 H) 1.69 (m, 2 H) 2.64 (s, 6 H) 4.39 (m, 2 H) 7.10 (dd, 7=7.72, 4.78 Hz, 1 H) 8.45 (dd, 7=7.72, 1.84 Hz, 1 H) 8.56 (dd, 7=4.60, 2.02 Hz, 1 H).
Example 315C l-butyl-4-hydroxy-3-{7-r(methoxymethoχy)methyn-l,l-dioxido-4H-thienor2.3- eiri,2,41thiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one
The product of Example 309G (110 mg, 0.43 mmol) and the product of Example 315B (140.6 mg, 0.43 mmol) were reacted in toluene (5 mL) at 100°C for 3 hours. The reaction was concentrated under reduced pressure and the residue was purified by chromatography on silica gel using a Biotage-12m column eluting with 1:99 methanohdichloromethane to give the title compound as a white solid (114 mg, 54.6%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MΗz,CDCCl3) δ. ppm 1.00 (t, J=7.35 Hz, 3 H), 1.46 (m, 2 H), 1.74 (m, 2 H), 3.45 (s, 3 H), 4.56 (m, 2 H), 4.80 (s, 2 H), 4.84 (s, 2 H), 7.09 (s, 1 H), 7.26 (s, 1 H), 7.36 (dd, J=8.09, 4.41 Hz, 1 H), 8.57 (dd, J=8.09, 1.84 Hz, 1 H), 8.81 (dd, J=4.78, 1.84 Hz, 1 H), 15.06 (s, I H), 15.11 (s, I H).
Example 316
-330- l-butyl-4-hydroxy-3-r7-(hvdroxymethyl)-l,l-dioxido-4H-thienor2,3-gin,2,41thiadiazin-3- yll-1 ,8-naphthyridin-2(lH)-one The product of Example 315C (92 mg, 0.19 mmol) was reacted with 6N aqueous hydrochloric acid (4 mL) and tetrahydrofuran (8 mL) at 70°C for 3 hours. The reaction was concentrated under reduced pressure to remove the tetrahydrofuran, and freated with . methanol (5 mL). The resulting precipitate was collected by filtration and washed with water and diethylether to give the title compound as a white solid (65 mg, 77.8%). The sodium salt of the tifli compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, CDC13) δ ppm 1.00 (t, J=7.35 Hz, 3 H), 1.47 (dd, J=15.26, 7.54 Hz, 2 H), 1.73 ( , 2 H) 4.57 (m, 2 H), 4.86 (s, 2 H), 7.07 (s, 1 H), 7.37 (dd, J=8.09, 4J8 Hz, 1 H), 8.58 (dd, J=8.09, 1.84 Hz, 1 H), 8.82 (dd, J=4.60, 2.02 Hz, 1 H), 14.94 (s, 1 H), 15.24 (s, 1 H).
Example 317A methyl 4-(aminosulfonyl)-5-nitrothiophene-3-carboxylate A solution of the product of Example 309A (2g, 6.5 mmol) in dichloromethane (38 mL) and 1.5 N aqueous hydrochloric acid (21 mL) at 0°C was bubbled with chlorine gas over 30 minutes. The reaction flask was sealed and stirred for an additional 1 hour. Nitrogen gas was bubbled through the reaction to dispel the chlorine, followed by the addition of solid sodium bisulfite (5.12g) with stirring for 5 minutes. Dichloromethane (10 mL) and water (10 mL) were added to the reaction. The organic layer was separated and eluted through 20g of 1:1 mixture of magnesium sulfate and sodium sulfate. The filtrate was concentrated under reduced pressure, and the residue trituated with hexanes to give the sulfonyl chloride as a white solid (1.8 g, 97%). A solution of the crude sulfonyl chloride (1.5 g) in dichloromethane (15 mL) at -40°C was bubbled with ammonia gas over a period of 5 minutes. The reaction flask was sealed and stiπed for another 15 minutes. Nitrogen gas was bubbled into the reaction mixture to dispel the ammonia. The reaction was concentrated under reduced pressure while maintaining the temperature under 0°C. The residue was chromatographed on silica gel using a Biotage-40s column eluting with 5:95 methanohdichloromethane to give an oil. This oil was triturated with a mixture of 5% methanohdichloromethane (20 mL) and hexanes (20 mL), to give the title compound as a yellow solid (0.75 g, 54%). Η NMR (300 MHz, DMSO-d6) δ ppm 3.81 (s, 3 H), 7.88 (s, 2 H), 8.31 (s, 1 H).
-331- methyl 5-amino-4-(aminosulfonyI)thiophene-3-carboxylate The product of Example 317A (0.75 g, 2.86 mmol) was reacted with iron powder (0.64 g, 4 equivalents) in acetic acid (30 mL) at 50°C for 7.5 hours. The reaction was concentrated under reduced pressure and the residue was slurried in 5% methanohdichloromethane (20mL) and water (2 mL) and filtered through a short column of silica gel (20 g) that was washed with 5% methanohdichloromethane (200mL). The filtrate was concentrated under reduced pressure and residue was chromatographed on silica gel using a Biotage-12s column eluting with 1:1 ethyl acetate/ hexane to give the title compound as a yellow'solid (0.527 g, 78%). 1H NMR (300 MHz, DMSO-d6) δ ppm 3.77 (s, 3 H), 6.84 (s, 2 H), 6.88 (s, 2 H), 7.28 (s, 1 H).
Example 317C methyl 3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-4H-thienor2,3- el ri.2,41thiadiazine-7 -carboxylate 1,1-dioxide
The product of Example 317B (180 mg, 0.76 mmol) and the product of Example 309B (270 mg, 0.76 mmol) were reacted in toluene (15 mL) at 100°C for 3 hours. The reaction was cooled to 25°C and the resulting precipitate was collected by filtration, washed with toluene and and diethyl ether to give the title compound (302 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-de) δ ppm 3.85 (s, 3 H), 5.61 (s, 2 H), 7.29 ( , 5 H), 7.40 (m, 1 H), 7.52 (m, 1 H), 7J4 (m, 1 H), 8.21 (d, 7=7.72 Hz, 1 H), 8.26 (s, 1 H).
Example 318 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-4H-thienor2,3-giri,2,41thiadiazine-
7-carboxylic acid 1,1-dioxide The product of Example 317C (90 mg, 0.09 mmol) was reacted with a solution of IN aqueous sodium hydroxide (0.8 mL, 4.4 equivalents) in ethanol (2 mL) at 70°C for 1.5 hours. The reaction was filtered and the filtrate was acidified with IN aqueous hydrochloric acid (0.8 mL). The resulting precipitate was collected by filtration and washed with water, methanol, and diethyl ether to give the title compound (80 mg, 91.5%). *Η NMR (300 MHz, DMSO-d6) δ ppm 5.62 (s, 2 H), 7.29 (m, 5 H), 7.42 (t, 7=7.54 Hz, 1 H), 7.53 (d, 7=8.82 Hz, 1 H), 7.76 (t, 7=7.17 Hz, 1 H), 8.19 (s, 1 H), 8.22 (dd,J=8.09, 1.47 Hz, 1 H). The disodium salt of the title compound was prepared according to the procedure of Example ID substituting two equivalent of sodium hydroxide for one equivalent of sodium hydroxide.
Example 319
-332- 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-4H-thienor2,3-giri,2,41thiadiazine-
7-carboxamide 1,1-dioxide The product of Example 317C (25 mg, 0.05 mmol) was suspended in ammonium hydroxide (1 mL) and heated at 40°C for 16 hours. The reaction mixture was cooled to 25°C, concentrated under reduced pressure to remove the excess ammonia, and a solution of IN ΗC1 (0.8 mL), MeOΗ (1 mL), and water (3 mL) was added to the reaction mixture. The resulting precipitate was collected by filtration and washed with water, methanol, and diethyl ether to give the title compound (19 mg, 78.4%). 1H NMR (300 MHz, DMSO-d6) δ ppm 5.62 (s, 2 H), 7.30 (m, 7 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.53 (m, 2 H), 7.76 (m, 2 H), 7.98 (s, 1 H), 8.22 (m, 1 H). The sodium salt of the title compound was prepared according to the procedure of Example ID.
Example 320A 3 - f7-(benz ylox y)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yll - 1 - { rcyclopropylmethylene1amino|-4-hydroxyquinolin-2(lH)-one The product of Example 304F (0.800 g, 1.73 mmol) and cyclopropane carboxaldehyde (1.60 mL, 20.76 mmol) in N,N-dimethylacetamide (2 mL) were reacted at 120°C for 60 minutes in a microwave reactor in a sealed tube. The reaction was concenfrated under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.750 g, 84%).
Example 320B 3-r7-(benzyloxy)-Ll-dioxido-4H-l,2.4-benzothiadiazin-3-yll-l-r(cyclopropylmethyl)aminol-
4-hydroxyquinolin-2(lH)-one The produce of Example 320A (0.75 g, 1.46 mmol) in tetrahydrofuran (8 mL) and methanol (0.100 mL) at 0°C was reacted with lithium borohydride (2.0 M solution in tefrahydrofuran, 1.0 mL, 2.0 mmol). The reaction was stiπed at 25°C for 1 hour then diluted with 1 M aqueous hydrochloric acid and filtered. The product was purified by trituration with methyl sulfoxide, filtered and dried to give the title compound (0.296 g, 40%).
Example 320C l-r(cyclopropylmethyl)aminol-4-hydroxy-3-(7-hydroxy-lT-dioxido-4H-l,2,4- benzothiadiazin-3-vI)quinolin-2(lH)-one
-333- The product of Example 320B (0.296 g, 0.57 mmol) in tetrahyrofuran (15 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon, and ammonium formate (0.180 g, 2.85 mmol) at 60°C for 2 hours. The warm reaction mixture was filtered through celite® (diatomaceous earth) and the filtrate was diluted with diethyl ether and the precipitate filtered and dried to give the title compound (0.127 g, 53%).
Example 320 D 2-r(3-{ l-r(cvclopropylmethyl)amino1-4-hvdroxy-2-oxo-l,2-dihydroquinoIin-3-yll-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxylacetamide The product of Example 320C (0.125 g, 0.29 mmol) was reacted with cesium carbonate (0.38 g, 1.17 mmol), 2-bromoacetamide (0.060 g, 0.43 mmol) and a catalytic amount of tetrabuylammonium iodide in N,N-dimethylformamide (3 mL) at 25°C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.134 g, 95%). MS (ESI-) m/z 482 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.21 (m, 7=3.86, 2.39 Hz, 2 H) 0.46 (m, 2 H) 0.99 (m, 1 H) 2.55 (m, 2 H) 4.49 (s, 2 H) 5.96 (t, 7=6.43 Hz, 1 H) 7.06 (m, 1 H) 7.21 ( , 2 H) 7.40 (m, 2 H) 7.53 (m, 1 H) 7.62 (m, 7=1.84 Hz, 1 H) 7.67 (d, 7=8.46 Hz, 1 H) 8.07 (dd, 7=8.09, 1.47 Hz, 1 H) 16.25 (s, 1 H).
Example 321A 3 - F7-(benzylox y)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yll -4-hydroxy- 1 - ( l"2- methylpropylidenelamino|quinolin-2(lH)-one The product of Example 304F (0.150 g, 0.32 mmol) and isobutyrlaldehyde (0.44 mL,
4.84 mmol) in N,N-dimethylacetamide (1.5 mL) were reacted at 125°C for 40 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.140 g, 84%).
Example 321B 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl1-4-hydroxy-l-
-334- (isobutylamino)quinolin-2(lH)-one The produce of Example 321 A (0.140 g, 0.27 mmol) in tefrahydrofuran (3 mL) and methanol (0.020 mL) at 0°C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.20 mL, 0.40 mmol). The reaction was stiπed at 25°C for 1 hour then diluted with 1 M aqueous hydrochloric acid and filtered. The product was purified by dissolving in tetrahydrofuran, absorbing onto silica gel, loading onto a silica gel column and eluting with dichloromethane. The filtrate was evaporated'to dryness under reduced pressure to give the title compound (0.081 g. 58%).
Example 32 IC
4-hydroxy-3-(7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l- (isobutylamino)quinolin-2( lHVone The product of Example 321B (0.081 g, 0.16 mmol) in tetrahyrofuran (10 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon, and ammonium formate (0.040 g, 0.64 mmol) at 60°C for 30 minutes. The warm reaction mixture was filtered through celite® (diatomaceous earth) and the filtrate was evaporated under reduced pressure to give the title compound (0.048 g, 72%).
Example 32 ID 2-({3-r4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yll-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-ylloxy)acetamide The product of Example 32 IC (0.048 g, 0.11 mmol) was reacted with cesium carbonate (0.11 g, 0.34 mmol), 2-bromoacetamide (0.023 g, 0.17 mmol) and a catalytic amount of tetrabuylammonium iodide in N,N-dimethylformamide (3 mL) at 25°C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.042 g, 77%). MS (ESI-) m/z 484 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ ppm 1.03 (m, 6 H) 1.86 (m, 1 H) 3.25 (m, 2 H) 4.50 (m, 2 H) 5.94 (t, J=7.35 Hz, 1 H) 7.07 (t, J=7.72 Hz, 1 H) 7.21 (m, 2 H) 7.40 (s, 1 H) 7.58 (m, 2 H) 8.07 (dd, J=7.72, 1.47 Hz, 1 H) 16.23 (s, 1 H).
Example 322A 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yn-l-rbutylideneamino1-4-
-335- hydroxyquinolin-2(lH)-one The product of Example 304F (0.150 g, 0.32 mmol) and butyrlaldehyde (0.29 mL, 3.24 mmol) in N,N-dimethylacetamide (1.5 mL) were reacted at 120°C for 25 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a stream of nifrogen warmed through a manifold heated to 165°C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.134 g, 80%).
Example 322B
3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl1-l-(butylamino)-4- v hydroxyquinolin-2( lH)-one
The produce of Example 322A (0.134 g, 0.26 mmol) in tetrahydrofuran (3 mL) and methanol (0.020 mL) at 0°C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.195 mL, 0.39 mmol). The reaction was stirred at 25°C for 1 hour then diluted with 1 M aqueous hydrochloric acid and filtered. The product was purified by dissolving in tetrahydrofuran, absorbing onto silica gel, loading onto a silica gel column and eluting with dichloromethane. The filtrate was evaporated to dryness under reduced pressure to give the title compound (0.045 g. 33%).
Example 322C l-(butylamino)-4-hydroxy-3-(7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)quinolm-2(lH)-one The product of Example 322B (0.045 g, 0.087 mmol) in tetrahyrofuran (8 mL) was reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon, and ammonium formate (0.03 g, 0.48 mmol) at 60°C for 4 hours. The warm reaction mixture was filtered through celite® (diatomaceous earth) and the filtrate was evaporated under reduced pressure to give the title compound (0.038 g, 100%).
Example 322D2-({3-ri-(butylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yn-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy)acetamide The product of Example 322C (0.038 g, 0.089 mmol) was reacted with cesium carbonate (0.087 g, 0.27 mmol), 2-bromoacetamide (0.018 g, 0.13 mmol) and a catalytic amount of tetrabuylammonium iodide" in N,N-dimethylformamide (3 mL) at 25°C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting solution was diluted with water and the precipitate was collected by filfration and dried to give the title compound (0.041 g, 95%). ■ MS (ESI-) m/z 484 (M-Η)". The sodium salt of the title compound was prepared according to ' the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.93 (t, J=7.17 Hz, 3
-336- H) 1.48 (m, 4 H) 2.76 (m, 2 H) 4.49 (s, 2 H) 5.90 (t, J=6.80 Hz, 1 H) 7.06 (t, J=6.99 Hz, 1 H) 7.21 (m, 2 H) 7.40 (m, 1 H) 7.54 (m, 2 H) 8.07 (dd, J=8.09, 1.10 Hz, 1 H) 16.24 (s, 1 H).
Example 323A 3-17^benzyloxy)-l,l-dioxido-4H-1.2.4-benzothiadiazin-3-yl1-4-hvdroxy-l-. (lE)-3- methylbutylidenel amino 1 quinolin-2( lH)-one The product of Example 304F (0.220 g, 0.48 mmol) and isovaleraldehyde (0J7 mL,
7.18 mmol) in N,N-dimethylacetamide (1.5 mL) were reacted at 130°C for 35 minutes in a microwave reactor in a sealed tube. The reaction was concentrated under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting residue was triturated with diethyl ether and filtered to give the title compound (0.181 g, 72%).
Example 323B 3-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vI1-4-hydroxy-l-r(3- methylbutyl)aminolquinolin-2(lH)-one The produce of Example 323 A (0.061 g, 0.11 mmol) in tetrahydrofuran (3 mL) and methanol (0.010 mL) at 0°C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.09 mL, 0.18 mmol). The reaction was stiπed at 25°C for 1 hour then diluted with 1 M aqueous hydrochloric -acid and filtered. The product was purified by dissolving in tetrahydrofuran, absorbing onto silica gel, loading onto a 2g Alltech Sep-pack and eluting with dichloromethane. The filtrate was evaporated to dryness under reduced ; pressure to give the title compound (0.037 g. 62%).
Example 323C 4-hvdroxy-3-(7-hydroxy-l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(3- methylbutyl)amino1quinolin-2(lH)-one
The product of Example 323B (0.037 g, 0.07 mmol) in tetrahyrofuran (8 mL) was - reacted with a catalytic amount of palladium hydroxide on carbon, a catalytic amount of 5% palladium on carbon, and ammonium formate (0.018 g, 0.29 mmol) at 60°C for 30 minutes. The warm reaction mixture was filtered through celite® (diatomaceous earth) and the filfrate was evaporated under reduced pressure to give the title compound (0.025 g, 80%).
Example 323D
-337- 2- (3-{4-hvdroxy-l-r(3-methylbutyl)amino1-2-oxo-l,2-dihydroquinolin-3-yll-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl)oxy]acetamide The product of Example 323C (0.025 g, 0.057 mmol) was reacted with cesium carbonate (0.055 g, 0.17 mmol), 2-bromoacetamide (0.012 g, 0.087 mmol) and a catalytic amount of tetrabuylammonium iodide in N,N-dimethylformamide (3 mL) at 25°C for 2 hours. The reaction was concentrated to half the volume under a stream of nitrogen warmed through a manifold heated to 165°C. The resulting solution was diluted with water and the precipitate was collected by filtration and dried to give the title compound (0.020 g, 72%). MS (ESI-) m/z 498 (M-Η)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *Η NMR (300 MHz, DMSO-d6) δ ppm 0.90 (m, 3 H) 1.33 (m, 6 H) 1.54 (m, 2 H) 4.49 (s, 2 H) 5.90 (m, 1 H) 7.06 (m, 1 H) 7.21 (m, 2 H) 7.40 (m, 1 H) 7.55 (m, 2 H) 8.07 (dd, J=8.27, 1.29 Hz, 1 H) 16.23 (s, 1 H).
Example 324A 4-amino-N-r2-(aminosulfonyl)-4-(benzyloxy)phenyll-7-hydroxy-5-oxo-4,5- dihvdrothienor3,2-b1pyridine-6-carboxamide and N-r2-(aminosulfonyl)-4- (benzyloxy)phenyll-7-hydroxy-5-oxo-4-{ r(lE)-phenylmethylenelamino 1-4,5- dihydrothienor3,2-&1pyridine-6-carboxamide The products of Example 304D (1.55g, 5.57 mmol) and Example 268C (1.27 g, 3.71 mmol) in toluene (100 mL) were reacted at 118°C for 5 hours. The cooled sluπy was filtered, washed with 25 mL toluene and dried to give the title compounds .
Example 324B 4-amino-6-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vn-7-hydroxythienor3,2- blpyridin-5(4H)-one The product of Example 324A (1.95g, 3.7mmole) was reacted with 10% aqueous potassium hydroxide (100 mL) at reflux for 24 hours, cooled to 25°C and acidified with concentrated hydrochloric acid to pΗ 2. The resulting solid was collected by filtration, washed repeatedly with water and dried to provide the title compound (2.05 g, 100%). MS (ESI-) m/z 467 (M-Η)-.
Example 324C
6-r7-(benzyloxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vn-4-(cyclohexylideneamino)-7- hydroxythienor3,2-blpyridin-5(4H)-one
-338- The product of Example 324B (0.20 g, 0.42 mmol) and cyclohexanone (2.0g, 20 mmol) in N,N-dimethylacetamide (4 mL) were reacted at 130°C for 60 minutes in a microwave reactor in a sealed tube. The solvent was removed under reduced pressure and the resulting residue was triturated with diethyl ether (8 mL), filtered and dried to give the title compound (0.167g 73%).
Example 324D 6-r7-(benzyloxy)-lJ-dioxido-4H-l,2,4-benzothiadiazin-3-yll-4-(cyclohexyIamino)-7- hydroxythienor3,2-fc1pyridin-5(4H)-one The product of Example 324C (0.167g, .30 mmol) in tetrahydrofuran (6 mL) and methanol (0.030 mL, 0.8 mmol) at 0°C was reacted with lithium borohydride (2.0 M solution in tetrahydrofuran, 0.250 mL, 0.50 mmol). The reaction was stiπed at 25°C for 1.5 hour, acidified to pΗ 2 with 1 M aqueous hydrochloric acid and diluted with water (25 mL). The resulting precipitate was collected by filtration and dried to constant weight to give the title compound (0.114 g, 69%). MS (APCI+) m/z 551 (M+Η)+. 1H NMR (300 MHz, DMSO-d6) δ ppm 1.36 (m, 10 H) 5.25 (s, 2 H) 6.50 (s, 1 H) 7.43 (m, 8 H) 7.69 (d, 7=8.82 Hz, 1 H) 8.29 (d, 7=5.15 Hz, 1 H) 14.10 (s, 1 H) 14.87 (s, 1 H).
Example 324E 4-(cvclohexylamino)-7-hydroxy-6-(7-hvdroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3- v thieno |"32-blv yridin-5 (4H)-one The product of Example 324D (0.114g, 0.21 mmol) in dry acetonitrile (11 mL) at 25°C was reacted with iodotrimethylsilane (0.29 mL, 2.1 mmol) at 50°C for 4 hours. The reaction was cooled to 25°C and diluted with water (50 mL). The resulting precipitate was collected by filtration and dried under reduced pressure to give the title compound (0.083g, 87% yield). MS (ESI-) m/z 459 (M-Η)". 1H NMR (300 MHz, DMSO-dg) δ ppm 1.20 (m, 5 H) 1.66 (m, 5 H) 6.51 (s, 1 H) 7.18 (m, 2 H) 7.48 (d, 7=5.52 Hz, 1 H) 7.57 (d, 7=9.56 Hz, 1 H) 8.29 (d, 7=5.15 Hz, 1 H) 10.42 (s, 1 H) 14.04 (s, 1 H) 14.93 (s, 1 H).
. Example 324F
2-({3-r4-(cvclohexylamino)-7-hvdroxy-5-oxo-4,5-dihydrothienor3,2- )lpyridin-6-yn-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-ylloxy)acetamide The product of Example 324E (0.209 g, 0.45mmol) was reacted with cesium carbonate (0.589 g, 1.81 mmol), 2-bromoacetamide (0.125 g, 0.91 mmol) and a catalytic amount of tefrabutylammonium iodide in N,N-dimethylformamide (8 mL) at 25°C for 18 hours. The reaction was diluted with 50 mL water, acidified to pΗ 2 with 1 M hydrochloric acid. The resulting precipitate was collected by filtration and purified by column
-339- chromatography on silica gel eluting with 5% methanol in chloroform to give the title compound (0.050 g, 21% yield). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI-) m/z 516 (M-H)". 1H NMR (300 MHz, DMSO-de) δ ppm 1.48 (m, 10 H) 4.59 (s, 2 H) 6.50 (s, 1 H) 7.39 (m, 2 H) 7.44 (s, 1 H) 7.48 (d, 7=5.15 Hz, 1 H) 7.65 (s, 1 H) 7.70 (d, 7=9.56 Hz, 1 H) 8.28 (d, 7=5.15 Hz, 1 H) 14.13 (s, 1 H) 14.89 (s, 1 H).
Example 325
3-( 1 -benzyl -4-hydroxy-2-oxo- 1 ,2-dihvdroquinolin-3-yl)-N-(2-hvdroxyethyl)-4H-thieno f2,3- giri,2,41thiadiazine-7-carboxamide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added ethanolamine (2.8 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stirred for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.7mg, 85.8%). The sodium salt of the title compound was prepared according to the procedure of Example ID. Η NMR (300 MHz, DMSO-de) δ 3.34 (m, 2 H), 3.51 (m, 2 H), 5.61 (m, 2 H), 7.29 (m, 5 H), 7.42 (m, 1 H), 7.52 (m, 1 H), 7.75 (m, 1 H), 7.96 (s, 1 H), 8.23 (m, 1 H), 8.37 (m, 1 H). MS (DCF) m/z 525 (M+H)+.
796523 Example 326
3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-r(lS)-2-hydroxy-l-
(aminocarbonyl)ethyl1-4H-thienor2,3-eiri,2,41thiadiazine-7-carboxarnide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in Ν,Ν-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added L-serinamide hydrochloride (6.5 mg, 1.1 equivalents) followed by N-methylmorpholine (12.6 μL, 2.72 equivalents) and the solution was stirred for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (17.1mg, 73%). The sodium salt of the title compound was prepared according to the procedure of Example ID. JΗ NMR (300 MHz, DMSO-d6) δ 3.69 (dd, 7=4.96, 3.13 Hz, 2 H), 4.40 (m, 1 H), 5.62 (s, 2 H), 7.27 (m, 5 H), 7.41 (m, I H), 7.53 (m, 1 H), 7.75 (m, 1 H), 8.12 (s, 1 H), 8.22 (d, 7=7.72 Hz, 1 H), 8.28 (d, 7=7.72 Hz, 1 H). MS (DCI+) m/z 568 (M+H)+.
-340- Example 327 N-(2-amino-2-oxoethyl)-3-( 1 -benzyl -4-hydrox y-2-oxo-l,2-dih ydroquinolin-3-yl)-4H- thienor2,3-eirL2,41thiadiazine-7-carboxamide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in Ν,Ν-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added glycinamide hydrochloride (5.1 mg, 1.1 equivalents) followed by Nrmethylmorpholine (14 μL, 3 equivalents) and the solution was stiπed for 3 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (17 mg, 76%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 3.83 (d, 7=5.52 Hz, 2 H), 5.61 (s, 2 H), 7.13 (s, 1 H), 7.32 (m, 6 H), 7.51 (d, 7=8.09 Hz, 1 H), 7.75 (m, 1 H), 8.04 (s, 1 H), 8.21 (d, 7=6.99 Hz, 1 H), 8.59 (t, 7=5.88 Hz, 1 H). MS (DCf) m/z 538 (M+H)+.
Example 328 3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N-r(lS)-2-hvdroxy-l-methylethyll- 4H-thienoF2,3-eirL2,41thiadiazine-7-carboxamide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added (S)-(+)-2-amino- 1-propanol (3.6 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid.(4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.4 mg, 82%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 3.46 (m, 2 H), 3.95 (m, 1 H), 5.62 (s, 2 H), 7.30 (m, 5 H), 7.41 (t, 7=7.72 Hz, 1 H), 7.52 (d, 7=8.82 Hz, 1 H), 7.74 (d, 7=6.99 Hz, 1 H), 7.96 (s, 1 H), 8.10 (d, 7=8.09 Hz, 1 H), 8.22 (d, 7=6.99 Hz, 1 H). MS (DCI ) m/z 539 (M+H)+.
Example 329 • 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N,N-bis(2-hydroxyethyl)-4H- thienor2,3-eirL2,41thiadiazine-7-carboxamide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added diethanolamine
-341- (4.43 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1J2 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (6.85 mg, 29%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 3.53 (m, 4 H), 5.62 (s, 2 H), 7.30 (m, 6 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.53 (d, 7=8.46 Hz, 1 H), 7.59 (s, 1 H), 7.76 (m, 1 H), 8.22 (d, 7=8.09 Hz, 1 H).' MS (ESf ) m/z 569 (M+ή)+.
Example 330 3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N-r2-hydroxy-l-
(hvdroxymethyl)ethyn-4H-thienor2.3-el ri,2,41thiadiazine-7-carboxamide 1 , 1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added serinol (4.21 mg, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.2 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example ID. H NMR (300 MHz, DMSO-de) δ 3.51 (d, 7=5.52 Hz, 4 H), 3.89 (m, 7=6.25 Hz, 1 H), 5.63 (s, 2 H), 7.30 (m, 6 H), 7.42 (t, 7=7.54 Hz, 1 H), 7.53 (d, 7=8.82 Hz, 1 H), 7.75 (d, 7=8.46 Hz, 1 H), 8.02 (m, 2 H), 8.22 (d, 7=8.09 Hz, 1 H). MS (DCI+) m/z 555 (M+H)+.
Example 331 1 -benzyl-4-hydroxy-3-(7- f r(3R)-3-hydroxyp yrrolidin- 1 -yllcarbonyl 1-1,1 -dioxido-4H- thienor2,3-e1 [1 ,2,41thiadiazin-3-yl)quinolin-2(lH)-one A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added (R)-(+)-3- pyπolidinol (3.84 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (19.8 mg, 87%). The sodium salt of the title compound was prepared according to the procedure of Example ID. XH NMR (300 MHz, DMSO-dg) δ 1.89 (m, 2 H), 3.55 (m, 2 H), 4.31 (d, 1 H), 4.99 (br. s., 1 H), 5.62 (s, 2 H), 7.31 (m, 6 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.53 (d, 7=8.82 Hz, 1 H), 7.69
-342- (d, 7=6.99 Hz, 1 H), 7.76 (t, 7=7.35 Hz, 1 H), 8.22 (d, 7=6.99 Hz, 1 H). MS (ESf) m/z 551 (M+H)+.
Example 332 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N-(3-hydroxypropyl)-4H- thienor2,3-eiπ,2,41thiadiazine-7-carboxamide 1,1-dioxide
A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added 2-(methylamino)- ethanol (2.8 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (19.2mg, 86%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 1.67 (m, 2 H), 3.28 (m, 2 H), 3.48 (t, 7=6.25 Hz, 2 H), 5.61 (s, 2 H), 7.30 (m, 6 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.52 (d, 7=8.46 Hz, 1 H), 7.75 (t, 7=6.99 Hz, 1 H), 7.92 (s, 1 H), 8.21 (m, 1 H), 8.34 (t, 7=5.33 Hz, 1 H). MS (DCI+) m/z 539 (M+H)+.
Example 333 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N-r(2S)-2.3-dihvdroxypropyl1-4H- thienor2,3-el [l,2,41thiadiazine-7-carboxamide 1.1 -dioxide
A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added (S)-(-)-3-amino- 1,2-propanediol (4.21 mg, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.4mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 3.15 (m, 2 H), 3.60 (m, 2 H), 5.62 (s, 2 H), 7.30 (m, 6 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.52 (d, 7=8.46 Hz, 1 H), 7.75 (m, 1 H), 7.98 (s, 1 H), 8.22 (d, 7=6.62 Hz, 1 H), 8.32 (t, 7=5.88 Hz, 1 H). MS (DCf) m/z 555 (M+H)+.
Example 334 3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-r(lS)-l-(hydroxymethyl)propyll- 4H-thienor2,3-eiri,2,41thiadiazine-7-carboxamide 1,1-dioxide
A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and
-343- 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added (S)-(+)-2-amino- 1-butanol (4.36 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 5 mL) was added and the resulting precipitate was collected by filfration and washed with water, methanol and diethyl ether to give the title compound as a white solid (16.5 mg, 72%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H Ϊ^MR (300 MHz, DMSO-ds) δ 0.91 (t, 7=7.35 Hz, 3 H), 1.54 ( , 2 H), 3.45 (m, 2 H), 3.81 (m, 1 H), 5.62 (s, 2 H) 7.31 (m, 6 H), 7.41 (t, 7=7.72 Hz, 1 H), 7.52 (d, 7=8.09 Hz, 1 H), lό 7.76 (t, 7=7.91 Hz, 1 H), 7.98 (m, 1 H), 8.01 (d, 7=8.46 Hz, 1 H), 8.22 (d, 7=6.99 Hz, 1 H). MS (DCF) m/z 553 (M+H)+.
Example 335
3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-N-r(lS)-l-(hydroxymethyl)-2- methylpropyl1-4H-thienor2,3-eir 2,41thiadiazine-7-carboxamide 1,1-dioxide
15 A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stirred for 15 minutes at room temperature. To this mixture was added (S)-(+)-2-amino- 3-methyl-l -butanol (5.15 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72
20 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.8 mg, 80%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.92 (dd, 7=6.62, 5.15 Hz, 6 H), 1.95 (m, 1 H), 3.48
25 (d, 7=5.88 Hz, 2 H), 3.80 (m, 1 H), 5.62 (s, 2 H), 7.30 (m, 6 H), 7.40 (t, 7=7.72 Hz, 1 H), 7.51 (d, 7=8.46 Hz, 1 H), 7.75 (m, 1 H), 7.95 (d, 7=8.82 Hz, 1 H), 8.00 (s, 1 H), 8.22 (d, 7=6.62 Hz, 1 H). MS (DCI*) m/z 567 (M+H)+.
Example 336 3-(l-benzyl-4-hydroxy- 2-oxo-l, 2-dihydroquinolin-3-yl)-N-r2-hvdroxybutvn-4H-thienor2,3-
30 eiri^^lthiadiazineT-carboxamide 1,1-dioxide
A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added l-amino-2-
35 butanol (4.43 μL, 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water,
-344- methanol and diethyl ether to give the title compound as a white solid (19.97 mg, 87%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.90 (t, 7=7.35 Hz, 3 H), 1.41 (m, 2 H), 3.14 (m, 2 H), 3.50 (m, 1 H), 5.62 (s, 2 H), 7.29 (m, 6 H), 7.41 (t, 7=7.72 Hz, 1 H), 7.52 (d, 7=8.82 Hz, 1 H), 7.74 (m, 7=8.09 Hz, 1 H), 7.97 (s, 1 H), 8.21 (m, 1 H), 8.31 (t, 7=5.33 Hz, 1 H). MS (DCT) m/z 553 (M+H)+.
Example 337 j-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-r2-hvdroxy-2-(4- hydroxyphenyl)ethvn-4H-thienor2,3-eiri.2,41thiadiazine-7-carboxamide 1,1-dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added octopamine hydrochloride (8.6 mg, 1.1 equivalents) followed by N-methylmorpholine (12.6 μL, 2.72 equivalents) and the solution was stiπed for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and' the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (13.58 mg, 53%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 4.63 (dd, 7=7.72, 4.41 Hz, 1 H), 5.62 (s, 2 H), 6J2 (d, 7=8.46 Hz, 2 H), 7.18 (d, 7=8.46 Hz, 2 H), 7.31 (m, 6 H), 7.41 (t, 7=7.54 Hz, 1 H), 7.52 (d, 7=8.82 Hz, 1 H), 7.74 (t, 7=6.99 Hz, 1 H), 7.94 (s, 1 H), 8.21 ( , 1 H), 8.42 (t, 7=5.52 Hz, 1 H), 9.27 (s, 1 H). MS (EST) m/z 615 (M-H)".
Example 338 l-benzyl-3-ri,l-dioxido-7-(piperazin-l-ylcarbonyl)-4H-thienor2,3-eiri,2,41thiadiazin-3-yn- 4-hydroxyquinolin-2( lH)-one
A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added piperazine (4 mg , 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents) and the solution was stiπed for 16 hours. Water (5 mL) was added and the resulting precipitate was collected by filtration and washed with water, methanol and diethyl ether to give the title compound as a white solid (18.3 mg, 80.16%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 3.14 (s, 4 H), 3.65 (m, 4 H), 5.43 (s, 2 H), 7.26 (m, 8 H), 7.46 (m, 2 H), 8.11 (t, 7=7.72 Hz, 1 H), 8J0 (br.s, 1 H). MS (DCf) m/z 550 (M+H)+.
-345- Example 339 N-r5-(aminocarbonyl)pyridin-2-vn-3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yl)- 4H-thieno \2 ,3 -el I" 1 ,2 ,41 thiadiazine-7-carboxamide 1 , 1 -dioxide A solution of the product of Example 318 (20 mg, 0.042 mmol), l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (11.76 mg, 1.48 equivalents), and 1-hydroxybenzotriazole (8.66 mg, 1.54 equivalents) in N,N-dimethylformamide (0.4 mL) was stiπed for 15 minutes at room temperature. To this mixture was added 6- aminoni tinamide (6.33 mg , 1.1 equivalents) followed by N-methylmorpholine (8 μL, 1.72 equivalents.) and the solution was heated at 70 °C for 16 hours. A solution of 1 N hydrochloric acid (4 mL) was added and the resulting precipitate was collected by filtration and washed with water, and diethyl ether. The solid was dissolved in 5% methanol/dichloromethane with 2 drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with 10:90 methanol/ dichloromethane to give the title compound as a white solid (5.4 mg, 21.6%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 5.64 (s, 2 H,) 7.30 (m, 6 H), 7.43 (t, 7=7.54 Hz, 1 H), 7.50 (m, 1 H), 7.54 (d, 7=8.46 Hz, 1 H), 7.76 (m, 1 H), 8.10 (s, 1 H), 8.24 (m, 2 H), 8.32 (m, 1 H), 8.38 (s, 1 H), 8.88 (d, 7=1.84 Hz, 1 H), 11.17 (s, 1 H). MS (DCI+) m/z 601 (M+H)+.
Example 340A ethyl 2-(isopentylamino)nicotinate A mixture of ethyl 2-chloronicotinate (3.71 g, 20 mmol), isoamylamine (3.03 mL, 26 mmol) and triethylamine (3.62 mL, 26 mmol) was heated in a sealed tube at 140°C for 8 hours, cooled to 25C, diluted with ethyl acetate and the mixture washed with water. The organic layer was extracted with IN aqueous hydrochloric acid. The acidic aqueous layer was adjusted to pH 8.0 with saturated sodium bicarbonate solution then extracted with ethyl acetate (2 portions). The combined organic extracts were dried over sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound (3.58 g, 76%). MS (DCI NH3) m/z 237 (M+H)+. 1H NMR (300 MHz, DMSO-de) δ ppm 0.93 (d, 7=6.25 Hz, 6 H) 1.31 (t, 7=6.99 Hz, 3 H) 1.47 (q, 7=6.99 Hz, 2 H) 1.64 (m, 1 H) 3.47 (m, 2 H) 4.28 (q, 7=6.99 Hz, 2 H) 6.59 (dd, 7=7.72, 4.78 Hz, 1 H) 7.90 (t, 7=5.15 Hz, 1 H) 8.07 (dd, 7=7.91,. 2.02 Hz, 1 H) 8.28 (dd, 7=4.78, 1.84 Hz, 1 H).
Example 340B 2-(isopentylamino)nicotinic acid
A mixture of Example 340A (1.73 g, 7.31 mmol), IN aqueous sodium hydroxide (14.6 mL), and methanol (7 mL) was stiπed for 18 hours and diluted with water. The
-346- aqueous mixture was washed with ethyl acetate followed by dichloromethane, and adjusted to pH 7.5 with IN aqueous hydrochloric acid. The resulting precipitate was collected by vacuum filtration, washed with water and air dried to give the title compound (424.4 mg, 28%). MS (DCI NH3) m/z 209 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ ppm 0.91 (d, 7=6.62 Hz, 6 H) 1.46 (q, 7=6.99 Hz, 2 H) 1.63 (m, 1 H) 3.45 (t, 7=7.17 Hz, 2 H) 6.56 (dd, 7=7.72, 4.78 Hz, 1 H) 8.04 (dd, 7=7.72, 1.84 Hz, 1 H) 8.05 (m, 1 H) 8.25 (dd, 7=4.78, 2.21 Hz, 1 H) 12.96 (s, 1 H).
,} Example 340C
4-hvdroxy-l-(3-methylbutyI)-l,8-naphthyridin-2(lH)-one A mixture of Example 340B (1 g, 4.81 mmol), acetic anhydride (10 mL) and glacial acetic acid (10 mL) was heated at 130°C for 2 hours. The mixture was cooled to 25C and concenfrated under reduced pressure. The residue was partitioned between ethyl acetate and saturated aqueous sodium bicarbonate. The organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 0-100% hexane in ethyl acetate step gradient to give the title compound (100 mg, 9%). MS (DCFNH3) m z 233 (M+H)+. IH NMR (300 MHz, DMSO-D6) δ ppm 0.94 (d, 7=6.62 Hz, 6 H) 1.46 (m, 2 H) 1.60 (m, 1 H) 4.33 (m, 2 H) 5.88 (s, 1 H) 7.27 (dd, 7=7.72, 4J8 Hz, 1 H) 8.22 (dd, 7=7.72, 1.84 Hz, 1 H) 8.65 (dd, 7=4.78, 1.84 Hz, 1 H) 11.61 (s, 1 H). Example 340D
3-rbis(methylthio)methylene1-l-butyl-L8-naphthyridine-2,4(lH,3H)-dione A solution of the product of Example 340C (0.2 g, 0.86 mmol) in dimethylformamide (7 mL) was treated with sodium hydride (76 mg, 60% in mineral oil, 2.2 equivalents), stirred for 30 min at 25°C, freated with carbon disulfide (0.14 g, 2.2 eq.), heated at 50°C for 6 hours, cooled to 25°C, and treated with methyl iodide (0.27 g, 2.2 eq.). The mixture was stiπed at 25°C for 18 hours and concentrated. The residue was triturated with water and the resulting solids were filtered and dried in vacuo to give the title compound (0.23 g, crude yield 80%). Η NMR (300 MHz, DMSO-de) δ 1.00 (d, 7=10 Hz, 6 H), 1.6 (m, 2H), 1.75 (m, IH), 2.63 (s, 6H), 4.4 (m, 2H), 7.1 (dd, 7=10 Hz, 7 Hz, IH), 8.42 (dd, 7=10 Hz, 3 Hz, IH), 8.58 (dd, 7=7 Hz, 3 Hz, IH). MS (DCI+) m/z 337 (M+H)+.
Example 340E 4-hydroxy-3- { 7-r(methoxymethoxy)methyl|- 1 , l-dioxido-4H-thieno 2,3-e1 Tl ,2,41thiadiazin- 3-yll-l-(3-methylbutyl)-1.8-naphthyridin-2riH)-one The product of Example 309G (37.5 mg, 0.15 mmol) and the product of Example
340D (50 mg, 0.15 mmol) were reacted in toluene (5 mL) at 100°C for 3 hours. The reaction was concentrated under reduced pressure and the residue was purified by chromatography on
-347- silica gel using a Biotage-12m column eluting with 2:98 methanohdichloromethane to give the title compound as a yellow solid (36mg, 49%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.99 Hz, 6 H), 1.57 (m, 2 H), 1.66 (m, 1 H), 4.45 (d, 7=7.35 Hz, 2 H), 4.64 (s, 3 H), 4.71 (s, 3 H), 7.43 (s, 1 H), 7.46 (m, 1 H), 8.54 (d, 7=6.99 Hz, 1 H), 8.87 (s, 1 H), 14.45 (br.s, 1 H). MS (DCF) m/z 510 (M+NRtf.
Example 341 4-hydro y-3-r7-(hvdroxymethyl)-l,l-dioxido-4H-thienor2,3-eiri,2,41thiadiazin-3-yll-l-(3- methylbutyl)-l,8-naphthyridin-2(lH)-one The product of Example 340C (23 mg, 0.05 mmol) was reacted with 6 N aqueous hydrochloric acid (1 mL) in tetrahydrofuran (2 mL) at 70°C for 3 hours. The reaction was concentrated under reduced pressure to remove the tetrahydrofuran, and freated with methanol (5 mL). The resulting precipitate was collected by filfration and washed with water and diethyl ether to give the title compound as a white solid (13 mg, 62%). The sodium salt of the title compound was prepared- according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-de) δ 0.98 (d, 7=6.62 Hz, 6 H), 1.57 (m, 2 H), 1.67 (m, 1 H), 4.46 (m, 2 H), 4.62 (s, 2 H), 7.30 (s, 1 H), 7.47 (dd, 7=8.09, 4.78 Hz, 1 H), 8.54 (dd, 7=7.72, 1.84 Hz, 1 H), 8.86 (m, 1 H), 14.39 (br.s, 1 H). MS (DCI+) m/z 466 (M+NH4)+.
Example 342 r3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thienor2,3- el [1 ,2,41thiadiazin-7-vnmethyl carbamate A suspension of the product of Example 310 (40 mg, 0.086 mmol) in a solution of L N,N-dimethylformamide (2 mL) and acetonitrile (0.6 mL) at -20°C was treated with chlorosulfonyl-isocyanate (16.4 μL, 2.2 equivalents). The mixture was stiπed 0.5 hour at - 20°C and 2 hours at 0°C, 6N hydrochloric acid (2 mL) was added and the mixture was heated 2.5 hours at 70°C. The mixture was cooled and water (10 mL) was added, the resulting precipitate was collected by filfration and washed with water and diethyl ether. The solid was dissolved in 5% methanol/dichloromethane with a few drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with 6:94 methanol/ dichloromethane to give the title compound as a white solid (23 mg, 52.6%). The sodium salt of the title compounds was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 5.08 (s, 2 H), 5.62 (s, 2 H), 6.72 (s, 2 H,) 7.29 (m, 5 H), 7.42 (m, 2 H), 7.53 (d, 7=8.82 Hz, 1 H), 7.77 (t, 7=7.35 Hz, 1 H), 8.22 (d, 7=6.99 Hz, 1 H). MS (DCI*) m/z 528 (M+NH )+.
-348- Example 343 \3 -( 1 -benz yl-4-h ydroxy-2-oxo- 1 ,2-dih ydroquinolin-3 -yl)- 1 , 1 -dioxido-4H-thieno |"2,3- e\ Tl ,2,41thiadiazin-7-yl]methyl aminocarbonylcarbamate A suspension of the product of Example 310 (40 mg, 0.086 mmol) in a solution of N,N-dimethylformamide (2 mL) and acetonitrile (0.6 mL) at -20°C was treated with chlorosulfonyl-isocyanate (16.4 μL, 2.2 equivalents). The mixture was stirred 0.5 hour at - 20°C and 2 hours at 0°C, 6N hydrochloric acid (2 mL) was added and the mixture was heated 2.5 hours}at 70 °C. The mixture was cooled and water (10 mL) was added, the resulting precipitate was collected by filtration and washed with water and diethyl ether. The solid was dissolved in 5% methanol/dichloromethane with a few drops of triethylamine and purified by flash chromatography on silica gel using a Biotage-12s column eluting with 6:94 methanol/ dichloromethane to give the title compound (6 mg, 12.7%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !Η NMR (300 MHz, DMSO-de) δ 5.23 (s, 2 H), 5.61 (s, 2 H), 7.28 (m, 4 H), 7.35 (m, 2 H), 7.51 (m, 1 H), 8.20 (m, 2 H), 10.01 (s, 1 H). MS (EST) m/z 552 (M-H)".
Example 344 3-r7-(azidomethyl)-l.l-dioxido-4H-thienor2,3-eiri,2,41thiadiazin-3-yll-l-benzyl-4- h ydroxyquinolin-2( 1 H)-one To the solution of the product of Example 310 (156.4 mg, 0.33 mmol) in dichloromethane (3 mL) was added l,8-diazabicyclo[5.4.0]undec-7-ene (0.37 mL, 2.47 mmol) and diphenylphosphoryl azide (0.54 mL, 2.50 mmol) at room temperature. The solution was stirred at room temperature overnight and concentrated in vacuo. The residue was diluted with ethanol and aqueous hydrogen chloride (1 N, 2 mL) was added slowly and precipitates appeared. The solid was filtered and rinsed with a solution of ethanol/water (2:1) to give the title compound as a light brown solid (124.47 mg, 76%). MS (EST) m/z 491 (M- H)". IH NMR (300 MHz, DMSO-d6) δ 4.59 (s, 2 H) 5.62 (br s, 2 H) 7.30 (m, 5 H) 7.41 (t, 7=7.54 Hz, 1 H) 7.52 (d, 7=8.82 Hz, 1 H) 7.58 (s, 1 H) 7.76 (m, 1 H) 8.22 (dd, 7=8.09, 1.47 Hz, 1 H).
Example 345 3-r7-(aminomethyl)-l,l-dioxido-4H-thienor2,3-eiri,2,41thiadiazin-3-yll-l-benzyl-4- hydroxyquinolin-2(lH)-one To the solution of the product of Example 344 (136.2 mg, 0.28 mmol) in pyridine (1.68 mL) and concentrated ammonium hydroxide (1.12 mL) was added triphenylphosphine (145 mg, 0.55 mmol) at room temperature. The solution was stirred at room temperature overnight and concentrated in vacuo. The residue was diluted with toluene and the solid was filtered to give the title compound as a light brown solid (100.78 mg, 78%). MS (ESV) m/z 467 (M+H)+. IH NMR (300 MHz, DMSO-d6) δ 4.10 (s, 2 H) 5.41 (br s, 2 H) 7.07-7.32 (m,
-349- 8 H) 7.43 (m, 1 H) 8.10 (dd, 7=7.91, 1.65 Hz, 1 H).
Example 346 N-{r3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thienor2,3- el IT ,2,41thiadiazin-7-yl1methyl Imethanesulfonamide To a solution of the product of Example 345 (15mg, 0.032 mmol) in tetrahydrofuran
(0.4 mL) was added triethylamine (0.018 mL, 0.129 mmol) followed by 1,8- diazabicyclo[5.4.0]undec-7-ene ( 0.018 mL, 0.129 mmol). The mixture was cooled to 0°C and methanesulfonyl chloride was added (0.003 mL, 0.032 mmol). The mixture was stirred at 0 °C for 2.5 hours and then warmed to 23°C and stirred for 2.5 hours. Additional 1,8- diazabicyclo[5.4.0]undec-7-ene ( 0.010 mL 0.064 mmol) and methane sulfonyl chloride
(0.003 mL, 0.032 mmol) were added and the mixture was stiπed at 23°C for 15 hours. A few drops of N,N-dimethylformamide were added to increase solubility. Additional methane sulfonyl chloride ( 0.003 L, 0.032 mmol) was added and the reaction mixture was stiπed at 23°C for 3 hours. A few drops of N,N-dimethylformamide and methane sulfonyl chloride (0.003 mL, 0.032 mmol) were added and the reaction mixture was stiπed at 23°C for 1 hour. Additional methane sulfonyl chloride (0.006 mL, 0.064 mmol) was added and the reaction mixture was stirred at 23°C for 72 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was diluted with diethyl ether and 1 N hydrochloric acid was added until no further precipitation was observed. The precipitate was then washed with water followed by diethyl ether. The solid was dissolved in 1% triethylamine/ dichloromethane and purified by preparative thin layer chromatography eluting with 5% (5% triethylamine/ methanol)/ dichloromethane. The silica gel was washed with 10% (5% triethylamine/ methanol)/ dichloromethane to give the triethylamine salt of the title compound (4.7 mg, 23%). 1H NMR (500 MHz, DMSO-de) δ 1.16 (t, 7=6.71 Hz, 9 H) 2.94 (s, 3 H) 3.08 (bs, 6 H) 4.26 (d, 2 H) 5.40 (bs, 2 H) 7.06 (m, 2 H) 7.12 (d, 7=8.54 Hz, 1 H) 7.23 (m, 5 H) 7.40 (t, 7=7.32 Hz, 1 H) 7.50 (t, 7=6.41 Hz, 1 H) 8.10 (d, 7=6.10 Hz, 1 H).
Example 347
N- { \3 -( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dih ydroquinolin-3 -yl)- 1 , 1 -dioxido-4H-thieno f2,3- el T 1 ,2,41thiadiazin-7-yl1methyl I nicotinamide To the solution of the product of Example 345 ( 0.015 g, 0.032 mmol) in tetrahydrofuran (0.4 mL) was added triethylamine (0.022 mL, 0.160 mmol), and 1,8- diazabicyclo[5.4.0]undec-7-ene (0.020 mL, 0.129 mmol). The mixture was cooled to 0°C and nicotinoylchloride hydrochloride (0.007 g, 0.035 mmol) was added. The mixture was stirred for-2.5 hours and then warmed to 23°C and stiπed for 2.5 hours. Additional 1,8 diazabicyclo[5.4.0]undec-7-ene ( 0.010 mL, 0.068 mmol) and nicotinoylchloride hydrochloride (0.006 g, 0.032 mmol) were added and the mixture was stirred at 23°C for 15 hours. Added additional nicotinoyl chloride hydrochloride (0.006g, 0.032 mmol) and stirred
-350- at 23°C for 6 hours. A few drops of N,N-dimethylformamide were added to increase solubility. Added additional nicotinoyl chloride hydrochloride (0.006g, 0.032 mmol) and stirred at 23 °C for 72 hours. Hydrochloric acid ( 4 M in dioxane) ( 0.095 mL, 0.370 mmol) was added and the reaction mixture was concenfrated under reduced pressure. The resulting 5 solid was then washed with diethyl ether and water. The solid was dissolved in 1% triethylamine/ dichloromethane and purified by preparative thin layer chromatography eluting with 5%(5% triethylamine/ methanol)/ dichloromethane. The silica gel was washed with 10%" (5% triethylamine/ methanol)/ dichloromethane to give the triethylamine salt of the title compound (0.0068 g, 31%). 1H NMR (500 MHz, DMSO-d6) δ 1.17 (t, 7=7.32 Hz, 9 H) lό 3.09 (q, 7=7.32 Hz, 6 H) 4.60 (d, 7=4.88 Hz, 2 H) 5.44 (bs, 2 H) 7.00 (bs, 1 H) 7.12 (m, 1 H) 7.26 (m, 5 H) 7.46 (m, 1 H) 7.53 (dd, 7=7.63, 4.58 Hz, 1 H) 8.12 (d, 7=7.32 Hz, 1 H) 8.26 (m, 7=7.93 Hz, 1 H) 8.72 (d, 7=3.66 Hz, 1 H) 8.86 (bs, 1 H) 9.09 (s, 1 H) 9.16 (bs, 1 H).
Example 348 N- { f3-( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)- 1 , 1 -dioxido-4H-thieno f2,3- 15 el Tl ,2,4]thiadiazin-7-vπmethyl lmorpholine-4-carboxamide
To the solution of the product of Example 345 (0.015 g, 0.032 mmol) in tetrahydrofuran ( 0.4 mL) was added triethylamine (0.009 mL, 0.064 mmol). The mixture was cooled to 0 C and 4-morpholinecarbonyl chloride (0.004 mL, 0.035 mmol) was added. The reaction mixture was warmed to 23°C and stiπed for 15 hours. 1 N hydrochloric acid ( 20 0.065 mL, 0.064 mmol) was added and the mixture was then concentrated under reduced pressure. The product was washed with diethyl ether and water to give the title compound ( 7.5 mg, 40%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (500 MHz, DMSO-d6) δ 3.57 (t, 4 H) 4.38 (d, 7=4.88 Hz, 2 H) 5.60 (bs, 2 H) 7.11 (m, 2 H) 7.27 (m, 6 H) 7.38 (m, 7=7.32, 3.05 Hz, 1 H) 7.49 (m, 25 7=7.32 Hz, 1 H) 7.73 (bs, 1 H) 8.21 (d, 7=7.32 Hz, 1 H). :
Example 349
N-ir3-(l-benzyl-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thieno[2,3- eiri,2,41thiadiazin-7-yllmethyl}-2-hvdroxyacetamide
To the solution of the product of Example 345 (0.0226 g, 0.048 mmol) in N,N-
30 dimethylformamide (0.5 mL) was added triethylamine ( 0.020 mL, 0.145 mmol), 4-
(dimethylamino)pyridine (0.018 g, 0.145 mmol), glycolic acid (0.011 g, 0.145 mmol), and 1- (3-dimethylaιninopropyl)-3-ethylcarbodiimide hydrochloride ( 0.028 g, 0.145 mmol). The mixture was stirred at 23 °C for 15 hours and then was heated to 60 °C and stirred for 20 hours. The reaction mixture was concentrated under reduced pressure. The concentrate was 5 diluted with dichloromethane, cooled to 0 °C, and hydrochloric acid ( 4 M in dioxane) was added ( 0.037 mL, 0.145 mmol). The mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10%
-351- acetonitrile in 0.1% trifluoroacetic acid/ water to 95% acetonitrile in 0.1%trifluoracetic acid/ water to give the title compound (10.8 mg, 42%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 3.91 (s, 2 H) 4.44 (d, 7=5.88 Hz, 2 H) 5.61 (bs, 2 H) 7.14 (s, 1 H) 7.29 (m, 5 H) 7.41 (t, 7=7.35 Hz, 1 H) 7.52 (d, 7=9.19 Hz, 1 H) 7.75 (t, 1 H) 8.21 (dd, 1 H) 8.35 (t, 1 H).
Example 350 A v 1 -amino-4-hydroxyquinolin-2( lH)-one
To a solution of 25% by weight aqueous potassium hydroxide (200 mL) and 1,4- dioxane (50 mL) heated to 90-100°C was added portion wise the product of Example 226C (6.72 g, 20.0 mmol). The reaction mixture was heated at reflux for 90 minutes allowing distillation to occur and additional water and dioxane (30 mL each) were added to the reaction vessel to reach the original volume. The mixture was refluxed for an additional 90 minutes with distillation, cooled, washed with 200 mL of 1:1 diethyl ether/ethyl acetate, acidified with concentrated hydrochloric acid to pΗ 2 and the resulting solid was collected by filtration, washed with water and dried to constant mass to give the title compound as a tan sold (3.22 g, 91% yield). MS (DCI) m/z 177 (M+Η)+. JH NMR (300 MHz, DMSO-d6) δ 5.56 (s, 2 H) 5.94 (s, 1 H) 7.20 (t, J=7.54 Hz, 1 H) 7.62 (m, 1 H) 7.85 (m, 2 H) 11.33 (s, 1 H).
Example 350B
2-(4-hvdroχy-2-oxoquinolin-l(2H)-yl)-lH-isoindole-l,3(2H)-dione A mixture of the product of Example 350A (0.54 g, 3 mmol), phthalic anhydride (1.36 g, 2.2 eq.) and diisopropylethylamine (1.97 g, 5 eq.) in dioxane (20 mL) was heated at 100°C for 2 hours, cooled to 25C and concenfrated. The residue was triturated with water - and ether. The resulting solids were filtered and dried in vacuum to give the title compound (0.6 g, 64% crude yield) which was used directly for the next step. 1H NMR (300 MHz, DMSO-de) δ 5.95 (s, IH), 7.37 (m, IH), 7.6 (m, 2H), 7.95-8.1 (m, 5H),. 12.18 (s, IH). MS
Figure imgf000354_0001
■ Example 350C
3-rbis(methylthio)methylene1-l-(l,3-dioxo-l,3-dihydro-2H-isoindol-2-yl)quinoline-
2.4(lH,3H)-dione ■ A solution of the product of Example 350B (0.6 g, 1.96 mmol) in acetic acid:pyridine (5:1, 15 mL) was treated with tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi)(1.6 g, 3 eq.) and heated at 100°C for 2 hours. The reaction mixture was
-352- treated with ice, and the precipitated solids were filtered and dried in vacuum to give 0.53 g (66 %) of the title compound. 1H NMR (300 MHz, DMSO-d6) δ 2.63 (s, 6H), 7.34 (m, IH), 7.55 (d, IH), 7.61 (m, IH), 8.08 (m, 5H). MS (DCI+) m/z 411 (M+H)+.
Example 350D 5 2-r4-hydroxy-3-{7-l"(methoxymethoxy)methyll-Tl-dioxido-4H-thienor2,3- el Tl ,2,41thiadiazin-3-yl }-2-oxoquinolin-l (2H)-vn-lH-isoindole-l ,3(2H)-dione The product of Example 309G (32.6 mg, 0.13 mmol) and the product of Example 350C (53/mg, 0.13 mmol) were reacted in toluene (3 mL) at 100° C for 3 hours. The resulting precipitate was collected by filtration and washed with methanol and diethyl ether lό to give the title compound (45 mg, 61.5%). 1H NMR (300 MHz, DMSO-d6) δ 3.32 (s, 3 H), 4.61 (s, 2 H), 4J0 (s, 2 H), 7.28 (s, 1 H), 7.42 (m, 1 H), 7.70 (d, 7=4.04 Hz, 2 H), 8.06 (m, 2 H), 8.11 (m, 2 H), 8.22 (d, 7=8.09 Hz, 1 H). MS (EST) m/z 565 (M-H)".
Example 350E l-amino-4-hydroxy-3-{7-r(methoxymethoxy)methyll-l,l-dioxido-4H-thienor2,3- 15 eiri,2,41thiadiazin-3-yllquinolin-2(lH)-one
A solution of the product of Example 350D (185 mg, 0.326 mmol), methylhydrazine (43.47 μL, 2.5 equivalents), and triethylamine (0.126 mL, 3 equivalents) in 1,4-dioxane (10 mL) was heated at 102°C for 3 hours. The reaction was concentrated under reduced pressure, and treated with a solution of methanol (75 mL) and IN hydrochloric acid (100 mL). The 0 resulting precipitate was collected by filtration and washed with water and diethyl ether to give the title compound as a white solid (94 mg, 66%). 1H NMR (300 MHz, DMSO-de) δ 4.65 (s, 2 H), 4.71 (s, 2 H), 5.84 (br.s, 1 H), 7.44 (m, 2 H), 7.88 (m, 1 H), 8.04 (d, 1 H), 8.15 (d, 1 H), 14.73 '(br.s, 2 H). MS (EST) m/z 435 (M-H)".
5 Example 350F l-i rcyclopropylmethylene1aminol-4-hydroxy-3-{7-r(methoxymethoxy)methvn-l,l-dioxido- 4H-thienor2,3-el n ,2,41thiadiazin-3-yl 1quinolin-2(lH)-one The product of Example 350D (94 mg, 0.22 mmol) was reacted with cyclopropanecarbaldehyde (0.162 mL, 2.2 mmol) in N,N-dimethylacetamide (1 mL) in a 30 sealed tube at 120°C for 90 minutes in a microwave reactor. The reaction was cooled to 25°C and concentrated under reduced pressure. The resulting residue was triturated with diethyl ether and filtered to give the title compound (78.9 mg, 75%).
-353-
Figure imgf000356_0001
Example 350G l-r(cycloprvopylmethyl)aminol-4-hydroxy-3-(7-r(methoxymethoxy)methyll-Ll-dioxido-4H- thienor2.3-eiri,2,41thiadiazin-3-yllquinolin-2(lH)-one The product of Example 350F (78.9 mg, 0.16 mmol) in tetrahydrofuran (4 mL) and methanol (0.013 mL, 0.32 mmol) at 0°C was treated dropwise with a 2.0 M solution of lithium borohydride in tetrahydrofuran (0.131 mL, 0.24 mmol). The reaction was stirred at 25°C for 1 hour, acidified with IN hydrochloric acid to approximately pH 2-4, diluted with water (20 mL), and the resulting precipitate was collected by filfration and dried. The crude product was chromatographed on silica gel with 2% methanol/ dichloromethane to give the title compound (41.6 mg, 52.5%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.15 (d, 7=4.41 Hz, 2 H), 0.42 (d, 7=8.09 Hz, 2 H), 1.01 (m, 1 H), 2.84 (d, 7=6.62 Hz, 2 H), 4.64 (s, 2 H), 4.71 (s, 2 H), 6.36 (br.s, 1 H), 7.41 (m, 2 H), 7.88 (t, 7=7.35 Hz, 1 H), 8.07 (d, 7=8.46 Hz, 1 H), 8.16 (d, 7=8.09 Hz, 1 H). MS (EST) m/z 489 (M-H)".
Example 351 l-r(cvclopropylmethyl)aminol-4-hvdroxy-3-r7-(hvdroxymethyl)-l,l-dioxido-4H-thienor2,3- eiri,2,41thiadiazin-3-yl1quinolin-2(lH)-one The product of Example 350G (35 mg, 0.07 mmol) at 0°C was treated with 4 N solution of hydrogen chloride in 1,4-dioxane (1 mL). The reaction was stiπed at 0°C for 2 hour and 25°C for 3 hour, basified with 10% sodium bicarbonate (3 mL) and extracted with 2% methanol/ dichloromethane. The solvent was concenfrated and the residue was purified by flash column chromatography on silica gel eluting with 7% methanol/dichloromethane to give the title compound as a white solid (20 mg, 62.7%). The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 0.15 (d, 7=4.04 Hz, 2 H), 0.42 (d, 7=8.09 Hz, 2 H), 1.01 (m, 1 H), 2.81 (d, 2 H), 4.62 (s, 2 H), 5.55 (br.s, 1 H), 6.35 (br.s, 1 H), 7.28 (s, 1 H), 7.39 (m, 1 H), 7.85 (m, 1 H), 8.03 (m, 1 H), 8.15 (d, 7=7.35 Hz, 1 H). MS (EST) m/z 489 (M-H)".
-354- Example 352A ethyl 3-{r2-(aminosulfonyl)-4-(benzyloxy)phenyπaminol-3-oxopropanoate A suspension of the product of Example 304D (508.3 mg, 1.826 mmol) and triethylamine (0.47 mL, 3.394 mmol) in anhydrous dichloromethane (10 mL) was cooled to 0°C under a nitrogen atmosphere. Ethyl malonyl chloride (0.43 mL, 3.023 mmol) was added dropwise and the resulting gold colored solution was stirred at 0°C for 15 minutes, then at room temperature for 5 hours. The reaction was diluted with dichloromethane (50 mL) and washed with water (20 mL). The aqueous wash was exfracted with dichloromethane (25 mL), and the combined organic layers were washed with IN aqueous hydrochloric acid (20 mL), water (20 mL), and brine (20 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent removed under reduced pressure. The yellow oil was purified by column chromatography on silica gel eluting with a gradient of 12% to 15% ethyl acetate/dichloromethane to give the title compound as a white solid (340 mg, 47%). MS (ESI") m/z 391 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.22 (t, 7=7.17 Hz, 3 H) 3.56 (s, 2 H) 4.14 (q, 7=6.99 Hz, 2 H) 5.15 (s, 2 H) 7.27 (dd, 7=9.01, 3.13 Hz, 1 H) 7.42 (m, 8 H) 7.75 (d, 7=8.82 Hz, 1 H) 9.42 (s, 1 H).
Example 352B ethyl |7-(benzyloxy)- 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl1 acetate The product of Example 352A (292 mg, 0.744 mmol) and sodium carbonate (394 mg,
3.722 mmol) in anhydrous ethanol (12 mL) was heated to reflux under a nitrogen atmosphere for 6.5 hours. The reaction was cooled to room temperature, filtered, and the filtrate concentrated under reduced pressure. The residue was purified by column chromatography on silica gel eluting with 3% methanol/dichloromethane to give the title compound as a white solid (237 mg, 85%). MS (EST) m/z 373 (M-Η)". 1H NMR (300 MHz, DMSO-d6) δ 1.21 (t, 7=6.99 Hz, 3 H) 3.67 (s, 2 H) 4.16 (q, 7=6.99 Hz, 2 H) 5.20 (s, 2 H) 7.39 (m, 8 H) 12.21 (s, 1 H).
Example 352C ethyl (7-hydroxy-l , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)acetate The product of Example 352B (277 mg, 0.7398 mmol) in ethanol (20 mL) was hydrogenated at 1 atmosphere hydrogen pressure (balloon) with 10% palladium on carbon (28 mg, 10 weight %) for 1.25 hour. The reaction was filtered through a PTFE membrane filter (0.45 μm) and the catalyst thoroughly washed with ethanol (50 mL). The filtrate was concentrated under reduced pressure and the resulting oil triturated with dichloromethane/hexanes (1:1 v/v) to give the title compound as a crystalline white solid (194 mg, 92%). MS (EST) m/z 283 (M-Η)". 1H NMR (300 MHz, DMSO-d6) δ 1.21 (t, 7=7.17 Hz, 3 H) 3.64 (s, 2 H) 4.15 (q, 7=7.23 Hz, 2 H) 7.06 (d, 7=2.57 Hz, 1 H) 7.11 (dd,
-355- 7=8.83, 2.57 Hz, 1 H) 7.20 (d, 7=8.83 Hz, 1 H) 10.21 (s, 1 H) 12.11 (s, 1 H).
Example 352D ethyl (7-hvdroxy-8-nifro-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)acetate A suspension of the product of Example 352C (100 mg, 0.352 mmol) in glacial acetic acid (3 mL) was treated at room temperature with a solution of concentrated nitric acid in glacial acetic acid (1.43 M, 0.305 mL, 0.436 mmol) and stirred at this temperature for 19 hours. Abided additional 1.43 M nitric acid/acetic acid (0.020 mL, 0.029 mmol) and let stir for 1.5 hours. The reaction was diluted with water (30 mL) and exfracted with ethyl acetate (2 x 50mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel eluting with 8% methanol/dichloromethane to give the title compound as a light yellow solid (47 mg, 41%). MS (ESI") m/z 328 (M-Η)". 1H NMR (300 MHz, PYRIDINE-ds) δ 0.98 (t, 7=7.17 Hz, 3 H) 3.86 (s, 2 H) 4.01 (q, 7=7.23 Hz, 2 H) 7.11 (d, 7=8.82 Hz, 1 H) 7.22 (d, 7=8.82 Hz, 1 H).
Example 352E ethyl (8-amino-7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)acetate The product of Example 352D (61 mg, 0.1852 mmol) in methanol (5 mL) was hydrogenated at 1 atmosphere hydrogen pressure (balloon) with 10% palladium on carbon (9 mg, 15 weight %) for 45 minutes. The reaction was filtered through a PTEE membrane filter (0.45 μm) and the catalyst thoroughly washed with warm methanol (50 mL). The filtrate was concentrated under reduced pressure to give the title compound as a beige solid (55 mg, 99%). MS (EST) m/z 298 (M-Η)". ]Η NMR (300 MHz, DMSO-de) δ 1.21 (t, 7=7.17 Hz, 3 H) 3.61 (s, 2 H) 4.15 (q, 7=6.99 Hz, 2 H) 5.22 (s, 2 H) 6.40 (d, 7=8.46 Hz, 1 H) 6.93 (d, 7=8.46 Hz, 1 H) 9.82 (s, 1 H) 11.86 (s, 1 H).
Example 352F ethyl (8-methyl-l . l-dioxido-4H-r 1 ,31oxazolor5 A-hλ IT ,2,41benzothiadiazin-3-yl)acetate A solution of the product of Example 352E (56.3 mg, 0.188 mmol) in anhydrous N,N- dimethylformamide (2 mL) was treated with trimethylorthoacetate (0.098 mL, 0.752 mmol) and p-toluenesulfonic acid monohydrate (1 mg) at room temperature for 3 hours under a nitrogen atmosphere. The solvent was removed under reduced pressure and the residue purified by column chromatography on silica gel eluting with 4% methanol/dichloromethane to give the title compound as a white crystalline solid (48 mg, 79%). MS (EST) m/z 322 (M- Η)\ 1H NMR (300 MHz, DMSO-d6) δ 1.22 (t, 7=7.17 Hz, 3 H) 2.69 (s, 3 H) 3.71 (s, 2 H) 4.17 (q, 7=7.11 Hz, 2 H) 7.27 (d, 7=8.82 Hz, 1 H) 8.02 (d, 7=8.82 Hz, 1 H) 12.33 (s, 1 H).
Example 352G 4-hydroxy-l-(3-methylbutyl)-3-(8-methyl-l,l-dioxido-4H-ri,31oxazolor5,4-
-356- hiri.2,41benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one To a solution of the product of Example 12A (16.7 mg, 0.0714 mmol) and the product of Example 352F (23.1 mg, 0.0714 mmol) in anhydrous tetrahydrofuran (2 mL) at 0°C was added sodium hydride (60%, 11.4 mg, 0.286 mmol) under a nitrogen atmosphere. The reaction was heated at reflux for 3 hours, -cooled to 0°C, and treated with glacial acetic acid (0.165 mL). The resulting yellow solution was heated at reflux for 2 hours, cooled to 0°C, diluted with water (5 mL), and acidified with IN aqueous hydrochloric acid to pH 3. The resulting precipitate was collected by filtration, washed with water and dried to give the title compound as a yellow sohd (20 mg, 60%). MS (EST) m/z 466 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 0.99 (d, 7=6.25 Hz, 6 H) 1.58 (m, 2 H) 1.71 (m, 1 H) 2.73 (s, 3 H) 4.50 (m, 2 H) 7.50 (dd, 7=7.72, 4.41 Hz, 1 H) 7.64 (d, 7=8.82 Hz, 1 H) 8.10 (d, 7=8.82 Hz, 1 H) 8.57 (dd, 7=7.91, 2.02 Hz, 1 H) 8.89 (dd, 7=4.60, 2.02 Hz, 1 H) 14.18 (s, 1 H). A suspension of the product of Example 352G (14:6 mg, 0.0312 mmol) in anhydrous tetrahydrofuran (3 mL) and distilled water (1 mL) was treated with 0.998 N aqueous sodium hydroxide (0.0313 mL, 0.0312 mmol) and the yellow solution mixed for 15 minutes. The solvent was removed under reduced pressure and the residue dried to afford the sodium salt of Example 352G (15 mg, 98%). 1H NMR (300 MHz, DMSO-d6) δ 0.97 (d, 7=6.25 Hz, 6 H) 1.48 (m, 2 H) 1.65 (m, 1 H) 2.67 (s, 3 H) 4.30 (m, 7=8.82, 6.25 Hz, 2 H) 7.13 (dd, 7=7.91, 4.60 Hz, 1 H) 7.21 (d, 7=8.82 Hz, 1 H) 7.86 (d, 7=8.82 Hz, 1 H) 8.38 (dd, 7=8.09, 1.47 Hz, 1 H) 8.53 (m, 7=2.94 Hz, 1 H) 16.09 (s, 1 H).
Example 353A l-r(cyclopropylmethyl)aminol-4-hvdroxyquinolin-2(lH)-one To the suspension of the product of Example 350A (1.033 g, 5.86 mmol) in methanol " (58 mL) was added acetic acid (0.29 mL) and cyclopropylcarboxaldehyde (482 μL, 6.45 mmol) followed by the addition of sodium cyanoborohydride (744.6 mg, 11.85 mmol) at room temperature. The suspension was stirred at room temperature overnight and quenched with half saturated brine (100 mL) and sodium bicarbonate (425 mg, 5.06 mmol). The mixture was extracted with ethyl acetate (300 mL) and the organic layer was separated and washed with half saturated brine (2 x 50 mL). The combined aqueous layers were extracted with dichloromethane (2 x 100 mL). The combined organic solution was dried with magnesium sulfate, filtered and concentrated. The residue was used without any purification. !Η NMR (300 MHz, DMSO-d6) δ 0.09 (m, 2 H) 0.40 (m, 2 H) 0.95 (m, 1 H) 2J0 (t, 7=6.43 Hz, 2 H) 5.91 (s, 1 H) 6.10 (t, 7=6.07 Hz, 1 H) 7.21 (m, 1 H) 7.62 (t, 7=7.17 Hz, 1 H) 7.87 (m, 2 H) 11.42 (br s, 1 H).
-357- Example 353B 3-rbis(methylthio)methylene1-l-r(cyclopropylmethyl)aminolquinoline-2,4(lH,3H)-dione To the suspension of the product of Example 353A (984.4 mg, 4.28 mmol) in 1,4- dioxane (40 mL) was added pyridine (2.8 mL, 34.6 mmol) and tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (2.26 g, 8.55 mmol) at room temperature. The suspension was put in a preheated oil bath at 55°C and stiπed for 15 minutes. To the solution was addecl another portion oftris(methylthio)methyl methyl sulfate (2.26 g, 8.55 mmol) and the mixture, was stiπed at 55 °C for 15 minutes and cooled to room temperature. The mixture was concentrated in vacuo and the residue was diluted with dichloromethane and loaded on a silica gel column and eluted with dichloromethane, 2% ethyl acetate/dichloromethane and then 5% ethyl acetate/dichloromethane to give the title compound (852.1 mg, 60%). 1H NMR (300 MHz, DMSO-d6) δ 0.15 (m, 2 H) 0.42 (m, 2 H) 0.98 (m, 1 H) 2.61 (s, 6 H) 2J3 (t, 7=6.43 Hz, 2 H) 6.05 (t, 7=5.88 Hz, 1 H) 7.15 (m, 1 H) 7.64 (m, 1 H) 7J6 (d, 7=8.09 Hz, 1 H) 7.98 (m, 1 H).
Example 353C l-r(cvclopropylmethyl)amino]-4-hydroxy-3-{7-f(methoxymethoxy)methvn-l,l-dioxido-4H- thienor2,3-eiri,2,41thiadiazin-3-yllquinolin-2(1 7r)-one A solution of the product of Example 353B (500.3, 1.5 mmol) and the product of Example 309G (377.62 mg, 1.5 mmol) in dioxane (15mL) was stirred at reflux for 1.5 hours and concentrated under reduced pressure. The residue was purified by chromatography on silica gel eluting with 0% to 10% ethyl acetate/dichloromethane to give the title compound (384J mg, 52%). 1H NMR (300 MHz, DMSO-d6) δ 0.15 (m, 2 H) 0.42 (m, 2 H) 1.01 (m, 1 H) 2.84 (d, 7=6.99 Hz, 2 H) 4.64 (s, 2 H) 4.71 (s, 2 H) 6.36 (br s, 1 H) 7.42 (m, 2 H) 7.86 (m, 1 H) 8.07 (d, 7=8.46 Hz, 1 H) 8.16 (m, 1 H).
Example 353D • 3-r7-(azidomethyl)-l,l-dioxido-4H-thienor2,3-eiri.2,41thiadiazin-3-vn-l- r(cyclopropylmethyl)amino1-4-hydroxyquinolin-2(lH)-one To the product of Example 353C (384.7 mg, 0.78 mmol) was added a solution of hydrogen chloride in dioxane (4N, 7.8 mL) at 0°C. The solution warmed to room temperature and stiπed for 5.5 hours and concentrated under reduced pressure. This solid was suspended in dichloromethane (7.8 mL) and to the suspension was added 1,8- diazabicyclo[5.4.0]undec-7-ene (0.6 mL, 4.01 mmol) and diphenylphosphoryl azide (0.85 mL, 3.94 mmol) at room temperature and stirred overnight. The solution was concentrated in vacuo. The residue was purified by chromatography, eluting with 1% triethylamine/dichloromethane to give a triethylamine salt of the title compound (357mg, 79%). MS (EST) m/z 470 (M-Η)". 1Η NMR (300 MHz, DMSO-d6) δ 0.22 (m, 2 H) 0.46 (br
-358- d, 7=7.35 Hz, 2 H) 1.01 (m, 1 H) 4.52 (s, 2 H) 5.98 (t, 7=6.62 Hz, 1 H) 7.24 (s, 1 H) 7.40 (m, 1 H) 7.56 (m, 1 H) 8.05 (m, 1 H).
Example 353E 3-r7-(aminomethyl)-lT-dioxido-4H-thienor2.3-eiri,2,41thiadiazin-3-yl1-l- 5 r(cyclopropylmethyl)aminol-4-hydroxyquinolin-2(lH)-one
To the solution of the product of Example 353D (357 mg, 0.62 mmol) in pyridine (4.6 mL) and concentrated ammonium hydroxide (3 mL) was added triphenylphosphine (397 mg, 1.51 mm^l) at room temperature. The solution was stiπed at room temperature overnight and concentrated under reduced pressure. The residue was diluted with 30% hexane/toluene and lό the solid was filtered to give the title compound (250 mg, 90%). MS (EST) m/z 446 (M+Η)+. 1H NMR (300 MHz, DMSO-d6) δ 0.21 (m, 2 H) 0.46 (br d, 7=8.09 Hz, 2 H) 1.00 (m, 1 H) 4.12 (s, 2 H) 5.98 (t, 7=6.43 Hz, 1 H) 7.12 (m, 1 H) 7.22 (s, 1 H) 7.58 (m, 1 H) 7J2 (d, 7=7.72 Hz, 1 H) 8.04 (m, 1 H).
Example 353F 15 N-r(3-{ l-r(cvclopropylmethyl)aminol-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yll-l,l- dioxido-4H-thienor2,3-eiri,2,41thiadiazin-7-yl)methyllmethanesulfonamide To the suspension of the triethylamine salt of the product of Example 353E (85.26 mg, 0.16 mmol) in N,N-dimethylformamide (1.6 mL) was added triethylamine (48 μL, 0.34 mmol) and then methanesulfonyl chloride (13.3 μL, 0.17 mmol) at room temperature. The 20 solution was stirred at room temperature for 20 minutes and concentrated in vacuo. The residue purified by reverse phase chromatography, eluting with 20% to 95% acetonitrile/0.1% triflouroacetic acid in water to give the title compound (39.86 mg, 49%). MS (ESI*) m/z 524 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 0.15 (m, 2 H) 0.42 (m, 2 H) 1.01 (m, 1 H) 2.84 (d, 7=7.35 Hz, 2 H) 2.99 (s, 3 H) 4.29 (d, 7=6.25 Hz, 2 H) 6.37 (br s, 1 H) 5 7.41 (m, 2 H) 7.75 (t, 7=6.25 Hz, 1 H) 7.87 (m, 1 H) 8.08 (d, 7=8.09 Hz, 1 H) 8.16 (m, 1 H)" 14.46 (m, 1 H).
Example 354 3-(8-amino-7-hvdroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l- (isobutylamino)quinolin-2(lH)-one 30 A solution of the product of Example 321C (0.26 g, 0.61 mmol) in concentrated sulfuric acid (4 mL) at 0°C was treated with ammonium nitrate (55 mg, 0.69 mmol). After stirring at room temperature for 30 minutes, the solution was poured into ice water and the precipitate was filtered, dried, and triturated with ethyl acetate to yield to nitrated intermediate (0.23 g, 79%). A solution of this solid (0.23 g, 0.48 mmol) in 5 methanol:tetrahydrofuran:water (3:3:1) (2.3 mL) was treated with powdered iron (0.12 g, 2.15 mmol) and ammonium chloride (0.031 g, 0.58 mmol) at 60°C for 1 hour. The warm solution was filtered through diatomaceous earth, rinsed with tetrahydrofuran. The filtrate
-359- was concentrated and the resulting solid was triturated with 1:1 dichloromethane: ethyl acetate to yield the title compound (0.088 g, 42%). MS (EST) m/z 442 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 1.04 (d, 7=6.62 Hz, 6 H) 1.92 (m, 1 H) 2J6 (m, 2 H) 5.40 (s, 2 H) 6.34 (m, 1 H) 6.66 (d, 7=7.72 Hz, 1 H) 7.00 (d, 7=8.46 Hz, 1 H) 7.44 (m, 1 H) 7.94 (m, 2 H) 8.17 (d, 7=6.99 Hz, 1 H) 10.12 (s, 1 H) 13.82 (s, 1 H) 15.19 (s, 1 H). l
Example 355 3-(l,l-dioxido-4H-ri.31oxazolor5,4-hiπ.2.41benzothiadiazin-3-yl)-4-hvdroxy-l-
V (isobutylamino)quinolin-2(lH)-one
A solution of Example 354 (0.036 g, 0.081 mmol) in dimethylformamide (2 mL) was freated with trimethyl orthoformate (1 mL) and a catalytic amount of para-toluenesulfonic acid at room temperature for 20 hours. The solvent was removed under a stream of warm nitrogen and the residue was triturated with 1:1 ethyl acetate: tetrahydrofuran, filtered, and dried to yield the title compound (8 mg, 22%). MS (EST) m/z 452 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 1.05 (d, J=6.62 Hz, 6 H) 1.93 (m, 1 H) 2.78 (m, 2 H) 6.33 (m, 1 H) 7.45 (t, 1=7.54 Hz, 1 H) 7.73 (d, J=8.82 Hz, 1 H) 7.92 (t, J=7.72 Hz, 1 H) 8.00 (m, 1 H) 8.21 (m, 2 H) 9.04 (s, 1 H) 14.28 (s, 1 H).
Example 356 2-(i8-amino-3-r4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl1-l,l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl I o y)acetamide A solution of the product of Example 321C (0.49 g, 1.15 mmol) in concentrated sulfuric acid (6 mL) at 0°C was treated with ammonium nitrate (100 mg, 1.25 mmol). After stirring at room temperature for 1 hour, the solution was poured into ice water and the precipitate was filtered, dried, and triturated with ethyl acetate to yield to nitrated intermediate (0.27 g, 49%). A solution of the nitrated intermediate (75 mg, 0.16 mmol) in N,N-dimethylformamide (3 mL) was treated with 2-bromoacetamide (33mg, 0.24 mmol) arid cesium carbonate (206 mg, 0.63 mmol) in the presence of a catalytic amount of tetrabutylammonium idodide at room temperature for 24 hours. The solvent was removed with a stream of warm nitrogen and the residue was triturated with water, filtered, and dried to yield the alkylated material (76 mg, 90%). A solution of this material in a 3:3: 1 mixture of methanol:tetrahydrofuran:water (2.3 mL) was treated with powdered iron (36 mg, 0.64 mmol) and ammonium chloride (9 mg, 0.17 mmol) at 60 °C for 2 hours. The solution was filtered through diatomaceous earth, and rinsed with tetrahydrofuran. The filfrate was concentrated and purified by flash column, eluting with 1% methanol in dichloromethane to yield the title compound (16mg, 22%). The sodium salt was prepared by the procedure of Example ID. MS (EST) m/z 499 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.03 (d, J=6.62 Hz, 6 H) 1.86 (m, 1 H) 2.55 (m, 2 H) 4.39 (s, 2 H) 5J3 (s, 2 H) 5.93 (t, J=7.54 Hz, 1 H) 6.37 (d, 1=8.46 Hz, 1 H) 7.04 (m, 2 H) 7.56 (m, 3 H) 7.84 (s, 1 H) 8.06 (d, J=8.46 Hz, 1 H) 15.91
-360- (s, 1 H).
Example 357 3-r8-(chloromethyl)-l.l-dioxido-4H-ri.31oxazolor5,4-hin,2,41benzothiadiazin-3-yll-4- hydroxy-l-(isobutylamino)quinolin-2(lH)-one 5 A solution of Example 354 (0.030 g, 0.067 mmol) in dimethylformamide (3 mL) was treated with 2-chloro-l,l,l-trimethoxyethane (0.50 mL) and a catalytic amount of para- toluenesulfonic acid at 60°C for 4 hours. The solvent was removed under a stream of warm nifrogen nd the resulting residue was triturated with water and filtered, then triturated with methanol and filtered to yield the title compound (22 mg, 51%). The sodium salt was made lό by the procedure of Example ID. MS (EST) m z 500 (M-H)". 1H NMR (300 MHz, DMSO- de) δ 1.04 (d, J=6.62 Hz, 6 H) 1.87 (m, J=20.04, 13.42, 6.99 Hz, 1 H) 2.63 (m, 2 H) 5.13 (s, 2 H) 5.95 (t, J=6.99 Hz, 1 H) 7.08 (t, J=7.54 Hz, 1 H) 7.36 (d, J=9.19 Hz, 1 H) 7.57 (m, 2 H) 7.99 (d, J=8.82 Hz, 1 H) 8.09 (dd, J=7.91, 1.29 Hz, 1 H) 16.59 (s, 1 H).
15 Example 358 A
3-r7-(benzyioxy)-l.l-dioxido-4H-l,2,4-benzothiadiazin-3-yn-4-hydroxy-l- rpropylideneamino1quinolin-2(iH)-one The product of Example 304F (0.1 g, 0.22 mmol) in N,N-dimethylacetamide (lmL) was reacted with propionaldehyde diethylacetal (0.34 mL, 2.2 mmol) ih a sealed tube in a 20 microwave reactor at 100°C for 60 minutes. The reaction was cooled to 25°C, concentrated under a stream of nitrogen warmed through a manifold heated to 165°C and the resulting residue was triturated with diethyl ether to give the title compound (0.045g, 42 %).
Example 358B 3- F7-(benzyloxy)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yll-4-hydroxy- 1 - 5 ■ (propylamino)quinolin-2(lH)-one
The product of Example 358A (0.045 g, 0.09 mmol) in tetrahydrofuran (2 mL) at 0°C was treated with methanol (0.005 mL, 0.35 mmol), followed by dropwise addition of a 2.0 M solution of lithium borohydride in tefrahydrofuran (0.07 mL, 0.13 mmol), stirred at 25°C for one hour, and diluted with 1 N hydrochloric acid. The resulting precipitate was filtered and 30 dried. The solid was dissolved in tetrahydrofuran and absorbed onto silica gel by evaporating to dryness. The resulting silica was loaded onto a 2g Alltech sep pack and eluted with dichloromethane to give the title compound (0.020 g, 44 %). MS (EST) m/z 503 (M-Η)".
Example 358C 4-hydroxy-3-(7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l- 35 (propylamino)quinolin-2(lH)-one
The product of Example 358B (0.020 g, 0.04 mmol) in tefrahydrofuran (5 mL) was treated with ammonium formate (13 mg, 0.19 mmole), palladium hydroxide (2 mg) and 10%
-361- Pd/C (1 mg) and the resulting mixture was refluxed for 1 hour. The catalyst was filtered off and the filtrate evaporated to give a white solid. The solid residue was partitioned between ethyl acetate (100 mL) and water (5 mL). The layers were separated and the organic solvent was removed under reduced pressure to give the title compound (0.016 g, 100%). MS (ESI") m/z 413 (M-H)".
Example 358D 2-({3-r4-hvdroxy-2-oxo-l-(propylamino)-l,2-dihvdroquinolin-3-vn-lJ-dioxido-4H-l,2,4- v benzothiadiazin-7-ylloxy)acetamide
The. product of Example 358C (0.016 g, 0.04 mmol) in N,N-dimethylformamide (2 mL) was reacted with cesium carbonate (0.015 g, 0.045 mmol), bromoacetamide (0.006 g, 0.18mmol), and a catalytic amount of tetrabutylammonium iodide at 25°C for 3 hours. The reaction was concentrated under a stream of nitrogen stream of nitrogen warmed through a manifold heated to 165°C and the resulting residue was triturated with water, filtered and dried. The resulting solid was triturated in hot ethyl acetate, filtered, and dried to give the title compound (0.008 g, 37%). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (ESI") m/z 470 (M-H)". Η NMR (300 MHz, DMSO-de) δ 0.99 (m, 3 H)1.55 (t, 2 H) 2.73 (t, 2 H) 4.11 (d, 1 H) 4.41 (d, 1 H) 5.83 (d, 1 H) 7.05 (s, 3 H)7.39 (s, 1 H) 7.54 (s, 2 H) 7.98 (s, 1 H) 16.24 (s, 1 H).
Example 359 3-{3- 4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yll-l,l-dioxido-4H- ri,31oxazoIor5,4-hiri,2,41benzothiadiazin-8-yI Ipropanoic acid A solution of the product of Example 354 (15 mg, 0.033 mmol) and maleic anhydride (100 mg, 1.0 mmol) in pyridine (2 mL) was heated at 160°C in a microwave reactor for 1 hour. The crude mixture was cooled to 25°C and purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous trifluoroacetic to yield the title compound (5.3 mg, 30%). The disodium salt was made by the procedure of Example ID using 2 equivalents of sodium hydroxide. MS (ESI") m/z 524 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.03 (d, J=6.25 Hz, 6 H) 1.86 (m, 1 H) 2.27 (m, 4 H) 2.66 (m, 2 H) 5.94 (t, J=7.54 Hz, 1 H) 6.81 (m, 2 H) 7.05 (t, J=7.91 Hz, 1 H) 7.53 (m, 2 H) 8.06 (d, J=6.62 Hz, 1 H) 15.74 (s, 1 H).
Example 360 3-(8-{ r(2-aminoethyl)aminolmethvIl-l,l-dioxido-4H-ri,31oxazolor5,4- hiri,2,41benzothiadiazin-3-vD-4-hvdroxy-l-(isobutylamino)quinolin-2(lH)-one A solution of the product from Example 357 (20 mg, 0.039 mmol) and tert-butyl-N- (2-aminoethy])carbamate (7.7 mg, 0.046 mmol) in N,N-dimethylformamide (3 mL) was treated with cesium carbonate (39 mg, 0.117 mmol) at 50°C for 2 hours. The solvent was removed with a stream of warm nitrogen and the resulting residue was triturated with water,
-362- filtered and dried. This solid was suspended in 1,4- dioxane (2 mL) and treated with a 4M solution of hydrochloric acid in 1,4-dioxane (2 mL) and stirred at room temperature for 20 hours. The solution was concentrated by half, filtered, and dried to yield the dihydrochloride salt of the title compound (5.8 mg, (24%). MS (EST) m/z 524 (M-H)". 1H 5 NMR (500 MHz, benzene-d6) δ 1.05 (d, J=6J1 Hz, 6 H) 1.93 (m, 1 H) 2.60 (m, 2 H) 2.81 (d, J=6.10 Hz, 2 H) 3.61 (m, 2 H) 4.67 (s, 2 H) 6.17 (m, 1 H) 7.05 (d, J=9.16 Hz, 1 H) 7.20 (d, .1=8.54 Hz, 1 H) 7.44 (t, J=7.63 Hz, 1 H) 7.90 (m, 1 H) 7.99 (m, 2 H) 8.17 (d, J=7.93 Hz, 1 H) 8.24 (m,"£ H) 13.76 (s, 1 H).
Example 361 lό 2-(|3-r4-hvdroxy-l-(isobutylamino)-2-oxo-1.2-dihvdroquinolin-3-yll-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yl 1 oxy)propanamide To a solution of the product of Example 321C (20 mg, 0.0467 mmol) in N,N- dimethylformamide (2 mL) was added 2-bromopropionamide (10.6 mg, 0.070 mmol), tetra- /i-butylammonium iodide (1.7 mg, 0.0047 mmol) and cesium carbonate (61 mg, 0.187
15 mmol). The mixture was stirred at 25°C for 72 hours. To the solution was then treated with IN aqueous hydrochloric acid (10 mL) and extracted with ethyl acetate (10 mL). The organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (18.4 mg, 79%). The sodium salt of the title compound was prepared according to the procedure of Example ID. MS (EST) m/z
20 498 (M-Na)". 1H NMR (300 MHz, DMSO-d6) δ 1.03 (d, 7 = 6.6Hz, 6H), 1.45 (d, 7 = 6.6Hz, 3H), 1.86 (m,lH), 2.50 (m,lH), 2.75 (m,lH), 4.65(q, 7 = 6.6Hz,lH), 5.94(t, 7 = 7.3Hz, IH), 7.08 (m,2H), 7.17 (m,lH), 7.23 (m,lH), 7.29 (s,lH), 7.58 (m,2H), 7.64 (s,lH), 8.07 (d, 7 = 6.6Hz,lH), 16.22 (s,lH).
Example 362 5 2-({3-r4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihvdroquinolin-3-vn-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yl 1 oxy)butanamide To a solution of the product of Example 321C (20 mg, 0.0467 mmol) in N,N- dimethylformamide (2 mL) was added 2-chlorobutyramide (8.5 mg, 0.070 mmol), tetra-n- butylammonium iodide (1.7 mg, 0.0047 mmol) and cesium carbonate (61 mg, 0.187 mmol).
30 The mixture was stirred at 25°C for 18 hours, then heated to 80°C for 3 hours. After cooling to 25°C, IN aqueous hydrochloric acid (10 mL) was added and the mixture extracted with ethyl acetate (10 mL). The resulting organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (24 mg, 100%). The sodium salt of the title compound was prepared according to the procedure 5 of Example ID. MS (EST) m/z 512 (M-Na)". !H NMR (300 MHz, DMSO-d6) δ 0.99 (t, 7 = 7.7Hz, 3H), 1.03 (d, 7= 6.3Hz, 6H), 1.83 (m,3H), 2.50 (m,lH), 2.75 (m,lH), 4.46 (m,lH), 5.94 (m,lH), 7.08 (m,2H), 7.17 (m,lH), 7.23 (m,lH), 7.32 (s,lH), 7.58 (m,2H), 7.64 (s,lH),
-363- 8.07 (d, 7 = 7.8Hz,lH), 16.23 (bs,lH).
Example 363 methyl {3-r4-hvdroxy-l-(isobutylamino)-2-oxo-l,2-dihvdroquinolin-3-vn-l,l-dioxido-4H- ri,31oxazolor5,4-hiri,2,41benzothiadiazin-8-yl)acetate
A solution of the product of Example 354 (67.5 mg, 0.015 mmol) in N,N- dimethylformamide (2 mL) was treated with p-toluenesulfonic acid monohydrate (1 mg) and monoorthomalonic acid tetramethyl ester (272 mg, 1.52 mmol). The mixture was heated at 50° C in an.oil bath under a nitrogen atmosphere and the resulting yellow solution was stiπed for 3hrs. At this time, additional ortho ester was added (272 mg, 1.52 mmol) and heating continued for another 5 hrs. The reaction was cooled to room temperature and the solution was concentrated by rotary evaporation in vacuo. The residue was further dried on a vacuum pump, then dissolved in dichloromethane (100 mL) and washed with water (2 x 50 mL) and brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1% methanol/dichloromethane. The resulting impure material was rechromatographed on silica gel, eluting with a gradient of 5% to 7% acetonitrile/dichloromethane to give the title compound (36 mg, 45%). MS (APCf) m/z 526 (M+H)+. 1H NMR (300 MHz, DMSO-d6) δ 1.05 (d, 7=6.62 Hz, 6 H) 1.91 (m, 1 H) 2.77 (br m, 2 H) 3.72 (s, 3 H) 4.40 (s, 2 H) 6.36 (br m, 1 H) 7.45 (t, 7=7.35 Hz, 1 H) 7.70 (d, 7=9.19 Hz, 1 H) 7.94 (m, 2 H) 8.20 (d, 7=8.82 Hz, 2 H) 14.25 (br s, 1 H). A suspension of the product of Example 363 (6.0 mg, 0.0114 mmol) in anhydrous tetrahydrofuran (3 mL) and distilled water (1 mL) was treated with 0.998 N aqueous sodium hydroxide (0.0114 mL, 0.0114 mmol) and the yellow solution mixed for 15 minutes. The solvent was removed under reduced pressure and the residue dried on a vacuum pump to afford the sodium salt of Example 363 (6.1 mg, 98%). ]H NMR (300 MHz, DMSO-de) δ 1.04 (d, 7=5.15 Hz, 6 H) 1.88 (m, 1 H) 2.75 (m, 1 H) 3.72 (s, 3 H) 4.31 (s, 2 H) 5.95 (m, 1 H) 7.08 (m, 1 H) 7.30 (m, 1 H) 7.58 (m, 2 H) 7.95 (m, 1 H) 8.09 (m, 1 H) 16.55 (s, I H).
- Example 364
4-hydroxy-3-(8-{ r3-hvdroxypyrrolidin-l-yl1methyll-l,l-dioxido-4H-ri,31oxazolor5,4- hirL2,41benzothiadiazin-3-yl)-l-(isobutylamino)quinolin-2(lH)-one A solution of the product from Example 357 (80 mg, 0.160 mmol) and 3-hydroxy pyrrolidine (20 mg, 0.240 mmol) in acetonitrile (4 mL) was treated with diisopropylethyl amine (0.115 mL, 0.640 mmol) at room temperature for 24 hours. The solvent was removed under a stream of with warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7um particle size) using a gradient of 10%
-364- to 100% acetonitrile:0.1% aqueous trifluoroacetic to yield the title compound (16.2 mg, 18%). The sodium salt was made by the procedure of Example ID. MS (EST) m/z 551 (M- H)". IH NMR (300 MHz, DMSO-d6) δ 1.04 (d, J=6.62 Hz, 6 H) 1.58 (m, 1 H) 1.88 (m, 1 H) 2.03 (m, 1 H) 2.60 ( , 2 H) 2.75 (m, 2 H) 2.88 (m, J=9.56, 6.25 Hz, 2 H) 3.97 (s, 2 H) 4.23 (m, 1 H) 4.76 (m, 1 H) 5.95 (t, J=7.35 Hz, 1 H) 7.08 (m, 1 H) 7.27 (d, J=8.82 Hz, 1 H) 7.56 (m, 2 H) 7.92 (d, J=8.82 Hz, 1 H) 8.09 (d, J=6.62 Hz, 1 H) 16.51 (s, 1 H).
>} Example 365
• 3-riT-dioxido-8-(pyridinium-l-ylmethyl)-4H-ri,31oxazolor5,4-hirT2,41benzothiadiazin-3- yll-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-4-olate
A solution of the product of Example 357 (16.5 mg, 0.033 mmol) in pyridine (2 mL) was heated at 45°C for 20 hours. The excess pyridine was removed with a stream of warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous trifluoroacetic to yield the title compound (6 mg, 34%). MS (EST) m/z 543 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.03 (d, J=6.62 Hz, 6 H) 1.84 (m, J=13.42, 6.43 Hz, 1 H) 2.72 (m, 2 H) 5.93 (t,' J=7.35 Hz, 1 H) 6.39 (s, 2 H) 7.07 (m, 1 H) 7.36 (d, J=8.82 Hz, 1 H) 7.56 (m, 2 H) 8.00 (d, J=8.82 Hz, 1 H) 8.08 (m, 1 H) 8.33 (m, 2 H) 8.78 (t, J=7.91 Hz, 1 H) 9.30 (d, J=5.52 Hz, 2 H) 16.59 (s, 1 H).
Example 366 3-ri.l-dioxido-8-(pyrrolidin-l-ylmethyl)-4H-ri.31oxazolof5,4-hiri,2,41benzothiadiazin-3- ylT4-hvdroxy-l-(isobutylamino)quinolin-2(lH)-one A solution of the product from Example 357 (80 mg, 0.160 mmol) and pyrrolidine (17 mg, 0.240 mmol) in acetonitrile (4 mL) was treated with diisopropylethyl amine (0.115 mL; 0.640 mmol) at ambient temperature for 24 hours. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonifrile:0.1% aqueous trifluoroacetic to yield the title compound (12.4 mg, 15%). The sodium salt was made by the procedure of Example ID. MS (EST) m/z 535 (M-H)". 1H
NMR (300 MHz, DMSO-dg) δ 1.04 (d, J=6.62 Hz, 6 H) 1.73 (m, 4 H) 1.87 (m, 1 H) 2.63 (q, J=4.90 Hz, 4 H) 2.75 (m, 2 H) 3.99 (s, 2 H) 5.95 (t, J=7.35 Hz, 1 H) 7.08 (m, 1 H) 7.27 (d, J=8.82 Hz, 1 H) 7.56 (m, 2 H) 7.92 (d, J=8.82 Hz, 1 H) 8.09 (dd, J=7.90, 1.29 Hz, 1 H) 16.50 (s, I H).
Example 367 -amino-3- r4-hydroxy- 1 -(isobutylamino)-2-oxo- 1 ,2-dihydroq uinoIin-3-yll -1,1 -dioxido-4H-
-365- 1 ,2,4-benzothιadiazin-7-yl methanesulfonate A solution of the product of Example 354 (44 mg, 0.099 mmol) and methane sulfonyl chloride (0.010 mL, 0.011 mmol) in tetrahydrofuran (4 mL) was treated with diisopropylethylamine (0.075 mL, 0.040 mmol) at roo, temperature for 2 hours. The solution 5 was poured into water. The resulting the precipitate was filtered, dried, and purified by flash column, eluting with 1% methanol in dichloromethane to yield the title compound (14.2 mg, 28%). The sodium salt was made by the procedure of Example ID. MS (ESI") m/z 520 (M- H)". 1H NMR (300 MHz, DMSO-de) δ 1.03 (d, J=6.62 Hz, 6 H) 1.88 (m, 1 H) 2.71 (m, 2 H) 3.46 (s, 3 H) 5.94 (m, 1 H) 6.53 (m, 1 H) 7.16 (m, 1 H) 7.35 (m, 1 H) 7.64 (m, 2 H) 8.09 (d, lό J=7.35 Hz, 1 H) 16.23 (s, 1 H).
Example 368 3-[8-(3-aminophenyl)-l,l-dioxido-4H-ri,31oxazolor5,4-hiπ,2,41benzothiadiazin-3-vn-4- hvdroxy-l-(isobutylamino)quinolin-2(lH)-one 15 A mixture of the product of Example 354 (38 mg, 0.086 mmol) and 3-aminobenzoic acid (13 mg, 0.094 mmol) in polyphosphoric acid (1 mL)was heated to 190°C for 1 hour. The solution was cooled to 25°C, triturated with water and a 10% solution of sodium carbonate. The solid was filtered, dried, and purified by flash column, eluting with 2% methanol in dichloromethane to yield the title compound (15mg, 38%). The sodium salt was 20 made by the procedure of Example ID. MS (EST) m/z 543 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 1.04 (d, J=6.62 Hz, 6 H) 1.86 (m, 1 H) 2.56 (m, 2 H) 5.53 (s, 2 H) 5.96 (t, J=7.35 Hz, 1 H) 6.82 (ddd, J=8.09, 2.21, 1.10 Hz, 1 H) 7.08 (td, J=7.35, 1.47 Hz, 1 H) 7.27 (m, 2 H) 7.36 (dt, J=7J2, 1.29 Hz, 1 H) 7.57 (m, 3 H) 7.96 (d, J=8.82 Hz, 1 H) 8.10 (dd, J=8.09, 1.47 Hz, 1 H) 16.51 (s, 1 H). 5
Example 369 3-r8-(aminomethyl)-l,l-dioxido-4H-ri,31oxazolor5,4-hiri,2,41benzothiadiazin-3-vn-4- hydroxy-l-(isobutylamino)quinolin-2(lH)-one A solution of the product of Example 357 (32 mg, 0.063 mmol) in tetrahydrofuran (2 0 mL) was treated with 20% ammonia in methanol (1 mL) and ammonium hydroxide (1 mL) and IM sodium hydroxide solution (0.063 mL, 0.063 mmol) at room temperature of 16 hours. The mixture was blown dry with warm nifrogen and the resulting residue was partitioned between water and ethyl acetate. The organic layer was concenfrated and purified by flash chromatography, eluting with a gradient of 100% dichloromethane to 2% methanol 5 in dichloromethane, to yield the title compound (4 mg, 13%). MS (EST) m/z 481 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.04 (d, J=6.62 Hz, 6 H) 1.91 (m, 1 H) 2.75 (m, 2 H) 4.55 (s, 2 H) 6.33 ( , 1 H) 6.98 (d, J=7.72 Hz, 1 H) 7.16 (d, J=8.46 Hz, 1 H) 7.44 (m, 1 H) 7.92 (m, 2
-366- H) 8.17 (d, J=8.09 Hz, 1 H) 13.65 (s, 1 H) 15.60 (s, 1 H).
Example 370 4-hvdroxy-3-[8-(hvdroxymethyl)-l,l-dioxido-4H-Fl,31oxazolof5,4-hirT2,41benzothiadiazin- 3-yll - 1 -(isobutylamino)quinolin-2( lH)-one
A solution of the product of Example 357 (32 mg, 0.063 mmol) in tetrahydrofuran (2 mL) was treated with 20% ammonia in methanol (1 mL) and ammonium hydroxide (1 mL) and IM sbdium hydroxide solution (0.063 mL, 0.063 mmol) at ambient temperature of 16 hours. The. mixture was blown dry with warm nitrogen and the resulting residue was partitioned between water and ethyl acetate. The aqueous layer was adjusted to pH 1 with IM hydrochloric acid and extracted with ethyl acetate. The organic layer was concentrated under reduced pressure to yield the title compound (5 mg, 16%). MS (ESI") m/z 482 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.04 (d, J=6.62 Hz, 6 H) 1.91 (m, 1 H) 2J6 (m, 2 H) 4.82 (s, 2 H) 6.34 (d, J=8.82 Hz, 1 H) 7.31 (d, J=8.82 Hz, 1 H) 7.43 (m, 2 H) 7.92 (m, 2 H) 8.18 (d, J=7.72 Hz, 1 H) 9.04 (s, 1 H) 14.31 (s, 1 H).
Example 371 3-f 8-r(butylamino)methvn-Ll-dioxido-4H-rL31oxazolor5,4-hiri,2,41benzothiadiazin-3-yl|- 4-hydroxy- 1 -(isobutylamino)quinolm-2(lH)-one A solution of the product of Example 357 (15.5 mg, 0.031 mmol) in pyridine (2 mL) was treated with n-butyl amine (0.030 mL, 0.31 mmol) at room temperature for 4 hours. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous trifluoroacetic to yield the title compound (1.2 mg, 7.2%). MS (ESI ) m/z 537 (M-H)". 1H.NMR (300 MHz, DMSO-d6) δ : 0.91 (t, 1=7.35 Hz, 3 H) 1.04 (d, J=6.62 Hz, 6 H) 1.36 (m, 2 H) 1.64 (m, 2 H) 1.87 (m, 1 H) 2.66 (m, 2 H) 3.05 (m, 2 H) 4.62 (s, 2 H) 5.96 (t, J=7.54 Hz, 1 H) 7.10 (t, J=6.80 Hz, 1 H) 7.39 (d, J=9.19 Hz, 1 H) 7.59 (m, 2 H) 8.02 (d, J=8.82 Hz, 1 H) 8.09 (d, J=8.09 Hz, 1 H) 16.54 (s, 1 H).
Example 372 RZ N- { 3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l ,2-dihvdro- 1 ,8-naphthyridin-3-yll-Ll-dioxido-
4H- 1 ,2,4-benzothiadiazin-7-yl lacetamide To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.5 mL) was added acetic anhydride (0.057 g, 0.0053 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 30 minutes. The reaction was poured into 30 mL of water. The solid was collected by filtration to give the title compound (15.8 mg, 72%). H
-367- NMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.70 (m, 1 H) 2.10 (s, 3 H) 4.48 (m, 2 H) 7.48 (dd, J=8.09, 4.78 Hz, 1 H) 7.66 (d, 1=8.82 Hz, 1 H) 7.78 (m, 1 H) 8.30 (d, 1=1.84 Hz, 1 H) 8.55 (dd, J=7.72, 1.84 Hz, 1 H) 8.87 (dd, J=4.60, 1.65 Hz, 1 H) 10.39 (s, 1 H) 14.21 (br s, 1 H). MS (ESI") m/z 468 (M-H)".
Example 373 2,2,2-trifluoro-N-13-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-1.8-naphthyridin-3- yll- 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-7-yl 1 acetamide
To a slurry of the product of Example 205 (0.043 g, 0.1 mmol) in 5 mL chloroform was added dropwise trifluoroacetic anhydride (0.074 g, 0.35 mmol). The reaction mixture was stirred for 30 minutes and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to give the title compound (0.048 g, 92% yield). MS (EST) m/z 522 (M- H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-dg) δ 0.96 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.65 (m, 1 H) 4.30 (m, 2 H) 7.14 (dd, J=7.54, 4.60 Hz, 1 H) 7.35 (d, J=8.82 Hz, 1 H) 7.83 (dd, J=8.82, 2.57 Hz, 1 H) 8.07 (d, J=2.57 Hz, 1 H) 8.37 (dd, J=7.72, 1.84 Hz, 1 H) 8.54 (dd, J=4.78, 1.84 Hz, 1 H) 11.43 (s, 1 H) 16.09 (s, 1 H).
, Example 374
2,2,2-trifluoro-N-{3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-l,8-naphthyridin-3- yll-8-nitro-l , l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl 1 acetamide To a solution of trifluoroacetic acid (2.5 mL) and trifluoroacetic anhydride (2.5 mL) at 0°C was added portion wise the product of Example 205 (0.5 g, 1.17 mmol). The resulting red solution was stirred at 0°C for 30 minutes, cooled to -20°C and treated portion wise with potassium nitrate (0.13 g, 1.3 mmol). The mixture was stiπed at -20°C for 1 hour, poured onto ice and the resulting tan solid was collected by filtration, washed with water and dried to constant mass to give the title compound (0.628 g, 94% yield). MS (EST) m/z 567 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 0.96 (d, J=6.62 Hz, 6 H) 1.49 (m, 2 H) 1.64 (m, 1 H) 4.30 (m, 2 H) 7.16 (dd, J=7.72, 4J8 Hz, 1 H) 7.67 (m, 2 H) 8.38 (dd, J=7.54, 2.02 Hz, 1 H) 8.57 (dd, 1=4.41, 1.84 Hz, 1 H) 11.61 (s, 1 H) 16.67 (s, 1 H).
Example 375 3-ri,l-dioxido-8-(trifluoromethyl)-4,7-mhydroimidazor4,5-hiri,2,41benzothiadiazin-3-yll-4- hydroxy-l-(3-methylbutyl)-L8-naphthyridin-2(lH)-one A mixture of the product of Example 374 (0.043 g, 0.075 mmol) and iron dust (0.025
-368- g, 0.45 mmol) in acetic acid (2 mL) was heated at 80°C for 1 hour, cooled, diluted with 20 mL ethyl acetate and filtered through a plug of Celite®. The ethyl acetate filtrate was washed with water, brine, dried over sodium sulfate, filtered and concentrated to give the title compound as an orange solid (0.035 g, 90% yield). MS (EST) m/z 519 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 0.97 (d, J=6.25 Hz, 6 H) 1.48 (m, 2 H) 1.66 (m, 1 H) 4.31 ( , 2 H) 7.14 (m, 1 H) 7.25 (d, J=8.46 Hz, 1 H) 7.96 (d, J=9.19 Hz, 1 H) 8.38 (d, J=6.99 Hz, 1 H) 8.54 (m, 1 H) 14.46 (s, 1 H) 16.33 (s, 1 H).
\ Example 376
3-(7-amino-8-nitro-l,l-dioxido-4H-L2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(3- methylbutvP- 1 ,8-naphthyridin-2( lH)-one
A mixture of the product of Example 374 (0.500 g, 0.88 mmol) and potassium carbonate (1.4 g, 10.1 mmol) in methanol (20 mL), tefrahydrofuran (8 mL) and water (8 mL) was heated at 60°C for 4 hours, cooled and concentrated. The resulting residue was dissolved in ethyl acetate, treated with IM hydrochloric acid to a pH of about 1, washed with brine, dried over sodium sulfate, filtered and concentrated to give the title compound as a brown solid (0.4 g, 96% yield). MS (EST) m/z 471 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-de) δ 0.96 (d, J=6.62 Hz, 6 H) 1.45 (m, 2 H) 1.64 (m, 1 H) 4.28 (m, 2 H) 6.37 (s, 2 H)
7.13 (dd, J=7.17, 4.23 Hz, 1 H) 7.16 (d, J=9.19 Hz, 1 H) 7.33 (d, J=9.19 Hz, 1 H) 8.35 (dd,
J=7.72, 1.84 Hz, 1 H) 8.53 (dd, J=4.78, 1.84 Hz, 1 H) 16.02 (s, 1 H).
Example 377 3-(7,8-diamino-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hvdroxy-l-(3-methylbutyl)-
1 , 8-naphthyridin-2( lH)-one A mixture of the product of Example 376 (2.1 g, 4.45 mmol), iron powder (1.24 g, 22.25 mmol) and ammonium chloride (0.29 g, 5.3 mmol) in methanol (50 mL), tetrahydrofuran (50 mL) and water (20 mL) was heated at 75°C for 6 hours, cooled and filtered through a plug of Celite®. The filtrate was treated with IM hydrochloric acid to a pH of about 2 and the solution was concentrated under vacuum. The resulting residue was stirred in 100 mL of water for 30 minutes and filtered to collect a solid which was then triturated with 50 mL of diethyl ether, filtered and dried to give the title compound (1.72 g, 87% yield). MS (EST) m/z 441 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. !H NMR (300 MHz, DMSO-d6) δ 0.96 (d, J=6.62 Hz, 6 H) 1.49 (m, 2 H) 1.63 (m, 1 H) 4.28 (m, 2 H) 4.63 (s, 2 H) 5.20 (s, 2 H) 6.30 (d, J=8.09 Hz, 1 H) 6.74 (d, J=8.46 Hz, 1 H) 7.10 (dd, J=7.72, 4.78 Hz, 1 H) 8.34 (dd, J=7.72,
-369- 1.84 Hz, 1 H) 8.50 (dd, J=4.60, 2.02 Hz, 1 H) 15.41 (s, 1 H).
Example 378 4-hvdroxy-3-(8-hydroxy-l,l-dioxido-4,7-dihydroimidazor4,5-hiri,2,41benzothiadiazin-3-vI)- l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one
A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and urea (0.012 g, 0.2 mmol) in N,N-dimethylacetamide (0.5 mL) in a sealed tube was heated by microwave at 180°C for1' 60 minutes. The mixture was cooled and partitioned between ethyl acetate and water adjusted to pH 3 with 1 M hydrochloric acid. The ethyl acetate layer was washed with water, brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting first with dichloromethane and then 96:4 dichloromethane/methanol to give the title compound (0.022 g, 90% yield). MS (EST) m/z 467 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. *H NMR (300 MHz, DMSO-d6) δ 0.97 (d, J=6.62 Hz, 6 H) 1.49 (m, 2 H) 1.65 (m, 1 H) 4.29 (m, 2 H) 6.69 (br. s, 1 H) 7.00 (br. s., 1 H) 7.12 (dd, J=7.72, 4.78 Hz, 1 H) 8.36 (m, 1 H) 8.51 (dd, J=4.41, 1.84 Hz, 1 H) 10.66 (s, 1 H) 15.76 (s, 1 H).
Example 379 4-hvdroxy-l-(3-methylbutyl)-3-(8-methyl-l,l-dioxido-4J-dihvdroimidazo[4,5- hiri,2,41benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one
A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and acetic^acid (lmL) in a sealed tube was heated by microwave at 160°C for 30 minutes, cooled and filtered to collect a solid which was washed repeatedly with diethyl ether and dried to give the title compound as a tan solid (0.006 g, 26 % yield). MS (EST) m/z 465 (M-H)". The sodium salt of the title compound was prepared according to. the procedure of Example ID. 1H NMR (300 MHz, DMSO-de) δ 0.97 (d, J=6.62 Hz, 6 H) 1.48 (m, 2 H) 1.64 (m, 1 H) 2.47 (s, 3 H) 4.31 (m, 2 H) 6.98 (d, J=8.46 Hz, 1 H) 7.13 (dd, 1=7.54, 4.96 Hz, 1 H) 7.67 (d, J=8.46 Hz, 1 H) 8.38 (dd, 1=7.54, 2.02 Hz, 1 H) 8.53 (dd, J=4.60, 1.65 Hz, 1 H) 12.57 (s, 1 H) 16.04 (s, IH).
Example 380 3-rU-dioxido-8-(pentafluoroethyl)-4J-dihydroimidazor4,5-hiri,2,41benzothiadiazin-3-yll- 4-hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and pentafluoropropionic acid (0.5 mL) in a sealed tube was heated by microwave at 130°C for 30 minutes, cooled and concenfrated under reduced pressure. The crude material was chromatographed on silica eluting first with dichloromethane and then 99:1
-370- dichloromethane/methanol to give the title compound (0.011 g, 38 % yield). MS (ESI") m/z 569 (M-H)". The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.25 Hz, 6 H) 1.52 (m, 2 H) 1.69 (m, 1 H) 4.37 (m, 2 H) 7.30 (m, 2 H) 7.97 (m, 1 H) 8.54 (m, 2 H) 14.65 (m, 1 H). 5
Example 381 l-r(cvclopropylmethyl)aminol-4-hydroxy-3-(7-hvdroxy-8-nitro-lT-dioxido-4H-l,2,4- >} benzothiadiazin-3-yl)quinolin-2(lH)-one
A solution of the product of Example 320C (47 mg, 0.11 mmol) in concentrated lό sulfuric acid (2 mL) at 0°C was treated with ammonium nitrate (10 mg, 0.13 mmol). After stirring at ambient temperature for 25 minutes, the solution was poured into ice water and the precipitate was filtered, dried, and purified by flash chromatography, eluting with 2% methanol in dichloromethane to yield the title compound (10 mg, 19%). MS (ESF) m/z 470 (M-Η)". 1H NMR (300 MHz, DMSO-de) δ 0.14 (d, J=4.04 Hz, 2 H) 0.41 15 (m, 2 H) 1.01 (m, 1 H) 2.84 (d, J=6.99 Hz, 2 H) 7.44 (m, 2 H) 7.77 (d, J=9.56 Hz, 1 H) 7.88 (t, J=7.91 Hz, 1 H) 8.08 (d, 1=8.46 Hz, 1 H) 8.16 (dd, J=8.09, 1.10 Hz, 1 H) 11.83 (s, 1 H).
Example 382 3-(7-{2-r(3S)-3-aminopyπolidin-l-yll-2-oxoethoxyl-lT-dioxido-4H-l,2,4-benzothiadiazin-
20 3-yl)-l-r(cyclopropylmethyl)aminol-4-hydroxyquinolin-2(lH)-one
A mixture of the product of Example 384, l-[3-(dimethylamino)propyl]-3- ethylcarbodiimide hydrochloride and 1-hydroxybenzotriazole in N,N-dimethylformamide is added pyπolidin-3(S)-yl-carbamic acid tert-butyl ester. The mixture is stiπed for 1 day. The solution is poured into ethyl acetate and washed with saturated sodium bicarbonate, water,
25 brine and dried with magnesium sulfate. The solvent is removed by vacuo. The residue is triturated with methanol / water and filtered. The solid is added in hydrochloric acid (1 M in dioxane, 2 mL) and stirred overnight, filtered and washed with ethyl acetate/hexane (1:1) to give title compound.
0 Example 3832-IY3-11-f (cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l ,2-dihvdroquinolin-3- yll-l,l-dioxido-4Η-l,2,4-benzothiadiazin-7-yl)oxy1-N-ethylacetamide The product of Example 384 (24 mg, 0,05 mmole), l-[3-(dimethylamino)propyl]-3 ethylcarbodiimide hydrochloride (16 mg, 0.08 mmol) and 1-hydroxybenzotriazole (14 mg, 0.1 mmol) in N,N- dimethylformamide (2 mL) was added ethylamine (100 μl, 2M in tetrahydrofuran, 0.2 5 mmol). The mixture was stiπed for 1 day. The solution was poured into ethyl acetate (40 mL) and washed with saturated aqueous sodium bicarbonate, water, brine and dried with magnesium sulfate. The solvent was removed under reduced pressure. The residue was
-371- triturated with methanol / water and filtered to give title compound (6 mg, 24%). !H NMR (500 MHz, DMSO-de) δ 0.20 (m, 2 H) 0.45 (m, 2 H) 1.00 (m, 1 H) 1.07 (t, J=7.08 Hz, 3 H) 2.70 (s, 2 H) 3.18 (m, 2 H) 4.49 (s, 2 H) 5.99 (s, br, 1 H) 7.08 (s„br, 1 H) 7.23 (s, br, 3 H) 7.52 (s, br, 1 H) 7.70 (s, br, 1 H) 7.88 (s, br, 1 H) 8.09 (d, 1=7.81 Hz, 1 H). MS (ESI") m/z 510 (M-H)".
Example 384Atert-butyl f(3-{ l-r(cvclopropylmethyl)amino1-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl 1-1,1 -dioxido-4H-l ,2,4-benzothiadiazin-7-yl)oxy1 acetate The product of Example 320C (400 mg, 0.94 mmol) in N,N-dimethylformamide (10 mL) was reacted with tert-butyl bromoacetate (0.555 mL, 3.76 mmol), potassium carbonate (1.225 g, 3.76 mmol) and tetrabutylammonium iodide (catalytic) at 25 °C for overnight. The reaction mixture was diluted with water and adjusted to pΗ 7 with glacial acetic acid. The reaction was extracted with ethyl acetate and the organic layer was washed with aqueous sodium , bicarbonate, water and brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was chromatographed on silica gel eluting with a gradient of 3:1 hexanes:ethyl acetate to 1:1 hexanes:ethyl acetate to give the title compound (195 mg, 38%).
Example 384B IY3- f 1 - F(cyclopropylmethyl)amino1-4-hydroxy-2-oxo'- 1 ,2-dihydroquinolin-3- yl I - 1 , 1 -dioxido-4Η-l ,2,4-benzothiadiazin-7-yl)oxy1 acetic acid The product of Example 384A (195 mg, 0.36 mmol) in a mixture of trifluoroacetic acid (5 mL) and dichloromethane (5 mL) was stirred for three hours at 25°C. The solvents were removed under reduced pressure. The residue was triturated with hexanes/ethyl acetate (1:1) and filtered to give title compound (114 mg, 65%). 1H NMR (300 MHz, DMSO-d6) δ 0.14 (d, J=4.04 Hz, 2 H) 0.41 (d, J=7.35 Hz, 2 H) 1.02 ( , 1 H) 2.86 (d, J=6.25 Hz, 2 H) 4.88 (s, 2H) 6.44 (s, 1 H) 7.39 (m, 3 H) 7.67 (d, J=8.82 Hz, 1 H) 7.89 (m, 1 H) 8.10 (d, J=8.46 Hz, 1 H) 8.17 (dd, J=1.47 Hz, J=6.62 Hz, 1 H) 13.16 (s, 1 H) 14.07 (s, 1 H) 15.12 (s, 1 H). MS (EST) m/z 483 (M-H)".
Example 385
3-{ 7-r2-(3-aminoρyπolidin-l-yl)-2-oxoethoxyl-l , l-dioxido-4H-l,2,4-benzothiadiazin-3-yl I- l-f(cvclopropylmethyl)aminol-4-hydroxyquinolin-2(lH)-one The product of Example 384B (24 mg, 0,05 mmole), l-[3-(dimethylamino)propyl]-3- ethylcarbodiimide hydrochloride (16 mg, 0.08 mmol) and 1-hydroxybenzotriazole (14 mg, 0.1 mmol) in N,N-dimethylformamide (2 mL) was added pyπolidin-3-yl-carbamic acid tert- butyl ester(19 mg, 0.1 mmol). The mixture was stiπed for 1 day. The solution was poured into ethyl acetate (40 mL) and washed with saturated aqueous sodium bicarbonate, water, and brine, dried with magnesium sulfate, filtered and concentrated. The residue was triturated with methanol / water and filtered. The solid was treated with hydrochloric acid (1 M in dioxane, 2 mL) and stirred overnight, filtered and washed with ethyl acetate/hexane (1:1) to
-372- give title compound (15 mg, 51%).
1HNMR (500 MHz, BENZENE-d6) δ 0.16 (m, 2 H) 0.43 (m, 2 H) 1.01 (m, 1 H) 2.14 (m, 2 H) 2.29 (m, 1 H) 2.89 (d, J=6.84 Hz, 2 H) 3.36 (m, 2 H) 3.81 (m, 2 H) 4.88 (m, 2 H) 7.42 (m, 3 H) 7.61 (m, 1 H) 7.88 (m, 1 H) 8.09 (d, J=8.30 Hz, 1 H) 8.17 (d, J=8.30 Hz, 1 H) 8.28 (s, 3 H) 13.99 (s, 1 H). MS (EST) m/z 551 (M-H)". ■
793695 Example 386 DL2 3-(8-amino-7-hydroxy- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-vD- 1 - . r(cvcIopropylmethyl)aminol-4-hydroxyquinolin-2(lH)-one
A mixture of the product of Example 381 (10 mg, 0.021 mmol), iron powder (5.9 mg, 0.105 mmol), and ammonium chloride (1.3 mg, 0.024 mmol) in methanol:tetrahydrofuran:water (2:2:1, 2mL) was heated at 60°C for 1 hour. The solution filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate, filtered and washed with water and dried to give title compound (5 mg, 53%). 1H NMR (300 MHz, DMSO-d6) δ 0.13 (d, J=3.68 Hz, 2 H) 0.40 (d, J=7.72 Hz, 2 H) 1.02 (m, 1 H) 2.85 (d, J=5.52 Hz, 2 H) 5.40 (s, 2 H) 6.46 (s, 1 H) 6.65 (d, J=8.46 Hz, 1 H) 7.00 (d, 1=8.09 Hz, 1 H) 7.45 (t, 1=7.35 Hz, 1 H) 7.89 (t, J=7.17 Hz, 1 H) 8.10 (d, J=8.46 Hz, 1 H) 8.17 (d, J=8.82 Hz, 1 H) 10.13 (s, 1 H) 13.82 (s, 1 H) 15.17 (s, 1 H). MS (EST) m/z 440 (M-H)".
Example 387A 2-r(3-{l-r(cvclopropylmethyl)aminol-4-hvdroxy-2-oxo-l,2-dihydroquinolin-3-yl)-8-nitro- 1 ,l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl)oxylacetamide The product of Example 381 (20 mg, 0.042 mmol) in N,N-dimethylformamide (2 mL) was treated with 2-bromoacetamide (11.6 mg, 0.084 mmol), potassium carbonate (54.7 mg, 0.168 mmol) and tetrabutylammonium iodide (catalytic) at 25°C, stirred at 25°C for 18 hours. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate, filtered and washed with water to give the title compound (12 mg, 54%).
A mixture of the product of Example 387A (12 mg, 0.023 mmol), iron powder (6.0 mg, 0.107 mmol), and ammonium chloride (1.4 mg, 0.026 mmol) in methanol:tetrahydrofuran:water (2:2:l,2mL) was heated at 60°C for 1 hour. The solution filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate, filtered washed with water and dried to give title compound (7 mg, 62%). Η NMR (300 MHz, DMSO-d6) δ 0.14 (d, J=3.31 Hz, 2 H) 0.41 (d, J=6.99 Hz, 2 H) 1.01 (m, 1 H) 2.85 (d, J=5.88 Hz, 2 H) 4.49 (s, 2 H) 5.98 (s, 2 H) 6.46 (s, 1 H) 6.73 (d, J=8.46 Hz, 1 H) 7.17 (d, J=8.46 Hz, 1 H) 7.44 (t,
-373- J=7.54 Hz, 1 H) 7.55 (s, 1 H) 7.89 (t, J=8.07, 1 H) 7.92 (s, 1 H) 8.10 (d, J=8.46 Hz, 1 H) 8.16 (d, J=8.09 Hz, 1 H) 13.86 (s, 1 H) 15.07 (s, 1 H). MS (EST) m/z 497 (M-H)".
Example 388 A F(3 - 11 - f (c ycloprop ylmethyDaminol -4-h ydroxy-2-oxo- 1 ,2-dihvdroquinolin-3 -yl } -8 -nitro- 1 , 1 - ,) dioxido-4H-L2,4-benzothiadiazin-7-yl)oxy1acetonitrile
The product of Example 381 (20 mg, 0.042 mmol) in N,N-dimethylformamide (2 L) was reacted with 2-bromoacetonitrile (6 μl, 0.086 mmol), potassium carbonate (54.7 mg, 0.168 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 18 hours. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate, filtered and washed with water to give the title compound (13 mg, 60%).
Example 388B r(8-amino-3 - { 1 - lϊc yclopropylmethypaminol -4-hydrox y-2-oxo- 1 ,2-dihydroquinolin-3 -yl 1 - 1 , l-dioxido-4Η-l ,2,4-benzothiadiazin-7-yl)oxy1acetonitrile A mixture of the product of Example 388A (13 mg, 0.025 mmol), iron powder (6.0 mg, 0.107 mmol), and ammonium chloride (1.5 mg, 0.028 mmol) in methanol tetrahydrofuran : water (2:2:1, 2mL) was heated at 60°C for 1 hour. The solution filtered through Celite® and washed with tetrahydrofuran. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate, filtered washed with water and dried to give title compound (5 mg, 41%). !H NMR (300 MHz, DMSO-d6) δ 0.14 (d, J=l.ll Hz, 2 H) 0.41 (d, J=5.88 Hz, 2 H) 1.01 (m, 1 H) 2.85 (d, J=5.40 Hz, 2 H) 5.23 (s, 2 H) 5.80 (s, 2 H) 6.45 (s, 1 H) 6.83 (d, 1=8.46 Hz, 1 H) 7.38 (d, J=8.46 Hz, 1 H) 7.44 (t, J=7.02 Hz, 1 H) 7.90 (t, J=7.02 Hz, 1 H) 8.10 (d, J=8.46 Hz, 1 H) 8.16 (d, J=7.74 Hz, 1 H) : 13.93 (s, 1 H) 14.94 (s, 1 H). MS (EST) m/z 479 (M-H)".
Example 389 l-r(cyclopropylmethyl)aminol-4-hvdroxy-3-r7-(2-hydroxyethoxy)-l,l-dioxido-4H-l,2,4- benzothiadiazin-3-yllquinolin-2(lH)-one
Product of Example 384 (10 mg, 0.021 mmol) in tetrahydrofuran (10 mL) was added borane (0.8 mL, IM in tetrahydrofuran, 0.8 mmol). The mixture was refluxed for 4 hours. Then poured into ice water (20 mL) and acidified to pH 2 with IN hydrochloric acid. The solid was filtered and washed with water to give the title compound (5 mg, 51%). 1H NMR (300 MHz, DMSO-de) δ 0.14 (d, J=4.41 Hz, 2 H) 0.41 (d, J=7.72 Hz, 2 H) 1.01 (m, 1 H) 2.86 (d, J=5.52 Hz, 2 H) 3.74 (t, J=4.78 Hz, 2 H) 4.13 (t, J=4.78 Hz, 2 H) 4.89 (s, 1 H) 6.44 (s, 1 H) 7.4i (m, 3 H) 7.65 (d, J=9.84 Hz, 1 H) 7.89 (t, J=7.91 Hz, 1 H) 8.10 (d, J=8.46 Hz, 1 H)
-374- 8.17 (d, J=7.35 Hz, 1 H) 14.05 (s, 1 H) 15.14 (s, 1 H). MS (EST) m/z 469 (M-H)"
5 Example 390A
3 - { 7- IT 1 -benzyl- lH-imidazol-2-yl)methoxyl -1,1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl } - 1 - r(cyclopropylmethyl)amino1-4-hydroxyquinolin-2(lH)-one Product of Example 320C (20 mg, 0.047 mmol) in N,N-dimethylformamide (1 mL) was was heated with l-benzyl-2-(chloromethyl)-lΗ-imidazole hydrochloride (23 mg, 0.095 lό mmol), potassium carbonate (0.061 g, 0.187 mmol) and tetrabutylammonium iodide
(catalytic) at 120°C for 2 hours in a microwave reactor. The solution was cooled to 25°C and concenfrated. The residue was triturated with ethyl acetate, filtered and washed with water to give title compound (21 mg, 75%).
15 Example 390B l-r(cvclopropylmethyl)aminol-4-hvdroxy-3-r7-(lH-imidazol-2-ylmethoxy)-l,l-dioxido-4H- l,2,4-benzothiadiazin-3-vnquinolin-2(lH)-one Product of Example 390A (16 mg, 0.027 mmol) in N,N-dimethylformamide (1 mL) was added 1,4-cyclodiene (25.5 μl, 0.27 mmol) and palladium black (16 mg). The mixture 20 was heated at 70°C for 1 day. The mixture was filtered with Celite® and washed with N,N- dimethylformamide. The solution was evaporated under reduced pressure and the residue was chromatographed on silica gel eluting with dichloromethane:methanol (98:2 ) to give the title compound (6 mg, 44%). 1H NMR (300 MHz, DMSO-d6) δ 0.16 (d, J=4.41 Hz, 2 H) 0.43 (d, J=7.35 Hz, 2 H) 0.99 (m, 1 H) 2.78 (s, br, 2 H) 5.25 (s, 2 H) 6.27 (s, br, 1 H) 7.22 (s, 25 2 H) 7.31 (m, 1 H) 7.39 (dd, J=9.01, 2.76 Hz, 1 H) 7.49 (d, J=2.57 Hz, 1 H) 7.54 (d, J=8.82 Hz, 1 H) 7.77 (m, 1 H) 7.95 (d, 1=8.09 Hz, 1 H) 8.13 (dd, J=8.09 Hz, 1.47 Hz, 1 H) 14.83 (s, ' br, 1 H). MS (EST) m/z 505 (M-H)".
30
Example 391 A 1 ,3-thiazol-2-ylmethanol To thiazole-2-carbaldehyde (113mg, lmmol) in methanol (10 mL) was added sodium borohydride (41 mg, 1.2 mmol) portion wise at 0°C. The mixture was stirred at room 5 temperature for 2 hours. The mixture was diluted with water and acidified to pH 3 with IM hydrochloric acid, and extracted with ethyl acetate (2 x 50 mL). The organic layers were washed with saturated aqueous sodium bicarbonate, water, brine, dried over magnesium
-375- sulfate, filtered and concentrated to give the title compound (69 mg, 60%).
Example 39 IB 2-fchloromethyl)-l ,3-thiazole The product of Example 391 A (66 mg, 0.57 mmol) was added dropwise into thionyl chloride (0.2 mL, 2.7 mmol) in dichloromethane (9 mL) keeping the temperature at 25°C. The mixture was refluxed for 2 hours. The solvent was evaporated to give the title compound (quantitative yield).
Example 39 IC l-r(cvclopropyImethyl)aminol-3-π.l-dioxido-7-(l,3-thiazol-2-ylmethoxy)-4H-l,2,4- benzothiadiazin-3-yll-4-hydroxyquinolin-2(lH)-one Product of Example 320C (15 mg, 0.035 mmol) in N,N-dimethylformamide (1 mL) was was heated with Example 391B (19 mg, 0.142 mmol), potassium carbonate (68 g, 0.209 mmol) and tetra-butylammonium iodide (catalytic) at 120°C for 2 hours. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate/hexane (1:1), filtered and washed with water to give title compound (17 mg, 92%). 1H NMR (500 MHz, DMSO-de) δ 0.21 (d,' J=4.27 Hz, 2 H) 0.46- (d, J=7.32 Hz, 2 H) 0.99 (m, 1 H) 2.67 (s, br, 2 H) 5.49 (s, 2 H) 5.95 (t, 1=6.71 Hz, 1 H) 7.04 (m, 1 H) 7.26 (m, 3 H) 7.50 (m, 1 H) 7.66 (d, J=8.54 Hz, 1 H) 7.75 (d, J=3.66 Hz, 1 H) 7.84 (d, J=3.05 Hz, 1 H) 8.07 (dd, J=7.93 Hz, 1.08 Hz, 1 H) 16.19 (s, 1 H). MS (EST) m/z 522 (M-H)".
Example 392A : r(3-{ l-r(cvclopropylmethyl)aminol-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yll-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl)oxylacetonitrile The product of Example 320C (0.050 g, 0.117 mmol) in N,N-dimethylformamide (2 mL) was reacted with 2-bromoacetonitrile (16 μL, 0.230 mmol), potassium carbonate (0.15 g, 0.46 mmol) and tetrabutylammonium iodide (catalytic) at 25°C for 1 day. The solution was evaporated under reduced pressure and the residue was triturated with ethyl acetate/hexane (1:1), filtered and washed with water to give title compound (52 mg, 95%).
Example 392B methyl 2-IY3-I l-r(cvclopropylmethyl)amino1-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl 1- 1 , l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl)oxylethanimidoate Hydrogen chloride gas was bubbled into a solution of the product of Example392A
-376- (50 mg, 0.11 mmol) in methanol (10 mL) at 0°C until saturation. The reaction was stiπed at room temperature for 3 hours. The solution was evaporated under reduced pressure to give title compound (quantitative yield).
Example 392C l-r(cyclopropylmethyl)aminol-3-r7-(4,5-dihvdro-lH-imidazol-2-ylrnethoxy)-Tl-dioxido- 4H-l,2,4-benzothiadiazin-3-yll-4-hvdroxyquinolin-2(lH)-one The product of Example of 392B (53 mg, 0.11 mmol) in methanol (10 mL) was added ethane- 1,2-diamine (0.2 mL, 3 mmol) and refluxed overnight. The solvent was removed under reduced pressure and the residue was chromatographed on silica gel eluting with 4:1 dichloromethane/methanol to 3:2 dichloromethane/methanol 3:2 to give the title compound (11 mg, 20%). 1H NMR (500 MHz, DMSO-dg) δ 0.18 (m, 2 H) 0.45 (m, 2 H) 1.00 (m, 1 H) 2.77 (d, J=6.71 Hz, 2 H) 3.91 (s, 4 H) 5.23 (s, 2 H) 6.11 (s, 1 H) 7.21 (m, 1 H) 7.42 (m, 3 H) 7.66 (m, 1 H) 7,85 (d, J=7.32 Hz, 1 H) 8.12 (d, J=7.93 Hz, 1 H) 10.70 (s, 1 H) 15.29 (s, 1 H). MS (ESf ) m/z 509 (M+H)+.
Example 393A 2-(bromomethyl)-l,3-thiazole-4-carbonitrile
To a solution of 2-methyl-l-thiazole-4-carbonitrile (248 mg, 2 mmol) in benzene (20 mL) was added N-bromosuccinimide (1.78 g, 10 mmol) and dibenzoyl peroxide (20 mg, 0.08 mmol). The mixture was refluxed for 2 days. The solution was evaporated under reduced pressure. The residue was partitioned between dichloromethane and water. The organic layer was concentrated under reduced pressure and the residue was chromatographed on silica gel eluting with 1:1 dichloromethane :hexane to give the title compound (190 mg, 47%).
Example 393B 2- { \(3 - { 1 -f(c yclopropylmethvDaminol -4-hydroxy-2-oxo- 1 ,2-dih ydroquinolin-3 -yl 1 - 1 , 1 - dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxylmethyll-l,3-thiazole-4-carbonitrile
Product of Example 320C (20 mg, 0.047 mmol) in N,N-dimethylformamide (2 mL) was reacted with Example 393A (20 mg, 0.099 mmol), potassium carbonate (0.070 g, 0.215 mmol) and tetrabutylammonium iodide (catalytic) at room temperature for overnight. The solution was concentrated under reduced pressure and the residue was triturated with ethyl acetate/hexane (1:1), filtered and washed with water to give title compound (23 mg, 89%). ]H NMR (500 MHz, DMSO-dg) δ 0.22 (m, 2 H) 0.46 (m, 2 H) 1.00 (m, 1 H) 2.69 (m, 2 H) 5.54 (s, 2 H) 5.96 (t, J=6.32 Hz, 1 H) 7.04 (m, 1 H) 7.28 (m, 3 H) 7.49 (m, 1 H) 7.67 (d,
-377- J=8.62 Hz, 1 H) 8.08 (dd, J=8.05 Hz, 1.70 Hz, 1 H) 8.81 (s, 1 H) 16.15 (s, 1 H), MS (EST) m/z 547 (M-H)".
Example 394 5 3-r7-(2-aminoethoxy)-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-vn-.l- r(cvclopropylmethyl)amino1-4-hydroxyquinolin-2(lH)-one A solution of the product of Example392A (39 mg, 0.084 mmol) in anhydrous tetrahydr uran (2 mL) was treated with LiBE ; (1 mL, 2M in tetrahydrofuran, 0.2 mmol), stiπed at ambient temperature for 30 minutes, then 18 μl water was added and stirred lb overnight. The solution was diluted with water (20 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic layers were washed with brine and dried over anhydrous magnesium sulfate. The slurry was filtered and the solvent removed under reduced pressure to give title compound (38 mg, 97%). IH NMR (500 MHz, BENZENE-d6) δ 0.20 (d, J=3.05 Hz, 2 H) 0.46 (d, J=7.32 Hz, 2 H) 1.01 (m, 1 H) 2.74 (s, br, 2 H) 2.86 (m, 2 H) 4.19 (t, J=4.90 15 Hz, 2 H) 5.21 (s, br, 2 H) 6.04 (s, br, 1 H) 7.15 (s, br, 1 H) 7.24 (s, br, 2 H) 7.32 (s, br, 1 H) 7.59 (s, br, 1 H) 7.78 (s, br, 1 H) 8.11 (d, J=7.32 Hz, 1 H) 15.65 (s, br, 1 H). MS (EST) m/z 468 (M-H)".
Example 395 20 N-f2-r(3-{ l-r(cvclopropylmethyPaminol-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl|-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxylethyl|methanesulfonamide To the product of Example 394 (15 mg, 0.032 mmol) in pyridine (1 mL) was added methanesulfonyl chloride (12 μl, 0.156 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and 25 concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane: ethyl acetate. The crude product was purified by chromatography on silica gel eluting with 199:1 dichloromethane:methanol to give the title compound ( 5 mg, 29%). 1H NMR (300 MHz, DMSO-d6) δ 0.14 (d, J=4.04 Hz, 2 H) 0.41 (d, J=7.72 Hz, 2 H) 1.01 (m, 1 H) 2.86 (d, J=5.52 Hz, 2 H) 2.97 (s, 3 H) 3.38 (t, J=5.33 Hz, 2 H) 0 4.-18 (t, J=5.33 Hz, 2 H) 6.44 (s, 1 H) 7.32 (t, J=5.88 Hz, 1 H) 7.41 ( , 3 H) 7.67 (d, 1=9.93 Hz, 1 H) 7.89 (t, J=7.91 Hz, 1 H) 8.10 (d, J=8.46 Hz, 1 H) 8.17 (d, J=8.46 Hz, 1 H) 14.08 (s, 1 H) 15.11 (s, 1 H). MS (EST) m z 546 (M-H)".
Example 396 5 3-r9-(butylamino)-l,l-dioxidϋ-4H,8H-ri.41oxazinor2,3-hiπ,2,41benzothiadiazin-3-vn-4- hydroxy-l-(isobutylamino)quinolin-2(lH)-one A solution of the product of Example 357 (15.5 mg, 0.031 mmol) in pyridine (2 mL)
-378- was treated with n-butyl amine (0.030 mL, 0.31 mmol) at room temperature for 4 hours. The solvent was removed under a stream of warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous trifluoroacetic to yield the title compound (3.3 mg, 20%). MS (EST) m/z 537 (M-H)'. JH NMR (300 MHz, DMSO-d6) δ 0.92 (t, J=7.35 Hz, 3 H) 1.04 (d, J=6.62 Hz, 6 H) 1.36 (m, 2 H) 1.59 (m, 2 H) 1.90 (m, 1 H) 2.70 (m, 2 H) 3.41 (m, 2 H) 4.55 (s, 2 H) 6.32 (m, 1 H) 6.96 ( , 1 H) 7.15 (d, J=8.46 Hz, 1 H) 7.45 (hi, 1 H) 7.93 (m, 2 H) 8.17 (d, J=6.62 Hz, 1 H) 13.66 (s, 1 H) 15.69 (s, 1 H). Example 3973-{7-r(5-bromopyridin-2-yl)oxyl-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yll- 4-hydro y- 1 -(isobutylamino)quinolin-2(lH)-one
A mixture of the product of Example 32 IC (40.0 mg, 0.09 mmol), cesium carbonate (112 mg, 0.34 mmol), and 2,5-dibromopyridine (40.0 mg, 0.17 mmol) in dimethylsulfoxide (1.2 mL) was stirred while heating at 110°C in a microwave reactor for 20 minutes. After cooling to 25°C, the purple mixture was partitioned between ethyl acetate and water. The aqueous layer was extracted with an additional portion of ethyl acetate. The combined organic layers were dried over sodium sulfate, filtered, concentrated under reduced pressure and purified by column chromatography on silica gel eluting with a step gradient (0-100%) of dichloromethane in hexanes to give the title compound as an off-white solid (34.0 mg, 63%). MS (EST) m/z 582 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 1.05 (d, 1=6.62 Hz, 6 H) 1.93 (m, 1 H) 2.73 (m, 2 H) 6.35 (m, 1 H) 7.19 (d, J=8.82 Hz, 1 H) 7.45 ( , 1 H) 7.61 (dd, J=8.82, 2.57 Hz, 1 H) 7J7 (m, 2 H) 7.94 (m, 2 H) 8.13 (dd, J=8.82, 2.57 Hz, 1 H) 8.19 (m, 1 H) 8.31 (d, J=2.21 Hz, 1 H).
Example 398 4-hydroxy-l-(isobutylamino)-3-{7-r(3-nitropyridin-2-yl)oxy1-l,l-dioxido-4H-l,2,4- benzothiadi azin-3 -yl I quinolin-2( 1 H)-one A mixture the product of Example 321C (10.0 mg, 0.02 mmol), cesium carbonate (27.7 mg, 0.09 mmol), and 2-bromo-3-nitropyridine (8.4 mg, 0.04 mmol) in dimethylsulfoxide (0.3 mL) was stiπed while heating at 110°C in a microwave reactor for 20 minutes. After cooling to 25°C, the mixture was partitioned between ethyl acetate and water. The aqueous layer was extracted with an additional portion of ethyl acetate. The combined organic layers were dried over sodium sulfate, filtered, concentrated under reduced pressure and purified by column chromatography on silica gel eluting with a 0-100% dichloromethane in hexane step gradient to give the title compound as a yellow solid (8.6 mg, 68%). MS (ESI" ) m z 549 (M-H)". 1H NMR (300 MHz, CDC13) δ 1.13 (d, J=6.62 Hz, 6 H) 2.00 (m, 1 H) 2.81 (m, 2 H) 5.73 (m, 1 H) 7.23 (m, 1 H) 7.40 (m, 2 H) 7.50 (dd, J=8.82, 2.57 Hz, 1 H) 7.82 (m, 2 H) 7.97 (m, 1 H) 8.27 (dd, J=8.09, 1.10 Hz, 1 H) 8.35 (dd, J=4J8, 1.84 Hz, 1 H) 8.42 (dd,
-379- O 2004/041818
J=8.09, 1.84 Hz, 1 H) 14.39 (s, 1 H) 15.02 (s, 1 H).
Example 399 N-{3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-vn-l,l-dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl Imethanesulfonamide
To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added methanesulfonyl chloride (0.0064 g, 0.0043 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 38 minutes. The reaction was diluted with ethyl acetate (40mL), washed with 1 N hydrochloric acid, water, and brine. The organic layer was dried over magnesium sulfate and filtered. The filtrate was concentrated under reduced pressure to give a yellow solid, which was purified by chromatography on silica gel eluting with 99:1 dichloromethane : methanol to give the title compound (8.3 mg, 35%). TI NMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.62 Hz, 6 H)T.57 (m, 2 H) 1.70 (m, 1 H) 3.10 (s, 3 H) 4.49 (m, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.58 (dd, J=8.82, 2.57 Hz, 1 H) 7.64 (d, J=2.21 Hz, 1 H) 7.75 (d, 1=8.82 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.60, 1.65 Hz, 1 H) 10.29 (s, 1 H) 14.17 (s, 1 H). MS (EST) m/z 504 (M-H)".
Example 400 N-{3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-ylM,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yllbenzenesulfonamide
To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added benzenesulfonyl chloride (0.0099 g, 0.0072 mL, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 35 minutes. The reaction was cooled to 25°C, diluted with ethyl acetate (40mL), washed with 1 N hydrochloric acid, water, and brine. The organic layer was dried over magnesium sulfate, filtered and concentrated. The: residue was chromatographed on silica gel eluting with 99:1 dichloromethane : methanol to give the title compound (18.6 mg, 69%). *H NMR (300 MHz, DMSO-de) δ 0.97 (d, J=6.25 Hz, 6 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 4.46 ( , 2 H) 7.47 (m, 3 H) 7.61 (m, 4 H) 7.80 (d, J=6.99 Hz, 2 H) 8.54 (dd, J=7.91, 1.65 Hz, 1 H) 8.87 (dd, J=4.23, 1.29 Hz, 1 H) 10.85 (s, 1 H) 14.08 (br s, 1 H). MS (EST) m/z 566 (M-H)".
Example 401 N-{3-r4-hvdroxy-l-(3-methylbutyP-2-oxo-1.2-dihydro-l,8-naphthyridin-3-vn-l,l-dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl lthiophene-2-sulfonamide To the product of Example 205 (21.5 mg, 0.05mmol) in pyridine (lmL) was added 2- thiophenesulfonyl chloride (44 mg, 0.24 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and
-380- concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with hexane:ethyl acetate (1:1). The crude product was chromatographed on silica gel eluting with 199:1 dichloromethane:methanol to give the title compound ( 10 mg, 35%). 1H NMR (300 MHz, DMSO-de): δ 0.97 (d, J=6.25 Hz, 6 H) 1.55 (m, 2 H) 1.66 (m, 1 H) 4.46 (t, J=7.84 Hz, 2 H) 7.16 (dd, J=5.13 Hz, 3.66 Hz, 1 H) 7.48 (m, 2 H) 7.53 (d, 1=2.21 Hz, 1 H) 7.56 (d, J=2.55 Hz, 1 H) 7.61 (dd, J=3.68, 1.47 Hz, 1 H) 7.68 (d, J=8.82 Hz, 1 H) 7.96 (dd, J=5.13 Hz, 1.47 Hz, 1 H) 8.53 (dd, J=8.09, 1.84 Hz, 1 H) 8.87 (dd, J=4.78, 1.84 Hz, 1 H) 10.98 (s, 1 H) 14.10 (s, 1 H). MS (EST) m/z 572 (M-H)".
^ Example 402
N-j3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-L8-naphthyridin-3-vn-l,l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl 1 - 1 -methyl- 1 H-imidazole-4-sulf onamide To the product of Example 205 (21.5 mg, 0.05 mmol) in pyridine (lmL) was added 1- methylimidazolesulfonyl chloride (44 mg, 0.24 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with l:lhexane:ethyl acetate to give the title compound (21 mg, 73%). 1H NMR (300 MHz, DMSO-d6): δ 0.98 (d, J=6.62 Hz, 6 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 3.66 (s, 3 H) 4.48 (m, 2 H) 7.58 (m, 5 H) 7J8 (d, J=l.ll Hz, 1 H) 7.92 (d, J=1.47 Hz, 1 H) 8.55 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.78, 1.84 Hz, 1 H) 10.80 (s, 1 H) 13.99 (s, 1 H). MS (EST) m/z 570 (M-H)".
Example 403 4,5-dichloro-N-{3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-L8-naphthyridin-3-yn- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl lthiophene-2-sulf onamide
To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added 2,3-dichlorothiophene-5-sulfonyl chloride (0.015 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 15 minutes. The reaction was diluted with ethyl acetate (40mL), washed with 1 N hydrochloric acid, water, and brine. The organic layer was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99:1 dichloromethane: methanol to give the title compound (14.8 mg, 50%). H NMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.25 Hz, 6 H) 1.56 (m, 2 H) 1.69 (m, 1 H) 4.47 (m, 2 H) 7.50 (m, 2 H) 7.56 (s, 1 H) 7.71 (d, J=8.82 Hz, 1 H) 7.76 (s, 1 H) 8.55 (dd, J=7.91, 2.02 Hz, 1 H) 8.88 (dd, J=4.60, 1.65 Hz, 1 H) 11.28 (s, 1 H) 14.19 (br s, 1 H). MS (EST) m/z 640 (M-H)".
-381- Example 404 2,2,2-trifluoro-N-(3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-l,8-naphthyridin-3- yll-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-vUethanesulfonamide To the product of Example 205 (21.5 mg, 0.05 mmol) in pyridine (1 mL) was added 2,-2,-2-trifluoroethanesulfonyl chloride (28 μl, 0.25 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with of 1:1 hexane:ethyl acetate. The crude product was chromatographed on silica gel eluting with 1:1 ethyl acetate/hexane to give the title compound (5 mg, 17%). 1H NMR (300 MHz, DMSO-de): δ 0.97 (d, J=6.62 Hz, 6 H) 1.49 (m, 2 H) 1.64 (m, 1 H) 4.31 (t, J=7.53 Hz, 2 H) 4.58 (q, 1=9.93 Hz, 2 H) 7.17 (dd, J=7.35, 4.78 Hz, 1 H) 7.43 (m, 4 H) 8.38 (dd, J=7.72, 1.84 Hz, 1 H) 8.57 (d, J=2.94 Hz, 1 H) 10.63 (s, 1 H) 15.90 (s, 1 H). MS (EST) m/z 572 (M-H)".
Example 405 methyl r({3-r4-hvdroxy-l-(3-methylbutvP-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yll-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl 1 amino)sulfonyll acetate To product of example 205 (21.5 mg, 0.05 mmol) in methylene chloride (1 mL) was added chlorosulfonyl-acetic acid methyl ester (35 mg, 0.2 mmol) and triethylamine (30 μl, 0.22 mmol) and the resulting mixture was stiπed at room temperature for 3 days. Upon completion of the reaction, the solvent was removed under reduced pressure. The residue was chromatographedon silica gel eluting with 199:1 dichloromethane:methanol. The product was dissolved in dichloromethane and added two drops of acetic acid, then stirred at rt for 10 min, washed with water. The organic layer was dried with magnesium sulfate and evaporated in vacuo to give the title compound (2 mg, 7%). IH NMR (300 MHz, DMSO- : d6): δ 0.99 (d, J=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.70 (m, 1 H) 3.65 (s, 3 H) 4.40 (s, 2 H) 4.49 (m, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.59 (dd, J=8.82 2.57 Hz, 1 H) 7.66 (d, J=2.57 Hz, 1 H) 7.76 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.41, 1.84 Hz, 1 H) 10.73 (s, 1 H) 14.15 (s, 1 H). MS (EST) m/z 562 (M-H)".
Example 406 N-{3-r4-hydroχy-l-(3-methylbutyl)-2-oxo-1.2-dihvdro-1.8-naphthyridin-3-yll-l.l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl 1 ethanesulfonamide To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added ethanesulfonyl chloride (19 μl, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with
-382- 1:1 hexane:ethyl acetate. The crude product was chromatographed on silica gel eluting with 199:1 dichloromethane:methanol to give the title compound ( 3 mg, 11%). *H NMR (300 MHz, DMSO-d6): δ 0.98 (d, J=6.62 Hz, 6 H) 1.22 (t, J=7.35 Hz, 3 H) 1.58 (m, 2 H) 1.70 (m, 1 H) 3.20 (q, J=7.35 Hz, 2 H) 4.49 (m, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.58 (dd, 1=8.82, 2.57 Hz, 1 H) 7.65 (d, 1=2.57 Hz, 1 H) 7.74 (d, J=9.19 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.60, 1.65 Hz, 1 H) 10.35 (s, 1 H) 14.15 (s, 1 H). MS (EST) m/z 518 (M-H)".
"=} Example 407
N-13-r4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihvdro-L8-naphthyridin-3-yll- 1 , 1 -dioxido- v 4H- 1 ,2,4-benzothiadiazin-7-yl 1 propane-2-sulfonamide
To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added isopropylsulfonyl chloride (22 μl, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane:ethyl acetate. The crude product was chromatographed on silica gel eluting with 199:1 dichloromethane:methanol to give the title compound (2 mg, 7%). H NMR (300 MHz, DMSO-d6): δ 0.98 (d, J=6.62 Hz, 6 H) 1.28 (d, J=6.99 Hz, 6 H) 1.57 (m, 2 H) 1.71 (m, 1 H) 3.29 (m, 1 H) 4.49 (m, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.59 (dd, J=8.82, 2.57 Hz, 1 H) 7.67 (d, J=2.57 Hz, 1 H) 7.74 (d, J=9.18 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.60, 1.65 Hz, 1 H) 10.33 (s, 1 H) 14.11 (s, 1 H). MS (EST) m/z 532 (M-H)".
Example 408 N-l3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-1.2-dihvdro-L8-naphthyridin-3-yll-lT-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl 1 - 1 -phenylmethanesulf onamide
A solution of the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was freated with -toluenesulfonyl chloride (38 mg, 0.2 mmol), heated in a microwave reactor at 120°C for 120 minutes, cooled to 25C and concenfrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with hexane:ethyl acetate (1:1). The crude product was chromatographed on silica gel, eluting with dichloromethane :methanol (399:1) to give the title compound (7 mg, 24%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.58 (m, 2 H) 1.69 (m, 1 H) 4.49 (m, 2 H) 4.59 (s, 2 H) 7.32 (m, 5 H) 7.51 (m, 2 H) 7.57 (d, J=2.21 Hz, 1 H) 7.71 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=8.09,.1.84 Hz, 1 H) 8.90 (dd, J=4J8, 1.84 Hz, 1 H) 10.38 (s, 1 H) 14.08 (s, 1 H) 15.14 (s, 1 H) (EST) m/z 580 (M-H)"
-383- Example 409A N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydro-l,8-naphthyridin-3-vP-l,l-dioxido-4H- 5 l,2,4-benzothiadiazin-7-yll-2-nitrobenzenesulfonamide
To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added 2- nifrobenzenesulfonyl chloride (44 mg, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was concentrated under reduced pressure. The residue was triturated with water (1 ml), filtered, and washed with of lό hexane:ethyl acetate (1:1). The crude product was chromatographed on silica gel, eluting with dichloromethane:methanol (399:1) to give the title compound (8 mg, 26%).
Example 409B 2-amino-N-r3-(4-hvdroxy-l-isopentyl-2-oxo-T2-dihvdro-l,8-naphthyridin-3-yl)-l,l-dioxido-
15 4H-l,2,4-benzothiadiazin-7-yllbenzenesulfonamide
A mixture of the product of Example 409A (8 mg, 0.013 mmol), iron powder (5.0 mg, 0.089 mmol), andNEUCl (1 mg, 0.019 mmol) in methanol:tetrahydrofuran:water (2:2:1,10 mL) was heated at 60°C for 2 hour. The solution filtered through Celite® and washed with TΗF. The solution was concentrated and the residue was diluted with water, and extracted
20 with ethyl acetate. The organic layer was washed with water, dried with MgS0 , filtered and concentrated to give title compound (7 mg, 92%). 1H NMR (300 MHz, DMSO-d6) δ 0.97 (d, J=6.62 Hz, 6 H) 1.54 (m, 2 H) 1.68 (m, 1 H) 4.46 (m, 2 H) 6.06 (s, 2 H) 6.59 (t, J=7.17 Hz, 1 H) 6.78 (d, J=8.46 Hz, 1 H) 7.23 (m, 1 H) 7.46 (m, 4 H) 7.63 (d, J=8.82 Hz, 1 H) 8.53 (dd, J=8.09, 1.84 Hz, 1 H) 8.87 (dd, J=4.41, 1.84 Hz, 1 H) 10.79 (s, 1 H) 14.00 (s, 1 H). (EST)
25 m/z 581 (M-H)". '
Example 410 3-r8-(chloromethyl)-l,l-dioxido-4J-dihvdroimidazor4,5-h1fl,2,41benzothiadiazin-3-yll-4- hydroxy-l-(3-methylbutyP-l,8-naphthyridin-2(lH)-one 30 A mixture of the product of Example 377 (0.022 g, 0.05 mmol) and chloroacetic acid
(0.06 g, 0.63 mmol) in a sealed tube was heated in a microwave reactor at 120°C for 30 minutes, cooled to 25 °C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with dichloromethane and then 98:2 35 dichloromethane:methanol to give the title compound (0.010 g, 40 % yield). MS (APCT m/z 501 (M+H)+. 1H NMR (300 MHz, DMSO-de) δ 0.99 (d, J=6.25 Hz, 6 H) 1.60 (m, 2 H) 1.71 (m, 1 H) 4.50 (m, 2 H) 5.00 (m, 2 H) 7.47 (m, 2 H) 7.95 (d, J=8.09 Hz, 1 H) 8.57 (dd,
-384- 1=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.41, 1.47 Hz, 1 H).
Example 411 {3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yll-l,l-dioxido-4,7- dihydroimidazor4,5-hl \1 ,2,41benzothiadiazin-8-yl I acetonitrile
A mixture of the product of Example 377 (0.044 g, 0.1 mmol) and cyanoacetic acid (0.085 g, TO mmol) in a sealed tube was heated in a piicrowave reactor at 120°C for 30 minutes,, tooled and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated to give a residue which was chromatographed on silica gel eluting first with dichloromethane and then 98:2 dichloromethane/methanol to give the title compound (0.007 g, 14 % yield). MS (ESI") m/z 490 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.71 (m, 1 H) 4.49 (m, 4 H) 7.50 (m, 2 H) 7.96 (m, 1 H) 8.57 (dd, 1=7.72, 1.84 Hz, 1 H) 8.89 (dd, J=4.60, 1.29 Hz, I H).
Example 412 methyl f3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yn-l,l- dioxido-4,7-dihvdroimidazor4,5-hiπ,2,41benzothiadiazin-8-yll acetate A mixture of the product of Example 377 (0.088 g, 0.2 mmol), 3,3,3-trimethoxy- propionic acid methyl ester (0.360 g, 2.0 mmol) and catalytic p-toluenesulfonic acid monohydrate in a sealed tube was heated in a microwave reactor at 60 °C for 30 minutes, cooled to 25°C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting first with dichloromethane and then 97:3 dichloromethane/methanol to give the title compound (0.051 g, 49 % yield). MS (EST) m/z 523 (M-H)". TT NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.25 Hz, 6 H) 1.58 (m, 2 H) 1.71 (m, 1 H) 3.68 (s, 3 H) 4.10 (s, 2 H) 4.49 (m, 2 H) 7.45 (d, J=8.46 Hz, 1 H) 7.51 (dd, J=7.91, 4.60 Hz, 1 H) 7.92 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=7.91, 1.65 Hz, 1 H) 8.90 (dd, J=4.60, 1.65 Hz, 1 H) 13.07 (br. s., 1 H) 14.21 (br. s., 1 H) 15.31 (br. s., 1 H).
Example 413 3-(9,9-dioxido-6H-fl,2,51thiadiazolor3,4-/ιiri,2,41benzothiadiazin-7-vP-4-hvdroxy-l-(3- methylbutvP-l,8-naphthyridin-2(lH)-one A mixture of the product of Example 377 (0.044 g, 0.1 mmol) and sulfamide (0.048 g, 0.5 mmol) in a sealed tube was heated in a microwave reactor at 190°C for 4 minutes, cooled TO 25°C and concentrated. The crude product was purified by chromatography on reverse phase gradient eluting with 0.1% trifluoroacetic acid in water/methanol (90/10) to
-385- 0.1%trifluoroacetic in water/methanol (5/95) to give the title compound (0.005 g, 11 % yield). MS (EST) m/z 469 (M-H)". 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.25 Hz, 6 H) 1.59 (m, 2 H) 1.71 (m, 1 H) 4.49 (m, 2 H) 7.48 (dd, J=7.91, 4.60 Hz, 1 H) 7.93 (d, J=9.56 Hz, 1 H) 8.39 (d, J=9.19 Hz, 1 H) 8.57 (dd, J=7.72, 1.84 Hz, 1 H) 8.88 (dd, J=4.78, 1.84 Hz, 1 H) 14.38 (s, 1 H).
Example 414A tert-butyl 4-amino-3-(aminosulfonyl)phenylcarbamate
A mixture of 2,5-diaminosulfonamide [prepared according to the procedure of /. Amer. Chem. Soc. 1943, 65, 738] (0.168 g, 0.896 mmol) and di-tert-butyl dicarbonate (0.196 g, 0.896 mmol) in tetrahydrofuran (10 mL) was stirred at room temperature for 16 hours. The reaction was concentrated under reduced pressure and the residue purified by chromatography on silica gel, eluting with 3:2 hexane/ethyl acetate, to provide the title compound (0.202 g, 78% yield).
Example 414B tert-butyl 3-jl-r(cvclopropylmethyl)amino1-4-hydroxy-2-oxo-l,2-dihvdroquinolin-3-yll-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-ylcarbamate
A mixture of the product of Example 414A (78.1 mg, 0.272 mmol) and the product of Example 353B (91.0 mg, 0.272 mmol) in anhydrous dioxane (2.7 mL) was heated under reflux for 3 h. The reaction mixture was then cooled to 25°C and concentrated under reduced pressure to yield an oily solid. The solid was triturated with methanol to yield the title compound (72.5 mg, 51 %). ]H NMR (300 MHz, DMSO-de) 60.14 (d, 7=4.04 Hz, 2 H) 0.42 (m, 2 H) 1.00 (m, 1 H) 1.51 (s, 9 H) 2.85 (bd, 7=4.78 Hz, 2 H) 6.45 (bs, 1 H) 7.44 (t, 7=7.54 Hz, 1 H) 7.62 (d, 7=8.82 Hz, 1 H) 7.69 (dd, 7=8.82, 2.20 Hz, 1 H) 7.89 (m, 7=7.91, 7.91 Hz, 1 H) 8.10 (d, 7=8.46 Hz, 1 H) 8.17 (m, 2 H) 9.93 (s, 1 H) 14;08 (s, 1 H) 15.15 (d, 7 =4.78 Hz, 1 H). MS (EST) m/z 524.0 (M-H)". The sodium salt of the compound was prepared by reacting example 414B (3.9 mg, 0.0074 mmol) with 1 N sodium hydroxide solution (0.0074 mL, 0.0074 mmol) in 0.5 mL water and 0.5 mL tetrahydrofuran at room temperature for 1.2 h. The reaction mixture was then evaporated under a stream of nitrogen to provide the sodium salt (4.1 mg, 100% yield). 1H NMR (300 MHz, DMSO-de) δ 0.20 (m, 7=5.52 Hz, 2 H) 0.46 (d, 7=8.82 Hz, 2 H) 1.00 (m, 1 H) 1.50 (s, 9 H) 3.30 (m,2 H) 5.96 (t, 7 =6.25 Hz, 1 H) 7.06 (t, 7=7.17 Hz, 1 H) 7.20 (d, 7=9.19 Hz, 1 H) 7.52 (m, 2 H) 7.67 (d, 7 =8.82 Hz, 1 H) 7.90 (s, 1 H) 8.06 (d, 7 =7.35 Hz, 1 H) 9.60 (s, 1 H) 16.22 (_, 1 H). MS (ESI4-) m/z 543.1 (M+H+H2O-Na)+, 526.1 (M-Na)+, (ESI") m/z 524.1 (M-H)".
-386- Example 415 3-(7-amino-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-r(cyclopropylmethyl)aminol-4- hydroxyquinolin-2( 1 H)-one 5 A solution of the product of Example 414B (TO.1 mg, 0.0192 mmol) in trifluoroacetic acid (0.5 mL) and dichloromethane (0.5 mL) was stirred at room temperature for 15 min. The solvent was then evaporated under a stream of nitrogen to provide the title compound (10.4 mg quantitative yield.). *H NMR (300 MHz, DMSO-d6) δ 0.13 (d, 7 =4.04 Hz, 2 H) 0.41 (d, 7 =6.99 Hz, 2 H) 1.01 (m, 1 H) 2.85 (d, 7 =6.99 Hz, 2 H) 6.98 (m, 2 H) 7.38 (d, 7 lό =8.46 Hz, 1 H) 7.44 (t, 7 =7.72 Hz, 1 H) 7.89 (m, 1 H) 8.10 (d, 7 =8.46 Hz, 1 H) 8.16 (d, 7 =6.99 Hz, 1 H) 13.87 (s, 1 H) 15.40 (s, 1 H). MS (ESI ) m/z 426.0 (M+H)+, 448.0 (M+Na)+, (EST) m/z 424.1 (M-H)".
Example 416 15 N-|3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-L8-naphthyridin-3-vn- l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl I -4-(methylsulfonyl)benzenesulfonamide To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added 4-methylsulfonylbenzenesulfonyl chloride (0.014 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 30 minutes. The reaction was cooled 20 to 25°C and diluted with ethyl acetate (40mL), washed with water and brine. The organic layer was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99:ldichloromethane:methanol to give the title compound (15 mg, 50%). ]H NMR (300 MHz, DMSO-d6) δ 0.97 (d, 1=6.25 Hz, 6 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 3.28 (s, 3 H) 4.46 (m, 2 H) 7.48 (m, 3 H) 7.65 (d, J=8.82 Hz, 1 H) 25 8.04 (d, J=8.82 Hz, 2 H) 8.15 (d, J=8.46 Hz, 2 H) 8.54 (dd, J=8.09, 1.84 Hz, 1 H) 8.86 (dd, : J=4.60, 1.65 Hz, 1 H) 11.11 (s, 1 H) 14.14 (s, 1 H). MS (EST) m/z 644 (M-H)".
Example 417 methyl 3-IY( 3-f4-hvdroxy- l-(3-methylbutyl)-2-oxo-L2-dihvdro-l ,8-naphthyridin-3-yll-l ,1- 30 dioxido-4H-1.2.4-benzothiadiazin-7-yllamino)sulfonyllthiophene-2-carboxylate
To the product of Example 205 (0.020 g, 0.047 mmol) in pyridine (0.2 mL) was added 2-(methoxylcarbonyl)thiophene-3-sulfonyl chloride (0.014 g, 0.056 mmol). The reaction mixture was heated in a microwave reactor at 100°C for 30 minutes. The reaction, was cooled to 25°C, diluted with ethyl acetate (40mL), washed with water and brine. The 35 organic layer was dried over magnesium sulfate, filtered and concentrated. The residue was chromatographed on silica gel eluting with 99:1 dichloromethane/methanol to give the title compound (15 mg, 50%). 1H NMR (300 MHz, DMSO-d6) δ 0.97 (d, 1=6.25 Hz, 6 H) 1.56
-387- O 2004/041818
(m, 2 H) 1.69 (m, 1 H) 3.89 (s, 3 H) 4.46 (m, 2 H) 7.50 (m, 4 H) 7.65 (d, J=8.82 Hz, 1 H) 8.01 (d, J=5.15 Hz, 1 H) 8.54 (dd, J=7.91, 1.65 Hz, 1 H) 8.88 (dd, J=4.60, 1.65 Hz, 1 H) 10.74 (s, 1 H) 14.06 (s, 1 H). MS (EST) m/z 630 (M-H)".
Example 418
3-(8-amino-l,l-dioxido-4J-dihydroimidazor4,5-hirL2,41benzothiadiazin-3-yl)-4-hydroxy-l-
(3-methylbutyl)-L8-naphthyridm-2(lH)-one The product of Example 377 (24 mg, 0.055 mmole) was suspended in water (0.1 mL) and cooled to 0°C in an ice bath. To this sluπy was added an acetonitrile solution of cyanogen bromide (0.1 mL, 0.067 mmole) and the mixture was stirred for 42 hours at room temperature. The reaction mixture was concentrated under reduced pressure to give the title compound (23.5 mg, 92%.) The compound was converted to the sodium salt as described in example ID. MS (EST) m/z 466 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 0.97 (d, J=6.62 Hz, 6 H) 1.49 (s, 2 H) 1.65 (s, 1 H) 4.29 (d, J=8.46 Hz, 2 H) 6.01 (s, 2 H) 6.49 (s, 1 H) 6.78 (d, J=8.09 Hz, 1 H) 7.12 (dd, J=7.72, 4.41 Hz, 1 H) 7.30 (d, J=8.09 Hz, 1 H) 8.38 (m, 1 H) 8.51 (d, J=1.47 Hz, 1 H) 11.03 (s, 1 H).
Example 419 N-{3-r4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-vn-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl|propane-l-sulfonamide
To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added 1- propanesulfonyl chloride (22.5 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane:ethyl acetate. The crude product was chromatographed on reverse phase HPLC eluting with 0.1% aqueous trifluoroacetic acid/methanol (90/10) to 0.1% aqueous trifluoroacetic acid/methanol (5/95) to give the title compound (3 mg, 11%). ]H NMR (300 MHz, DMSO-dg) δ 0.97 (m, 9 H) 1.57 (m, 2 H) 1.69 ( , 3 H) 3.17 (t, J=7.74 Hz, 2 H) 4.49 (t, J=7.74 Hz, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.58 (dd, J=8.82, 2.57 Hz, 1 H) 7.64 (d, J=2.21 Hz, 1 H) 7.75 (d, J=8.82 Hz, 1 H) 8.56 (dd, J=7.72, 1.84 Hz, 1 H) 8.90 (dd, J=4.41, 1.84 Hz, 1 H) 10.35 (s, 1 H) 14.09 (s, 1 H). MS (EST) m/z 532 (M-H)".
Example 420 2-chloro-N-{3-r4-hvdroχy-l-(3-methylbutyl)-2-oxo-l,2-dihvdro-T8-naphthyridin-3-yn-l,l- dioxido-4H-l.,2,4-benzothiadiazin-7-yljbenzenesulfonamide
To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added 2- chlorobenzenesulfonyl chloride (27 mL, 0.2 mmol). The reaction mixture was heated in a
' -388- microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane: ethyl acetate. The crude product was purified by chromatography on silica gel eluting with 199:ldichloromethane:methanol to give the title 5 compound (14 mg, 46%). 1H NMR (300 MHz, DMSO-dg) δ 0.96 (d, J=6.25 Hz, 6 H) 1.54 (m, 2 H) 1.67 (m, 1 H) 4.44 (t, J=7.71 Hz, 2 H) 7.57 (m, 7 H) 8.11 (d, J=8.46 Hz, 1 H) 8.52 (dd, J=8.09, 1.84 Hz, 1 H) 8.86 (dd, J=4.78, 1.84 Hz, 1 H) 11.24 (s, 1 H) 13.99 (s, 1 H). MS (EST) m& 600 (M-H)".
lό Example 421
1 -chloro-N- ( 3-r4-hvdroxy- 1 -(3-methylbutvP-2-oxo-l ,2-dihydro- 1 ,8-naρhthyridin-3-vn- 1.1 - dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl Imethanesulf onamide To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added chloromethylsulfonyl chloride (18 mL, 0.2 mmol). The reaction mixture was heated in a 15 microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with of 1:1 hexane:ethyl acetate. The crude product was purified by chromatography on reverse phase gradient eluting with 0.1% trifluoroacetic acid in water/methanol (90/10) to 0.1%frifluoroacetic in water/methanol (5/95) to give the title 20 compound (6 mg, 22%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.69 (m, 1 H) 4.49 (t, J=7.74 Hz, 2 H) 5.18 (s, 2 H) 7.51 (dd, J=7.91, 4.60 Hz, 1 H) 7.62 (dd, J=8.82, 2.57 Hz, 1 H) 7.67 (d, J=2.57 Hz, 1 H) 7.77 (d, J=8.82 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, 1=4.41, 1.84 Hz, 1 H) 10.91 (s, 1 H) 14.10 (s, 1 H). MS (EST) m/z 538 (M-H)". 25 :
Example 422 N-j3-r4-hvdroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yll-l,l-dioxido- 4H- 1 ,2;4-benzothiadiazin-7-yl 1 butane- 1 -sulfonamide To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added 1- 30 butanesulfonyl chloride (26 mL, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane:ethyl acetate. The crude product was chromatographed on silica gel eluting with 199:1 dichloromethane:methanol to give the title compound (8 mg, 29%). 35 1H NMR (300 MHz, DMSO-de) δ 0.84 (t, J=7.35 Hz, 3 H) 0.98 (d, J=6.62 Hz, 6 H) 1.37 (m, 2 H) 1.56 (m, 2 H) 1.69.(m, 3 H) 3.19 (t, J=7.74 Hz, 2 H) 4.48 (t, J= 7.74 Hz, 2 H) 7.50 (dd, J=7.91, 4.60 Hz, 1 H) 7.58 (dd, J=9.01, 2.39 Hz, 1 H) 7.65 (d, J=2.21 Hz, 1 H) 7.75 (d,
' -389- J=8.82 Hz, 1 H) 8.55 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.41, 1.84 Hz, 1 H) 10.35 (s, 1 H) 14.07 (s, 1 H) 15.13 (s, 1 H). MS (ESf) m/z 548 (M+H)+.
Example 423 2,6-dichloro-N-l3-f4-hvdroxy-l-(3-methylbutvP-2-oxo-l,2-dihydro-T8-naphthyridin-3-yll- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl I benzenesulf onamide To the product of Example 205 (21.5g, 0.05 mmol) in pyridine (1 mL) was added 2,6- dichloroϊjenzenesulfonyl chloride (49, 0.2 mmol). The reaction mixture was heated in a microwave reactor at 120°C for 120 minutes. The reaction was cooled to 25°C and concentrated under reduced pressure. The residue was triturated with water (1 mL), filtered, and washed with 1:1 hexane:ethyl acetat. The crude product was chromatographed on silica gel eluting with 399:ldichloromethane:methanol to give the title compound (5 mg, 16%). 1H NMR (300 MHz, DMSO-d6) δ 0.97 (d, J=6.62 Hz, 6 H) 1.54 (m, 2 H) 1.67 (m, 1 H) 4.46 (m, 2 H) 7.47 (m, 2 H) 7.58 (m, 2 H) 7.68 (m, 3 H) 8.54 (dd, J=7.72, 1.84 Hz, 1 H) 8.88 (dd, J=4J8, 1.84 Hz, 1 H) 11.43 (s, 1 H) 14.02 (s, 1 H). MS (EST) m/z 634 (M-H)".
"Example 424 methyl 2-chloro-6-({3-r4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yll-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy)isonicotinate A mixture of the product of Example 32 IC (40.0 mg, 0.138 mmol), potassium carbonate (19.1 mg, 0.138 mmol), copper(H)oxide (18.4 mg, 0.23 mmol)and methyl 2,6- dichloroisonicotinate (28.4 mg, 0.138 mmol) in pyridine (0.2 mL) was stiπed while heating at 125°C in a microwave reactor for 100 minutes. After cooling to 25°C, the mixture was loaded directly onto silica gel gel and eluted with a 0-5% methanol in dichloromethane step gradient. The fractions containing the desired product were combined and concentrated. The title compound was isolated by recrystallization of the residue using ethyl acetate/hexane (4.3 mg, 68%). MS (ESI") m/z 596 (M-H)". !H NMR (300 MHz, CDC13) δ 1.13 (d, 7=6.62 Hz, 6 H) 2.00 (m, 1 H) 2.84 (br m, 2 H) 3.99 (s, 3 H) 5.73 (br s, 1 H) 7.43 (m, .4 H) 7.62 (d, 7=8.46 Hz, 1 H) 7.80 (m, 2 H) 7.96 (d, 7=8.46 Hz, 1 H) 8.28 (d, 7=8.09 Hz, 1 H) 14.37 (s, 1 H) 15.04 (s, 1 H).
Example 425A 4-(benzyloxy)-l-(3-methylbutyl)pyridin-2(lH)-one
A solution of 4-benzyloxy-lH-pyridin-2-one (1.0 g, 4.97 mmol) and l-bromo-3- methyl butane (0J15 mL, 5.96 mmol) in N,N-dimethylformamide (20 mL) was treated with
-390- l,8-diazabicyclo[5.4.0]undec-7-ene (1.86 mL, 12.43 mmol) at 65°C for 5 days. The mixture was cooled to 25 °C and partitioned between water and dichloromethane. The organic layer was concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1% methanol in dichloromethane to give the title compound (0.57 g, 42%). MS (DCI NH3) m/z 272 (M+H)+. 1H NMR (300 MHz, CDC13) δ 0.96 (d, 7=6.25 Hz, 6 H) 1.61 (m, 3 H) 3.89 (m, 2 H) 4.99 (s, 2 H) 5.98 (dd, 7=7.54, 2.76 Hz, 1 H) 6.06 (d, 7=1.84 Hz, 1 H)
7.14 (d, 7=7.72 Hz, 1 H) 7.39 (m, 5 H).
"\
Example 425B 4-hvdroxy-l-(3-methylbutyl)pyridin-2(lH)-one
A solution of the product of Example 425A (0.55 g, 2.03 mmol) in tetrahydrofuran (10 mL) was treated with ammonium formate (0.37 g, 5.87 mmol) and a catalytic amount of 20% palladium hydroxide on carbon at 60°C for 3 hours. The solution was filtered through diatomaceous earth and the filfrate was concentrated to yield the title compound (0.21 g, 57%). MS (DCI/NΗ3) m/z 182 (M+H)+. 1H NMR (300 MHz, CDC13) δ 0.95 (d, 7=6.25 Hz, 6 H) 1.60 (m, 3 H) 3.90 (m, 2 H) 6.09 (dd, 7=7.35, 2.57 Hz, 1 H) 6.15 (d, 7=2.21 Hz, 1 H) 7.17 (d, 7=7.35 Hz, I H).
Example 425C 3-rbis(methylthio)methylene1-l-(3-methylbutyl)pyridine-2.4(lH.3H)-dione
A solution of the product of Example 425B (0.038 g, 0.21 mmol) in 1,4-dioxane (3 mL) was freated with pyridine (0.135 mL, 1.68 mmol) and tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0.11 g, 0.42 mmol) at 40°C for 1 hour. Another portion of tris(methylthio)methyl methyl sulfate (0. I l g, 0.42 mmol) was added and the solution was heated at 85°C for 1 hour. The reaction mixture was cooled to 25°C and the solvent was removed under a stream of with warm nitrogen. The residue was chromatographed on a 1 gram Alltech sep-pack cartridge eluting with 100% dichloromethane followed by 30% ethyl acetate in dichloromethane to yield the title compound (19 mg, 33%). 1H NMR (300 MHz, CHLOROFORM-D) δ 0.96 (d, 7=6.25 Hz, 6 H) 1.58 (m, 3 H) 2.66 (s, 6 H) 3.78 (m, 2 H) 5.99 (d, 7=7.35 Hz, 1 H) 7.06 (d, 7=7.72 Hz, 1 H).
Example 425D 2-amino-5-r(methylsulfonyPaminolbenzenesulfonamide A mixture of 2,5-diamino-benzenesulfonamide (0.288 g, 0.0015 mol, leq.), dichloromethane (5 mL), and pyridine (5 mL) was stiπed at 0°C. Methanesulfonyl chloride (119 uL, 0.0015 mol, leq.) was added dropwise over 3 minutes. The reaction mixture was
-391- O 2004/041818
warmed to 25° and stiπed for 18 hours. The reaction mixture was evaporated under reduced pressure and the residue was chromatographed on silica gel using a step gradient of 0-4% methanol in dichloromethane to yield the title compound (68% yield). !H NMR (300 MHz, DMSO-de) δ 2.87 (s, 3 H) 3.39 (s, 1 H) 5.80 (s, 1 H) 6J8 (d, 7=8.82 Hz, 1 H) 7.13 (dd, 7=8.64, 2.39 Hz, 1 H) 7.29 (s, 2 H) 7.45 (d, 7=2.57 Hz, 1 H) 9.21 (m, 1 H). MS (ESF) m/z=266 (M+H)+.
• Example 425E
N-13-f4-hvdroxy-l-(3-methylbutvP-2-oxo- 1 ,2-dihydropyridin-3-vn-l ,l-dioxido-4H-l ,2,4- benzothiadiazin-7-yl I methanesulfonamide
A solution of the product of Example 425C (0.019 g, 0.067 mmol) and the product of Example 425D (0.018 g, 0.067 mmol) in 1,4-dioxane was heated at 100°C for 1 hour. The solvent was removed under a stream of with warm nitrogen and the residue was purified by preparative HPLC on a Waters Symmetry C8 column (25mm X 100mm, 7um particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous trifluoroacetic acid to yield the title compound ( 0.007 g, 23%). MS (EST) m/z 453 (M-H)". 1H NMR (300 MHz, DMSO-de) δ 0.93 (d, J=6.25 Hz, 6 H) 1.58 (m, 3 H) 3.08 (s, 3 H) 3.99 (m, 2 H) 6.33 (d, J=6.62 Hz, 1 H) 7.57 (m, 2 H) 7.67 (d, J=8.82 Hz, 1 H) 8.07 (d, J=6.62 Hz, 1 H) 10.25 (s, 1 H) 13.84 (s, 1 H) 14.28 (s, 1 H).
Example 426A l-benzyl-4-hydroxypyridin-2(lH)-one The title compound was prepared by the method of Eschenhof, et. al., Tetrahedron, v 48, 30, p 6225-6230, 1992. :
Example 426B l-benzyl-3-rbis(methylthio)methylenelpyridine-2,4(lH,3H)-dione A solution of the product of Example 426A (0.124 g, 0.62 mmol) in 1,4-dioxane (6 mL) was treated with pyridine (0.400 mL, 4.96 mmol) and tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0.32 g, 1.24 mmol) at 40°C for 15 minutes. Another portion of tris(methylthio)methyl methyl sulfate (0.32 g, 1.24 mmol) was added and the solution was heated at 90°C for 1 hour. The solvent was removed under a stream of with warm nitrogen and the residue was purified using a 1 gram Alltech sep-pack cartridge eluting with 100% dichloromethane followed by 30% ethyl acetate in dichloromethane to yield the title compound (79 mg, 42%). 1HNMR (300 MHz, CHLOROFORM-D) δ 2.68 (s, 6 H) 4.99
-392- (s, 2 H) 6.11 (d, 7=7.72 Hz, 1 H) 7.17 (d, 7=8.09 Hz, 1 H) 7.33 (m, 5 H).
Example 426C N- f3 -( 1 -benzyl-4-h vdroxy-2-oxo- 1 ,2-dih ydrop yridin-3 -yl)- 1 , 1 -dioxido-4H- 1,2 ,4- benzothiadiazm-7-yllmethanesulfonamide
A solution of the product of Example 426B (0.028 g, 0.092 mmol) and the product of Example 425D (0.025 g, 0.092 mmol) in 1,4-dioxane was heated at 100°C for 40 minutes. The solvent was removed under a stream of with warm nitrogen and the residue was triturated with water and ethyl acetate. The precipitate in the organic layer was filtered and dried to yieid the title compound (0.006 g, 12%). MS (EST) m/z 473 (M-H)". XH NMR (500 MHz, DMSO-D6) δ 3.06 (s, 3 H) 5.21 (s, 2 H) 6.38 (d, 1=4.88 Hz, 1 H) 7.34 (m, 5 H) 7.55 (m, 3 H) 8.18 (d, J=3.05 Hz, 1 H) 10.25 (s, 1 H) 13.87 (s, 1 H) 14.05 (s, 1 H).
Example 427 N-r(3-{ l-r(cyclopropylmethyl)aminol-4-hvdroxy-2-oxo-l,2-dihvdroquinolin-3-yl)-l,l- dioxido-4H-thienof2,3-eiri,2,41thiadiazin-7-yl)methynethanesulfonamide To a solution of the product of Example 353E (16.1 mg, 0.036 mmol) in N,N- dimethylformamide (0.4 mL) was added triethylamine ( 0.011 mL, 0.079 mmol). The mixture was cooled to 0°C and ethanesulfonyl chloride was added (0.0036 mL, 0.038 mmol). The mixture was warmed to 23°C and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile in 0.1% trifluoroacetic acid in water to 95% acetonitrile/0.1% trifluoracetic acid in water to give the title compound (7.7 mg, 40 %). The sodium salt of the title compound was prepared by adding 1 N sodium hydroxide (0.029 mL, 0.0029 mmol) to a solution of the title compound ( 7.7 mg, 0.014 mmol) in water (0.4 mL) and stirring for thirty minutes. The reaction mixture was concentrated under reduced pressure. 1H NMR (300 MHz, DMSO-de) δ 0.21 (bs, 2 H) 0.46 (d, 2 H) 0.99 (m, 1 H) 1.19 (t, 3 H) 3.01 (q, 2 H) 4.23 (s, 2 H) 5.85 (t, 7=6.62 Hz, 1 H) 6.79 (s, 1 H) 6.93 (t, 7=7.54 Hz, 1 H) 7.35 (t, 7=6.99 Hz, 2 H) 7.59 (d, 7=8.09 Hz, 1 H) 7.95 (d, 7=6.62 Hz, 1 H).
Example 428 N- ["(3- { 1 - r(cycloprop ylmeth vPaminol -4-h ydrox y-2-oxo- 1 ,2-dih ydroquinolin-3 -yl I - 1 , 1 - dioxido-4H-thienor2,3-eiri.2.41thiadiazin-7-yl)methyllpropane-l-sulfonamide To a solution of the product of Example 353E (16.7 mg, 0.037 mmol) in Ν,Ν- dimethylformamide (0.4 mL) was added triethylamine ( 0.011 mL, 0.079 mmol). The mixture was cooled to 0 °C and 1-propane sulfonyl chloride was added (0.005 mL, 0.041
-393- mmol). The mixture was warmed to 23°C and stirred for 1.5 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile/0.1% trifluoroacetic acid in water to 95% acetonitrile/0.1%trifluoracetic acid in water to give the title compound (9.9 mg, 5 48%). 1H NMR (300 MHz, DMSO-d6) δ 0.15 (d, 7=4.04 Hz, 2 H) 0.42 (d, 7=7.35 Hz, 2 H) 0.99 (m, 4 H) 1.69 (m, 2 H) 2.84 (d, 7=7.35 Hz, 2 H) 3.06 (m, 2 H) 4.27 (d, 7=6.25 Hz, 2 H) 6.35 (bs, 1 H) 7.37 (s, 1 H) 7.42 (t, 7=7.54 Hz, 2 H) 7J5 (t, 7=6.07 Hz, 1 H) 7.87 (t, 7=7.17 Hz, 1 H);8.07 (d, 7=8.46 Hz, 1 H) 8.15 (dd, 1 H) 14.52 (bs, 1 H).
„ 0 Example 429N-IY3-1 l-r(cvclopropylmethyl)amino1-4-hvdroxy-2-oxo-l ,2-dihvdroquinolin-3- yl I -1 , l-dioxido-4H-thienor2,3-el Tl ,2,41thiadiazin-7-yl)methyl1propane-2-sulfonamide-
To a solution of the product of Example 353E (16.2 mg, 0.036 mmol) in Ν,Ν- dimethylformamide (0.4 mL) was added triethylamine ( 0.011 mL, 0.079 mmol). The mixture was cooled to 0 °C and isopropyl sulfonyl chloride was added (0.0043 mL, 0.038 5 mmol). The mixture was warmed to 23°C and stiπed for 3 hours. Additional isopropyl sulfonyl chloride ( 0.006 mL, 0.055 mmol) was added and the reaction mixture was stiπed at 23°C for 15 hours. The reaction mixture was stiπed at 50°C for 2 hours. Additional triethylamine (0.040 mL, 0.287 mmol) and isopropyl sulfonyl chloride ( 0.010 mL, 0.091 mmol) were added and the reaction mixture was stirred at 50°C for 2 hours. The reaction 0 mixture was cooled to 25 °C and concenfrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile/0.1% trifluoroacetic acid in water to 95% acetonitrile/0.1%trifluoracetic acid in water to give the title compound (6.7 mg, 33%). The sodium salt of the title compound was prepared according to the procedure of Example ID. 1H NMR (300 MHz, DMSO-d6) δ 0.21 (bs, 2 H) 5 0.48 (d, 2 H) 0.98 (m, 1 H) 1.24 (d, 7=6.99 Hz, 6 H) 3.19 (m, 1 H) 4.25 (s, 2 H) 5.85 (t, 1 H) 6.76 (s, 1 H) 6.92 (t, 1 H) 7.34 (m, 2 H) 7.57 (d, 1 H) 7.96 (d, 1 H).
Example 430 N- \(3- { 1 - r(cvclopropylmethvPamino1-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl 1-1,1- 0 dioxido-4H-thienor2,3-gll'l,2,41thiadiazin-7-yl)methyllbenzenesulfonamide
To a solution of the product of Example 353E (16.9 mg, 0.038 mmol) in N,N- dimethylformamide (0.4 mL) was added triethylamine ( 0.012 mL, 0.083 mmol) and benzene sulfonyl chloride (0.006 mL, 0.042 mmol). The reaction mixture was stirred at 23°C for 0.75 hours. The reaction mixture was concentrated under reduced pressure. The residue was 5 purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile/0.1% trifluoroacetic acid in water to 95% acetonitrile/0.1%trifluoracetic acid in water to give the title compound (10.7 mg, 48%). 1H NMR (300 MHz, DMSO-d6) δ 0.14 (d, 7=4.04 Hz, 2 H)
-394- 0.41 (d, 7=7.72 Hz, 2 H) 1.01 (m, 7=7.54, 7.54 Hz, 1 H) 2.83 (d, 7=6.99 Hz, 2 H) 4.07 (d, 7=6.25 Hz, 2 H) 6.38 (bs, 1 H) 7.30 (s, 1 H) 7.41 (t, 7=7.54 Hz, 1 H) 7.65 (m, 3 H) 7.86 (m, 3 H) 8.06 (d, 7=8.82 Hz, 1 H) 8.15 (d, 7=6.99 Hz, 1 H) 8.42 (t, 7=6.25 Hz, 1 H) 14.43 (bs, 1 H).
Example 431
N-K3- { 1 - r(cvclopropylmethyl)aminol-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl 1-1,1- dioxido-4H-thienor2,3-eiri,2,41thiadiazin-7-yl)methyll-l-phenylmethanesulfonamide T,o a solution of the product of Example 353E (16.5 mg, 0.037 mmol) in Ν,Ν- dimethylformamide (0.4 mL) was added triethylamine ( 0.011 mL, 0.079 mmol). The mixture was cooled to 0°C and α-toluene sulfonyl chloride was added (0.008 g, 0.041 mmol). The reaction mixture was warmed to 23°C and stiπed for 0.5 hours. The reaction mixture was then heated to 50°C and stiπed for 1.75 hours. Additional triethylamine (0.010 mL, 0.074 mmol) and α-toluene sulfonyl chloride (0.007 g, 0.037mmol) were added and the reaction mixture was stirred at 23°C for 1 hour. The reaction mixture was concentrated under reduced pressure. The residue was purified by reverse phase chromatography, eluting with a gradient of 10% acetonitrile/0.1% trifluoroacetic acid in water to 95% acetonitrile/0.1%trifluoracetic acid in water to give the title compound (7.7 mg, 35%). JΗ NMR (300 MHz, DMSO-d6) δ 0.15 (d, 7=4.04 Hz, 2 H) 0.42 (d, 7=7.72 Hz, 2 H) 1.00 (m, 1 H) 2.84 (d, 7=7.35 Hz, 2 H) 4.23 (d, 7=5.52 Hz, 2 H) 4.44 (s, 2 H) 6.37 (bs, 1 H) 7.32 (s, 1 H) 7.42 (m, 6 H) 7.86 (m, 2 H) 8.07 (d, 7=8.46 Hz, 1 H) 8.16 (dd, 1 H) 14.50 (bs, 1 H).
Example 432A 1 -(cvclobutylamino)-4-hydroxyquinolin-2( lH)-one
A solution of the product of Example 350A (0.516 g, 2.9 mmol) and cyclobutanone (1.05 g, 15.0 mmol) in acetic acid (0.90 g, 15.0 mmol) and methanol (20 mL) was freated portion wise with sodium cyanoborohydride (0.94 g, 15.0 mmol), stiπed for 48 hours and concenfrated. The residue was treated with 0.5 M aqueous sodium bicarbonate, acidified to pΗ 2 with IM hydrochloric acid and extracted with ethyl acetate. The ethyl acetate was washed with brine, dried over sodium sulfate, filtered and concentrated. The crude material was chromatographed on silica gel eluting with 3:2 hexane/ethyl acetate to give the title compound (0.400 g, 60 %). MS (ESI*) m/z 231 (M+Η)+. 1H NMR (300 MHz, DMSO-d6) δ 1.52 (m, 1 H) 1.63 (m, 1 H) 1.96 (m, 4 H) 3.64 (m, 1 H) 5.91 (s, 1 H) 6.26 (d, 7=6.62 Hz, 1 H) 7.20 (t, 7=8.09 Hz, 1 H) 7.61 (m, 1 H) 7.84 (m, 2 H) 11.42 (s, 1 H).
-395- Example 432B 3-rbis(methylthio)methylenel-l-(cyclobutylamino)quinoline-2,4(lH,3H)-dione A solution of the product of Example 432A (0.115 g, 0.5 mmol) and tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi) (0.27 g, 1.0 mmol) in pyridine (0.316 g, 4.0 mmol) and dioxane (5.0 mL) was heated at 60°C for 30 minutes. Additional tris(methylthio)methyl methyl sulfate was added (0.27 g, 1.0 mmol) and heating continued for 30 minutes. The mixture was cooled to 25 °C and partitioned between ethyl acetate and water. The ethyl acetate layer was washed with water, brine, dried over sodium sulfate, filtered and concentrated. The crude material was chromatographed on silica gel eluting with 95/5 dichloromethane/ethyl acetate to give the title compound (0.146 g, 87 % yield). MS (ESI ) m/z 335 (M+Η)+. 1H NMR (300 MHz, DMSO-d6) δ 1.54 (m, 1 H) 1.66 (m, 1 H) 1.99 (m, 4 H) 2.61 (s, 6 H) 3.62 (m, 1 H) 6.18 (d, 7=6.25 Hz, 1 H) 7.15 (t, 7=7.54 Hz, 1 H) 7.63 (m, 1 H) 7.72 (d, 7=8.09 Hz, 1 H) 7.98 (dd, 7=7.91, 1.29 Hz, 1 H).
Example 432C N-{3-ri-(cvclobutylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yll-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl Imethanesulfonamide A mixture of the product of Example 425D (0.195 g, 0.585 mmol, 1.5 eq.) and thέ product of Example 432B (O.lOOg, 0.390mmol, 1.5 eq.) in anhydrous dioxane (10 mL) was heated for 1 hour at 120°C. After cooling to 25°C, the reaction mixture was treated with methanol (20 mL) and diethyl ether (20 mL) and the precipitated product collected by vacuum filfration to yield the title compound (25 mg, 12% yield). 1H ΝMR (300 MHz, DMSO-de) δ 1.69 (m, 2 H) 2.13 (m, 4 H) 3.10 (s, 3 H) 3.77 (m, 1 H) 6.57 (s, 1 H) 7.44 (t, 7=7.35 Hz, 1 H) 7.65 (m, 3 H) 7.89 (t, 7=7.35 Hz, 1 H) 8.06 (d, 7=8.46 Hz, 1 H) 8.16 (d, : 7=7.72 Hz, 1 H) 10.31 (s, 1 H) 14.16 (s, 1 H) 15.03 (s, 1 H). MS (ESf ) m/z=504 (M+H)+.
Example 433 N-(3 - 11 - F(cvclopropylmethyl)amtno1-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3- yl 1-1,1- dioxido-4H- 1 ,2,4-benzothiadiaziri-7-yl)methanesulf onamide
A solution of the product of Example 353B (0.090 g, 0.269 mmol, 1 eq.), and the product of Example 425D (0.07 lg, 0.269mmol, 1 eq.), in anhydrous dioxane (5 mL) was heated for 1 hour at 120°C. After cooling the reaction mixture to 25°C, methanol (20 mL) and diethyl ether (20 mL) were added and the precipitated product collected by vacuum filtration to give the title compound (21 mg, 15.5% yield). XH ΝMR (300 MHz, DMSO-d6) δ 0.16 (m, 2 H) 0.41 (m, 2 H) 1.07 (m, 1 H) 2.85 (m, 2 H) 3.10 (s, 3 H) 6.44 (m, 1 H) 7.44 (t, 7=7.54 Hz, 1 H) 7.62 ( , 2 H) 7.71 (m, 1 H) 7.90 (t, 7=7.91 Hz, 1 H) 8.10 (d, 7=8.46 Hz, 1
-396- H) 8.17 (d, 7=6.99 Hz, 1 H) 10.30 (m, 1 H) 14.15 (m, 1 H). MS (ESI*) m/z=504 (M+H)+.
Example 434 4-hvdroxy-3-r8-(hydroxymethyl)-l,l-dioxido-4,9-dihvdroimidazor4,5- ιiri,2,41benzothiadiazin-3-vn-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one
The product of Example 377 (14 mg, 0.033 mmole) was treated with 4N ΗC1 (0.5 mL) and glycolic acid (4 mg, 0.052 mmole) and the resulting mixture was heated 24 hours at reflux. The mixture was concentrated under reduced pressure to a white pasty solid. The solid was purified by chromatography on silica gel eluting with 95:5 dichloromethane:methanol to give the title compound (10 mg, 63%). The title compound was converted to the sodium salt as described in Example ID. MS (ESr1") m/z: 483. 1H NMR (300 MHz, DMSO-dg) δ 0.97 (d, J=6.25 Hz, 6 H) 1.50 (s, 1 H) 1.64 (d, J=6.99 Hz, 1 H) 3.87 (s, 1 H) 4.08 (d, 1=6.62 Hz, 1 H) 4.30 (d, J=6.99 Hz, 1 H) 4.54 (s, 1 H) 4.66 (d, J=6.62 Hz, 1 H) 4.73 (s, 1 H) 5.33 (d, J=6.62 Hz, 1 H) 7.04 (d, 1=8.82 Hz, 1 H) 7.14 (dd, J=7.35, 4.78 Hz, 1 H) 7.76 (d, J=8.82 Hz, 1 H) 8.39 (dd, J=7.54, 2.02 Hz, 1 H) 8.53 (m, 1 H) 12.49 (s, 1 H).
Example 435A
2-chloroethyl (|3-r4-hvdroxy-l-C3-methylbutyl)-2-oxo-l,2-dihvdro-T8-naphthyridin-3-vn- 1 ,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl 1 amino)sulfonylcarbamate A solution of chlorosulfonyl isocyanate (33 mg, 0.23 mmol) in dichloromethane (8 mL) was cooled to 0°C and 2-chloroethanol (18.8 mg, 0.23 mmol) was added dropwise. The mixture was stirred at 0°C for 90 minutes followed by the addition of a solution containing ' the product of Example 205 (100 mg, 0.23 mmol) and triethylamine (71 mg, 0.70 mmol) in dichloromethane (2 mL). The mixture was stiπed for 24 hrs at 25°C then partititioned between dichloromethane (25 mL) and IN aqueous hydrochloric acid (20 mL). The resulting organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (96 mg, 67%). MS (ESI") m/z 611 (M- Η)". 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.69 (m, 1 H) 3.78 (m, 2 H) 4.32 (m, 2 H) 4.49 (m, 2 H) 7.51 (m, 2 H) 7.63 (s, 1 H) 7.77 (d, J=9.19 Hz, 1 H) 8.56 (dd, J=7.72, 1.10 Hz, 1 H) 8.90 (dd, J=4.41, 1.47 Hz, 1 H) 11.15 (s, 1 H) 12.26 (s, 1 H) 14.10 (s, 1 H).
Example 435B N-|3-r4-hvdroxy-l-(3-methylbutvP-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yll-l,l-dioxido-
-397- 4H-l,2,4-benzothiadiazm-7-yll-2-oxo-l,3-oxazolidine-3-sulfonamide To a solution of the product of Example 435 A (90 mg, 0.147 mmol) in dichloromethane (10 mL) was added triethylamine (1 mL). The mixture was stirred at 25°C for 6 hours. The reaction was treated with IN aqueous hydrochloric acid (10 mL) and extracted with dichloromethane (20 mL). The organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound as a colorless solid (70 mg, 82%). ]Η NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.69 (m, 1 H) 3.98 (m, 2 H) 4.36. (m, 2 H) 4.48 (m, 2 H) 7.49 (dd, 7=7.72, 4.78 Hz, 1 H) 7.60 (m, 1 H) 7.62 (s, 1 H) 7.75 (d, 7=8.82 Hz, 1 H) 8.56 (m, 1 H) 8.89 (m, 1 H) 11.59 (s, 1 H) 14.15 (s, 1 H).
Example 435 C N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdro-l,8-naphthyridin-3-yl)-lT-dioxido-4H- l,2,4-benzothiadiazin-7-yll-N-(2-phenylethyl)sulfamide A mixture of the product of Example 435B (28 mg, 0.05mmole) and phenethylamine (6 mg, 0.05 mmol) in acetonitrile (10 mL) and triethylamine (0.5 mL) was heated at reflux for 18 hours. The reaction mixture was cooled to 25C, diluted with ethyl acetate, exfracted with 10 mL 1 Ν ΗC1, followed by 10 mL brine. The organic layer was dried over anhydrous Νa SO , filtered, and concentrated under vacuum. The product was isolated by preparative thin layer chromatography on silica gel eluting with 25 % ethyl acetate in dichloromethane to provide 2 mg of the title compound (10% yield). 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.62 Hz, 6 H) 1.57 (m, 2 H) 1.69 (m, 1 H) 2.68 (m, 2 H) 3.09 (m, 2 H) 4.49 (m, 2 H) 7.20 (m, 5 H) 7.46 (m, 1 H) 7.51 (m, 1 H) 7.60 (d, 7=2.21 Hz, 1 H) 7.68 (d, 7=8.82 Hz, 1 H) 7.97 (m, 1 H) 8.56 (dd, 7=8.09, 1.84 Hz, 1 H) 8.89 (m, 1 H) 10.28 (s, 1 H) 14.13 (s, 1 H) 15.23 (s, I H).
Example 436 benzyl 3 - 13 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro I" 1 , 81naphthyridin-3 - yl)- 1 , 1 -dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl1diazathiane- 1 -carboxylate 2,2-dioxide A solution of chlorosulfonyl isocyanate (24.5 μL, 0.281 mmol) in dichloromethane (2 mL) was treated dropwise with benzyl alcohol (29 μL, 0.281 mmol) at 25°C, stiπed at 25°C for 30 min, treated with a solution of the product of Example 205 (100 mg, 0.234 mmol) and triethylamine (130 μL, 0.936 mmol) in dichloromethane (3 mL)and stirred for 2 hrs at 25°C. The reaction mixture was treated with dichloromethane (10 mL) and IN aqueous hydrochloric acid (10 mL). The resulting organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (122 mg, 81%). MS (EST) m/z 639 (M-Η)". *Η NMR (300 MHz, DMSO-d6) δ 0.99 (d, 7= 6.6 Hz, 6H), 1.59 (m, 2H), 1.66 (m, IH), 4.49 (m, 2H), 5.12 (s, 2H), 7.32 (m,
-398- 5H), 7.48 (m, 2H), 7.65 (d, 7 = 2.2Hz, IH), 7.75 (d, 7 = 8.8Hz, IH), 8.57 (dd, 7 = 7.7,1.8 Hz, IH), 8.90 (dd, 7 = .8,1.8 Hz, IH), 11.17 (s, IH), 12.19 (bs, IH), 14.11 (bs, IH).
Example 437 N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydrofl,81naphthyridin-3-yl)-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yll sulf amide A solution of the product of Example 436 (40 mg, 0.0625 mmol) in methanol (5 mL) was treatέd with 10% palladium on carbon (20 mg), and stirred at 25°C for 5 hours under hydrogen atmosphere. The resulting solution was then filtered and the filfrate concentrated under reduced pressure to provide the title compound (25 mg, 78%). MS (ESI") m/z 505 (M- Η)\ 1H ΝMR (300 MHz, DMSO-d6) δ ppm 0.98 (d, 7= 6.3 Hz, 6H), 1.57 (m, 2H), 1.66 (m, IH), 4.42 (m, 2H), 7.38 (m, IH), 7.43 (m, 2H), 7.59 (m, IH), 8.52 (m, IH), 8.82 (bs, IH), 9.99 (bs, IH).
Example 438 benzyl 3-T3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro I" 1 , 81naphthyridin-3 -yl)- 1 , 1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yll-l-propyldiazathiane-l-carboxylate 2,2-dioxide A solution of triphenylphosphine (1.5 eq) in dichloromethane is treated dropwise with diethyl azodicarboxylate (1.5 eq) at 25°C. The solution is allowed to stir for 10 min followed by the dropwise addition of a solution containing the product of Example 436 (1 eq) and n- propanol (1.1 eq) in dichloromethane. The resulting solution is stirred at 25°C for 20 hours, followed by the addition of dichloromethane and IN aqueous hydrochloric acid. The resulting organic layer is separated and dried over magnesium sulfate, and filtered to provide the title compound.
Example 439 N-r3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dih vdrol , 81naphthyridin-3-yP- 1 , 1 -dioxido-4H- l,2,4-benzothiadiazin-7-yll-N-propylsulf amide A solution of the product of Example 438 in methanol is treated with 10% palladium on carbon and stirred at 25°C for 5 hours under hydrogen atmosphere. The resulting solution is then filtered and the filtrate concentrated under reduced pressure to provide the title compound.
Example 440methyl 3- r3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydror 1 , 81naphthyridin-3-vP- 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-7-ylldiazathiane-l -carboxylate 2,2-dioxide
To a stirred solution of chlorosulfonyl isocyanate (4.9 μL, 0.0562 mmol) in dichloromethane (2 mL) was added dropwise methanol (2.3 μL, 0.0562 mmol) at 25°C. After
-399- 30 minutes, a solution of the product of Example 205 (20 mg, 0.0468 mmol) and triethylamine (26 μL, 0.187 mmol) in dichloromethane (2 mL) was added and stiπed for 24 hours at 25°C. The reaction mixture was diluted with dichloromethane (10 mL) and IN aqueous hydrochloric acid (10 mL). The resulting organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (12 mg, 39%) as a triethylamine salt. 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7 = 6.3 Hz, 3H), 1.38 (m, 2H), 1.67 (m, IH), 3.63 (s, 3H), 4.50 (m, 2H), 7.53 (m, 2H), 7.63 (d, 7 = 2.2 , IH), 7.77 (d, 7 = 8.8 Hz, IH), 8.57 (dd, 7 = 8.1, 1.8 Hz, IH), 8.90 (dd, 7 = 4.4, 1.8 Hz, IH), 11.15 (s, IH), 12.10 (s, IH), 14.10 (s, IH). MS (EST) m/z 563 (M-H)". Example 441benzyl 3-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yll-l-methyldiazathiane-l-carboxylate 2,2-dioxide A solution of the product of Example 436 (0.032 g, 0.05 mmol) in 1:1 tetrahydrofuran / methanol (2 ml) at -10°C was treated dropwise with trimethylsilyl diazomethane (2.0 M in hexanes, 50 μL, 0.1 mmol), then stiπed at 25°Cfor 16 hours and concentrated under reduced pressure. The residue was chromatographed on silica gel eluting with 3% methanol in dichloromethane to provide the title compound (5 mg, 15% yield). *Η NMR (300 MHz, DMSO-de) δ 0.99 (d, J=6.25 Hz, 6 H) 1.58 (m, 2 H) 1.69 (m, 1 H) 3.21 (s, 3 H) 4.49 (m, 2 H) 5.19 (s, 2 H) 7.32 (m, 5 H) 7.46 (m, 1 H) 7.51 (dd, J=7.91, 4.60 Hz, 1 H) 7.58 (d, J=2.21 Hz, 1 H) 7.68 (d, 1=8.82 Hz, 1 H) 8.57 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4J8, 1.47 Hz, 1 H) 11.29 (s, 1 H) 14.09 (s, 1 H). MS (EST) m/z 653 (M-H)".
Example 442N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdro[l,81naphthyridin-3-yI)-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-7-vn-iV-methylsulfamide A solution of the product ofExample 441 (14 mg, 0.0214 mmol) in methanol (3 mL) was reacted with 10% palladium on carbon (10 mg) under a hydrogen atmosphere at 25°C with stirring for 2 hours. The solution was filtered and concentrated under reduced pressure to provide the title compound (8 mg, 73%). 1H ΝMR (300 MHz, DMSO-de) δ 0.94 (d, 7 = 6.6 Hz, 6H), 1.57 (m, 2H), 1.69 (m, IH), 2.49 (s, 3H), 4.45 (m, 2H), 7.50 (m, 2H), 7.62 (m, 2H), 8.57 (m, IH), 8.84 (m, IH), 10.18 (bs, IH). MS (EST) m/z 519 (M-H)".
Example 443 2-aminoethyl 3-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-ylldiazathiane-l-carboxylate 2,2-dioxide To a solution of chlorosulfonyl isocyanate (7.3 μL, 0.0843 mmol) in dichloromethane (2 mL) was added t-butyl Ν-(2-hydroxyethyl)carbamate (13.6 mg, 0.0843 mmol) at 25°C. After 30 minutes, the solution was freated with a solution of the product of Example 205 (30 mg, 0.0703 mmol) and triethylamine (39 μL, 0.281 mmol) in dichloromethane (2 mL) and
-400- O 2004/041818
stiπed for 24 hours. The reaction mixture was diluted with dichloromethane (10 mL) and IN aqueous hydrochloric acid (10 mL). The resulting organic layer was separated and dried over magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by reverse phase preparative HPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/ιnin to provide 8 mg of a solid. This solid was treated with a solution of trifluoroacetic acid (1.6 mL) and dichlorohiethane (0.4 mL) at 25°C for 3 hours. The solvent was removed under reduced pressure to provide the title compound (12 mg, 24%) as a trifluoroacetic acid salt. JH NMR (300 MHz, DMSO-de) δ 0.98 (d, 7= 6.6 Hz, 6H), 1.57 (m, 2H), 1.68 (m, IH), 3.06 (m, 2H), 4.21 (t, 7= 5.1 Hz, 2H), 4.46 (m, 2H), 7.49 (m, 2H), 7.63 (d, 7 = 2.2 Hz, IH), 7.71 (d, 7= 8.8 Hz, IH), 7.83 (bs, 2H), 8.55 (dd, 7= 7.7, 1.8 Hz, IH), 8.86 (m, IH). MS (EST) m/z 592 (M- H)-.
Example 444
N-cyclopentyl-N'-r3-(4-hvdro'xy-l-isopentyl-2-oxo-L2-dihydrorL81naphthyridin-3-yP-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 1-amino cyclopentane (0.0085 g, 0.0099 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen gas, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (11 mg, 38%). 1H ΝMR (300 MHz, DMSO-d6) δ 0.97 (d, J=6.62 Hz, 6 H) 1.51 (m, 11 H) 3.53 (m, 'l H) 4.48 (m, 2 H) 7.49 (m, 2 H) 7.60 (d, J=2.57 Hz, 1 H) 7.70 (d, J=9.19 Hz, 1 H) 7.83 (d, J=7.35 Hz, 1 H) 8.55 (dd, J=8.09, 1.84 Hz, 1 H) 8.88 (dd, J=4.60, 1.65 Hz, 1 H) 10.19 (s, 1 H) 14.06 (s, 1 H). (ESI-) m/z 573 (M-H)".
Example 445
N-cyclobutyl-N'-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-3-yP-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yllsulfamide To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 1-amino cyclobutane (0.0071 g, 0.0085 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen gas, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size)
-401- using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (8 mg, 28%). !H NMR (300 MHz, DMSO- d6) δ 0.98 (d, J=6.62 Hz, 6 H) 1.64 (m, 7 H) 2.05 (m, 2 H) 3.68 (m, 1 H) 4.49 (m, 2 H) 7.50 (m, 2 H) 7.59 (d, J=2.57 Hz, 1 H) 7.73 (d, J=8.82 Hz, 1 5 H) 8.16 (d, J=8.46 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.60, 1.65 Hz, 1 H) 10.17 (s, 1 H) 14.02 (s, 1 H). MS (ESI-) m/z 559 (M-H)".
' A-825309.1
lό Example 446A tert-butyl 4-r(ir3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-3-vP-l,l- dioxido-4H- 1 ,2.4-benzothiadiazin-7-yll amino 1 sulfonvPaminol- 1 -piperidinecarboxylate To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added N-l-Boc-4-amino piperidine (0.020 g, 0.1 mmol). The reaction mixture was heated in 15 a microwave reactor at 80°C for 2 hours and cooled to about 25°C The solvent was removed under a stream of warm nitrogen gas, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (12 mg, 20 35%).
Example 446B
N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-yll -N-(4-piperi din vPsulf amide 25 The product of Example 446A (0.012 g, 0.017 mmol) was dissolved in the solution of hydrogen chloride in 1,4-dioxane (4 Ν, 3 mL). The mixture was stirred at 25°C for 18 hours.
The solvent was removed under reduced pressure to give the title compound as its hydrochloride salt (10 mg, 92%). JΗ ΝMR (300 MHz, DMSO- d6) δ 0.99 (d, J=6.25 Hz, 6
H) 1.70 (m, 7 H) 2.95 (m, 2 H) 3.16 (m, 3 H) 4.49 (m, 2 H) 7.50 (m, 2 H) 7.63 (d, J=2.21 Hz, 30 1 H) 7.73 (d, J=9.19 Hz, 1 H) 8.17 (d, J=7.35 Hz, 1 H) 8.52 (m, 1 H) 8.56 (dd, J=7.91, 1.65
Hz, 1 H) 8.75 (m, 1 H) 8.90 (dd, J=4.60, 1.65 Hz, 1 H) 10.34 (s, 1 H) 14.08 (s, 1 H). MS
(ESI-) m/z 588 (M-H)".
A-825311.0 Example 447 DL2 35 N-(2-hvdroxyethvD-N'-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)- lT-dioxido-4H-l,2,4-benzothiadiazin-7-vnsulf amide To the product of Example 435 B (0.006 g, 0.0104 mmol) in tetrahydrofuran (2 ml)
-402- was added water (0.1 ml) and sodium ethoxide in ethanol (20% w/w, 1 ml). The mixture was stirred for 24 hours at 25°C. The reaction was concentrated under a stream of warm nitrogen gas, and the residue was treated with IN hydrochloric acid (2 ml) with stirring for 10 min. The resulting solid was filtered and dried to give the title compound (4 mg, 70%). H NMR 5 (300 MHz, DMSO- d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.58 (m, 2 H) 1 '.71 (m, 1 H) 2.92 (m, 2 H) 3.39 (m, 2 H) 4.50 (m, 2 H) 7.51 (m, 2 H) 7.61 (d, J=2.21 Hz, 1 H) 7.72 (d, J=8.82 Hz, 1 H) 7.80 (t, J=5.88 Hz, 1 H) 8.56 (dd, J=8.09, 1.84 Hz, 1 H) 8.89 (dd, J=4.41, 1.47, 1 H) 10.21 (s, 1 H) 14.08 (s, 1 H). MS (EST) m/z 549 (M-H)". Example 4483- ["({ r3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro 1 ,81naphthyridin-3-vD- 1,1- lδ dioxido-4H-l,2,4-benzothiadiazin-7-yllamino|sulfonyl)aminolpropanamide
To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added glycinamide hydrochloride (0.0125 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen gas and, the residue
15 was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (3 mg, 10%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.59 (m, 2 H) 1.70 (m, 1 H) 2.25 (t, J=7.54 Hz, 2 H) 3.07 (m, 2 H) 4.49 (m, 2 H) 6.80 (s, 1 H) 7.30
20 (s, 1 H) 7.50 (m, 2 H) 7.61 (d, 1=2.21 Hz, 1 H) 7J0 (d, J=8.82 Hz, 1 H) 7.82 (t, J=5.70 Hz, 1 H) 8.56 (dd, J=7J2, 1.84 Hz, 1 H) 8.89 (dd, 1=4.41 Hz, 1.47 Hz, 1 H) 10.23 (s, 1 H) 14.13 (s, 1 H). MS (ESI-) m/z 576 (M-H)".
A-832731.0 Example 449 25 N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-3-vP-l,l-dioxido-4H-' l,2,4-benzothiadiazin-7-yll-l-azetidinesulfonamide To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added azetidine hydrochloride (0.0095 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to 30 about 25°C. The solvent was removed under a stream of warm nitrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (2 mg, 7%). 1H ΝMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.58 35 (m, 2 H) 1.71 (m, 1 H) 2.15 (m, 2 H) 3.83 (t, J=7.54 Hz, 4 H) 4.49 (m, 2 H) 7.53 (m, 2 H) 7.63 (d, 1=2.21 Hz, 1 H) 7.72 (d, J=9.19 Hz, 1 H) 8.56 (dd, 1=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.41, 1.84 Hz, 1 H) 10.50 (s, 1 H) 14.11 (s, 1 H). MS (EST) m/z 545 (M-H)".
-403- A-832735.0 Example 450 DL2 3-hydroxy-N-r3-(4-hydroxy-l -isopentyl-2-oxo-T2-dihvdro I" 1 , 81naphthyridin-3-yl)- 1,1- dioxido-4H-l,2,4-benzothiadiazin-7-vn-l-azetidinesulfonamide 5 To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added 3-hydroxyazetidine hydrochloride (0.011 g, 0.1 mmol) and potassium carbonate (0.4 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to^about 25°C. The solvent was removed under a stream of warm nifrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column lδ (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (3 mg, 13%). 1H ΝMR (300 MHz, DMSO-d6) δ 0.99 (d, J=6.62 Hz, 6 H) 1.58 (m, 2 H) 1.71 (m, 1 H) 3.66 (m, 2 H) 3.92 (m, 2 H) 4.38 (m, 1 H) 4.50 (m, 2 H) 7.55 (m, 3 H) 7.73 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=8.09 Hz, 1.08 Hz, 1 H) 8.90 (dd, J=4.41, 15 1.84 Hz, 1 H) 10.55 (s, 1 H) 14.08 (s, 1 H). MS (ESI-) m/z 561 (M-H)".
Example 451 A tert-butyl l-({r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-3-yl)-l,l- 20 dioxido-4H-l,2,4-benzothiadiazin-7-vnaminolsulfonyl)-3-pyrrolidinylcarbamate
To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added Ν-Boc-3-amino pyπolidine (0.0186 g, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen, and the residue was purified by reverse phase preparative 25 ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (23 mg, 68%).
Example 45 IB 30 3-amino-N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-vP-l,l-dioxido-
4H- 1 ,2,4-benzothiadiazin-7-yll- 1 -pyrrolidinesulf onamide The product of Example 446A (0.012 g, 0.017 mmol) was dissolved hf solution of hydrogen chloride in 1,4-dioxane (4N, 3 mL). The mixture was stiπed at 25°C for about 18 hours. The solvent was removed under reduced pressure to give the title compound as its 35 hydrochloride salt (16 mg, 88%). Η NMR (300 MHz, DMSO-de) δ 0.98 (d, J=6.62 Hz, 6 H) 1.54 (m, 2 H) 1.67 (m, 1 H) 1.91 (m, 1 H) 2.18 (m, 1 H) 3.26 (m, 2 H) 3.50 (m, 2 H) 3.79 (m, 1 H) 4.43 (m, 2 H) 7.40 (dd, J=7.72, 4.78 Hz, 1 H) 7.58 (m, 3 H) 8.22 (s, 3 H) 8.50 (dd,
-404- J=7.71 Hz, 1.47 Hz, 1 H) 8.80 (d, J=3.31 Hz, 1 H) 10.52 (s, 1 H) 14.55 (s, 1 H). MS (ESI-) m/z 574 (M-H)".
5 Example 452A
1-piperidinesulfonyl chloride A solution of sulfuryl chloride (IN in dichloromethane, 75 mL, 75 mmol) at -20°C was treated dropwise with piperidine (12.6 g, 150 mmol), stiπed at 0°C for 2 hours, and partitioned between dichloromethane and water (50 mL). The organic layer was washed with lb aqueous IN HCl, brine and dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The residue was distilled under reduced pressure (1 mm Hg) at 105°C to give the title compound (5 grams).
Example 452B
15 N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-3-yl)-l,l-dioxido-4H-
1 ,2,4-benzothiadiazin-7-vn - 1 -piperidinesulfonamide A mixture of the product of Example 205 (2 mg, 0.1 ml), the product of Example 451A (17 mg, 0.1 mmol) and triethylamine (0.1 mL) in dichloromethane (2 mL) was stirred for 18 hours at 25°C, diluted with dichloromethane (25 mL) and washed with 1 Ν ΗC1 and
20 brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The product was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min to provide the title compound (10 mg). 1H ΝMR (300 MHz,
25 DMSO-de) δ 0.98 (d, 7=6.62 Hz, 6 H) 1.43 (s, 6 H) 1.57 (m, 2 H) 1.69 (m, 1 H) 3.14 (s, 4 H) 4.49 (m, 2 H) 7.51 (m, 1 H) 7.53 (s, 1 H) 7.60 (d, 7=2.21 Hz, 1 H) 7J2 (d, 7=8.82 Hz, 1 H) 8.56 (dd, 7=8.09, 1.84 Hz, 1 H) 8.90 (dd, 7=4.78, 1.84 Hz, 1 H) 10.47 (s, 1 H) 14.06 (s, 1 H) 15.05 (s, 1 H). MS (EST) m/z 573 (M-H)".
30 A-805330.0 Example 453 DLM
N-benzyl-N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide A mixture of the product of Example 435B (28 mg, 0.05mmole), benzylamine (6 mg, 0.05 mmol) and triethylamine (0.5 mL) in acetonitrile (2 mL) was stiπed at 70°C for 18 35 hours. The reaction mixture was cooled to about 25°C, partitioned between ethyl acetate and 1 Ν ΗC1 (10 mL). The organic layer was washed with brine and dried over anhydrous Νa2S0 , filtered, and concenfrated under reduced pressure. The residue was purified by
-405- reverse phase preparative HPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mIJmin to give the title compound (12 mg). 1H NMR (300 MHz, DMSO- d6) δ 0.99 (d, 7=6.25 Hz, 6 H) 1.65 (m, 3 5 H) 4.08 (d, 7=6.25 Hz, 2 H) 4.49 (m, 2 H) 7.22 (m, 5 H) 7.45 (m, 1 H) 7.51 (dd, 7=8.09, 4.78 Hz, 1 H) 7.61 (d, 7=2.57 Hz, 1 H) 7.69 (d, 7=8.82 Hz, 1 H) 8.41 (t, 7=6.25 Hz, 1 H) 8.57 (dd, 7=8.09, 1.84 Hz, 1 H) 8.90 (dd, 7=4.78, 1.84 Hz, 1 H) 10.33 (s, 1 H) 14.08 (s, 1 H) 15.15 (s, 1 H). MiS (EST) m/z 595 (M-H)".
*0 Example 454ethyl 3-f({ r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yll amino I sulfonvDaminolbenzoate A solution of 3-amino-benzoic acid ethyl ester (0.165 g, 1.0 mmol) in dichloromethane (6 mL ) at about 0°C was added dropwise with chlorosulfonic acid (0.128 g, 1.1 mmol). The reaction mixture was stiπed at 25°C for 1 h and then phosphorous 5 pentachloride (0.229 g, 1.1 mmol) was added and the reaction mixture heated under reflux for 3.5 hours. The reaction mixture was then cooled to about 25°C and the solvent evaporated under reduced pressure. A solution of the residue in dichloromethane (10 mL) was treated with the product of Example 205 (0.214 g, 0.5 mmol), followed by triethylamine (0.152 g, 1.5 mmol). The reaction mixture was stiπed at 25°C for 3 hours and then poured 0 into 25mL of IN aqueous hydrochloric acid. The reaction mixture was then extracted with dichloromethane (3 x 25 mL). The combined organics were dried over anhydrous magnesium sulfate, filtered, and evaporated under reduced pressure. The residue was purified by chromatography on silica gel, eluting with 0-2% methanol/dichloromethane to provide the title compound (0.166 g, 48% yield). 1H NMR (300 MHz, DMSO- d6) δ 0.98 (d, 5 7=6.25 Hz, 6 H) 1.30 (t, 7=7.17 Hz, 3 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 4.29 (q, 7=6.99 Hz, 2 H) 4.48 (m, 2 H) 7.44 (m, 4 H) 7.57 (d, 7=2.21 Hz, 1 H) 7.62 (dt, 7=7.36, 1.47 Hz, 1 H) 7.69 (d, 7=8.82 Hz, 1 H) 7.74 (s, 1 H) 8.55 (dd, 7=8.09, 1.84 Hz, 1 H) 8.88 (dd, 7=4.41, 1.84 Hz, 1 H) 10.80 (s, 1 H) 10.88 (s, 1 H) 14.11 (s, 1 H). MS (ESr") m/z 655.1 (M+H)+, 672.2 (M+NEL ", 677.0 (M+Na)+, (EST) m/z 653.1 (M-H)". 0
A-824028.0 Example 455 3-[( { [3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro \ 1 , 81naphthyridin-3-yl)-l , l-dioxido-4H- l,2,4-benzothiadiazin-7-yllamino|sulfonyl)aminolbenzoic acid A solution of the product of Example 454 (25.5 mg, 0.389 mmol) in 1 mL of IN 5 aqueous sodium hydroxide and 1 mL of methanol was stiπed at 25°C for 17 hours, and concentrated under a stream of warm nitrogen. The residue was freated with 2 mL of IN aqueous hydrochloric acid. The resulting solid was isolated by vacuum filtration, washed
-406- with 10 mL of water, and dried to provide the title compound (21.4 mg, 88% yield). 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.62 Hz, 6 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 4.48 (m, 2 H) 7.32-7.53 (m, 4 H) 7.59 (m, 2 H) 7.69 (d, 7=8.82 Hz, 1 H) 7.75 (s, 1 H) 8.55 (dd, 7=8.09, 1.84 Hz, 1 H) 8.88 (dd, 7=4.78, 1.47 Hz, 1 H) 10.79 (s, 1 H) 10.88 (s, 1 H) 13.01 (bs, 1 H) 14.12 (bs, 1 H). MS (ESI1) m/z 627.1 (M+H)+, 649.1 (M+Na)+, (EST) m/z 625.1 (M- H)\
Examplέ 4563-r({ r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yllaminolsulfonyl)amino1benzamide A solution of the product of Example 454 (7.6 mg, 0.012 mmol) in 1 mL of ammonium hydroxide was stiπed at 25°C for 17 hours. The solvent was evaporated under a stream of warm nitrogen to provide the title compound (7.4 mg). Η NMR (300 MHz, DMSO-de) δ 0.96 (d, 7=6.62 Hz, 6 H) 1.47 (m, 2 H) 1.64 (m, 1 H) 4.30 (m, 2 H) 7.14 (m, 1 H) 7.28 (m, 6 H) 7.43 (s, 1 H) 7.49 (d, 7=7.72 Hz, 1 H) 7.66 (s, 1 H) 7.87 (s, 1 H) 8.36 (dd, 7=7.54, 1.65 Hz, 1 H) 8.54 (s, 1 H) 10.45 (bs, 1 H) 10.51 (bs, 1 H) 15.89 (bs, 1 H).
Example 457 A4-(benzyl oxy)- l-isopentyl-2(lH)-pyridinone A solution of 4-benzyloxy-lH-pyridin-2-one (1.0 g, 4.97 mmol) and 1,8- diazabicyclo[5.4.0]undec-7-ene (1.86 mL, 12.43 mmol) and l-bromo-3-methyl butane (0.715 mL, 5.96 mmol) in N,N-dimethylacetamide (20 mL) was heated at 65°C for 5 days. The solution was cooled to about 25°C and partitioned between 10% aqueous ammonium chloride and dichloromethane, the organic layer separated and concentrated under reduced pressure. The residue was chromatographed on silica gel, eluting with 1%. methanol in dichloromethane to provide the title compound (0.569 g, 42%).
Example 457B 4-hydroxy- 1 -isopentyl-2( lHVpyridinone The product of Example 457A (0.452 g, 1.67 mmol) in tetrahydrofuran (20 mL) was treated with ammonium formate (0.30 g, 5.01 mmol) and a catalytic amount of 20% palladium hydroxide on carbon at 60°C for 2 hours. The reaction was filtered through diatomaceous earth and the filtrate concentrated under reduced pressure to provide the title compound (0.30 g, 100%).
Example 457C
3-fbis(methylsulfanyl)methylenel-l-isopentyl-2,4(lH,3H)-pyridinedione The product of Example 457B (2.24 g, 12.37 mmol) in pyridine (8.0 mL, 98.96
-407- mmol) and dioxane (50 mL) at 90°C was treated with excess tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi), stirred at 90°C for 1.5 hours and cooled to about 25°C. The reaction solution was decanted from the resulting solids and the solvent was 5 removed under reduced pressure. The residue was dissolved in hexanes and loaded onto a pad of silica gel (300 mL) and eluted with hexane followed by dichloromethane then 25% • ethyl acetate in dichloromethane to provide the title compound (2.42 g, 75%). ' '\
Example 457D lδ 3-(7-amino- 1.1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -isopentyl-2( 1H)- pyridinone The product of Example 457C (2.08 g, 7.29 mmol) was freated with the product of Example 414A (2.00 g, 6.96 mmol) in dioxane (20 mL) at 115°C for 30 minutes, cooled to 25°C and concenfrated under reduced pressure. A solution of the residue in 4M hydrochloric
15 acid in dioxane (20 mL) was stiπed at 25°C for 18 hours and concentrated under reduced pressure. The residue was triturated with dichloromethane and filtered to give the title compound. The filtrate containing the protected intermediate was concentrated and purified by chromatography on silica gel eluting with 1% methanol in dichloromethane. The protected product was re-subjected to the above deprotection conditions to provide the title
20 compound as its hydrochloride salt (2.02 g, 96%). 1H NMR (300 MHz, DMSO-de) 0.92 (s, 3 H) 0.94 (s, 3 H) 1.58 (m, 3 H) 3.99 (m, 2 H) 6.31 (d, J=7.35 Hz, 1 H) 6.96 (m, 2 H) 7.34 (d, J=8.46 Hz, 1 H) 8.04 (d, J=7.35 Hz, 1 H) 14.04 (s, 1 H) 14.19 (s, 1 H). MS (ESI-) m/z 375 (M-H)".
25 ' Example 457E benzyl 3-r3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro-3-pyridinyl)-l , 1 -dioxido-4H- 1 ,2,4- benzothiadiazin-7-vHdiazathiane-l-carboxylate 2,2-dioxide A solution of chlorosulfonylisocynate (61.8 mg, 0.436 mmol) and benzyl alcohol (47.0 mg, 0.436 mmol) in dichloromethane (7.5 ml) was stiπed at 25°C for 1 hour followed 30 by the addition of a solution of the product of Example 457D (150 mg, 0.363 mmol) and triethylamine (183.7 mg, 1.82 mmol) in dichloromethane (14 mL), stiπed at 25°C for 20 hours, and partitioned between dichloromethane (25 mL) and IN aqueous hydrochloric acid (25 mL). The organic layer was separated and dried over magnesium sulfate, filtered and concenfrated under reduced pressure to provide the title compound (200 mg, 93%). XΗ NMR 35 (300 MHz, DMSO-de) δ 0.93 (s, 3 H) 0.95 (s, 3 H) 1.58 (m, 3 H) 4.00 (m, 2 H) 5.11 (s, 2 H) 6.35 (d, J=7J2 Hz, 1 H) 7.32 (m, 5 H) 7.46 (dd, J=9.01, 2.39 Hz, 1 H) 7.61 (d, J=2.57 Hz, 1 H) 7.65 (d, J=9.19 Hz, 1 H) 8.09 (d, J=7.72 Hz, 1 H) 11.10 (s, 1 H) 12.14 (s, 1 H) 13.87 (s, 1
-408- H) 14.25 (s, 1 H). MS (ESI-) m/z 588 (M-H)".
Example 458N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdro-3-pyridinyl)-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl"|sulf amide 5 A solution of the product of Example 457E (40 mg, 0.068 mmol) in methanol (5 mL) was stiπed with 10% palladium on carbon (22 mg) under hydrogen atmosphere at 25°C for 4 hours. The reaction was filtered and the filtrate concentrated under reduced pressure to provide the title compound (28 mg, 99%). 1H ΝMR (300 MHz, DMSO-d6) δ 0.92 (s, 3 H) 0.94 (s, 3 H) 1.58 (m, 3 H) 3.98 (m, 2 H) 6.32 (d, J=4.41 Hz, 1 H) 7.36 (s, 2 H) 7.47 (m, 1 H) lδ 7.60 (m, 2 H) 8.06 (s, 1 H) 10.00 (s, 1 H) 13.97 (s, 1 H) 14.23 (s, 1 H). MS (EST) m/z 454 (M-H)".
Example 459 A 15 tert-butyl 2-r(( r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydro[l,81naphthyridin-3-vP-lT- dioxido-4H-l,2,4-benzothiadiazin-7-yllaminolsulfonyl)amino1ethylcarbamate To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added tert-butyl Ν-(2-aminoethyl) carbamate (0.016 g, 0.016 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. 20 The solvent was removed under a stream of warm nitrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mIJmin give the title compound (6.3 mg, 20%). 1H NMR (300 MHz, DMSO-d6) δ 0.99 (d, 7=6.25 Hz, 6 H) 1.34 25 (s, 9 H) 1.58 (m, 2 H) 1.68 (m, 1 H) 2.88 (m, 2 H) 2.97 (m, 2 H) 4.50 (m, 2 H) 6.75 (s, 1 H) 7.50 (m, 2 H) 7.60 (d, 7=2.21 Hz, 1 H) 7.72 (d, 7=8.82 Hz, 1 H) 7.87 (t, 7=5.70 Hz, 1 H) 8.57 (dd, 7=8.09, 1.84 Hz, 1 H) 8.90 (dd, 7=4.41, 1.84 Hz, 1 H) 10.26 (s, 1 H) 14.09 (s, 1 H). MS (EST) m/z 648 (M-H)".
Example 459B 30 N-(2-aminoethyp-N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihydrori,81naphthyridin-
3-vP-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-vnsulf amide A solution of the product of Example 459A (0.0053 g, 0.0082 mmol) in a solution of hydrogen chloride in 1,4-dioxane (4 Ν, 3 mL) and stiπed at 25°C and stirred for 18 hours. The solvent was removed under reduced pressure to give the title compound as the 35 hydrochloride salt (4 mg, 89%). XΗ ΝMR (300 MHz, DMSO-de) δ 0.99 (d, 7=6.62 Hz, 6 H) 1.56 (m, 2 H) 1.68 (m, 1 H) 2.89 (m, 2 H) 3.10 (m, 2 H) 4.49 (m, 2 H) 7.51 (m, 2 H) 7.62 (d, 7=2.21 Hz, 1 H) 7.74 (d, 7=8.82 Hz, 1 H) 7.79 (s, 2 H) 8.03 (t, 7=5.70 Hz, 1 H) 8.56 (dd,
-409- 7=7.72, 1.84 Hz, 1 H) 8.89 (dd, 7=4.41, 1.84 Hz, 1 H) 10.37 (s, 1 H) 14.16 (s, 1 H). MS (EST) m/z 548 (M-H)".
Example 460 5 ethyl l-({f3-(4-hvdroxy-l-isopentvI-2-oxo-l,2-dihydroπ,81naphthyridin-3-yP-l.l- dioxido-4H-l,2,4-benzothiadiazin-7-yllaminolsulfonvP-3-piperidinecarboxylate To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was added ethyl nipecotate (0.016 g, 0.016 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours, and cooled to about 25°C. The solvent was removed lδ under a stream of warm nitrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (20.3 mg, 63%). 1H NMR (300 MHz, DMSO-d6) δ 0.98 (d, 7=6.62 Hz, 6 H) 1.15 (t, 7=7.17 Hz, 3 H) 1.45 (m, 2 15 H) 1.56 (m, 2 H) 1.68 (m, 2 H) 1.82 (m, 1 H) 2.88 (m, 1 H) 3.04 (m, 1 H) 3.63 (m, 1 H) 4.02 (m, 2 H) 4.49 (m, 2 H) 7.51 (dd, 7=9.01, 2.39 Hz, 2 H) 7.57 (d, 7=2.21 Hz, 1 H) 7.70 (d, 7=8.46 Hz, 1 H) 8.56 (dd, 7=8.09, 1.84 Hz, 1 H) 8.88 (d, 7=3.68 Hz, 1 H) 10.52 (s, 1 H) 14.13 (s, 1 H). MS (EST) m/z 645 (M-H)".
20
Example 461 A methyl (2 ')-l-(chlorosulfonyl)-2-pyrrolidinecarboxylate A solution of L-proline methyl ester hydrochloride (0.33 g, 0.002 mole) in toluene (5 ml), dichloromethane (2 ml) and triethylamine (0.6 ml, 0.004 mole) was added dropwise over 25 a period of 3 minutes to a cold (-20°C) solution of sulfuryl chloride (0.32 ml, 0.0039 mole) in toluene. The mixture was stiπed an additional 45 minutes at -20°C. The reaction was filtered and the solvent was removed under reduced pressure to give the title compound (0.40 g). !H NMR (300 MHz, CDC13) δ 2.13 (m, 2 H) 2.32 (m, 2 H) 3.58 (m, 1 H) 3J5 (m, 1 H) 3.79 (s, 3 H) 4.40 (dd, 7=8.82, 4.04 Hz, 1 H). 30
Example 46 IB methyl (2S)-l-(( r3-(4-hvdroxy-l-isopentyl-2-oxo-l ,2-dihvdro| ,81naphthyridin-3-yl)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] amino 1 sulfonyl)-2-pyrrolidinecarboxylate The product of Example 205 (0.030g, 0.0703 mmol) in acetonitrile (2 ml) was treated 35 with the product of Example 461A (0.018 g, 0.077 mmol) and triethylamine (0.011 ml, 0.077 mmol), stirred at 60°C for 20 hours and cooled to about 25°C. The solvent was evaporated under reduced pressure, and the residue was purified by reverse phase preparative
-410- HPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (7 mg, 16%). 1H NMR (300 MHz, DMSO-dg) δ 0.99 (d, J=6.25 Hz, 6 H) 1.59 (m, 2 H) 1.67 (m, 2 H) 1.87 (m, 4 H) 2.09 (d, 1=8.46 Hz, 1 H) 3.60 (s, 3 H) 4.26 (dd, J=8.64, 3.86 Hz, 1 H) 4.50 (m, 2 H) 7.55 (m, 4 H) 7.73 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.78, 1.84 Hz, 1 H)
10.53 (s, 1 H) 14.07 (s, 1 H). MS (ESI-) m z 617 (M-H)".
' ">
Example 462 N-r3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihvdrori,81naphthyridin-3-yl)-l,l-dioxido-
4H-l,2,4-benzothiadiazin-7-yn-l-pyrrolidinesulfonamide The product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was'treated with pyπolidine (0.0076 g, 0.009 mL, 0.1 mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/ lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (2.6 mg, 9%). Η ΝMR (300 MHz, DMSO-d6) δ 0.98 (d, J=6.25 Hz, 6 H) 1.23 (s, 1 H) 1.55 (s, 1 H) 1.75 (m, 1 H) 2.51 (m, 4 H) 3.21 (t, 1=6.62 Hz, 4 H) 4.48 (s, 2 H) 7.60 (s, 6 H) 8.53 (s, 1 H) 8.87 (s, 1 H) 10.35 (s, 1 EL). MS (ESI-) m/z 559 (M-H)".
Example 4633-hydroxy-N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l ,2-dihvdro|T ,81naphthyridin-3- yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yll-l-piperidinesulfonamide To the product of Example 435B (0.029 g, 0.05 mmol) in acetonitrile (2 mL) was treated with 3-hydroxypiperidine hydrochloride (0.0079 g, 0.1 mmol) and triethylamine (0.00796 ml, 0.057mmol). The reaction mixture was heated in a microwave reactor at 80°C for 2 hours and cooled to about 25°C. The solvent was removed under a stream of warm nitrogen, and the residue was purified by reverse phase preparative ΗPLC on a Waters Symmetry C8 column (25mm x 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile/lOmM ammonium acetate in water over 8 minutes (10 minutes run time) at a flow rate of 40mL/min give the title compound (4.8 mg, 18%). JΗ ΝMR (300 MHz, DMSO- de) δ 0.99 (d, J=6.62 Hz, 6 H) 1.18 (s, 1 H) 1.35 (s, 1 H) 1.59 (m, 2 H) 1.67 (d, J-34.56 Hz, 2 H) 2.71 (s, 4 H) 3.51 (s, 4 H) 4.50 (m, 2 H) 7.51 (m, 2 H) 7.58 (m, 1 H) 7.72 (d, J=8.82 Hz, 1 H) 8.57 (dd, J=8.09, 1.84 Hz, 1 H) 8.90 (dd, J=4.60, 1.65 Hz, 1 H) 10.46 (s, 1 H) 14.08 (s, 1 H). MS (EST) m/z 589 (M-H)".
-411- Example 464A tert-butyl 3-[l-(cvclobutylamino)-4-hydroxy-2-oxo-l,2-dihydro-3-quinolinyl1-l,l-dioxido-
4H- 1 ,2,4-benzothiadiazin-7-ylcarbarnate A mixture of the product of Example 432B (1.25 g, 3.74 mmol) and the product of Example 414A (1.06 g, 3.7 mmol) in anhydrous dioxane (50 mL) was heated at reflux for 3 hours, cooled to 25°C, and concentrated under reduced pressure. The residue was triturated in hot 3:1} hexane/ethyl acetate (30 mL), cooled, and the solid was collected by filtration and dried to provide the title compound (1.5 g, 76% yield).
Example 464B 3-(7-amino-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(cvclobutylamino)-4-hydroxy-
2( lH)-quinolinone A sluπy of the product of Example 464A (1.5-g, 2.85 mmol) in dichloromethane (10 mL) at 0°C was treated dropwise with 6 mL of trifluoroacetic acid, stiπed at 25°Cfor 2 hours and concentrated under reduced pressure. The residue was dissolved in ethyl acetate, washed with 10% aqueous sodium bicarbonate (3 x 50 mL), washed with brine, dried over sodium sulfate, filtered and concenfrated under reduced pressure to provide the title compound (1.1 g, 91% yield).
Example 464C N-{3-ri-(cvclobutylamino)-4-hvdroxy-2-oxo-l,2-dihydro-3-quinolinyn-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl I ethanesulfonamide A solution of the product of Example 464B (0.0425 g, 0.1 mmol) in pyridine (300 μL) was treated dropwise with ethane sulfonyl chloride (0.026 mg, 0.2 mmol), stiπed for 1 hour at 25°C and concentrated under reduced pressure. The residue was purified by preparative ΗPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 8min (lOmin run time) at a flow rate of 40 mL/minute to provide the title compound (0.020 g, 39% yield). TI ΝMR (300 MHz, DMSO-d6) δ 1.23 (t, J=7.17 Hz, 3 H) 1.56 (m, 1 H) 1 JO (m, 1 H) 2.05 (m, 4 H) 3.19 (q, J=7.35 Hz, 2 H) 3.77 (m, 1 H) 6.56 (s, 1 H) 7.44 (t, 1=7.54 Hz, 1 H) 7.60 (dd, J=8.82, 2.21 Hz, 1 H) 7.67 ( , 2 H) 7.89 (m, 1 H) 8.06 (d, J=8.46 Hz, 1 H) 8.17 (d, 1=8.09 Hz, 1 H) 10.33 (s, 1 H) 14.16 (s, 1 H) 15.03 (br. s„ 1 H). MS (EST) m/z 516 (M-H)". Example 465benzyl 3-{ 3-ri-(cyclobutylamino)-4-hyάiOXV-2-oxo-l ,2-dihydro-3-quinolinvn- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl 1 diazathiane- 1 -carboxylate 2,2-dioxide
A solution of chlorosulfonyl isocyanate (0.051 g, 0.36 mmol) in dichloromethane (2 mL) was treated dropwise with benzyl alcohol (0.039 g, 0.36 mmol) at 0°C, stiπed at 25°C
-412- for 30 minutes and treated with a solution of the product of Example 464B (0.127 g, 0.03 mmol) and triethylamine (0.12 g, 1.2 mmol) in dichloromethane (4 mL). The reaction mixture was stirred for 2 hours at 25°C and partitioned between dichloromethane (10 mL) and IN aqueous hydrochloric acid (10 mL). The resulting organic layer was separated, dried over sodium sulfate, filtered, and concentrated under reduced pressure. The residue was chromatographed on silica gel eluting with 3% methanol in dichloromethane to provide the title compound (0.127 g, 66% yield). 1H NMR (300 MHz, DMSO-d6) δ 1.57 (m, 1 H) 1.70 (m, 1 H)'S.04 (m, 4 H) 3.78 (m, 1 H) 5.12 (s, 2 H) 6.57 (s, 1 H) 7.30 (m, 5 H) 7.44 (t, J=7.54 Hz, 1 H) 7.50 (m, 1 H) 7.66 (m, 2 H) 7.89 (t, J=7.91 Hz, 1 H) 8.07 (d, J=8.09 Hz, 1 H) 8.17 (d, J=8.46 Hz, 1 H) 11.13 (s, 1 H) 12.16 (s, 1 H) 14.15 (s, 1 H) 15.06 (s, 1 H). MS (EST) m/z 637 (M-H)".
Example 466A benzyl 3- { 3 - I" 1 -(c vclobutylamino)-4-h ydroxy-2-oxo- 1 ,2-dih ydro-3 -quinolin yll -1,1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yll-l-methyldiazathiane-l-carboxylate 2,2-dioxide A solution of the product of Example 465 (0.045 g, 0.07 mmol) in 1:1 tefrahydrofuran methanol (2 ml) at -10°C was treated dropwise with trimethylsilyl diazomethane (2.0 M in hexanes, 70 μL, 0.14 mmol), stiπed at 25°C for 16 hours and concentrated under reduced pressure to provide the title compound (0.045 g, 98% yield).
Example 466B N-|3-ri-(cyclobutylamino)-4-hvdiOxy-2-oxo-l,2-dihvdro-3-quinolinvn-l,l-dioxido-
4H-1 ,2,4-benzothiadiazin-7-yl 1 -N-methylsulf amide A solution of the product of Example 466A (0.045 g, 0.069 mmol) in tetrahydrofuran (8 mL) and methanol (2 mL) was treated with 10% palladium on carbon (20 mg) and stirred for 24 hours at 25°C under a hydrogen atmosphere. The resulting solution was filtered through Celite® (diatomaceous earth) and the filtrate concentrated under reduced pressure. The residue was purified by preparative ΗPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 8min (lOmin run time) at a flow rate of 40 miJminute to provide the title compound (0.006 g, 17% yield). 1H ΝMR (300 MHz, DMSO-d6) δ 1.55 (m, 1 H) 1.69 (m, 1 H) 2.03 (m, 4 H) 3.78 (m, 1 H) 6.55 (s, 1 H) 7.40 (d, J=5.52 Hz, 1 H) 7.45 (m, 1 H) 7.52 (dd, J=8.82, 2.57 Hz, 1 H) 7.65 (m, 2 H) 7.88 (t, j=7.91 Hz, 1 H) 8.07 (d, 1=8.46 Hz, 1 H) 8.16 (d, J=6.99 Hz, 1 H) 10.24 (s, 1 H) 14.11 (s, 1 H) 15.11 (s, 1 H). MS (EST) m/z 517 (M-H)".
Example 467N-{3-ri-(cvclobutylamino)-4-hvdroxy-2-oxo-l,2-dihydro-3-quinolinvn- 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadi azin-7-yl 1 sulf amide A solution of the product of Example 465 (0.790 g, 1.2 mmol) in tetrahydrofuran (80 mL) and methanol (20 mL) was treated with 10% palladium on carbon (200 mg) and stiπed for 24 hours at 25°C under a hydrogen atmosphere. The reaction was filtered through Celite® (diatomaceous earth) and
-413- the filfrate concentrated under reduced pressure to provide the title compound (0.500 g, 83% yield). Η NMR (300 MHz, DMSO-de) δ 1.58 (m, 1 H) 1.67 (m, 1 H) 2.03 (m, 4 H) 3.78 (m, 1 H) 6.56 (s, 1 H) 7.39 (s, 2 H) 7.44 (t, J=7.54 Hz, 1 H) 7.52 (m, 1 H) 7.64 (m, 2 H) 7.89 (t, J=7.91 Hz, 1 H) 8.07 (d, 1=8.82 Hz, 1 H) 8.17 (d, J=8.46 Hz, 1 H) 10.06 (s, 1 H) 14.09 (s, 1 H) 15.14(s, 1 H). MS (EST) m/z 503 (M-H)".
Example 468A 4-(benzyloxy)- 1 -(c yclobutylmethyl)-2( lH)-pyridinone
A solution of 4-benzyloxy-lH-pyridin-2-one (0.60 g, 2.98 mmol) in N,N- dimethylacetamide (10 mL) at 0°C was treated with sodium hydride ( 0.086 g, 3.58 mmol) for 30 min, then bromomethyl cyclobutane (0.40 mL, 3.58 mmol) was added and the mixture was stirred at 25°Cfor 48 hours. The solution was partitioned between 10% aqueous ammonium chloride solution and dichloromethane, the organic layer was separated, concentrated under reduced pressure and the residue was chromatographed on silica gel, eluting with 1% methanol in dichloromethane to provide the title compound (0.426 g, 53%).
Example 468B 1 -(cvclobutylmethyl)-4-hvdroxy-2( lH)-pyridinone
A solution of the product of Example 468A (0.426 g, 1.58 mmol) in tetrahydrofuran (20 mL) was treated with ammonium formate (0.38 g, 6.03 mmol) and a catalytic amount of 20% palladium hydroxide on carbon at 70°C for 2 hours. The reaction mixture was cooled to about 25°C, filtered through diatomaceous earth and the filtrate concentrated under reduced pressure to provide the title compound (0.244 g, 86%).
Example 468C 3-rbis(methylsulfanyl)methylenel-l-(cvclobutylmethvP-2,4(lH,3H)-pyridinedione A solution of the product of Example 468B (0.244 g, 1.36 mmol) and pyridine (0.88 mL, 10.89 mmol) in dioxane (6 mL) was freated with excess tris(methylthio)methyl methyl sulfate (prepared using the procedures in Synthesis, 22-25, 1988; M. Barbero, S. Cadamuro, I. Degani, R. Fochi, A. Gatti, V. Regondi), stiπed at 90°C for 1.5 hours, and cooled to about 25°C. The reaction solution was decanted from the resulting solids and the solvent was removed under a stream of warm nitrogen. The residue was dissolved in hexanes and loaded onto a 2 g Alltech Seppack and eluted with hexanes followed by dichloromethane followed by 25% ethyl acetate in dichloromethane to provide the title compound (0.192 g, 50%).
-414- Example 468D N-f 3-ri-(cvclobutylmethvP-4-hydroxy-2-oxo-l,2-dihvdro-3-pyridmyn-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl I methanesulf onamide A solution of the product of Example 468C (0.050 g, 0.176 mmol) in dioxane (5 mL) 5 was freated with the product of Example 425D (0.030 g, 0.113 mmol), stiπed at 110°C for 1 hour, and cooled to 25°C. The solid precipitate was collected by filtration and dried to provide the title compound (0.018 g, 35%). 1H NMR (300 MHz, DMSO-d6) δ 1.88 (m, 6 H) 2.74
Figure imgf000417_0001
Hz, 2 H) 6.32 (d, J=7.72 Hz, 1 H) 7.56 (dd, J=8.82,'2.57 Hz, 1 H) 7.62 (d, 1=2.21 Hz, 1 H) 7.66 (m, 1 H) 8.06 (d, J=7.35 Hz, lδ 1 H) 10.24 (s, 1 H) 13.83 (s, 1 H) 14.28 (s, 1 H). MS (ESI-) m/z 451 (M-H)".
Example 469 N- 13 - [5 -bromo- 1 -(c yclobutylmethyl)-4-h vdroxy-2-oxo- 1 ,2-dihydro-3 -pyridinyll -1,1- dioxido-4H-l,2,4-benzothiadiazin-7-yllmethanesuIfonamide 15 A solution of the product of Example 468D (0.030 g, 0.066 mmol) in tetrahydrofuran
(2 mL) was treated with l,3-dibromo-5,5-dimethyl-hydantoin (0.015 g, 0.052 mmol) at 25°C for 18 hours. The reaction was concenfrated under a warm stream of nitrogen and the residue was purified by preparative ΗPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 20 8min (lOmin run time) at a flow rate of 40mL/min to provide the title compound (0.008 g, 23%). .1H ΝMR (300 MHz, DMSO-d6) δ 1.83 (m, 4 H) 1.95 (m, 2 H) 2.75 (m, 1 H) 3.08 (s, 3 H) 4.03 (d, J=6.99 Hz, 2 H) 7.56 (dd, J=9.01, 2.39 Hz, 1 H) 7.62 (d, J=2.21 Hz, 1 H) 7.67 (d, J=8.82 Hz, 1 H) 8.55 (s, 1 H) 10.24 (s, 1 H) 14.35 (s, 1 H). MS (EST) m/z 530 (M-H)".
25
Example 470A N-r3-(4-hvdroxy-l-isopentyl-2-oxo-l,2-dihvdro-3-pyridinyP-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yllmethanesulfonamide 30 A solution of the product of Example 457C (0.195 g, 0.68 mmol) in dioxane (10 mL) was reacted with the product of Example 425D (0.17 g, 0.64 mmol) at 115°C for 1 hour. After cooling to about 25°C, the solid precipitate was collected by filtration and dried to provide the title compound (0.258 g, 89%). Η ΝMR (300 MHz, DMSO-d6) δ 0.93 (d, J=6.25 Hz, 6 H) 1.58 (m, 3 H) 3.08 (s, 3 H) 3.99 (m, 2 H) 6.33 (d, J=6.62 Hz, 1 H) 7.57 (m, 2 35 H) 7.67 (d, J=8.82 Hz, 1 H) 8.07 (d, J=6.62 Hz, 1 H) 10.25 (s, 1 H) 13.84 (s, 1 H) 14.28 (s, 1 H). MS (EST) m/z 453 (M-H)".
-415- Example 470B N- [3 -(5 -bromo-4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dih vdro-3 -pyridinyl)- 1 , 1 -dioxi do- 4H-l,2,4-benzothiadiazin-7-vHmethanesulfonamide A solution of the product of Example 470A (0.258 g, 0.57 mmol) in tetrahydrofuran (10 mL) was treated with l,3-dibromo-5,5-dimethyl hydantoin (0.24 g, 0.84 mmol) at 25°C for 18 hours. The solvent was under a warm stream of nitrogen and the residue was chromatographed on silica gel eluting with dichloromethane to provide the title compound (0.13 g, 43%). Ti ΝMR (300 MHz, DMSO-d6) δ 0.94 (d, J=6.25 Hz, 6 H) 1.61 (m, 3 H) 3.08 (s, 3 H) 4.00 (m, 2 H) 7.56 (dd, J=8.82, 2.21 Hz, 1 H) 7.63 (d, J=2.21 Hz, 1 H) 7J0 (m, 1 H) 8.59 (s, 1 H) 10.26 (s, 1 H) 14.29 (s, 1 H). MS (ESI-) m/z 532 (M-H)".
Example 470C N-[3-(4-hydroxy-l-isopentyl-2-oxo-5-vinyl-l,2-dihvdro-3-pyridinyl)-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yllmethanesulfonamide The product of Example 470B (0.027 g, 0.051 mmol) and tributyl(vinyl)tin (0.015 mL, 0.051 mmol) in tetrahydrofuran and a catalytic amount of dichlorobis(triphenyl phospine)palladium(II) were reacted at 75°C for 20 hours. The solution was cooled to about 25°C and concenfrated. The residue was purified by preparative ΗPLC on a Waters Symmetry C8 column (25mm X 100mm, 7μm particle size) using a gradient of 10% to 100% acetonitrile:0.1% aqueous TFA over 8min (lOmin run time) at a flow rate of 40mLmin to provide the title compound (0.005 g, 21%). 1H ΝMR (300 MHz, DMSO-de) δ 0.95 (d, J=5.88 Hz, 6 H) 1.61 (m, 3 H) 3.08 (s, 3 H) 4.05 (m, 2 H) 5.32 (d; J=11.03 Hz, 1 H) 5.87 (d, J=18.02 Hz, 1 H) 6.64 (m, 1 H) 7.64 (m, 3 H) 8.42 (s, 1 H) 10.26 (s, 1 H) 14.42 (s, 1 H) 14.67 (s, 1 H). (EST) m/z 479 (M-H)". :
Example 471 N-(2-furylmethyl)-3-r3-(4-hydroxy-l-isopentyl-2-oxo-T2-dihydro|l,81naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-ylldiazathiane-l-carboxamide 2,2-dioxide A solution of chlorosulfonyl isocyanate (4.9 μL, 0.0562 mmol) in dichloromethane (2 mL) was treated dropwise with furfurylamine (5 μL, 0.0562 mmol) at 25°C, stiπed at 25°C for 30 min, freated with a solution of product of Example 205 (20 mg, 0.0468 mmol) and triethylamine (26 μL, 0.187 mmol) in dichloromethane (2 mL) and stiπed for 24 hours at 25°C. The reaction mixture was partitioned between dichloromethane (10 mL) and IN aqueous hydrochloric acid (10 mL). The resulting organic layer was separated, dried over magnesium sulfate, filtered, and concentrated under reduced pressure to provide the title compound (15%). MS m/z 630 (M+Η)+.
The following additional compounds of the present invention, can be prepared by one
-416- skilled in the art using known synthetic methodology or by using synthetic methodology described in the Schemes and Examples contained herein. The additional compounds encompassed by the following tables can be described by taking one core from Table 1, one R1 substituent from Table 2 (wherein Xi represents the Core Ring Structure), one or two Y3 substituent from Table 4, and when needed Yi and/or Y2 substituent from Table 3.
Figure imgf000419_0001
-417-
Figure imgf000420_0001
-418-
Figure imgf000421_0001
-419-
Figure imgf000422_0001
-420-
Figure imgf000423_0001
Figure imgf000423_0002
-421-
Figure imgf000424_0001
-422-
Figure imgf000425_0001
-423-
Figure imgf000426_0001
-424-
Figure imgf000427_0002
Table 3: Substituents ofYιandY2
Figure imgf000427_0003
Figure imgf000427_0001
Figure imgf000427_0004
-425-
Figure imgf000428_0002
Figure imgf000428_0001
-426-
Figure imgf000429_0001
-427-
Figure imgf000430_0001
-428-
Figure imgf000431_0001
It will be evident to one skilled in the art that the present invention is not limited to the foregoing illustrative examples, and that it can be embodied in other specific forms without departing from the essential attributes thereof. It is therefore desired that the examples be considered in all respects as illustrative and not restrictive, reference being made to the appended claims, rather than to the foregoing examples, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
-429-

Claims

WHAT IS CLAIMED IS
1. A compound
Figure imgf000432_0001
(I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NR0Re), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R and R are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
-430- alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaR N-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituejits independently selected from the group consisting of halo, nitro, cyano, -OH,
-NH2> and -COOH; J
\
ID
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaR N-, RaC(O)-, RaS-, Ra(O)S-,
15 Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, R OC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherem each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl,
20 heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, 25 alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(R ), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, 30 -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, 35 haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, R O-. RkOalkyl-, RcR Nalkyl-, RcRdNC(O)alkyl-, RcS02-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-,
-431- RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a tljree- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(0)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and R , at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, - (alkyl) (ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORfj -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRRh, -N(Re)C(O)NRfRh, -alky!N(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and " -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
-432- Rf, Rg and R_, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alky|, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl,'-C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, R and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; :
R is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
-433- n is 0, 1, 2, 3, or 4;
with the proviso that when A is ring other than
Figure imgf000436_0001
and R4 is- alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, * RaS-, Ra(O S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaR NSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SR -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that
Figure imgf000436_0002
and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
2. The compound of claim 1 wherein A is a monocyclic ring selected from the group consisting of aryl and heteroaryl.
3. The compound of claim 2 wherein
A is aryl; and
R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
-434-
4. The compound of claim 3 wherein A is phenyl.
5. The compound of claim 4 wherein R2 and R together with the carbon atoms to which they are attached form a pyridyl ring.
6. The compound of claim 1 of formula (II)
Figure imgf000437_0001
(H) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, ' alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl,
-435- hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(0)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -OR , -N(Ra)(Rb), -C(O)Ra, -C(0)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, R0OC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(0)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and
-436- -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and R is independently substituted with 0, 1, 2, or 3 substituehts independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(0)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -lalkylNH2, -alkylN(H) (alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O (alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl,
-437-' cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and 5 heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), lό -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H) (alkyl), and -C(0)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl,
15 haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl,
20 heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRcι), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
25 n is 0, 1, 2, 3, or 4;
with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf , RaRbNC(O)-, 30 RkOC(O , RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
35
7. The compound of claim 6 wherein R 4 : is hydroxy
-438-
8. The compound of claim 7 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-.
9. The coϊrnpound of claim 5 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of: l-[2-(l-cyclohexen-l-yl)ethyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy- 1 , 8-naphthyridin-2( lH)-one; ethyl [3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8- naphthyridin- 1 (2H)-yl] acetate ; l-(3-anilinopropyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one;
3-[3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxo-l,8-naphthyridin- 1 (2H)-yl]propanal ; l-[3-(dimethylamino)propyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy- 1 , 8-naphthyridin-2( 1 H)-one ; 1 - { 3-[[2-(dimethylamino)ethyl] (methyl)amino]propyl } -3-( 1 , l-dioxido-4H- 1 ,2,4- benzothiadiazin-3-yl)-4-hydroxy-l,8-naphthyridin-2(lH)-one; l-(2-aminoethyl)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2(lH)-one; l-[3-(diethylamino)propyl]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxy- l,8-naphthyridin-2(lH)-one;
1 -(benzyloxy)-3 -(1,1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-4-hydroxy- 1,8- naphthyridin-2(lH)-one; l-(benzyloxy)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l,8- naphthyridin-2( lH)-one 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-isobutoxy-l,8- naphthyridin-2( 1 H)-one ;
1 -benzyl-4-chloro-3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)- 1 , 8-naphthyridin- 2(lH)-one; l-butyl-4-chloro-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin- 2(lH)-one;
4-amino- 1 -butyl-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 ,8-naphthyridin- 2(lH)-one;
-439- l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-(methylamino)-l,8- naphthyridin-2 ( lH)-one ; l-butyl-4-(dimethylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8- naphthyridin-2(lH)-one; l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydrazino-l,8-naphthyridin-
2(lH)-one;
4-azido-l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l,8-naphthyridin-
Figure imgf000442_0001
l-bμtyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(2-hydroxyethyl)amino]- l,8-naphthyridin-2(lH)-one;
N- [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro- 1 ,8-naphthyridin-3-yl)- 1 , 1 -dioxido- 4H-l,2,4-benzothiadiazm-7-yl]-N-(2-phenylethyl)sulfamide; benzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; N- [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro[l ,8]naphthyridin-3-yl)- 1 , 1 -dioxido-
4H-l,2,4-benzothiadiazin-7-yl]sulfamide; benzyl 3-[3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro [ 1 ,8]naphthyridin-3-yl)-l , 1 - dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] - 1 -propyldiazathiane-1 -carboxylate 2,2-dioxide;
N- [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro [ 1 , 8 jnaphthyridin-3 -yl)- 1 , 1 -dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl]-N -propylsulf amide; methyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l, 8]naphthyridin-3-yl)-l, 1- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; allyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; 2-propynyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-y})- '
1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] diazathiane-1-carboxylate 2,2-dioxide;
2-cyanoethyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; 2-(trimethylsilyl)ethyl 3- [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2- dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l- carboxylate 2,2-dioxide; methyl 3-[3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro[ 1 ,8]naphthyridin-3-yl)- 1 , 1 - dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; benzyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-methyldiazathiane-l-carboxylate 2,2-dioxide; N-[3-(4-hydroxy-l-isoρentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-N'-methylsulfamide;
-440- 2-aminoethyl 3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] diazathiane- 1 -carboxylate 2,2-dioxide;
N-cyclopentyl-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide; N-cyclobutyl-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-
1 , l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl] sulf amide;
N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H-l,2,4^benzothiadiazin-7-yl]-N'-(4-piperidinyl)sulf amide;
N-(2-hydroxyethyl)-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin- 3-yl)- 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-7-yl] sulf amide;
3-[({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl] amino } sulfonyl)amino]propanamide;
N-[3-(4-hydroxy- l-isopentyl-2-oxo-l ,2-dihydro[l ,8]naphthyridin-3-yl)- 1 , 1-dioxido- 4H-l,2,4-benzothiadiazin-7-yl]-l-azetidinesulfonamide; 3-hydroxy-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-azetidinesulfonamide;
3-amino-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-pyrrolidinesulf onamide;
N- [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro [ 1 ,8]naphthyridin-3 -yl)- 1 , 1 -dioxido- 4H- 1 ,2,4-benzothiadiazin-7-yl] - 1-piperidinesulf onamide;
N-benzyl-N'-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulf amide; ethyl 3-[({ [3-(4-hydroxy-14sopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)aιnino]benzoate; 3-[({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxido-
4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)amino]benzoic acid;
3-[({[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l-dioxιdo- 4H-l,2,4-benzothiadiazin-7-yl]amino}sulfonyl)amino]benzamide;
N-(2-aminoethyl)-N'-[3-(4-hydroxy- 1 -ιsopentyl-2-oxo- 1 ,2-dihydro [ 1 ,8]naphthyridin-3- yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]sulfamide; ethyl l-({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3-yl)-l,l- dioxido-4H-l ,2,4-benzothiadiazin-7-yl]amino } sulfonyl)-3-piperidinecarboxylate; methyl (2S)-l-({ [3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l ,8]naphthyridin-3-yl)- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl] amino } sulfonyl)-2-pyrrolidinecarboxylate; N- [3-(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro [1 ,8]naphthyridin-3-yl)-l , 1 -dioxido-
4H-1 ,2,4-benzothiadiazin-7-yl] - 1 -pyrrolidinesulf onamide;
3-hydroxy-N-[3-(4-hydroxy-l-isopentyl-2-oxo-l ,2-dihydro[ 1 ,8]naphthyridin-3-yl)-l , 1-
-441- dioxido-4H-l,2,4-benzothiadiazin-7-yl]-l-piperidinesulfonamide; and
N-(2-furylmethyl)-3-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro[l,8]naphthyridin-3- yl)-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxamide 2,2-dioxide.
10. The compound of claim 4 wherein R2 and R3, together with the carbon atoms to which they are attached form a thienyl ring.
11. The compound of claim 1 of formula (III):
Figure imgf000444_0001
(m) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbΝ-, RaRbNalkyl-, RaRt,NC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OΗ, -NΗ2, and - COOH;
R is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo,
-442- haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkylXNRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(R0)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl , RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, R0RdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(RG)(Rd), -C(O)R0, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd,
-443- -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl) (NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf) -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form
-444- a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, "øyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(0)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, or 2; and
n is O, 1, 2, 3, or 4;
with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-,
RkOC(O)-, RaRbNSO2- or -ORk, and Rδ is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
12. The compound of claim 11 wherein R4 is hydroxy.
-445-
13. The compound of claim 12 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(0)alkyl-,
RfRgC=N- and RkO-.
"t,
14. The compound of claim 10 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of:
4-amino-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3,2- &]pyridin-5(4H)-one;
6-(l,l-Dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4- (isobutylamino)thieno[3,2-b]pyridin-5(4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{ [(3S)-3- methylcyclopentyl]amino}thieno[3,2-b]pyridin-5(4H)-one;
4- { [ 1 -cyclopropylethyl] amino } -6-(l , l-dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(butylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3,2- b]pyridin-5(47J)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(2-ethylbutyl)amino]-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(pentylamino)thieno[3,2- b]pyridin-5(4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- : methylbutyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
4-[(3,3-dimethylbutyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-&]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- methylbenzyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(2- methylbenzyl)amino]thieno[3,2-&]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(4- methylbenzyl)amino]thieno[3,2-b]pyridin-5(4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3-methylbut-2- enyl)amino]thieno[3,2-&]pyridin-5(4H)-one;
6-( 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-(propylamino)thieno [3 ,2-
-446- b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-4- ylmethyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-3- ylmethyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(pyridin-2- ylmethyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
6 (l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(3- methoxybenzyl)amino]thieno [3 ,2- ?]pyridin-5 (4H)-one; 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(3-furylmethyl)amino]-7- hydroxythieno [3 ,2-b]pyridin-5 (4H)-one;
3-({ [6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-5-oxothieno[3,2- &]pyridin-4(5H)-yl]amino}methyl)benzonitrile;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(thien-3- ylmethyl)amino]thieno[3,2-έ>]pyridin-5(4H)-one;
4-(cyclobutylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(benzylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxythieno[3,2- b]pyridin-5(4H)-one; 4-[(cyclohexylmethyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzofhiadiazin-3-yl)-7- hydroxythieno [3 ,2-b]pyridin-5 (4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-[(l,3-thiazol-5- ylmethyl)amino]thieno[3,2-b]pyridin-5(4H)-one;
4- [(3-bromobenzyl) amino] -6-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3 -yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(cyclohexylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-(cyclopentylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno [3 ,2-b]pyridin-5 (4H)-one; 4-(cycloheptylamino)-6-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{[(lR,3S)-3- methylcyclohexyl]amino}thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{[(lR,3R)-3- methylcyclohexyl]amino}thieno[3,2-b]pyridin-5(4H)-one;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-[(l-ethylpropyl)amino]-7- hydroxythieno[3,2÷b]pyridin-5(4H)-one;
-447- 6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{[l- phenylethyl] amino } thieno[3 ,2-£>]pyridin-5 (4H)-one ;
6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7-hydroxy-4-{[(lR)-l- methylbutyl] amino }thieno [3 ,2-Z?]pyridin-5 (4H)-one;
4-(cyclobutylamino)-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one;
4-[(cyclopropylmethyl)amino]-6-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-7- hydroxythieno[3,2-b]pyridin-5(4H)-one; and
2-({3-[4-(cyclohexylamino)-7-hydroxy-5-oxo-4,5-dihydrothieno[3,2-b]pyridin-6-yl]- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl}oxy)acetamide.
15. The compound of claim 1 of formula (IV)
Figure imgf000450_0001
(IV) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(0)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R ,4 ; is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents
-448- independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S' } RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, kaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, R O-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached
_449_ form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R0 and R , at each occurrence, are independently selected from the group consisting of hydrogen, -NR Rh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf) -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl),
-450- -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
n is 0, 1, 2, 3, or 4;
with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-(
RkOC(O)-, RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra,
-451- -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
16. The compound of claim 15 wherein R4 is hydroxy.
17. The compound of claim 16 wherein R1 is selected from the group consisting of RaRbN-, R RgC=N- and RkO-.
18. The compound of claim 15 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of:
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [(lE)- phenylmethylene] amino } -2( lH)-quinolinone ; l-amino-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2(lH)- quinolinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-propoxyquinolin-2(lH)- one; l-(benzylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin- 2(lH)-one; l-amino-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin-2(lH)- one;
3-(l , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(l- propylbutyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(isobutylamino)quinolin- 2(lH)-one; :
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-[(l-ethylpropyl)amino]-4- hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(pentylamino)quinolin- 2(lH)-one; l-(cyclohexylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one ;
3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1- { [(2-methyl-l ,3-thiazol- 4-yl)methyl]aιmno}quinolin-2(lH)-one;
3 -( 1 , 1 -dioxidό-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 - (isopropylamino)quinolin-2(lH)-one;
1 -(cyclobutylamino)-3-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4- hydrpxyquinolin-2(lH)-one;
-452- 1 -(cyclopentylamino)-3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [3- methylcyclopentyl]amino}quinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-(tetrahydro-2H-pyran-4- yl amino)quinolin-2( lH)-one ;
3 -( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 - { [ 1 -ethylbutyl] amino } -4- hydroxyήuinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[(3R)-3- methylcyclohexyl] amino }quinolin-2(lH)-one; l-(cycloheptylamino)-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-{ [3-ethylcyclopentyl]amino}-4- hydroxyquinolin-2( lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{[l- isopropylbutyl]amino}quinolin-2(lH)-one;
3-(l ,l-dioxido-4H-l,2,47benzothiadiazin-3-yl)-4-hydroxy-l-{ [1- p'henylethyl] amino }quinolin-2( lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [l-thien-3- ylethyl] amino }quinolin-2(lΗ)-one; l-{ [3,5-dimethylcyclohexyl]amino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)- 4-hydroxyquinolin-2( lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(4- isopropylcyclohexyl)amino]quinolin-2(lH)-one; 3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1- [ 1 ,2,3 ,4- tetrahydronaphthalen-2-ylamino]quinolin-2(lH)-one;
3-(l ,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [3- (trifluoromethyl)cyclohexyl] amino } quinolin-2( lH)-one ;
1 -(butylamino)-3-(l , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4-hydroxyquinolin- 2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(3- methylbutyl)amino]quinolin-2(lH)-one;
3-( 1 ,1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1 - [(3-furylmethyl)amino]-4- hydroxyquinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-[(2-furylmethyl)amino]-4- hydroxyquinolin-2(lH)-one;
3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy- 1 -.[(thien-2-
-453- ylmethyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(l,3-thiazol-2- ylmethyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-{ [(2R)-2-ethyl-3- methylbutyl]arnino}-4-hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(4- methylbenzyl)amino]quinolin-2(lH)-one;
3 (l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(3- methylbenzyl)amino]quinolin-2(lH)-one; 3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(2- methylbenzyl)amino]quinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-{ [(3-methylthien-2- yl)methyl] amino } quinolin-2( lH)-one ;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(4- methoxybenzyl)amino]quinolin-2(lH)-one; l-{ [(5-chlorothien-2-yl)methyl]amino}-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3- yl)-4-hydroxyquinolin-2(lH)-one;
1 - { [(2-chloro-l ,3-thiazol-5-yl)methyl] amino } -3-( 1 , 1 -dioxido-4H- 1 ,2,4- benzothiadiazin-3-yl)-4-hydroxyquinolin-2( lH)-one; 1 - [(3 -bromobenzyl) amino] -3 -( 1 , 1 -dioxido-4HT ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one; l-[(4-bromobenzyl)amino]-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2( lH)-one;
1 - [(2-bromobenzyl)amino]-3-( 1 , 1 -dioxido-4H-l ,2,4-benzothiadiazin-3-yl)-4- hydroxyquinolin-2(lH)-one;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l-[(pyridin-3- ylmethyl)amino]quinolin-2(lH)-one;
3-({ [3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-2-oxoquinolin-l(2H)- yl] amino }methyl)benzonitrile; 2-({3-[l-(cyclobutylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-
4Hrl,2,4-benzothiadiazin-7-yl}oxy)acetamide;
2-({3-[l-(cyclopentylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl } oxy)acetamide;
2-({3-[l-(cyclohexylainino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}oxy)acetamide;
2-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl)oxy] acetamide;
-454- 2-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido- 4H-1 ,2-benzothiazin-7-yl } oxy)acetamide;
2-({3-[l-(butylamino)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl } oxy)acetamide; 2-[(3-{4-hydroxy-l-[(3-methylbutyl)amino]-2-oxo-l,2-dihydroquinolin-3-yl}-l,l- dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]acetamide;
3-(8-amino-7-hydroxy-l,I-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-l- (isobutyliamino)quinolin-2(lH)-one;
2-({ 8-amino-3- [4-hydroxy- l-(isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxido-4Η-l ,2,4-benzothiadiazin-7-yl }oxy)acetamide;
2-({3-[4-hydroxy-2-oxo-l-(propylamino)-l,2-dihydroquinolin-3-yl]-l,l-dioxido-4H- l,2,4-benzothiadiazin-7-yl}oxy)acetamide;
2-({ 3-[4-hydroxy-l -(isobutylamino)-2-oxo-l ,2-dihydroquinolin-3-yl]-l , 1-dioxido- 4H-1 ,2,4-benzothiadiazin-7-yl } oxy)propanamide; 2-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-
4H-l,2,4-benzothiadiazin-7~yl}oxy)butanaπιide;
8 -amino-3 - [4-hydroxy- 1 -(isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxido-4H-l,2,4-benzothiadiazin-7-yl methanesulfonate;
1 -[(cyclopropylmethyl)amino] -4-hydroxy-3-(7-hydroxy-8-nitro- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)quinolin-2(lH)-one;
3-(7-{2-[(35)-3-aminopyrrolidin-l-yl]-2-oxoethoxy}-l,l-dioxido-4H-l,2,4- benzothiadiazin-3-yl)-l-[(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one;
2-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4Η-l,2,4-benzothiadiazin-7-yl)oxy]-N-ethylacetamide; [(3 - { 1 - [(cyclopropylmethyl)amino] -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl } - 1 , ϊ - dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]acetic acid;
3 - { 7- [2-(3 -aminopyrrolidin- 1 -yl)-2-oxoethoxy] -1,1 -dioxido-4H- 1 ,2,4- benzothi adiazin-3 -yl } - 1 - [(cyclopropylmethyl) amino] -4-hydroxyquinolin-2( lH)-one;
3-(8-amino-7-hydroxy-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one;
2-[(8-amino-3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin- 3-yl}-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]acetamide;
[(8-aιmno-3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl}-l,l-dioxido-4Η-l,2,4-benzothiadiazin-7-yl)oxy]acetonitrile; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-[7-(2-hydroxyethoxy)-l,l-dioxido-4H-
1 ,2,4-benzothi adiazin-3 -yl] quinolin-2( 1 H)-one ; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-[7-(lH-imidazol-2-ylmethoxy)-l,l-
-455- dioxido-4H-l,2,4-benzothiadiazin-3-yl]quinolin-2(lH)-one; l-[(cyclopropylmethyl)amino]-3-[l,l-dioxido-7-(l,3-thiazol-2-ylmethoxy)-4H-l,2,4- benzothiadiazin-3-yl] -4-hydroxyquinolin-2( lH)-one;
"" l-[(cyclopropylmethyl)amino]-3-[7-(4,5-dihydro-lH-imidazol-2-ylmethoxy)-l,l- dioxido-4H- 1 ,2 ,4-benzothiadiazin-3 -yl] -4-hydroxyquinolin-2( lH)-one ;
2- { [(3- { l-[(cyclopropylmethyl)amino] -4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl } - 1 , l-dioxido-4H- 1 ,2,4-benzothiadiazin-7-yl)oxy]methyl } - 1 ,3-thiazole-4-carbonitrile;
3^[7-(2-aminoethoxy)- 1 , l-dioxido-4H-l ,2,4-benzothiadiazin-3-yl]- 1- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one; N-{2-[(3-{ l-[(cyclopropylmethyl)airiino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl}-l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)oxy]ethyl}methanesulfonamide;
3-{7-[(5-bromopyridin-2-yl)oxy]-l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl}-4- hydroxy-l-(isobutylamino)qumolin-2(lH)-one;
4-hydroxy-l-(isobutylamino)-3-{7-[(3-nitropyridin-2-yl)oxy]-l,l-dioxido-4H-l,2,4- benzothiadiazin-3-yl}quinolin-2(lH)-one; tert-butyl 3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl }-l ,l-dioxido-4H-l ,2,4-benzothiadiazin-7-ylcarbamate;
3-(7-amino- 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)- 1- [(cyclopropylmethyl)amino]-4-hydroxyquinolin-2(lH)-one; methyl 2-chloro-6-({3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3- yl] - 1 , 1 -dioxido-4H- 1 ,2 ,4-benzothiadiazin-7-yl } oxy)isonicotinate ;
N- { 3 - [ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl] - 1 , 1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yl}methanesulfonamide;
N-(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-l ,2,4-benzothiadiazin-7-yl)methanesulfonamide;
N-(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydro-3-quinolinyl}- l,l-dioxido-4H-l,2,4-benzothiadiazin-7-yl)methanesulfonamide;
2- { [3 -( 1 -amino-4-hydroxy-2-oxo- 1 ,2-dihy dro-3 -quinolinyl)- 1 , 1 -dioxido-4H- 1 ,2,4- benzothiadiazin-7-yl]oxy}acetamide; N- { 3-[ l-(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3-quinolinyl] -1,1 -dioxido-
4H-1 ,2,4-benzothiadiazin-7-yl } ethanesulfonamide; benzyl 3-{ 3-[l-(cyclobutylamino)-4-hydroxy-2-oxo-l ,2-dihydro-3 -quinolinyl] -1 ,1- dioxido-4H-l,2,4-benzothiadiazin-7-yl}diazathiane-l-carboxylate 2,2-dioxide;
N- { 3-[l -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] -1,1 -dioxido- 4H-l,2,4-benzothiadiazin-7-yl}-N'-methylsulfamide; and
N-{3-[l-(cyclobutylamino)-4-hydroxy-2-oxo-l,2-dihydro-3-quinolinyl]-l,l-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}sulfamide.
-456-
19. The compound of claim 1 wherein:
A is heteroaryl; and
R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl, pyrimidinyl, pyridazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, tetrazolyl, cyclopentyl and cyclohexyl.
20. The compound of claim 19 wherein A is thienyl.
\
21. The compound of claim 20 wherein R2 and R3 together with the carbon atoms to which they are attached form a phenyl ring.
22. The compound of claim 1 of formula (Va)
Figure imgf000459_0001
(Va) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, •- alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo,
-457- hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-i RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-,
R Oalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(OR0), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORC) -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(R ), -C(O)Rc, -C(O)QRc and -C(O)NRcRd;
-458- alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh,
-C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and ■ -alkylN(Re)C(O)NRfRh;
alternatively, Rc and R , together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl', oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl,
-459- heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkdnyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)0(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; and
m is 0, 1, 2, 3, or 4;
with the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl,
-460- arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
23. The compound of claim 22 wherein R4 is hydroxy.
24. The compound of claim 23 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-.
25. The compound of claim 1
Figure imgf000463_0001
(Vb) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -
-461- COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. R Oalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(0)alkyl-, R0OC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and
-462- heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(0)Rc, -C(O)ORc and -C(O)NRcRd;
Ri and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -OR , -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf; -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-463- -alkylS(alkyl), -alkylS(O) (alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, R and Rg together with the carbon atom to which they are attached form 5 a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and
10 heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
15 -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl,
20 haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(0)alkyl-, wherein each R is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl,
-25 heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), ' -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; and
m is O, 1, 2, 3, or 4;
30 with the proviso that when R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl,
35 heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
26. The compound of claim 25 wherein R4 is hydroxy.
-464-
27. The compound of claim 26 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-,
RfRgC=N- and RkO-.
">
28. The compound of claim 21 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of:
N-( { 3 - [ 1 -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] -1,1 -dioxido- 4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl}methyl)urea;
1 -benzyl-4-hydroxy-3 - { 7- [(methoxymethoxy)methyl] -1,1 -dioxido-4H-thieno [2,3 - e] [ 1 ,2,4]thiadiazin-3-yl } quinolin-2( lH)-one; l-Benzyl-4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl]quinolin-2(lH)-one;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-4H-thieno[2,3- e][l,2,4]thiadiazine-7 -carboxylic acid 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-4H-thieno[2,3- e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-(2-hydroxyethyl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-2-hydroxy-l- (aminocarbonyl)ethyl] -4H-thieno [2 ,3 -e] [ 1 ,2,4] thiadi azine-7-carboxamide 1 , 1 -dioxide ; N-(2-amino-2-oxoethyl)-3 -(1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)-4H- thieno[2,3-e][l ,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3 -( 1 -benzyl-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3 -yl)-Ν- [(IS )-2-hydroxy- 1 - methylethyl]-4Η-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N,N-bis(2-hydroxyethyl)- 4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3 -( 1 -benzyl-4-hy droxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)-N- [2-hydroxy- 1 - (hydroxymethyl)ethyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide; l-benzyl-4-hydroxy-3-(7-{ [(3R)-3-hydroxypyrrolidin-l-yl]carbonyl}-l,l-dioxido- 4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl)quinolin-2(lH)-one; 3-( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl)-N-(3 -hydroxypropyl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(2S)-2,3-
-465- dihydroxypropyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-l- (hydroxymethyl)propyl]-4H-thieno[2,3-e] [1 ,2,4]thiadiazine-7-carboxamide 1 , 1-di oxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[(lS)-l-(hydroxymethyl)- 2-methylpropyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[2-hydroxybutyl]-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
3^(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-N-[2-hydroxy-2-(4- hydroxyphenyl)ethyl]-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide; l-benzyl-3-[l,l-dioxido-7-(piperazin-l-ylcarbonyl)-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl]-4-hydroxyquinolin-2(lH)-one;
N-[5-(aminocarbonyl)pyridin-2-yl]-3-(l-benzyl-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl)-4H-thieno[2,3-e][l,2,4]thiadiazine-7-carboxamide 1,1-dioxide;
[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-7-yl]methyl carbamate;
[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-7-yl]methyl aminocarbonylcarbamate;
3-[7-(azidomethyl)- 1 , 1 -dioxido-4Η-thieno [2,3-e] [1 ,2,4]thiadiazin-3-yl] - 1 -benzyl-4- hydroxyquinolin-2( lH)-one; 3-[7-(aminomethyl)-l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl]-l-benzyl-4- hydroxyquinolin-2(lH)-one;
N- { [3 -( 1 -benzyl -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)- 1 , 1 -dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-7-yl]methyl}methanesulfonamide;
N-{[3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-7-yl]methyl}nicotinamide;
N- { [3 -( 1 -benzyl -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)- 1 , 1 -dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-7-yl]methyl}morpholine-4-carboxamide;
N- { [3 -( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)- 1 , 1 -dioxido-4H- thieno[2,3-e] [l,2,4]thiadiazin-7-yl]methyl }-2-hydroxyacetamide; l-[(cyclopropylmethyl)amino]-4-hydroxy-3- { 7-[(methoxymethoxy)methyl]-l , 1- dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl}quinolin-2(lH)-one; l-[(cyclopropylmethyl)amino]-4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H- thieno[2,3-e][l,2,4]thiadiazin-3-yl]quinolin-2(lH)-one;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]methanesulfonamide;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]ethanesulfonamide;
-466- N- [(3 - { 1 - [(cyclopropylmethyl) amino] -4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl } - l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]propane-l-sulfonamide;
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl } - 1 , l-dioxido-4H-thieno[2,3-g] [1 ,2,4]thiadiazin-7-yl)methyl]propane-2-sulfonamide; N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo- 1 ,2-dihydroquinolm-3-yl } -
1 , 1 -dioxido-4H-thieno [2 ,3 -e] [ 1 ,2,4]thiadiazin-7 -yl)methyl]benzenesulf onamide ; and
N-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}- 1 , l-dioxido-4H-thieno[2,3-e] [1 ,2,4]thiadiazin-7-yl)methyl]-l-phenylmethanesulfonamide.
29. The compound of claim 20 wherein R2 and R3, together with the carbon atoms to which they are attached form a pyridyl ring.
30. The compound of claim 1 of formula (Via)
Figure imgf000469_0001
(Via) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbΝ-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(0)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents
-467- independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S- RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R5 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcR Nalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RCOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)OalkyK RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached
-468- form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, ~S(0)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(0)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf> -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and R , together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl),
-469- -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
, alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; and
m is O, 1, 2, 3, or 4;
with the proviso that R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl,
-470- heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
31. The compound of claim 30 wherein R4 is hydroxy.
32. The compound of claim 31 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-.
33. The compound of claim 1 of formula (VIb)
Figure imgf000473_0001
(VIb) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -
-471- COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(0)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSG>2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)R0, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl) (NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra; .
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcR N-, RkO-. RkOalkyl-, RcR Nalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-3 RcRdNC(O)-, RcRdNC(O)Oalkyl-, R0RdNC(O)N(Re)alkyl-, where Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)OR0 and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and
-472- heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(R ), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and R is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and ■ -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alk.yl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf; -ORf, -N(Rf)(Rh), -C(O)R(, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-473- -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, f and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaR Nalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; and
m is O, 1, 2, 3, or 4;
with the proviso that when R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
34. The compound of claim 33 wherein R4 is hydroxy.
-474-
35. The compound of claim 34 wherein R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl,
5 cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaR Nalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-. "\
36. The compound of claim 29 or a pharmaceutically acceptable salt form, stereoisomer or lb tautomer thereof selected from the group consisting of: l-butyl-4-hydroxy-3-{7-[(methoxymethoxy)methyl]-l,l-dioxido-4H-thieno[2,3- e] [ 1 ,2,4]thiadiazin-3-yl } - 1 , 8-naphthyridin-2(lH)-one; l-butyl-4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl]-l,8-naphthyridin-2(lH)-one; 15 methyl 3-(l-benzyl-4-hydroxy-2-oxo-l,2-dihydro-l ,8-naphthyridin-3-yl)-4H- thieno[2,3-e][l,2,4]thiadiazine-7-carboxylate 1,1-dioxide;
4-hydroxy-3-{7-[(methoxymethoxy)methyl]-l,l-dioxido-4H-thieno[2,3- e][l,2,4]thiadiazin-3-yl}-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one; and
4-hydroxy-3-[7-(hydroxymethyl)-l,l-dioxido-4H-thieno[2,3-e][l,2,4]thiadiazin-3-yl]- 20 l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one.
37. The compound of claim 19 wherein A is pyridyl.
38. The compound of claim 1 of formula (VII)
25
Figure imgf000477_0001
(VU) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
0 R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl,
-475- carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and - COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1 , 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting
-476- of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RCOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, dlkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(0)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NR0Rd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and R is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)S02NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl,
-477- heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
R is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl,
-478- heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and 5 n is O, 1, 2, 3 or 4;
w th the proviso that when R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, lb cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-,
RkOC(O)-, RaRbNSO - or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl,
15 heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl.
39. The compound of claim 38 wherein R4 is hydroxy.
40. The compound of claim 39 wherein R1 is selected from the group consisting of hydrogen, 20 alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-. 25
41. The compound of claim 37 wherein R2 and R3, together with the carbon atoms to which they are attached, form a pyridyl ring.
42. The compound of claim 41 wherein R4 is hydroxy. 30
43. The compound of claim 42 whererin R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkynyl, arylalkenyl, arylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkenyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroarylalkenyl, heteroarylalkyl, heterocycle,
35 heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RfRgC=N- and RkO-.
-479-
44. The compound of cl
Figure imgf000482_0001
(I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-,
RaR NC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(R0)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra andRaC(O)-; wherein R and R are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2
-480- substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-^ RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, . heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcR N-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
-481- Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2R , -ORf, -N(RfXRh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SR , -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
-482- alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd; and
n is O, 1, 2, 3, or 4.
45. The compound of claim 44 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of: 1 -benzyl-3-( 1 , 1 -dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-2( 1H)- pyridinone; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6-dimethyl- 2( lH)-pyridinone ; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-5- phenyl-2(lH)-pyridinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-5,6-dimethyl-l-(3- methylbutyl)-2(lH)-pyridinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-5,6- dimethyl-2(lH)-pyridinone; l-benzyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-phenyl-2(lH)- pyridinone;
1 ,5-dibenzyl-3-(l , l-dioxido-4H- 1 ,2,4-benzothiadiazin-3-yl)-4-hydroxy-6-methyl-
-483- 2(lH)-pyridinone;
3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-l-(2-ethylbutyl)-4-hydroxy-6-methyl- 5-phenyl-2( lH)-pyridinone; l-butyl-3-(l,l-dioxido-4H-l,2,4-benzothiadiazin-3-yl)-2(lH)-pyridinone; N- { 3-[4-hydroxy- 1 -(3-methylbutyl)-2-oxo-l ,2-dihydropyridin-3-yl]- 1 , 1 -dioxido-4H-
1 ,2,4-benzothiadiazin-7-yl Jmethanesulf onamide;
N- [3 -( 1 -benzyl-4-hydroxy-2-oxo- 1 ,2-dihydropyridin-3-yl)- 1 , 1 -dioxido-4H- 1 ,2 ,4- benzothiiidiazin-7-yl]methanesulfonamide;
N-[3-(4-hydroxy-2-oxo- 1 ,2-dihydro-3-pyridiriyl)- 1 , 1 -dioxido-4H-l ,2,4- benzothiadiazin-7-yl]methanesulfonamide;
N- [3 -(4-hydroxy- 1 -isopentyl-5 ,6-dimethyl-2-oxo- 1 ,2-dihydro-3-pyridinyl)- 1,1- dioxido-4H-l,2,4-benzothiadiazin-7-yl]methanesulfonamide; benzyl 3 - [3 -(4-hydroxy- 1 -isopentyl-2-oxo- 1 ,2-dihydro-3-pyridinyl)- 1 , 1 -dioxido-4H- l,2,4-benzothiadiazin-7-yl]diazathiane-l-carboxylate 2,2-dioxide; N-[3-(4-hydroxy-l-isopentyl-2-oxo-l,2-dihydro-3-pyridinyl)-l,l-dioxido-4H-l,2,4- benzothiadiazin-7-yl]sulfamide;
N-IS-tl-^yclobutylmethy^^-hydroxy^-oxo-l^-dihydro-S-pyridinylJ-lT-dioxido- 4H-l,2,4-benzothiadiazin-7-yl}methanesulfonamide;
N- { 3 - [5 -bromo- l-(cyclobutylmethyl)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -pyridinyl]- 1 , 1 - dioxido-4H-l,2,4-benzothiadiazin-7-yl}methanesulfonamide; and
N-[3-(4-hydroxy-l-isopentyl-2-oxo-5-vinyl-l,2-dihydro-3-pyridinyl)-l,l-dioxido-4H- l,2,4-benzothiadiazin-7-yl]methanesulfonamide.
46. The compound of claim 1 wherin R2 and R3, together with the carbon atoms to which they are attached, form a cycloalkyl ring.
47. The compound of claim 1 wherin R2 and R3, together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of thienyl, furanyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxadiazolyl, triazolyl, thiadiazolyl, tetrazolyl, phenyl, pyridyl, pyridazinyl and pyrimidinyl; wherein said ring is optionally substituted with (R )m; wherein
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(ΝRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa,
-484- -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra; and m is 0, 1, 2, 3 or 4.
48. The compound of claim 47 wherein R 4 i •s hydroxy.
49. The compound of claim 1 wherein R is hydroxy, halo, -NH2,-NH(alkyl), -N(alkyl) , - N(H)NH2, -N3, -N(H)(hydroxyalkyl), or RCS-.
50. The compound of claim 1 wherein A is a bicyclic ring selected from the group consisting of heterocycle and heteroaryl.
51. The compound of claim 50 wherein A is selected from the group consisting of naphthyl, indolizinyl, indolyl, isoindolyl, benzofuranyl, benzothienyl, indazolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzoisothiazolyl, benzoisoxazolyl, benzoxazinyl, benzothiadiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl and naphthyridinyl, cinnolinyl and pteridinyl.
52. The compound of claim 1 of formula (VIII)
Figure imgf000487_0001
(VIII) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
X is NH, N(alkyl), O or S.
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-,
-485- RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyϊ, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-,
RicOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(0)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
-486- R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl) (NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
R7 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSθ2N(R )alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)all<yl-, RicOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R7 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, . heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcR N-, R O-. RkOalkyl-, RcRdNalkyl-, R0RdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl,
-487- oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NR Rh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle,. arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl) (NRfRb), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(0)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-alkylS(alkyl), -alkylS(O) (alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
-488- alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with
0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, \ alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl),
-S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl),
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH,
-C(0)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
n is 0, 1 or 2.
53. The compound of claim 52 wherein R and R , together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m.
54. The compound of claim 53 wherein R2 and R3, together with the carbon atoms to which they are attached, form a five- or six-membered ring selected from the group consisting of phenyl, pyridyl pyridazinyl, pyrimidinyl, pyrazolyl, cyclopentyl, cyclohexyl and
-489- thienyl.
55. The compound of claim 54 wherein R4 is hydroxy.
56. The compound of claim 55 or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof selected from the group consisting of:
3-(l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl)-4-hydroxy-l- (isobutylέmino)quinolin-2(lH)-one;
3-[8-(chloromethyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl]- 4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-{3-[4-hydroxy-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxido-4H- [l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-8-yl}propanoic acid;
3-(8-{[(2-aminoethyl)amino]methyl}-l,l-dioxido-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl)-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one; methyl { 3- [4-hydroxy- 1 - (isobutylamino)-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-8-yl}acetate;
4-hydroxy-3-(8- { [(3R)-3-hydroxypyrrolidin- 1 -yl]methyl } -1 , 1 -dioxido-4H- [l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl)-l-(isobutylamino)quinolin-2(lH)-one; 3-[l,l-dioxido-8-(pyridinium-l-ylmethyl)-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl]-l-(isobutylamino)-2-oxo-l,2-dihydroquinolin-4-olate; 3-[l,l-dioxido-8-(pyrrolidin-l-ylmethyl)-4H-[l,3]oxazolo[5,4- h][l,2,4]benzothiadiazin-3-yl]-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-[8-(3-aminophenyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3- yl] -4-hydroxy- 1 -(isobutylamino)quinolin-2( 1 H)-one ; 3-[8-(aminomethyl)-l,l-dioxido-4H-[l,3]oxazolo[5,4-h][l,2,4]benzothiadiazin-3-yl"]-
4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
4-hydroxy-3 - [8-(hydroxymethyl)- 1 , 1 -dioxido-4H- [1,3] oxazolo[5 ,4- h][l,2,4]benzothiadiazin-3-yl]-l-(isobutylamino)quinolin-2(lH)-one; 3-{8-[(butylamino)methyl]-l,l-dioxido-4H-[l,3]oxazolo[5,4- h] [ 1 ,2,4]benzothiadiazin-3-yl } -4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
3-[9-(butylaιnino)-l,l-dioxido-4H,8H-[l,4]oxazino[2,3-h][l,2,4]benzothiadiazin-3- yl]-4-hydroxy-l-(isobutylamino)quinolin-2(lH)-one;
4-hydroxy-l-(3-methylbutyl)-3-(8-methyl-l,l-dioxido-4H-[l,3]oxazolo[5,4- h] [l,2,4]benzothiadiazin-3-yl)-l ,8-naphthyridin-2(lH)-one; 3-[l,l-dioxido-8-(trifluoromethyl)-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazi -
3 -yl] -4-hydroxy- 1-(3 -methylbutyl)- 1 , 8-naphthyridin-2( 1 H)-one;
4-hydroxy-3-(8-hydroxy-l,l-dioxido-4,7-dihydroimidazo[4,5-
-490- h][l,2,4]benzothiadiazin-3-yl)-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
4-hydroxy-l-(3-methylbutyl)-3-(8-methyl-l,l-dioxido-4,7-dihydroimidazo[4,5- h][l,2,4]benzothiadiazin-3-yl)-l,8-naphthyridin-2(lH)-one;
3-[l,l-dioxido-8-(pentafluoroethyl)-4J-dihydroimidazo[4,5- 5 h][l,2,4]benzothiadiazin-3-yl]-4-hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
3-[8-(chloromethyl)-l,l-dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-3- yl]-4-hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l,8-naphthyridin-3-yl]-l,l- dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-8-yl}acetonitrile; lό methyl { 3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydro-l ,8-naphthyridin-3-yl]-
1 ,l-dioxido-4J-dihydroimidazo[4,5-h][l,2,4]benzothiadiazin-8-yl } acetate;
3-(9,9-dioxido-6H-[l,2,5]thiadiazolo[3,4-/z][l,2,4]benzothiadiazin-7-yl)-4-hydroxy-l- (3-methylbutyl)-l,8-naphthyridin-2(lH)-one;
3-(8-amino-l ,l-dioxido-4,7-dihydroimidazo[4,5-h] [1 ,2,4]benzothiadiazin-3-yl)-4- 15 hydroxy-l-(3-methylbutyl)-l,8-naphthyridin-2(lΗ)-one; and
4-hydroxy-3-[8-(hydroxymethyl)-l,l-dioxido-4,9-dihydroimidazo[4,5- /ι][l,2,4]benzothiadiazin-3-yl]-l-(3-methylbutyl)-l,8-naphthyridin-2(lH)-one.
57. N-{ 3-[ l-(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxido-4H- 20 l,2,4-benzothiadiazin-7-yl}methanesulfonamide, or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof.
58. Ν-[(3-{ l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl}-l,l- dioxido-4Η-thieno[2,3-e][l,2,4]thiadiazin-7-yl)methyl]methanesulfonamide, or a 5 pharmaceutically acceptable salt, stereoisomer or tautomer thereof.
59. N-(3- { l-[(cyclopropylmethyl)amino]-4-hydroxy-2-oxo- 1 ,2-dihydro-3-quinolinyl } -1 , 1- dioxido-4H-l,2,4-benzothiadiazin-7-yl)methanesulfonamide, or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof.
30
60. N- { 3 - [ 1 -(cyclobutyl amino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] -1,1 -dioxido-4H- l,2,4-benzothiadiazin-7-yl}sulfamide, or a pharmaceutically acceptable salt, stereoisomer or tautomer thereof.
5 61. N-{3-[l -(cyclobutylamino)-4-hydroxy-2-oxo- 1 ,2-dihydro-3 -quinolinyl] -1,1 -dioxido-4H- l,2,4-benzothiadiazm-7-yl}-N'-methylsulfamide, or a pharmaceutically acceptable salt,
-491- stereoisomer or tautomer thereof.
62. A pharmaceutical composition comprising a therapeutically effective amount of a compound or combination of compounds of any one of claims 1, 57, 58, 59, 60 and 61, and a pharmaceutically acceptable carrier.
63. The pharmaceutical composition of claim 62 further comprising one or more agents selected from the group consisting of a host immune modulator and a second antiviral agent, or combination thereof.
64. The pharmaceutical composition of claim 63 wherein the host immune modulator is selected from the group consisting of interferon-alpha, pegylated-interferon-alpha, interferon- beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant.
65. The pharmaceutical composition of claim 63 wherein the second antiviral agent inhibits replication of HCV by inhibiting host cellular functions associated with viral replication.
66. The pharmaceutical composition of claim 63 wherein the second antiviral agent inhibits the replication of HCV by targeting proteins of the viral genome.
67. The pharmaceutical composition of claim 62 further comprising an agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of liver. . *
68. The pharmaceutical composition of claim 62 further comprising one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.
69. The pharmaceutical composition of claim 68 wherein the agent that treats patients for disease caused by hepatitis B (HBV) infection is selected from the group consisting of L- deoxythymidine, adefovir, lamivudine and tenfovir.
70. The pharmaceutical composition of claim 62 further comprising one or more agents that treat patients for disease caused by human immunodeficiency virus (HTV) infection.
71. The pharmaceutical composition of claim 70 wherein the agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection is selected from the group
-492- consisting of ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fos amprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S- 1360, enfuvirtide (T-20) and T-1249, or any combination thereof. 5
72. A method of treating or preventing infection caused by an RNA-containing virus comprising administering to a patient in need of such treatment a pharmaceutical composition of any orife of claims 62, 63, 64, 65, 66, 67, 68, 69, 70 and 71.
lό 73. A method of inhibiting the replication of an RNA-containing virus comprising contacting said virus with a therapeuctially effective amount of a compound or combination of compounds of any one of claims 1, 57, 58, 59, 60 and 61.
74. A method of treating or preventing infection caused by an RNA-containing virus 15 comprising administering to a patient in need of such treatment a therapeutically effective ' amount of a compound or combination of compounds of any one of claims 1, 57, 58, 59, 60 and 61.
75. The method of claim 72 wherein the RNA-containing virus is hepatitis C virus. 0
76. The method of claim 75 further comprising the step of co-administering one or more agents selected from the group consisting of a host immune modulator and a second antiviral agent, or a combination thereof.
5 77. The method of claim 76 wherein the host immune modulator is selected from the group" consisting of interferon-alpha, pegylated-interferon-alpha, interferon-beta, interferon-gamma, a cytokine, a vaccine and a vaccine comprising an antigen and an adjuvant.
78. The method of claim 76 wherein the second antiviral agent inhibits replication of HCV by 30 inhibiting host cellular functions associated with viral replication.
79. The method of claim 76 wherein the second antiviral agent inhibits the replication of HCV by targeting proteins of the viral genome.
5 80. The method of claim 75 further comprising the step of co-administering an agent or combination of agents that treat or alleviate symptoms of HCV infection including cirrhosis and inflammation of the liver.
-493-
81. The method of claim 75 further comprising the step of co-administering one or more agents that treat patients for disease caused by hepatitis B (HBV) infection.
82. The method of claim 81 wherein the agent that treats patients for disease caused by hepatitis B (HBV) infection is selected from the group consisting of L-deoxythymidine, adefovir, lamivudine and tenfovir, or any combination thereof.
'">
83. The method of claim 75 further comprising the step of co-administering one or more agents that treat patients for disease caused by human immunodeficiency virus (HIV) infection.
84. The method of claim 83 wherein the agent that treats patients for disease caused by human immunodeficiency virus (HIV) infection is selected from the group consisting of ritonavir, lopinavir, indinavir, nelfinavir, saquinavir, amprenavir, atazanavir, tipranavir, TMC-114, fosamprenavir, zidovudine, lamivudine, didanosine, stavudine, tenofovir, zalcitabine, abacavir, efavirenz, nevirapine, delavirdine, TMC-125, L-870812, S-1360, enfuvirtide (T-20) and T-1249, or any combination thereof.
85. A process for the
Figure imgf000496_0001
(I), or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl,
-494- (cycloalkyl) alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independently_selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rα} -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R4 is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O)-, RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc),
-495- -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2RC; -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each "occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-7 RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(0)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3
-496- substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SR , -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alky!N(alkyl)2,
-alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and R together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle,
-497- heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
R is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(0)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcR ;
m is 0, 1, 2, 3, or 4; and
n is O, 1, 2, 3, or 4;
with the proviso that when A is a ring other than
Figure imgf000500_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, • alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl,
-SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that when A is
Figure imgf000500_0002
-498- and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl;
comprising:
(a) contacting a compound of formula (26)
Figure imgf000501_0001
(26) with carbon disulfide and a methylating agent in the presence of a base to provide a compound of formula (27)
Figure imgf000501_0002
(27); and
(b) contacting the compound of formula (27) with a compound of formula (13)
Figure imgf000501_0003
(13).
86. A process for the preparation of a compound of formula (I),
Figure imgf000501_0004
-499- (I) or a pharmaceutically acceptable salt form, stereoisomer or tautomer thereof, wherein:
A is a monocyclic or bicyclic ring selected from the group consisting of aryl, cycloalkyl, cycloalkenyl, heteroaryl and heterocycle;
R1 is selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-, RaRbNC(O)NRcalkyl-, RfRgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl) (ORc), -(alkyl)(NRcRe), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra andRaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
R is selected from the group consisting of alkoxy, arylalkoxy, aryloxy, halo, hydroxy, RaRbN-, N3-, ReS-, wherein R4 is independently substituted with 0, 1 or 2 substituents independently selected from the group consisting of halo, nitro, cyano, -OH, -NH2, and -COOH;
-500- R5 is independently selected at each occurrence from the group consisting of alkenyl, alkoxy, alkyl, alkynyl, aryl, arylalkyl, arylcarbonyl, aryloxy, azidoalkyl, formyl, halo, haloalkyl, halocarbonyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, hydoxyalkyl, cycloalkyl, cyano, cyanoalkyl, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaRbNalkyl-, Ra(O)SN(Rf)-, RaSO2N(Rf)-, Ra(O)SN(Rf)alkyl-, RaSO2N(Rf)alkyl-, RaRbNSO2N(Rf)-, RaRbNSO2N(Rf)alkyl-, RaRbNC(O , RkOC(O)-, RkOC(O)alkyl-, RkOalkyl-, RaRbNSO2-, RaRbNSO2alkyl-, (RbO)(Ra)P(O)O- and -ORk, wherein each R5 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra;
Ra and R , at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, ' heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcRdN-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(O)-, RcRdNC(O)-, RcRdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl,
-501- oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRhϊ -ORf, -CO(Rf), -SRf, -SORf, -SO2R , -C(O)NRfRh, -SO2NRfRh, -C(O)O f, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and R is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2,
-alkylS (alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(O)OH, -C(O)O (alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
-502- alternatively, Rf and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, Rf and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherein each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(0)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O)-, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(0)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORe), -(alkyl) (NRcR ), -SRc, -S(O)Rc, -S(O)2RCl -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
n is 0, 1, 2, 3, or 4;
with the proviso that when A is a ring other than
Figure imgf000505_0001
and R4 is alkoxy, aryloxy, hydroxy or ReS-, and R5 is hydrogen, alkenyl, alkoxy, alkyl, alkynyl, aryl, halo, heteroaryl, heterocyclealkyl, cycloalkyl, cyano, nitro, RaRbN-, RaC(O)-, RaS-, Ra(O)S-, Ra(O)2S-, RaSO2N(Rf)-, RaRbNC(O)-, RkOC(O)-, RaRbNSO2- or -ORk, and R6
-503- is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl; and with the further proviso that
Figure imgf000506_0001
and R4 is hydroxy or ReS-, and R5 is hydrogen, unsubstituted alkyl, halo or -ORk, and R6 is hydrogen, alkyl, alkenyl, alkynyl, halo, cyano, nitro, aryl, heteroaryl, heterocyclealkyl, -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb, then R1 is not hydrogen, alkenyl, alkyl, alkynyl, aryl, arylalkenyl, arylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocyclealkenyl or heterocyclealkyl;
compnsmg:
(a) contacting a compound of formula (26)
Figure imgf000506_0002
(26) with tris(methylthio)methyl methyl sulfate in the presence of a base to provide a compound of formula (27)
Figure imgf000506_0003
(27); and (b) contacting the compound of formula (27) a compound of formula (13)
Figure imgf000506_0004
-504- (13).
87. A compound having formula (IX),
Figure imgf000507_0001
(IX) or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof, wherein
R .1 i :,s selected from the group consisting of hydrogen, alkenyl, alkoxyalkyl, alkoxycarbonylalkyl, alkyl, alkylcarbonylalkyl, alkylsulfanylalkyl, alkylsulfinylalkyl, alkylsulfonylalkyl, alkynyl, aryl, arylalkenyl, arylalkyl, arylsulfanylalkyl, arylsulfonylalkyl, carboxyalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, (cycloalkyl)alkenyl, (cycloalkyl)alkyl, formylalkyl, haloalkoxyalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heteroarylsulfonylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkyl, nitroalkyl, RaRbN-, RaRbNalkyl-, RaRbNC(O)alkyl-, RaRbNC(O)Oalkyl-,
RaRbNC(O)NRcalkyl-, R RgC=N- and RkO-, wherein R1 is independently substituted with 0, 1, 2 or 3 substituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRe), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Re), -C(O)Rc, -C(O)ORc and -C(O)NRcRe;
R2 and R3 are independently selected from the group consisting of hydrogen, alkenyl, alkynyl, alkoxyalkyl, alkoxycarbonyl, alkyl, aryl, arylalkyl, heteroaryl, heterocycle, heteroarylalkyl, cyano, halo, -N(Ra)(Rb), RaRbNC(O)-, -SRa, -S(O)Ra, -S(O)2Ra and RaC(O)-; wherein R2 and R3 are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of Ra, alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, -(alkyl)(ORk), -(alkyl)(NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb;
alternatively, R2 and R3, together with the carbon atoms to which they are attached form a five- or six-membered ring selected from the group consisting of aryl, cycloalkyl, heteroaryl and heterocycle, wherein said aryl, cycloalkyl, heteroaryl and heterocycle is optionally substituted with (R6)m;
-505- R6 is independently selected at each occurrence from the group consisting of alkyl, alkenyl, alkynyl, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, heterocyclealkyl, -(alkyl)(ORk), -(alkyl) (NRaRb), -SRa, -S(O)Ra, -S(O)2Ra, -ORk, -N(Ra)(Rb), -C(O)Ra, -C(O)ORa and -C(O)NRaRb; wherein each R6 is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, haloalkyl, cyano, nitro, -ORa, -NRaRb, -SRa, -SORa, -SO2Ra, -C(O)ORa, -C(O)NRaRb and -NC(O)Ra; ι
Ra and Rb, at each occurrence, are independently selected from the group consisting of hydrogen, alkenyl, alkyl, alkylsulfanylalkyl, aryl, arylalkenyl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkylalkenyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkenyl, heteroarylalkyl, heterocycle, heterocyclealkenyl, heterocyclealkyl, hydroxyalkylcarbonyl, nitroalkyl, RcR N-, RkO-. RkOalkyl-, RcRdNalkyl-, RcRdNC(O)alkyl-, RcSO2-, RcSO2alkyl-, RcC(O)-, RcC(O)alkyl-, RcOC(O)-, RcOC(O)alkyl-, RcRdNalkylC(OK RcRdNC(O)-, R0RdNC(O)Oalkyl-, RcRdNC(O)N(Re)alkyl-, wherein Ra and Rb are substituted with 0, 1 or 2 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcR ), -SRC, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
alternatively, Ra and Rb, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -alkylSO2NRcRd, -alkylC(O)NRcRd, -SR0, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
Rc and Rd, at each occurrence, are independently selected from the group consisting of hydrogen, -NRfRh, -ORf, -CO(Rf), -SRf, -SORf, -SO2Rf, -C(O)NRfRh, -SO2NRfRh, -C(O)ORf, alkenyl, alkyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, arylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle and heterocyclealkyl; wherein each Rc and Rd is independently substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf,
-506- -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf, -C(O)NRfRh, -C(O)N(H)NRfRh, -N(Re)C(O)ORf, -N(Re)SO2NRfRh, -N(Re)C(O)NRfRh, -alkylN(Re)C(O)ORf, -alkylN(Re)SO2NRfRh, and -alkylN(Re)C(O)NRfRh;
alternatively, Rc and Rd, together with the nitrogen atom to which they are attached form a three- to six-membered ring selected from the group consisting of heteroaryl and heterocycle, wherein the heteroaryl and heterocycle are independently substituted with 0, 1, 2 or 3 subsjituents independentlyselected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORf), -(alkyl)(NRfRh), -SRf, -S(O)Rf, -S(O)2Rf, -ORf, -N(Rf)(Rh), -C(O)Rf, -C(O)ORf and -C(O)NRfRh;
Re is selected from the group consisting of hydrogen, alkenyl, alkyl and cycloalkyl;
Rf, Rg and Rh, at each occurrence, are independently selected from the group consisting of hydrogen, alkyl, alkenyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, heterocycle, heterocyclealkyl, heteroaryl and heteroarylalkyl; wherein each Rf, Rg and Rh is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(O)(alkyl), -SO2alkyl, -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylN(alkyl)2, -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -N(H)C(O)NH2, -C(0)OH, -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2; : alternatively, R and Rg together with the carbon atom to which they are attached form a three- to seven-membered ring selected from the group consisting of cycloalkyl, cycloalkenyl and heterocycle;
alternatively, R and Rh together with the nitrogen atom to which they are attached form a three- to seven-membered ring selected from the group consisting of heterocycle and heteroaryl; wherem each of the heterocycle and heteroaryl is independently substituted with 0, 1, 2 or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, cyano, halo, oxo, nitro, aryl, arylalkyl, cycloalkyl, cycloalkenyl, heterocycle, heteroaryl, heteroarylalkyl, -OH, -O(alkyl), -NH2, -N(H)(alkyl), -N(alkyl)2, -S(alkyl), -S(alkyl), -S(O)(alkyl), -alkyl-OH, -alkyl-O-alkyl, -alkylNH2, -alkylN(H)(alkyl), -alkylS(alkyl), -alkylS(O)(alkyl), -alkylSO2alkyl, -alkylN(alkyl)2, -N(H)C(O)NH2, -C(O)OHi
-507- -C(O)O(alkyl), -C(O)alkyl, -C(O)NH2, -C(O)NH2, -C(O)N(H)(alkyl), and -C(O)N(alkyl)2;
Rk is selected from the group consisting of hydrogen, alkenyl, alkyl, aryl, arylalkyl, cyanoalkyl, cycloalkenyl, cycloalkenylalkyl, cycloalkyl, cycloalkylalkyl, formylalkyl, haloalkyl, heteroaryl, heteroarylalkyl, heterocycle, heterocyclealkyl, nitroalkyl, RaRbNalkyl-, RaOalkyl-, RaRbNC(O>, RaRbNC(O)alkyl, RaS-, RaS(O)-, RaSO2-, RaSalkyl-, Ra(O)Salkyl-, RaSO2alkyl-, RaOC(O)-, RaOC(O)alkyl-, RaC(O)-, RaC(O)alkyl-, wherein each Rk is substituted with 0, 1, 2, or 3 substituents independently selected from the group consisting of alkyl, alkenyl, alkynyl, oxo, halo, cyano, nitro, haloalkyl, haloalkoxy, aryl, heteroaryl, heterocycle, arylalkyl, heteroarylalkyl, alkoxyalkoxyalkyl, -(alkyl)(ORc), -(alkyl)(NRcRd), -SRc, -S(O)Rc, -S(O)2Rc, -ORc, -N(Rc)(Rd), -C(O)Rc, -C(O)ORc and -C(O)NRcRd;
m is 0, 1, 2, 3, or 4; and
R1 ] and R12 are independently selected from the group consisting of alkyl, alkenyl and alkynyl.
88. The compound of claim 87, or a pharmaceutically acceptable salt form, tautomer or stereoisomer thereof selected from the group consisting of: l-benzyl-3-(bis(methylthio)methylene)-lH-quinoline-2,4(lH,3H)-dione;
3-[bis(methylthio)methylene]-l-butyl-l,8-naphthyridine-2,4(lH,3H)-dione;
3-[bis(methylthio)methylene]-l-(l,3-dioxo-l,3-dihydro-2H-isoindol-2-yl)quinoline- 2,4(lH,3H)-dione;
3-[bis(methylthio)methylene]-l-[(cyclopropylmethyl)amino]quinoline-2,4(lH,3H)- dione;
3-[bis(methylthio)methylene]-l-(3-methylbutyl)pyridine-2,4(lH,3H)-dione; l-benzyl-3-[bis(methylthio)methylene]pyridine-2,4(lH,3H)-dione; 3-[bis(methylthio)methylene]-l-(cyclobutylamino)quinoline-2,4(lH,3H)-dione; and 3-[bis(methylthio)methylene]-l-(cyclobutylmethyl)pyridine-2,4(lH,3H)- dione.
-508-
PCT/US2003/034707 2002-11-01 2003-10-31 Anti-infective agents WO2004041818A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
MXPA05004670A MXPA05004670A (en) 2002-11-01 2003-10-31 Anti-infective agents.
EP03768559A EP1560827B1 (en) 2002-11-01 2003-10-31 Anti-infective agents
AT03768559T ATE493408T1 (en) 2002-11-01 2003-10-31 ANTINIFECTIVE AGENTS
DE60335564T DE60335564D1 (en) 2002-11-01 2003-10-31 ANTI-INFECTIOUS MEDIUM
BRPI0315897-7A BR0315897A (en) 2002-11-01 2003-10-31 anti-infectious agents
DK03768559.1T DK1560827T3 (en) 2002-11-01 2003-10-31 Anti-infectious agents
AU2003291670A AU2003291670A1 (en) 2002-11-01 2003-10-31 Anti-infective agents
SI200331953T SI1560827T1 (en) 2002-11-01 2003-10-31 Anti-infective agents
CA2504385A CA2504385C (en) 2002-11-01 2003-10-31 Thiadiazine compounds and uses thereof
JP2005502238A JP4738172B2 (en) 2002-11-01 2003-10-31 Antiinfectives

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US10/285,714 2002-11-01
US10/285,714 US20040097492A1 (en) 2002-11-01 2002-11-01 Anti-infective agents
US10/410,853 2003-04-10
US10/410,853 US20040087577A1 (en) 2002-11-01 2003-04-10 Anti-infective agents
US10/625,121 US20040162285A1 (en) 2002-11-01 2003-07-23 Anti-infective agents
US10/625,121 2003-07-23
US10/679,881 2003-10-06
US10/679,881 US20050075331A1 (en) 2003-10-06 2003-10-06 Anti-infective agents

Publications (1)

Publication Number Publication Date
WO2004041818A1 true WO2004041818A1 (en) 2004-05-21

Family

ID=32314949

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/034707 WO2004041818A1 (en) 2002-11-01 2003-10-31 Anti-infective agents

Country Status (8)

Country Link
EP (2) EP2361913A1 (en)
KR (1) KR20050065670A (en)
AU (1) AU2003291670A1 (en)
BR (1) BR0315897A (en)
CA (1) CA2504385C (en)
MX (1) MXPA05004670A (en)
PL (1) PL376823A1 (en)
WO (1) WO2004041818A1 (en)

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006091858A1 (en) * 2005-02-25 2006-08-31 Rigel Pharmaceuticals, Inc. Benzisothiazoles useful for treating or preventing hcv infection
WO2006117306A1 (en) 2005-05-04 2006-11-09 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2008011337A1 (en) * 2006-07-19 2008-01-24 Abbott Laboratories Hcv inhibitors
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7531534B2 (en) 2006-02-17 2009-05-12 Roche Palo Alto Llc Heterocyclic antiviral compounds
WO2009076747A1 (en) 2007-12-19 2009-06-25 Boehringer Ingelheim International Gmbh Viral polymerase inhibitors
WO2009090401A2 (en) * 2008-01-17 2009-07-23 Syngenta Limited Herbicidal compounds
WO2010010017A1 (en) * 2008-07-23 2010-01-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010080874A1 (en) 2009-01-07 2010-07-15 Scynexis, Inc. Cyclosporine derivative for use in the treatment of hcv and hiv infection
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010133528A1 (en) * 2009-05-20 2010-11-25 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
US7902203B2 (en) 2002-11-01 2011-03-08 Abbott Laboratories, Inc. Anti-infective agents
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011034518A1 (en) 2009-09-15 2011-03-24 Taigen Biotechnology Co., Ltd. Hcv protease inhibitors
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011057989A1 (en) * 2009-11-11 2011-05-19 Basf Se Heterocyclic compounds having herbicidal action
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
US7985769B2 (en) 2001-06-11 2011-07-26 Vertex Pharmaceuticals Incorporated Compounds and methods for the treatment or prevention of Flavivirus infections
US8003685B2 (en) 2006-11-15 2011-08-23 Vertex Pharmaceuticals (Canada) Incorporated Thiophene analogues for the treatment or prevention of flavivirus infections
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
EP2494991A1 (en) 2007-05-04 2012-09-05 Vertex Pharmaceuticals Incorporated Combination therapy for the treatment of HCV infection
US8357718B2 (en) 2002-12-10 2013-01-22 Vertex Pharmaceuticals (Canada) Incorporated Compounds and methods for the treatment or prevention of flavivirus infections
US8546602B2 (en) 2007-04-03 2013-10-01 Anadys Pharmaceuticals, Inc. 5,6-D hydro-1H-pyridin-2-one compounds
US8691849B2 (en) 2008-09-02 2014-04-08 Janssen Pharmaceuticals, Inc. 3-azabicyclo[3.1.0]hexyl derivatives as modulators of metabotropic glutamate receptors
US8691813B2 (en) 2008-11-28 2014-04-08 Janssen Pharmaceuticals, Inc. Indole and benzoxazine derivatives as modulators of metabotropic glutamate receptors
US8697689B2 (en) 2008-10-16 2014-04-15 Janssen Pharmaceuticals, Inc. Indole and benzomorpholine derivatives as modulators of metabotropic glutamate receptors
US8722894B2 (en) 2007-09-14 2014-05-13 Janssen Pharmaceuticals, Inc. 1,3-disubstituted-4-phenyl-1H-pyridin-2-ones
US8748621B2 (en) 2007-09-14 2014-06-10 Janssen Pharmaceuticals, Inc. 1,3-disubstituted 4-(aryl-X-phenyl)-1H-pyridin-2-ones
US8785486B2 (en) 2007-11-14 2014-07-22 Janssen Pharmaceuticals, Inc. Imidazo[1,2-A]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
US8841323B2 (en) 2006-03-15 2014-09-23 Janssen Pharmaceuticals, Inc. 1, 4-disubstituted 3-cyano-pyridone derivatives and their use as positive allosteric modulators of MGLUR2-receptors
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
US8906939B2 (en) 2007-03-07 2014-12-09 Janssen Pharmaceuticals, Inc. 3-cyano-4-(4-tetrahydropyran-phenyl)-pyridin-2-one derivatives
US8937060B2 (en) 2009-05-12 2015-01-20 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo [4,3-A] pyridine derivatives and their use for the treatment of prevention of neurological and psychiatric disorders
US8946205B2 (en) 2009-05-12 2015-02-03 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
US8993591B2 (en) 2010-11-08 2015-03-31 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a] pyridine derivatives and their use as positive allosteric modulators of MGLUR2 receptors
US9012448B2 (en) 2010-11-08 2015-04-21 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of MGLUR2 receptors
US9067891B2 (en) 2007-03-07 2015-06-30 Janssen Pharmaceuticals, Inc. 1,4-disubstituted 3-cyano-pyridone derivatives and their use as positive allosteric modulators of mGluR2-receptors
US9085577B2 (en) 2009-05-12 2015-07-21 Janssen Pharmaceuticals, Inc. 7-aryl-1,2,4-triazolo[4,3-A]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
US9114138B2 (en) 2007-09-14 2015-08-25 Janssen Pharmaceuticals, Inc. 1′,3′-disubstituted-4-phenyl-3,4,5,6-tetrahydro-2H,1′H-[1,4′] bipyridinyl-2′-ones
US9271967B2 (en) 2010-11-08 2016-03-01 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
CN106810557A (en) * 2015-11-27 2017-06-09 南京圣和药业股份有限公司 Heterocyclic compound and its application
US9708315B2 (en) 2013-09-06 2017-07-18 Janssen Pharmaceutica Nv 1,2,4-triazolo[4,3-a]pyridine compounds and their use as positive allosteric modulators of MGLUR2 receptors
US10106542B2 (en) 2013-06-04 2018-10-23 Janssen Pharmaceutica Nv Substituted 6,7-dihydropyrazolo[1,5-a]pyrazines as negative allosteric modulators of mGluR2 receptors
US10537573B2 (en) 2014-01-21 2020-01-21 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use
US10919865B2 (en) * 2011-04-22 2021-02-16 Signal Pharmaceuticals, Llc Substituted diaminocarboxamide and diaminocarbonitrile pyrimidines, compositions thereof, and methods of treatment therewith
US11369606B2 (en) 2014-01-21 2022-06-28 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085172A1 (en) * 2000-05-10 2001-11-15 Smithkline Beecham Corporation Novel anti-infectives
WO2002098424A1 (en) * 2001-06-07 2002-12-12 Smithkline Beecham Corporation Novel anti-infectives
WO2003059356A2 (en) * 2001-10-30 2003-07-24 Smithkline Beecham Corporation Novel anti-infectives

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085172A1 (en) * 2000-05-10 2001-11-15 Smithkline Beecham Corporation Novel anti-infectives
WO2002098424A1 (en) * 2001-06-07 2002-12-12 Smithkline Beecham Corporation Novel anti-infectives
WO2003059356A2 (en) * 2001-10-30 2003-07-24 Smithkline Beecham Corporation Novel anti-infectives

Cited By (75)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7985769B2 (en) 2001-06-11 2011-07-26 Vertex Pharmaceuticals Incorporated Compounds and methods for the treatment or prevention of Flavivirus infections
US7902203B2 (en) 2002-11-01 2011-03-08 Abbott Laboratories, Inc. Anti-infective agents
US8357718B2 (en) 2002-12-10 2013-01-22 Vertex Pharmaceuticals (Canada) Incorporated Compounds and methods for the treatment or prevention of flavivirus infections
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
WO2006091858A1 (en) * 2005-02-25 2006-08-31 Rigel Pharmaceuticals, Inc. Benzisothiazoles useful for treating or preventing hcv infection
US7776847B2 (en) 2005-02-25 2010-08-17 Rigel Pharmaceuticals, Inc. Benzisothiazoles useful for treating or preventing HCV infection
US7674810B2 (en) 2005-05-04 2010-03-09 Roche Palo Alto Llc 1,1-dioxo-1H-1Λ6-benzo[d]isothiazol-3-yl)-4-hydroxy-1,5-dihydro-pyrrol-2-one inhibitors of HCV polymerase
WO2006117306A1 (en) 2005-05-04 2006-11-09 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
JP2008540370A (en) * 2005-05-04 2008-11-20 エフ．ホフマン−ラ ロシュ アーゲー Heterocyclic antiviral compounds
US7531534B2 (en) 2006-02-17 2009-05-12 Roche Palo Alto Llc Heterocyclic antiviral compounds
US8841323B2 (en) 2006-03-15 2014-09-23 Janssen Pharmaceuticals, Inc. 1, 4-disubstituted 3-cyano-pyridone derivatives and their use as positive allosteric modulators of MGLUR2-receptors
US9266834B2 (en) 2006-03-15 2016-02-23 Janssen Pharmaceuticals, Inc. 1, 4-disubstituted 3-cyano-pyridone derivatives and their use as positive allosteric modulators of MGLUR2-receptors
US7951800B2 (en) 2006-07-19 2011-05-31 Abbott Laboratories, Inc. Anti-infective agents
US7662958B2 (en) 2006-07-19 2010-02-16 Rolf Wagner Anti-infective agents
WO2008011337A1 (en) * 2006-07-19 2008-01-24 Abbott Laboratories Hcv inhibitors
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
US8003685B2 (en) 2006-11-15 2011-08-23 Vertex Pharmaceuticals (Canada) Incorporated Thiophene analogues for the treatment or prevention of flavivirus infections
US8906939B2 (en) 2007-03-07 2014-12-09 Janssen Pharmaceuticals, Inc. 3-cyano-4-(4-tetrahydropyran-phenyl)-pyridin-2-one derivatives
US9067891B2 (en) 2007-03-07 2015-06-30 Janssen Pharmaceuticals, Inc. 1,4-disubstituted 3-cyano-pyridone derivatives and their use as positive allosteric modulators of mGluR2-receptors
US8765741B2 (en) 2007-04-03 2014-07-01 Anadys Pharmaceuticals, Inc. 5,6-dihydro-1H-pyridin-2-one compounds
US8546602B2 (en) 2007-04-03 2013-10-01 Anadys Pharmaceuticals, Inc. 5,6-D hydro-1H-pyridin-2-one compounds
US9156832B2 (en) 2007-04-03 2015-10-13 Anadys Pharmaceuticals, Inc. 5,6-dihydro-1H-pyridin-2-one compounds
EP2494991A1 (en) 2007-05-04 2012-09-05 Vertex Pharmaceuticals Incorporated Combination therapy for the treatment of HCV infection
US9114138B2 (en) 2007-09-14 2015-08-25 Janssen Pharmaceuticals, Inc. 1′,3′-disubstituted-4-phenyl-3,4,5,6-tetrahydro-2H,1′H-[1,4′] bipyridinyl-2′-ones
US8722894B2 (en) 2007-09-14 2014-05-13 Janssen Pharmaceuticals, Inc. 1,3-disubstituted-4-phenyl-1H-pyridin-2-ones
US8748621B2 (en) 2007-09-14 2014-06-10 Janssen Pharmaceuticals, Inc. 1,3-disubstituted 4-(aryl-X-phenyl)-1H-pyridin-2-ones
US9132122B2 (en) 2007-09-14 2015-09-15 Janssen Pharmaceuticals, Inc. 1′,3′-disubstituted-4-phenyl-3,4,5,6-tetrahydro-2H,1′H-[1,4′]bipyridinyl-2′-ones
US11071729B2 (en) 2007-09-14 2021-07-27 Addex Pharmaceuticals S.A. 1′,3′-disubstituted-4-phenyl-3,4,5,6-tetrahydro-2H,1′H-[1,4′]bipyridinyl-2′-ones
US8785486B2 (en) 2007-11-14 2014-07-22 Janssen Pharmaceuticals, Inc. Imidazo[1,2-A]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
WO2009076747A1 (en) 2007-12-19 2009-06-25 Boehringer Ingelheim International Gmbh Viral polymerase inhibitors
US8557840B2 (en) 2008-01-17 2013-10-15 Syngenta Limited Herbicidal compounds
WO2009090401A2 (en) * 2008-01-17 2009-07-23 Syngenta Limited Herbicidal compounds
WO2009090401A3 (en) * 2008-01-17 2010-09-10 Syngenta Limited Herbicidal compounds
US8987455B2 (en) 2008-01-17 2015-03-24 Syngenta Limited Herbicidal compounds
EA018801B1 (en) * 2008-01-17 2013-10-30 Синджента Лимитед Herbicidal compounds
JP2011528686A (en) * 2008-07-23 2011-11-24 エフ．ホフマン−ラ ロシュ アーゲー Heterocyclic antiviral compounds
WO2010010017A1 (en) * 2008-07-23 2010-01-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
US8691849B2 (en) 2008-09-02 2014-04-08 Janssen Pharmaceuticals, Inc. 3-azabicyclo[3.1.0]hexyl derivatives as modulators of metabotropic glutamate receptors
US8697689B2 (en) 2008-10-16 2014-04-15 Janssen Pharmaceuticals, Inc. Indole and benzomorpholine derivatives as modulators of metabotropic glutamate receptors
US8691813B2 (en) 2008-11-28 2014-04-08 Janssen Pharmaceuticals, Inc. Indole and benzoxazine derivatives as modulators of metabotropic glutamate receptors
WO2010080874A1 (en) 2009-01-07 2010-07-15 Scynexis, Inc. Cyclosporine derivative for use in the treatment of hcv and hiv infection
CN102341382A (en) * 2009-03-06 2012-02-01 弗·哈夫曼-拉罗切有限公司 Heterocyclic antiviral compounds
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
US10071095B2 (en) 2009-05-12 2018-09-11 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo [4,3-A] pyridine derivatives and their use for the treatment of neurological and psychiatric disorders
US9085577B2 (en) 2009-05-12 2015-07-21 Janssen Pharmaceuticals, Inc. 7-aryl-1,2,4-triazolo[4,3-A]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
US9226930B2 (en) 2009-05-12 2016-01-05 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo [4,3-a] pyridine derivatives and their use for the treatment of prevention of neurological and psychiatric disorders
US9737533B2 (en) 2009-05-12 2017-08-22 Janssen Pharmaceuticals. Inc. 1,2,4-triazolo [4,3-A] pyridine derivatives and their use for the treatment of prevention of neurological and psychiatric disorders
US8937060B2 (en) 2009-05-12 2015-01-20 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo [4,3-A] pyridine derivatives and their use for the treatment of prevention of neurological and psychiatric disorders
US8946205B2 (en) 2009-05-12 2015-02-03 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
WO2010133528A1 (en) * 2009-05-20 2010-11-25 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
CN102448548A (en) * 2009-05-20 2012-05-09 弗·哈夫曼-拉罗切有限公司 Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
WO2011034518A1 (en) 2009-09-15 2011-03-24 Taigen Biotechnology Co., Ltd. Hcv protease inhibitors
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
US8063072B2 (en) 2009-09-21 2011-11-22 Roche Palo Alto Llc Heterocyclic antiviral compounds
WO2011057989A1 (en) * 2009-11-11 2011-05-19 Basf Se Heterocyclic compounds having herbicidal action
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
US9012448B2 (en) 2010-11-08 2015-04-21 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of MGLUR2 receptors
US9271967B2 (en) 2010-11-08 2016-03-01 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a]pyridine derivatives and their use as positive allosteric modulators of mGluR2 receptors
US8993591B2 (en) 2010-11-08 2015-03-31 Janssen Pharmaceuticals, Inc. 1,2,4-triazolo[4,3-a] pyridine derivatives and their use as positive allosteric modulators of MGLUR2 receptors
US10919865B2 (en) * 2011-04-22 2021-02-16 Signal Pharmaceuticals, Llc Substituted diaminocarboxamide and diaminocarbonitrile pyrimidines, compositions thereof, and methods of treatment therewith
US11325890B2 (en) 2011-04-22 2022-05-10 Signal Pharmaceuticals, Llc Substituted diaminocarboxamide and diaminocarbonitrile pyrimidines, compositions thereof, and methods of treatment therewith
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
US10584129B2 (en) 2013-06-04 2020-03-10 Janssen Pharmaceuticals Nv Substituted 6,7-dihydropyrazolo[1,5-a]pyrazines as negative allosteric modulators of mGluR2 receptors
US10106542B2 (en) 2013-06-04 2018-10-23 Janssen Pharmaceutica Nv Substituted 6,7-dihydropyrazolo[1,5-a]pyrazines as negative allosteric modulators of mGluR2 receptors
US9708315B2 (en) 2013-09-06 2017-07-18 Janssen Pharmaceutica Nv 1,2,4-triazolo[4,3-a]pyridine compounds and their use as positive allosteric modulators of MGLUR2 receptors
US10537573B2 (en) 2014-01-21 2020-01-21 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use
US11103506B2 (en) 2014-01-21 2021-08-31 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use
US11369606B2 (en) 2014-01-21 2022-06-28 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use
US12048696B2 (en) 2014-01-21 2024-07-30 Janssen Pharmaceutica Nv Combinations comprising positive allosteric modulators or orthosteric agonists of metabotropic glutamatergic receptor subtype 2 and their use
CN106810557B (en) * 2015-11-27 2021-05-04 南京圣和药物研发有限公司 Heterocyclic compounds and their use
CN106810557A (en) * 2015-11-27 2017-06-09 南京圣和药业股份有限公司 Heterocyclic compound and its application

Also Published As

Publication number Publication date
PL376823A1 (en) 2006-01-09
MXPA05004670A (en) 2005-08-18
BR0315897A (en) 2008-05-13
EP2361913A8 (en) 2012-04-18
EP1560827B1 (en) 2010-12-29
EP2361913A1 (en) 2011-08-31
EP1560827A1 (en) 2005-08-10
AU2003291670A1 (en) 2004-06-07
CA2504385A1 (en) 2004-05-21
KR20050065670A (en) 2005-06-29
CA2504385C (en) 2012-12-18

Similar Documents

Publication Publication Date Title
US7902203B2 (en) Anti-infective agents
WO2004041818A1 (en) Anti-infective agents
US20050075331A1 (en) Anti-infective agents
ES2357230T3 (en) ANTI-INFECTIVE AGENTS.
US20040162285A1 (en) Anti-infective agents
US5366972A (en) 5,11-dihydro-6H-dipyrido(3,2-B:2&#39;,3&#39;-E)(1,4)diazepines and their use in the prevention or treatment of HIV infection
JP5250649B2 (en) Antiinfectives
JP4463565B2 (en) Nitrogen-containing bicyclic heterocycles for use as antibacterial agents
AU2006343808B2 (en) Inhibitors of VEGF receptor and HGF receptor signaling
AU2006313456B2 (en) Inhibitors of VEGF receptor and HGF receptor signaling
WO2006004636A2 (en) Fused heterocyclic kinase inhibitors
JP2002517396A (en) Anti-inflammatory compounds that inhibit cell adhesion
EP1963337B1 (en) THIENO[2,3-b]PYRIDINE DERIVATIVES
JP2009521460A (en) Antiviral compounds
JP6301474B2 (en) Novel compounds for treating cancer and inflammatory diseases
TW200427678A (en) Anti-infective agents
JPH07620B2 (en) Condensed imidazopyridine derivative
BRPI0620440A2 (en) antiviral compounds

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2005502238

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: PA/a/2005/004670

Country of ref document: MX

Ref document number: 376823

Country of ref document: PL

Ref document number: 2504385

Country of ref document: CA

Ref document number: 539726

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 168315

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020057007790

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2003291670

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2005/04413

Country of ref document: ZA

Ref document number: 200504413

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 522/MUMNP/2005

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2003768559

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 20038A78855

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 1020057007790

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2003768559

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0315897

Country of ref document: BR

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)