WO2004033695A2 - A promoter from streptomyces coelicolor - Google Patents

Abstract

The invention provides an operator sequence (ROP), derived from S. coelicolor, that is sensitive to NAD+/NADH ratio. The invention further provides the cognate repressor, Rex. Naturally occurring and artificial homologues of the operator and repressor are also provided, including mutants with altered function, along with related methods, uses and materials.

Description

A PROMOTER FROM STREPTOMYCES COELICOLOR

The invention relates to a promoter and corresponding regulator from Strepto yces coelicolor, and variants and uses thereof.

As used herein, and unless the context requires otherwise, the term "promoter" is intended to be interpreted broadly, to include any operator sequence that is associated with the promoter. However, the term "promoter sequence" is intended to refer only to the sequence necessary for initiation of transcription (and including e.g. the -35, -10 and transcription initiation sites), and to exclude any operator sequence.

In aerobic organisms, oxygen plays a critical role as the ultimate electron acceptor in the oxidation of nutrients to produce energy. Free-living bacteria have to cope with wide fluctuations in oxygen tension and have therefore evolved strategies that help them adapt to these changes.

Key transcriptional regulators that co-ordinate cellular responses to oxygen fluctuation have been discovered both in Gram-positive and Gram-negative bacteria. These include unrelated two-component regulatory systems that control transcription of genes involved in the transition from aerobic to anaerobic metabolism in the Gram-negative Escherichia coli (ArcA-ArcB) and in the low G+C Grara- positive Bacillus subtilis (ResD-ResE) . In each case the actual signal that promotes autophosphorylation of the sensor kinase is not known, although it is now thought that the ArcA-ArcB system is modulated by the redox status of the quinone pool (Georgellis et al . , 2001) . i Another key regulator in bacteria is FNR, a transcriptional regulator (both an activator and a repressor) that contains an oxygen-sensitive iron-sulphur cluster, and that is also present in E. coli and B . subtilis .

Even though for other organisms such as Escherichia coli and Bacillus subtillis, regulatory systems have been already identified and well characterised, for Streptomyces it is still unknown how oxygen levels are sensed and how the organism responds to anoxia. For the avoidance of doubt, it is hereby stated that the term "anoxia" is intended to refer to oxygen limitation in general. It need not imply the total absence of oxygen.

The high G+C Gram positive Streptomyces bacteria are ubiquitous in nature and occur in especially large numbers in soil, where their mycelial growth habit helps in their exploitation of insoluble organic debris such as plant cell walls. When nutrients become limiting on agar plates, the non-motile Streptomyces take two approaches for survival. Firstly, they undergo a complex process of differentiation whereby aerial mycelium is produced that eventually septates to form long chains of uninucleoid spores. Secondly, they extend hyphae deep into the substrate and in these conditions are likely to encounter anoxia/oxygen limitation. Although Streptomyces are generally considered to be strict aerobes, this view is brought into question by the discovery of anaerobic dissimilatory genes in the S . coelicolor genome sequence (i.e. genes such as narGHJl that are thought to allow Streptomyces to produce energy in anaerobic environments) . These genes may be important during late stages of fermentations that have become near anaerobic. The genes are likely to be regulated but the identity of the regulator is not known.

The Streptomyces genus is particularly well known for its production of a large number of antibiotics and other chemotherapeutic compounds, and is therefore of great medical and industrial interest. Oxygen supply is often a crucial factor in determining antibiotic yields, yet little is known about how Streptomyces senses and responds to changes in oxygen tension and no regulatory genes have been identified. Analysis of the near-complete S. coelicolor genome sequence has not revealed obvious homologues of the FNR, Arc or Res systems, suggesting that they use a novel regulatory mechanism.

The present invention is based on the discovery of an oxygen-sensitive promoter from S . coelicolor and a co- regulated repressor of that promoter that serves to impart oxygen sensitivity.

As shown in the examples, the promoter (named the cydpl promoter) is up-regulated approximately 20-fold within 15 minutes of the onset of anoxia/oxygen limitation. It is also up-regulated in the presence of approximately ImM Zn²⁺ ions (data not shown) .

The repressor binding site, or operator (named ROP site) of the cydpl promoter was identified, as was the repressor protein (named Rex) and the gene ( rex) which encodes it. The rex promoter was also found to have a ROP site, suggesting the rex gene is autoregulated. Binding of DNA by Rex is inhibited by 0.1 mM NADH, and indeed as little as 5 μM NADH, whereas up to 2 mM NAD⁺ has little inhibitory effect. Furthermore, it has also been found that NAD⁺ can compete with NADH for binding to Rex, thereby allowing Rex to sense NAD⁺/NADH redox balance. Indeed, this has been found across a range of total concentrations of NAD⁺ and NADH (total concentration of NAD⁺ and NADH is also referred to herein as concentration of NAD (H) ) . The NAD⁺/NADH redox balance may be more physiologically relevant than NADH concentration alone.

Based on the above findings, the inventors propose a model (illustrated diagrammatically in Fig. 5A and Fig. 5B) to describe the regulation of activity of the cydpl promoter.

Rex protein binds to and represses the cydpl promoter (and also, presumably in an autoregulatory manner, the rex promoter) . Reduced electron flow in the cellular electron transfer chain (resulting either from reduced oxygen levels or the presence of zinc ions or any other factor that inhibits electron flow through the electron transport chain) leads to a reduction in the NAD⁺/NADH ratio. Increased NADH inhibits binding of Rex protein to DNA, lifting repression of the cydpl promoter (and, presumably, the rex promoter) . Zinc ions are thought to lead to reduced electron flow in the electron transfer chain by inhibition of a zinc sensitive cytochrome terminal oxidase.

The inventors have additionally found that DNA fragments upstream of the nuo and atp operons (which encode NADH dehyrogenase and ATP synthase, respectively) contain ROP sites similar to those found in the rex and cydpl promoters. These fragments are also bound by Rex. These additional ROP sites help to define the proposed minimal ROP sequence as 5'-TGTGN NNNNN NNCAC A-3' and/or a sequence having at least 10 residues identical to the ROP sequences discovered thus far.

Accordingly, in a first aspect, the invention provides an nucleic acid up to 2kb in length, comprising:

(a) the nucleotide sequence 5'-TGTGA ACGCG TTCAC A- 3 ' • (b) the nucleotide sequence 5'-TGTGC ACGCG TTCAC A- 3' ;

(c) the nucleotide sequence 5'-TGTGA CCTGC TTCAC A- 3 ' •

(d) the nucleotide sequence 5'-TGTGA CAGCA AGCAC A- 3';

(e) a nucleotide sequence which has at least 10 nucleotides identical with the nucleotide sequence of

(a) , (b) , (c) or (d) above;

(f) the nucleotide sequence 5'-TGTGN NNNNN NNCAC A- 3', wherein N is any nucleotide; or

(g) a nucleotide sequence which is the reverse complement of the nucleotide sequence of any one of (a) to (f) above.

Preferably the nucleotide sequence of (e) or (f) has the ability to be specifically bound by Rex protein or by a homologue thereof which is able to specifically bind to the nucleotide sequence of any one or more of (a) to (d) .

The nucleotide sequence of (a) is the ROP site from the cydpl promoter; the nucleotide sequence of (b) is the ROP site from the rex promoter; the nucleotide sequence of (c) occurs upstream of nuo, the NADH dehydrogenase operon; the nucleotide sequence of (d) occurs upstream of atp, the ATP synthase operon. The inventors have also demonstrated (data not shown) that Rex will bind to DNA fragments containing the sequences (c) and (d) .

Preferably the nucleotide sequence of (e) has at least 11, 12, 13, 14 or 15 nucleotides identical with the nucleotide sequence of any one or more of (a) to (d) .

Preferably the nucleotide sequence of (e) also falls within the definition of (f) .

The nucleotide sequence of (a) , (b) , (c) , (d) , (e) , (f) or (g) above is hereafter also known as the "operator" sequence .

Preferably the nucleic acid is up to 1.5kb, l.Okb, 0.8kb, 0.6kb, 500bp, 400bp, 300bp, 200bp, lOObp, 80bp, 60bp, 50bp, 40bp, 30bp or 20bp in length.

"Specific binding" in this context takes place when a protein binds to the sequence of the invention with substantially greater affinity (preferably with at least 10-fold greater affinity, more preferably 100-fold or 1000-fold greater affinity) than to random unrelated sequences of DNA.

In determining the level of identity in this context, up to a total of 6 (preferably 5, 4, 3, 2 or 1) gaps may be inserted into the sequences being compared to optimise alignment. More preferably, however, the level of identity is displayed without gaps. In this context a gap of two adjacent nucleotides is deemed to be two gaps. The amino acid sequence of the Rex protein is that set out for _?. coelicolor in Fig. 4. Homologues from other species are also shown in Fig. 4. It is a matter of routine to identify other Rex homologues by sequence similarity. The ability of a Rex homologue to bind to the operator sequence of the invention may be determined as described in the Examples. Preferred homologues have at least 35%, 40% or 45% amino acid sequence identity, more preferably at least 50% amino acid sequence similarity or identity, to the amino acid sequence of the S . coelicolor Rex protein as shown in Fig. 4. Preferably, the level of similarity or identity is at least 60%, 70%, 80%, 85%, 90%, 95%, 98% or 99% .

The invention further provides a nucleic acid comprising the operator sequence as defined above and a promoter sequence, wherein the nucleic acid is either recombinant , such that the operator sequence and the promoter sequence do not naturally occur in the same relationship as in the nucleic acid of the invention, or is up to 2kb in length (preferably up to 1.5kb, l.Okb, 0.8kb, 0.6kb, 500bp, 400bp, 300bp, 200bp, or lOObp in length) .

The skilled person is well aware of the component parts of a promoter sequence, e.g. for prokaryotic promoters a -35 motif, a -10 motif and a transcription initiation site. The promoter sequence may be eukaryotic or prokaryotic. Preferably, however, it is prokaryotic. More preferably, the promoter sequence contains the consensus -35, -10 and transcription initiation sites for a promoter from a Streptomyces species. Further details of streptomycete promoters are available from Bourn and Babb (1995) . Preferably, the promoter sequence contains the -35, -10 and transcription initiation sites of a naturally occurring promoter (preferably from a Streptomyces species) .

The promoter sequence may contain the -35, -10 and transcription initiation sites of the cypdl promoter or the rex promoter disclosed herein. However, the operator sequence may be recombined with the promoter sequence of a different promoter.

It is a matter of routine to identify these sites within the sequences disclosed herein. The -10 and -35 motifs are usually hexameric sequences that are centred approximately lObp and -35 bp upstream from the transcription initiation site, respectively. The transcription initiation site can be easily mapped using a technique such as SI nuclease protection assay.

For example, the nucleic acid may comprise all or part of the nucleic acid sequence shown in Figure 3A (which is derived from S . coelicolor cosmid SCD78 and which contains the cydpl promoter and ROP site) , preferably at least residues 11400 to 11490 (also shown in Figure 3B) , which have the sequence:

5 ' -agaggggttg acgtcacagg ggacccccct tccggtgtcg aaaagctgta ggtcataatt gcttgtgaat gtgaacgcgt tcacaagcgt g-3'

The numbering is derived from GenBank / EMBL accession number AL034355, now superseded by AL939118 (GI =24413861) , which contains several cosmid sequences joined together. The corresponding numbering in the latter sequence is 113805 to 113895. (To convert numbering for A 034355 to numbering for AL939118, add 102405.)

Alternatively, the nucleic acid may comprise at least the reverse complement of the following sequence from the S. coelicolor cosmid SCE68, which contains the backwards- pointing rex promoter:

5 ' -accgccccgt cgaatgcagg ctatgtcttt gtgaacgcgt gcacaaagat ggtgtccgat ttgcccggcc-3 '

Single stranded nucleic acid containing the complementary strands of the sequences disclosed herein is also within the scope of the invention. Generally, however, the nucleic acid of the invention will be double stranded.

The region of cosmid SCE68 that contains the rex promoter and ROP site may be smaller than the region of cosmid SCD78 that contains the cydpl promoter and ROP site, as the rex promoter and ROP site appear to overlap in SCE68.

Desirably, the promoter sequence is that of a promoter that is constitutively active in a host cell of interest (though of course when associated with the operator sequence of the invention, it will no longer be constitutive, but rather will be inducible by low oxygen concentration and/or high NADH concentration and/or low NAD⁺/NADH ratio) . However, it is contemplated that an inducible promoter may also be used as the promoter sequence .

Preferably the operator sequence functions to at least partially inhibit transcription from the promoter sequence upon binding of Rex protein (or homologue) to the operator sequence .

Most bacterial repressors bind to operators that are located approximately -40 to +10 (Rojo 1999) , though there is variation (for example some repressors work by binding to operators situated on either side of the promoter sequence to form, by protein-protein interaction, a repressing DNA loop: e.g. Semsey S et al . 2002) . The skilled person will be able to suitably position the operator relative to the promoter sequence to allow at least partial inhibition of transcription upon binding of Rex protein (or homologue) to the operator sequence. In particular, the operator may be located downstream of the promoter sequence (as with the cydpl promoter identified herein) or may overlap the promoter sequence (as with the rex promoter identified herein) .

Where the promoter is the cydpl promoter disclosed herein, the nucleic acid is preferably isolated from the cydp2 promoter, which is constitutively active in S . coelicolor and which can mask repression of the cydpl promoter .

The invention further provides a recombinant nucleic acid comprising a promoter sequence, an operator sequence as defined above and a nucleic acid sequence of interest under the control of the promoter sequence, wherein the operator sequence, the promoter sequence and the nucleic acid of interest do not naturally occur in the same relationship as in the nucleic acid of the invention. Generally the operator sequence will be positioned between the promoter sequence and the nucleic acid sequence of interest and will be capable of releasably repressing transcription of the nucleic acid sequence of interest .

Preferably at least one of the operator sequence, the promoter sequence and the nucleic acid sequence of interest is derived from a source different from at least one other said sequence.

Preferably the promoter sequence is as defined above.

Preferably the nucleic acid sequence of interest is under the control only of said promoter sequence, i.e. it is not also operatively associated with any other promoter sequence, unless such other promoter sequence is similarly releasably repressed by the operator sequence (or another operator sequence) .

Preferably, the nucleic acid sequence of interest is other than the complete set of open reading frames of the cydAB ox rex-hem operons of S . coelicolor or their homologues in other bacterial (especially Streptomycete) species. Preferably the nucleic acid sequence of interest excludes any open reading frame of the cydAB or" rex- e-T. operons of S . coelicolor or their homologues in other bacterial (especially Streptomycete) species.

The cydAB operon is located on S . coelicolor cosmid

SCD78, the sequence of which is publicly available under GenBank / EMB accession number A 034355 (GI 20520812) , now superseded by AL939118 (GI : 24413861) . The open reading frames of the operon are SCD78.12 and SCD78.13. An additional two open reading frames may also be part of this operon, namely cydCD (one gene, SCD78.14) and SCD78.15, which encodes a sensor kinase protein. The phrase "complete set of open reading frames of the cydAB operon" may exclude the open reading frames SCD78.14 and SCD78.15, but preferably includes them. SCD78.12 and SCD78.13 are also known as SC03945 and SC03946, respectively.

The rex-hem operon is located on S . coelicolor cosmid

SCE68, the sequence of which is publicly available under GenBank / EMBL accession number A 079345 (GI 5123647) , now superseded by AL939116 (GI : 24413781) , which contains several cosmid sequences joined together. To convert numbering for AL079345 to numbering for A 939116, add 28823. The open reading frames of the operon are SCE68.18C to SCE68.15C.

In this context, a homologue encodes a polypeptide having at least 30% amino acid identity with the amino acid sequence encoded by the open reading frame of the cydAB or rex-hem operon.

The term "nucleic acid sequence of interest" is to be interpreted broadly, to include for example a nucleic acid sequence encoding one or more polypeptides of interest, as well as a nucleic acid sequence that upon transcription generates an antisense nucleic acid of interest (such as an antisense oligonucleotide) . Usually, the nucleic acid sequence of interest will encode one or more polypeptides of interest (e.g. by comprising some or all of the open reading frames of an operon) . The polypeptide of interest will usually be a polypeptide which one wishes to express specifically under conditions of high NADH concentration and/or low NADNNADH ratio (which may for example occur, at least transiently, under conditions of low oxygen concentration) .

Since conditions of low oxygen concentration frequently accompany the stationary phase of bacterial cell culture, the polypeptide of interest may be any desired product of fermentation, particularly advantageously (but not necessarily) a product that may inhibit, reduce or otherwise adversely affect bacterial cell growth (e.g. a product that is toxic to bacterial cells) . Alternatively, the polypeptide of interest may be a biosynthetic polypeptide for the desired product of fermentation, such as an antibiotic biosynthetic enzyme, or a regulator of synthesis of the desired product of fermentation, or a polypeptide which improves yield.

In one particularly preferred embodiment, the nucleic acid sequence of interest encodes the polypeptides necessary for production of an antibiotic of interest (typically a primary translation product and biosynthetic enzymes necessary for modifying the primary translation product into an antibiotic) . Thus antibiotic production will be repressed at high oxygen (and low NADH) concentration, and the repression will be lifted (at least transiently) at low oxygen (and high NADH) concentration .

Similarly, in another preferred embodiment, the nucleic acid sequence of interest encodes a positive regulator of antibiotic production, such as a pathway- specific regulator, e.g. actII-orf4 for the actinorhodin biosynthetic gene cluster.

Similarly, in another preferred embodiment, the nucleic acid sequence of interest encodes a polypeptide which improves the yield of a desired fermentation product, such as bacterial haemoglobin, which can improve the yield of fermentation products in bacteria (e.g. Streptomyces) by improving oxygen utilisation (Magnolo et al. 1991) .

In another preferred embodiment, the nucleic acid sequence of interest is a marker gene, e.g. lacZ or a gene encoding a fluorescent protein, such as green fluorescent protein. The nucleic acid of this embodiment may for example be used to determine or monitor the NADH level and/or NADNNADH ratio and/or oxygen concentration in a cell comprising the nucleic acid: low oxygen concentration and low NAD⁺/NADH ratio (i.e. high NADH concentration) in the cell leading to expression of the marker gene. Strictly, it is thought that expression will be governed by NADH levels and/or NAD⁺/NADH ratio, rather than directly by oxygen levels. Determination need not be quantitative, but may be qualitative.

The skilled person is well aware of the need to include translation control sequences, e.g. a ribosome binding site and translation initiation sequence (i.e. start codon) , when placing a nucleic acid encoding a polypeptide of interest under the control of a promoter sequence. These are well known and very similar in all bacteria . The present invention also provides a vector comprising any one of the nucleic acids defined above, and a host cell comprising any one of the nucleic acids defined above or said vector.

Generally, the vector of the invention will be a plasmid, containing an origin of replication suitable for replication in a cell or cells of interest. The skilled person is well aware from standard reference texts of vectors suitable for use in different cells. See e.g. Sambrook and Russell (2001) and Kieser et al (2000) .

The vector may additionally comprise a coding sequence for Rex polypeptide or a homologue thereof capable of binding the operator sequence. Preferably the coding sequence is under the control of a promoter that is constitutive or inducible in the cell of interest. Such a vector is primarily intended for use in cells which lack a naturally occurring Rex polypeptide or homologue thereof.

The host cell may be any cell of interest, but will usually be a bacterial cell, preferably an actinomycete cell, more preferably a streptomycete cell, more preferably a cell of the genus Streptomyces, especially a cell of the species Streptomyces coelicolor.

The invention further provides a method of providing for preferential expression of a nucleic acid of interest in a host cell when the host cell is subject to low oxygen concentration and/or low NAD⁺/NADH ratio and/or high NADH concentration, the method comprising providing a host cell as defined previously and propagating the host cell in a cell culture medium. Preferably the host cell is allowed to propagate until a stationary phase of cell culture is reached, under which low oxygen concentration and/or low NAD⁺/NADH ratio and/or high NADH concentration may prevail. Again, strictly, it is thought that the expression is in response to the NADH level and/or NAD⁺/NADH ratio, rather than directly to oxygen concentration .

The invention further provides the use of an operator sequence as defined above to impart oxygen sensitivity and/or sensitivity to NADH concentration and/or sensitivity to NAD⁺/NADH ratio to a promoter sequence.

Generally, transcription from the promoter sequence will in consequence be at least partially inhibited under conditions of high oxygen concentration and/or low NADH concentration and/or high NADNNADH ratio, in the presence of Rex protein or a homologue thereof .

Such use will generally involve placing the operator sequence downstream of or overlapping the transcription initiation site of the promoter sequence. Similarly, the use will generally involve placing the operator sequence upstream of a nucleic acid sequence of interest (e.g. coding sequence) that is under the control of the promoter.

Similarly, the invention also provides a method of imparting oxygen sensitivity and/or sensitivity to NADH concentration and/or sensitivity to NADNNADH ratio to a promoter, the method comprising recombining said promoter with an operator sequence as defined above. Again, generally, transcription from the promoter will in consequence be at least partially inhibited under conditions of high oxygen concentration and/or low NADH concentration and/or high NADVNADH ratio, in the presence of Rex protein or a homologue thereof .

The host cell may be one that, at least under conditions of low oxygen concentration and/or high NADH concentration and/or low NADNNADH ratio, naturally expresses Rex protein or a homologue thereof capable of binding to the operator sequence of the invention. All Streptomyces cells are thought to so express Rex or a homologue thereof under such conditions. The host cell may be recombinantly provided with the rex gene disclosed herein (or homologue thereof) under the control of a constitutive or inducible promoter, particularly if the host cell does not naturally express Rex or a homologue thereof under such conditions.

However, the inventors have identified a potential problem with using the system even in Streptomyces and other host cells that naturally express Rex (or homologues) . Since the rex gene is negatively autoregulated, an increase in NADH and/or a decrease in NAD⁺/NADH ratio will lead to a transient increase in Rex production, which will feed back and ultimately repress rex and other target genes under the control of the operator sequences of the invention (e.g. a reporter gene that has an upstream ROP site) . In other words, the expression of the reporter gene may not continue accurately to reflect the level of NADH and/or the NAD⁺/NADH ratio. The rex gene is preferably therefore constitutively expressed, so that the level of Rex does not change when the NADH concentration changes. This should allow activity of the Rex-controlled reporter gene to directly correlate to NADH concentration and/or NAD⁺/NADH ratio. However, it will probably not correlate directly to oxygen concentration. The level of NADH may decrease as NADH dehydrogenase genes are induced, but the concentration of oxygen may not change. Therefore the operator sequence of the invention appears to be sensitive to NADH concentration and/or NAD⁺/NADH ratio, rather than necessarily to oxygen concentration. Of course, low oxygen concentration will generally at least initially result in high NADH concentration and/or low NADNNADH ratio, though these changes may be transient even if oxygen concentration remains low.

The promoter may be as defined above

The invention further provides the use of a nucleic acid comprising the operator sequence as defined above for the identification of homologues of the Rex protein that are capable of binding the operator sequence. Preferably such use will be of a nucleic acid of the invention. Such use may involve a gel shift assay to determine binding of polypeptide to the nucleic acid. The use may for example involve fragments or variants of a known Rex protein (e.g. randomly mutated variants) or cell extracts (e.g. when it is unknown whether a species has a rex gene or homologue thereof) , especially an extract from cells grown under conditions of low oxygen concentration.

The invention further provides the use of a nucleic acid comprising the operator sequence as defined above and Rex protein (or a homologue thereof that is capable of binding said operator sequence) for the identification of compounds that are capable of modulating the binding of the Rex protein or homologue to the operator sequence. Candidate compounds will generally be fragments or variants of the Rex protein or a homologue thereof. Preferably such use will be of a nucleic acid of the invention. Such use may involve a gel shift assay to determine whether the Rex protein or homologue thereof binds to the nucleic acid in the presence or absence of a test compound.

In a third aspect, the invention provides a nucleic acid comprising an open reading frame that encodes the S . coelicolor Rex protein shown in Fig. 4, wherein the nucleic acid is isolated from one or more other open reading frames of the rex-hem operon.

Preferably the open reading frame is the reverse complement of residues 18642 to 19418 of S . coelicolor cosmid SCE68, i.e. residues 47465 to 48241 in AL939116 (GI :24413781) .

Similarly, the invention provides a nucleic acid comprising an open reading frame that encodes a protein having any one of the other amino acid sequences shown in Fig. 4, wherein the nucleic acid is isolated from one or more open reading frames of an operon in which the naturally occurring open reading frame appears and/or isolated from the regulatory sequences with which the open reading frame is naturally associated.

The invention further provides a nucleic acid comprising an isolated open reading frame that encodes an amino acid sequence having at least 35%, 40% or 45% amino acid sequence identity, more preferably at least 50% sequence similarity or identity, to the amino acid sequence of the S . coelicolor Rex protein shown in Fig. 4. Preferably, the level of similarity or identity is at least 60%, 70%, 80%, 85%, 90%, 95%, 98% or 99%. In this context, "isolated" indicates that, when the open reading frame (orf) is naturally occurring or derived from a naturally occurring orf, it is isolated from one or more other orfs within the naturally occurring operon that contains the orf and/or isolated from the regulatory sequences with which the orf is naturally associated. The nucleic acid sequence is other than a nucleic acid sequence that encodes the Thermus aquaticus AT-rich DNA-binding protein of unknown function that is disclosed in Du and Pene, 1999 (GenBank accession number AAD22519, sequence:

1 m vpeaaisr litylrilee leaggv rts seglgelagv tafq r dls yfgsygtrgv 61 gytvpvlkre Irhilglnrk wglcivgmgr lgsaladypg fgesfelrgf fdvdpekvgr

121 pvrggviehv dllpqrvpgr ieialltvpr eaaqkaadll vaagikgiln fapwlevpk

181 evavenvdfl agltrlsfai lnpkwreemm g) .

Preferably the amino acid sequence is that of a polypeptide capable of binding to one or more of the operator sequences defined herein, more preferably one or more of the operator sequences identified as (a) to (d) herein.

The nucleic acid preferably further comprises a promoter in operative association with the open reading frame. The promoter may be the naturally occurring promoter associated with the rex-hem operon. For example, the nucleic acid may comprise some or all of the reverse complement of residues 19418 to 18609 of S . coelicolor cosmid SCE68 (preferably at least residues 19540 to 19470) . Corresponding numbering for AL939116 (GI .24413781) is 48241 to 47432, preferably at least 48363 to 48293. Alternatively, the promoter may be an exogenous promoter. The promoter may be constitutive or inducible. Preferably the promoter is an exogenous inducible promoter.

The invention further provides a vector comprising the nucleic acid of this aspect. As described previously, the vector may be a plasmid, having an origin of replication for replication in a cell or cells of interest .

The invention further provides a host cell comprising the vector of this aspect. Preferably the host cell is prokaryotic, e.g. E. coli or streptomycete. Especially preferred is S . coelicolor.

The invention further provides an isolated polypeptide having any one of the amino acid sequences set out in Fig. 4. Preferably the polypeptide has the amino acid sequence as shown for S . coelicolor.

Such a polypeptide can be used to identify nucleic acid sequences to which the polypeptide is capable of binding. Such nucleic acid sequences may be operator sequences that impart sensitivity to oxygen and/or NADH and/or NADNNADH ratio. For example, fragmented labelled DNA may be screened for binding to the immobilised polypeptide or labelled polypeptide may be screened for binding to fragmented immobilised DNA.

The invention further provides an isolated polypeptide having at least at least 35%, 40% or 45% amino acid sequence identity, more preferably at least 50% amino acid sequence similarity or identity, to the S . coelicolor Rex protein shown in Fig. 4. Preferably, the level of similarity or identity is at least 60%, 70%, 80%, 85%, 90%, 95%, 98% or 99%. Such polypeptides are candidate regulators of the operator sequences of the invention. Again, the polypeptide is other than the Thermus aquaticus AT-rich DNA-binding protein of unknown function that is disclosed in Du and Pene, 1999 mentioned above .

One class of preferred polypeptides retain the motif GxGxxG, wherein x is any amino acid. This motif represents the conserved amino acids of the putative

NADH-binding motif shown with downward arrows in Fig. 4A. Preferably the retained motif is G (I/V/A/C) GN (L/l) G.

However, the invention also provides polypeptides in which the amino acid residue at the position corresponding to the glycine at amino acid 102 of the S . coelicolor Rex protein shown in Fig. 4A is replaced by another residue, such as alanine.

Such a mutation to Rex protein removes the ability of

NADH to release Rex from binding to the ROP (end hence to release repression of transcription) . G102 -mutated Rex (and G102 -mutated Rex homologues) could therefore be used to downregulate transcription from a promoter that is associated with an operator sequence of the invention

(e.g. transcription of the rex operon), independently of NAD⁺/NADH ratio. The mutant, together with an operator of the invention, may therefore be used as a generic repressor/operator system to control gene expression in heterologous systems. The G102 -mutated Rex (or homologue) may be placed under the control of an inducible promoter. G102 -mutated Rex and G102 -mutated Rex homologues preferably retain the motif GxxxxG motif (i.e. the GxGxxG motif in which the middle G has been mutated) .

Independently of the preceding discussion of the GxGxxG / GxxxxG motif, another preferred class of polypeptides have an acidic amino acid residue (aspartate or glutamate) at the position corresponding to amino acid 126 of the S . coelicolor Rex protein shown in Fig. 4A. The presence of an acidic residue at this position is thought to be important for discriminating between NAD(H) and NADP (H) . Preferably the residue is aspartate.

However, the invention also provides polypeptides in which the amino acid residue at the position corresponding to the aspartate at amino acid 126 of the S. coelicolor Rex protein shown in Fig. 4A is replaced by a non-acidic residue, such as alanine.

The known role of this residue in other proteins with a

Rossman fold suggests that this mutation in Rex (and homologues able to bind the operator sequences defined herein) will alter the relative binding affinities of NADH and NADPH for Rex (or homologue) , such that NADPH will bind the mutant Rex protein (or homologue) and inhibit DNA binding activity. Such a change may not be such that binding by NADH is excluded.

Accordingly, the disclosure herein relating to Rex and homologues thereof and their relationship with NADNNADH also applies, mutatis mutandis, to D126-mutated Rex and D126-mutated Rex homologues and their relationship with NADPNNADPH (or NADPNNADPH and NADNNADH) . All definitions of the invention, and preferred features thereof, may also therefore be applied, mutatis mutandis, to D126-mutated Rex (and D126-mutated Rex homologues) and NADP⁺/NADPH (or NADP⁺/NADPH and NAD⁺/NADH) .

NADPH is an essential source of reducing equivalents in all cells. In Streptomyces, many antibiotics are highly reduced and the source of the reducing equivalents is typically NADPH. In Butler et al . (2002), the level of NADPH in Streptomyces was modulated by disrupting genes involved in its production. This partially influenced antibiotic production. It is therefore of interest to monitor NADP⁺/NADPHP levels in cells, e.g. by placing a reporter gene under the control of an operator sequence of the invention, in a host cell that expresses D126- mutated Rex or a D126 -mutated Rex homologue.

Preferred polypeptides of the invention retain a Rossmann fold, a motif which typically consists of two sets of β- -β-α-β units, which together form a parallel β-sheet flanked by α-helices (Fig. 4B) . These and other structural motifs referred to herein may be predicted using known secondary structure prediction programs, such as PSIPRED (McGuffin et al . , 2000), and/or sequence structure homology recognition programs, such as FUGUE (Shi et al . , 2001) .

Another preferred class of polypeptides have a mutation in the DNA-binding domain, such that it is incapable of binding to the operator sequences of the invention. The DNA-binding domain of Rex is thought to reside in the first third of the protein (residues 1-90) , in a putative three-helix bundle containing a classic helix-turn-helix motif (Fig. 4B) . It is thought that Rex binds to DNA as a dimer. Overexpression of such a mutant that retains a functional dimerisation domain in a host cell that contains endogenous Rex may therefore cause derepression of the operator sequences of the invention, irrespective of the NAD⁺/NADH ratio in the cell, because the mutant will sequester the endogenous Rex and cause it to lose affinity for the operator sequences of the invention.

For the avoidance of doubt, it is hereby stated that, unless the context requires, the preceding classes are not necessarily mutually exclusive. Thus, for example, a polypeptide of the invention may retain the GxGxxG motif and may be D126-mutated.

A summary of especially preferred and non-limiting applications of the invention follows:

1. Sensing intracellular redox status

The inventors propose in particular that the cydpl promoter is regulated by the intracellular NADNNADH ratio and/or the NADH level and that a decrease in this ratio (and/or increase in NADH level) will induce the promoter, caused by the release of the Rex repressor from the ROP site. Therefore monitoring cydpl activity, for example by fusing it (or a recombinant promoter including the operator sequence) to a reporter gene (e.g. GFP) , will allow indirect assessment of the NAD⁺/NADH ratio and/or NADH level. The ability to monitor changes in this ratio may prove useful in fermentations that are affected by this ratio. Alternatively, if it is not possible to construct recombinant strains the activity of the cyd promoter could be monitored at the mRNA level using a technique such as SI nuclease mapping. Quantitative RT-PCR or DNA icroarrays could also be used but these lack the resolution to assess the activity of cydpl as opposed to cydp2. However, these techniques could be used to assess the activity of the rex promoter and are within, the. scope of the invention.

2. Regulation of Rex target genes during fermentation

To date, four operons have been shown or implicated to be targeted by Rex. However, still more are likely to exist. These can be identified using Rex (or via homology searches, followed by in vi tro testing). Expression of these genes can be controlled by varying the expression of rex, by placing rex under control of an inducible promoter. The same applies also to rex mutants with altered NAD⁺/NADH sensing characteristics (e.g. Rex^G102A) and/or NAD (H) specificity (e.g. D126-mutated Rex) and/or DNA binding characteristics.

Control of genes not normally targeted by Rex.

A strain can be engineered in which a particular gene is under the control of Rex and therefore responds to changes in the NADNNADH ratio and/or NADH level. Such a gene can be placed downstream of the cydpl promoter or some other promoter that contains the operator sequence of the invention, to make it subject to regulation by Rex 4. Applications in Gram positive organisms that contain likely homologues of Rex

Controlling the NADNNADH ratio may be important in several industrial fermentations. For example control of the NADNNADH ratio has an effect on end-product formation in Lactococcus lactis (Lopez de Felipe et al . , 1999). A homologue of Rex is present in this organism. It is proposed to over-express Rex homologues, including homologues having altered DNA-binding and/or NADNNADH sensing, in such organisms to control the NAD⁺/NADH balance. The identification of further target promoters of such Rex homologues would also allow the NAD⁺/NADH redox status to be monitored in a similar way to Strep tomyces .

A nucleic acid of interest introduced into such an organism under the control of the operator sequence of the invention will be pref rentially expressed under conditions of low NADNNADH ratio and/or high NADH.

5. Applications in organisms that do not contain likely homologues of Rex

It is proposed that the operator sequence of the invention can be positioned to repress transcription of any promoter. If Rex is introduced into the same cell, then the activity of the promoter should be responsive to the cellular NADH level and/or NADNNADH ratio. Such a system could be used to analyse the intracellular NADH level and/or NAD⁺/NADH ratio by placing the promoter upstream from a reporter gene. Alternatively, the system may be used to control the expression of specific genes in response to changes in the NAD⁺/NADH concentration.

Additional definitions

Percent (%) amino acid sequence identity with respect to a reference sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. % identity values may be determined by WU-BLAST-2 (Altschul et al . , Methods in Enzymology, 266:460-480 (1996)). WU- BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11. A % amino acid sequence identity value is determined by the number of matching identical residues as determined by WU-BLAST- 2, divided by the total number of residues of the reference sequence (gaps introduced by WU-BLAST-2 into the reference sequence to maximize the alignment score being ignored), multiplied by 100. Percent (%) amino acid similarity is defined in the same way as identity, with the exception that residues scoring a positive value in the BLOSUM62 matrix are counted. Thus, residues which are non-identical but which have similar properties (e.g. as a result of conservative substitutions) are also counted.

Substitutions which score positive in the BLOSUM62 matrix are as follows:

In a similar manner, percent (%) nucleic acid sequence identity with respect to a reference nucleic acid is defined as the percentage of nucleotide residues in a candidate sequence that are identical with the nucleotide residues in the reference nucleic acid sequence. The identity values used herein may be generated by the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.

A promoter is "in operative association" with a nucleic acid sequence if it effects the transcription of that ^' •sequence .

For the avoidance of doubt, it is hereby stated that the term "Rex homologue" is not limited to naturally occurring homologues of Rex in species other than S. coelicolor. Rather, it also extends to artificial variant forms of Rex protein, within the sequence similarity or identity limits set out herein, including variants having the specific mutations set out herein.

The work underlying the invention, and various aspects thereof, will now be described in detail, and by way of example only, with reference to the following figures:

Figure 1 shows maps of plasmids pSX131 and pSX132. The pGEM-T Easy vector was used for initial cloning of the 180bp, __cc.RI-.__baI, cydpl promoter fragment. The pIJ8660 is an integrative plasmid that utilises the EGFP reporter gene. It was used for fluorescence analysis of the cydpl . The promoter fragment was cloned as an EcoRV-Xbal fragment .

Figure 2 shows maps of multicopy plasmids pSX133 and pSX134. The pIJ487 plasmid comprises the promoter-less neo gene and was used for the analysis of a mutant version of the cydpl promoter region. The pMT3010 plasmid contains the mel reporter system and was used for screening assay of cydpl localisation. In both cases, the cydpl promoter was cloned as an EcoRI -Xbal fragment of approximately 180bp.

Figure 3A shows the sites of cassette mutagenesis of the cydpl promoter region within a fragment of the S. coelicolor cosmid SCD78. Thirteen mutants (M1-M13) were constructed each replacing the 6bp native DNA with the BamHI restriction site (GGATCC) . The transcriptional start point of cydpl is marked by an arrow.

Figure 3B shows a portion of the sequence shown in Fig. 3A in greater detail. The non-template strand of the cydpl promoter is indicated, together with the location of the cydpl transcript 5' -end. DNA replaced by the BamHI restriction site in each of the mutations, M1-M13 (Example 6) , is underlined. The activity of each mutant promoter, as judged by the level of kanamycin resistance conferred on S. coelicolor when fused to neo in pIJ487 (Example 7), is indicated: (-) no detectable activity; (+) 2-3 μg/ml; (+++) 10-12 μg/ml. The wild-type promoter conferred resistance to 2-3 μg/ml kanamycin. An inverted repeat (ROP), believed to be a repressor binding site, is marked by inverted arrows. A putative overlapping half- site is also marked by a rightward arrow. The non- template sequence corresponding to the region of the template strand protected from DNase I by the ROP-binding protein Rex (see Figure 4) is shaded in gray.

Fig. 4A shows an alignment of Rex-related proteins from Gram-positive bacteria. The likely NADH-binding motif is marked by downward arrows. Sco, Streptomyces coelicolor; Lmo, Listeria monocytogenes,- Bsu, Bacillus subtilis; Cpe, Clos tridium perfringens ; Sau, Staphylococcus aureus ; Spy, Streptococcus pneumoniae .

Fig. 4B shows a similar alignment of some of the Rex- related proteins of Fig. 4A using Clustal_W. The proteins are also aligned with rat biliverdin reductase (BVR) as predicted by sequence-structure comparisons using FUGUE

(Shi et al . , 2001) . As in Fig. 4A, identical residues are highlighted in black, and similar residues are outlined in grey. The secondary structure of the pyridine nucleotide-binding domain (Rossmann fold) of BVR, as determined from the crystal structure (Kikuchi et al . , 2001) , is indicated by black lines (helices) or arrows

(strands) . A secondary structure prediction of Rex, determined using PSIPRED (McGuffin et al . , 2000), is indicated by grey lines (helices) or arrows (strands) . A putative HTH motif in Rex is marked with dotted arrows. A conserved glycine-rich signature motif (GxGxxG, from amino acids 100-105 in S. coelicolor) that is found in most NAD⁺-dependent dehydrogenases is indicated by asterisks. Also indicated is an aspartate (Aspl26 in S. coelicolor) that might play a role in discriminating between NAD (H) and NADP (H) . The ammo acid sequence data was obtained from the SwissProt database. Sco , S . coelicolor (Q9WX14) ; Lmo, L. monocytogenes (Q929U6) ; Bsu, B . subtilis (005521) ; Sau, S. aureus (Q99SK6) . The non- conserved C-terminal 20 residues of S. coelicolor Rex are not included.

Figure 5A and B show schematic diagrams of the regulation of the cydpl promoter.

EXAMPLE 1: Transcriptional analysis of the cyd promoter region

Introduction

CydAB cytochrome oxidases are often the mam terminal oxidases of the electron transport chain during microaerobic conditions inside the cell, m contrast to the cyoABCDE cytochrome oxidases (which are the ma terminal oxidases at higher levels of oxygen) . This is because the cydAB oxidases possess higher oxygen affinity than cyoABCDE, so can scavenge low concentrations of available oxygen. CydAB was identified in S . coelicolor following the deposit of the sequence in the databases by the Sanger Centre as part of the genome sequencing program.

Materials and Methods

S. coelicolor was grown in 50ml NMMP liquid medium (Kieser et al . , 2000) to an OD₄₅o of 0.7-0.8. The culture was poured into 15ml tubes (such that the culture completely filled the tube leaving no air space) sealed, and incubation was continued at 30°C without shaking. At 15 min intervals the mycelium from one 15ml sample was harvested by centrifugation at 6,000 g for 1 min at room temperature. RNA was isolated from mycelial pellets using a scaled down version of the Kirby Mix method as detailed in Paget et al . , (2001). Briefly, the pellet was suspended in 1 ml of ice-cold Kirby mix (1% sodium trisopropylnapthalene sulphonate, 6% sodium 4 -amino salicylic acid, 6% phenol mixture, made up in 50 mM Tris- HCI pH8.3; Kieser et al . , 2000), then transferred to a 2 ml centrifuge tube on ice. The mycelial suspension was sonicated twice for 4-5 seconds each, then extracted with 0.8 ml 1:1 (v/v) phenol (Amersham) /chloroform (Merck) (pH8.0) by vortex mixing for 2 min followed by centrifugation in a microfuge. The top aqueous layer of approximately 700-800μl was removed and samples were re- extracted with 0.8ml 1:1 phenol/chloroform (pH 8.0), before removing the top aqueous layer and precipitating nucleic acids at -20°C for 30 min using 0.3 M sodium acetate (pH6.0) (final concentration) and an equal volume of isopropanol. Following centrifugation, the pellet was washed with 70% ethanol, air dried then redissolved in DNasel buffer (Kieser et al . , 2000) . Samples were treated with 5 units DNasel (Promega) for 45 min at 37°C then extracted with an equal volume of 1:1 phenol/chloroform (pH8.0) and precipitated as before. Following centrifugation pellets were dissolved in 100 μl water. This procedure typically yields 0.5 mg RNA. The cyd promoter region was SI mapped using a 360 bp probe generated by PCR using primers CD1 (5'- CGAGGCGAACGACATCTTCCTG-3' ) and CD2 (5'- GTAGACGGTCGTGATGCCGAAC-3' ) and S. coelicolor M600 (Chakraburtty and Bibb, 1997) chromosomal DNA as template. The PCR conditions used were as follows:

PCR Reaction:

10x Reaction Buffer 5. Oμl CD1, lOpmol/μl stock 2. Oμl

CD2 labelled stock (see below) 2. Oμl dNTPs (deoxynucleotide 5 ' -triphosphates ; lOm ) l.Oμl

Template DNA (Streptomyces M600 chromosomal DNA) l.Oμl

40% Glycerol (5% final concentration) 6.3μl Distilled H₂0 up to 50μl 32.7μl

Total volume 5 Oμl

PCR Conditions :

The above components were initially mixed in a 0.5ml microcentrifuge tube without the Tag DNA polymerase, heated in a thermal cycler at 97°C for 5 min and then the heating block was set to 80°C. Tag DNA polymerase (2.5units) was then added to the tube and the PCR reaction was thermocycled according the following profile :

95°C for 50 sec (denaturation) } 60°C for 45 sec (annealing) } 27 cycles total 72°C for 60 sec (extension) } 70°C for 5 min 4°C hold

The 5' end of primers GDI and CD2 correspond to positions 11235 and 11639 on the sequenced cosmid SCD78, respectively (the sequence of cosmid SCD78 is available under GenBank / EMBL accession number AL034355) . These positions correspond to positions 113640 to 114044 in AL939118 (GI : 24413861) .

The 5' end of CD2 was phosphorylated with ³²P phosphate using T4 polynucleotide kinase and γ-²P-ATP prior to use in the above PCR. The conditions for labelling the 5' end of CD2 were as follows :

5' end primer labelling and PCR amplification of labelled probe

The 5 ' end of the primer corresponding to the template strand had to be labelled before PCR amplif ication of the desired region . Thus , the following were combined in a 1 . 5ml screw cap eppendorf tube :

Primer CD2 ( lOpmol/μl) 3μl

[γ-³²P] -ATP (Amersham Pharmacia Biotech #AA0068 ) 6μl

T4 polynucleotide kinase lOx buffer (Promega) 4μl

T4 polynucleotide kinase (5u/μl) (Promega) 5 units Sterile distilled H₂0 up to 40μl

The mixture was incubated at 37°C for 30 min . 4μl 3M sodium acetate pH6 . 0 and 80μl 100% ethanol were added, the tube mixed , and stored at - 80°C for 16h . The labelled primer was collected by centrifugation at 13000 rpm for 20 min and washed with 70% (v/v) ethanol and air-dried. Then, the remaining constituents for PCR amplification (including the unlabelled upstream primer CD1) were added to the labelled primer, and the PCR cycling program started as described above.

On completion of the PCR reaction, the PCR product was purified using the QIAquick PCR purification kit (Qiagen) and 5μl of the final 50μl eluted volume was analysed using agarose gel electrophoresis . 10 ng of purified end- labelled PCR probe was hybridised to 20 μg RNA at 45°C in 20 μl sodium trichloroacetate (NaTCA) buffer for 14 h. NaTCA buffer was prepared as described in Kieser et al . , 2000. Following hybridisation 300 μl of SI nuclease digestion mix (150 units SI nuclease (Gibco BRL #18001- 016) in IX SI digestion buffer [5x SI digestion buffer: 1.4M NaCl, 150mM sodium acetate pH .4 , 22.5 mM zinc acetate, 100 μg/ml partially cleaved and denatured herring sperm DNA (Promega #D1811) ] ) was forcibly pipetted into the hybridisation and rapidly mixed. SI digestion was continued for 45 min at 37°C. The SI digestion reactions were stopped by the addition of 75 μl SI termination mix (2.5M ammonium acetate, 0.05M EDTA) and 400μl isopropanol, and centrifuged to pellet the protected DNA fragments. Protected DNA fragments were separated by denaturing polyacrylamide gel electrophoresis and detected by autoradiography. Results and Discussion

The cydAB operon is transcribed from two promoters, one constitutive and one induced by anoxia/oxygen limitation

Expression of the cydAB operon was investigated using SI nuclease mapping. RNA was isolated from NMMP liquid medium over a one-hour time course following the onset of anoxia/oxygen limitation. Two promoters were identified, initiating transcription -115 bp, later determined to be 113 bp, {cydpl) and -245 bp { cydp2) upstream from the cydA start codon, respectively. Whereas cydp2 was constitutively expressed, cydpl was induced at least 20- fold within 15 min of the onset of anoxia/oxygen limitation.

EXAMPLE 2 : Cloning the cydpl promoter region

Materials and Methods

A DNA fragment that included the cydpl promoter but lacked the cydp2 promoter was amplified by PCR using the primers :

CDPla (5' -CGGGAATTCCGGACTCAACGGTCTGTTG-3' ) and CDPlb (5 ' -CGGTCTAGAGCGTGTTTGTCACACCCATC-3 ' )

and S. coelicolor M600 chromosomal DNA as template. The 5' ends of primers CDPla and CDPlb contain an EcoRI and an Xbal site and correspond to positions 11361 and 11535 on the sequenced cosmid SCD78, respectively, corresponding to positions 113756 to 113940 in AL939118 (GI.24413861) . The conditions used for the PCR amplification were as follows:

PCR Reaction

10x Reaction Buffer 5. Oμl

CDPla, lOpmol/μl stock 2.0μl

CDPlb lOpmol/μl stock 2.0μl dNTPs (deoxynucleotide 5~-trip osphates) l.Oμl ^* Template DNA (Streptomyces M600 chromosomal DNA) l.Oμl

40% Glycerol (5% final concentration) 6.3μl

Distilled H₂0 up to 50μl 32.7μl

Total volume 50μl

PCR Conditions :

The above components were initially mixed in a 0.5ml microcentrifuge tube without the Tag DNA polymerase, heated in a thermal cycler at 97°C for 5 min and then the heating block was set to 80°C. Tag DNA polymerase (2.5 units) was then added to the tube and the PCR reaction was ther ocycled according the following profile :

95°C for 50 sec (denaturation) }

60°C for 45 sec (annealing) } 27 cycles total 72°C for 60 sec (extension) } 70°C for 5 min 4°C hold

Following PCR using Taq polymerase (Promega) the amplified product was cloned into the vector pGEM T-easy using the DNA ligase, buffer and conditions provided and specified in the pGEM T-easy vector kit (Promega #A1360) The sequence of the cydpl clone was confirmed by DNA sequencing (provided by Genetix Ltd) . The resulting plasmid was named pSX131 (Figure 1) .

Results and Discussion

The cypdl sequence following ligation into pGEM T-easy, was :

5 ' -gaattccgga ctcaacggtc tgttgaagtt ccggcagagg ggttgacgtc acaggggacc ccccttccgg tgtcgaaaag ctgtaggtca taattgcttg tgaatgtgaa cgcgttcaca agcgtgtccc gattgcgccc gcgatgggtg tgacaaacac gctctaga-3 ' (168 bp)

The underlined sequences are non-native and were added to the primers to incorporate an upstream EcoRI site and a downstream Xbal site. (Following PCR using Taq polymerase, the PCR products have 3' A overhangs. The vector in the pGEM T-easy kit is linearised with 3' T overhangs, allowing PCR products to be directly cloned without restriction digestion. The EcoRI and Xbal sites generated by their incorporation into the oligos were therefore never digested in the cloning of the PCR product .

EXAMPLE 3: Construction and analysis of cydpl : : gfp transcriptional fusions

Materials and Methods

pSX131 was digested with EcoRI and Xbal (Roche) using standard conditions (Sambrook et al . , 1989) and the cydpl fragment gel purified using a QIAGEN gel extraction kit . The purified fragment was ligated to the integrative reporter plasmid pIJ8660 (Sun et al . , 1999), encoding green fluorescent protein (gfp) , that had been previously digested with EcoRI and Xbal. The ligation reaction was performed in a final volume of 15μl using a 1:3 molar ratio of vector to insert. T4 DNA ligase (1.5U/μl) and lOx buffer were supplied by Promega. Ligation reactions were incubated at 16°C overnight. The ligation mix was used to transform E. coli DH5α to apramycin resistance using the following method. A 50μl aliquot of competent cells (subcloning efficiency E. coli DH5α cells purchased from Gibco BRL) was thawed on ice and 7.5μl of ligation mix was then added to the tube. The mixture was incubated for 15 min on ice and heat-shocked for 90 seconds at 42°C. 1ml of L Broth (Kieser et al . , 2000) was added to the mixture and incubated for 60 min at 37°C. Transformed cells were harvested by centrifugation at 13000 rpm for 10 seconds and the pellet resuspended in the remaining L Broth. lOOμl cells were plated on L Agar plates containing ampicillin (lOOμg/ml) . The plates were inverted and incubated for 16 hours at 37°C. Transformants were inoculated into L Broth containing ampicillin (lOOμg/ml) and grown with aeration at 37°C for 16 hours. Plasmid DNA was purified from cultures and digested with Hindlll, Xbal and Sail (Roche) to check the structure and orientation of the plasmid. These restriction enzymes will distinguish between a 2. Okb fragment of the original plasmid and a 2.2kb fragment of the desired recombinant plasmid. Restriction enzyme digests were analysed by agarose gel electrophoresis to determine the sizes of the restriction fragments. A recombinant plasmid generating the restriction pattern indicative of the desired recombinant was identified and named pSX132 (Figure 1) . pSX132 was used to transform the non- ethylating helper E. coli strain ET12567 (pUZ8002) (Paget et al . , 1999) to apramycin resistance. Competent cells of ET12567/pUZ8002 were prepared according to the TSS method (Chung et al . , 1989) . pSX132 was added to 150μl competent cells and incubated on ice for 15 min. Following heat-shock for 90 seconds at 42°C, 1ml of L Broth was added to the mixture and incubated for 60 min at 37°C. Transformed cells were harvested by centrifugation at 13000 rpm for 10 seconds, most of the supernatant removed and the pellet resuspended in the remaining L Broth. lOOμl cells were plated on L Agar plates containing apramycin (lOOμg/ml) . The plates were inverted and incubated for 16 hours at 37°C. Conjugation between a resulting transformant and S. coelicolor M600 was performed as described (Kieser et al . , 2000) to give M600 (pSX132) . Briefly, a ET12567 (pUZ8002) transformant containing pSX132 was inoculated into L-broth containing apramycin (50 μg/ml), kanamycin (50 μg/ml) and chloramphenicol (12.5 μg/ml) and grown to an OD₆₀o of 0.4. 10 ml of cells were centrifuged for 10 min at 4,000 g, washed twice with 10 ml L-broth, then resuspended in 1 ml L-broth. Approximately 10⁸ S. coelicolor spores were used to inoculate 0.5 ml of 2xYT broth (Kieser et al . , 2000), heat-shocked at 50°C for 10 min, cooled on ice then mixed with 0.5 ml of the E. coli ET12567 (pUZ8002) cells prepared above. The spores and cells were concentrated by centrifugation (centrifuged at lOOOOrp in a microfuge for 1 minute, then most of the supernatant was removed and the pellet resuspended in the residual liquid of approximately 100 to 200μl) then used to inoculate a single MS (Mannitol-Soya flour [Kieser et al . , 2000]) agar plate. For localisation of GFP, M600 (pSX132) was streaked to single colonies on minimal medium (Kieser et al . , 2000) plus glucose. Colonies were carefully sliced using a razor blade, and colony sections placed on slides and analysed by confocal fluorescence microscopy.

Results and Discussion

The cydpl promoter was cloned into the integrative gfp reporter plasmid pIJ8660. pIJ8660 is derived from pSET152 (Bierman et al . , 1992), a bifunctional plasmid that integrates into the ΦC31 attachment site. The resulting plasmid pSX132 was introduced into S. coelicolor M600 by conjugation from the non-methylating E. coli strain ET12567 (pUZ8002) (Paget et al . , 1999). S. coelicolor M600 containing p8660 or piJ8660 :: cydpl (pSX132) was grown on minimal agar at 30°C for 2 days, cross-sectioned, then analysed for gfp fluoresence using confocal microscopy. Fluorescence detection was complicated by the apparent fluorescence of one of the S. coelicolor pigmented antibiotics. However, it was possible to detect green fluorescence deep in the substrate mycelium that was not present in the vector-alone control. Presumably this reflects the reduced levels of oxygen expected to occur deep in the agar.

gfp has also been detected in liquid grown mycelial pellets (data not shown) , although fluorescence has not yet been correlated with oxygen concentration. These experiments can, however, be routinely performed using a fermentor in which the concentration of oxygen is controlled. EXAMPLE 4: Construction and analysis of cydpl : :neo transcriptional fusions

Materials and Methods

pSX131 was digested with EcoRI and Xbal and the cydpl fragment gel purified using a QIAGEN gel extraction kit. The purified fragment was ligated to the neo reporter plasmid pIJ487 (Ward et al . , 1986) that had been previously digested with EcoRI and Xbal. The ligation mix was used to transform S. lividans 1326 to thiostrepton resistance using the method for protoplast formation and transformation as given in Kieser et al . , 2000. A recombinant plasmid with the expected structure was named pSX133 (Figure 2) .

Plasmid structure was checked by isolating plasmid DNA from transformants as per the method of Kieser et al . , 2000, and performing restriction enzyme digestion with EcoRI and Xbal followed by agarose gel electrophoresis to analyse the sizes of the resulting restriction fragments. Correct recombinants were selected on the basis of the presence of a 180bp fragment. Expression of the neo reporter gene was analysed by determining the conferred level of kanamycin resistance on minimal agar plates containing 0.2% casamino acids.

Results and Discussion

In order to easily screen for promoter mutants, the cydpl promoter was cloned into the multicopy neo reporter plasmid pIJ487. The resulting plasmid pSX133 conferred only low levels of kanamycin resistance on S . lividans (-2-3 μg/ml) . However it should be noted that promoter activity would only be detected using this assay if the promoter was active soon after spore germination. It is quite possible that cydpl is not expressed strongly at such early stages of growth where 0₂ is unlikely to be limiting. Although pSX133 is not useful for the routine analysis of cydpl activity, it has been useful in the characterisation of mutant versions of cydpl some of which appeared to be deregulated and conferred up to 20μg/ml kanamycin resistance (unpublished data) .

EXAMPLE 5: Construction and analysis of cydpl : :mel transcriptional fusions

Methods

pSX131 was digested with EcoRI and Xbal and the cydpl fragment gel purified using a QIAGEN gel extraction kit. The purified fragment was ligated to the mel reporter plasmid pMT3010 (Paget et al . , 1994) that had been previously digested with EcoRI and Xbal. The ligation mix was used to transform S. lividans 1326 to thiostrepton resistance using the protoplast formation and transformation method given in Kieser et al . , 2000. Plasmid structure was checked by isolating plasmid DNA from transformants as per the method of Kieser et al . , 2000 and performing restriction enzyme digestion with EcoRI and HindiII to differentiate between a 1.8kb fragment that would be obtained from the original pMT3010 plasmid and a 2. Okb fragment that would be obtained from the desired recombinant plasmid. Restriction enzyme digestions were analysed by agarose gel electrophoresis to analyse the sizes of the resulting restriction fragments . A recombinant plasmid with the expected structure was identified and named pSX134 (Figure 2) . Promoter activity was determined by growing the strain on minimal agar plates containing 0.5 g /l tyrosine.

Results and Discussion

A 175bp DNA fragment containing the anoxia-/oxygen limitation-inducible cydpl promoter was cloned into the multicopy mel reporter plasmid pMT3010. S. lividans containing the resulting plasmid pMT3010 :: cydpl (plasmid pSX134) or pMT3010 was grown on minimal agar plus tyrosine at 30°C for 3 days. pSX134 conferred on S. lividans the ability to convert tyrosine to the black pigment melanin, confirming that the cydpl promoter was present on the 175 bp fragment. However it was impossible to determine the localisation of melanin due to its diffusion in the medium. pSX134 may be useful in screening for regulatory mutants that no longer express or over express cydpl .

EXAMPLE 6: Construction of cydpl promoter mutants

Materials and Methods

As shown in Fig. 3, a series of 13 mutations were made in the cydpl promoter region, each replacing contiguous sections of 6bp native DNA with a BamHI restriction site (GGATCC) . Of particular interest to this invention, mutants M12 and M13 were constructed using the inversely orientated primers pairs DMCD23/DMCD24 and DMCD25/DMCD26 , respectively.

DMCD23 5 ' -TCCGAACGCGTTCACAAGCGTGT-3 ' DMCD24 5 ' -TCCACAAGCAATTATGACCTACA-3 ' DMCD25 5 ' -TCCGTTCACAAGCGTGTCCCGAT-3 ' DMCD26 5'- CCACATTCACAAGCAATTATGA-3 '

Mutant Mil was similarly constructed using the primer pair DMCD21/DMCD22.

DMCD21 5 ' -TCCGAATGTGAACGCGTTCACAA-3 ' DMCD22 5 ' -TCCAATTATGACCTACAGCTTTT-3 '

Prior to PCR each primer was phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ATP as recommended by the manufacturer. PCR reactions were set up as follows: Pfu DNA polymerase buffer (5μl; Stratagene) ; phosphorylated oligonucleotide primers (20pmol) ; pSX131 (lOng) ; deoxynucleotide triphisphosphate mix (200μM, Roche) ; water (to 50μl) . The reaction was heated to 97°C for 5 min then set to 80°C whereupon 5 units Pfu DNA polymerase (Stratagene) was added. Amplification was achieved by cycling lOx (96°C, 50s,^■ 60°C, 45s; 72°C, 7.5min) then lOx (96°C, 50s ; 60°C, 45s; 72°C, 10.5min), then 72°C, 20min. On completion the PCR reaction was extracted with an equal volume of 1:1 phenol/chloroform (pH8.0) (phenol from USB, chloroform from BDH Laboratory Supplies) , then run on an agarose gel. The PCR product, corresponding in size to linear pSX131, was excised from the gel and purified using a gel purification kit (Qiagen) as recommended by the manufacturer. The pure fragment was self-ligated overnight at 16°C in a final volume of 20 μl using T4 DNA ligase (New England Biolabs) as recommended by the manufacturer. Ligation mixes were use to transform competent Escherichia coli DH5α (Life Technologies GIBCOBRL) by the following method. Competent cells (50μl aliquots) were initially thawed on ice for 3-4 minutes and 7.5μl of the ligation mix was then added to the tube. The mixture was incubated for 15 minutes at 4°C and heat shocked for 90 seconds at 42°C. 1ml of L Broth was added to the mixture, which was then incubated for 60 minutes at 37°C. Transformed cells were harvested by centrifugation at 13000 rpm and the pellet resuspended in the remaining L Broth medium. lOOμl was then plated on L Agar plates supplemented with ampicillin (lOOμg/ml) . The plates were then incubated for 12-16 hours at 37°C. Possible transformants were picked up with a loop and grown up at 37°C in L Broth medium plus amplicillin. Plasmid DNA was purified from transformants and checked for the presence of the mutation by digestion with BamHI . The plasmids were named pSX131::Ml to pSX131::M13.

EXAMPLE 7: Construction and analysis of mutant cydpl : :neo transcriptional fusions: identification of a repressor binding site (ROP) using cassette mutagenesis

Materials and Methods

The cydpl M12 and M13 mutant promoters were cloned into pIJ487 as follows. pSX131::M12 or pSX131::M13 were digested with EcoRI and Xbal and the cydpl fragment gel purified using a QIAquick gel extraction kit (Qiagen) . The purified fragment was ligated to the neo reporter plasmid pIJ487 (Ward et al.,1986) that had been previously digested with EcoRI and Xbal. The ligation mixtures were used to transform S. lividans 1326 protoplasts (prepared according to the procedure outlined in Kieser et al . , 2000) to thiostrepton resistance. Recombinant plasmids were initially checked by digesting them with EcoRI and Xbal and then by sequencing (by MWG- BIOTECH) the mutated promoter fragments to reveal the expected structure and sequence. Recombinant plasmids carrying the M12 or M13 mutation were named pSX133::M12 or pSX133::M13, respectively. Expression of the neo reporter gene was analysed by replica-plating on to minimal agar plates (Kieser et al . , 2000) containing 0.5% glucose, 0.2% casamino acids and 2 μg/ml or 8 μg/ml kanamycin. Growth indicates promoter activity.

Results and Discussion

In order to identify possible regulator binding sites in the cydpl region a contiguous series of mutant promoters were constructed, each with only 6bp native DNA replaced by the BamHI restriction site GGATCC . 12 mutants were constructed M1-M13 (Mil was not successfully constructed at this stage, though was later) covering the cydpl promoter region from approximately -65 to +15. Each mutant promoter was cloned in to pIJ487 and analysed for activity by replica-plating to agar containing various concentrations of kanamycin. Of relevance to the current invention, M12 and M13 both gave increased levels of kanamycin resistance suggesting that the promoter was more active. This in turn suggests that the binding site for a repressor protein has been disrupted in the M12 and M13 mutants. Analysis of the sequence revealed a 16bp palindromic sequence, 5 ' -TGTGAACGCGTTCACA-3 ' , that overlapped the site of each mutation. DNA binding proteins often bind to palindromic sequences, further suggesting that this was indeed the target site for a cydpl repressor. Such sites for this repressor are herein termed ROP sites (Rex operator) .

EXAMPLE 8: Preparation of S . coelicolor crude protein extracts

Materials and Methods

S. coelicolor M600 was grown in 50ml NMMP + 0.5% glucose liquid medium (Kieser at al . , 2000) to an OD₄₅₀ of 0.5- 0.6. The culture was poured into 50ml tubes then harvested by centrifugation at 4,000 rpm for 5 min at room temperature. The pellet was washed in 0.9% ice-cold NaCl and harvested by centrifugation as before. The pellet was resuspended in 500μl lysis buffer [25mM Tris- HC1 pH8.0, 5mM EDTA, 5% (v/v) glycerol , ImM DTT (dithiothreitol , always added prior to use) , ImM protease inhibitor Prefabloc (Roche) (always added prior to use) , 150mM NaCl] , then sonicated 4x10s using a hand-held Braun sonicator. Insoluble material was removed by centrifugation for 20 min at 13,000 rpm in a refrigerated microcentrifuge (Eppendorf) . The lysates were stored on ice .

EXAMPLE 9: Detection of NADH- sensitive, ROP-specific DNA binding activity in S . coelicolor crude cell extracts using gel shift analysis

Materials and Methods

The cydpl EcoRI -Xbal fragment from pSX131 or pSX131:-.M12 was purified using a QIAquick gel extraction kit (Qiagen) and labelled with ³²P-CTP and DNA polymerase Klenow fragment for 15 min at room temperature. Reaction mixtures contained: DNA (50ng) ; Sure Buffer H (Roche) ; Klenow enzyme (Roche) ; dATP, dTTP, and dGTP (Roche) ; and ³²P-CTP (NEN) . The labelled probe was purified from unincorporated nucleotides using a PCR purification kit (Qiagen) according to manufacturer's recommendations.

For each gel shift the following reaction was set up: 2μl probe (~2ng) ; 2μl 5x binding buffer [20mM Tris HCI (pH8) , 5% glycerol, 0. ImM EDTA, lO M 2-mercaptoethanol, 0. ImM Prefabloc (Roche)]; 4μl crude extract; lμl herring sperm DNA (Promega; lμg) ; lμl water. Cofactors NAD or NADH (Sigma) were added as required. Gel shift assays were performed at room temperature. The gel used for all gel shift assays was 6% native polyacrylamide gel (Severn Biotech Ltd) and the time of running the gels was about 45-60 minutes at a constant 140V.

Results

Gel-shift analysis revealed the presence of a protein in S. coelicolor crude extracts that bound to the cydpl promoter region. This DNA binding activity was reproducibly present in S . coelicolor extracts isolated from exponentially growing mycelium. When the experiment was repeated using the cydpl M12 mutant, a shift was barely detectable implying that the observed DNA binding activity was specific to the ROP site and probably reflects binding by the repressor.

Although the cydpl promoter is activated under anoxic/oxygen limited conditions, the actual signal sensed was not known. The discovery that the cydpl promoter is also induced by zinc ions (data not shown) suggests that it is not oxygen itself but a change in the redox status of some component (s) in the electron transport chain. It was recently found that the redox status of the quinone pool modulates the ArcAB system in E. coli (Georgellis et al . , 2001). The redox status of the NAD/NADH pool is also likely to change under anoxic/oxygen limited conditions, although to date no regulator has been discovered in bacteria that senses and responds to this change. The transfer of electrons from

NADH to quinones, catalysed by NADH dehydrogenase, is the first step in the electron transport chain. Therefore, any condition, such as anoxia/oxygen limitation, that blocks electron flow will result in a build up in NADH and a decrease in the NAD⁺/NADH ratio. To test the possibility that NADH affects the ability of the repressor to bind ROP, varying concentrations of NADH were added to gel shift reactions. The addition of NADH caused a reduction in the shift seen with S. coelicolor crude cell extracts. This suggests that NADH somehow modulates the activity of the ROP-binding repressor.

EXAMPLE 10: Identification and characterisation of the rex promoter: the rex-hem operon promoter is regulated by anoxia/oxygen limitation

Materials and Methods

A sequence closely related to the ROP site was identified upstream of the rex-hem operon by searching the whole genome sequence of S. coelicolor using the editing program Artemis (Sanger Centre: www.sanger.ac.uk/Software/Artemis). The rex-hem promoter region was SI mapped using a 360 bp probe generated by PCR using primers :

E68 . 18C1 (5 ' -GGCGACGGTGGCCTCGGGAATC -3 ' ) and E68 . 18C2 (5 ' - CTTCTGGCGTGTGAACGAGGAA - 3 ' )

and S . coelicolor M600 chromosomal DNA as template . The 5 ' end of E68 . 18cl was phosphorylated with ³²P phosphate using T4 polynucleotide kinase (New England Biolabs ) and γ-³²P-ATP (Amersham Pharmacia Biotech Ltd) by the ^• following method :

5 ' end primer labelling reaction :

primer to be labelled 30pmol (3 μl from a stock of lOpmol/μl ) [γ-³²P] -ATP 6μl

T4 PNK lOx buffer 3 μl

T4 PNK ( 5u/μl) 5 units

Sterile distilled H₂0 up to 30μl

The reaction took place in a 1.5ml screw cap eppendorf tube. The mixture was mixed gently and incubated at 37°C for at least 30 minutes. 1/lOth of the volume of 3M sodium acetate pH6.0 and twice the volume of 100% (v/v) ethanol were then added to the tube, the reagents mixed and the tube stored at -80°C overnight. The labelled primer was collected by centrifugation at 13000rpm for 20 minutes, washed with 70% (v/v) ethanol and air dried for 10-20 minutes before redissolving .

10 ng of purified end-labelled probe was hybridised to 30 μg RNA at 45°C in 20 μl sodium trichloroacetate (NaTCA) buffer for 14 h. NaTCA buffer was prepared as described in Kieser et al . , 2000. Following hybridisation, 300 μl of SI nuclease digestion mix (150 units SI nuclease in IX SI digestion buffer [5x SI digestion buffer: 1. M NaCl, 150mM sodium acetate pH4.4 , 22.5 mM zinc acetate, 100 μg/ml partially cleaved and denatured herring sperm DNA (Promega #D1811)]) was forcibly pipetted into the hybridisation and rapidly mixed. SI digestion was continued for 45 min at 37°C. The SI digestion reactions were stopped by the addition of 75 μl SI termination mix (2.5M ammonium acetate, 0.05M EDTA) and 400μl isopropanol, and centrifuged to pellet the protected DNA fragments. Protected DNA fragments were separated by denaturing polyacrylamide gel electrophoresis and detected by autoradiography. RNA for the experiment was identical to that used to map the cydpl promoter (see cydpl methods) .

Results and Discussion

Autoregulation, where a regulator controls expression of its own gene, is a relatively common phenomenon. Therefore, as a step to possibly identifying the regulator gene, we searched for further promoters that were likely to be controlled by the repressor, paying particular attention to regulatory genes. Searches for ROP-like sequences gave one particularly good "hit" upstream from a likely four gene operon (SCE68.18c to SCE68.15c) the last three genes of which encode three enzymes involved in heme biosynthesis. The ROP-like sequence was 5 ' -TGTGCACGCGTTCACA-3 ' and matched the ROP site upstream from cydAB at 15/16 positions. The first gene of the operon has been annotated as a DNA binding protein by the Sanger Centre, and is herein referred to as rex. SI nuclease mapping was performed on the rex-hem operon using RNA isolated from mycelium that had been subjected to anoxia/oxygen limitation for 15 min. This was the same RNA used to map the cydpl promoter. A promoter upstream from the rex-hem operon was indeed induced by anoxia/oxygen limitation, suggesting that the repressor binds this ROP-like sequence.

EXAMPLE 11: Cloning and overexpression of the rex gene

Materials and Methods

A DNA fragment that included the rex gene was amplified by PCR using ^'the primers:

DBPciii (5' -CGGGAATTCATATGGCAACTGGCCGAGCACACCGA-3 ' ) and DBP18ci (5' -CGGGGATCCGCTGCGGTGGCTCAGTCC -3')

and S . coelicolor M600 chromosomal DNA as template. The 5' ends of primers DBPciii and DBPci contain an EcoRI and a BamHI site, respectively, and correspond to positions 19418 and 18609, respectively, on the sequenced cosmid SCE68 (EMBL accession no. AL079345, also available from ftp : //ftp . sanger . ac .uk/pub/S_coelicolor/cosmid_inserts/St E68. seq obtained from the Sanger centre website htt : //www. sanger. ac .uk/Proj ects/S coelicolor/) . These positions correspond to positions 48241 to 47432 in AL939116 (GI : 24413781) .

A PCR reaction was set up containing: chromosomal DNA (lOOng) , dNTPs 300μM (Roche) , primers (150 pmol each) , Pfu buffer (Stratagene), 5% glycerol , in a final reaction volume of 50ml. After hot start at 96oC for 5 min, 5units Pfu (Stratagene) was added and the reaction was cycled as follows: 28x (96°C 40s, 60°C 45s, 72°C 3min) then 72°C for 5min. On completion the PCR reaction was extracted with an equal volume of phenol chloroform (pHδ.O), then purified using a PCR purification kit (Qiagen) . The fragment was digested with EcoRI and BamHI and ligated, using T4 DNA ligase (New England Biolabs) to pBlusescript II SK+ (Stratagene) that had been digested with EcoRI and BamHI. Ligation reactions were performed at 16°C for 12-16 hours and the resultant reaction mxitures were used to transform competent E. coli DH5α cells (GIBCOBRL Life

Technologies) using the method previously described and recombinant colonies were screened using blue/white selection on L Agar medium supplemented with ampicillin (lOOμg/ml final cone.) and X-gal (40μg/ml final cone.) . Transformed cells were grown at 37°C for 12-16 hours.

Recombinant plasmids were checked by digesting with EcoRI and BamHI for the presence of the expected band of 0.9kb as visualised on a 1% agarose gel electrophoresis gel. A recombinant plasmid that contained the rex gene was named pSX135 (later re-named pSX136; references in subsequent examples to pSX136 are to this plasmid) .

An Ndel -BamHI fragment containing rex gene was isolated from pSX135 (later re-named pSX136) and subcloned into the expression plasmid pET15b (Novagen) that had been cut with the same enzymes. Ligation reactions used T4 DNA ligase (New England Biolabs) and proceeded at 16°C for 14 h. The ligation reaction was used to transform competent Escherichia coli DH5α cells (GIBCOBRL Life Technologies) to ampicillin resistance using the method described previously, and potential recombinants tested by digestion of miniprep DNA using Xbal and EcoRI. Plasmids with the correct structure should generate a band of 0.9kb as visualised by agarose gel electrophoresis. A recombinant plasmid with the expected structure was named pET15b::rex (later re-named pSX135; references in subsequent examples to pSX135 are to this plasmid) . Overexpression of rex was achieved by using pET15b::rex (later re-named pSX135) to transform competent E. coli BL21 (pLysS) to ampicillin resistance. Competent cells were prepared using the TSS method described by Chung et al . (1989) . A transformant was used to inoculate 5ml Luria Broth (LB) containing ampicillin (lOOμg/ml) and chloramphenicol (25μg/ml) and incubated in a shaking incubator at 37°C overnight. The overnight culture was used to inoculate a 30ml LB containing ampicillin (lOOμg/ml) and chloramphenicol (25μg/ml) and incubated with shaking at 37°C until an OD600 0.6. Induction was achieved using ImM IPTG (final concentration) and a further three hours incubation. His-tagged Rex protein was purified from cells using a Ni-NTA spin kit (Qiagen) according to manuf cturer's recommendations. Following this purification procedure the Rex protein appeared to be >95% pure as judged on Coomassie stained SDS-PAGE gels.

To further purify Rex, Rex protein that had been partially purified by Ni-affinity chromatography was treated with thrombin (Sigma) , then purified to >95% purity by gel filtration using a Superdex 200 HiLoad 16/60 column (Amersham Biosciences) .

EXAMPLE 12: Gel shift analysis using partially purified Rex and the cydpl promoter: rex encodes a protein that binds to ROP; the Rex binding activity is modulated by the redox status of NAD (H) Materials and Methods

The gel shift reactions were set up as described for crude cell extracts, except that various amounts of purified Rex (O.lng to lOOng) were added in place of the crude extracts. Protein concentrations were determined using the Bicinchronic Acid kit (Sigma) according to manufacturer's instructions. NAD⁺ or NADH were included at various concentrations in gel -shift reactions that contained lOng Rex.

Results and Discussion

Annotation of the rex gene as a DNA binding protein appears to stem from work carried out on a homologous protein from Thermus aquaticus (Du and Pene, 1999) . In this work it was noted that the protein bound to AT rich DNA sequences but no function was assigned. Comparison of Rex to other proteins in the database revealed that it is well conserved amongst Gram-positive bacteria (Figure 4). Of particular note was a sequence GxGxxG which occurs in all homologues. This sequence is conserved in proteins that contain a Rossmann fold - a structural fold that is usually associated with pyridine nucleotide binding (Lesk, 1995) .

In support of this, the sequence-structure homology recognition program FUGUE (Shi et al . , 2001) predicted homology between Rex (residues -90 to -190) and several dinucleotide-binding domains of known structure. One of the closest structural homologues was biliverdin reductase (BVR; Z-score 11.6), which catalyses the last step in heme degradation and is aligned with Rex homologues in Figure 4B. The Rossmann fold typically consists of two sets of β-α-β-α-β units, which together form a parallel β-sheet flanked by α-helices (Lesk, 1995) . The first and third glycines in the GxGxxG motif play important structural roles; the first allows a tight turn of the main chain from the βl strand into the loop and the third allows the close packing of helix αA with βl (Lesk, 1995; Figure 4). The role of the central glycine is to permit close contact between the main chain and the pyrophosphate of the nucleotide. Dehydrogenases that use NAD (H) rather than NADP (H) often contain an acidic residue (aspartate or glutamate) at the C-terminal edge of β2 that interacts with the 2 ' -OH group of the adenosine ribose of NAD (H) (Lesk, 1995; Baker et al . , 1992) . Aspι₆ is located in this position and is highly conserved in Rex homologues, supporting the idea that Rex binds NAD (H) via a Rossmann fold.

To test if Rex was the ROP binding protein, the rex gene' was amplified by PCR and cloned into the E. coli His-tag expression plasmid pET15b. His-tagged Rex was purified to >95% homogeneity then used in gel-shift assays. Purified Rex shifted the cydpl promoter fragment but did not shift the cydpl M12 mutant promoter. This confirms that Rex binds to the ROP sequence and most likely represents the ROP-binding activity seen in S. coeli color crude cell extracts .

To see if the purified Rex responded to the redox status of NAD(H), gel shift reactions were performed in the presence of increasing concentrations of NAD⁺ or NADH. The results showed that whereas 2mM NAD⁺ had little effect on Rex binding activity, as little as lOOμM NADH inhibited DNA binding activity. This further supports the idea that the ROP-binding activity seen in S. coeli color crude extracts corresponds to Rex and that Rex DNA-binding activity is directly modulated by the redox status of the NAD(H) pool.

EXAMPLE 13: Gel shift analysis using purified Rex and the rex promoter: the DNA binding activity of Rex is modulated by micromolar levels of NADH.

Materials and Methods

Gel shift assays were performed using a 200 bp fragment that included the rex promoter, which was amplified by PCR using the primers :

E68.18cl (5'- GGCGACGGTGGCCTCGGGAAT - 3) and rexGSrev (5 ' - CGGGAATTCGCGTGACCCCGGTCACGTTGGC- ' 3 )

and S. coelicolor M600 chromosomal DNA as template. Following PCR using Taq polymerase (Bioline) the amplified product was run on a 0.9% agarose gel, excised from the gel, purified using a QIAquick Gel Extraction Kit (QIAGEN) and then 5 ' end-labelled using [γ-³²P] -ATP (Amersham) and T4 Polynucleotide Kinase (New England Biolabs) . Gel-shift assays contained in a final volume of 10 μl: DNA probe (~1 nM) ; binding buffer (20 M Tris-HCl, pH 8.0, 5% v/v glycerol, 1 mM MgCl₂, 40 mM KCl) ; pure Rex protein (50nM) ; 1 μg herring sperm DNA (Promega) ; and a range of NADH (Melford) concentrations, as indicated. Following 15 min incubation at room temperature the binding reactions were separated by electrophoresis in a 6% polyacrylamide gel. Bands were detected using a Storm phosphorimager (Amersham) , quantified, and binding curves were plotted as % Rex-DNA complex versus NADH concentration. Values were normalised to 0 μM NADH (100% Rex-DNA complex) . The concentration of NADH required to generate a -50% loss of the Rex-DNA complex (IC₅₀) was determined from the best-fit curve.

Results and Discussion

Gel shift experiments using a wide range of NADH concentrations and purified Rex indicated that, for 50 nM Rex, the concentration of NADH required to generate an -50% loss of the Rex-DNA complex was ~6 μM (data not shown; Brekasis and Paget , 2003). Although the concentration of NADH in the S. coelicolor cytoplasm has not been determined, this figure is thought to be physiologically relevant.

EXAMPLE 14: Mutagenesis of the Rex GxGxxG motif: evidence that Rex binds NADH using a Rossmann fold.

Materials and Methods

A Rex^G102A mutant was constructed by PCR mutagenesis using the primers

G102Afor 5'- CACCGAGGTTGGCGATACCGACG- ' 3 G102Arev 5'- CGTCGGTATCGCCAACCTCGGTG- 3

converting the central glycine (GGC codon) in the GxGxxG Rossmann fold fingerprint to an alanine (GCC codon) . 200 pmol of each primer was phosphorylated using T4 polynucleotide kinase (Biolabs) and ATP (Sigma) . PCR reactions were set up as follows: Pfu DNA polymerase buffer (5μl; Stratagene); phosphorylated oligonucleotide primers (30pmol) ; pSX135 (lOng) ; deoxynucleotide triphisphosphate mix (200 μM, Roche) ; water (to 50 μl) . The reaction was heated to 96 °C for 5 min then set to 80 °C whereupon 5 units Pfu DNA polymerase (Stratagene) was added. Amplification was achieved by cycling 27x

(96°C, 40s; 60°C, 45s; 72°C, 20 min) then 72°C, 25min. On completion the PCR reaction was extracted with an equal volume of 1:1 phenol/chloroform (pH8.0) (phenol from USB, chloroform from BDH Laboratory Supplies) . The amplified PCR product was self-ligated using T4 DNA ligase

(Biolabs) for 6 h at room temperature, then treated with Dpnl . The mixture was used to transform E. coli DH5 to ampillicin resistance and a plasmid that contained the correct mutation was named pSX135^G102A. Overexpression and purification of Rex ^G102A was performed as outlined in

Example 11. Gel shift assays were performed using the rex promoter fragment (1 nM) and purified Rex^G102A protein (35 nM) as described in Example 13. NAD⁺, NADH, NADP⁺ or NADPH (Melford) were added to final concentrations of 0.1 mM or 1 mM and the reactions were separated by electrophoresis on 6% polyacrylamide gels.

Results and Discussion

The Rex amino acid sequence G100-I101-G102-N103-L104-G105 corresponds to the fingerprint GxGxxG motif found in the Rossmann fold of pyridine nucleotide-binding proteins. Whereas the first and third glycine residues are predicted to play important structural roles, and therefore were not targeted for mutagenesis, the role of the central glycine is to permit close contact between the main peptide chain and the pyrophosphate of the nucleotide. In gel shift assays it was found that as much as 1 mM NADH (or any of the other pyridine nucleotides) had no effect on the ability of Rex^G102A to bind to DNA. This strongly suggests that the Rex^G102A mutant cannot bind NADH, and further strengthens the idea that Rex interacts with NADH via a classical Rossmann fold.

EXAMPLE 15 : Rex senses the NADH/NAD⁺ redox balance

Materials and Methods

Gel shift experiments were performed as detailed in Example 13 except that in each assay an increase in NADH was balanced by a decrease in NAD⁺ such that the combined concentration of NADH plus NAD⁺ was maintained either at 0.25 mM (Experiment 1) or 1 mM (Experiment 2) . In both experiments the concentrations of NADH used were 0 μM, 0.1 μM, 0.5 μM, 1 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM, 17.5 μM, 50 μM, 100 μM, and 250 μM.

Results and Discussion

There are two possible explanations for the failure of NAD⁺ to inhibit Rex DNA binding activity. Either 1) NAD⁺ does not bind to Rex or 2) an NAD⁺-Rex complex retains ROP-binding activity. If the second possibility were true then NAD⁺ might compete with NADH for binding, thereby reducing its ability to inhibit Rex DNA binding activity. It was indeed found that the presence of balanced levels of NAD⁺ in the gel shift assays influenced the ability of NADH to inhibit Rex DNA binding activity. The binding curves revealed that the IC₅₀ for the loss of Rex DNA binding activity was 5 μM NADH when the total nucleotide concentration was 0.25 mM (ie 245 μM NAD⁺) , and 20 μM when the total nucleotide concentration was 1 mM (ie 980 μM NAD⁺) . In other words the four-fold increased levels of NAD⁺ in Experiment 2 compared to Experiment 1 required a four-fold greater concentration of NADH to inhibit DNA binding suggesting that NAD⁺ competes with NADH for binding Rex. In both Experiment 1 and Experiment 2, the IC₅₀ of NADH was equivalent to 2% of the total nucleotide pool. This implies that, over a certain range of total nucleotide concentrations (minimally 0.25 mM to 1 mM) , Rex is able to sense the NADH/NAD redox poise rather than NADH concentration per se. This is likely to be physiologically important because if Rex were to respond only to NADH concentration, then any change in the total NADH plus NAD⁺ cofactor level that occurred irrespective of redox change, would influence the ability of Rex to bind DNA. Competition between NAD⁺ and NADH for Rex binding, with opposite regulatory outcomes, allows Rex to act as a redox sensor, not simply as a monitor of NADH concentration.

EXAMPLE 16: Construction and analysis of a rex deletion mutant: the cyd and rex-hem operons are regulated by rex .

Materials and Methods

The SCO3320 (rex) open reading frame was replaced with an apramycin resistance cassette using the PCR-directed approach described by Gust et al. (2003) . Briefly, a gene replacement cassette containing an apramycin resistance gene { apr) and an RK2 origin of transfer ( ori T) was amplified from pIJ773 (Gust et al . , 2003) by PCR using the primers :

RexKOfor ( 5 ' - GCGGGGGTCAACTCCGCGAAGCTGCGCAAGGACTTCTCCAT TCCGGGGATCCGTCGACC- 3 )

RexKOrev (5'- GGCCTCCTCGCCCGCCTTGCGCTGCTCGTGGAAGGCGAGTG TAGGCTGGAGCTGCTTC- ' 3 )

The primers were specifically designed to contain 39 nt 5' homology extensions corresponding to the N-terminal or C-terminal regions of rex, and 20 nt 3 ' homology to the unique priming sites at each end of the gene replacement cassette. The PCR product was recombined into the rex- containing cosmid SCE68 using E. coli BW25113 (pIJ790) as host, thereby creating a replacement mutation in which only the first 50 and last 36 codons of rex were present. The mutant allele was recombined into the M600 chromosome as described (Gust et al . , 2003). A ΔSCO3320 : :apr mutant was identified and named S105. However, S105 grew poorly, was delayed in aerial mycelium development, and produced faster-growing suppressor mutants at a high frequency. Nonetheless, the isolation of a stable S105 suppressor, named S105^supl, allowed an initial investigation into the in vivo function of rex.

S. coelicolor cultures M600 and S105^SUP1 were grown in 50 ml NMMP liquid medium to an OD₄₅₀ of 0.6-0.8. The cultures were limited for oxygen by sealing 15 ml aliquots in tubes as detailed in Example 1. RNA was purified at 15 min intervals as described in Example 1, except that the mycelium was isolated by rapidly filtering onto a nitrocellulose filter. The probes used for SI nuclease mapping cyd and rex promoter regions were prepared as described in Example 1 and Example 10, respectively. SI nuclease mapping reactions and their analysis was performed as described in Example 10. Results and Discussion

In order to see if rex regulates genes that possess an upstream ROP site, the rex gene was deleted from the chromosome and replaced with an apramycin resistance cassette. Although the rex mutation was unstable, probably due to polar effects on the downstream heme biosynthetic genes, a stable suppressor S105^supl was isolated. In RNA isolated from S105^supl both the cydpl promoter and the rex promoter were upregulated at the first time point, before the onset of oxygen limitation. This indicates that rex regulates these two genes, presumably through the interaction of the Rex protein with the ROP site located in each promoter region. This data substantiates the claim that Rex regulates the cyd and rex-hem operons in vivo .

EXAMPLE 17: Confirmation of the site of Rex-DNA interaction using a DNase I footprinting assay

Materials and Methods

DNase I footprinting studies were performed as described by Takano et al . , 2001. Specifically, 40 pmol of oligonucelotide primer CD2 (Example 1) was uniquely labelled on the 5' end with [γ-³²P] - ATP using T4 polynucleotide kinase (Promega) and used, with oligonucleotide primer CD1 (Example 1) , in a PCR reaction to amplify a 400 bp DNA fragment that included the cydpl promoter region. The amplified fragment was purified using a QIAquick PCR purification kit (QIAGEN) . 30ng of labelled DNA was incubated in DNase I binding buffer (30 mM Tris-base pH8 , 2 mM EDTA, 5% glycerol, 1 mM MgCl₂, 40 mM KC1, and 1 mM DTT) containing Iμg Herring sperm DNA (Promega) and a range of Rex concentrations. After incubation at 30°C for 10 min, 25 μl of DNase I digestion buffer (10 mM Tris-base pH8 , 10 mM MgCl₂, 5 mM CaCl₂, 10% glycerol) was added. After 1 min, 0.1 unit of DNase I (Promega) was added, the mixture incubated for 2 min at 37°C and the reaction terminated by adding 50 μl of DNase I stop solution (20 mM EDTA, 200 mM NaCl, 1% SDS) . The DNA fragments were purified by 50 μl phenol -chloroform extraction and precipitated with one tenth of the volume 3M sodium acetate pH6, two volumes of ethanol and lμl glycogen (Boehringer Mannheim-Roche) . DNA fragments were separated by denaturing polyacrylamide gel electrophoresis and detected by autoradiography . A sequencing reaction was run alongside the DNasel footprinitng lanes to define the extent of the protected DNA.

Gel shift assays were performed using the cydpl promoter fragment, derived mutant promoters cydpl-Mil and cydpl-

M12, and purified Rex as described in Example 9 except that 1) purified Rex was used and 2) no pyridine nucleotides were added to the assays.

Results and Discussion

To confirm that Rex interacted specifically with the ROP site, DNasel footprinting assays were performed on the cydpl promoter. In these assays the Rex-DNA complex was subjected to partial degradation by DNasel, which degrades any DNA that is not protected by a protein. The results indicated that Rex protects a region of 32 nucleotides (5'- TTGCT TGTGA A TGTG AACGC GTTCA CAAGC GT- 3'), which includes the ROP site (underlined). However the ROP site is not central to this region suggesting that Rex binds additionally to DNA located immediately upstream from the main ROP site. This upstream region includes a possible ROP half-site (5'-TGTGA ATG-3'), which may constitute an additional binding site. Support for this idea came from gel shift analysis using mutant cydpl promoter fragments Mil and M12 (Example 6 and Figure 3B) . In the cydpl-Mil mutant the sequence (5'- GCTTG T-3'), which partially overlaps the ROP half-site, was replaced with the sequence (5'-GGATC C-3'). Gel-shift analysis using the wild-type cydpl promoter fragment gave rise to two shifted bands, with the upper shifted band appearing in a concentration-dependent manner. However, with the cydpl-Mll mutant fragment, only the lower shifted band was detected, and with the cydpl-M12 mutant fragment neither upper nor lower shifted bands were detected. In combination with the DNasel footprinting data, this strongly suggests that the lower shifted band corresponds to Rex interacting with the main complete ROP site and that the upper band corresponds to Rex additionally interacting with the upstream half-site. It is possible that such an arrangement of a complete ROP site together with an appropriately positioned upstream ROP half-site improves the overall affinity between the operator sequence and Rex. The cydpl operator region may therefore have unique properties that allow particularly stringent repression.

SUMMARY

The cydpl promoter is induced under anoxic/oxygen limited conditions and also by treatment with zinc, both conditions that are likely to inhibit passage of electrons through the electron transport chain. By identifying a binding site for a repressor in the cydpl promoter region we were able to search for other co- regulated promoters in the genome. This led to the identification of a co-regulated gene that encoded the regulator itself, Rex. Purified Rex was able to bind directly to the cydpl region suggesting that Rex regulates cydpl and the rex promoter in vivo. Indeed a constructed rex chromosomal deletion mutation conferred upregulated expression of both the cydpl and rex promoters. DNasel footprinting assays, and gel shift assays using mutant cydpl promoter fragments, indicated that the cydpl operator includes an upstream half ROP site that may increase the affinity of the operator for Rex. Rex DNA binding activity is very sensitive to NADH levels, being completely inactivated with 0. ImM NADH. Indeed, as little as ~5μM NADH causes 50% inhibition of Rex. In contrast up to 2mM NAD⁺ had little effect on DNA binding activity. However, NAD⁺ was able to compete with

NADH for binding to Rex, which means that, over a certain range of total nucleotide concentrations (minimally 0.25 mM to 1 mM) , Rex is able to sense the NADH/NAD⁺ redox poise rather than NADH concentration per se . It therefore seems likely that Rex is a major regulator of cellular redox, responding to changes in the NADNNADH ratio, modulating the expression of components of the electron transport chain accordingly. Searches of the S. coelicolor genome sequence using the consensus ROP site will probably reveal further members of the Rex regulon. REFERENCES

All references cited herein, including (but not limited to) those listed below, are hereby incorporated by reference in their entirety, and for all purposes.

Baker, P. J., Britton, K.L. , Rice,D.W., Rob, A. and Stillman, T. J. (1992) Structural consequences of sequence patterns in the fingerprint region of the nucleotide binding fold. Implications for nucleotide specificity. J. Mol . Biol . , 228, 662-671.

Bierman, M. , Logan, R. , O'Brien, K. , Seno, E.T., Rao R.N. , and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp . Gene 116: 43-49.

Bourn WR, Babb B. (1995) Computer assisted identification and classification of streptomycete promoters. Nucleic Acids Res. 23:3696-703.

Brekasis, D. and Paget, M.S.B. (2003) A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3 (2) . EMBO J 22 : 4856-4865.

Butler MJ, Bruheim P, Jovetic S, Marinelli F, Postma PW, Bibb MJ. (2002) Engineering of primary carbon metabolism for improved antibiotic production in Streptomyces lividans. Appl Environ Microbiol . 2002 Oct ; 68 (10) : 4731-9.

Chakraburtty, R. and Bibb, M.J. (1997) The ppGpp sythetase [relA) of Streptomyces coelicolor A3 (2) plays a conditional role in antibiotic production and morphological differentiation. J Bacteriol 179: 5854- 5861.

Chung, C. T. et al . (1989) One-step preparation of competent E. coli: Transformation and storage of bacterial cells in the same solution. Proc . Natl . Acad . Sci . USA 86:2172-2175.

Du X, Pene JJ (1999) Identification, cloning and expression of p25, an AT-rich DNA-binding protein from the extreme thermophile, Thermus aquaticus YT-1. Nucleic Acids Res 27:1690-7.

de Felipe L and Hugenholtz, J. (1999) Pyruvate flux distribution in NADH-oxidase-overproducing Lactococcus lactis strain as a function of culture conditions. FEMS Microbiol Lett 179: 461-6

Georgellis D, Kwon O, and Lin EC (2001) Quinones as the redox signal for the arc two-component system of bacteria. Science 292: 2314-6

Gust,B., Challis,G.L. , Fowler, K. , Kieser, T. and Chater,K.F. (2003) PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc . Na tl . Acad . Sci . U S A . , 100, 1541-1546.

Kieser, T. , Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, D.A. (2000) Practical Streptomyces Genetics.

Norwich: The John Innes Foundation. Kikuchi,A., Park,S.Y., Miyatake,H., Sun,D., Sato,M., Yoshida,T. and Shiro,Y. (2001) Crystal structure of rat biliverdin reductase. Nat. Struct. Biol., 8, 221-225.

Lesk AM (1995) NAD-binding domains of dehydrogenases. Current Opinion in Structural Biology 5: 775-783.

McGuffin,L. J. , Bryson,K. and Jones, D.T. (2000) The PSIPRED protein structure prediction server. Bioinformatics, 16, 404-405.

Magnolo SK et al (1991) Actinorhodin production by Streptomyces coelicolor and growth of Streptomyces lividans are improved by the expression of a bacterial hemoglobin. Biotechnology (NY) 1991 May, 9(5):473-6.

Paget, M.S.B., Hintermann, G. and Smith, CP. (1994) Construction and application of streptomycete promoter probe vectors which employ the Streptomyces glaucescens tyrosinase-encoding gene as reporter. Gene 146: 105-110.

Paget, M.S.B., Chamberlin, L. Atrih, A., Poster, S.J. and Buttner, M.J. (1999) Evidence that the extracytoplasmic function sigma factor, σ^E, is required for normal cell wall structure in Streptomyces coeli color A3 (2) . J^" Bacteriol 181: 204-211.

Paget, M.S.B., Bae, J.-B., Hahn, M.-Y., Li, W. , Kleanthous, C, Roe, J.-H., and Buttner, M.J. (2001) Mutational analysis of RsrA, a zinc-binding anti-sigma factor with a thiol-disulphide redox switch. Mol Microbiol 39: 1036-1047. Rojo, F., (1999) Repression of transcription initiation in bacteria. J. Bacteriol 181: 2987-2991.

Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Habor, NY.

Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual (3rd edition) , Cold Spring Harbor Laboratory Press, Cold Spring Habor, NY.

Semsey S, Geanacopoulos M, Lewis DE, Adhya S. (2002) Operator-bound GalR dimers close DNA loops by direct interaction: tetramerization and inducer binding. EMBO J. Aug 15,-21 (16) :4349-56

Shi.J., Blundell_.T.L. and Mizuguchi,K. (2001) FUGUE: sequence structure homology recognition using environment-specific substitution tables and structure- dependent gap penalties. J. Mol. Biol., 310, 243-257

Sun J, Kelemen GH, Fernandez-Abalos JM, Bibb MJ. (1999) Green fluorescent protein as a reporter for spatial and temporal gene expression in Streptomyces coeli color A3 (2). Microbiology 145: 2221-2227.

Takano,E., Chakraburtty, R. , Nihira,T., Yamada,Y. and Bibb, M.J. (2001) A complex role for the γ-butyrolactone SCBl in regulating antibiotic production in Streptomyces coelicolor A3 (2) . Mol . Mi crobiol . , 41, 1015-1028.

Ward, J.M., Janssen, G.R., Kieser, T., Bibb, M.J., Buttner, M. J. , and Bibb, M.J. (1986) Construction and characterisation of a series of multi -copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase gene from Tn5 as indicator. Mol Gen Genet 203: 468-478.

Claims

1. A nucleic acid up to 2kb in length, comprising an operator sequence, wherein the operator sequence is selected from the group consisting of:

(a) the nucleotide sequence 5'-TGTGA ACGCG TTCAC A- 3' ;

(b) the nucleotide sequence 5'-TGTGC ACGCG TTCAC A- 3' ; (c) the nucleotide sequence 5'-TGTGA CCTGC TTCAC A- 3' ;

(d) the nucleotide sequence 5'-TGTGA CAGCA AGCAC A- 3' ;

(e) a nucleotide sequence which has at least 10 nucleotides identical with the nucleotide sequence of

(a) , (b) , (c) or (d) above;

(f) the nucleotide sequence 5'-TGTGN NNNNN NNCAC A- 3' , wherein N is any nucleotide; or

(g) a nucleotide sequence which is the reverse complement of the nucleotide sequence of any one of (a) to (f) above.

2. The nucleic acid of claim 1, wherein the nucleotide sequence of (e) or (f) has the ability to be specifically bound by Rex protein having the amino acid set out for S. coelicolor in Fig. 4A, or by a homologue thereof which is able to specifically bind to the nucleotide sequence of any one or more of (a) to (d) .

3. The nucleic acid of claim 1 or claim 2, wherein the nucleotide sequence of (e) has at least 11, 12, 13, 14 or 15 nucleotides identical with the nucleotide sequence of any one or more of (a) to (d) .

4. The nucleic acid of any preceding claim, wherein the nucleotide sequence of (e) also falls within the definition of (f) .

5. The nucleic acid of any preceding claim, which is up to 1.5kb, l.Okb, 0.8kb, 0.6kb, 500bp, 400bp, 300bp, 200bp, lOObp, 80bp, 60bp, 50bp, 40bp, 30bp or 20bp in length.

6. A nucleic acid comprising an operator sequence as defined in any one of claims 1 to 4 and a promoter sequence, wherein the nucleic acid is either recombinant, or is up to 2kb in length.

7. A nucleic acid according to claim 6, which is up to 1.5kb, l.Okb, 0.8kb, 0.6kb, 500bp, 400bp, 300bp, 200bp, or lOObp in length.

8. A nucleic acid according to claim 6 or claim 7, wherein the promoter is prokaryotic.

9. A nucleic acid according to claim 8, which comprises all or part of the nucleic acid sequence shown in Figure 3A.

10. A nucleic acid according to claim 9, which comprises the nucleic acid sequence:

5J -agaggggttg acgtcacagg ggacccccct tccggtgtcg aaaagctgta ggtcataatt gcttgtgaat gtgaacgcgt tcacaagcgt g-3'

11. A nucleic acid according to claim 9 or claim 10, which is isolated from the cydp2 promoter of s. coelicolor.

12. A nucleic acid according to claim 8, which comprises the reverse complement of the nucleic acid sequence:

5 ' -accgccccgt cgaatgcagg ctatgtcttt gtgaacgcgt gcacaaagat ggtgtccgat ttgcccggcc-3 '

13. A nucleic acid according to any one of claims 6 to 12, wherein the operator sequence functions to at least partially inhibit transcription from the promoter sequence when bound by Rex protein having the amino acid sequence set out for S. coelicolor in Fig. 4A, or by a homologue thereof .

14. A recombinant nucleic acid comprising a promoter sequence, an operator sequence as defined in any one of claims 1 to 4 , and a nucleic acid sequence of interest under the control of the promoter sequence, wherein the operator sequence, the promoter sequence and the nucleic acid of interest do not naturally occur in the same relationship as in the recombinant nucleic acid.

15. A nucleic acid according to claim 14, wherein at least one of the operator sequence, the promoter sequence and the nucleic acid sequence of interest is derived from a source different from at least one other said sequence.

16. A nucleic acid according to claim 14 or claim 15, which comprises all or part of the nucleic acid sequence shown in Figure 3A.

17. A nucleic acid according to claim 16, which comprises the nucleic acid sequence:

5' -agaggggttg acgtcacagg ggacccccct tccggtgtcg aaaagctgta ggtcataatt gcttgtgaat gtgaacgcgt tcacaagcgt g-3'

18. A nucleic acid according to claim 14 or claim 15, which is isolated from the cydp2 promoter of S. coelicolor.

19. A nucleic acid according to claim 14 or claim 15, which comprises the reverse complement of the nucleic acid sequence : 5 ' -accgccccgt cgaatgcagg ctatgtcttt gtgaacgcgt gcacaaagat ggtgtccgat ttgcccggcc-3'

20. A vector comprising a nucleic acid according to any one of claims 1 to 19.

21. A vector according to claim 20, which additionally comprises a coding sequence for Rex protein having the amino acid sequence set out for S. coelicolor in Fig. 4A, or by a homologue thereof .

22. A host cell comprising a nucleic acid or vector according to any preceding claim.

23. A host cell according to claim 22, which is a streptomycete cell.

24. A host cell according to claim 23, which is a cell of the species Streptomyces coelicolor.

25. A host cell according to any one of claims 22 to 24, which, at least under conditions of low oxygen concentration and/or high NADH concentration and/or low NAD⁺/NADH ratio, naturally expresses Rex protein having the amino acid set out for S. coelicolor in Fig. 4A, or a homologue thereof capable of binding to an operator sequence as defined in any one of claims 1 to 4.

26. A host cell according to any one of claims 22 to 25, which recombinantly expresses Rex protein having the amino acid set out for S. coelicolor in Fig. 4A, or a homologue thereof capable of binding to an operator sequence as defined in any one of claims 1 to 4.

27. A host cell according to claim 26, wherein the expression is under the control of a constitutive promoter.

28. A method of providing for preferential expression of a nucleic acid of interest in a host cell when the host cell is subject to low oxygen concentration and/or low NADNNADH ratio and/or high NADH concentration, the method comprising providing a host cell according to any one of claims 23 to 27 and propagating the host cell in a cell culture medium.

29. A method according to claim 28, wherein the host cell is allowed to propagate until a stationary phase of cell culture is reached.

30. Use of an operator sequence as defined in any one of claims 1 to 4 to impart oxygen sensitivity and/or sensitivity to NADH concentration and/or sensitivity to NADNNADH ratio to a promoter sequence.

31. A method of imparting oxygen sensitivity and/or sensitivity to NADH concentration and/or sensitivity to NADNNADH ratio to a promoter, the method comprising recombining said promoter with an operator sequence as defined in any one of claims 1 to 4.

32. A method or use according to claim 30 or claim 31, wherein transcription from the promoter is at least partially inhibited under conditions of high oxygen concentration and/or low NADH concentration and/or high NAD⁺/NADH ratio, in the presence of Rex protein or a homologue thereof .

33. Use of a nucleic acid comprising an operator sequence as defined in any one of claims 1 to 4 for the identification of homologues of the Rex protein that are capable of binding the operator sequence.

34. Use of:

(a) a nucleic acid comprising an operator sequence as defined in any one of claims 1 to 4 ; and

(b) Rex protein having the amino acid set out for S. coelicolor in Fig. 4A, or a homologue thereof that is capable of binding said operator sequence for the identification of compounds that are capable of modulating the binding of the Rex protein or homologue to the operator sequence.

35. Use according to claim 33 or claim 34, wherein the nucleic acid is the nucleic acid of any one of claims 1 to 19.

36. A nucleic acid comprising an open reading frame that encodes a protein having any one of the amino acid sequences shown in Fig. 4A, wherein the nucleic acid is isolated from one or more open reading frames of an operon in which the naturally occurring open reading frame appears and/or isolated from the regulatory sequences with which the open reading frame is naturally associated.

37. A nucleic acid according to claim 36, which comprises an open reading frame that encodes the S. coelicolor Rex protein shown in Fig. 4A, wherein the nucleic acid is isolated from one or more other open reading frames of the rex-hem operon.

38 . A nucleic acid comprising an isolated open reading frame that encodes an amino acid sequence having at least 35% amino acid sequence identity, or at least about 50% amino acid similarity, to the amino acid sequence of the S . coelicolor Rex protein shown in Fig . 4A, wherein the encoded amino acid sequence is other than :

mkvpeaaisr litylrilee leaqgvhrts seqlgelaqv tafqvrkdls yfgsygtrgv gytvpvlkre lrhilglnrk wglcivgmgr lgsaladypg fgesfelrgf fdvdpekvgr pvrggviehv dllpqrvpgr ieialltvpr eaaqkaadl l vaagikgiln fapvvlevpk evavenvdf l agltrlsfai lnpk reemm g .

39 . A nucleic acid according to claim 38 , wherein the level of identity is at least 50 % .

40. A nucleic acid according to claim 38 or claim 39, wherein the level of similarity or identity is at least 80%.

40. A nucleic acid according to claim 38 or claim 39, wherein the level of similarity or identity is at least 90%.

41. A nucleic acid according to any one of claims 36 to 40, which further comprises a promoter in operative association with the open reading frame.

42. A vector comprising the nucleic acid of any one of claims 36 to 41.

43. A host cell comprising the vector of claims 42.

44. An isolated polypeptide encoded by the open reading frame as defined in any one of claims 36-40.

45. An isolated polypeptide according to claim 44, which comprises the amino acid motif GxGxxG, wherein x is any amino acid.

46. An isolated polypeptide according to claim 45, which comprises the amino acid motif G (I/V/A/C) GN(L/l) G.