WO2004038043A2

WO2004038043A2 - POLYMORPHISM IN THE Per3 GENE AS A INDICATOR IN THE DIAGNOSIS AND TREATMENT OF CIRCADIAN RHYTHM SLEEP DISORDERS

Info

Publication number: WO2004038043A2
Application number: PCT/GB2003/004602
Authority: WO
Inventors: Simon Archer; Malcolm Von Schantz; Josephine Arendt
Original assignee: University Of Surrey
Priority date: 2002-10-25
Filing date: 2003-10-24
Publication date: 2004-05-06
Also published as: AU2003278333A8; WO2004038043A3; AU2003278333A1

Abstract

The invention relates to a polymorphism in the Per3 gene and to uses of that polymorphism to detect and treat extreme diurnal preference disorders.

Description

Polymorphism

The invention relates to a polymorphism in the Per3 gene and to uses of that polymorphism to detect and treat extreme diurnal preference disorders. In particular it relates to the diagnosis and treatment of Delayed Sleep Phase Syndrome (DSPS).

Circadian rhythms are generated by organisms to allow them to anticipate the predictable variation which occur in their environment during the day and night cycle. Each individual has a specific circadian period <tau> which is close, but rarely identical to 24 hours. Circadian rhythms are controlled by clock genes. Circadian clock genes are involved in feedback loops that control both their own production as well as those of clock-controlled genes. Polymorphisms in a number of these core clock genes have been shown to alter circadian parameters, including the sleep-wake cycle. The period (PER) gene family is a central component of the circadian molecular machinery, providing negative auto-feedback on its own expression. Per transcripts and PER proteins oscillate with a period length identical to the observed <tau>. PER proteins dimerise with themselves and other clock proteins (cryptochromes), enabling them to undergo nuclear translocation where they are able to suppress their own expression. Phosphorylation targets PER for degradation imposing a rate-limiting step on the amount of PER available for dimerization and nuclear translocations. At present 4 Per genes are known Perl, Per2, Per3 and Per4 (Per4 is a pseudogene). In mammals, the functions of Perl and Per2 were established by the creation of knockout mice, and the discovery of a family in which Advanced Sleep Phase Syndrome (ASPS) segregates with a dominant Perl mutation. This mutation causes a 4-hour advance in circadian rhythm parameters such as sleep, temperature, and melatonin secretion by destroying a casein kinase 1 (CK1) phosphorylation site. Phosphorylation is believed to stabilise PER2, allowing earlier nuclear entry, thereby closing the negative auto-feedback loop earlier and causing the observed shortened period length in the output cycle. Less is known about Per 3. Homozygous Per 3 knockout mice display less dramatic changes in circadian phenotype, with a <tau> 30 minutes shorter than wildtype.

There is an inter-individual variation in circadian period length. Some people have a morning preference and find it easier to get up, whilst others have an evening preference, preferring to sleep later and be more active later in the day. This preference is taken to extremes in some people who are classified as suffering from ASPS (extreme morning preference) or DSPS (extreme evening preference).

At present DSPS is diagnosed by clinical interview, questioimaires and physiological investigation. However, an additional and more rapid objective screening tool for the prediction of a subject's diurnal optimum to aid in the diagnosis of extreme diurnal phenotypes would be extremely beneficial.

Five Rer3 polymorphisms have been reported by Ebisawa et al., (2001) which in the Japanese population were found to occur in 4 haplotypes. Ebisawa et ah, 2001 focussed on a particular substitution polymorphism G647 and its presence in one of the haplotypes. The group reported that this haplotype was more frequent in DSPS subjects, although the association between the five polymorphisms with this haplotypes and the disorder were not determined. In fact, in the inventors' investigation of a largely European population, no significant difference was found between DSPS and control subjects with regard to this specific haplocyte.

The inventors have surprisingly found a link between a repeat polymorphism in the Per3 gene and diurnal preference.

Accordingly, the invention provides a method of determining a predisposition of a subject to a diurnal preference comprising identifying a repeat polymorphism in the Per3 gene, wherein the presence of the repeat polymorphism is suggestive of predisposition to a particular diurnal preference.

The term "repeat polymorphism" means a polymorphism in a region of the gene which is composed of repeated units, the polymorphism arising because the number of repeated units in the region is variable. The term "diurnal preference" is used herein to mean the inclination of a subject towards a certain activity pattern, for example an inclination towards rising early and going to bed early, or towards rising late and going to bed later.

"Predisposition" is used to mean an increased likelihood of a certain pattern of behaviour in a subject compared to a subject without the repeat polymorphism.

Identification of a repeat polymorphism may be carried out by methods known in the art, as discussed in the description. In particular polymerase chain reaction (PCR) based methods, comprising amplifying the region of DNA comprising the repeat polymorphism are preferred.

Preferably the Per 3 gene is a human Per 3 gene. The repeat polymorphism is preferably found between nucleotides 973 and 1063 of the human Per 3 gene.

An individual may have a different repeat polymorphism (i.e. a different number of repeated units) in each allele of the Per 3 gene, one allele of the Per3 gene having 4 units and the other allele having 5 units (4/5). Alternatively, the individual may have the same polymorphism (i.e. same number of repeated units) in each allele, both alleles having the same number of units (5/5 or 4/4).

Preferably both alleles of the Per3 gene having the same repeat polymorphism (homozygote) is suggestive of a predisposition to an extreme diurnal preference. It is also preferable that the alleles of the Per3 gene having different repeat polymorphisms (heterozygote) is suggestive of a low predisposition to an extreme diurnal preference, namely it is unlikely that an individual having different repeat polymorphisms will have an extreme diurnal preference.

The term "extreme diurnal preference" means an inclination towards an exaggerated sleep pattern. For example in extreme morning preference a subject will, when given a free choice, rise much earlier than a subject without an extreme diurnal preference

(usually referred to as intermediate sleep preference). In extreme evening preference a subject will find it very difficult to rise early in the morning when compared to a subject with intermediate sleep preference.

It is also preferred that both alleles of the Per 3 gene having only 4 repeated units in the repeat polymorphism is suggestive of a predisposition to DSPS. It is preferred that both alleles of the Per3 gene having 5 repeated units in the repeat polymorphism is suggestive of a predisposition to extreme morning preference.

It is further preferred that one allele of the Per 3 gene having only 4 repeated units in the repeat polymorphism, and the other allele having 5 repeated units in the repeat polymorphism is suggestive of a low predisposition to an extreme diurnal preference.

The method according to the invention may further comprise identifying an additional polymorphism associated with sleep preference. The additional polymorphism may typically be found in a Per gene, especially in the Per 3 gene or in other clock genes, such as Clock, BMALI, Cryl, Cry2 and casein kinase delta and epsilon.

Preferably, the subject is a member of a European population and is more preferably a caucasion.

The invention further provides the use of a repeat polymorphism in Per3 as a marker for a predisposition to a particular diurnal preference. Preferably a homozygous repeat polymorphism is a marker for a predisposition to an extreme sleep preference.

By "homozygous repeat polymorphism" it is meant that both alleles of the PerS gene have the same polymorphism, that is the same number of repeated units.

A homozygous 4 unit repeat polymorphism is preferably a marker for predisposition to DSPS. A homozygous 5 unit repeat polymorphism is preferably a marker for predisposition to extreme morning preference. By "homozygous 4 unit repeat polymorphism" it is meant that both alleles of the Per3 gene have only 4 repeated units in the repeat polymorphism. Equally by "homozygous 5 unit repeat polymorphism" it is meant that both alleles of the Pe 3 gene have 5 repeated units in the repeat polymorphism.

A heterozygous repeat polymorphism is preferably a marker for a low predisposition to an extreme diurnal preference.

"Heterozygous repeat polymorphism" is used to mean that the alleles of the Per 3 gene each have a different repeat polymorphism, that is a different number of repeated units.

The use of the repeat polymorphism according to the invention may further comprise the use of an additional polymorphism associated with diurnal preference as a marker for predisposition to a diurnal preference. The additional polymorphism may typically be found on a Per gene, especially on the PerJ gene, or in other clock genes, such as Clock, BMALI, Cryl, Cry2 and casein kinase delta and epsilon.

Also provided is a method of treating a subject suffering from extreme diurnal preference comprising:

a) identifying whether the subject has a homozygous repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of the polymorphism.

By "phosphorylation activity" we mean the propensity of the protein encoded, at least in part by the polymorphism to be phosphorylated. Modification of the phosphorylation activity may be achieved by, for example, by modifying the polymorphism, the encoded protein, the phosphorylation process, or the quantity or efficacy of the enzymes catalysing that process.

Further provided by the invention is a method of treating a subject suffering from DSPS, comprising: a) identifying whether the subject has a homozygous 4 unit repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of that polymorphism.

The invention also provides a method of treating a subject suffering from extreme morning preference comprising:

a) identifying whether the subject has a homozygous 5 unit repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of that polymorphism.

Preferably the phosphorylation activity is modified by modifying kinase activity, most preferably casein kinase lε (CKl) activity. Pharmaceutical methods of modifying kinase activity are well known to those skilled in the art.

By "kinase activity" we mean the catalysation of phosphorylation by kinase enzymes. This activity may be modified by, for example only, altering the quantity or efficacy of the enzymes, or by altering the polymorphism or encoded protein.

The invention also provides a method of treating a subject suffering from extreme diurnal preference comprising:

a) identifying whether the subject has a homozygous repeat polymorphism in the Per3 gene, and b) changing the homozygous polymorphism to a heterozygous polymorphism.

Methods for altering the polymorphism are known in the art. Preferably the method comprising gene therapy wherein the repeat polymorphism is changed by homologous recombination. The invention also provides the use of a phosphorylation activity modulator in the preparation of a medicament for the treatment of extreme diurnal preference, especially DSPS.

Preferably the phosphorylation activity modulator is a casein kinase lε activity modulator.

Also provided by the invention is a method of treating a subject suffering from an extreme diurnal preference comprising: a) identifying whether the subject has a homozygous repeat polymorphism in the Per3 gene; and b) treating the subject by one or more of the following treatments: modifying the subject's behaviour, exposing the subject to bright light treatment to regulate circadian phase, treating the subject with chronobiotics to regulate circadian phase, advising the subject on scheduling of work, leisure and sleep time, advising the subject on detrimental work schedules, and advising the subject on timing of chronobiotic intervention.

The invention further encompasses the use of any known standard therapy or treatment for extreme diurnal preference and the use of any such therapy or treatment that becomes known, for the treatment of subjects having a homozygous repeat polymorphism in the Per 3 gene.

Further provided is the use of one or more chronobiotics in the preparation of a medicament for the treatment of extreme diurnal preference in subjects with a homozygous repeat polymorphism in the Per3 gene.

The invention also provides the use of bright light in the preparation of a treatment for extreme diurnal preference in subjects with a homozygous repeat polymorphism in the Per3 gene.

The invention will now be described in detail with reference to the figures in which Figure 1 shows the percentage of subjects with the two Per 3 repeat genotypes in each group, (b) Frequency of alleles (n = 70) in morning-, intermediate and evening-preference subject groups, in the three groups combined (n = 210), and in the DSPS group (n = 32).

Figure 2 is a schematic diagram of the human PER3 protein. Binding to other PER molecules occurs a the PAS A and B domains. The 5- and 4-repeat region amino acid sequences are shown expanded below the sequence (5R and 4R respectively). The repeats are numbered 1-5 and the one that is missing in the 4-repeat allele is indicated by dashes. Predicated targets for CKl<epsilon> phosphorylation are indicated above by filled circles (the concensus CKl <epsilon>motif is Sp/Tp-X-ι-3-S/T, where x is any (1-3) amino acid(s), where the lead serine or threonine is prephosphorylated and the target serine or threonine is underlined).

Figure 3 shows the Horne-Ostberg score plotted against age for (a) male and (b) female subjects. The regression lines are shown for each plot. These lines and lines lying parallel to each regression line were used to select subjects for the morning-preference, intermediate and evening-preference groups.

Figure 4 shows an electrophoretic analysis of the 4/5 repeat polymorphism.

Examples

Methods and Materials

Visitors (n = 484) at the Live Science Exhibition (Science Museum, London) donated buccal swabs for DNA extraction and completed HO questionnaires (approved by the

University of Surrey's Advisory Committee on Ethics). The HO score distribution did not differ from normality (Kolmogorov-Smirnov). Because diurnal preference varies with age (13), HO score was plotted against age for males (n = 217, mean age + SD = 35+13 years, HO range = 25-74, HO mean_+ SD = 51+11) and females (n = 267, mean age+SD = 35+12 years, HO range = 25-80, HO mean + SD 53+11). Linear regression lines for the data were calculated. Cut-off lines parallel to each regression line were used to select 7% of male and female subjects with the highest (morning preference) and lowest (evening preference) HO scores, irrespective of age. An equal number of controls (intermediate) were chosen with an average HO score (positioned on the regression line). This gave a total selected subject base of 105 and allowed positive confirmation of Hardy- Weinberg equilibrium (Figure 3, <chi>-squared test, P = 0.91). Blood samples were also collected for genetic analysis from 16 unrelated subjects (8 males and 8 females, aged 27+16 years, mean+SD) clinically diagnosed with intrinsic DSPS according to the International Classification of Sleep Disorders (14). PCR and agarose gel electrophoresis identified whether individuals were heterozygous or homozygous for either of the Per 3 repeat alleles.

Example 1

METHOD USED FOR DETERMINING Per3 GENOTYPE

Genomic DNA was extracted from either buccal swabs (QuickExtract DNA Extraction Solution, Epicentre Technologies, Madison, WI, USA) or from blood samples (QIAamp Blood Kit (QIAGEN GmbH, Hilden, Germany) collected form study subjects.

Exon 18 of Per 3 containing the 4/5 repeat domain was amplified by the polymerase chain reaction (PCR) using the following oligonucleotide primers (Ebisawa et al, 2001):

Sense primer 5' CAAAATTTTATGACACTACCAGAATGGCTGAC 3 ' Antisense primer 5' AACCTTGTACTTCCACATCAGTGCCTGG 3 ' PCR reactions consisted of: 6μl of genomic DNA, 0.66μM of each PCR primer, 200μM of each dNTP, 6μl oflx reaction buffer, 1.5u TaqlPwo polymerase (Proofsprinter, Hybaid, Ashford, Middx) in a final volume of 60μl.

PCR cycling was performed as follows: denaturing at 94° for 3 minutes followed by 38 cycles of 94° for 45 seconds, 58° for 45 seconds and 72° for 1 minute.

After PCR lOμl of each reaction were electrophoresed on a 2% high-resolution agarose gel (3:1 agarose, Amresco, Solon, Ohio) stained with ethidium bromide. The same volume of a control blank reaction containing no DNA was also ran on the same gel together with a size marker (lOObp ladder, Hybaid). After sufficient electrophoresis, gels were visualised under UV illumination and images captured with either Polaroid film or by digital image analysis (NersaDoc, Biorad, Hercules, CA).

The PCR primers surround the 4/5 repeat domain and will amplify both the 4- and the 5-repeat alleles. Because the 5-repeat amplicon is larger than the 4-repeat by 54 bases it will migrate at a higher position in the agarose gel than the 4-repeat amplicon. The presence of the 4- or the 5-repeat alleles was determined by the presence or absence of the corresponding bands in the electrophoresis image (see figure). The presence of both bands indicates a heterozygote, just the smaller band a 4/4 homozygote and just the larger band a 5/5 homozygote.

Although this method was employed by the inventors, the following alternatives have also been considered.

Alternative to PCR

No restriction site is altered by the insertion, although it would still impact fragment size in a RFLP analysis of unamplified genomic DNA.

PCR method The high-fidelity thermostable DNA polymerase mixture used by the inventors has been discontinued by the manufacturer. Any other equivalent mixture of Taq and a proofreading thermostable DNA polymerase, as sold by several manufacturers (e.g. Expand from Roche) would work. Native or modified Taq, or a pure proofreading enzyme such as Pfu are quite likely to suffice.

Alternative detection methods

Different methods to detect the length polymorphism can be envisioned. Naturally, a polyacrylamide gel could be used instead of an agarose one. By performing the PCR under conditions that leave the product labelled with a dye, the size of the amplification products can also be analysed by different methods such as an automated DNA sequencer running size fragment analysis software. Unlabelled PCR product could also be analysed in a lab-on-a-chip bioanalyser (Agilent).

Figure 1 shows the frequency of the 4- and 5-repeat in groups with extreme evening, and extreme morning preference, as well as an intermediate group, as determined by HO scores. A significant linear trend was observed (<chi>-squared test, P=0.030), with the frequency of the 5-repeat allele significantly higher in the morning-preference (5-repeat: 0.42, 4-repeat: 0.58) compared to the evening-preference group (5-repeat: 0.24, 4 repeat: 0.76; Fisher's Exact Test, P=0.047). In the DSPS patient group, the frequency of the 4-repeat allele was significantly higher (5-repeat: 0.12, 4-repeat: 0.88) compared to the total normal population (all 105 selected individuals; 5-repeat: 0.32, 4-repeat: 0.68) (Fisher's Exact Test, P=0.023, odds ratio = 3.3). No 5/5 homozygotes were found in the DSPS group, and 75% were homozygous for the 4-repeat.

This is the first reported correlation between a polymorphism in a clock gene coding region and extreme diurnal preference in humans. The same polymorphism clearly shows a strong association with DSPS, a pathological form of extreme eveningness. The findings provide some important insights into the potential function of Per 3. CKl phosphorylates all three PER proteins, regulating their stability and nuclear translocation. Each of the 4- or 5-repeat sequences in PER3 contain potential CKlε phosphorylation motifs clustered in a similar arrangement to those in PER2 (Figure 2). Phosphorylation by CKlε is enhanced by pre-phosphorylation of a lead serine or threonine residue in the recognition motif. In PER2, a mutation in the first of a cluster of tandemly arranged CKlε recognition motifs has been hypothesised to reduce the chain of local phosphorylation leading to a more stabilised protein product and associated ASPS. In PER3, the decreased number of amino acids available as phosphorylation substrates in the shorter variant (4-repeat) would predict a functional polymorphism in phosphorylation-dependent effects. The identification of a robust link between the polymorphism and extreme diurnal preference in humans identifies the precise way in which differential PER3 phophorylation contributes to the phenotype differences as a priority area for future studies.

The link between human diurnal preference and DSPS and the Per3 polymorphism described identifies a novel correlation between genotype and phenotype and a potential genetic marker for extreme diurnal preference. It will be clinically useful in the differential diagnosis of DSPS. Further the ability of individuals to tolerate night-shift work, time-zone transitions and artificial time cues in a 24-hour society is likely to depend upon the presence of specific clock gene variants such as the Per3 polymorphism. The methods and uses of this invention will prove useful in advising individuals on their abilities to tolerate certain lifestyles such as particular working hours and how sleep preference may affect them.

References

1. Reppert SM, Weaver DR. Coordination of circadian timing in mammals. Nature 2002; 418: 935-41.

2. Czeisler CA, Duffy JF, Shanahan TL, Brown EN, Mitchell JF, Rimmer DW, et al. Stability, precision and near-24-hour period of the human circadian pacemaker. Science 1999; 284: 2177-81.

3. Home JA, Ostberg O. A self-assessment questionnaire to determine morningness-eveningness in human circadian rhythms. Int J Chronobiol 1976; 4: 97-110.

4. Duffy JF, Rimmer DW, Czeisler CA. Association of intrinsic circadian period with morningness-eveningness, usual wake time, and circadian phase. Behav Neurosci

2001; 115: 895-9.

5. Jones CR, Campbell SS, Zone SE, Cooper F, DeSano A, Murphy PJ et al. Familial advanced sleep-phase syndrome. A short-period circadian rhythm variant in humans. Nat Med 1999; 5: 1062-5.

6. Katzenberg D, Young T, Finn L, Lin L, King DP, Takahashi JS, et al, A CLOCK polymorphism associated with human diurnal preference. Sleep 1998; 21: 569-76.

7. Toh KL, Jones CR, He Y, Eide EJ, Hinz WA, Virshup DM, et al. An hPer2 phosphorylation site mutation in familial advanced sleep phase syndrome. Science 2001; 291: 1040-3.

8. Ebisawa T, Uchiyama M, Kajimura N, Mishima K, Kamei Y, Katoh M, et al. Association of structural polymorphisms in the human period3 gene with delayed sleep phase syndrome. EMBO Rep 2001; 2: 342-6. 9. Field MD, Maywood ES, O'Brien JA, Weaver DR, Reppert SM, Hastings MH. Analysis of clock proteins in mouse SCN demonstrates phylogenetic divergence of the circadian clockwork and resetting mechanisms. Neuron 2000; 25: 437-47.

10. Zheng B, Larkin DW, Albrecht U, Sun ZS, Sage M, Eichele G, et al. The mPerl gene encodes a functional component of the mammalian circadian clock. Nature 1999; 400: 169-173.

11. Shearman LP, Jin X, Lee C, Reppert SM, Weaver DR. Targeted disruption of the mPer3 gene: subtle effects on circadian clock function. Mol Cell Biol 2000; 20: 6269-75.

12. Akashi M, Tsuchiya Y, Yoshino T, Nishida E. Control of intracellular dynamics of mammalian period proteins by casein kinase I epsukib (CKlε) and CKIδ in cultured cells. Mol Cell Biol 2002; 22: 1693-703.

13. Carrier J, Monk TH, Buysse DJ, Kupfer DJ. Sleep and morningness-eveningness in the 'middle' years of life (20-59y). J Sleep Res 1997; 6: 230-237.

14. American Sleep Disorders Association. ICSD - International classifications of sleep disorders: Diagnostic and coding manual. Rochester, MN: American Sleep Disorders Association; 1990.

Claims

1. A method of determining predisposition of a subject to a diurnal preference, comprising identifying a repeat polymorphism in the Per3 gene, wherein the presence of the repeat polymorphism is suggestive of a predisposition to a particular diurnal preference.

2. A method according to claim 1 wherein the Per3 gene is a human Per3 gene.

3. A method according to claim 2 wherein the repeat polymorphism is found between nucleotides 973 and 1063 of the Per 3 gene.

4. A method according to any preceding claim wherein both alleles of the Per3 gene having the same repeat polymorphism is suggestive of a predisposition to an extreme diurnal preference.

5. A method according to any preceding claim wherein the alleles of the Per 3 gene having different repeat polymorphisms is suggestive of a low predisposition to an extreme diumal preference.

6. A method according to any preceding claim wherein both alleles of the Per 3 gene having only 4 repeated units in the repeat polymorphism is suggestive of a predisposition to Delayed Sleep Phase Syndrome.

7. A method according to any preceding claim wherein both alleles of the Per3 gene having 5 repeated units in the repeat polymorphism is suggestive of a predisposition to extreme morning preference.

8. A method according to any preceding claim wherein one allele of the Per 3 gene having only 4 repeated units in the repeat polymorphism and the other allele having

5 repeated units is suggestive of a low predisposition to an extreme diurnal preference.

9. The method of any preceding claim, further comprising identifying an additional polymorphism associated with diurnal preference.

10. The method of claim 9 wherein the additional polymorphism is in a Per gene.

11. The method of claim 9 or clam 10 wherein the additional polymorphism is in the Per3 gene.

12. The method according to any preceding claim wherein the subject is a member of a European population

13. The method of claim 12 wherein the subject is caucasion.

14. The use of a repeat polymorphism in Per3 as a marker for a predisposition to a particular diurnal preference.

15. The use of a repeat polymorphism according to claim 14, wherein a homozygous repeat polymorphism is a marker for a predisposition an extreme diurnal preference.

16. The use of a repeat polymorphism according to claim 14 or claim 15 wherein a homozygous 4 unit repeat polymorphism is a marker for a predisposition Delayed Sleep Phase Syndrome.

17. The use of a repeat polymorphism according to claim 14 or claim 15 wherein a homozygous 5 unit repeat polymorphism is a marker for a predisposition to extreme morning preference.

18. The use of a repeat polymorphism according to claim 14, wherein a heterozygous repeat polymorphism is a marker for a low predisposition to an extreme diumal preference.

19. The use of any of claims 14 to 18 further comprising the use of an additional polymorphism associated with diurnal preference as a marker for a diumal preference.

20. The use of claim 19 wherein the additional polymorphism is in a Per gene.

21. The use of claim 19 or claim 20 wherein the additional polymorphism is in the Per 3 gene.

22. A method of treating a subject suffering from an extreme diurnal preference comprising: a) identifying whether the subject has a homozygous repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of that polymorphism.

23. A method of treating a subject suffering from Delayed Sleep Phase Syndrome comprising: a) identifying whether the subject has a homozygous 4 unit repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of that polymorphism.

24. A method of treating a subject suffering from extreme morning preference comprising: a) identifying whether the subject has a homozygous 5 unit repeat polymorphism in the Per 3 gene, and b) modifying the phosphorylation activity of that polymorphism.

25. A method according to claim 23 or claim 24 wherein the phosphorylation activity is modified by modifying kinase activity.

26. A method according to claim 25 wherein the kinase activity is casein kinase lε activity.

27. A method of treating a subject suffering from an extreme diurnal preference comprising: a) identifying whether the subject has a homozygous repeat polymorphism in the Per 3 gene, and b) changing the Per 3 gene polymorphism to a heterozygous polymorphism.

28. The use of a phosphorylation activity modulator in the preparation of a medicament for the treatment of extreme diurnal preference .

29. The use of claim 28 wherein the extreme diumal preference is Delayed Sleep Phase Syndrome.

30. The use of claim 28 or claim 29 wherein the phosphorylation activity modulator is a kinase activity modulator.

31. A method of treating a subject suffering from an extreme diumal preference comprising: a) identifying whether the subject has a homozygous repeat polymorphism in the Per3 gene; and b) treating the subject by one or more of the following treatments: modifying the subject's behaviour, exposing the subject to bright light treatment to regulate circadian phase, treating the subject with clironobiotics to regulate circadian phase, advising the subject on scheduling of work, leisure and sleep time, advising the subject on detrimental work schedules, and advising the subject on timing of chronobiotic intervention.

32. A method of treating a subject suffering from an extreme diumal preference comprising: a) identifying whether the subject has a homozygous repeat polymorphism in the Per3 gene; and b) treating the subject with any known therapy or treatment for extreme diurnal preference, or any such therapy or treatment that becomes known.

33. The use of one or more chronobiotics in the preparation of a medicament for the treatment of extreme diumal preference in subjects with a homozygous repeat polymorphism in the Per3 gene.

34. The use of bright light in the preparation of a treatment for extreme diurnal preference in subjects with a homozygous repeat polymorphism in the Per3 gene.