WO2004024162A1 - 2-amino-4-quinazolinones as lxr nuclear receptor binding compounds - Google Patents

2-amino-4-quinazolinones as lxr nuclear receptor binding compounds Download PDF

Info

Publication number
WO2004024162A1
WO2004024162A1 PCT/EP2003/007067 EP0307067W WO2004024162A1 WO 2004024162 A1 WO2004024162 A1 WO 2004024162A1 EP 0307067 W EP0307067 W EP 0307067W WO 2004024162 A1 WO2004024162 A1 WO 2004024162A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound according
protected
amino
alkyl
mammal
Prior art date
Application number
PCT/EP2003/007067
Other languages
French (fr)
Inventor
Ulrich Deuschle
Ralph Loebbert
Beatrix Blume
Manfred Koegl
Claus Kremoser
Ingo Kober
Ulrike Bauer
Kristina Hermann
Original Assignee
Phenex Pharmaceuticals Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Phenex Pharmaceuticals Ag filed Critical Phenex Pharmaceuticals Ag
Priority to JP2004535046A priority Critical patent/JP2006502169A/en
Priority to AU2003296861A priority patent/AU2003296861A1/en
Priority to CA002498655A priority patent/CA2498655A1/en
Publication of WO2004024162A1 publication Critical patent/WO2004024162A1/en
Priority to US11/076,163 priority patent/US20050261319A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D239/00Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/70Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
    • C07D239/72Quinazolines; Hydrogenated quinazolines
    • C07D239/95Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in positions 2 and 4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/12Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links

Definitions

  • the present invention relates to compounds according to the general formula (1), which bind to the LXR receptors and act as agonists and antagonists of the LXR receptors.
  • the invention further relates to the treatment of diseases and/or conditions through binding of said nuclear receptor by said compounds and the production of medicaments using said compounds.
  • Multicellular organisms are dependent on advanced mechanisms of information transfer between cells and body compartments.
  • the information that is transmitted can be highly complex and can result in the alteration of genetic programs involved in cellular differentiation, proliferation, or reproduction.
  • the signals, or hormones are often simple molecules, such as peptides, fatty acid, or cholesterol derivatives.
  • NR nuclear receptors
  • Orphan receptors may be indicative of unknown signaling pathways in the cell or may be nuclear receptors that function without ligand activation. The activation of transcription by some of these orphan receptors may occur in the absence of an exogenous ligand and/or through signal transduction pathways originating from the cell surface (Mangelsdorf, D. J. et al., The nuclear receptor superfamily: the second decade, Cell 83, 835-839, 1995). In general, three functional domains have been defined in NRs. An amino terminal domain is believed to have some regulatory function.
  • a DNA-binding domain hereinafter referred to as "DBD” usually comprises two zinc finger elements and recognizes a specific Hormone Responsive Element hereinafter referred to as "HRE” within the promoters of responsive genes. Specific amino acid residues in the “DBD” have been shown to confer DNA sequence binding specificity (Schena, M. & Yamamoto, K.R., Mammalian Glucocorticoid Receptor Derivatives Enhance Transcription in Yeast, Science, 241:965-967, 1988).
  • a Ligand-binding-domain hereinafter referred to as "LBD” is at the carboxy-terminal region of known NRs.
  • Coactivators or transcriptional activators are proposed to bridge between sequence specific transcription factors and the basal transcription machinery and in addition to influence the chromatin structure of a target cell.
  • proteins like SRC-1, ACTR, and Gripl interact with NRs in a ligand enhanced manner (Heery et al., A signature motif in transcriptional coactivators mediates binding to nuclear receptors, Nature, 387, 733 - 736; Heinzel et al., A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression, Nature 387, 43 - 47, 1997).
  • Nuclear receptor modulators like steroid hormones affect the growth and function of specific cells by binding to intracellular receptors and forming nuclear receptor-ligand complexes. Nuclear receptor-hormone complexes then interact with a hormone response element (HRE) in the control region of specific genes and alter specific gene expression.
  • HRE hormone response element
  • LXR Liver X Receptor
  • LXRa also known as LXRalpha, RLD-1 and NR1H3
  • LXRb also known as LXRbeta, NER, NER1, UR, OR-1, R1P15 and NH1H2
  • ligands of LXR should be under- stood to include ligands of LXRa or LXRb.
  • LXR is a prototypical type 2 nuclear receptor which activates genes upon binding to promoter region of target genes in a prototypical het- erodimeric fashion with Retinoid X Receptor (hereinafter RXR, Forman et al., Cell, 81, 687- 93, 1995).
  • RXR Retinoid X Receptor
  • the relevant physiological ligands of LXR seem to be oxidized derivatives of cholesterol, including 22-hydroxy cholesterol and 24,25 (S)-epoxy cholesterol (Lehmann, et al., Biol. Chem. 272(6), 3137-40, 1997).
  • the oxysterol ligands bound to LXR were found to regulate the expression of several genes that participate in cholesterol metabolism (Janowski, et al., Nature, 383, 728-31, 1996).
  • LXR is proposed to be a hepatic oxysterol sensor. Upon activation (e.g. binding of oxysterols) it influences the conversion of dietary cholesterol into bile acids by upregulating the transcription of key genes which are involved in bile acid synthesis such as CYP7A1. Hence, activation of LXR in the liver could result in an increased synthesis of bile acids from cholesterol which could lead to decreased levels of hepatic cholesterol.
  • This proposed LXR function in hepatic cholesterol metabolism was experimentally confirmed using knockout mice. Mice lacking the receptor LXRa lost their ability to respond normally to an increase in dietary cholesterol and did not induce transcription of the gene encoding CYP7A1. This resulted in accumulation of large quantities of cholesterol in the livers and impaired hepatic function. (Peet, et al., Cell, 93, 693-704, 1998).
  • an ideal synthetic LXR binding compound should have properties that retain the agonistic activity on hepatic bile acid formation and ABC-transporter -mediated decrease in cholesterol uptake from the diet and increased cholesterol efflux from macrophages.
  • such a compound should lack the hyperlipidemic potential which is exerted through increased fatty acid and triclyceride synthesis.
  • HDL High Density lipoproteins
  • LDL Low Density Lipoproteins
  • the present invention provides, inter alia, novel LXR nuclear receptor protein binding compounds according to the general formula (1) shown below. Said compounds are also binders of mammalian homologues of said receptor. Further the object of the invention was solved by providing for amongst the LXR nuclear receptor protein binding compounds according to the general formula (1) such compounds which act as agonists, antagonists or mixed agonists / antagonists of the human LXR receptor or a mammalian homologue thereof.
  • the invention provides for LXR agonists that may be used for the manufacture of a medicament for the treatment of cholesterol associated conditions or diseases.
  • LXR agonists that may be used for the manufacture of a medicament for the treatment of cholesterol associated conditions or diseases.
  • HDL High Density lipoproteins
  • LDL Low Density Lipoproteins
  • the invention provides for a compound according to the following formula (1), or pharmaceutical acceptable salts or solvates thereof, hereinafter also referred to as the "compounds according to the invention” including particular and preferred embodiments thereof, wherein
  • R ⁇ ; R , R 3 and/or R 4 is independently from each other selected from H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C alkyl, Ci to C 6 substituted alkyl, to C alkoxy, C t to C substituted alkoxy, C ⁇ to C 7 acyl, Ci to C 7 substituted acyl, Ci to C 7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hy- droxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Ci to C 6 al- kyl)carboxamide, protected N-(Ci to C 6 alkyl)carboxamide, N, N-di(C ⁇ to C 6 al- kyl)carboxamide, trifluoromethyl,
  • R 5 is H, Ci to C 8 alkyl, to C 8 substituted alkyl, C to C 12 alkyl- phenyl or C 7 to C ⁇ 2 substituted phenylalkyl
  • R 6 is H, Ci to C 8 alkyl, to C 8 substituted alkyl, C to C 12 alkylphenyl or C 7 to C 12 substituted phenylalkyl
  • R 7 is H, Ci to C 8 alkyl, Ci to C 8 substituted alkyl, C to C ⁇ alkylphenyl or C 7 to C 12 substituted phenylalkyl
  • R 6 and R may be taken together with nitrogen to form a heterocycle or substituted heterocycle or a heteroaryl or substituted heteroaryl ring.
  • the compounds of the invention can also exist as solvates and hydrates. Thus, these compounds may crystallize with, for example, waters of hydration, or one, a number of, or any fraction thereof of molecules of the mother liquor solvent.
  • the solvates and hydrates of such compounds are included within the scope of this invention.
  • H denotes a hydrogen atom
  • Ci to C 7 acyl encompasses groups such as formyl, acetyl, propionyl, butyryl, pentanoyl, pivaloyl, hexanoyl, heptanoyl, benzoyl and the like. Preferred acyl groups are acetyl and benzoyl.
  • Ci to C 7 substituted acyl denotes the acyl group substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, cyclohexyl, naphthyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C alkoxy, to C acyl, Ci to C acyloxy, nitro, Ci to C 6 alkyl ester, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(C ⁇ to C 6 alkyl)carboxamide, protected N-( to C 6 alkyl)carboxamide, N,N-di(C ⁇ to
  • substituted phenyl specifies a phenyl group substituted with one or more, and preferably one or two, moieties chosen from the groups consisting of halogen, hydroxy, protected hydroxy, cyano, nitro, C t to C 6 alkyl, Ci to C 6 substituted alkyl, Ci to C 7 alkoxy, Ci to C substituted alkoxy, Ci to C 7 acyl, Ci to C substituted acyl, to C 7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hy- droxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-( to C 6 al- kyl)carboxamide, protected N-(C ⁇ to C alkyl)carboxamide, N, N-di(C ⁇ to C ⁇ to C
  • substituted phenyl includes a mono- or di(halo)phenyl group such as 2, 3 or 4-chlorophenyl, 2,6-dichlorophenyl, 2,5-dichlorophenyl, 3,4-dichlorophenyl, 2, 3 or 4- bromophenyl, 3,4-dibromophenyl, 3-chloro-4-fluorophenyl, 2, 3 or 4-fluorophenyl and the like; a mono or di(hydroxy)phenyl group such as 2, 3 or 4-hydroxyphenyl, 2,4-dihydroxyphenyl, the protected-hydroxy derivatives thereof and the like; a nitrophenyl group such as 2, 3 or 4-nitrophenyl; a cyanophenyl group, for example, 2, 3 or 4- cyanophenyl; a mono- or di(alkyl)phenyl group such as 2, 3 or 4-methylphenyl, 2,4- dimethylphenyl, 2, 3 or 4-(iso
  • substituted phenyl represents disubsti- tuted phenyl groups wherein the substituents are different, for example, 3-methyl-4- hydroxyphenyl, 3 -chloro-4-hydroxyphenyl, 2-methoxy-4-bromophenyl,
  • heteroaryl means a heterocyclic aromatic derivative which is a five-membered or six-membered ring system having from 1 to 4 heteroatoms, such as oxygen, sulfur and/or nitrogen, in particular nitrogen, either alone or in conjunction with sulfur or oxygen ring atoms.
  • heteroaryls include pyridinyl, pyrimidinyl, and pyrazinyl, pyridazinyl, pyrrolo, furano, thiopheno, oxazolo, isoxazolo, phthalimido, thiazolo and the like.
  • substituted heteroaryl means the above-described heteroaryl is substituted with, for example, one or more, and preferably one or two, substituents which are the same or different which substituents can be halogen, hydroxy, protected hydroxy, cyano, nitro, to C 6 alkyl, Ci to C 7 alkoxy, Ci to C substituted alkoxy, d to C acyl, Ci to C substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hy- droxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(C ⁇ to C 6 alkyl)carboxamide, protected N-(C ⁇ to C 6 alkyl)carboxamide, N, N-di(C ⁇ to C 6 alkyl
  • substituted naphthyl specifies a naphthyl group substituted with one or more, and preferably one or two, moieties either on the same ring or on different rings chosen from the groups consisting of halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C 6 alkyl, Ci to C 7 alkoxy, Ci to C 7 acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(C ⁇ to C 6 alkyl)carboxamide, protected N-(C ⁇ to C 6 al- kyl)carboxamide, N, N-di(C ⁇ to C 6 alkyl)carboxamide, trifluoromethyl, N-((C ⁇ to)
  • substituted naphthyl includes a mono or di(halo)naphthyl group such as 1, 2, 3, 4, 5, 6, 7 or 8-chloronaphthyl, 2, 6-dichloronaphthyl, 2, 5-dichloronaphthyl, 3, 4- dichloronaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-bromonaphthyl, 3, 4-dibromonaphthyl, 3-chloro-4- fluoronaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-fluoronaphthyl and the like; a mono or di(hydroxy)naphthyl group such as 1, 2, 3, 4, 5, 6, 7 or 8-hydroxynaphthyl, 2, 4- dihydroxynaphthyl, the protected-hydroxy derivatives thereof and the like; a nitronaphthyl group such as 3- or 4-nitronaphthyl; a cyan
  • substituted naphthyl represents disubstituted naphthyl groups wherein the substituents are different, for example, 3- methyl-4-hydroxynaphth- 1 -yl, 3 -chloro-4-hydroxynaphth-2-yl, 2-methoxy-4-bromonaphth- 1 - yl, 4-ethyl-2-hydroxynaphth-l-yl, 3-hydroxy-4-nitronaphth-2-yl, 2-hydroxy-4-chloronaphth- 1-yl, 2-methoxy-7-bromonaphth-l-yl, 4-ethyl-5-hydroxynaphth-2-yl, 3-hydroxy-8- nitronaphth-2-yl, 2-hydroxy-5-chloronaphth-l-yl and the like.
  • Ci to C 8 alkyl denotes such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, amyl, tert-amyl, hexyl , n-heptyl, 2-heptyl, 3-heptyl, 4-heptyl, 2-methyl-lhexyl, 2-methyl-2hexyl, 2-methyl-3 -hexyl, n-octyl and the like.
  • Examples of the above substituted alkyl groups include the 2-oxo-prop-l-yl, 3-oxo-but-l-yl, cyanomethyl, nitromethyl, chloromethyl, hydroxymethyl, tetrahydropyranyloxymethyl, trity- loxymethyl, propionyloxymethyl, amino, methylamino, aminomethyl, dimethylamino, carboxymethyl, allyloxycarbonylmethyl, allyloxycarbonylaminomethyl, methoxymethyl, eth- oxymethyl, t-butoxymethyl, acetoxymethyl, chloromethyl, bromomethyl, iodomethyl, trifluoromethyl, 6-hydroxyhexyl, 2,4-dichloro(n-butyl), 2-aminopropyl, 1-chloroethyl, 2- chloroethyl, 1- bromoethyl, 2-chloroethyl, 1-fluoroethyl, 2-fluoroethyl, 1-
  • C 8 substituted alkyl denotes that the above Q to C 8 alkyl groups are substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, C 3 to C 7 cycloalkyl, naphthyl, amino, protected amino, (monosubsti- tuted)amino, protected (monosubstituted)amino, (disubstituted)amino, guanidino, protected guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C alkoxy, Ci to C 7 acyl, Ci to C acyloxy, nitro, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(Q to C 6 alkyl)carboxamide, protected N-(C ⁇ to C 6 alkyl)carboxamide,
  • C 7 to C ⁇ phenylalkyl denotes a Ci to C 6 alkyl group substituted at any position by a phenyl, substituted phenyl, heteroaryl or substituted heteroaryl. Examples of such a group include benzyl, 2-phenylethyl, 3-phenyl(n-propyl), 4-phenylhexyl, 3-phenyl(n-amyl), 3- phenyl(sec-butyl) and the like.
  • Preferred C to C ⁇ 2 phenylalkyl groups are the benzyl and the phenylethyl groups.
  • C to C ⁇ 2 substituted phenylalkyl denotes a C to C 1 phenylalkyl group substituted on the d to C 6 alkyl portion with one or more, and preferably one or two, groups chosen from halogen, hydroxy, protected hydroxy, oxo, protected oxo, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, guanidino, protected guanidino, heterocyclic ring, substituted heterocyclic ring, substituted heterocyclic ring, substituted heterocyclic ring, Ci to C 6 alkyl, Ci to C 6 substituted alkyl, Ci to C alkoxy, Ci to C substituted alkoxy, Ci to C acyl, Q to C substituted acyl, Ci to C acyloxy, nitro, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-
  • C 7 to C 12 substituted phenylalkyl examples include groups such as 2-phenyl-l- chloroethyl, 2-(4-methoxyphenyl)ethyl, 4-(2,6-dihydroxy phenyl)n-hexyl, 2-(5-cyano-3- methoxyphenyl)n-pentyl, 3-(2,6-dimethylphenyl)n-propyl, 4-chloro-3-aminobenzyl, 6-(4- methoxyphenyl)-3-carboxy(n-hexyl), 5-(4-aminomethylphenyl)- 3-(aminomethyl)n-pentyl, 5- phenyl-3-oxo-n-pent-l-yl and the like.
  • R 6 and R 7 may be taken together with nitrogen to form a heterocycle or substituted heterocycle of the following kind aziridine, azetidine, pyrrolidine, 3- methylpyrrolidine, 3-aminopyrrolidine, 3-hydroxypyrrolidine, pyrazolidine, imidazolidine, piperidine, 2-methylpiperidine, piperazine, morpholine, azepine, tetrahydroisoquinoline
  • heterocycle or “heterocyclic ring” denotes optionally substituted five-membered to eight-membered rings that have 1 to 4 heteroatoms, such as oxygen, sulfur and/or nitrogen, in particular nitrogen, either alone or in conjunction with sulfur or oxygen ring atoms.
  • heteroatoms such as oxygen, sulfur and/or nitrogen, in particular nitrogen, either alone or in conjunction with sulfur or oxygen ring atoms.
  • These five-membered to eight-membered rings may be saturated, fully unsaturated or partially un- saturated, with fully saturated rings being preferred.
  • Preferred heterocyclic rings include mor- pholino, piperidinyl, piperazinyl, 2-amino-imidazoyl, tetrahydrofurano, pyrrolo, tetrahydro- thiophen-yl, hexylmethyleneimino and heptylmethyleneimino.
  • substituted heterocycle or "substituted heterocyclic ring” means the above- described heterocyclic ring is substituted with, for example, one or more, and preferably one or two, substituents which are the same or different which substituents can be halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C ⁇ 2 alkyl, Ci to C 12 alkoxy, Ci to C 1 substituted alkoxy, Ci to C 12 acyl, Ci to C 12 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstiruted)amino, protected (monosubstituted)amino, (disubstituted)amino carbox- amide, protected carboxamide, N-(Ci to Q 2 alky ⁇ )carboxamide, protected N-(C ⁇ to C ⁇ 2 al- kyl)carboxamide, N, N-di(C ⁇
  • Ci to C 8 alkoxy denotes groups such as methoxy, ethoxy, n- propoxy, isopropoxy, n-butoxy, t-butoxy and like groups. A preferred alkoxy is methoxy.
  • Ci to C 8 substituted alkoxy means the alkyl portion of the alkoxy can be substituted in the same manner as in relation to Ci to C 8 substituted alkyl.
  • Ci to C 8 aminoacyl encompasses groups such as formyl, acetyl, propionyl, buty- ryl, pentanoyl, pivaloyl, hexanoyl, heptanoyl, octanoyl, benzoyl and the like.
  • Ci to C 8 substituted aminoacyl denotes the acyl group substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, cyclo- hexyl, naphthyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C 12 alkoxy, Ci to C 12 acyl, Ci to C 12 acyloxy, nitro, Ci to C 12 alkyl ester, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(C ⁇ to C 12 alkyl)carboxamide, protected N-(C ⁇ to C 12 alkyl)carboxamide, N,
  • Ci to C 8 substituted acyl groups include 4-phenylbutyroyl, 3-phenylbutyroyl, 3-phenylpropanoyl, 2- cyclohexanylacetyl, cyclohexanecarbonyl, 2-furanoyl and 3 -dimethylaminobenzoyl.
  • This invention provides a pharmaceutical composition comprising an effective amount of a compound according to the invention.
  • Such compounds can be administered by various routes, for example oral, subcutaneous, intramuscular, intravenous or intracerebral.
  • the preferred route of administration would be oral at daily doses of the compound for adult human treatment of about 0.01 -5000 mg, preferably 1-1500 mg per day.
  • the appropriate dose may be administered in a single dose or as divided doses presented at appropriate intervals for example as two, three four or more subdoses per day.
  • inert, pharmaceutically acceptable carriers are used.
  • the pharmaceutical carrier can be either solid or liquid. Solid form preparations include, for example, powders, tablets, dispersible granules, capsules, cachets, and suppositories.
  • a solid carrier can be one or more substances which can also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, or tablet disintegrating agents; it can also be an encapsulating material.
  • the carrier is generally a finely divided solid which is in a mixture with the finely divided active component.
  • the active compound is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired.
  • a low-melting wax such as a mixture of fatty acid glycerides and cocoa butter is first melted and the active ingredient is dispersed therein by, for example, stirring. The molten homogeneous mixture is then poured into convenient-sized molds and allowed to cool and solidify.
  • Powders and tablets preferably contain between about 5% to about 70% by weight of the active ingredient.
  • Suitable carriers include, for example, magnesium carbonate, magnesium ste- arate, talc, lactose, sugar, pectin, dextrin, starch, tragacanth, methyl cellulose, sodium carboxymethyl cellulose, a low-melting wax, cocoa butter and the like.
  • compositions can include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component (with or without other carriers) is surrounded by a carrier, which is thus in association with it.
  • a carrier which is thus in association with it.
  • cachets are also included. Tablets, powders, cachets, and capsules can be used as solid dosage forms suitable for oral administration.
  • Liquid pharmaceutical compositions include, for example, solutions suitable for oral or par- enteral administration, or suspensions, and emulsions suitable for oral administration.
  • Sterile water solutions of the active component or sterile solutions of the active component in sol- vents comprising water, ethanol, or propylene glycol are examples of liquid compositions suitable for parenteral administration.
  • Sterile solutions can be prepared by dissolving the active component in the desired solvent system, and then passing the resulting solution through a membrane filter to sterilize it or, alternatively, by dissolving the sterile compound in a previously sterilized solvent under sterile conditions.
  • a compound is claimed according to formula (1) above, or pharmaceutical acceptable salts or solvates thereof, wherein R ⁇ ; R 2 , R 3 , R 4 , is H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C 6 alkyl, Ci to C 6 substituted alkyl, Ci to C 7 alkoxy, Ci to C 7 substituted alkoxy, Ci to C acyl, d to C substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(C ⁇ to C 6 alkyl)carboxamide, protected N-(C ⁇ to C 6 alkyl)carboxamide, N, N-di(C ⁇ to C 6 alky
  • a compound is provided, or pharmaceutical acceptable salts or solvates thereof, wherein R 1; R 2 , R 3 , Rj, is H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C 6 alkyl, Ci to C 6 substituted alkyl, Ci to C 7 alkoxy, Ci to C 7 substituted alkoxy, Ci to C 7 acyl, Ci to C 7 substituted acyl, Ci to C 7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disub- stituted)amino, carboxamide, protected carboxamide, N-(C ⁇ to C 6 alkyl)carboxamide, pro- tected N-(C ⁇ to C 6 alkyl)carboxamide, N, N-di(C ⁇ to C 6 alkyl)carboxamide
  • a particularly preferred compound which may act as agonist of LXR is shown in formula (6) below.
  • the inventors have been able to demonstrate that the compound according to formula (3) has a low effective concentration at LXR with an EC 50 of 0.5 ⁇ M wherein the EC 5 0 reflects the half-maximal effective concentration, and which is higher than the EC 50 of 0.015 ⁇ M for the published LXR agonist TO901317 (J. Schultz et al, Genes Dev. 14, 2831-2838, 2000)
  • the inventors have also found the compounds according to formula (4, 5 and 6) (shown below) to be active as agonist of the LXR human nuclear receptor (see figures for details).
  • the invention relates to a compound as described above wherein said compounds is capable of binding the LXR receptor protein or a portion thereof according to SEQ ID NO. 1 (Fig. 3 A to F) or a mammalian homologue thereof.
  • the claimed compound can bind to the LXR receptor protein or a portion thereof in a mixture comprising 10-200 ng of LXR receptor protein, a fusion protein containing LXR or a portion thereof, preferably the ligand binding domain, fused to a Tag, 5-100 mM Tris /HC1 at pH 6,8-8,3 ; 60-1000 mM KC1; 0-20 mM MgC12; 100-1000ng/ ⁇ l BSA in a total volume of preferably about 25 ⁇ l).
  • a mammalian receptor protein homologue of the protein according to SEQ ID NO. 1 as used herein is a protein that performs substantially the same task as LXR does in humans and shares at least 40% sequence identity at the amino acid level, preferably over 50 % sequence identity at the amino acid level more preferably over 65 % sequence identity at the amino acid level, even more preferably over 75 % sequence identity at the amino acid level and most preferably over 85 % sequence identity at the amino acid level.
  • the invention in particular concerns a method for prevention or treatment of a LXR receptor protein or LXR receptor protein homologue mediated disease or condition in a mammal comprising administration of a therapeutically effective amount of a compound according to the invention wherein the prevention or treatment is directly or indirectly accomplished through the binding of a compound according to the invention to the LXR receptor protein or to the LXR receptor protein homologue.
  • the term mediated herein means that the physiological pathway in which the LXR receptor protein acts is either directly or indirectly involved in the disease or condition to be treated or prevented.
  • it could be that, e.g. modulating the activity of LXR by a compound according to the invention influences a parameter which has a beneficial effect on a disease or a condition.
  • modulation of LXR activity leads to decreased levels of serum cholesterol or certain lipoproteins which in turn have a beneficial effect on the prevention and treatment of atherosclerosis.
  • a condition is a physiological or phenotypic state which is desirably altered.
  • One such example would be obesity which is not necessarily medically harmful but nonetheless a non desirable phenotypic condition.
  • the method for prevention or treatment of a LXR receptor protein mediated disease or condition is applied to a human. This may be male or female.
  • compositions generally are administered in an amount effective for treatment or prophylaxis of a specific condition or conditions. Initial dosing in human is accompanied by clinical monitoring of symptoms, such symptoms for the selected condition.
  • the compositions are administered in an amount of active agent of at least about 100 ⁇ g/kg body weight. In most cases they will be administered in one or more doses in an amount not in excess of about 20 mg/kg body weight per day. Preferably, in most cases, doses is from about 100 ⁇ g/kg to about 5 mg/kg body weight, daily.
  • the daily dosage level of active agent will be 0,1 mg/kg to 10 mg/kg and typically around 1 mg/kg.
  • terapéuticaally effective amount is meant a symptom- alleviating or symptom -reducing amount, a cholesterol-reducing amount, a cholesterol absorption blocking amount, a protein and/or carbohydrate digestion-blocking amount and/or a de novo cholesterol biosynthesis- blocking amount of a compound according to the invention.
  • the invention concerns a method of treating in mammal a disease which is correlated with abnormal cholesterol, triglyceride, or bile acid levels or deposits comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to the invention.
  • the compounds according to the invention may also be used as a method of prevention or treatment of mammalian atherosclerosis, gallstone disease, lipid disorders, Alzheimer's disease, skin disorders, obesity or cardiovascular disorders such as coronary heart disease or stroke.
  • the invention further concerns a method of blocking in a mammal the cholesterol absorption in the intestine in need of such blocking comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to the invention.
  • the invention may also be used to treat obesity in humans.
  • the Liver X Receptor alpha is a prototypical type 2 nuclear receptor meaning that it activates genes upon binding to the promoter region of target genes in a heterodimeric fashion with Retinoid X Receptor.
  • the relevant physiological ligands of LXR are oxysterols
  • the present compounds according to the invention have been demonstrated to have a high binding efficacy (binding coefficients measured as EC50 in the range 100 nM to 1500 nM) as well as agonistic and / or antagonistic properties. Consequently they may be applied to regulate genes that participate in bile acid, cholesterol and fatty acid homeostasis as well as other downstream regulated genes.
  • LXR often functions in vivo as a heterodimer with the Retinoid X Receptor.
  • Published LXR agonists such as the Tularik compound "TO901317" (See figure 5) are known to influence the regulation of various liver genes. Genes found to be regulated by TO901317 can be found in figure 6.
  • the invention also concerns a method of modulating a gene whose expression is regulated by the LXR receptor in a mammal comprising administration of a therapeutically effective amount of a compound according to the invention to said mammal.
  • a number of direct and indirect LXR target genes have been described whose regulated expression contribute to cholesterol homeostasis and lipogenesis.
  • the direct regulation of Cyp7A which was shown to be a direct target gene of LXR at least in the rodent lineage is an important aspect of cholesterol removal by increased metabolism of bile acids (Lehmann et al, J Biol.Chem. 272 (6) 3137-3140; 1007).
  • Gupta et al. (Biochem. Biophys Res.Com, 293; 338-343, 2002) showed that LXR regulation of Cyp7A is dominant over FXR inhibitory effects on Cyp7A transcription.
  • SREBP-IC A key transcription factor that was also shown to be a direct target gene for the LXR receptor is SREBP-IC (Repa et al., Genes and Development, 14:2819-2830; 2000: Yoshikawa et al; Mol.Cell.Biol.21 (9) 2991-3000, 2001).
  • SREBP-IC itself activates transcription of genes involved in cholesterol and fatty acid synthesis in liver but also other mammalian tissues.
  • Some of the SREBPlc target genes involved in lipogenesis like FAS and SCD have shown to be additionally direct targets of the LXR receptors (Joseph et al.; J Biol Chem. 2002 Mar 29;277(13):11019-25; Liang et al, J Biol Chem. 2002 Mar 15;277(ll):9520-8.).
  • LPL gene Another gene that has been shown to be directly regulated by LXRs is the LPL gene, that codes for a key enzyme that is responsible for the hydrolysis of triglycerides in circulating lipoprotein, releasing free fatty acids to peripheral tissues.
  • This enzyme is believed to promote uptake of HDL cholesterol in liver, thereby promoting reverse cholesterol transport.
  • a similar functional involvement in HDL clearance is described for the CETP gene product that facilitated the transfer of HDL cholesterol esters from plasma to the liver.
  • LXR response elements were found in the CETP promoter and direct activation of this gene by LXR was demonstrated (Luo and Tall; J Clin Invest. 2000 Feb;105(4):513-20.).
  • ABCAl and ABCGl were identified as direct LXR target genes (Costet et al; J Biol Chem. 2000 Sep 8;275(36):28240-5) that mediate cholesterol efflux and prevent thereby e.g. generation of artherogenic plaques in macrophages (Singaraja et al. J Clin Invest. 2002 Jul;110(l):35-42).
  • ABC transporters like ABCG5 and ABCG8 , primarily expressed in hepatocytes and enterocytes have also been reported to be directly responsive to LXR agonists ( Repa et al, J Biol Chem. 2002 May 24;277(21): 18793-800. Kennedy et al, J Biol Chem. 2001 Oct 19;276(42):39438-47) and mediate the secretion of sterols from the liver and efflux of dietary sterols from the gut .
  • Apolipoproteins E, C-I, C-II, and C-IN, that fulfill important roles in lipoprotein/lipid homeostasis have also been shown to be direct targets of the LXR receptor ( Laffitte et al., Proc ⁇ atl Acad Sci U S A. 2001 Jan 16;98(2):507-12; Mak et al.; J Biol Chem. 2002 May 24 [epub ahead of print]). These proteins have been found to be crucial components of chylomicrons, VLDL, IDL, and HDL and are among other things associated with hypertriglyceridemia and arteriosclerosis.
  • LXR ⁇ itself was shown to be regulated by both LXR receptors in human cell types including macrophages suggesting an autoregulatory amplification event in the response to LXR ligands which could e.g. lead to an enhanced stimulation of LXR target genes like e.g. ABCAl (Bolten et al; Mol Endocrinol. 2002 Mar;16(3):506-14.; Laffitte et al, Mol Cell Biol. 2001 ⁇ ov;21(22):7558-68; Whitney et al.; J Biol Chem. 2001 Nov 23;276(47):43509- 15).
  • ABCAl Bolten et al; Mol Endocrinol. 2002 Mar;16(3):506-14.
  • Laffitte et al Mol Cell Biol. 2001 ⁇ ov;21(22):7558-68
  • Whitney et al. J Biol Chem. 2001 Nov 23;276(47):43509-
  • LXR receptors Besides the important function of LXR receptors in tissues like liver and macrophages it has recently been reported that that stimulation of epidermal differentiation is mediated by Liver X receptors in murine epidermis. Differentiation maker genes like involucrin, loricin and pro- filaggrin have been shown to be upregulated upon LXR ligand treatment (K ⁇ muves et al.; J Invest Dermatol. 2002 Jan;118(l):25-34.).
  • the invention concerns are methods that enhances or suppresses amongst other today yet unknown LXR target genes the above mentioned genes and the associated biological processes and pathways through LXR compounds that are subject of this invention.
  • the compounds according to the invention may be used as medicaments, in particular for the manufacture of a medicament for the prevention or treatment of a LXR receptor protein or LXR receptor protein homologue mediated disease or condition in a mammal wherein the prevention or treatment is directly or indirectly accomplished through the binding of the compound according to the invention to the LXR receptor protein or LXR receptor protein homologue.
  • These pharmaceutical compositions contain 0,1 % to 99,5 % of the compound according to the invention, more particularly 0,5 % to 90 % of the compound according to the invention in combination with a pharmaceutically acceptable carrier.
  • the invention concerns also the use of a compound according to the invention for the manufacture of a medicament for the prevention or treatment of a LXR receptor protein mediated disease or condition wherein the mammal described above is a human.
  • the medicament may be used for regulating the cholesterol transport system , for regulating levels of cholesterol, triglyceride, and/or bile acid in a mammal preferentially a human by activating the LXR receptor.
  • the medicament may be used for the treatment of atherosclerosis, gallstone disease, lipid disorders, Alzherimer's disease, skin disorders, obesity or a cardiovascular disorder.
  • a compound according to the invention for the manufacture of a medicament capable for blocking in a mammal, preferentially a human the cholesterol absorption in the intestine.
  • the claimed compound may be used for the manufacture of a medicament for treating obesity in humans and for modulating a gene whose expression is regulated by the LXR receptor (see details above and figures).
  • SEQ ID NO. 1 shows protein sequence of the LRX alpha protein a portion of which was used for cloning as described in the examples,
  • SEQ ID NO. 2 shows the mRNA sequence of the LRX alpha protein
  • SEQ ID NO. 3 shows the protein sequence of TIF2 (Ace. No: XM_011633 RefSeq DB)
  • SEQ ID NO. 4 shows the respective mRNA sequence corresponding to the TIF2 protein
  • SEQ ID NO 5 shows the protein sequence of the LXR beta protein a portion of which was used for cloning as described in examples,
  • SEQ ID NO 6 shows the mRNA sequence of the LXR beta protein
  • SEQ ID NO 7 shows the sequence of primer (a) used in Example 1
  • SEQ ID NO 8 shows the sequence of primer (b) used in Example 1.
  • Fig. 1 shows the synthesis of the compounds according to the invention as also described in Example 2.
  • Fig. 2 shows the measurement parameters employed by the Wallace NICTOR2NTM Multila- bel Counter which was used for measuring the EC 50 values
  • Fig. 3 A shows SEQ ID NO. 1 which is the protein sequence of the LRX alpha protein a portion of which was used for cloning as described in the examples .
  • Figure 3 B shows SEQ ID NO. 2 which is the mRNA sequence of the LRX alpha protein.
  • Figure 3 C shows SEQ ID NO. 3 which is the protein sequence of TIF2 (Ace. No: XM_011633 RefSeq DB),
  • Figure 3 D shows SEQ ID NO. 4 which is the respective mRNA sequence corresponding to the TIF2 protein.
  • Figure 3 E shows SEQ ID NO 5 which is the protein sequence of the LXR beta protein a portion of which was used for cloning as described in examples.
  • Figure 3 F shows SEQ ID NO 6 which is the mRNA sequence of the LXR beta protein.
  • Fig. 4 shows the internal molecular name used by the applicant (MOLNAME) as well as the corresponding structures of preferred compounds according to the invention.
  • the figure further shows their respective EC 50 values (EC50 AVG) as established according to the experiment 1 in multiple experiments (see above), as well as their respective average efficacy (% activity relative to 22-(R)-hydroxy cholesterol control agonist).
  • Figure 5 shows various known LXR ligands. It is apparent from their structures that the inventors have identified novel compounds which are structurally not related to these known ligands.
  • Figure 6 shows various genes that have been found to be regulated through binding of an LXR agonist to the LXR protein.
  • Figure 7 shows a dose-dependent transactivation (EC50 ⁇ 3 ⁇ M) by LN0000007465 of the luciferase reporter gene via LXR alpha.
  • Figure 8 shows (A) Analysis of mRNA content of the indicated genes in total RNA isolated from THP-1 cells treated for 24 hours with 2, 10 or 25 ⁇ M of LN0000006500 or 10 ⁇ M of the Tularik compound (T0901317). (B) Analysis of mRNA content fo the indicated genes in total RNA from HepG2 cells treated for 24 hours with 2, 10 or 25 ⁇ M of LN0000006500 or 10 ⁇ M of the Tularik compound (T0901317).
  • Figure 9 shows the dose dependent transactivation by LN0000006500 of the pFR-luc reporter gene in CHO cells via Gal4 LBD-fusion constructs derived from LXRa- or LXRb. Concentrations of the compound administered ( ⁇ M) and RLU's determined from extracts of cells are indicated.
  • Figure 10 shows the analysis of total cholesterol from supernatants of cultivated THP-1 cells incubated without or with ApoAl and ApoAl plus lO ⁇ M of the compounds Tularik (T0901317) or LN0000006500, LN0000006662, LN0000006671 or LN0000006672 as indicated.
  • PCR fragment specifically amplified from human liver cDNA was cloned into the resulting pACGHLT-GW following the manufacturers instructions for Gateway cloning (Invitrogen) to yield pACGHLT-GW-hLXRalphaLBD.
  • Primers used for amplification were: primer (a)
  • Recombinant Baculovirus was constructed from pACGHLT-GW-hLXRalphaLBD using the Pharmingen Baculovirus Expression vector system according to instructions of the manufacturer. Monolayer cultures of SF9 cells were infected by the virus as recommended by Pharmingen or 200ml cultures of 1 xlO cells/ml grown in 2 liter Erlenmeyer flasks on an orbital shaker at 30 rpm were infected by 10ml of same virus stock. In both cases cells were harvested 3 days after infection. All cell growth was performed in Gibco SF900 II with Glutamine (Invitrogen) medium without serum supplementation at 28°C.
  • All eluates were dialyzed against 20 mM Tris/HCl pH 6,8, 300 mM KC1; 5 mM MgCl 2 ; 1 mM DTT; 0,2 mM PMSF; 10% Glycerol.
  • a typical dialyzed eluate fraction contained the fusion protein at a purity of more than 80%. Total protein concentration was 0,1-0,3 mg/ml.
  • pDestl7-hTif2BD expressing a NR interaction domain from amino acids 548-878 of human Tif2 (Ace. No: XM_011633 RefSeq) tagged by 6 N-terminal His residues was constructed. Therefore, a PCR fragment specifically amplified from human liver cDNA was subcloned into pDest 17 (Invitrogen) following the manufacturers instructions for Gateway cloning (Invitrogen).Primers used for Amplification were: primer
  • E. coli expression plasmid DNA was transformed into chemically competent E. coli BL21 (Invitrogen, USA) and cells were grown to an OD600 of 0.4-0.7 before expression was induced by addition of 0,5 mM IPTG according instructions of the manufacturer (Invitrogen). After induction for 8 hours at 30°C cells were harvested by centrifugation for 10 minutes at 5000 x g. Fusion proteins were affinity purified using Ni-NTA Agarose (QIAGEN) according to the instructions of the manufacturer.
  • Recombinant Tif2 construct was dialyzed against 20 mM Tris/HCL pH 7.9; 60 mM KC1; 5 mM MgCl 2 ; 1 mM DTT, 0,2 mM PMSF; 10% glycerol.
  • a typical dialyzed eluate fraction contained the fusion protein at a purity of more than 80%. Total protein concentration was 0,1-0,3 mg/ml.
  • TIF2 fragment was subsequently biotinylated by addition of 5-40 ⁇ l/ml Tif2 fraction of a Biotinamidocaproate N-Hydroxysuccinimide-ester (Sigma) solution (20 mg/ml in DMSO). Overhead rotating samples were incubated for 2 hours at room temperature. Unincorporated label was then separated using G25 Gel filtration chromatography (Pharmacia Biotech, Sweden). Protein containing fractions from the column were pooled and tested for activity in the assay as described below.
  • the Perkin Elmer LANCE technology was applied. This method relies on the binding dependent energy transfer from a donor to an acceptor fluorophore attached to the binding partners of interest.
  • This method relies on the binding dependent energy transfer from a donor to an acceptor fluorophore attached to the binding partners of interest.
  • For ease of handling and reduction of background from compound fluorescence LANCE technology makes use of generic fluorophore labels and time resoved detection (for detailed description see Hernmila I, Blomberg K and Hurskainen P, Time-resolved resonance energy transfer (TR- FRET) principle in LANCE, Abstract of Papers Presented at the 3 rd Annual Conference of the Society for Biomolecular Screening, Sep., California (1997) )
  • the LANCE signal was detected by a Perkin Elmer NICTOR2VTM Multilabel Counter applying the detection parameters listed in Fig. 2. The results were visualized by plotting the ratio between the emitted light at 665 nm and at 615 nm. For every batch of recombinant proteins amount of proteins, including BSA and labeling reagents giving the most sensitive detection of hits was determined individually by analysis of dose response curves for 22R Hydroxycholesterol and TO 901317
  • the anthranilic acid (1, 1 eq., 0.5-1 M) was suspended in 6 M HC1, containing enough AcOH (0-20% dependent upon the anthranilic acid) to facilitate dissolution of the anthranilic acid and/or the intermediate diazonium salt, and cooled to 0 °C.
  • NaNO 2 1.1 eq., 1.3-2.5 M
  • H 2 O was added to the anthranilic acid solution at a rate such that the temperature of the reaction solution remained below 5 °C.
  • the resulting homogeneous solution of the diazonium salt was slowly filtered through a sintered glass funnel into a solution of NaN 3 (1.1 eq., 0.7-1.1 M) and NaOAc (12 eq.) in H 2 O.
  • the reaction mixture was stirred/shaken for 30- 60 min following cessation of vigorous N evolution.
  • the mixture was cooled to 0 °C to encourage complete precipitation of the o-azidobenzoic acid.
  • the precipitate was collected by filtration and washed with 6 M HC1 (2x) and H 2 O (2x).
  • the o-azidobenzoic acid product (2) was dried in vacuo (500 mtorr, 30 °C).
  • HEK293 cells were grown in 48 well plates and co-transfected with the pTRexDest30 (Invitrogen) derivatives pTRexDest30-hLXRa, pTRexDest30-hRXRD and the pGL2promoter (Promega) derivative pGL2promoter-LXRRE (each 300 ng of plasmid DNA).
  • the full length human LXR (accession U68233) and the full length human RXR ⁇ (accession PI 9793) were cloned into the pTRexDest30 applying the manufacturer protocols for the Gateway 1 system (Invitrogen).
  • LXRRE The LXR response elements (LXRRE) were (upper case and underlined) 5' CccttTGGTCActcaAGTTCAagtgatgatagaattcggatccttTGGTCActcaAGTTCAagtgA 3' (SEQ ID NO. 5) derived from the rat Cyp7a promoter (Laffite et al, 2001, PNAS 98,pp 507).
  • Luciferase reporter activity was measured in triplicates from extracts of cells after incubating cells in culture medium (DMEM [Gibco-BRL] + 10% FCS [PAA laboratories]) for 16 hours (5% CO 2 , 37°C) containing 0,5% DMSO (control) or 0,5% DMSO with increasing concentrations of LN0000007465.
  • This example shows that described compounds can increase the abundance of mRNA of target genes for the LXR proteins in THP-1 cells treated with TPA.
  • THP-1 ( 3xl0 5 cells per dish) cells were seeded in 24 well dishes in 3 ml modified RPMI- 1640 medium (ATTC, Cat.No. 30-2001) containing 10%FCS (GIBCO) and lOOnM TPA and cultivated at 37°C in 5% CO 2 for 48 hours.
  • the medium was then removed and replaced with medium containing 10% charcoal/stripped FBS (Hyclone) and incubated with LN0000006500 at 2, 10 or 25 ⁇ M concentration or Tularik (T0901317) at 10 ⁇ M for 24 hours as indicated in Fig 8 A as an example.
  • HepG2 (4,5x10 5 cells per dish) were seeded in 24 well dishes in 3 ml DMEM Medium containing 10%FCS (GIBCO) and cultivated at 37°C in 5% CO 2 for 48 hours as indicated in Fig 8B.
  • CHO cells (lxl 0 5 cells 96well plate) were co-transfected (Lipofectamine 2000 GIBCO) with pFR-luc (Stratagene) as a reporter gene construct and pCMV-AD derivatives containing the LXRa or LXRb ligand binding domains, which were cloned via the gateway system (GIBCO) described in Example 1, in order to express Gal4DBD-LXRa or Gal4DBD-LXRb fusion proteins.
  • pFR-luc Stratagene
  • Luciferase activity was determined from aliquots of extracts prepared from cells following standard luciferase assay kits and protocols from Promega.
  • This example shows that described compounds at 10 ⁇ M concentration for 24 hours can increase the reverse cholesterol transport in THP-1 cells that were treated with TPA.
  • THP-1 (lxl 0 6 cells per dish) cells were seeded in 6 well dishes in 3ml modified RPMI1640 medium ( ATTC, Cat.No. 30-2001) containing 10%FCS (GIBCO) and lOOnM TPA and cultivated at 37°C in 5% CO 2 for 72 hours. The medium was then removed and replaced with fresh medium containing 100 nM TPA and 0,15 % BSA.

Abstract

The present invention relates to 2-amino-4-oxo-quinazolines according to the general formula (1), which bind to the LXR receptors and act as agonists and antagonists of the LXR receptors. The invention further relates to the treatment of diseases and/or conditions through binding of said nuclear receptor by said compounds and the production of medicaments using said compounds. In particular the compounds are useful in the treatment of hypercholesterolemia, obesity or other diseases associated with elevated lipoprotein (LDL) levels.

Description

2-AMINO-4-QUINAZOLIN0NES AS LXR NUCLEAR RECEPTOR BINDING COMPOUNDS
The present invention relates to compounds according to the general formula (1), which bind to the LXR receptors and act as agonists and antagonists of the LXR receptors. The invention further relates to the treatment of diseases and/or conditions through binding of said nuclear receptor by said compounds and the production of medicaments using said compounds.
BACKGROUND OF THE INVENTION
Multicellular organisms are dependent on advanced mechanisms of information transfer between cells and body compartments. The information that is transmitted can be highly complex and can result in the alteration of genetic programs involved in cellular differentiation, proliferation, or reproduction. The signals, or hormones, are often simple molecules, such as peptides, fatty acid, or cholesterol derivatives.
Many of these signals produce their effects by ultimately changing the transcription of specific genes. One well-studied group of proteins that mediate a cells response to a variety of signals is the family of transcription factors known as nuclear receptors, hereinafter referred to often as "NR". Members of this group include receptors for steroid hormones, vitamin D, ecdysone, cis and trans retinoic acid, thyroid hormone, bile acids, cholesterol-derivatives, fatty acids (and other peroxisomal proliferators), as well as so-called orphan receptors, proteins that are structurally similar to other members of this group, but for which no ligands are known (Escriva, H. et al., Ligand binding was acquired during evolution of nuclear receptors, PNAS, 94, 6803 - 6808, 1997). Orphan receptors may be indicative of unknown signaling pathways in the cell or may be nuclear receptors that function without ligand activation. The activation of transcription by some of these orphan receptors may occur in the absence of an exogenous ligand and/or through signal transduction pathways originating from the cell surface (Mangelsdorf, D. J. et al., The nuclear receptor superfamily: the second decade, Cell 83, 835-839, 1995). In general, three functional domains have been defined in NRs. An amino terminal domain is believed to have some regulatory function. A DNA-binding domain hereinafter referred to as "DBD" usually comprises two zinc finger elements and recognizes a specific Hormone Responsive Element hereinafter referred to as "HRE" within the promoters of responsive genes. Specific amino acid residues in the "DBD" have been shown to confer DNA sequence binding specificity (Schena, M. & Yamamoto, K.R., Mammalian Glucocorticoid Receptor Derivatives Enhance Transcription in Yeast, Science, 241:965-967, 1988). A Ligand-binding-domain hereinafter referred to as "LBD" is at the carboxy-terminal region of known NRs. In the absence of hormone, the LBD of some but not all NRs appears to interfere with the interaction of the DBD with its HRE. Hormone binding seems to result in a conformational change in the NR and thus opens this interference (Brzozowski et al, Molecular basis of agonism and antagonism in the oestrogen receptor, Nature, 389, 753 - 758, 1997; Wagner et al., A structural role for hormone in the thyroid hormone receptor, Nature, 378, 690 - 697. 1995). A NR without the HBD constitutively activates transcription but at a low level.
Coactivators or transcriptional activators are proposed to bridge between sequence specific transcription factors and the basal transcription machinery and in addition to influence the chromatin structure of a target cell. Several proteins like SRC-1, ACTR, and Gripl interact with NRs in a ligand enhanced manner (Heery et al., A signature motif in transcriptional coactivators mediates binding to nuclear receptors, Nature, 387, 733 - 736; Heinzel et al., A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression, Nature 387, 43 - 47, 1997). Furthermore, the physical interaction with repressing receptor-interacting proteins or corepressors has been demonstrated (Xu et al., Coactivator and Corepressor complexes in nuclear receptor function, Curr Opin Genet Dev, 9 (2), 140 - 147, 1999).
Nuclear receptor modulators like steroid hormones affect the growth and function of specific cells by binding to intracellular receptors and forming nuclear receptor-ligand complexes. Nuclear receptor-hormone complexes then interact with a hormone response element (HRE) in the control region of specific genes and alter specific gene expression.
The term LXR (Liver X Receptor) includes all subtypes of this receptor. Specifically LXR includes LXRa (also known as LXRalpha, RLD-1 and NR1H3) and LXRb (also known as LXRbeta, NER, NER1, UR, OR-1, R1P15 and NH1H2) and ligands of LXR should be under- stood to include ligands of LXRa or LXRb. LXR is a prototypical type 2 nuclear receptor which activates genes upon binding to promoter region of target genes in a prototypical het- erodimeric fashion with Retinoid X Receptor (hereinafter RXR, Forman et al., Cell, 81, 687- 93, 1995). The relevant physiological ligands of LXR seem to be oxidized derivatives of cholesterol, including 22-hydroxy cholesterol and 24,25 (S)-epoxy cholesterol (Lehmann, et al., Biol. Chem. 272(6), 3137-40, 1997). The oxysterol ligands bound to LXR were found to regulate the expression of several genes that participate in cholesterol metabolism (Janowski, et al., Nature, 383, 728-31, 1996).
1 . LXR is proposed to be a hepatic oxysterol sensor. Upon activation (e.g. binding of oxysterols) it influences the conversion of dietary cholesterol into bile acids by upregulating the transcription of key genes which are involved in bile acid synthesis such as CYP7A1. Hence, activation of LXR in the liver could result in an increased synthesis of bile acids from cholesterol which could lead to decreased levels of hepatic cholesterol. This proposed LXR function in hepatic cholesterol metabolism was experimentally confirmed using knockout mice. Mice lacking the receptor LXRa lost their ability to respond normally to an increase in dietary cholesterol and did not induce transcription of the gene encoding CYP7A1. This resulted in accumulation of large quantities of cholesterol in the livers and impaired hepatic function. (Peet, et al., Cell, 93, 693-704, 1998).
Besides its important function in liver, LXR plays an important role in the regulation of cholesterol homeostasis in macrophages and intestinal mucosa cells where it upregulates cholesterol transporters from the ABC (=ATP binding cassette) family of membrane proteins (Repa, et al, J Biol Chem. 2002 May 24;277(21): 18793-800). These transporters are believed to be crucially involved in the uptake of cholesterol from the diet since mutations in their genes leads to diseases such as sitosterolemia (Berge, et al., Science (2000);290(5497):1771-5.).
Other members of the ABC transporter family seem to be responsible for the efflux .of cholesterol from loaded macrophages, a process which is thought to prevent the generation of atherosclerotic lesions. Stimulation of LXR by synthetic ligands might result in an increased cholesterol efflux from macrophages and a decreased deposition of atherosclerotic plaques (Venkateswaran, et al., PNAS (2000) 24;97(22): 12097-102; Sparrow, et al., J Biol Chem (2002) 277(12):10021-7; Joseph, et al., PNAS (2002);99(l l):7604-9). However, in animal studies it was observed that activation of LXR in the liver by full agonists does not only increase bile acid synthesis but also stimulates the de novo synthesis of fatty acids and triglygerids through the upregulation of key enzymes such as Fatty Acid Synthase (FAS) or Stearyl-CoA Desaturase (SCD-1). (Schultz, et al, Genes Dev (2000) 14(22):2831-8.
Therefore, an ideal synthetic LXR binding compound should have properties that retain the agonistic activity on hepatic bile acid formation and ABC-transporter -mediated decrease in cholesterol uptake from the diet and increased cholesterol efflux from macrophages. In parallel such a compound should lack the hyperlipidemic potential which is exerted through increased fatty acid and triclyceride synthesis.
To date few compounds have been described which bind the LXR receptor and thus show utility for treating diseases or conditions which are due to or influenced by said nuclear receptor (Collins, et al, J Med Chem. (2002) 45(10): 1963-6; Schultz, et al., Genes Dev (2000) 14(22):2831-8; Sparrow, et al, J Biol Chem (2002) 277(12): 10021 -7).
It was thus an object of the present invention to provide for compounds which by means of binding the LXR receptor act as agonist, antagonist or mixed agonist / antagonist of said receptor and thus show utility for treating diseases or conditions which are due to or influenced by said nuclear receptor.
It was further an object of the invention to provide for compounds that may be used for the manufacture of a medicament for the treatment of cholesterol associated conditions or diseases. In a preferred embodiment of the invention it was an object of the invention to provide for compounds that lower serum cholesterol and/or increase High Density lipoproteins (HDL) and/or decrease Low Density Lipoproteins (LDL). It was also an object of the invention to provide for compounds that may be used for the treatment of lipid disorders including hyper- cholesterolemia, atherosclerosis, Alzheimer's disease, skin disorders, obesity and diabetes.
SUMMARY OF THE INVENTION
The present invention provides, inter alia, novel LXR nuclear receptor protein binding compounds according to the general formula (1) shown below. Said compounds are also binders of mammalian homologues of said receptor. Further the object of the invention was solved by providing for amongst the LXR nuclear receptor protein binding compounds according to the general formula (1) such compounds which act as agonists, antagonists or mixed agonists / antagonists of the human LXR receptor or a mammalian homologue thereof.
The invention provides for LXR agonists that may be used for the manufacture of a medicament for the treatment of cholesterol associated conditions or diseases. In a preferred embodiment of the invention it was an object of the invention to provide for compounds that lower serum cholesterol and/or increase High Density lipoproteins (HDL) and/or decrease Low Density Lipoproteins (LDL). It was also an object of the invention to provide for compounds that may be used for the treatment of lipid disorders including hypercholesterolemia, atherosclerosis, Alzheimer's disease, skin disorders, obesity and diabetes.
The foregoing merely summarizes certain aspects of the present invention and is not intended, nor should it be construed, to limit the invention in any manner. All patents and other publications recited herein are hereby incorporated by reference in their entirety.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The invention provides for a compound according to the following formula (1), or pharmaceutical acceptable salts or solvates thereof, hereinafter also referred to as the "compounds according to the invention" including particular and preferred embodiments thereof, wherein
R6
Figure imgf000006_0001
(formula (1))
; R , R3 and/or R4, is independently from each other selected from H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C alkyl, Ci to C6 substituted alkyl, to C alkoxy, Ct to C substituted alkoxy, C\ to C7 acyl, Ci to C7 substituted acyl, Ci to C7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hy- droxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Ci to C6 al- kyl)carboxamide, protected N-(Ci to C6 alkyl)carboxamide, N, N-di(Cι to C6 al- kyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsulfo- nyl)amino or phenyl, wherein the phenyl is substituted or unsubstituted, such that, for example, a biphenyl results. R5 is H, Ci to C8 alkyl, to C8 substituted alkyl, C to C12 alkyl- phenyl or C7 to Cι2 substituted phenylalkyl, R6 is H, Ci to C8 alkyl, to C8 substituted alkyl, C to C12 alkylphenyl or C7 to C12 substituted phenylalkyl, R7 is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, C to Cι alkylphenyl or C7 to C12 substituted phenylalkyl, R6 and R may be taken together with nitrogen to form a heterocycle or substituted heterocycle or a heteroaryl or substituted heteroaryl ring.
The compounds of the invention can also exist as solvates and hydrates. Thus, these compounds may crystallize with, for example, waters of hydration, or one, a number of, or any fraction thereof of molecules of the mother liquor solvent. The solvates and hydrates of such compounds are included within the scope of this invention.
The symbol "H" denotes a hydrogen atom.
The term "Ci to C7 acyl" encompasses groups such as formyl, acetyl, propionyl, butyryl, pentanoyl, pivaloyl, hexanoyl, heptanoyl, benzoyl and the like. Preferred acyl groups are acetyl and benzoyl.
The term "Ci to C7 substituted acyl" denotes the acyl group substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, cyclohexyl, naphthyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C alkoxy, to C acyl, Ci to C acyloxy, nitro, Ci to C6 alkyl ester, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-( to C6 alkyl)carboxamide, N,N-di(Cι to C6 alkyl)carboxamide, cyano, methylsulfonylamino, thiol, to C4 alkylthio or Ci to C4 alkylsul- fonyl groups. The substituted acyl groups may be substituted once or more, and preferably once or twice, with the same or with different substituents.
The term "substituted phenyl" specifies a phenyl group substituted with one or more, and preferably one or two, moieties chosen from the groups consisting of halogen, hydroxy, protected hydroxy, cyano, nitro, Ct to C6 alkyl, Ci to C6 substituted alkyl, Ci to C7 alkoxy, Ci to C substituted alkoxy, Ci to C7 acyl, Ci to C substituted acyl, to C7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hy- droxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-( to C6 al- kyl)carboxamide, protected N-(Cι to C alkyl)carboxamide, N, N-di(Cι to C6 al- kyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsulfo- nyl)amino or phenyl, wherein the phenyl is substituted or unsubstituted, such that, for example, a biphenyl results.
Examples of the term "substituted phenyl" includes a mono- or di(halo)phenyl group such as 2, 3 or 4-chlorophenyl, 2,6-dichlorophenyl, 2,5-dichlorophenyl, 3,4-dichlorophenyl, 2, 3 or 4- bromophenyl, 3,4-dibromophenyl, 3-chloro-4-fluorophenyl, 2, 3 or 4-fluorophenyl and the like; a mono or di(hydroxy)phenyl group such as 2, 3 or 4-hydroxyphenyl, 2,4-dihydroxyphenyl, the protected-hydroxy derivatives thereof and the like; a nitrophenyl group such as 2, 3 or 4-nitrophenyl; a cyanophenyl group, for example, 2, 3 or 4- cyanophenyl; a mono- or di(alkyl)phenyl group such as 2, 3 or 4-methylphenyl, 2,4- dimethylphenyl, 2, 3 or 4-(iso-propyl)phenyl, 2, 3 or 4-ethylphenyl, 2, 3 or 4-(n- propyl)phenyl and the like; a mono or di(alkoxyl)phenyl group, for example, 2,6-dimethoxyphenyl, 2, 3 or 4-methoxyphenyl, 2, 3 or 4-ethoxyphenyl, 2, 3 or 4- (isopropoxy)phenyl, 2, 3 or 4-(t-butoxy)phenyl, 3-ethoxy~4-methoxyphenyl and the like; 2, 3 or 4-trifluoromethylphenyl; a mono- or dicarboxyphenyl or (protected carboxy)phenyl group such as 2, 3 or 4-carboxyphenyl or 2,4-di(protected carboxy)phenyl; a mono-or di(hydroxymethyl)phenyl or (protected hydroxymethyl)phenyl such as 2, 3, or 4-(protected hydroxymethyl)phenyl or 3,4-di(hydroxymethyl)phenyl; a mono- or di(aminomethyl)phenyl or (protected aminomethyl)phenyl such as 2, 3 or 4-(aminomethyl)phenyl or 2,4-(protected aminomethyl)phenyl; or a mono- or di(N-(methylsulfonylamino))phenyl such as 2, 3 or 4-(N-(methylsulfonylamino))phenyl. Also, the term "substituted phenyl" represents disubsti- tuted phenyl groups wherein the substituents are different, for example, 3-methyl-4- hydroxyphenyl, 3 -chloro-4-hydroxyphenyl, 2-methoxy-4-bromophenyl,
4-ethyl-2-hydroxyphenyl, 3-hydroxy-4-nitrophenyl, 2-hydroxy 4-chlorophenyl and the like.
The term "heteroaryl" means a heterocyclic aromatic derivative which is a five-membered or six-membered ring system having from 1 to 4 heteroatoms, such as oxygen, sulfur and/or nitrogen, in particular nitrogen, either alone or in conjunction with sulfur or oxygen ring atoms. Examples of heteroaryls include pyridinyl, pyrimidinyl, and pyrazinyl, pyridazinyl, pyrrolo, furano, thiopheno, oxazolo, isoxazolo, phthalimido, thiazolo and the like.
The term "substituted heteroaryl" means the above-described heteroaryl is substituted with, for example, one or more, and preferably one or two, substituents which are the same or different which substituents can be halogen, hydroxy, protected hydroxy, cyano, nitro, to C6 alkyl, Ci to C7 alkoxy, Ci to C substituted alkoxy, d to C acyl, Ci to C substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hy- droxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-(Cι to C6 alkyl)carboxamide, N, N-di(Cι to C6 alkyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino or N- (phenylsulfonyl)amino groups.
The term "substituted naphthyl" specifies a naphthyl group substituted with one or more, and preferably one or two, moieties either on the same ring or on different rings chosen from the groups consisting of halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C6 alkyl, Ci to C7 alkoxy, Ci to C7 acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-(Cι to C6 al- kyl)carboxamide, N, N-di(Cι to C6 alkyl)carboxamide, trifluoromethyl, N-((Cι to C6 al- kyl)sulfonyl)amino or N-(phenylsulfonyl)amino.
Examples of the term "substituted naphthyl" includes a mono or di(halo)naphthyl group such as 1, 2, 3, 4, 5, 6, 7 or 8-chloronaphthyl, 2, 6-dichloronaphthyl, 2, 5-dichloronaphthyl, 3, 4- dichloronaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-bromonaphthyl, 3, 4-dibromonaphthyl, 3-chloro-4- fluoronaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-fluoronaphthyl and the like; a mono or di(hydroxy)naphthyl group such as 1, 2, 3, 4, 5, 6, 7 or 8-hydroxynaphthyl, 2, 4- dihydroxynaphthyl, the protected-hydroxy derivatives thereof and the like; a nitronaphthyl group such as 3- or 4-nitronaphthyl; a cyanonaphthyl group, for example, 1, 2, 3, 4, 5, 6, 7 or 8-cyanonaphthyl; a mono- or di(alkyl)naphthyl group such as 2, 3, 4, 5, 6, 7 or 8- methylnaphthyl, 1, 2, 4-dimethylnaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-(isopropyl)naphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-ethylnaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-(n-propyl)naphthyl and the like; a mono or di(alkoxy)naphthyl group, for example, 2, 6-dimethoxynaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-methoxynaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-ethoxynaphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-(isopropoxy)naphthyl, 1, 2, 3, 4, 5, 6, 7 or 8-(t-butoxy)naphthyl, 3-ethoxy-4- methoxynaphthyl and the like; 1, 2, 3, 4, 5, 6, 7 or 8-trifluoromethylnaphthyl; a mono- or di- carboxynaphthyl or (protected carboxy)naphthyl group such as 1, 2, 3, 4, 5, 6, 7 or 8- carboxynaphthyl or 2, 4-di(-protected carboxy)naphthyl; a mono-or di(hydroxymethyl)naphthyl or (protected hydroxymethyl)naphthyl such as 1, 2, 3, 4, 5, 6, 7 or 8-(protected hydroxymethyl)naphthyl or 3, 4-di(hydroxymethyl)naphthyl; a mono- or di(amino)naphthyl or (protected amino)naphthyl such as 1, 2, 3, 4, 5, 6, 7 or 8- (amino)naphthyl or 2, 4-(protected amino)-naphthyl, a mono- or di(aminomethyl)naphthyl or (protected aminomethyl)naphthyl such as 2, 3, or 4-(aminomethyl)naphthyl or 2, 4-(protected aminomethyl)-naphthyl; or a mono- or di-(N-methylsulfonylamino) naphthyl such as 1, 2, 3, 4, 5, 6, 7 or 8-(N-methylsulfonylamino)naphthyl. Also, the term "substituted naphthyl" represents disubstituted naphthyl groups wherein the substituents are different, for example, 3- methyl-4-hydroxynaphth- 1 -yl, 3 -chloro-4-hydroxynaphth-2-yl, 2-methoxy-4-bromonaphth- 1 - yl, 4-ethyl-2-hydroxynaphth-l-yl, 3-hydroxy-4-nitronaphth-2-yl, 2-hydroxy-4-chloronaphth- 1-yl, 2-methoxy-7-bromonaphth-l-yl, 4-ethyl-5-hydroxynaphth-2-yl, 3-hydroxy-8- nitronaphth-2-yl, 2-hydroxy-5-chloronaphth-l-yl and the like.
The term "Ci to C8 alkyl" denotes such radicals as methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, amyl, tert-amyl, hexyl , n-heptyl, 2-heptyl, 3-heptyl, 4-heptyl, 2-methyl-lhexyl, 2-methyl-2hexyl, 2-methyl-3 -hexyl, n-octyl and the like.
Examples of the above substituted alkyl groups include the 2-oxo-prop-l-yl, 3-oxo-but-l-yl, cyanomethyl, nitromethyl, chloromethyl, hydroxymethyl, tetrahydropyranyloxymethyl, trity- loxymethyl, propionyloxymethyl, amino, methylamino, aminomethyl, dimethylamino, carboxymethyl, allyloxycarbonylmethyl, allyloxycarbonylaminomethyl, methoxymethyl, eth- oxymethyl, t-butoxymethyl, acetoxymethyl, chloromethyl, bromomethyl, iodomethyl, trifluoromethyl, 6-hydroxyhexyl, 2,4-dichloro(n-butyl), 2-aminopropyl, 1-chloroethyl, 2- chloroethyl, 1- bromoethyl, 2-chloroethyl, 1-fluoroethyl, 2-fluoroethyl, 1- iodoethyl, 2- iodoethyl, 1-chloropropyl, 2-chloropropyl, 3- chloropropyl, 1-bromopropyl, 2-bromopropyl, 3-bromopropyl, 1-fluoropropyl, 2-fluoropropyl, 3-fluoropropyl, 1- iodopropyl, 2-iodopropyl, 3-iodopropyl, 2-aminoethyl, 1- aminoethyl, N-benzoyl-2-aminoethyl, N-acetyl-2-aminoethyl, N-benzoyl-1-aminoethyl, N-acetyl-1 -aminoethyl and the like. The term "d to C8 substituted alkyl" denotes that the above Q to C8 alkyl groups are substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, C3 to C7 cycloalkyl, naphthyl, amino, protected amino, (monosubsti- tuted)amino, protected (monosubstituted)amino, (disubstituted)amino, guanidino, protected guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C alkoxy, Ci to C7 acyl, Ci to C acyloxy, nitro, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(Q to C6 alkyl)carboxamide, protected N-(Cι to C6 alkyl)carboxamide, N,N-di(Ci to C6 alkyl)carboxamide, cyano, methylsulfonylamino, thiol, Ci to C4 alkylthio or Ci to C alkylsulfonyl groups. The substituted alkyl groups may be substituted once or more, and preferably once or twice, with the same or with different substituents.
The term "C7 to Cι phenylalkyl" denotes a Ci to C6 alkyl group substituted at any position by a phenyl, substituted phenyl, heteroaryl or substituted heteroaryl. Examples of such a group include benzyl, 2-phenylethyl, 3-phenyl(n-propyl), 4-phenylhexyl, 3-phenyl(n-amyl), 3- phenyl(sec-butyl) and the like. Preferred C to Cι2 phenylalkyl groups are the benzyl and the phenylethyl groups.
The term "C to Cι2 substituted phenylalkyl" denotes a C to C1 phenylalkyl group substituted on the d to C6 alkyl portion with one or more, and preferably one or two, groups chosen from halogen, hydroxy, protected hydroxy, oxo, protected oxo, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, guanidino, protected guanidino, heterocyclic ring, substituted heterocyclic ring, Ci to C6 alkyl, Ci to C6 substituted alkyl, Ci to C alkoxy, Ci to C substituted alkoxy, Ci to C acyl, Q to C substituted acyl, Ci to C acyloxy, nitro, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-(Cι to C6 al- kyl)carboxamide, N, N-(Ci to C6 dialkyl)carboxamide, cyano, N-(Cι to C6 alkylsulfo- nyl)amino, thiol, Ci to C4 alkylthio, Ci to C4 alkylsulfonyl groups; and/or the phenyl group may be substituted with one or more, and preferably one or two, substituents chosen from halogen, hydroxy, protected hydroxy, cyano, nitro, Q to C6 alkyl, Ci to C6 substituted alkyl, Ci to C alkoxy, Ci to C substituted alkoxy, Ci to C7 acyl, Ci to C7 substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl) carboxamide, protected N-(Cι to C6 alkyl) carboxamide, N, N-di(Cι to C6 alkyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsulfonyl)amino, cyclic C2 to C7 alkylene or a phenyl group, substituted or unsubsti- tuted, for a resulting biphenyl group. The substituted alkyl or phenyl groups may be substituted with one or more, and preferably one or two, substituents which can be the same or different.
Examples of the term "C7 to C12 substituted phenylalkyl" include groups such as 2-phenyl-l- chloroethyl, 2-(4-methoxyphenyl)ethyl, 4-(2,6-dihydroxy phenyl)n-hexyl, 2-(5-cyano-3- methoxyphenyl)n-pentyl, 3-(2,6-dimethylphenyl)n-propyl, 4-chloro-3-aminobenzyl, 6-(4- methoxyphenyl)-3-carboxy(n-hexyl), 5-(4-aminomethylphenyl)- 3-(aminomethyl)n-pentyl, 5- phenyl-3-oxo-n-pent-l-yl and the like.
As outlined above R6 and R7 may be taken together with nitrogen to form a heterocycle or substituted heterocycle of the following kind aziridine, azetidine, pyrrolidine, 3- methylpyrrolidine, 3-aminopyrrolidine, 3-hydroxypyrrolidine, pyrazolidine, imidazolidine, piperidine, 2-methylpiperidine, piperazine, morpholine, azepine, tetrahydroisoquinoline
The term "heterocycle" or "heterocyclic ring" denotes optionally substituted five-membered to eight-membered rings that have 1 to 4 heteroatoms, such as oxygen, sulfur and/or nitrogen, in particular nitrogen, either alone or in conjunction with sulfur or oxygen ring atoms. These five-membered to eight-membered rings may be saturated, fully unsaturated or partially un- saturated, with fully saturated rings being preferred. Preferred heterocyclic rings include mor- pholino, piperidinyl, piperazinyl, 2-amino-imidazoyl, tetrahydrofurano, pyrrolo, tetrahydro- thiophen-yl, hexylmethyleneimino and heptylmethyleneimino.
The term "substituted heterocycle" or "substituted heterocyclic ring" means the above- described heterocyclic ring is substituted with, for example, one or more, and preferably one or two, substituents which are the same or different which substituents can be halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to Cι2 alkyl, Ci to C12 alkoxy, Ci to C1 substituted alkoxy, Ci to C12 acyl, Ci to C12 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstiruted)amino, protected (monosubstituted)amino, (disubstituted)amino carbox- amide, protected carboxamide, N-(Ci to Q2 alkyι)carboxamide, protected N-(Cι to Cι2 al- kyl)carboxamide, N, N-di(Cι to Cι2 alkyl)carboxamide, trifluoromethyl, N-((Ci to C12 al- kyl)sulfonyl)amino, N-(phenylsulfonyl)amino, heterocycle or substituted heterocycle groups.
The term "Ci to C8 alkoxy" as used herein denotes groups such as methoxy, ethoxy, n- propoxy, isopropoxy, n-butoxy, t-butoxy and like groups. A preferred alkoxy is methoxy. The term "Ci to C8 substituted alkoxy" means the alkyl portion of the alkoxy can be substituted in the same manner as in relation to Ci to C8 substituted alkyl.
The term "Ci to C8 aminoacyl" encompasses groups such as formyl, acetyl, propionyl, buty- ryl, pentanoyl, pivaloyl, hexanoyl, heptanoyl, octanoyl, benzoyl and the like.
The term "Ci to C8 substituted aminoacyl" denotes the acyl group substituted by one or more, and preferably one or two, halogen, hydroxy, protected hydroxy, oxo, protected oxo, cyclo- hexyl, naphthyl, amino, protected amino, (monosubstituted)amino, protected (monosubsti- tuted)amino, (disubstituted)amino, guanidino, heterocyclic ring, substituted heterocyclic ring, imidazolyl, indolyl, pyrrolidinyl, Ci to C12 alkoxy, Ci to C12 acyl, Ci to C12 acyloxy, nitro, Ci to C12 alkyl ester, carboxy, protected carboxy, carbamoyl, carboxamide, protected carboxamide, N-(Cι to C12 alkyl)carboxamide, protected N-(Cι to C12 alkyl)carboxamide, N,N-di(Cι to C12 alkyl)carboxamide, cyano, methylsulfonylamino, thiol, Ci to Qo alkylthio or Ci to C10 alkylsulfonyl groups. The substituted acyl groups may be substituted once or more, and preferably once or twice, with the same or with different substituents.
Examples of Ci to C8 substituted acyl groups include 4-phenylbutyroyl, 3-phenylbutyroyl, 3-phenylpropanoyl, 2- cyclohexanylacetyl, cyclohexanecarbonyl, 2-furanoyl and 3 -dimethylaminobenzoyl.
This invention provides a pharmaceutical composition comprising an effective amount of a compound according to the invention. Such compounds can be administered by various routes, for example oral, subcutaneous, intramuscular, intravenous or intracerebral. The preferred route of administration would be oral at daily doses of the compound for adult human treatment of about 0.01 -5000 mg, preferably 1-1500 mg per day. The appropriate dose may be administered in a single dose or as divided doses presented at appropriate intervals for example as two, three four or more subdoses per day. For preparing pharmaceutical compositions containing compounds of the invention, inert, pharmaceutically acceptable carriers are used. The pharmaceutical carrier can be either solid or liquid. Solid form preparations include, for example, powders, tablets, dispersible granules, capsules, cachets, and suppositories.
A solid carrier can be one or more substances which can also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, or tablet disintegrating agents; it can also be an encapsulating material.
In powders, the carrier is generally a finely divided solid which is in a mixture with the finely divided active component. In tablets, the active compound is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired.
For preparing pharmaceutical composition in the form of suppositories, a low-melting wax such as a mixture of fatty acid glycerides and cocoa butter is first melted and the active ingredient is dispersed therein by, for example, stirring. The molten homogeneous mixture is then poured into convenient-sized molds and allowed to cool and solidify.
Powders and tablets preferably contain between about 5% to about 70% by weight of the active ingredient. Suitable carriers include, for example, magnesium carbonate, magnesium ste- arate, talc, lactose, sugar, pectin, dextrin, starch, tragacanth, methyl cellulose, sodium carboxymethyl cellulose, a low-melting wax, cocoa butter and the like.
The pharmaceutical compositions can include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component (with or without other carriers) is surrounded by a carrier, which is thus in association with it. In a similar manner, cachets are also included. Tablets, powders, cachets, and capsules can be used as solid dosage forms suitable for oral administration.
Liquid pharmaceutical compositions include, for example, solutions suitable for oral or par- enteral administration, or suspensions, and emulsions suitable for oral administration. Sterile water solutions of the active component or sterile solutions of the active component in sol- vents comprising water, ethanol, or propylene glycol are examples of liquid compositions suitable for parenteral administration.
Sterile solutions can be prepared by dissolving the active component in the desired solvent system, and then passing the resulting solution through a membrane filter to sterilize it or, alternatively, by dissolving the sterile compound in a previously sterilized solvent under sterile conditions.
In one embodiment of the present invention a compound is claimed according to formula (1) above, or pharmaceutical acceptable salts or solvates thereof, wherein Rι; R2, R3, R4, is H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C6 alkyl, Ci to C6 substituted alkyl, Ci to C7 alkoxy, Ci to C7 substituted alkoxy, Ci to C acyl, d to C substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-(Cι to C6 alkyl)carboxamide, N, N-di(Cι to C6 alkyι)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsul- fonyl)amino or phenyl, R5 is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, C to C12 alkylphenyl or C7 to C12 substituted phenylalkyl, R6 and R7 may be taken together with nitrogen to form the heterocycle according to formula (2),
formula (2)
Figure imgf000015_0001
In a preferred embodiment of the invention a compound is provided, or pharmaceutical acceptable salts or solvates thereof, wherein R1; R2, R3, Rj, is H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C6 alkyl, Ci to C6 substituted alkyl, Ci to C7 alkoxy, Ci to C7 substituted alkoxy, Ci to C7 acyl, Ci to C7 substituted acyl, Ci to C7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disub- stituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, pro- tected N-(Cι to C6 alkyl)carboxamide, N, N-di(Cι to C6 alkyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsulfonyl)amino or phenyl, R5 is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, R6 and R may be taken together with nitrogen to form the heterocycle according to formula (2) shown above.
A particularly preferred compound which may act as agonist of LXR is shown in formula (6) below. The inventors have been able to demonstrate that the compound according to formula (3) has a low effective concentration at LXR with an EC50 of 0.5 μM wherein the EC50 reflects the half-maximal effective concentration, and which is higher than the EC50 of 0.015 μM for the published LXR agonist TO901317 (J. Schultz et al, Genes Dev. 14, 2831-2838, 2000)
formula (3) (MOLNAME 3252)
Figure imgf000016_0001
The inventors have also found the compounds according to formula (4, 5 and 6) (shown below) to be active as agonist of the LXR human nuclear receptor (see figures for details).
formula (4) (MOLNAME 7459)
Figure imgf000016_0002
formula (5) (MOLNAME 6584)
Figure imgf000017_0001
formula (6) ) (MOLNAME 7364)
Figure imgf000017_0002
In particular the invention relates to a compound as described above wherein said compounds is capable of binding the LXR receptor protein or a portion thereof according to SEQ ID NO. 1 (Fig. 3 A to F) or a mammalian homologue thereof. The claimed compound can bind to the LXR receptor protein or a portion thereof in a mixture comprising 10-200 ng of LXR receptor protein, a fusion protein containing LXR or a portion thereof, preferably the ligand binding domain, fused to a Tag, 5-100 mM Tris /HC1 at pH 6,8-8,3 ; 60-1000 mM KC1; 0-20 mM MgC12; 100-1000ng/μl BSA in a total volume of preferably about 25 μl).
A mammalian receptor protein homologue of the protein according to SEQ ID NO. 1 as used herein is a protein that performs substantially the same task as LXR does in humans and shares at least 40% sequence identity at the amino acid level, preferably over 50 % sequence identity at the amino acid level more preferably over 65 % sequence identity at the amino acid level, even more preferably over 75 % sequence identity at the amino acid level and most preferably over 85 % sequence identity at the amino acid level.
The invention in particular concerns a method for prevention or treatment of a LXR receptor protein or LXR receptor protein homologue mediated disease or condition in a mammal comprising administration of a therapeutically effective amount of a compound according to the invention wherein the prevention or treatment is directly or indirectly accomplished through the binding of a compound according to the invention to the LXR receptor protein or to the LXR receptor protein homologue.
The term mediated herein means that the physiological pathway in which the LXR receptor protein acts is either directly or indirectly involved in the disease or condition to be treated or prevented. In the case where it is indirectly involved it could be that, e.g. modulating the activity of LXR by a compound according to the invention influences a parameter which has a beneficial effect on a disease or a condition. One such example is that modulation of LXR activity leads to decreased levels of serum cholesterol or certain lipoproteins which in turn have a beneficial effect on the prevention and treatment of atherosclerosis. Herein a condition is a physiological or phenotypic state which is desirably altered. One such example would be obesity which is not necessarily medically harmful but nonetheless a non desirable phenotypic condition. In a preferred embodiment of the invention the method for prevention or treatment of a LXR receptor protein mediated disease or condition is applied to a human. This may be male or female.
Pharmaceutical compositions generally are administered in an amount effective for treatment or prophylaxis of a specific condition or conditions. Initial dosing in human is accompanied by clinical monitoring of symptoms, such symptoms for the selected condition. In general, the compositions are administered in an amount of active agent of at least about 100 μg/kg body weight. In most cases they will be administered in one or more doses in an amount not in excess of about 20 mg/kg body weight per day. Preferably, in most cases, doses is from about 100 μg/kg to about 5 mg/kg body weight, daily.
For administration particularly to mammals, and particularly humans, it is expected that the daily dosage level of active agent will be 0,1 mg/kg to 10 mg/kg and typically around 1 mg/kg.
By "therapeutically effective amount" is meant a symptom- alleviating or symptom -reducing amount, a cholesterol-reducing amount, a cholesterol absorption blocking amount, a protein and/or carbohydrate digestion-blocking amount and/or a de novo cholesterol biosynthesis- blocking amount of a compound according to the invention. Likewise, the invention concerns a method of treating in mammal a disease which is correlated with abnormal cholesterol, triglyceride, or bile acid levels or deposits comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to the invention.
Accordingly, the compounds according to the invention may also be used as a method of prevention or treatment of mammalian atherosclerosis, gallstone disease, lipid disorders, Alzheimer's disease, skin disorders, obesity or cardiovascular disorders such as coronary heart disease or stroke.
The invention further concerns a method of blocking in a mammal the cholesterol absorption in the intestine in need of such blocking comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to the invention. The invention may also be used to treat obesity in humans.
The Liver X Receptor alpha is a prototypical type 2 nuclear receptor meaning that it activates genes upon binding to the promoter region of target genes in a heterodimeric fashion with Retinoid X Receptor. The relevant physiological ligands of LXR are oxysterols The present compounds according to the invention have been demonstrated to have a high binding efficacy (binding coefficients measured as EC50 in the range 100 nM to 1500 nM) as well as agonistic and / or antagonistic properties. Consequently they may be applied to regulate genes that participate in bile acid, cholesterol and fatty acid homeostasis as well as other downstream regulated genes. Examples of such genes are but are not limited to lipid absorption, cholesterol biosynthesis, cholesterol transport or binding, bile acid transport or binding, pro- teolysis, amino acid metabolism, glucose biosynthesis, protein translation, electron transport, and hepatic fatty acid metabolism. LXR often functions in vivo as a heterodimer with the Retinoid X Receptor. Published LXR agonists such as the Tularik compound "TO901317" (See figure 5) are known to influence the regulation of various liver genes. Genes found to be regulated by TO901317 can be found in figure 6. Thus, the invention also concerns a method of modulating a gene whose expression is regulated by the LXR receptor in a mammal comprising administration of a therapeutically effective amount of a compound according to the invention to said mammal. A number of direct and indirect LXR target genes have been described whose regulated expression contribute to cholesterol homeostasis and lipogenesis. In this respect the direct regulation of Cyp7A, which was shown to be a direct target gene of LXR at least in the rodent lineage is an important aspect of cholesterol removal by increased metabolism of bile acids (Lehmann et al, J Biol.Chem. 272 (6) 3137-3140; 1007). Gupta et al. (Biochem. Biophys Res.Com, 293; 338-343, 2002) showed that LXR regulation of Cyp7A is dominant over FXR inhibitory effects on Cyp7A transcription.
A key transcription factor that was also shown to be a direct target gene for the LXR receptor is SREBP-IC (Repa et al., Genes and Development, 14:2819-2830; 2000: Yoshikawa et al; Mol.Cell.Biol.21 (9) 2991-3000, 2001). SREBP-IC itself activates transcription of genes involved in cholesterol and fatty acid synthesis in liver but also other mammalian tissues. Some of the SREBPlc target genes involved in lipogenesis like FAS and SCD have shown to be additionally direct targets of the LXR receptors (Joseph et al.; J Biol Chem. 2002 Mar 29;277(13):11019-25; Liang et al, J Biol Chem. 2002 Mar 15;277(ll):9520-8.).
Another gene that has been shown to be directly regulated by LXRs is the LPL gene, that codes for a key enzyme that is responsible for the hydrolysis of triglycerides in circulating lipoprotein, releasing free fatty acids to peripheral tissues. (Zhang et al. J Biol Chem. 2001 Nov 16;276(46):43018-24.) This enzyme is believed to promote uptake of HDL cholesterol in liver, thereby promoting reverse cholesterol transport. A similar functional involvement in HDL clearance is described for the CETP gene product that facilitated the transfer of HDL cholesterol esters from plasma to the liver. LXR response elements were found in the CETP promoter and direct activation of this gene by LXR was demonstrated (Luo and Tall; J Clin Invest. 2000 Feb;105(4):513-20.).
The regulated transport of cholesterol through biological membranes is an important mechanism in order to maintain cholesterol homeostasis. A pivotal role in these processes in multiple tissues like e.g. macrophages and intestinal mucosa cells is maintained by the ATP- binding cassette transporter proteins (ABC). ABCAl and ABCGl were identified as direct LXR target genes (Costet et al; J Biol Chem. 2000 Sep 8;275(36):28240-5) that mediate cholesterol efflux and prevent thereby e.g. generation of artherogenic plaques in macrophages (Singaraja et al. J Clin Invest. 2002 Jul;110(l):35-42). Other ABC transporters like ABCG5 and ABCG8 , primarily expressed in hepatocytes and enterocytes have also been reported to be directly responsive to LXR agonists ( Repa et al, J Biol Chem. 2002 May 24;277(21): 18793-800. Kennedy et al, J Biol Chem. 2001 Oct 19;276(42):39438-47) and mediate the secretion of sterols from the liver and efflux of dietary sterols from the gut .
Apolipoproteins E, C-I, C-II, and C-IN, that fulfill important roles in lipoprotein/lipid homeostasis have also been shown to be direct targets of the LXR receptor ( Laffitte et al., Proc Νatl Acad Sci U S A. 2001 Jan 16;98(2):507-12; Mak et al.; J Biol Chem. 2002 May 24 [epub ahead of print]). These proteins have been found to be crucial components of chylomicrons, VLDL, IDL, and HDL and are among other things associated with hypertriglyceridemia and arteriosclerosis.
Recently the LXRα itself was shown to be regulated by both LXR receptors in human cell types including macrophages suggesting an autoregulatory amplification event in the response to LXR ligands which could e.g. lead to an enhanced stimulation of LXR target genes like e.g. ABCAl (Bolten et al; Mol Endocrinol. 2002 Mar;16(3):506-14.; Laffitte et al, Mol Cell Biol. 2001 Νov;21(22):7558-68; Whitney et al.; J Biol Chem. 2001 Nov 23;276(47):43509- 15).
Besides the important function of LXR receptors in tissues like liver and macrophages it has recently been reported that that stimulation of epidermal differentiation is mediated by Liver X receptors in murine epidermis. Differentiation maker genes like involucrin, loricin and pro- filaggrin have been shown to be upregulated upon LXR ligand treatment (Kόmuves et al.; J Invest Dermatol. 2002 Jan;118(l):25-34.).
Another recent report describes the regulation of cholesterol homeostasis (primarily the regulation of ABCAl, ABCGl and SREBP-IC) by the LXR receptors in the central nervous system suggesting that LXRs may prove beneficial in the treatment of CNS diseases such as Alzheimer's and Niemann-Pick disease that are known to be accompanied by dysregulation of cholesterol balance (Whitney et al.; Mol Endocrinol. 2002 Jun;16(6):1378-85).
Therefore one important embodiment the invention concerns are methods that enhances or suppresses amongst other today yet unknown LXR target genes the above mentioned genes and the associated biological processes and pathways through LXR compounds that are subject of this invention.
The compounds according to the invention may be used as medicaments, in particular for the manufacture of a medicament for the prevention or treatment of a LXR receptor protein or LXR receptor protein homologue mediated disease or condition in a mammal wherein the prevention or treatment is directly or indirectly accomplished through the binding of the compound according to the invention to the LXR receptor protein or LXR receptor protein homologue. These pharmaceutical compositions contain 0,1 % to 99,5 % of the compound according to the invention, more particularly 0,5 % to 90 % of the compound according to the invention in combination with a pharmaceutically acceptable carrier.
The invention concerns also the use of a compound according to the invention for the manufacture of a medicament for the prevention or treatment of a LXR receptor protein mediated disease or condition wherein the mammal described above is a human. The medicament may be used for regulating the cholesterol transport system , for regulating levels of cholesterol, triglyceride, and/or bile acid in a mammal preferentially a human by activating the LXR receptor. The medicament may be used for the treatment of atherosclerosis, gallstone disease, lipid disorders, Alzherimer's disease, skin disorders, obesity or a cardiovascular disorder.
The further concerns the use of a compound according to the invention for the manufacture of a medicament capable for blocking in a mammal, preferentially a human the cholesterol absorption in the intestine. Further the claimed compound may be used for the manufacture of a medicament for treating obesity in humans and for modulating a gene whose expression is regulated by the LXR receptor (see details above and figures).
The present invention shall now be further illustrated based on the following examples without being limited thereto. In the accompanying sequence protocol and the figures:
SEQ ID NO. 1 shows protein sequence of the LRX alpha protein a portion of which was used for cloning as described in the examples,
SEQ ID NO. 2 shows the mRNA sequence of the LRX alpha protein, SEQ ID NO. 3 shows the protein sequence of TIF2 (Ace. No: XM_011633 RefSeq DB),
SEQ ID NO. 4 shows the respective mRNA sequence corresponding to the TIF2 protein,
SEQ ID NO 5 shows the protein sequence of the LXR beta protein a portion of which was used for cloning as described in examples,
SEQ ID NO 6 shows the mRNA sequence of the LXR beta protein,
SEQ ID NO 7 shows the sequence of primer (a) used in Example 1
SEQ ID NO 8 shows the sequence of primer (b) used in Example 1.
Fig. 1 shows the synthesis of the compounds according to the invention as also described in Example 2.
Fig. 2 shows the measurement parameters employed by the Wallace NICTOR2N™ Multila- bel Counter which was used for measuring the EC50 values
Fig. 3 A shows SEQ ID NO. 1 which is the protein sequence of the LRX alpha protein a portion of which was used for cloning as described in the examples . Figure 3 B shows SEQ ID NO. 2 which is the mRNA sequence of the LRX alpha protein. Figure 3 C shows SEQ ID NO. 3 which is the protein sequence of TIF2 (Ace. No: XM_011633 RefSeq DB), Figure 3 D shows SEQ ID NO. 4 which is the respective mRNA sequence corresponding to the TIF2 protein. Figure 3 E shows SEQ ID NO 5 which is the protein sequence of the LXR beta protein a portion of which was used for cloning as described in examples. Figure 3 F shows SEQ ID NO 6 which is the mRNA sequence of the LXR beta protein.
Fig. 4 shows the internal molecular name used by the applicant (MOLNAME) as well as the corresponding structures of preferred compounds according to the invention. The figure further shows their respective EC50 values (EC50 AVG) as established according to the experiment 1 in multiple experiments (see above), as well as their respective average efficacy (% activity relative to 22-(R)-hydroxy cholesterol control agonist). Figure 5 shows various known LXR ligands. It is apparent from their structures that the inventors have identified novel compounds which are structurally not related to these known ligands.
Figure 6 shows various genes that have been found to be regulated through binding of an LXR agonist to the LXR protein.
Figure 7 shows a dose-dependent transactivation (EC50 ~ 3 μM) by LN0000007465 of the luciferase reporter gene via LXR alpha.
Figure 8 shows (A) Analysis of mRNA content of the indicated genes in total RNA isolated from THP-1 cells treated for 24 hours with 2, 10 or 25μM of LN0000006500 or 10 μM of the Tularik compound (T0901317). (B) Analysis of mRNA content fo the indicated genes in total RNA from HepG2 cells treated for 24 hours with 2, 10 or 25 μM of LN0000006500 or 10 μM of the Tularik compound (T0901317).
Figure 9 shows the dose dependent transactivation by LN0000006500 of the pFR-luc reporter gene in CHO cells via Gal4 LBD-fusion constructs derived from LXRa- or LXRb. Concentrations of the compound administered (μM) and RLU's determined from extracts of cells are indicated.
Figure 10 shows the analysis of total cholesterol from supernatants of cultivated THP-1 cells incubated without or with ApoAl and ApoAl plus lOμM of the compounds Tularik (T0901317) or LN0000006500, LN0000006662, LN0000006671 or LN0000006672 as indicated.
EXAMPLES
EXAMPLE 1:
In vitro screening for compounds which influence LXR binding to coactivators.
For screening purposes a GST and 6 x His fusion of the LBD (from amino acids 155 of hLXRalpha to 447) of human LXRalpha was constructed by first cloning a Gateway cassette
(Invitrogen) in frame into the Sma I site of the pAGGHLT Polylinker (Pharmingen). Then a
PCR fragment specifically amplified from human liver cDNA was cloned into the resulting pACGHLT-GW following the manufacturers instructions for Gateway cloning (Invitrogen) to yield pACGHLT-GW-hLXRalphaLBD.
Primers used for amplification were: primer (a)
GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCTTCGCAAATGCCGTCAG (SEQ ID NO 7), and primer (b)
GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCTTCTCAGTCTGTTCCACTT (SEQ ID NO 8).
100 % sequence integrity of all recombinant products was verified by sequencing. Recombinant Baculovirus was constructed from pACGHLT-GW-hLXRalphaLBD using the Pharmingen Baculovirus Expression vector system according to instructions of the manufacturer. Monolayer cultures of SF9 cells were infected by the virus as recommended by Pharmingen or 200ml cultures of 1 xlO cells/ml grown in 2 liter Erlenmeyer flasks on an orbital shaker at 30 rpm were infected by 10ml of same virus stock. In both cases cells were harvested 3 days after infection. All cell growth was performed in Gibco SF900 II with Glutamine (Invitrogen) medium without serum supplementation at 28°C. Since SF9 cells contain significant amounts of endogenous GST, purification was performed via His and not via GST affinity chromatog- raphy. To this end instructions of Pharmingen for purification of recombinant His tagged proteins from SF9 cells were followed with the following modifications: All detergents were omitted from the buffers and cells were lysed on ice by 5 subsequent sonication pulses using a sonicator needle at maximum power.
All eluates were dialyzed against 20 mM Tris/HCl pH 6,8, 300 mM KC1; 5 mM MgCl2; 1 mM DTT; 0,2 mM PMSF; 10% Glycerol. A typical dialyzed eluate fraction contained the fusion protein at a purity of more than 80%. Total protein concentration was 0,1-0,3 mg/ml.
For E. coli expression of a NR coactivator, pDestl7-hTif2BD expressing a NR interaction domain from amino acids 548-878 of human Tif2 (Ace. No: XM_011633 RefSeq) tagged by 6 N-terminal His residues was constructed. Therefore, a PCR fragment specifically amplified from human liver cDNA was subcloned into pDest 17 (Invitrogen) following the manufacturers instructions for Gateway cloning (Invitrogen).Primers used for Amplification were: primer
(a) GGGGACAAGTTTGTACAAAAAAGCAGGCTCGTTAGGGTCATCGTTGGCTTCACC and primer (b)
GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAAAGTTGCCCTGGTCGTGGGTTA
For E. coli expression plasmid DNA was transformed into chemically competent E. coli BL21 (Invitrogen, USA) and cells were grown to an OD600 of 0.4-0.7 before expression was induced by addition of 0,5 mM IPTG according instructions of the manufacturer (Invitrogen). After induction for 8 hours at 30°C cells were harvested by centrifugation for 10 minutes at 5000 x g. Fusion proteins were affinity purified using Ni-NTA Agarose (QIAGEN) according to the instructions of the manufacturer. Recombinant Tif2 construct was dialyzed against 20 mM Tris/HCL pH 7.9; 60 mM KC1; 5 mM MgCl2; 1 mM DTT, 0,2 mM PMSF; 10% glycerol. A typical dialyzed eluate fraction contained the fusion protein at a purity of more than 80%. Total protein concentration was 0,1-0,3 mg/ml.
The TIF2 fragment was subsequently biotinylated by addition of 5-40μl/ml Tif2 fraction of a Biotinamidocaproate N-Hydroxysuccinimide-ester (Sigma) solution (20 mg/ml in DMSO). Overhead rotating samples were incubated for 2 hours at room temperature. Unincorporated label was then separated using G25 Gel filtration chromatography (Pharmacia Biotech, Sweden). Protein containing fractions from the column were pooled and tested for activity in the assay as described below.
For screening of compound libraries as provided for by the methods shown below in the examples for substances which influence the LXR/Tif 2 interaction, the Perkin Elmer LANCE technology was applied. This method relies on the binding dependent energy transfer from a donor to an acceptor fluorophore attached to the binding partners of interest. For ease of handling and reduction of background from compound fluorescence LANCE technology makes use of generic fluorophore labels and time resoved detection (for detailed description see Hernmila I, Blomberg K and Hurskainen P, Time-resolved resonance energy transfer (TR- FRET) principle in LANCE, Abstract of Papers Presented at the 3 rd Annual Conference of the Society for Biomolecular Screening, Sep., California (1997) )
For screening, 20-200 ng of biotinylated Tif 2 fragment and 10-200 ng of GST-LXR fragment were combined with 0.5-2 nM LANCE Eu-(W1024) labelled anti-GST antibody (Perkin Elmer) and 0,1 -0,5 μg of highly fluorescent APC-labelled streptavidin (Perkin Elmer, AD0059) in the presence of 50μM of individual compounds to be screened in a total volume of 25 μl of 20 mM Tris /HC1 pH 6,8; 300 mM KC1; 5 mM MgC12; 100-1000 ng/μl/ BSA DMSO content of the samples was kept below 4%. Samples were incubated for a minimum of 60 minutes in the dark at room temperature in FIA-Plates black 384well med. binding (Gre- iner).
The LANCE signal was detected by a Perkin Elmer NICTOR2V™ Multilabel Counter applying the detection parameters listed in Fig. 2. The results were visualized by plotting the ratio between the emitted light at 665 nm and at 615 nm. For every batch of recombinant proteins amount of proteins, including BSA and labeling reagents giving the most sensitive detection of hits was determined individually by analysis of dose response curves for 22R Hydroxycholesterol and TO 901317
EXAMPLE 2:
Experimental procedure for the preparation of the compounds according to the invention.
o-AZIDOBEΝZOIC ACID SYNTHESIS (2)
The anthranilic acid (1, 1 eq., 0.5-1 M) was suspended in 6 M HC1, containing enough AcOH (0-20% dependent upon the anthranilic acid) to facilitate dissolution of the anthranilic acid and/or the intermediate diazonium salt, and cooled to 0 °C. NaNO2 (1.1 eq., 1.3-2.5 M) dissolved in H2O was added to the anthranilic acid solution at a rate such that the temperature of the reaction solution remained below 5 °C. The resulting homogeneous solution of the diazonium salt was slowly filtered through a sintered glass funnel into a solution of NaN3 (1.1 eq., 0.7-1.1 M) and NaOAc (12 eq.) in H2O. The reaction mixture was stirred/shaken for 30- 60 min following cessation of vigorous N evolution. Following acidification of the reaction mixture to pH 1 with concentrated HC1, the mixture was cooled to 0 °C to encourage complete precipitation of the o-azidobenzoic acid. The precipitate was collected by filtration and washed with 6 M HC1 (2x) and H2O (2x). The o-azidobenzoic acid product (2) was dried in vacuo (500 mtorr, 30 °C).
ACYLATION OF HYDROXYMETHYL RESIN (4)
To hydroxymethyl resin (1.0 eq., 1.3 mmol/g) and the o-azidobenzoic acid (1, 2.5 eq.) was added DMF (to give 400 mM o-azidobenzoic acid ,1), CsCO3 (2.0 eq.) and KI (2.0 eq.). Following agitation of the reaction mixture for 36-48 h, the resin-bound o-azidobenzoic acid (4) was washed with MeOH (2 cycles), CH2C12 (3 cycles), MeOH (3 cycles), DMF (3 cycles), MeOH (3 cycles) and CH2C1 (3 cycles), and dried in vacuo.
AZA-WITTIG FORMATION (5)
To the resin-bound o-azidobenzoic acid (4,1.0 eq.) was added a solution of PPh3 (THF, 500 mM, 5.0 eq.). After 6 h, the resin was washed with 3 cycles of the following: THF (3 cycles), toluene (3 cycles), CH2C12 (3 cycles) and hexanes (3 cycles). Followed by drying in vacuo to afford resin bound iminophosphorane (5)
CARBODIIMIDE FORMATION (6)
To the resin-bound iminophosphorane (5, 1 eq.) was added isocyanate (9 , 5 eq., 450 mM) dissolved in C1CH2CH2C1. The compounds were shaken at ambient temperature for 16 h, washed with 3 cycles of the following: THF (3 cycles), toluene (3 cycles), CH2CI2 (3 cycles) and hexanes (3 cycles), and dried in vacuo to afford carbodiimide (6).
GUANIDINE FORMATION / CYCLIZATION
To the carbodiimide functionalized resin (6) was added secondary amine (10, 0.6 eq., 500 mM) dissolved in C1CH2CH2C1. The reaction mixture was heated to 50 °C in an incubator for 12-72 h to afford 2-aminoquinazoline (8).
All of the final products were analyzed by HPLC using mass and an Evaporative Light Scattering Detector (ELSD) detection to determine purity and identity.
One skilled in the art will be able to arrive at the compounds claimed herein making use of said protocol.
EXAMPLE 3:
This example illustrates that a compound according to the invention (experiments shown were done with MOLSTRUCTURE LN 0000007465 (see figures 4 for structural formula)) can mediate transactivation of LXR mediated transcription in HEK293 cells.
HEK293 cells were grown in 48 well plates and co-transfected with the pTRexDest30 (Invitrogen) derivatives pTRexDest30-hLXRa, pTRexDest30-hRXRD and the pGL2promoter (Promega) derivative pGL2promoter-LXRRE (each 300 ng of plasmid DNA). The full length human LXR (accession U68233) and the full length human RXRα (accession PI 9793) were cloned into the pTRexDest30 applying the manufacturer protocols for the Gateway1 system (Invitrogen).
The LXR response elements (LXRRE) were (upper case and underlined) 5' CccttTGGTCActcaAGTTCAagtgatgatagaattcggatccttTGGTCActcaAGTTCAagtgA 3' (SEQ ID NO. 5) derived from the rat Cyp7a promoter (Laffite et al, 2001, PNAS 98,pp 507). Luciferase reporter activity was measured in triplicates from extracts of cells after incubating cells in culture medium (DMEM [Gibco-BRL] + 10% FCS [PAA laboratories]) for 16 hours (5% CO2, 37°C) containing 0,5% DMSO (control) or 0,5% DMSO with increasing concentrations of LN0000007465.
A dose-dependent transactivation (EC50 ~ 3 μM) of the reporter gene by LXRa was observed (Fig- 7).
Example 4:
This example shows that described compounds can increase the abundance of mRNA of target genes for the LXR proteins in THP-1 cells treated with TPA.
THP-1 ( 3xl05 cells per dish) cells were seeded in 24 well dishes in 3 ml modified RPMI- 1640 medium (ATTC, Cat.No. 30-2001) containing 10%FCS (GIBCO) and lOOnM TPA and cultivated at 37°C in 5% CO2 for 48 hours. The medium was then removed and replaced with medium containing 10% charcoal/stripped FBS (Hyclone) and incubated with LN0000006500 at 2, 10 or 25 μM concentration or Tularik (T0901317) at 10 μM for 24 hours as indicated in Fig 8 A as an example. HepG2 (4,5x105 cells per dish) were seeded in 24 well dishes in 3 ml DMEM Medium containing 10%FCS (GIBCO) and cultivated at 37°C in 5% CO2 for 48 hours as indicated in Fig 8B.
After incubation for 24 hours in presence of compound, total RNA was isolated from the cells using a Quiagen RNAeasy kit (Quiagen) according to the manufacturers protocol. The RNA was then reverse transcribed and analyzed by TaqMan Analysis using kits and equipment from Perkin-Elmer known to those knowledgeable in the field. The fold change of mRNA abundancy of compound treated versus DMSO treated as a control is shown in Figure 8 A and B for several analyzed target genes indicated in Figure 8Aand B.
Example 5:
This example shows that described compounds can selectively enhance transcription mediated by the LBD's of the respective nuclear receptors LXRa and LXRb.
CHO cells (lxl 05 cells 96well plate) were co-transfected (Lipofectamine 2000 GIBCO) with pFR-luc (Stratagene) as a reporter gene construct and pCMV-AD derivatives containing the LXRa or LXRb ligand binding domains, which were cloned via the gateway system (GIBCO) described in Example 1, in order to express Gal4DBD-LXRa or Gal4DBD-LXRb fusion proteins.
Cells were grown in DMEM containing 10%FCS at 37°C in 5% humidified CO2 for 16h in presence of 0,05% DMSO vehicle or 0,032 to 50 μM LN0000006500 in vehicle (as indicated in Fig.9). Luciferase activity was determined from aliquots of extracts prepared from cells following standard luciferase assay kits and protocols from Promega.
Example 6:
This example shows that described compounds at 10 μM concentration for 24 hours can increase the reverse cholesterol transport in THP-1 cells that were treated with TPA.
THP-1 (lxl 06 cells per dish) cells were seeded in 6 well dishes in 3ml modified RPMI1640 medium ( ATTC, Cat.No. 30-2001) containing 10%FCS (GIBCO) and lOOnM TPA and cultivated at 37°C in 5% CO2 for 72 hours. The medium was then removed and replaced with fresh medium containing 100 nM TPA and 0,15 % BSA. After 24 h incubation the cells were washed in PBS and 1,5 ml of fresh medium containing either 0,1 % DMSO alone or 0,1 % DMSO together with 40μg/ml ApoAl (Calbiochem) or 40μg/ml ApoAl plus the in Fig.10 as an example indicated compounds Tularik (T0901317), LN0000006500, LN0000006662, LN0000006671, LN0000006674 at 10 μM.
After incubation for 24 hours, total cholesterol was determined from cell supernatant in each of the wells using an enzymatic assay with fluorescence read-out for the determination of cholesterol (Amplex Red Cholesterol Assay Kit (A- 12213). The fluorescence readout per mg of total protein content as determined from cells that were present in the respective well are shown in Figure 9 as an example.

Claims

Claims:
1. A compound of the formula (1), or pharmaceutical acceptable salts or solvates thereof according to formula (1)
Figure imgf000032_0001
wherein:
Ri, R2, R3 and/or Rt, is independently from each other H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C6 alkyl, Ci to C6 substituted alkyl, Ci to C7 alkoxy, Ci to C7 substituted alkoxy, Ci to C7 acyl, Ci to C substituted acyl, Ci to C7 acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstituted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 alkyl)carboxamide, protected N-(Cι to C6 alkyl)carboxamide, N, N-di(Cι to C6 alkyl)carboxamide, trifluoromethyl, N-((Cι to C6 alkyl)sulfonyl)amino, N- (phenylsulfonyl)amino or phenyl, wherein the phenyl is substituted or unsubstituted, R5 is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, C to C12 alkylphenyl or C to C12 substituted phenylalkyl,
Rδ is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, C to C12 alkylphenyl or C to C12 substituted phenylalkyl, and
R is H, Ci to C8 alkyl, Ci to C8 substituted alkyl, C to Cι2 alkylphenyl or C to C12 substituted phenylalkyl.
A compound according to claim 1 wherein R^ and R are taken together with nitrogen to form a heterocycle or substituted heterocycle or a heteroaryl or substituted heteroaryl according to the following formula
(2).
Figure imgf000032_0002
3. A compound according to claim 2, or pharmaceutical acceptable salts or solvates thereof, wherein:
Ri, R2, R3, R4, is H, halogen, hydroxy, protected hydroxy, cyano, nitro, Ci to C6 alkyl, Ci to C6 substituted alkyl, Ci to C7 alkoxy, Ci to C7 substituted alkoxy, Ci to C7 acyl, Ci to C substituted acyl, Ci to C acyloxy, carboxy, protected carboxy, carboxymethyl, protected carboxymethyl, hydroxymethyl, protected hydroxymethyl, amino, protected amino, (monosubstiιuted)amino, protected (monosubstituted)amino, (disubstituted)amino, carboxamide, protected carboxamide, N-(Cι to C6 al- kyl)carboxamide, protected N-(Cι to C6 alkyl)carboxamide, N, N-di(Cι to C6 al- kyl)carboxamide, trifluoromethyl, N-((Ci to C6 alkyl)sulfonyl)amino, N- (phenylsul- fonyl)amino or phenyl, and R5 is H, Ci to C8 alkyl, Ci to C8 substituted alkyl.
4. A compound according to claim 1 wherein R6 and R are taken together with nitrogen to form the heterocycle according to the following formula (3)
Figure imgf000033_0001
A compound according to any of claims 1 to 3 of the following formula (4)
formula (4)
Figure imgf000033_0002
A compound according to any of claims 1 to 3 of the following formula (5)
formula (5)
Figure imgf000034_0001
A compound according to any of claims 1 to 3 of the following formula (6)
formula (6)
Figure imgf000034_0002
A compound according to any of claims 1 and 4 wherein Re and R are taken together with nitrogen to form the heterocycle according to the following formula (7)
formula (7)
Figure imgf000034_0003
9. A compound according to claim 1 according to the following formula (8) formula (8)
Figure imgf000034_0004
10. A compound according to claims 1 and 4 according to the following formula (8)
formula (8)
Figure imgf000035_0001
11. A compound according to any of claims 1 to 10 wherein said compound is capable of binding the NR1H3 receptor protein or a portion thereof according to SEQ ID NO. 1 or a mammalian homologue thereof.
12. A compound according to any of claims 1 to 10 wherein said compound is capable of binding the NR1H2 receptor protein or a portion thereof or a mammalian homologue thereof.
13. Use of a compound according to any of claims 1 to 12 as a medicament
14. A method for prevention or treatment of a NR1H3 and/or NR1H2 receptor protein mediated disease or NR1H3 and/or NR1H2 receptor protein homologue mediated disease or condition in a mammal comprising administering a therapeutically effective amount of a compound according to any of claims 1 to 12, wherein the prevention or treatment is directly or indirectly accomplished through the binding of the compound according claims 1 to 13 to the NR1H3 and/or NR1H2 receptor proteins or to the NR1H3 and/or NR1H2 receptor protein homologues.
15. A method for prevention or treatment of a NR1 H3 receptor protein and/or NR1 H2 receptor protein mediated disease or condition according to claim 14, wherein said mammal is a human.
16. A method for regulating the cholesterol synthesis and/or transport in a mammal which comprises activating the NR1H3 and/or NR1H2 receptors with a therapeutically effective amount of a compound according to claims 1 to 12.
17. A method of treating in a mammal a disease which is affected by cholesterol, triglyc- eride, or bile acid levels comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to claims 1 to 12.
18. A method of treating atherosclerosis, alzheimers disease, lipid disorders, obesity or a cardiovascular disorder in a mammal, in particular a human, comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to claims 1 to 12.
19. A method according to any of claims 14 to 18 wherein the expression of ABCAl and/or ABCGl and/or ABCG5 and/or ABCG8 is increased.
20. A method according to any of claims claim 14 to 19 wherein the expression of the cholesterol 7 α hydroxylase and/or the activity of the cholesteryl ester transfer protein is increased.
21. A method of blocking in a mammal the cholesterol or fatty acid absorption in the intestine of a mammal in need of such blocking comprising administering to a mammal in need of such treatment a therapeutically effective amount of a compound according to claims 1 to 12.
22. A method for treating obesity in a mammal comprising administering a therapeutically effective amount of a compound according to any of claims 1 to 12.
23. A method of modulating a gene whose expression is regulated by the NR1H3 and/or NR1H2 receptor in a mammal comprising administering a therapeutically effective amount of a compound according to claims 1 to 10.
24. A method according to any of claims claim 14 to 19 wherein the expression of the cholesterol 7 α hydroxylase and/or the activity of the cholesteryl ester transfer protein is enhanced.
25. Use of a compound according to any of claims 1 to 12 wherein the mammal is a human
26. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for the prevention or treatment of a NR1H3 and/or NR1H2 receptor protein or NR1H3 and/or NR1H2 receptor protein homologue mediated disease or condition in a mammal wherein the prevention or treatment is directly or indirectly accomplished through the binding of the compound according claims 1 to 8 to the NR1H3 and/or NR1H2 receptor protein or NR1H3 and/or NR1H2 receptor protein homologue.
27. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for prevention or treatment of a NR1H3 and/or NR1H2 receptor protein mediated disease or condition according to claim 26, wherein the mammal is a human.
28. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for regulating the cholesterol transport system in a mammal by activating the NR1H3 and/or NR1H2 receptor.
29. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for regulating levels of cholesterol, triglyceride, and/or bile acid.
30. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for treating in a mammal atherosclerosis, alzheimer disease, gallstone disease, lipid disorders, obesity or a cardiovascular disorder.
31. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament capable for blocking in a mammal the cholesterol and/or fatty acid absorption in the intestine.
32. Use of the compound according to any of claims 1 to 12 for the manufacture of a medicament for treating obesity in a mammal.
33. Use of a compound according to any of claims 1 to 12 for the manufacture of a medicament for modulating a gene whose expression is regulated by the NR1H3 and/or NR1H2 receptor.
34. Use of a compound according to any of claims 1 to 12 in a mammal for the selective up-regulation of one or more genes selected from the group consisting of ABCAl, ABCGl, ABCG5 and ABCG8 and a down-regulation of one or more of the genes selected from the group comprising FAS and SREBP-lc, said compound showing a larger difference in regulation of the two groups of genes when compared with the regulatory behavior of T0901317 on both groups of genes.
35. Use of a compound according to claims 28, 30, 31, 32, and 34 wherein the mammal is a human.
PCT/EP2003/007067 2002-09-10 2003-07-02 2-amino-4-quinazolinones as lxr nuclear receptor binding compounds WO2004024162A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2004535046A JP2006502169A (en) 2002-09-10 2003-07-02 LXR nuclear receptor binding compound
AU2003296861A AU2003296861A1 (en) 2002-09-10 2003-07-02 2-amino-4-quinazolinones as lxr nuclear receptor binding compounds
CA002498655A CA2498655A1 (en) 2002-09-10 2003-07-02 2-amino-4-quinazolinones as lxr nuclear receptor binding compounds
US11/076,163 US20050261319A1 (en) 2002-09-10 2005-03-09 Novel 2-amino-4-quinazolinones and 2-amino-4-oxoquinazolones as LXR nuclear receptor binding compounds with partial agonistic properties

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20020020255 EP1407774A1 (en) 2002-09-10 2002-09-10 2-Amino-4-quinazolinones as LXR nuclear receptor binding compounds
EP02020255.2 2002-09-10

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/076,163 Continuation-In-Part US20050261319A1 (en) 2002-09-10 2005-03-09 Novel 2-amino-4-quinazolinones and 2-amino-4-oxoquinazolones as LXR nuclear receptor binding compounds with partial agonistic properties

Publications (1)

Publication Number Publication Date
WO2004024162A1 true WO2004024162A1 (en) 2004-03-25

Family

ID=31985024

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2003/007067 WO2004024162A1 (en) 2002-09-10 2003-07-02 2-amino-4-quinazolinones as lxr nuclear receptor binding compounds
PCT/EP2003/010036 WO2004024161A1 (en) 2002-09-10 2003-09-10 Novel 2-amino-4-oxoquinazolones as lxr nuclear receptor binding compounds with partial agonistic properites

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/010036 WO2004024161A1 (en) 2002-09-10 2003-09-10 Novel 2-amino-4-oxoquinazolones as lxr nuclear receptor binding compounds with partial agonistic properites

Country Status (8)

Country Link
US (1) US20050261319A1 (en)
EP (2) EP1407774A1 (en)
JP (1) JP2006502169A (en)
AT (1) ATE325609T1 (en)
AU (2) AU2003296861A1 (en)
CA (1) CA2498655A1 (en)
DE (1) DE60305193T2 (en)
WO (2) WO2004024162A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004111014A1 (en) * 2003-06-06 2004-12-23 Vertex Pharmaceuticals Incorporated Pyrimidine derivatives as modulators of atp-binding cassette transporters
WO2012033353A2 (en) 2010-09-07 2012-03-15 서울대학교 산학협력단 Sesterterpene compounds and use thereof
US10220027B2 (en) 2011-07-13 2019-03-05 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US10329286B2 (en) 2016-06-13 2019-06-25 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10421730B2 (en) 2016-06-13 2019-09-24 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
WO2020021064A1 (en) 2018-07-26 2020-01-30 Domain Therapeutics Substituted quinazolinone derivatives and their use as positive allosteric modulators of mglur4
US11225473B2 (en) 2019-01-15 2022-01-18 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11524005B2 (en) 2019-02-19 2022-12-13 Gilead Sciences, Inc. Solid forms of FXR agonists
US11833150B2 (en) 2017-03-28 2023-12-05 Gilead Sciences, Inc. Methods of treating liver disease

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4887139B2 (en) * 2003-03-25 2012-02-29 武田薬品工業株式会社 Dipeptidyl peptidase inhibitor
JP2006525816A (en) * 2003-05-21 2006-11-16 エフ.ホフマン−ラ ロシュ アーゲー Markers for LXR activation
WO2005101007A1 (en) * 2004-04-15 2005-10-27 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with liver x receptor beta (lxrb)
US8383637B2 (en) 2004-08-06 2013-02-26 Jansssen Pharmaceutica N.V. 2-amino-quinazoline derivatives useful as inhibitors of β-secretase (BACE)
WO2006017844A1 (en) 2004-08-06 2006-02-16 Janssen Pharmaceutica, N.V. NOVEL 2-AMINO-QUINAZOLINE DERIVATIVES USEFUL AS INHIBITORS OF β-SECRETASE (BACE)
US8426429B2 (en) 2004-08-06 2013-04-23 Jansssen Pharmaceutica N.V. 2-amino-quinazoline derivatives useful as inhibitors of β-secretase (BACE)
US8436006B2 (en) 2004-08-06 2013-05-07 Jansssen Pharmaceutica N.V. 2-amino-quinazoline derivatives useful as inhibitors of β-secretase (BACE)
US7846915B2 (en) * 2004-10-20 2010-12-07 Resverlogix Corporation Stilbenes and chalcones for the prevention and treatment of cardiovascular diseases
ES2438739T3 (en) * 2005-06-28 2014-01-20 Daiichi Sankyo Company, Limited LXR ligand test procedure
AU2006275514B2 (en) * 2005-07-29 2012-04-05 Resverlogix Corp. Pharmaceutical compositions for the prevention and treatment of complex diseases and their delivery by insertable medical devices
EP1966198B1 (en) 2005-10-25 2011-03-16 Janssen Pharmaceutica NV 2-amino-3,4-dihydro-pyrido[3,4-d]pyrimidine derivatives useful as inhibitors of beta-secretase (bace)
US7776882B2 (en) 2006-02-06 2010-08-17 Baxter Ellen W 2-amino-3,4-dihydro-quinoline derivatives useful as inhibitors of β-secretase (BACE)
WO2007092839A2 (en) 2006-02-06 2007-08-16 Janssen Pharmaceutica N.V. Macrocycle derivatives useful as inhibitors of beta-secretase (bace)
US7868022B2 (en) 2006-02-06 2011-01-11 Janssen Pharmaceutica Nv 2-amino-quinoline derivatives useful as inhibitors of β-secretase (BACE)
CN101595096B (en) 2006-11-30 2012-06-27 兴和株式会社 Substituted carbinol compound
CN101641339B (en) 2007-02-01 2013-07-17 雷斯韦洛吉克斯公司 Compounds for the prevention and treatment of cardiovascular diseases
CN101925578B (en) 2008-01-28 2012-11-28 詹森药业有限公司 6-substituted-thio-2-amino-quinoline derivatives useful as inhibitors of ss-secretase (BACE)
JP2011510993A (en) 2008-01-29 2011-04-07 ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ 2-Amino-quinoline derivatives useful as β-secretase (BACE) inhibitors
US7919509B2 (en) 2008-02-29 2011-04-05 Kowa Company, Ltd. 2-oxochromene derivatives
JP5511080B2 (en) 2008-03-31 2014-06-04 興和株式会社 1,3-dihydroisobenzofuran derivative
EP2272843A4 (en) 2008-04-30 2011-07-20 Kowa Co Quinoline compound
US8153634B2 (en) 2008-05-29 2012-04-10 Kowa Company, Ltd. Carbinol derivatives having cyclic linker
KR101629356B1 (en) 2008-06-26 2016-06-13 리스버로직스 코퍼레이션 Methods of preparing quinazolinone derivatives
AU2010204106B2 (en) 2009-01-08 2014-05-08 Resverlogix Corp. Compounds for the prevention and treatment of cardiovascular disease
MX2021012876A (en) 2009-03-18 2022-06-23 Resverlogix Corp Novel anti-inflammatory agents.
EP2414521B1 (en) * 2009-03-31 2016-10-26 The General Hospital Corporation Regulation of mir-33 micrornas in the treatment of cholesterol-related disorders
ES2821018T3 (en) 2009-04-22 2021-04-23 Resverlogix Corp New anti-inflammatory agents
NZ595910A (en) 2009-04-29 2013-06-28 Kowa Co Carbinol compound having heterocyclic linker
PT2773354T (en) 2011-11-01 2019-07-17 Resverlogix Corp Oral immediate release formulations for substituted quinazolinones
WO2014080291A2 (en) 2012-11-21 2014-05-30 Rvx Therapeutics Inc. Biaryl derivatives as bromodomain inhibitors
US9073878B2 (en) 2012-11-21 2015-07-07 Zenith Epigenetics Corp. Cyclic amines as bromodomain inhibitors
AU2013365926B9 (en) 2012-12-21 2019-01-17 Zenith Epigenetics Ltd. Novel heterocyclic compounds as bromodomain inhibitors
UY35675A (en) 2013-07-24 2015-02-27 Novartis Ag SUBSTITUTED DERIVATIVES OF QUINAZOLIN-4-ONA
AU2015204572B2 (en) 2014-01-10 2020-07-30 Inspirna, Inc. LXR agonists and uses thereof
US10111885B2 (en) 2015-03-13 2018-10-30 Resverlogix Corp. Compositions and therapeutic methods for the treatment of complement-associated diseases
EP3402477A4 (en) 2016-01-11 2019-08-21 The Rockefeller University Methods for the treatment of myeloid derived suppressor cells related disorders
WO2019104062A1 (en) 2017-11-21 2019-05-31 Rgenix, Inc. Polymorphs and uses thereof
US11174220B2 (en) 2019-12-13 2021-11-16 Inspirna, Inc. Metal salts and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3609152A (en) * 1965-03-23 1971-09-28 Pfizer Certain 2-amino-3,4-dihydrogen-inazolin-4-ones and 4-thiones
WO1997020823A2 (en) * 1995-12-01 1997-06-12 Novartis Ag 2-amino quinazoline derivatives as npy receptor antagonists
WO2002048152A2 (en) * 2000-12-12 2002-06-20 Neurogen Corporation Spiro[isobenzofuran-1,4'-piperidin]-3-ones and 3h-spiroisobenzofuran-1,4'-piperidines
WO2002062798A2 (en) * 2001-02-05 2002-08-15 Dr. Reddy's Laboratories Ltd. Salts of pyrimidine derivatives for use against coronary heart disease and atherosclerose

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE792206A (en) * 1971-12-02 1973-06-01 Byk Gulden Lomberg Chem Fab
US3867384A (en) * 1972-09-01 1975-02-18 Greg A Bullock 2-Amino-4(3H)-quinazolinones
RU2139862C1 (en) * 1993-05-12 1999-10-20 Е.И. Дю Пон де Немурс энд Компани Substituted 4(3h) quinazolinones having fungicidal properties, compositions based thereon, and methods of controlling powdery mildew
JP2005531583A (en) * 2002-05-23 2005-10-20 カイロン コーポレイション Substituted quinazolinone compounds

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3609152A (en) * 1965-03-23 1971-09-28 Pfizer Certain 2-amino-3,4-dihydrogen-inazolin-4-ones and 4-thiones
WO1997020823A2 (en) * 1995-12-01 1997-06-12 Novartis Ag 2-amino quinazoline derivatives as npy receptor antagonists
WO2002048152A2 (en) * 2000-12-12 2002-06-20 Neurogen Corporation Spiro[isobenzofuran-1,4'-piperidin]-3-ones and 3h-spiroisobenzofuran-1,4'-piperidines
WO2002062798A2 (en) * 2001-02-05 2002-08-15 Dr. Reddy's Laboratories Ltd. Salts of pyrimidine derivatives for use against coronary heart disease and atherosclerose

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Chem.Folio", 15 January 2001, LION BIOSCIENCE AG, HEIDELBERG, GERMANY *
COLLINS, J. L. ET AL.: "Identification of a Nonsteroidal Liver X Receptor Agonist through Parallel Array Synthesis of Tertiary Amines", JOURNAL OF MEDICINAL CHEMISTRY, vol. 45, 2002, pages 1963 - 1966, XP002225147 *
DATABASE CHEMCATS CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 2001, XP002225148 *
GUPTA C M ET AL: "Drugs acting on the central nervous system. Syntheses of substituted quinazolones and quinazolines and triazepino- and triazocinoquinazolones", JOURNAL OF MEDICINAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY. WASHINGTON, US, vol. 11, no. 2, 26 February 1968 (1968-02-26), pages 392 - 395, XP002156695, ISSN: 0022-2623 *
MANABU HORI ET AL: "Novel 4-Substituted 2-Piperazinylquinazolines as potent Anticonvulsive and Antihypoxic Agents", CHEMICAL AND PHARMACEUTICAL BULLETIN, PHARMACEUTICAL SOCIETY OF JAPAN. TOKYO, JP, vol. 38, no. 5, 1990, pages 1286 - 1291, XP002128282, ISSN: 0009-2363 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004111014A1 (en) * 2003-06-06 2004-12-23 Vertex Pharmaceuticals Incorporated Pyrimidine derivatives as modulators of atp-binding cassette transporters
US8642609B2 (en) 2003-06-06 2014-02-04 Vertex Pharmaceuticals Incorporated Modulators of ATP-binding cassette transporters
WO2012033353A2 (en) 2010-09-07 2012-03-15 서울대학교 산학협력단 Sesterterpene compounds and use thereof
US10485795B2 (en) 2011-07-13 2019-11-26 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US10220027B2 (en) 2011-07-13 2019-03-05 Gilead Sciences, Inc. FXR (NR1H4) binding and activity modulating compounds
US10329286B2 (en) 2016-06-13 2019-06-25 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10421730B2 (en) 2016-06-13 2019-09-24 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10774054B2 (en) 2016-06-13 2020-09-15 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US10981881B2 (en) 2016-06-13 2021-04-20 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11247986B2 (en) 2016-06-13 2022-02-15 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11739065B2 (en) 2016-06-13 2023-08-29 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11833150B2 (en) 2017-03-28 2023-12-05 Gilead Sciences, Inc. Methods of treating liver disease
WO2020021064A1 (en) 2018-07-26 2020-01-30 Domain Therapeutics Substituted quinazolinone derivatives and their use as positive allosteric modulators of mglur4
US11225473B2 (en) 2019-01-15 2022-01-18 Gilead Sciences, Inc. FXR (NR1H4) modulating compounds
US11524005B2 (en) 2019-02-19 2022-12-13 Gilead Sciences, Inc. Solid forms of FXR agonists

Also Published As

Publication number Publication date
US20050261319A1 (en) 2005-11-24
WO2004024161A1 (en) 2004-03-25
ATE325609T1 (en) 2006-06-15
CA2498655A1 (en) 2004-03-25
EP1407774A1 (en) 2004-04-14
AU2003271595A1 (en) 2004-04-30
EP1536799B1 (en) 2006-05-10
EP1536799A1 (en) 2005-06-08
DE60305193T2 (en) 2007-06-14
JP2006502169A (en) 2006-01-19
DE60305193D1 (en) 2006-06-14
AU2003296861A1 (en) 2004-04-30

Similar Documents

Publication Publication Date Title
EP1407774A1 (en) 2-Amino-4-quinazolinones as LXR nuclear receptor binding compounds
EP1398032A1 (en) 4-Oxo-quinazolines as LXR nuclear receptor binding compounds
EP1285914B1 (en) Nr1h4 nuclear receptor binding compounds
US20070010562A1 (en) Nr1h4 nuclear receptor binding compounds
JP6556154B2 (en) Isoquinoline derivatives and uses thereof
EP2116523B1 (en) Rexinoid compound having alkoxy group
JP2010280732A (en) Modulators of lxr
EP2280706B1 (en) Lipoprotein lipase-activating compositions comprising benzene derivatives
KR20070041560A (en) Arylidenes for the treatment of estrogen related receptor-alpha mediated diseases
KR20080089416A (en) Compositions and methods for modulating gated ion channels
JP2006501243A (en) A pyrrole-based inhibitor of glycogen synthase kinase 3
CN101679297A (en) lxr and fxr modulators
JP2006514614A (en) 11β-hydroxysteroid dehydrogenase type 1 and type 2 inhibitors
WO2003015777A1 (en) Nr1h4 nuclear receptor binding compounds
US8119640B2 (en) Hedgehog pathway antagonists methods of use
KR20150037877A (en) Bifluorodioxalane-amino-benzimidazole kinase inhibitors for the treatment of cancer, autoimmune inflammation and cns disorders
JP2002114768A (en) 2-(2,5-dihalogen-3,4-dihyroxyphenyl)azole and medicinal composition containing the same
US20060148876A1 (en) Nr3b1 nuclear receptor binding 3-substituted pyrazoles
WO2006127379A2 (en) Par2-modulating compounds and their use
Crocetti et al. Synthesis and pharmacological evaluation of new pyridazin‐based thioderivatives as formyl peptide receptor (FPR) agonists
Cai et al. Design, synthesis, and biological evaluation of benzofuran derivatives as ET receptor antagonists
Ohnuma et al. S1P 3 receptor antagonist

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 11076163

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2498655

Country of ref document: CA

Ref document number: 2004535046

Country of ref document: JP

122 Ep: pct application non-entry in european phase