WO2004039391A1 - Viral serpin regulation of inflamation - Google Patents

Abstract

The present invention provides for a pharmaceutical composition containing at least one compound that promotes intracellular signalling via the human urokinase plasminogen activator receptor. The compound binds the human urokinase plasminogen activator receptor, the compound binds one or more intracellular protein(s) directly or indirectly associated with intracellular signalling via human urokinase plasminogen activator receptor, and the compound binds one or more intracellular protein(s) that are modulated by urokinase plasminogen activator receptor activity. The compound is an organic or inorganic compound with a molecular weight less than 1kDa, compound is a peptide between 2 and 20 amino acids in length, and the compound is a polypeptide greater than 20 amino acids in length. The compound is an antibody or fragment thereof, the compound is a nucleic acid, and the compound is administered to humans in vivo, and to human cells ex vivo. The composition includes a pharmaceutically acceptable carrier, and the composition is administered to a human individual for the treatment of an inflamatory condition.

Description

VIRAL SERPIN REGULATION OF INFLAMMATION

FIELD OF INVENTION

The present invention relates to the regulation of vascular cellular responses. More specifically, a viral serpin which inhibits the regulation of vascular cellular responses.

BACKGROUND OF THE INVENTION Complex DNA viruses have tapped into cellular serpin responses that are key regulatory steps in coagulation and inflammatory cascades.

An integrated balance between the thrombotic and thrombolytic cascades, both of which are regulated by serine proteinases, activates arterial clot formation and also mediates the inflammatory cell responses at sites of vascular injury [Libby, P., Ridker, P.M., Maseri, A(2002). Circulation.105, 1135-XXX; Ross, R. (1999) N. Engl. J.Med. 340,115-126; Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C., Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L., Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Cell. Biol.134:1563-1571 ; Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, D , Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem. 276:33293-33296]. Serine proteinase inhibitors, termed serpins, in turn regulate these cascades [Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, D.A., Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold- O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem. 276:33293-33296]. Larger DNA containing viruses have captured host serpins during millions of years of evolution, and adapted them into highly effective shields against host inflammatory responses [Turner, P.C. and Moyer, R.W. (2001) Am. Soc. Microbiol. News. 67:201 -XXX].

The precise targets and/or receptors, through which viral serpins, specifically Serp-1 , inhibit inflammatory cell responses are not yet defined [Nash, P., Whitty, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol.Chem.273: 20982- 20991 ; Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Steward, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, lcton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038; Stefansson, S. and Lawrence, D.A. (1996) Nature 383:441-443; Jackson, CL. and Reidy, M.A. (1992) Ann. N.Y. Acad. Sci. 667,141-150; Zalai, C.V., Nash, P., Dai, E., Liu, L., Lucas, A. (2001 ) Cardiovascular Plaque Rupture, Brown DL (Editor), Marcel Dekker, Inc., New York 2001 (In Press)]. The urokinase-type plasminogen activator (uPA), when bound to the uPA receptor (uPAR), enhances inflammatory cell migration [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C., Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, D , Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem. 276:33293-33296; Zalai, C.V., Nash, P., Dai, E., Liu, L, Lucas, A. (2001 ) Cardiovascular Plaque Rupture, Brown DL (Editor), Marcel Dekker, Inc., New York 2001 (In Press); Reidy, M.A., Irvin, C, Lindner, V. (1996) Circ. Res. 78, 405-414], cell adhesion mediated by vitronectin [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Chang, A.W., Kuo, A., Barnathan, E.S., and Okada, S.S. (1998) Arterioscler. Thromb. Vase. Biol. 18:1855-1860; Germer, M., Kanse, S.M., Kirkegaard, T., Kjoller, L., Felding-Habermann, B., Goodman, S., and Preissner, K.T. (1998) Eur. J. Biochem. 253:669-674], cell invasion through activation of matrix metalloproteinase enzymes (MMP) [Chavakis, T., Kanse, S.M., Yutzy, B., Lijnen, H.R., Preissner, K.T. (1998) Blood. 91 , 2305-2312; Lijnen H.R. Van Hoef, B., Lupu, F., Moons, L., Carmeliet, P., Collen D. (1998) Arterioscler. Thromb. Vase. Biol. 18, 1035-1045], and the release and activation of growth factors [Falcone, D.J., McCaffrey, T.A., Haimovitz-Friedman, A. Vergilio, J.A., Nicholson, A.C. (1993) J. Biol. Chem. 268, 11951 -11958]. Serpins, inhibit individual steps in these cascades through directed one-to-one stoichiometric inhibition of many of these enzymes [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, CO, Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L., Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Cell. Biol. 134:1563-1571 ; Silverman, GA, Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, DA, Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem.276:33293-33296; Falcone, D.J., McCaffrey, T.A., Haimovitz-Friedman, A. Vergilio, J.A., Nicholson, A.C. (1993) J. Biol. Chem.268, 11951 -11958; Gettins, P., Patston, P ., and Schapira, M. (1992) Hematology/Oncology Clin. N. Am.6:1393-1408; Forsyth, K.D., Talbot, V., and Beckman, I. (1994) Clin. Exp. Immunol. 95:277-282]. PAI-1 is a naturally occurring vascular serpin that binds to uPA and tPA in the circulating blood, inhibiting plasminogen activator activity, but does not inhibit plasmin activity [Turner, P.C and Moyer, R.W. (2001) Am. Soc. Microbiol. News. 67:201 -XXX; Germer, M., Kanse, S.M., Kirkegaard, T., Kjoller, L., Felding-Habermann, B., Goodman, S., and Preissner, K.T. (1998) Eur. J. Biochem. 253:669-674; Lijen, H.R., Van Hoef, B., Lupu, F., Moons, L, Carmeliet, P., Collen D. (1998) Arterioscler. Thromb. Vase. Biol. 18, 1035-1045; Falcone, D.J., McCaffrey, T.A., Haimovitz-Friedman, A. Vergilio, J.A., Nicholson, A.C. (1993) J. Biol. Chem.268, 11951-11958; Gettins, P., Patston, P.A., and Schapira, M. (1992) Hematology/Oncology Clin. N. Am. 6:1393-1408; Forsyth, K.D., Talbot, V., and Beckman, I. (1994) Clin. Exp. Immunol. 95:277-282; Carmeliet, P. and Colen, D. (1995) FASEB J. 9:934-938; Carmeliet, P., Schoonjans, L., Kieckans, L, Ream, B., Degen, J., Bronson, R., De Vos, R., van den Oord, J.J., Collen, D., Mulligen, R.C. (1994) Nature. 368, 419-424]. Plasminogen activator inhibitor-1 (PAI-1 ) deficient mice have significantly increased intimal hyperplasia after arterial injury [Carmeliet, P. and Colen, D. (1995) FASEB J. 9:934-938; Carmeliet, P., Schoonjans, L., Kieckans, L., Ream, B., Degen, J., Bronson, R., De Vos, R., van den Oord, J.J., Collen, D., Mulligen, R.C. (1994) Nature. 368,419-424; Carmeliet, P., Moons, L, Lijnen, R., Janssens, S., Lupu, F., Collen, D., Gerard, R.D. (1997) Circulation. 96:3180-3191 ]. This injury induced intimal hyperplasia is reduced by administration of Adenoviral vectors expressing PAI-1 , suggesting that PAI-1 together with the plasminogen system acts as a central regulator of vascular wound repair responses [Carmeliet, P. and Colen, D. (1995) FASEB J.9:934-938; Carmeliet, P., Schoonjans, L., Kieckans, L., Ream, B., Degen, J., Bronson, R., De Vos, R., van den Oord, J.J., Collen, D., Mulligen, R.C. (1994) Nature 368,419- 424; Carmeliet, P., Moons, L., Lijnen, R., Janssens, S., Lupu, F., Collen, D., Gerard, R.D. (1997) Circulation. 96:3180-3191]. Recent work in the field has demonstrated accelerated lesion growth in carotid arteries of cholesterol fed rabbits with over expression of uPA [Falkenberg, M., Tom, C, DeYoung, M.B., Wen, S., Linnemann, R., Dichek, D.A. (2002) Proc. Natl. Acad. Sci. 99:10665- 10670] and reduced plaque after arterial injury in uPA and plasminogen deficient mice [Moons, L, Shi, C, Ploplis, V., Plow, E., Haber, E., Collen, D., Carmeliet, P. (1998) J. Clin. Invest. 102:1788-1797; Levi, M., Moons, L, Bouche, A., Shapiro, S.D., Collen, D., Carmeliet, P. (2001 ) Circulation. 103:2014-2020] confirming a pro-atherogenic role for uPA in these animal models. Other studies have been less conclusive, demonstrating either pro-atherogenic or thrombotic effects, for plasminogen and plasmin inhibitors in animal models [Sjoland, H., Eitzman, D.T., Gordon, D., Westrick, R., Nabel, E.G., Ginsbur, D. (2000) Arterioscler. Thromb. Vase. Biol. 20:846-852; Ploplis, V.A., Castellino, F.J. (2001 ) Annals N.Y. Acad. Sci. 936:466-468]. Injury to the arteries of uPAR deficient mice has not, however, been found to alter plaque development [Carmeliet, P. and Colen, D. (1995) FASEB J. 9:934-938].

SUMMARY OF THE INVENTION In one embodiment of the present invention there is provided a pharmaceutical composition containing at least one compound that promotes intracellular signalling via the human urokinase plasminogen activator receptor.

Preferably, the compound binds the human urokinase plasminogen activator receptor, the compound binds one or more intracellular protein(s) directly or indirectly associated with intracellular signalling via human urokinase plasminogen activator receptor, and the compound binds one or more intracellular protein(s) that are modulated by urokinase plasminogen activator receptor activity.

Desirably, the compound is an organic or inorganic compound with a molecular weight less than 1 kDa, the compound is a peptide between 2 and 20 amino acids in length, and the compound is a polypeptide greater than 20 amino acids in length.

It is also desirable the compound is an antibody or fragment thereof, the compound is a nucleic acid, and the compound is administered to humans in vivo, and to human cells ex vivo.

It is preferable the composition includes a pharmaceutically acceptable carrier, and the composition is administered to a human individual for the treatment of an inflammatory condition.

It is further desirable in the above embodiment the composition is administered prior to the onset of the inflammatory condition, the composition is administered to reverse the onset of the inflammatory condition, and the composition is administered in combination with one or more agents.

It is further desirable to the above the agent is an anti-inflammatory agent, and is an anti-immune agent.

It is preferable in the above embodiment the inflammatory condition is selected from the group consisting of asthma, coronary restenosis, cirrhosis, endotoxemia, atherosclerosis, and reperfusion injury, unstable angina, type 1 insulin-dependent diabetes mellitus, inflammatory bowel disease, dermatitis, meningitis, thrombotic thrombocytopenic purpura, Sjόgren's syndrome, encephalitis, uveitis, leukocyte adhesion deficiency, rheumatoid and other forms of immune arthritis, rheumatic fever, Reiter's syndrome, psoriatic arthritis, progressive systemic sclerosis, primary biliary cirrhosis, pemphigus, pemphigoid, necrotizing vasculitis, myasthenia gravis, multiple sclerosis, lupus erythematosus, polymyositis, sarcoidosis, granulomatosis, vasculitis, pernicious anemia, CNS inflammatory disorder, antigen-antibody complex mediated diseases, autoimmune hemolytic anemia, Hashimoto's thyroiditis, Graves disease, habitual spontaneous abortions, Reynard's syndrome, glomerulonephritis, dermatomyositis, chronic active hepatitis, celiac disease, autoimmune complications of AIDS, atrophic gastritis, ankylosing spondylitis, trauma, transplant vascular disease, Addison's disease and transplant rejection.

It is desirable the compound is SERP-1.

BRIEF DESCRIPTION OF DRAWINGS

Fig. 1A - 1 B are cross-sectional views of intimal hyperplasia in a rat arterial taken at 28 days after angioplasty injury SAA control treated rats (A) is markedly reduced after treatment with Serp-1 CHO (B) (p<0.016). Arrows in Panel A indicate limits of intimal plaque growth. Mag. 50X.

Fig. 1 C is a bar graph of mean plaque area ± S.E. for each treatment group demonstrating similar and significant reductions (p<0.05) in plaque area after treatment with Serps-1 W or Serp-1 CHO when compared to the SAA mutant (C).

Fig. 2A-2C are blotting assays which illustrate significant relative reductions in tPA (A) and relative increases in PAI-1 (B) and uPAR (C) mRNA detected by semi-quantitative RT-PCR analysis at 4 -12 hours after angioplasty injury and Serp-1 treatment.

Fig. 2D-2F are bar graphs of real time PCR analysis (tPA, D; PAI-1 , E; and uPAR.F) according to Fig. 2A- 2C

Fig. 2G-2H are blotting assays showing inactive SAA mutant and rat PAI-1 (G) had no effect on PAI-1 mRNA expression after angioplasty injury and Serp-1 had no effect on PAI-1 mRNA in non-injured arteries (H).

Fig.3A-3C are blotting assays showing a significant increase in PAI-1 message detected after 4 - 12 hours of treatment in HUVEC cultures (A) with Serp-1 treatment, but no change in mRNA expression for tPA, PAI-1 or uPAR was detectable in rat smooth muscle cells with Serp-1 treatment (B). Addition of antibody to both uPAR and vitronectin reduced the Serp-1 mediated increase in PAI-1 mRNA in HUVEC cultures (C).

Fig.4A-4C are cross-sectional views of haematoxylin and eosin stained mouse aortic isografts at 4 weeks follow up in Balb/c (PAI-1^+/+, A), C57B1/6 (PAI-1^{+ / +}, B), and C57B1/6J (PAI-1^"'^",C).

Fig. 4D is a bar graph demonstrating a significant increase in intimal area in PAI-1 ^"'^" isografts and a significant decrease in plaque area with Serp-1 treatment of the PAI-1 ^{+ /+} isografts (D).

Fig. 4E-4H are cross-sectional views of donor and recipient allograft transplants, whether from PAI-1^"'^" donors into PAI-1 ^{+ / +} recipients (E) or from PAI-1 ^+/+ donors to PAI-1^"'^" recipients (F), had increased plaque when compared to the PAI-1^{+ /+} allograft controls.

Fig. 4I-4J are bar graphs showing analysis of the donor and recipient according to Fig. 4E to Fig. 4H and the increase in PAI-1^" ' ^" allografts significantly reduced with Serp-1 treatment with a more significant inhibitory effect in the PAI-1^"'^" to PAI-1 ^{+ / +} allografts (I) when compared to the PAI-1^{+ /+} to PAI-1^"'^" allografts (J).

Fig. 4K-4L are cross-sectional views of aortic allograft transplant from uPAR ^" '^" to uPAR ^{+ +} mice having significant plaque growth in both saline treated (K) and Serp-1 treated (L) mice.

Fig. 4M is a bar graph showing analysis of the allographs according to Fig.

4Kto Fig. 4L with no significant inhibitory effects on mean plaque area ± S.E. with Serp-1 treatment (M).

Having thus generally described the invention, reference will now be made to the accompanying drawings.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Serp-1 is a viral serpin that effectively protects virus-infected tissues from host inflammatory responses and, when given as purified protein, markedly inhibits vascular monocyte invasion and plaque growth in animal models. We have investigated mechanisms of viral serpin inhibition of vascular inflammatory responses. In vascular injury models, Serp-1 altered early cellular plasminogen activator (tPA), inhibitor (PAI-1 ), and receptor expression (uPAR)(p<0.01 ). Serp- 1 , but not an active site mutant, also up-regulated PAI-1 serpin expression in human endothelial cells. Treatment of endothelial cells with antibody to uPAR and vitronectin blocked Serp-1 induced changes. Significantly, Serp-1 blocked intimal hyperplasia (p<0.0001 ) after aortic allograft transplant (p<0.0001 ) in PAI-1 deficient mice. Serp-1 also blocked plaque growth after aortic isograft transplant and after wire-induced injury (p<0.05) in PAI-1 deficient mice indicating that an increase in PAI-1 expression is not required for Serp-1 to block vasculopathy development. Serp-1 did not block plaque growth in uPAR deficient mice after aortic allograft transplant. Thus, the poxviral serpin, Serp-1 , attenuates vascular inflammatory responses to injury through a pathway mediated by native uPA receptors and vitronectin.

Serp-1 , a secreted anti-inflammatory protein encoded by myxoma virus, is a poxviral serpin that binds and inhibits, in vitro, the thrombolytic serine proteinases tissue-type and urokinase-type plasminogen activators (tPA and uPA, respectively) and plasmin [Upton, C, Macen, J.L., Wishart, D.S., McFadden, G., (1990) Virology. 170:618-631 ; Nash, P., Whitty, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol. Chem. 273:20982-20991]. In vivo, Serp-1 reduces inflammatory leukocyte responses to myxoma viral infection [Upton, C, Macen, J.L, Wishart, D.S., McFadden, G., (1990) Virology. 170:618-631 ; Nash, P., Whitty, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol. Chem. 273:20982-20991]. Furthermore, infusion of picogram to nanogram doses of purified Serp-1 protein also profoundly inhibits monocytic cell invasion and subsequent atherosclerotic plaque growth following vascular injury induced by angioplasty [Lucas, A.R., Liu, LY., Macen, J, Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900] or allograft transplant [Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; R. Zhong personal communication] in animal models, thus providing a new class of anti- inflammatory drugs.

PAI-1 forms ternary complexes together with uPA and its receptor, uPAR [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L, Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Cell. Biol.134: 1563-1571 ; Seiffert, D., Loskutoff, D.J. (1991 ) Biochim. Biophys. Acta. 1078:23-30; Stefansson, S., Muhammad, S., Cheng, X.F., Battey, F.D., Strickland, D.K., Lawrence, D.A. (1998) J. Biol. Chem.. 273:6358-6366]. This ternary complex is rapidly internalized, effectively blocking the pro- chemotactic, adhesive, and proteolytic activity of the uPA / uPAR complex. The uPA/ uPAR complex interacts with the α2- macroglobulin (low density lipoprotein related protein, LRP) receptor at the cellular membrane, an interaction that is believed to regulate intracellular tyrosine kinase activity [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med. 8, 175-180; Chavakis, T., Kanse, S.M., Yutzy, B., Lijnen, H.R., Preissner, K.T. (1998) Blood. 91 , 2305-2312; Seiffert, D., Loskutoff, D.J. (1991 ) Biochim. Biophys. Acta. 1078:23-30; Stefansson, S., Muhammad, S., Cheng, X.F., Battey, F.D., Strickland, D.K., Lawrence, D.A. (1998) J. Biol. Chem. 273:6358-6366]. This inhibition of the plasminogen activators reduces activation of the pro-form of matrix metalloproteinase (MMP) enzymes to active forms [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L., Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Cell. Biol. 134:1563-1571 ; Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, DA., Luke, C.J., Moyer, R.W., Pemberton, PA., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C (2001) J. Biol. Chem. 276:33293-33296; Zalai, C.V, Nash, P., Dai, E., Liu, L., Lucas, A. (2001 ) Cardiovascular Plaque Rupture, Brown DL (Editor), Marcel Dekker, Inc., New York 2001 (In Press); Reidy, M.A., Irvin, C, Lindner, V. (1996) Circ. Res. 78, 405-414; Chavakis, T., Kanse, S.M., Yutzy, B., Lijnen, H.R., Preissner, K.T. (1998) Blood. 91 , 2305-2312; Lijnen H.R., Van Hoef, B., Lupu, F., Moons, L., Carmeliet, P., Collen D. (1998) Arterioscler. Thromb. Vase. Biol. 18, 1035-1045; Stefansson, S., Muhammad, S., Cheng, X.F., Battey, F.D., Strickland, D.K., Lawrence, D.A. (1998) J. Biol. Chem.273:6358-6366], thus potentially halting cellular invasion at sites of vessel trauma. Vitronectin is a multifunctional adhesion molecule that binds to uPAR forming more stable PAI-1 / uPA / uPAR complexes and has also been reported to also enhance inhibition of thrombin [Seiffert, D., Loskutoff, D.J. (1991 ) Biochim. Biophys. Acta. 1078:23- 30; Stoop, A. A., Lupu, F., Pannekoek, H. (2000) Arterioscler. Thromb. Vase. Biol. 20:1143-1149].

It is postulated that, Serp-1 , interacts with the uPA / uPAR pathway, to inhibit inflammatory responses to arterial injury [Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, lcton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038]. uPAR linked regulation of vascular and endothelial cell serpin expression following Serp-1 treatment after arterial injury in rat models was initially examined. Based on those studies, the effect of Serp-1 infusion on plaque growth after aortic transplant in mouse knock outs deficient in PAI-1 or uPAR was examined. The capacity of Serp-1 to inhibit plaque growth differed dramatically when the PAI-1 (PAI-1 ^"'^") and uPAR (uPAR-1^"'^") deficient mouse strains were compared, indicating that Serp-1 inhibits inflammatory cell responses through native vascular uPA receptors. Delineation of the mechanisms through which viral serpins and other anti-inflammatory proteins inhibit arterial inflammatory responses provides a new approach to the investigation of inflammatory cell responses and their regulation, both innate and virally mediated.

EXPERIMENTAL PROCEDURES: Animal Models of Arterial Surgery -

General surgical method - All research protocols and animal care conformed to the Guiding Principles for Animal Experimentation of the Canadian Council on

Animal Care. Surgeries were performed under general anesthetic (6.5 mg per

100g body weight intra-muscular injection of Somnotrol, MTC Pharmaceuticals,

Cambridge Canada). Serp-1 or controls (1.0 ml volume - rats, 0.2 ml - mice) were given by intra-arterial injection through the central balloon lumen immediately after surgery. Animals were sacrificed with euthanyl (Bimeda- MTC Animal Health

Ltd., Cambridge, Ontario, Canada), 0.05 ml for mice and 0.25 ml (rats) given i.m.

No increase in mortality was detected for any of the rats with angioplasty injury or mice after aortic transplant using either PAI-1 or uPAR deficient mouse strains

(P=0.49). Serp-1 infusion did not result in any increase in adverse events or mortality.

Rat angioplasty injury model - In Study 1 (Table 1 A) the effects were analyzed of either 30 ng (per animal) Serp-1 purified from vaccinia vector (Serp-1 W) [Lucas,

A.R., Liu, L.Y., Macen, J., Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-20991] or isolated from CHO cells (Serp-1 CHO) [Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038], the Serp-1 active site mutant (SAA) [Lucas, A. R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038], or saline (Fig. 1 ) infusion on intimal hyperplasia after iliofemoral angioplasty balloon injury in 30 Sprague Dawley rats (250-350 gms, Charles River Laboratories, Wilmington, Massachusetts) at 28 days [Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19: 1029-1038]. In Study 2 (Table 1 a, 207 rats), 120 rats, treated with either Serp-1 CHO (60 rats) or saline (60 rats) mRNA levels of tPA, uPA, PAI-1 and uPAR were analyzed by semi-quantitative RT-PCR analysis in rat arteries at 0, 4, 12, and 24 hours and 10 days after angioplasty injury (12 rats / treatment group /time). A subset of 21 rats had arterial injury with Serp-1 (12 rats) or saline (9 rats) treatment for real time PCR analysis. A set of 30 rats treated with either saline, rat PAI-1 , SAA or Serp-1 CHO infusion was sacrificed at 12 hours. Thirty- six rats were sacrificed at 0, 12, and 24 hours after Serp-1 or saline infusion without angioplasty injury. In Study 3, 48 rats treated with either 30 ng Serp-1 CHO (6 rats) or saline (6 rats) were sacrificed at 0, 12, and 24 hours and 28 days after angioplasty for analysis of tPA and PAI-1 protein expression and enzyme activity (Table 1 a). All rats were maintained on a normal rat diet.

Mouse aortic allograft transplant model - A segmental 0.3 cm aortic isograft and allograft transplantation was performed [Miller, L.W., Dai, E., Nash, P., Liu, L., lcton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; J. Koulack, J., McAlister, V.C, Giacomantonio, C.A., Bitter-Suermann, H., MacDonald, A.S., Lee, T.D. (1995) Microsurgery. 16:110-113] using all combinations of Balb/c (PAI-1^+/+), C57B1/6 (PAI-1^{+ +}), and C57B1/6J (PAI-1^"'^"), mice and similarly C57B1/6 (uPAR-1^"'^"), to Balb/c (uPAR-1^+/+) (Table 1 b). Mice were purchased directly from Jackson Laboratories (Bar Harbour, Maine). Sharpoint 11/0 nylon sutures (Surgical Specialties Corporation, Reiding, Massachusetts) were used for end to end aortic anastomosis [Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1308].

Mouse femoral arterial wire injury model - A wire injury was performed in the femoral artery of 12 C57B1/6J PAI-1 ^"'^" mice and C57B1/6 PAI-1 ^+/+ mice while under general anesthetic. A 0.01 in. angioplasty guide wire (Medtronic Inc., Mississauga, ON, Canada) was introduced through a femoral arteriotomy, advanced to the level of the abdominal aorta and then withdrawn 3 times and removed. The site was then sealed with surgical glue, t?-butyl cyanoacrylate monomer (Nexaband Veterinary Products Laboratories, Phoenix, Arizona, U.S.A.), as previously described [Lucas, A., Dai, E., Liu, L., Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038; Liu, L.Y., Lalani, A., Dai, E., Seet, B., Macauley, C, Singh, R., Fan, L., McFadden, G., and Lucas, A. (2000) J. Clin. Invest. 105: 1613-1621 ] and the tissue layers at the cut down site closed by suture. Mice were given a single injection of Serp-1 (6 PAI-1^"'^" mice) or saline (6 PAI-1^"'^" mice and 6 PAI-1 ^+/+ mice) by intravenous injection immediately after vascular injury. Mice were then sacrificed the injured artery from the iliac bifurcation through the femoral arterial branch harvested for histological analysis at 4 weeks follow up. Table la Flow Chart for Rat ϊliofemoral Angioplasty Studies

Study 1 Study 2

S-l CHO (8 R) S-l CHO (60 R) S-l CHO (12 R) S-l CHO (6 R) S-l CHO (18 R) S-l VV(7R) (12R/time/ (3-4 R/time/ PAI-1 (6 R) (6 R/time/ SAA(6R). treatment) treatment) PAI-2C (12 R) treatment) SAA (6 R)

Ψ

4 weeks 0,4 I,12, 24 hrs 0, 14, or 24 hrs 12 hrs 0,1 I2, 24 hrs

Histological analysis Mo hometric analysis SQ SQ Q- Real time SQ Abbreviations - SD - Spragυe Da ley, SQ - - semi quantitative, RT-PCR, Q - quantitative real time RT-PCR, R- rats, S-l - Serp-1, hrs - hours, ds - days

Table 1 b:

Mouse Aortic Transplant Studies

Donor Mouse Recipient Mouse Treatment Number mic<

Iso^raft

Total - 16 mice

Balb/C (PAI-1^{+ +}) Balb/C (PAI-1^+/+) Saline 6

C57bl/6 (PAI-1^{+ +}) C57bl/6 (PAI-1^{+ +}) Saline 4

C57bl/6J (PAI-l^"'^") C57bl/6J (PAI-l^"'^") . Saline 6

Alloεjraft

Total - 61 mice

C57bl/6J (PAI-l"'^") Balb/C (PAI-1^{+ +}) Saline 5

Balb/C (PAI-1^{+ +}) Serp-1 500ng/g 6

Balb/C (PAI-1^{+ +}) C57bl/6J (PAI-r'^") Saline 6

C57bl/6J (PAI-l-⁷-) Serp-1 500ng/g 5

C57bl/6 (PAI-1^+/+) Saline 6

C57bl/6 (PAI-l⁺'⁺) Serp-1 500ng/g .6

C57bl/6 (PAI-l⁺'⁺) ^' C57bl/6J (PAI-1^"'^") Saline ^■ 6

Balb/C (PAI-r^/+) Saline 5

Balb/C (PAI-1^{+ +}) Serp-1 500ng/g 6.

C57bl/6 (uPAR^"'^") Balb/C (uPAR^+/+) ^■ Saline 5

Balb/C (uPAR^w+) Serp-1 500ng/g 5 Histological, Immunohistochemical, and Morphometric Analysis -

Arterial sections, 3.0 cm in length, were harvested from the distal abdominal aorta just proximal to the iliac bifurcation to the femoral branch from each rat in Study 1, cut into three 1.0 cm lengths, sectioned and stained with hematoxylin and eosin for morphometric analysis of plaque area [Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038]. Two 5 μm sections were cut and stained for each of the 3 arterial sections from each rat (a total of 6 sections was examined for each artery). Aortic transplant artery specimens or femoral arterial wire injured arterial specimens, 0.5-0.6 cm in length, from the mice were cut into two 0.25-0.3 cm long sections and two 5 μm sections were cut from each specimen for histological analysis. Morphometric analysis was used to measure plaque area, using sections with the largest detectable area, by means of the Empix Northern Eclipse trace application program (Empix Imaging Inc., Mississauga, Ontario, Canada) using a Sony Power HAD3CCD color video camera attached to the microscope and calibrated to the microscope objective [Lucas, A. R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19: 1029-1038]. The mean total cross sectional area of the intima was calculated for each arterial specimen using measurements from the pieces taken from each artery.

Cell Culture and Preparation -

Human umbilical vein endothelial cells (HUVEC, CC-2519 Clonetics, Walkersville, Maryland, passages 2-5), rat aortic smooth muscle cells (Passages 3-5) [Rocnik, E.F., Chan, B.M.O, Pickering, J.G. (1998) J. Clin. Invest. 101 : 1889-1898], or THP-1 cells (ATCC TIB 202) were incubated with saline or 4 ng/ml of Serp-1 , or SAA. Cells were also incubated with 20 μg/ml of anti-human antibodies to uPAR, α2 macroglobulin, or vitronectin, or various combinations of proteins and antibodies.

The human umbilical vein endothelial cell line (HUVEC, CC-2519 Clonetics, Walkersville, MD, U.S.A.) was cultured in EGM® bullet kit CC-3124 (clonetics) medium and isolated at passages 2-5 for all experiments. Rat aortic smooth muscle cells, collected at passages 3-5, were isolated and grown as previously described [Rocnik, E.F., Chan, B.M.O, Pickering, J.G. (1998) J. Clin. Invest. 101 : 1889-1898] in Medium 199 (Sigma, Oakville, Canada) with HEPES (25 mM), and L-glutamine (2 mM) (Gibco BRL, Burlington, Ontario, Canada). THP-1 cells (ATCC TIB 202) provided by Dr. M. Sandig (Department of Anatomy and Cell Biology, University of Western Ontario, London, Ontario, Canada) were cultured in RPMI 1640 medium (Gibco) with mercaptoethanol (2 X 10^"5 M). Cells were cultured with 10% fetal bovine serum (FBS), Penicillin (100 units/ml), and Streptomycin (100 μg/ml) (Gibco BRL). Medium was supplemented with 10% fetal bovine serum (FBS), Penicillin (s100 units/ml), and Streptomycin (100 μg/ml) (Gibco BRL).

Expression and Purification of Serp-1 and Serp-1 Chimeras -

Serp-1 CHO was purified from the supernatant of a recombinant Chinese hamster ovary (CHO) cell line (Biogen, Inc, Boston, MA) and Serp-1 W, and SAA, were harvested and purified from Buffalo green monkey kidney (BGMK) cell supematants as previously described [Nash, P., Whitty, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol. Chem. 273:20982-20991 ; Lucas, A.R., Liu, LY., Macen, J., Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038]. SAA was prepared by mutating the Serp-1 P1 -P1 ' active site (R-N) to an A-A sequence as' previously reported [Nash, P., Whitty, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol. Chem. 273:20982-20991 ; Lucas, A.R., Liu, LY., Macen, J., Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890- 2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598- 1605; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19: 1029-1038]. Serp-1 , or SAA proteins were more than 95% pure as judged by overloaded Coomassie stained SDS-PAGE gels and a single peak on reverse-phase HPLC [Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation., 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038]. Analysis of Gene Expression - Reverse Transcriptase and Northern Blot Analysis -

Total RNA was isolated from tissue and cells for (RT-PCR) analysis using TRIzol Reagent (Gibco BRL) [Sestini, R., Orlandoo, C, Zentilin, L., Lami, D., Gelmini, S., Pinzani, P., Giacca, M., Pazzagli, M. (1995) Clin. Chem.41 :826-832]. Preliminary experiments demonstrated that the amount of tP A, uPA, PAI-1 , uPAR, PARs 1-4, and β-actin cDNA (PCR products) reached plateau levels over 36-38 cycles of reaction and were therefor co-amplified using 32 cycles with β-actin as an internal standard (PTC-100 Programmable Thermal Controller, MJ Research, Watertown, Mass, U.S.A.) [Gladson, C.L., Stewart, J.E., Olman, M.A., Chang, P.-L., Schnapp, L.M., Grammar, J.R., Benveniste, E.N. (2000) Neuroscience Lett. 283:157-161 ; Yamamoto, M., Ikeda, K., Ohshima, K., Tsugu, H., Kimura, H., Tomonaga, M. (1997) Cancer Res. 57:2799-2805]. tPA, uPA, PAI-1 , uPAR, PARs 1-4, and β- actin cDNA (PCR products) were measured using a densitometer (BIO-RAD Gel doc 1000, Mississauga, Canada) and expressed as a ratio to β-actin (PTC-100 Programmable Thermal Controller, MJ Research, Watertown, Massachusetts) [Sestini, R., Orlandoo, C, Zentilin, L, Lami, D., Gelmini, S., Pinzani, P., Giacca, M., Pazzagli, M. (1995) Clin. Chem. 41 :826-832; S.A. Bustin, S.A. (2000) J. Mol. Endocrin. 25:169-193]. Primers are shown in Table 2. Real time PCR was performed as described using SYBR green dye and AmpliTaq Gold DNA polymerase in an ABI Prism 7900HT Sequence Detection System (AB Applied Biosystems, Warrington, UK, 39). RT-PCR products were verified by sequencing cDNA from the gel band (Gel Extraction Kit, Qiagen, Mississauga, ON, Canada) with an ABI 377 automated sequencer (PE Applied Biosystems Inc., Mississauga, ON, Canada). Northern blot analysis was carried out by the chemiluminescence method [Barka, T., van der Noen, H. (1993) J. Histochem. Cytochem. 41 :1863- 1867].

RNA detection (30 μg from HUVEC cultures treated with control protein or Serp-1 ) in the Northern blot was carried out by the chemiluminescence method as previously described [Manejwala, F.M., Logan, C.Y., and Schultz, R.M. (1991) Dev. Biol.144:301-308; Nagai, N., DeMol, M., Lijnen, H.R., Carmeliet, P., Collen, D. (1999) Circulation.99:2440-2444] using chemiluminescent substrate CSPD (Disodium 3-(4-methoxyspiro{1 ,2-dioxetane-3,2'-(5'- chloro)tricyclo[3.3.1.1^3,7]decan}-4-yl) phenyl phosphate (Boehringer Mannheimn; 0.25 mM final concentration), and exposed to Kodak XAR-5 film (Sigma, Steinheim, Germany) for 20 minutes at room temperature. Each membrane was probed first for PAI-1 and then stripped and re-probed with β-actin or tRNA.

Western Blot and Enzyme Activity Assay -

Arterial sections, from balloon injured rat iliofemoral branches at designated time points (0,4, 24 hours and 30 days) after Serp-1 or saline control treatment, were used for the enzyme activity assays and for Western blot analysis [Sawa, H., Sobel, B.E., Fujii, S. (1993) Circ. Res. 73:671-680]. Arterial sections were homogenized on ice in 20 mM Tris HCI, 125 mM NaCI buffer, pH 7.4 containing 100 μg/ml phenylmethylsulfonyl fluoride (PMSF) and 10 μg/ml leupeptin proteinase inhibitor (Sigma, Oakville, Ontario, Canada). Protein concentrations for each sample tested were measured by colorimetric assay (Bio-Rad, Mississauga, Ontario, Canada). For Western analysis, after blocking nonspecific binding sites with blocking solution (5% skim milk, 3% BSA and 0.1% Tween 20 in PBS) overnight at 4°C, blots were incubated with 1 :800 dilution of rabbit anti-rat PAI-1, or rabbit anti-rat tPA (American Diagnostics), followed by a 1:100,000 dilution of a monoclonal anti-rabbit IgG (Alkaline phosphatase conjugate, Sigma). The color reaction was performed (Bio-Rad Mississauga, Canada) using 5-bromo -4 chloro - 3 indoyl; phosphate/nitro blue tetrazolium (BCIP/NBT) liquid.

TPA and uPA activity were measured by chromogenic assay (American Diagnostics, Inc.), using des-aa-fibrinogen substrate (5 mg/ml. DESAFIB®,

Table 2. Primers for RT-PCR Analysis

Target gene Primers Length rat PAI-1: 5'- - AGTCTTTCCGACCAAGAGCA,

3'- CCAGTTTTGTCCCAAAGGAA 273bp rat tP : 5'- -GGCCTGAGGCAATACAAACA,

3'- -ATAGCACCCAGCAGGAACTG 168bp rat uPAR: 5'- -GGAACAGCACCTTTGGATGT,

3'- -CAGGGAGGCAATGAGGATAA 296bp mouse β-actin: 5'- -CGTGACATCAAAGAGAAGCTGTGC,

3'- - GCTCAGGAGGAGCAATGATCTTGAT 376bp human PAI-1: 5'- ■GTCTGCTGTGCACCATCCCCCATC,

3'- -TTGTCATCAATCTTGAATCCCATA 212bp human PAR- 1 5' CTCGTCCTCAAGGAGCAAAC 294bp

3' AATCAGGAGGACGTTTGTGG human PAR-2 5' TCTCTGTCATCTGGTTCCCC 285bp

3' TGAAGATGGTCTGCTTCACG human PAR-3 5' GAGCTGAAGTCACCTGGGAG 2.68bp

3' AGCTGGAAGAGGACTGGTCA human PAR-4 5' CAGGAGACTGAGGCAGAAGG 271bp

3' GAGATGGGATCCCCCTATGT American Diaganostics, Inc.), and incubated for 75 minutes at 37°C Plasmin activity was determined by analyzing absorbance at 405 nm on an automated microplate reader (Bio-Rad). For the PAI-1 assay arterial extracts were mixed with 100 μl tPA substrate (American Diagnostics, Inc.) And PAI-1 activity subsequently measured as above using the des-aa-fibrinogen substrate reaction and absorbance at 405 nm.

Statistics -

Mean plaque area for individual animals was used for statistical analyses. Plaque area, enzyme activity, and RT-PCR ratios were assessed by Student's T test and Analysis of Variance (ANOVA) and unpaired Student's T test. RT-PCR densitometry ratios were compared by paired T test and ANOVA. A p value less than 0.05 was considered significant.

Results:

Plaque growth is reduced after vascular angioplasty injury by Serp-1 infusion -

To extend the generality of prior studies in rabbit angioplasty [Lucas, A.R., Liu, LY., Macen, J., Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900] and rat allograft transplant models [Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029- 1038], we tested Serp-1 efficacy for plaque inhibition in a rat angioplasty injury model. Fig. 1 A illustrates the plaque growth detected at 28 days follow up after infusion of control SAA (a catalytically inactive variant of Serp-1 ) was significantly greater than that following active Serp-1 infusion (Fig. 1 B). The arrows in Fig. 1A indicate limits of intimal plaque growth, magnification 50X. The infusion dose given (30 ng per animal) was comparable to prior animal model studies [Lucas, A.R., Liu, LY., Macen, J., Nash, P., Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038]. With reference to Fig. 1 C, Serp-1 expressed eitherfrom recombinant CHO cells (Serp- 1 CHO) or Serp-1 isolated from a vaccinia recombinant (Serp-1 W) inhibited plaque growth to the same extent when compared to the inactive SAA reactive site construct (p<0.016), or saline (Fig. 1 C) indicating that Serp-1 inhibition of plaque growth is mediated through serpin activity. The bar graph of mean plaque area ± S.E. for each treatment group of Fig. 1 C demonstrates similar and significant reductions (p<0.05) in plaque area after treatment with Serp-1 W or Serp-1 CHO when compared to the SAA mutant. Areas of intimal hyperplasia at 4 weeks post injury were predominantly composed of smooth muscle cells with occasional hemosiderin laden macrophages, as is characteristic of the rat arterial angioplasty injury model (Fig. 1 B) [Lucas, A., Dai, E., Liu, L., Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038]. Thrombosis was only seen occasionally in all groups with no significant difference detected for any of the treatments tested.

Altered serine proteinase and serpin expression following rat angioplasty injury -

Semi-quantitative and real time RT-PCR analysis of rat arterial sections -

Altered gene expression after Serp-1 treatment was analyzed in rat arteries using a balloon-induced vascular angioplasty injury model. Semi-quantitative RT-PCR analysis demonstrated significant changes in mRNA expression in the rat arterial wall at early time points after angioplasty injury and Serp-1 infusion when compared to saline control treatment (p<0.01). A time course of mRNA expression in representative arterial isolates after balloon angioplasty injury and treatment with either saline control or Serp-1 is shown in Fig. 2. A significant reduction in mRNA for tPA (Fig. 2A, lanes 2-9) and a relative increase in both PAI-1 (Fig.2B, lanes 2-9) and uPAR (Fig. 2C, lanes 2-9) at 4-12 hours after injury were detected in arterial isolates after Serp-1 treatment on comparison with the saline control treated arteries after injury (p<0.01 ). Real time PCR analysis confirmed similar significant changes in tPA (Fig. 2D), PAI-1 (Fig. 2E) and uPAR (Fig. 2F) mRNA expression after angioplasty injury at 4 to 24 hours. No significant change in uPAwas detected after injury plus treatment with Serp-1 (not shown).

Saline control treated rat arteries following injury had significant increases in the levels of mRNA expression for tPA (p<0.013) and uPAR (p<0.0006), but not PAI- 1 , at selected time points after angioplasty injury when compared to the baseline (0 hour) time point (Fig. 2D-2F). SAA control treatment of rat arteries after angioplasty injury had no effect on PAI-1 mRNA levels in the rat artery compared to Serp-1 treatment (Fig. 2G, lanes 1-3). Treatment of rats with PAI-1 at equivalent, or 10 fold higher, doses to Serp-1 infusion, also had no detected significant effect on PAI-1 up-regulation (Fig.2G, lanes 4,5). Normal, non-injured rat ilio-femoral arterial branches had no demonstrated change in expression of PAI-1 (Fig. 2H, lanes 2-7), tPA (not shown) or uPAR (not shown) after treatment with Serp-1.

In a separate series, the protein levels and enzyme activity for tPA and PAI-1 in the rat ilio-femoral arterial wall were directly measured after angioplasty and Serp- 1 or control treatment. A marked reduction in the tPA levels, as detected both by immunohistochemical analysis and Western blot analysis (data not shown), was observed following Serp-1 treatment. A significant attenuation in tPA enzyme activity increase following injury was also detected in Serp-1 treated rat arteries by 24 hours after angioplasty injury (p<0.01 ). PAI-1 inhibitory activity was reduced during the same time frame, and this reduction was attenuated by Serp-1 treatment (p<0.01).

Analysis of plasminogen activator and inhibitor expression in cell culture:

The effect of Serp-1 treatment on selected cell lines was examined by RT-PCR analysis of several select genes in the host serpin pathway with potential Serp-1 regulation. PAI-1 mRNA was significantly increased (p<0.05) in HUVEC cultures after incubation with Serp-1 when compared to saline controls (Fig. 3A). Serp-1 treatment produced an increase in PAI-1 mRNA starting at 4 hours post treatment (lanes 4,5), a time frame similar to that observed for the increase in PAI-1 detected in angioplasty injured rat arteries with Serp-1 treatment. In contrast, Serp-1 had no effect on PAI-1 expression in smooth muscle (Fig. 3B, lanes 4,5) or THP-1 monocytic cell cultures (data not shown). Serp-1 also had no effect on tPA, uPA (not shown), protease activated receptors 1 - 4 (PARs1-4, not shown), or uPAR mRNA expression as measured by RT-PCR analysis in cell lines tested (Fig. 3B, lanes 2,3,6,7). To further confirm this finding, PAI-1 mRNA was also assessed at 24 hours after Serp-1 treatment using Northern blot analysis. Serp-1 , but not saline, PAI-1 or SAA (not shown), again significantly increased levels of PAI-1 mRNA on Northern blot analysis.

Inhibition of HUVEC responses to Serp-1 with antibodies to uPAR and vitronectin -

Addition of uPAR or vitronectin blocking antibodies alone to HUVEC cultures had no effect on PAI-1 mRNA levels (Fig. 3C, lanes 4,6). When antibody to either the uPA receptor or vitronectin was given during Serp-1 treatment of HUVEC cultures, however, the up-regulation of PAI-1 mRNA produced by Serp-1 treatment was partially attenuated (Fig. 3C, lanes 2,3,5,7). Treatment of HUVEC cells with both antibodies together completely prevented the Serp-1 mediated increase in PAI-1 mRNA (lane 8). Treatment with antibody to α2-macroglobulin had no effect on Serp-1 induced up-regulation of PAI-1 expression (not shown). Based on these results, we examined whether PAI-1 or uPAR might play a role in mediating the anti-inflammatory properties of Serp-1 in knockout mouse models.

Treatment of PAI-1 deficient mouse strains with Serp-1 after vascular -

Based upon changes in gene expression in rat arteries detected with Serp-1 infusion after angioplasty injury, we tested Serp-1 for inhibition of plaque growth after aortic allograft transplant in mouse models deficient for PAI-1 and uPAR. The aortic allograft transplant model provides a model of chronic rejection with a marked vascular inflammatory response.

Isograft aortic transplants in PAI-1 deficient (PAl- *^') mice -

Aortic sections from isograft transplants in Balb/c (Fig.4A) and C57B1/6 (Fig. 4B) mice with normal PAI-1 expression had only small areas of intimal hyperplasia 4 weeks after transplant. In contrast, PAI-1 deficient mouse aortic isografts had larger areas of plaque development (Fig. 4C). Morphometric analysis of plaque area demonstrated a significant increase in plaque area in the PAI-1^"'^" isografts when compared to either mouse strains expressing PAI-1 (p<0.02 for C57B1/6 and p<0.04 for Balb/c mice) (Fig. 4D). Serp-1 treatment significantly inhibited plaque growth in the PAI-1^"'^" isograft transplants (p<0.025) indicating that up- regulated arterial PAI-1 expression is not needed to block inflammatory responses and plaque growth (Fig. 4D), although up-regulation of PAI-1 expression might provide additive inhibitory activity. Allograft aortic transplants in PAI-1^''^' mice -

Aortic allograft transplants also demonstrated increased plaque development when compared to the isografts (Fig. 4E-4J). Transplants using PAI-1^"'^" mice as either the donor (Fig. 4E, 41) or recipient (Fig. 4F, 4J) had larger areas of plaque development when compared to the isografts. When compared to aortic allografts from mice where both the donor and the recipient expressed PAI-1 (PAI- 1^{+ +})(p<0.04 for C57BL/6 to Balb/c when compared to C57B1/6J to Balb/c and p<0.06for Balb/c to C57B1/6 when compared to Balb/c to C57B1/6J) plaque area was increased for the PAI-1 deficient mice (Fig. 41, 4J). Of interest was the finding that when the aorta from PAI-1^"'^" mice was used for the donor transplant aortic arterial segment, the plaque area was larger, although not significant (p<0.093), than when the PAI-1^"'^" mouse was the recipient (Figs. 41, 4J), suggesting a greater local effect of aortic serpin expression on transplant vasculopathy development.

Serp-1 infusion after aortic allograft transplant in PAI-1^'1' deficient mice - Serp-1 treatment reduced plaque area significantly in C57B1 /6J (PAI-1 ^"'^") to Balb/c (PAI-1 ^+/+) aortic allograft transplants where the donor aortic section was isolated from the PAI-1^"'^" mouse (Fig. 4G, 41, p<0.0008), and in Balb/c to C57B1/6J mice (Fig. 4H, 4J, p=0.051 ), where the PAI-1^"'^" mouse was the recipient. Serp-1 reduced mean plaque sizes to the range of plaque sizes observed for isograft transplants. Serp-1 treatment also showed a trend toward reducing plaque growth after aortic allograft transplant in PAI-1^+/+ mouse models (C57B1/6 to Balb/c, p=0.143 and Balb/c to C57B1/6, p=0.057), but this did not reach significance (Fig. 41, 4J). We conclude that Serp-1 retains the ability to mediate plaque reduction even in the absence of PAI-1 in either the donor or recipient mouse aorta.

Serp-1 infusion after femoral arterial wire injury in PAI-1^'1' deficient mice - A significant increase in plaque area was seen in the PAI-1 deficient mice when compared to normal PAI-1 expressing C57B1/6 mice after wire injury. Serp-1 treatment reduced the excess plaque area in the PAI-1 deficient mice as follows: plaque area - saline treated C57B1/6 PAI-1 ⁺'⁺ mice - 0.002 ±0.0009 mm², saline treated C57B1/6J PAI-1 ^"'^" mice -0.028±0.022 mm2, Serp-1 treated C57B1/6J PAI- 1^"'^" mice - 0.00009 ±0.00004 mm², p<0.05). This work indicates that Serp-1 is capable of preventing the increase in plaque seen in mice lacking PAI-1 , both in models of aortic allograft transplant and in this second model of mechanical, wire induced arterial injury.

Serp-1 infusion after aortic allograft transplant from uPAR deficient mice -

The transplant of aortic allograft segments from uPAR deficient (uPAR^"'^") mice into Balb/c mice had no effect on generalized plaque growth when compared to uPAR^+/+ C57B1/6 to Balb/c aortic transplant (Fig. 4K, 4L, p=0.121 ). Treatment of the uPAR^"'^" aortic transplant with Serp-1 at doses proven to inhibit plaque growth in the PAI-1^"'^" mouse model no longer blocked plaque growth (Fig. 4L, 4M) (p=0.85), indicating that Serp-1 inhibits plaque growth through mechanisms dependent, at least in part, on the uPAR complex. Thus, Serp-1 targets serine proteinases which utilize uPAR on cells found in the donor transplanted tissue.

DISCUSSION:

Serp-1 treatment following vascular injury reduces vascular serine proteinase (tPA) expression and induces increased vascular uPAR and serpin (PAI-1 ) expression levels in the injured arterial wall. In addition, Serp-1 up-regulates expression of PAI-1 in human endothelial cells (HUVEC), specifically through signalling that is dependent upon the uPA receptor and vitronectin. Based upon these findings we assessed the role of PAI-1 and the uPA receptor in Serp-1 mediated inhibition of inflammation [Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Stewart, M., Graham, K., Etches, W., Boshkov, L, Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L, Icton, C, Klironomos, D., Fan, L, Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038] in mouse models of aortic transplant. Significantly, we detected inhibition of plaque growth with Serp-1 treatment in PAI-1 deficient, but not in uPAR deficient, mouse strains. Serp-1 thus successfully exploits the mammalian cellular uPA receptor to alter expression of a key arterial regulator, PAI-1 , and to regulate inflammatory cell responses and plaque growth in the arterial wall [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med. 8,175-180; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L., Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Cell. Biol.134: 1563-1571 ; Silverman, G.A., Bird, P. I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, D.A., Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem. 276:33293-33296; Zalai, C.V., Nash, P., Dai, E., Liu, L., Lucas, A. (2001) Cardiovascular Plaque Rupture, Brown DL (Editor), Marcel Dekker, Inc., New York, 2001 (In Press); Reidy, M.A., Irvin, C, Lindner, V. (1996) Circ. Res. 78, 405-414; Stefansson, S. and Lawrence, D.A. (1996) Nature 383:441-443; Carmeliet, P., and Colen, D. (1995) FASEB J. 9:934-938]. This study provides a definitive demonstration of a viral serpin acting to alter cellular expression and regulation of a host proteinase / receptor system.

Serp-1 mediated up-regulation of PAI-1 was unexpected, but has the potential to amplify inhibition of uPA / uPAR complex mediated cellular invasion in accelerated inflammatory responses. The altered expression of host vascular plasminogen activators and inhibitors is observed beginning as early as 4 hours after Serp-1 treatment, suggesting that this amplification of host mediated regulatory activity plays a role in subsequent anti-inflammatory and anti- atherogenic activity of Serp-1 (Fig. 2). Our finding that Serp-1 blocked plaque growth in the PAI-1 knockout isografts and after wire injury in PAI-1 deficient mice indicated, however, that Serp-1 anti-inflammatory activity does not depend on increased expression of PAI-1 (Fig. 4D). Increased expression of PAI-1 and uPAR have been previously reported after vascular injury [Hasenstab, D., Forough, R., Clowes, A.W. (1997) Circ. Res. 80:490-496; Strauss, B.H., Lau, H.K., Bowman, K.A., Sparkes, J., Chisholm, R.J., Garvey, M.B., Fenkell, L.L., Natarajan, M.K. Singh, I., Teitel, J.M. (1999) Circulation. 100:1616-1622; Nagai, N., De Mol, M., Lijnen, H.R., Carmeliet, P., Collen, D. (1999) Circulation. 99:2440- 2444] and also after injury of other organ systems [Nagai, N., De Mol, M., Lijnen, H.R., Carmeliet, P., Collen, D. (1999) Circulation. 99:2440-2444; T. Saxne, I. Lecander, P. Geborek, J. Rheumatol. 20, 91 (1993)] or invasive carcinoma [Gladson, CL., Stewart, J.E., Olman, M.A., Chang, P.-L, Schnapp, L.M., Grammar, J.R., Benveniste, E.N. (2000) Neuroscience Lett. 283: 157-161 ; Yamamoto, M., Ikeda, K., Ohshima, K., Tsugu, H., Kimura, H., Tomonaga, M. (1997) Cancer Res. 57:2799-2805]. Our work demonstrates similar increases in control saline treated animals, but comparison of Serp-1 treated specimens with the saline controls at each time point detected significant alternations in tPA and uPAR gene expression that were greater than the changes in gene expression observed after injury alone.

Dysregulated expression of PAI-1 and tPA induced by Serp-1 is consistent with a reduction in inflammation and cellular invasion, as mediated by the uPA/ uPAR receptor complex. The inability of the biochemically inactive Serp-1 mutant, SAA, or PAI-1 itself to up-regulate PAI-1 gene expression suggests that this was not a non-specific reaction to local arterial injury. The finding that Serp-1 altered PAI-1 and uPAR expression, but not expression of protease activated receptors, PAR'S 1 to 3 (the main thrombin receptors), suggests that Serp-1 activity is specifically mediated through the cell surface uPA / uPAR system, and not circulating thrombin or the clotting cascade. Also, the ability of Serp-1 to trigger similar effects in human endothelial cells is of great significance and suggests that Serp- 1 triggers a non-species specific response in the arterial wall that is a conserved regulatory mechanism. The inhibition of PAI-1 increase by the combined action of blocking antibodies to uPAR and vitronectin is also consistent with mediation of Serp-1 anti-inflammatory activity through the uPA / uPAR system. Vitronectin is known to bind the uPA / uPAR / PAI-1 complex and thereby enhance PAI-1 inhibitory activity [Stefansson, S., Muhammad, S., Cheng, X.F., Battey, F.D., Strickland, D.K., Lawrence, D.A. (1998) J. Biol. Chem. 273:6358-6366; Stoop, A.A., Lupu, F., Pannekoek, H. (2000) Arterioscler. Thromb. Base. Biol. 20:1143- 1149; J. Koulack, J., McAlister, V.C Giacomantonio, C.A., Bitter-Suermann, H., MacDonald, A.S., Lee, T.D. (1995) Microsurgery. 16:10-113; Gladson, C.L., Stewart, J.E., Olman, M.A., Chang, P.-L., Schnapp, L.M., Grammar, J.R., Benveniste, E.N. (2000) Neuroscience Lett. 283:157-161]. The mechanism for the increase in uPAR expression in the arterial wall by Serp-1 remains to be explained, but is likely to be of functional significance closely linked to the inflammatory process, as well as acting on clot regulatory systems to prevent excessive vascular thrombosis. The pro-inflammatory cytokines, such as tumour necrosis factor (TNF), up-regulate tPA and PAI-1 expression [Blasi, F. (1997) Trends Immunol. Today. 18:415-417; Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med. 8,175-80; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L, Vassalli, J.D. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg, S., Loskutoff, D.J. (1996) J. Ceil. Biol. 134:1563-1571 ; Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas, D.A., Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen, G.S., Travis, J., Whisstock, J.C. (2001 ) J. Biol. Chem. 276:33293-33296; Zalai, C.V., Nash, P., Dai, E., Liu, L., Lucas, A. (2001 ) Cardiovascular Plaque Rupture, Brown DL (Editor), Marcel Dekker, Inc., New York 2001 (In Press); Reidy, M.A., Irvin, C, Lindner, V. (1996) Circ. Res. 78, 405-414; Chang, A.W., Kuo, A., Barnathan, E.S., and Okada, S.S. (1998) Arterioscler. Thromb. Vase. Biol. 18:1855-1860; Chavakis. T., Kanse, S.M., Yutzy, B., Lijnen, H.R., Preissner, K.T. (1998) Blood. 91 , 2305-2312; Carmeliet, P., Schoonjans, L., Kieckans, L., Ream, B., Degen, J., Bronson, R., De Vos, R., van den Oord, J.J., Collen, D., Mulligen, R.C. (1994) Nature. 368,419-424]. In turn, the plasminogen activators and plasmin proteolytically activate 'pro-forms' of the matrix metalloproteinase enzymes (MMPs) to their active state, which serves to accelerate the break down of connective tissue and allows cellular invasion at sites of injury and inflammation. The 'pro-form' of TACE, the TNF activator is similarly activated by plasminogen activators [Ross, R. (1999) N. Engl. J.Med. 340,115-126; Blasi, F. (1997) Trends Immunol. Today. 18:415-417 Stefansson, S., Haudenschild, C.C, Lawrence, D.A. (1998) Trends Card. Med 8,175-80; Estreicher, A., Muhlhauser, J., Carpentier, J.L., Orci, L, Vassalli, J. (1990) J. Cell. Biol. 111 ,783-792; Deng, G., Curridan, S., Wang, S., Rosenberg S., Loskutoff, D.J. (1996) J. Cell.Biol.134:1563-1571 ; Silverman, G.A., Bird, P.I. Carrell, R.W., Church, F.D., Coughlin, P.B., Gettins, P.G.W., Irving, J.A., Lomas D.A., Luke, C.J., Moyer, R.W., Pemberton, P.A., Remold-O'Donnell, E., Salvesen G.S., Travis, J., Whisstock, J.C. (2001) J. Biol. Chem.276:33293-33296 Carmeliet, P., Schoonjans, L., Kieckans, L., Ream, B., Degen, J., Bronson, R., De Vos, R., van den Oord, J.J., Collen, D., Mulilgen, R.C. (1994) Nature. 368,419- 424]. Transforming growth factor beta (TGFβ), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF) are all activated by serine proteinase enzymes in the thrombolytic cascade (specifically, the plasminogen activators).

Correlation has recently been demonstrated between early inflammatory activity secondary to surgical injury and ischemia and with late transplant vasculopathy development [Yamamoto, M., Ikeda, K., Ohshima, K., Tsugu, H., Kimura H, Tomonaga, M. (1997) Cancer Res. 57:2799-2805; McMahon, G.A., Petitclerc, E., Steffansson, S., Smith, E., Wong, M.K.K., Westrick, R.J., Ginsburg, D., Brooks, P.C., Lawrence, D.A. (2001 ) J. Biol. Chem. 276:33964-33968; Miller, L, Kobashigawa, J., Valantine, H., Ventura, H., Hauptman, P., O'Donnel, J., Wiedermann, J., Yeung, A. (1995) J. Heart Lung Transplant. 14:S227-S234; Hayry, P. Myllamiemi, M., Aavik E. (1996) Transplantation Proc. 28:2337-2338]. The angioplasty injury model provides a model for assay of serpin effects on simple mechanical (balloon mediated) vascular injury. These results then established a basis for examining inflammatory mechanisms for inhibitory effects of Serp-1 on vascular injury and plaque growth after transplant [Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101:1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001 ) Transplant. 72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038] using mouse knock out models. Transplant is associated with a very vigorous inflammatory response, providing a challenging system for testing serpin mediated anti-inflammatory activity. Of further interest is the apparent greater plaque inhibitory activity of Serp-1 when given to mice with aortic transplants lacking PAI-1 (PAI-1 ^" ' ^" donor aorta, Fig. 4) when compared to transplant of PAI-1 expressing aorta into a PAI-1 deficient (PAI-1 ^" ' ^" recipient mouse aorta). In line witih this observation was the fact that plaque area in the transplanted artery was larger when the donor aorta lacked PAI-1 expression. Surprisingly serpin mediated reductions plaque development would appear to have more profound local effects, intrinsic to the transplanted arterial wall, rather than a generalized or systemic effect. Further confirmation of this observation will require further study.

Viral immunomodulating factors such as Serp-1 are believed to mimic mammalian cell factors, targeting central regulatory activities in the immune and inflammatory systems [Turner, P.C. and Moyer, R.W. (2001) Am. Soc. Microbiol. News.67:201- XXX; Upton, C, Macen, J.L, Wishart, D.S., McFadden, G., (1990) Virology. 170:618-631 ; Nash, P., Whity, A., Handwerker, J., Macen, J., McFadden, G. (1998) J. Biol. Chem. 273: 20982-20991 ; Lucas, A.R., Liu, LY., Macen, J., Nash, P, Dai, E., Steward, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Hausen, B., Boeke, K., Berry, G.J., Morris, R.E. (2001) Transplant.72:364-368; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L. (2000) J. Heart Lung Transplant. 19:1029-1038]. The lack of Serp-1 anti-atherogenic activity in the uPAR^'7' mouse aortic transplant model provides excellent confirmation for the necessity of the uPA receptor for Serp-1 mediated anti-inflammatory activity. This finding was in marked contrast to the capacity of Serp-1 to reduce plaque growth in the PAI-1^"'^" aortic allograft and isograft transplants. Analysis of the pathways through which viral serpins, and specifically Serp-1 , block inflammatory responses and intimal hyperplasia after vascular injury will define serpin regulated inflammatory responses to vascular injury. Viral cytokine and cytokine receptor mimicking proteins (termed virokines and viroceptors) provide highly effective inhibitors that block inflammatory responses at very low concentrations, estimated at picomolar to nanomolar amounts [Lucas, A. R., Liu, LY., Macen, J., Nash, P, Dai, E., Steward, M., Graham, K., Etches, W., Boshkov, L., Nation, P.N., Lundstrom Hobman, M., McFadden, G. (1996) Circulation. 94:2890-2900; Miller, L.W., Dai, E., Nash, P., Liu, L., Icton, C, Klironomos, D., Fan, L., Nations, P.N., Zhong, R., McFadden, G., Lucas, A. (2000) Circulation. 101 :1598-1605; Lucas, A., Dai, E., Liu, L, Guan, H., Nash, P., McFadden, G., Miller, L (2000) J. Heart Lung Transplant. 19:1029-1038; Bot, I., von der Thusen, J.H., Lucas, A., Donners, M.M.C, Heeneman, S., Fekkes, M.L., Kuper, J., Daemen, M.J.A.P., van Berkel, T., Biessen, E.A.L. in preclinical evaluation of Gene Therapeutic approaches to Atherosclerosis editor J van der Thusen (In Press 2002)]. The extraordinary efficacy of these inhibitors at low pharmacological concentrations is predicted to provide new insights into central regulatory mechanisms in the inflammatory cascades.

Claims

CLAIMS:

1. A pharmaceutical composition containing at least one compound that promotes intracellular signalling via the human urokinase plasminogen activator receptor.

2. The pharmaceutical composition of claim 1 , wherein said compound binds the human urokinase plasminogen activator receptor.

3. The pharmaceutical composition of claim 1 , wherein said compound binds one or more intracellular protein(s) directly or indirectly associated with intracellular signalling via human urokinase plasminogen activator receptor.

4. The pharmaceutical composition of claim 1 , wherein said compound binds one or more intracellular protein(s) that are modulated by urokinase plasminogen activator receptor activity.

5. The pharmaceutical composition of claim 1 , wherein said compound is an organic or inorganic compound with a molecular weight less than 1kDa.

6. The pharmaceutical composition of claim 1 , wherein said compound is a peptide between 2 and 20 amino acids in length.

7. The pharmaceutical composition of claim 1 , wherein said compound is a polypeptide greater than 20 amino acids in length.

8. The pharmaceutical composition of claim 1 , wherein said compound is an antibody or fragment thereof.

9. The pharmaceutical composition of claim 1 , wherein said compound is a nucleic acid.

10. The pharmaceutical composition of claim 1 , wherein said compound is administered to humans in vivo.

11. The pharmaceutical composition of claim 1 , wherein said compound is administered to human cells ex vivo.

12. The pharmaceutical composition of claim 1 , wherein said composition includes a pharmaceutically acceptable carrier.

13. The pharmaceutical composition of claim 1 , wherein said composition is administered to a human individual for the treatment of an inflammatory condition.

14. The pharmaceutical composition of claim 13, wherein said composition is administered prior to the onset of said inflammatory condition.

15. The pharmaceutical composition of claim 13, wherein said composition is administered to reverse the onset of said inflammatory condition.

16. The pharmaceutical composition of claim 13, wherein said composition is administered in combination with one or more agents.

17. The pharmaceutical composition of claim 16, wherein said agent is an anti- inflammatory agent.

18. The pharmaceutical composition of claim 16, wherein said agent is an anti- immune agent.

19. The pharmaceutical composition of claim 13, wherein said inflammatory condition is selected from the group consisting of asthma, coronary restenosis, cirrhosis, endotoxemia, atherosclerosis, and reperfusion injury, unstable angina, type 1 insulin-dependent diabetes mellitus, inflammatory bowel disease, dermatitis, meningitis, thrombotic thrombocytopenic purpura, Sjόgren's syndrome, encephalitis, uveitis, leukocyte adhesion deficiency, rheumatoid and otherforms of immune arthritis, rheumatic fever, Reiter's syndrome, psoriatic arthritis, progressive systemic sclerosis, primary biliary cirrhosis, pemphigus, pemphigoid, necrotizing vasculitis, myasthenia gravis, multiple sclerosis, lupus erythematosus, polymyositis, sarcoidosis, granulomatosis, vasculitis, pernicious anemia, CNS inflammatory disorder, antigen-antibody complex mediated diseases, autoimmune hemolytic anemia, Hashimoto's thyroiditis, Graves disease, habitual spontaneous abortions, Reynard's syndrome, glomerulonephritis, dermatomyositis, chronic active hepatitis, celiac disease, autoimmune complications of AIDS, atrophic gastritis, ankylosing spondylitis, trauma, transplant vascular disease, Addison's disease and transplant rejection.

20. The composition of claim 1 , wherein said compound is SERP-1.