WO2004023869A1 - Use of plag or plag-inhibitors to diagnose and/or treat disease - Google Patents

Use of plag or plag-inhibitors to diagnose and/or treat disease Download PDF

Info

Publication number
WO2004023869A1
WO2004023869A1 PCT/EP2003/050404 EP0350404W WO2004023869A1 WO 2004023869 A1 WO2004023869 A1 WO 2004023869A1 EP 0350404 W EP0350404 W EP 0350404W WO 2004023869 A1 WO2004023869 A1 WO 2004023869A1
Authority
WO
WIPO (PCT)
Prior art keywords
plag1
proteins
plagl2
plag
nucleic acids
Prior art date
Application number
PCT/EP2003/050404
Other languages
French (fr)
Inventor
Wim J. M. Van De Ven
Caroline Braem
Marcela Chavez
Karen Hensen
Isabelle Van Valckenborgh
Marianne Voz
Original Assignee
Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw
K.U. Leuven Research & Development
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw, K.U. Leuven Research & Development filed Critical Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw
Priority to AU2003296309A priority Critical patent/AU2003296309A1/en
Publication of WO2004023869A1 publication Critical patent/WO2004023869A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • Plag or Plag-inhibitors to diagnose and/or treat disease
  • Plag 1 and Plag L2 two members of the Plag gene family, have oncogenic capacity and expression of Plagl is highly upregulated in pleomorphic salivary gland adenomas.
  • the present invention discloses Plag transgenic mouse strains and Plag knockout mice and reveals that the Plag nucleic acids and proteins are crucial targets to diagnose or treat several neoplasms, urine/faeces retention, infertility, heart failure and/or aberrant body weight.
  • Pleomorphic adenoma of the salivary gland constitute benign epithelial tumors originating from the major and minor salivary glands, which only rarely undergo malignant transformation.
  • the largest cytogenetic subgroup of pleomorphic adenoma of the salivary glands (40% of cases) carries chromosome 8q12 aberrations with 3p21 as preferential translocation partner.
  • Kas et al. (1997) demonstrated that this t(3;8)(p21;q12), results in promoter swapping between PLAG1, a novel, developmental ⁇ regulated zinc finger protein gene at 8q12, and the ubiquitously and constitutively expressed gene for beta-catenin, a protein interface functioning in cell adhesion and the Wnt signaling pathway.
  • Fusions occur in the 5'-noncoding regions of both genes, exchanging regulatory elements while preserving the coding sequences. Due to the translocation, PLAG1 transcription is activated and expression levels of beta-catenin are reduced. Activation of PLAG1 was also observed in an adenoma with a variant translocation t(5;8). The latter translocation leads to ectopic expression of a chimeric transcript consisting of sequences from the ubiquitously and constitutively expressed gene for the leukemia inhibitory factor receptor (LIFR) and PLAG1 (Voz et al., 1998). As for the t(3;8), the fusions occurred in the ⁇ '-noncoding regions of both genes, exchanging regulatory control elements while preserving the coding sequences.
  • LIFR leukemia inhibitory factor receptor
  • the PLAG1 gene is the prototype member of a larger gene family to which also PLAGL1 and PLAGL2 belong (Kas et al., 1998).
  • the PLAG1 protein contains seven canonical C 2 H 2 zinc finger domains and a serine-rich carboxy-terminus. While the carboxy-terminal part of PLAGL1 shows strong overall transcriptional activity in the mesenchymal COS-1 cells and the epithelial 293 cells, both PLAG1 and PLAGL2 transactivate in COS-1 cells only if depleted from a repressing region. This effect is less profound in the 293 epithelial cells. These data suggest that the activation in pleomorphic adenomas of PLAG1, most likely results in uncontrolled activation of downstream target genes.
  • PLAG1 and PLAGL2 seem to share functional characteristics and are considered by us as candidate proto-oncogenes.
  • PLAGL1 differs from the two other members. It has been isolated by Abdollahi et al. (1997) and Spengler et al. (1997) and is considered to be a candidate tumor suppressor gene (Bilanges et al., 1999; Varrault et al., 1998).
  • PLAG1 is a nuclear protein that binds DNA in a specific manner.
  • the consensus PLAG1 binding site is a bipartite element containing a Core sequence, GRGGC, and a G-cluster, RGGK, separated by 7 random nucleotides. DNA binding is mediated mainly via three of the seven zinc fingers, with fingers 6 and 7 interacting with the Core and finger 3 with the G-cluster.
  • PLAG1 specifically activates transcription from its consensus DNA binding site indicating that PLAG1 is a genuine transcription factor.
  • Potential PLAG1 binding sites were found in promoter 3 of the human insulin-like growth factor 2 (IGF-II) gene.
  • PLAG1 binds IGF-II promoter 3 and stimulates its activity. Moreover, IGF-II transcripts originating from the P3 promoter are highly expressed in salivary gland adenomas over-expressing PLAG1. In contrast, they are not detectable in adenomas without abnormal PLAG1 expression or in normal salivary gland tissue. This indicates a perfect correlation between PLAG1 and IGF-II expression.
  • PLAG1 and PLAGL2 More expression data are provided by Queimado ef al. (1999) and the involvement of PLAG1 in lipoblastoma is described by Astrom et al. (2000) and Hibbard et al. (2000). Lipoblastomas are pediatric neoplasms resulting from transformation of adipocytes. It is demonstrated that chromosome 8q12 rearrangements in lipoblastoma bring about promoter-swapping events in the PLAG1 proto-oncogene. It is shown that the hyaluronic acid synthase 2 (HAS2) or collagen 1 alpha 2 (COL1A2) gene promoter regions are fused to the entire PLAG1 coding sequence in each of four lipoblastomas that were studied.
  • HAS2 hyaluronic acid synthase 2
  • COL1A2A2 collagen 1 alpha 2
  • the present invention discloses PLAG 1 and/or PLAGL2 transgenic mouse strains and PLAG 1 and/or PLAG L2 knockout mice and reveals that the PLAG nucleic acids and/or proteins encoded by said nucleic acids are crucial targets and/or therapeutic molecules to diagnose and/or treat disorders such as abdominal distention characterized by severe urine retention and/or faeces retention, several over-growth related neoplasms, mammary gland tumors, reduced fertility, heart failure and/or aberrant body weight.
  • Figure 1 Schematic overview of the genetic organization of the inducible PLAG1 transgenic construct
  • a Cre-mediated intramolecular recombination event leads to the excision and circularization of the floxed Neomycine cassette.
  • One LoxP site remains on each reaction product.
  • PLAG1 is placed under the control of the actin promoter again leading to high expression of PLAG1.
  • the arrow represents the transcription initiation.
  • the map displays the position of three identified exons for plagl (blocks).
  • the filled blocks represent the coding part and the hatched blocks represent non-coding exons.
  • Most important restriction sites are indicated: EcoRI (E); Hindlll (H); BamHI (B); Xbal (X); Mscl (M)
  • the 2KB coding region is deleted and replaced by the LacZ reporter gene and the neomycin selection gene expressed from a PGK promoter (PGK-neo) (both together ⁇ 5KB).
  • the primer pair mP1KH26-up (®) and LacZ2-down (- ⁇ ) used for the PCR screening of the ES cells is indicated.
  • PLAG gene family members appear to act as transcriptional regulators affecting expression of specific target genes.
  • PLAG1 has further been suggested to be involved in the development of adenomas of the salivary gland and lipoblastomas.
  • the present invention aims at providing such a detailed analysis and, as a consequence, aims at providing new diagnostic tools and therapeutic agents for certain specific diseases. Concerning said detailed analysis, the present invention aims at first instance to provide a non- human transgenic animal comprising the PLAG1 and/or PLAGL2 transgene(s).
  • the term 'transgenic animal' refers to any non-human animal such as mice, rats, hamsters, goats, horses, dogs, cats, non-human primates or any other vertebrate and invertebrate animal containing genetic material into which nucleic acids, which are possibly but not necessarily derived from an unrelated organism, have been artificially (i.e. via recombinant gene technology or genetic engineering) introduced.
  • the gene (or nucleic acids) which has been introduced into the genome of said non-human animal is denominated as 'the transgene' or 'heterologous gene' or 'exogenous gene'.
  • transgenes of the present invention PLAG1 and/or PLAGL2 are disclosed in great detail in WO 98/07748 to Van De Ven et al. Methods to produce transgenic animals are well-known in the art; some of said methods are explained in detail in the 'Examples' section (see further).
  • the present invention aims at providing a non-human transgenic animal as mentioned -above wherein the expression of said transgene(s) is regulated by the mouse mammary tumor virus promotor, the Mx1 promotor or a tetracycline inducible system.
  • Mouse mammary tumor virus is an endogenous retrovirus of mice which is causally associated with mammary carcinomas and whose transcription is regulated by steroid hormones. Expression of viral R ⁇ A in the mouse appears to occur predominantly in lactating mammary glands. In this organ, new genomic copies of the virus result from reverse transcription of MMTV R ⁇ A and reintegration of these sequences into novel chromosomal sites. The newly inserted proviruses may cause cellular transformation by activating the Int gene (Choi et al., 1987).
  • MMTV-LTR mouse mammary tumor virus long terminal repeat
  • MMTV expression is regulated by glucocorticoids, progestin, androgens (the MMTN LTR has been shown to contain androgen responsive elements and to be responsive to androgens in vitro) and tissue- specific factors (Donjacour ef al., 1998) and to a lesser extent, mineralocorticoids. Androgens have been demonstrated to induce the MMTV promoter along with the progestagens and glucocorticoids, while the estrogens have not (Mangues ef al., 1990). Androgens can act on the LTR of MMTV when the appropriate receptors are present in the cells, and this interaction can influence the expression of additional adjacent genes (Darrow ef al., 1986).
  • Mx1-Cre mouse By the use of an Mx1-Cre mouse in cross breeding, we have the opportunity to study the more general expression pattern of PLAG1 and/or PLAG L2 in tissues susceptible for PLAG1 and/or PLAGL2 transforming capacity.
  • Mx1 part of a defense mechanism to viral infections, is silent in healthy mice.
  • the Mx1 promoter can be transiently activated to high amounts of transcription in many tissues upon application of interferon alpha or interferon beta or of synthetic double-stranded RNA [polyinosinic-poly-cytidylic acid (pl-pC): an interferon inducer]. Cre recombination in the liver and lymphocytes is 100 %.
  • the recombination rate is variable, ranging from 94% in spleen, duodenum 72%, heart, lung, uterus and thymus around 50% to 8 % in brain (Kuhn etal., 1995).
  • a tetracycline-inducible (Tet-inducible) system allows PLAG1 and/or PLAGL2 overexpression independently in any organ.
  • Tet-inducible a fusion-controlled trans-activator protein (tTA) composed of the Tet repressor and the activating domain of viral protein VP16 of herpes simplex virus strongly activates transcription from the minimal promoter from the human cytomegalovirus (hCMV) fused to Tet operator sequences (tetO-PhCMV).
  • the tTA binds to the Tet operator sequences in the absence of Tetracycline but not in its presence. This results in repression of transcription upon introduction of Tetracycline.
  • the rtTA system which is identical to the tTA system with the exception of 4 amino acid exchanges in the TetR moiety. These changes convey a reverse phenotype to the repressor (rTetR).
  • the resulting rtTA requires Tetracycline, or analogs such as Doxycycline for binding to TetO and thus transcription activation.
  • the present invention thus also aims at providing a non-human animal wherein at least one allele of the gene(s) encoding for PLAG1 and/or PLAGL2 is (are) inactivated. More specifically, the present invention aims at providing a non-human, knockout animal wherein the complete open reading frame of PLAG 1 and/or PLAGL2 is replaced by a heterologous gene such as, but not limited to, the LacZ reporter gene.
  • PLAG1 and/or PLAG L2 play(s) an essential role in the development of disease states such as heart problems resulting in premature death (KO), reduced body weight (KO), reduced fertility (KO), mammary gland tumors (adenocarcinomas) (T), overgrowth (T) and overgrowth-related tumors such as Wilms tumor, leukemia, osteosarcoma and tumors of the kidney, liver and adrenal gland (T) and abdominal distention characterized by severe urine and faeces retention (T).
  • diseases states such as heart problems resulting in premature death (KO), reduced body weight (KO), reduced fertility (KO), mammary gland tumors (adenocarcinomas) (T), overgrowth (T) and overgrowth-related tumors such as Wilms tumor, leukemia, osteosarcoma and tumors of the kidney, liver and adrenal gland (T) and abdominal distention characterized by severe urine and faeces retention (T).
  • the present invention aims at providing a new usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids for the manufacture of a diagnostic tool to diagnose urine/faeces retention, growth and/or growth-related disorders, mammary gland tumors (adenocarcinomas), heart disorders and/or reduced fertility, or, for the manufacture of a medicament to treat growth disorders, heart disorders and/or reduced fertility.
  • the terms 'fragments or variants of said proteins or nucleic acids' refer to any fragment or any modified version or homologue of said protein or nucleic acid which retains enough specificity in order to be used to diagnose and/or treat the above-mentioned disorders.
  • the terms 'diagnostic tool' also refers to the usage of anti-PLAG 1 and/or PLAGL2 antibodies or nucleic acids hybridizing with nucleic acids said encoding PLAG 1 and/or PLAGL2 proteins or fragments or variants of said antibodies or nucleic acids in a diagnostic method.
  • the present invention provides a diagnostic method for determining if a subject bears modified (i.e. increased or decreased) PLAG1 and PLAGL2 expression comprising the steps of (1 ) providing a biological sample of said subject, and (2) detecting in said sample modified PLAG1 and PLAGL2 expression.
  • the choice of diagnostic methods of the present invention will be influenced by the nature of the available biological samples to be tested and the nature of the information required.
  • mRNA or cDNA When the diagnostic assay is to be based upon nucleic acids from a sample, either mRNA or cDNA may be used. With either mRNA or cDNA, standard methods well known in the art may be used to detect the presence of a particular sequence either in situ or in vitro (see, e.g. Sambrook et al., eds. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). A significant advantage of the use of either DNA or mRNA is the ability to amplify the amount of genetic material using the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • PLAG1 and PLAGL2 protein levels can be measured by any method well known in the art.
  • the term 'antibody' or 'antibodies' relates to an antibody characterized as being specifically directed against PLAG1 or PLAGL2 or any functional derivative thereof, with said antibodies being preferably monoclonal antibodies; or an antigen-binding fragment thereof, of the F(ab') 2 , F(ab) or single chain Fv type, or any type of recombinant antibody derived thereof.
  • the monoclonal antibodies of the invention can for instance be produced by any hybridoma liable to be formed according to classical methods from splenic cells of an animal, particularly of a mouse or rat immunized against PLAG1 or PLAGL2 or any functional derivative thereof, and of cells of a myeloma cell line, and to be selected by the ability of the hybridoma to produce the monoclonal antibodies recognizing PLAG1 or PLAGL2 or any functional derivative thereof which have been initially used for the immunization of the animals.
  • the monoclonal antibodies according to this embodiment of the invention may be humanized versions of the mouse monoclonal antibodies made by means of recombinant DNA technology, departing from the mouse and/or human genomic DNA sequences coding for H and L chains or from cDNA clones coding for H and L chains.
  • the monoclonal antibodies according to this embodiment of the invention may be human monoclonal antibodies.
  • Such human monoclonal antibodies are prepared, for instance, by means of human peripheral blood lymphocytes (PBL) repopulation of severe combined immune deficiency (SCID) mice as described in PCT/EP 99/03605 or by using transgenic non-human animals capable of producing human antibodies as described in US patent 5,545,806.
  • PBL peripheral blood lymphocytes
  • SCID severe combined immune deficiency
  • fragments derived from these monoclonal antibodies such as Fab, F(ab)' 2 and ssFv ("single chain variable fragment"), providing they have retained the original binding properties, form part of the present invention.
  • Such fragments are commonly generated by, for instance, enzymatic digestion of the antibodies with papain, pepsin, or other proteases. It is well known to the person skilled in the art that monoclonal antibodies, or fragments thereof, can be modified for various uses.
  • the antibodies involved in the invention can be labeled by an appropriate label of the enzymatic, fluorescent, or radioactive type.
  • the antibodies against PLAG1 or PLAGL2 can be derived from animals of the camelid family.
  • immunoglobulins devoid of light polypeptide chains are found.
  • Heavy chain variable domain sequences derived from camelids are designated as VHH's.
  • "Camelids" comprise old world camelids (Camelus bact anus and Camelus dromaderius) and new world camelids (for example Lama paccos, Lama glama and Lama vicugna).
  • EP0656946 describes the isolation and uses of camelid immunoglobulins and is incorporated herein by reference.
  • the terms 'medicament to treat' relate to a composition comprising PLAG1 and PLAGL2 proteins or anti-PLAG1 or anti-PLAGL2 antibodies as described above and a pharmaceutically acceptable carrier or excipient (both terms can be used interchangeably) to 'treat' growth disorders as described above, heart disorders and reduced fertility or via said antibodies to treat urine/faeces retention, mammary gland tumors (adenocarcinomas), and growth-related neoplasms.
  • Suitable carriers or excipients known to the skilled man are saline, Ringer's solution, dextrose solution, Hank's solution, fixed oils, ethyl oleate, 5% dextrose in saline, substances that enhance isotonicity and chemical stability, buffers and preservatives.
  • Other suitable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids and amino acid copolymers.
  • the 'medicament' may be administered by any suitable method within the knowledge of the skilled man. The preferred route of administration is parenterally.
  • the medicament of this invention will be formulated in a unit dosage injectable form such as a solution, suspension or emulsion, in association with the pharmaceutically acceptable excipients as defined above.
  • the dosage and mode of administration will depend on the individual.
  • the medicament is administered so that the protein, polypeptide, peptide of the present invention is given at a dose between 1 ⁇ g/kg and 10 mg/kg, more preferably between 10 ⁇ g/kg and 5 mg/kg, most preferably between 0.1 and 2 mg/kg.
  • it is given as a bolus dose.
  • Continuous infusion may also be used and includes continuous subcutaneous delivery via an osmotic minipump.
  • the medicament may be infused at a dose between 5 and 20 ⁇ g/kg/minute, more preferably between 7 and 15 ⁇ g/kg/minute.
  • antibodies or functional fragments thereof can be used for the manufacture of a medicament for the treatment of the above-mentioned disorders.
  • said antibodies are humanized (Rader et al., 2000, J. Biol. Chem. 275, 13668.
  • antibodies derived from camelids are used to manufacture a medicament.
  • Another aspect of administration for treatment is the use of gene therapy to deliver nuclei acids encoding PLAG1 and/or PLAGL2 or anti-sense nucleic acids (see further).
  • Gene therapy means the treatment by the delivery of therapeutic nucleic acids to patient's cells. This is extensively reviewed in Lever and Goodfellow 1995; Br. Med Bull. ,51, 1-242; Culver 1995; Ledley, F.D. 1995. Hum. Gene Ther. 6, 1129. To achieve gene therapy there must be a method of delivering genes to the patient's cells and additional methods to ensure the effective production of any therapeutic genes. There are two general approaches to achieve gene delivery; these are non-viral delivery and virus-mediated gene delivery. Also within the scope of the invention are oligoribonucleotide sequences, that include anti-sense nucleic acids that bind to said consensus binding motif or nucleic acids encoding PLAG1 or PLAGL2.
  • Anti-sense nucleic acids of the invention may be prepared by any method known in the art for the synthesis of nucleic acids. These include techniques for chemically synthesizing oligodeoxyribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize anti-sense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • the present invention further relates to the usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids in a method to screen for molecules which interfere with PLAG 1 and/or PLAGL2 biological activity comprising the following steps:
  • the invention thus provides methods for identifying compounds or molecules which bind to PLAG1 or PLAGL2 or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and which interfere with (i.e. which prevent or suppress) PLAG 1 and/or PLAGL2 biological activity.
  • interfering or “suppression” it is understood that said suppression of biological activity can occur for at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% compared to non-suppressed biological activity.
  • 'drug screening assays' or 'bioassays' typically include the step of screening a candidate/test compound or agent for the ability to interact with PLAG1 or PLAGL2 or to nucleic acids encoding PLAG1 or PLAGL2.
  • Candidate compounds or agents which have this ability can be used as drugs to combat or prevent PLAG bioactivity.
  • Candidate/test compounds such as small molecules, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries.
  • the assays are cell-free assays which include the steps of combining said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 and a candidate/test compound, e.g., under conditions which allow for interaction of (e.g. binding of) the candidate/test compound with said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 to form a complex, and detecting the formation of a complex, in which the ability of the candidate compound to interact with said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 is indicated by the presence of the candidate compound in the complex.
  • PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located extracellularly or even intracellularly.
  • PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 or its (their) target molecule(s) to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay.
  • Interaction (e.g., binding of) of PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 to a target molecule can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and microcentrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • PLAG1 or PLAGL2 -His tagged can be adsorbed onto Ni-NTA microtitre plates, or PLAG1 or PLAGL2 -ProtA fusions adsorbed to IgG, which are then combined with the cell lysates (e.g., 35 S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the plates are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated.
  • cell lysates e.g. 35 S-labeled
  • the candidate compound e.g., 35 S-labeled
  • the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
  • the plates are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the superna
  • the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of PLAG1 or PLAGL2 -binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
  • Other techniques for immobilizing protein on matrices can also be used in the drug screening assays of the invention.
  • PLAG1 or PLAGL2 can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated PLAG1 or PLAGL2 can be prepared from biotin-NHS (N- hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, III.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinylation kit Pierce Chemicals, Rockford, III.
  • streptavidin-coated 96 well plates Piereptavidin-coated 96 well plates
  • Another technique for drug screening which provides for high throughput screening of compounds having suitable binding affinity to PLAG1 or PLAGL2 is described in detail in "Determination of Amino Acid Sequence Antigenicity" by Geysen HN, WO 84/03564, published on 13/1584.
  • large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
  • the protein test compounds are reacted with fragments of PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 and washed. Bound PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 is then detected by methods well known in the art.
  • Purified PLAG1 or PLAGL2 can also be coated directly onto plates for use in the aforementioned drug screening techniques.
  • non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
  • This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding PLAG1 or PLAGL2 specifically compete with a test compound for binding PLAG1 or PLAGL2. In this manner, the antibodies can be used to detect the presence of any protein, which shares one or more antigenic determinants with PLAG1 or PLAGL2.
  • molecules that comprise a region specifically binding to PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 which can be used for the manufacture of a medicament to prevent PLAG bioactivity can be chosen from the list comprising an antibody or any fragment thereof binding to PLAG1 or PLAGL2, a (synthetic) peptide, a protein, a small molecule specifically binding to PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2, anti-sense nucleic acids hybridising with said nucleic acids encoding PLAG1 or PLAGL2, and a ribozyme against nucleic acids encoding PLAG1 or PLAGL2.
  • the term 'antibody' has been explained above. Small molecules, e.g.
  • the present invention further relates a method for the production of a pharmaceutical composition comprising the usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and further more mixing said molecule identified, or a derivative or homologue thereof, with a pharmaceutically acceptable carrier as is also stated above.
  • the present invention finally relates to the usage of compounds interfering with the expression of target genes of PLAG 1 and/or PLAGL2 or interfering with the biological activity of the proteins encoded by said target genes for the manufacture of a medicament to treat urine/faeces retention, mammary gland tumors (adenocarcinomas), and/or overgrowth-related disorders.
  • a non-limiting example of the latter compounds is carbachol which is further described in more detail.
  • Said target genes are genes encoding for the proteins chosen from the group consisting of: H19 (A view through the clouds of imprinting FASEB J. 2001 Aug; 15(10): 1694-703. Review) KIP2 (Algar, E.; Brickell, S.; Deeble, G.; Amor, D.; Smith, P.: Analysis of CDKN1C in Beckwith Wiedemann syndrome. Hum. Mutat. 15: 497-508, 2000)
  • IPL (Qian N, Frank D, O'Keefe D, Dao D, Zhao L, Yuan L, Wang Q, Keating M, Walsh C, Tycko B.
  • the IPL gene on chromosome 11p15.5 is imprinted in humans and mice and is similar to TDAG51 , implicated in Fas expression and apoptosis. Hum Mol Genet 1997 Nov;6(12):2021-9)
  • Filamin (Indications for a novel muscular dystrophy pathway, gamma-filamin, the muscle-specific filamin isoform, interacts with myotilin. van der Ven PF, Wiesner S, Salmikangas P, Auerbach D, Himmel M, Kempa S, Hayess K, Pacholsky D, Taivainen A, Schroder R, Carpen O, Furst DO.J Cell Biol 2000 Oct 16;151(2):235-48
  • RNCC Genes encoding three new members of the leukocyte antigen 6 superfamily and a novel member of Ig superfamily, together with genes encoding the regulatory nuclear chloride ion channel protein (hRNCC) and an N omega-N omega-dimethylarginine dimethylaminohydrolase homologue, are found in a 30-kb segment of the MHC class III region Ribas G, Neville M, Wixon JL, Cheng J, Campbell RD.J Immunol 1999 Jul 1;163(1):278-87) IGF-II (Insulin -like growth factors and cancer. Furstenberger G, Senn HJ. Lancet Oncol 2002
  • HUMECK cDNA cloning and characterization of eck, an epithelial cell receptor protein- tyrosine kinase in the eph/elk family of protein kinases. Lindberg RA, Hunter T. Mol Cell Biol
  • Plagl and PlaqL2 are proto-oncoqenes
  • the pMSCVpuro vector was derived from the Murine Embryonic Stem Cell Virus (MESV) and the LN retroviral vector (Hawley ef al., 1994).
  • the vector also contains reverse transcription signals as well as sequences required for integration of the genetically engineered recombinant RNA transcripts into virus particles upon its expression in the selected host.
  • LTR Long Terminal Repeat
  • Production of recombinant retroviruses containing sequences encoding PLAG1 or PLAGL2 involved co-transfection into HEK293T cells of DNA of the retroviral expression constructs together with DNA of the plK6.1 Ecopack vector, which codes for the three retroviral genes gag, pol, and env. Together the vectors and the cells can produce infectious but replication-defective recombinant retroviruses that contain the original gene of interest.
  • the infected cells were transfected with (WT2) 3 -TKLuc or with a reporter construct where the DNA binding sites were mutated (mCOmCLU).
  • WT2 3 -TKLuc
  • mCOmCLU mutated reporter construct
  • PLAG1 or PLAGL2 overexpressing cells can stimulate the luciferase activity 27- or 10-fold, respectively.
  • mock-infected cells only slightly induced the (WT2) 3 -Tk luc reporter construct ( ⁇ 2,5 fold). This induction is probably due to endogenous Plagl present in the NIH-3T3 cells.
  • NIH-3T3 cells were infected with the appropriate recombinant retrovirus and grown as a monolayer to confluence in medium containing either 1% or 10% fetal calf serum and the formation of foci was analyzed. Contact inhibition of growth appeared to be lost leading the cells to pile up and form foci.
  • the PLAG1 protein seemed to possess a greater capacity in focus formation than the PLAGL2 protein.
  • PLAG1 or PLAGL2 expressing NIH-3T3 cells are tumorigenic in nude mice
  • retrovirus-infected NIH-3T3 cells were injected subcutaneously into athymic nu/nu NMRI mice and examined every week for tumor development.
  • PLAG1 expressing cells induced rapidly growing tumors at the site of inoculation within 3 weeks, while tumor formation originating from cells expressing PLAGL2 became apparent only a few days later.
  • the mock- infected cells did not form any tumors during this time period.
  • 1.3 lgf-ll is upregulated in NIH-3T3 cells expressing PLAG1 OR PLAGL2.
  • PLAG1 as well as PLAGL2 have transcriptional properties as they can activate transcription via binding to the same DNA consensus sequence, although with different efficiencies. These observations suggest that PLAG1 and PLAGL2 could be transcription factors that regulate a similar spectrum of genes or at least some common genes.
  • IGF-II has been identified as a putative target gene of PLAG1 in human pleomorphic adenomas of the salivary glands [Voz, 2000 #89]
  • lgf-ll expression was tested in PLAG1 as well as PLAGL2 overexpressing NIH-3T3 cells by Northern blot analysis. The results demonstrated a strong correlation between PLAG1, PLAGL2 and lgf-ll expression in this heterologous assay system, suggesting that lgf-ll could be a target gene not only for PLAG1 but also for PLAGL2.
  • PLAG1 and PLAGL2 are not able to transform R ' cells.
  • IGF-II insulin-like growth factor receptor
  • R " cells are mouse 3T3 cells derived from mouse embryos with a targeted disruption of the Igfl-R gene (Sell ef al., 1994; Sell ef al., 1993).
  • R " cell lines overexpressing PLAG1 or PLAGL2 the same strategy of retroviral gene transfer was used.
  • R- cells infected with the appropriate recombinant retrovirus preparations were found to express relatively high levels of transcripts of both of the PLAG genes and also their corresponding proteins. These cell lines, however, were not able to produce foci, suggesting that the PLAG1 as well as the PLAGL2 induced transformation in our heterologous system might, at least partially, be mediated via the lgf-ll pathway.
  • DIM the gene found the highest upregulated in our mouse micro-array experiments (>63 times) is also an imprinted gene (see Wylie et al.,GenomeRes. 2000 Nov;10(11):1711-8; Takada et al. Human Molecular Genetics, 2002, Vol 11 , n 1 : 77-86 and Moon et al. Mol. Cell Biol. 2002:5585)).
  • DIM and Gtl2 (4, 10 and 6 times upregulated for three probes respectively) are reciprocally imprinted genes, located on mouse chromosome 12. Similarities between this domain and that of the well-characterized Igf2-H19 locus have been previously noted.
  • a first comparison of the mouse pleomorphic adenoma target genes these to this cell line results revealed 4 genes significantly and commonly upregulated in the PLAG1 expressing cells and in the mouse tumors (Igf2, Pigf, Crabp2, and SWISNF-related, matrix- associated, actin-dependent regulator of chromatin).
  • a second comparison is done between genes differentially expressed in human pleomorphic adenoma and the mouse pleomorphic adenoma.
  • Igf2 Igf2, Crabp2 and SWISNF-related, matrix-associated, actin-dependent regulator of chromatin, are thus commonly upregulated in human pleomorphic adenoma, cell lines overexpressing PLAG1 and mouse pleomorphic adenoma.
  • PLAG1 and/or PLAGL2 transgenic mice 2.1 Material and Methods
  • the objective was to design and create a DNA construct that allows controlled induction of PLAG1 gene expression in genetically engineered mice.
  • the complete PLAG1 ORF including a C-terminal HA tag, has been ligated as a blunt ended fragment into the blunt ended EcoRI site of pCAGGS [Niwa, 1991 #110] (pCB55).
  • a LoxP/PGK-Neo/LoxP DNA fragment isolated as a blunt ended Xhol/Xbal fragment from pHR68 (a kind gift of An Zwijsen of the laboratory of Cell Growth, Differentiation and Development K.U.Leuven, VIB), was cloned in the blunt ended EcoRI site of pCB55 (PIW13/PIW14).
  • the DNA of the construct was sequenced to confirm its design. Nucleotide sequence analysis was performed directly on the plasmids using the dideoxy chain termination method (Sanger ef al., 1977) and the AutoRead sequencing kit (Amersham Pharmacia Biotech) in presence of specifically designed fluorescence-labeled primers. Samples were processed and analyzed by PAGE on denaturing gels on the Automated Laser Fluorescent DNA Sequencer system from Pharmacia Biotech, Brussels. Generated sequences were analyzed using the Lasergene software package (DNASTAR).
  • PIVV13 was subsequently linearized with a Sail and Sfil double digest to obtain a 6.0 kb DNA insert containing the PLAGHHA-tag DNA under the expression control of a modified CMV promoter, a 3 X end DNA fragment of the gene encoding beta globin and the LoxP-Neo-LoxP DNA fragment (see 'Strategy').
  • Western Blotting Analysis
  • PIVV13 was co-transfected with DNA encoding the Cre enzyme using Fugene to evaluate transient expression of the PLAG1 protein by Western blotting analysis.
  • Co- transfection of PIW13 with the empty pCAGGS vector, and cells transfected with pCB55 alone were used as negative controls; PEM 148 (PLAG1 ORF sense orientation in the pCAGGS vector) was used as a positive control.
  • Cells were harvested the next day in PBS/EDTA. The cell pellets were lysed in SDS-PAGE sample buffer (60 mM TRIS-HCL pH 6.8, 12% glycerol, 4% SDS), and the lysate was sonicated, subsequently.
  • Genomic DNA prepared from the tail tips of the offspring has been genotyped by PCR and Southern blot analysis to identify transgenic founders.
  • One transgenic founder male was mated with two FVB/N female mice (virgin female of 8 weeks old, TACONIC). Every two weeks the single male rotated among sets of two FVB females.
  • tails were cut at the age of weaning (21 days).
  • Tail tips (about 0.5 cm) were incubated in 400 ml of proteinase K-solution overnight at 55 °C (proteinase K solution consists of proteinase K (1 mg/ml) in 0.5% SDS, 0.1 M NaCI, 0.05 M Tris HCI, 1 mM EDTA, pH8).
  • genomic DNA was precipitated with 0.7 M NaOH and 1 ml of EtOH, the DNA pellet was washed with 70% and 100% EtOH and finally dissolved in 300 ⁇ l TE.
  • the genomic DNA was purified further by phenol/chloroform extraction and the DNA was finally precipitated with EtOH and dissolved in 200 ⁇ l TE.
  • Genotyping PLAG1 transgenic mice by PCR To genotype the PLAG1 transgenic mice, standard conditions were used for the PCR reaction. To detect the transgene, a set of two primers were used with as forward primer, POS1599-F (5 TCTCAAGCATCGTCATCAT3') which corresponds to a region encoding the TAD of PLAG1 and as reverse primer, ⁇ -globin-low (5'-AAAATTCCAACACACTATTGC-3') which corresponds to the ⁇ -globin 3' region of the construct. Such a PCR amplification reaction generates a 520 bp DNAfragment. Different Cre-recombinase expressing mice were crossed with PLAG1 transgenic mice. The resulting double and triple transgenic mice are genotyped as follows.
  • Southern blot analysis 10 ⁇ g of genomic DNA was digested with the required restriction enzyme for 24 hours at 37 °C. The DNA fragments were separated by electrophoresis at 2 V/cm for 18 hours in 1% agarose gels. Gels were stained with ethidium bromide, depurinated in 0.24 % HCI followed by capillary transfer of the DNA to nylon membranes in 0.6 M NaOH transfer buffer.
  • conditional transgenic mice is usually used as an approach to study the effect of temporally and/or spatially regulated expression of a particular gene on the wild-type phenotype.
  • the use of the Cre-LoxP system is very well suited to generate such mice and this system has been used widely and successfully (Nagy, 2000).
  • Cre-LoxP system is very well suited to generate such mice and this system has been used widely and successfully (Nagy, 2000).
  • three types of genetically engineered Cre-mice including MMTV-Cre, Mx1-Cre and Tet-O- Cre/rTta.
  • mice with an MMTV-Cre homozygous genotype [B6129-TgN(MMTN-Cre)] were obtained from Jackson's Laboratory, USA (stock number JR 3551 ), described by Wagner et al. (Wagner ef al., 1997). A homozygous male and female were crossed to obtain offspring.
  • the MxCre mouse was a kind gift of Anton Roebroek (CME, KULeuven) (Kuhn ef al., 1995). This mouse has an interferon-responsive promoter controlling the expression of Cre- recombinase. Kuhn described the use of this mouse model for the first time. (Collet and Secombes, 2001 ; Kuhn et al., 1995)
  • mice transgenic for tet-O-Cre kind gift of Dr. J.Gordon, Washington
  • mice transgenic for the reverse tetracyclin transactivator (rtTA) (a kind gift of Dr Bujard, Heidelberg, Germany)
  • rtTA reverse tetracyclin transactivator
  • Doxycycline-inducible, rtTA-regulated Cre expression allows a floxed gene to be disrupted at any point during development (Kistner ef a/., 1996; Saam and Gordon, 1999).
  • Northern blot hybridisation was performed according to standard procedures (Sambrook et al 1989). 15 ⁇ g of total RNA was size fractionated through a 1 % agarose gel containing 6% formaldehyde and run for 5 hours at 5 Volt/cm in 1X MOPS buffer (MOPS 10X running buffer: 0.2 M MOPS, 50 mM NaAc, 10 mM EDTA). Capillary transfer of the RNA to nylon membranes (Hybond N, Amersham) was performed overnight in 10XSSC transfer buffer (438.25 gram NaCI, and 220.5 gram tri sodium citrate for 5 liters). RNA was fixed to the membranes by baking for 2 hours at 80 °C. Northern blot hybridisation
  • Filters are prehybridized for 3 hours at 42 °C in 5XSSPE (20X solution: 175.3 g NaCI, 27.6 g NaH2P04, 7.4 g EDTA pH 7.4), 10Xdenhardts (50X Denhards: 5g Ficoll-Type 400, Pharmacia- 5g polyvinylpyrrolidone, 5g bovine serum albumin - Fraction V; Sigma- in 500ml H20), 100 ⁇ g/ml denaturated salmon sperm DNA, 50% formamide, 2% SDS and hybridized in the same solution overnight at 42° C after the addition of 1 to 2 million cpm per ml of the indicated radiolabelled probe. Histological and immunohistological analysis
  • peroxidase-conjugated swine anti-rabbit SWAR/PO, DAKO; 1/100
  • rabbit anti-mouse Ig RAM/PO, DAKO; 1/50
  • PBS peroxidase-conjugated swine anti-rabbit
  • SWAR/PO peroxidase-conjugated swine anti-rabbit
  • RAM/PO rabbit anti-mouse Ig
  • PBS 10XPBS: 80 g NaCI, 2 g KCI, 14.4 g Na 2 HP0 4 , 2.4 g KH 2 P0 4 , pH7.4 with HCI in 1 liter H20
  • pH 7.2 containing 10% normal human AB-serum.
  • Each incubation with antibody was performed for 30 min at room temperature and was followed by three washes using PBS, pH 7.2.
  • transgenic mouse model is a powerful tool.
  • a transgenic mouse carrying a PLAG1 transgene under the control of a modified actin promoter fused to the CMV enhancer. Characterization of the fifty descendants obtained after micro-injection revealed that only one founder transgenic mouse contains the PLAG1 transgene and moreover in a very low copy number, suggesting that overexpression of PLAG1 during embryonic development could have a toxic effect on the embryo.
  • the CRE recombinase (Causes REcombination) is a protein classified as a member of the ⁇ integrase superfamily of site-specific recombinases (Argos et al., 1986; Sadowski, 1993) and belongs to the few members of the family which do not require cofactors or accessory proteins for recombination (Abremski and Hoess, 1984; Kilby ef al., 1993; Stark et al., 1992).
  • the loxP sequence consists of two 13 bp inverted repeats interrupted by an 8 bp non-palindromic sequence which dictates the orientation (Hoess and Abremski, 1984; Hoess et al., 1982).
  • a CRE-mediated intramolecular recombination event results in the excision of the loxP-flanked (or floxed) sequence as a circular molecule with one loxP site left on each DNA molecule.
  • Neomycin resistance cassette flanked by two loxP sites with the same orientation between the modified actin promoter and PLAG1 cDNA ( Figure 1). Because the stop codon of the Neo cassette should terminate translation, the transgenic mice obtained after microinjection will not express PLAGL To allow PLAG1 expression, the cassette can be excised simply by breeding with CRE recombinase transgenic mice.
  • the PLAG1 transgene will be activated in the organs where Cre is transcribed under the control of the MMTV LTR. Cre expression under control of the MMTV LTR has been reported to result in Cre-induced recombination in many tissues (Wagner et al., 1997). Expression of a transgene under such a control was found to be high in mammary tissue of lactating females, but it is also found in other secretory organs, such as the salivary gland, the Harderian gland, seminal vesicles and lymphoid cells. In adult MMTV-Cre mice, Cre expression and activity is detected in the salivary and mammary gland. Expression in salivary gland tissue was confined to the striated ducts.
  • the MMTN LTR-Cre was our initial method of choice to get an experimental animal model. Because low level of expression of the MMTV Cre transgene in this system could not be ruled out fully and in light of the fact that such expression would lead to induction of PLAG1 expression during embryonic development, which is thought to be toxic for the embryo, we have also generated inducible, conditional transgenic mice (see below).
  • PLAG1 was tested the expression of PLAG1 in HEK293T cells by cotransfecting the plW13 plasmids and the Cre expression vector. Western blot analysis revealed a high level of PLAG1 when these latter plasmids were cotransfected.. This was in contrast to the faint expression of PLAG1 when non-transfected cells or cells transfected with plVV13 in absence of the Cre vector. PLAG1 under the control of a strong CMV promoter is used as a positive control.
  • Pronuclear injection of the PLAG1 transgene was performed in two independent experiments. Potential founder animals were analyzed by PCR and Southern blot analysis on tail DNA, as described above. In the first experiment, we obtained three mice among which, one founder male (PLAG10FF1) displayed PLAG1 expression based upon PCR analysis. From the second zygote injection, a founder male (PLAG10FF2) out of 14 mice that was PLAG 1 -positive in PCR analysis. The 2 founder mice were subsequently bred to establish two independent lines of PLAG1 transgenic mouse.
  • PLAG10FF1 and PLAG10FF2 were independently mated with two FVB/N female mice (virgin female of 8 weeks old, TACONIC). Every two weeks each single male rotated among sets of two FVB females. This resulted in a large family of PLAG 1 -positive mice. An overview is given in the Table 1.
  • LoxpNeoLoxpPLAGI -positive mice were crossed with 3 different Cre-recombinase expressing mice: MMTV-Cre, MxlCre, and Tet-O-Cre/rTta.
  • FVB/N PLAG 1 -positive mice were crossed with offspring of the homozygous parents MMTV- LTR Cre. The offspring were tested for PLAG1 and Cre positivity by PCR (see Methods). An overview of the offspring generated until now is given in the Table 2.
  • mice We generated three virgin female mice (mmtv 2, mmtv 59 and mmtv 84) with a tumor mass at the level of the head and neck region.
  • the first female (mmtv 2) presented with the tumor at 67 days old. It was a solid mass, estimated of 1 cm by 1.5 cm. The tumor seemed to slightly increase one week later, at 74 days old (mmtv 2).
  • the mouse was sacrificed at that time and we observed that the female had an excitated and aggressive behaviour.
  • a solid tumor of 1 cm by 1.5 cm was resected from the neck (mmtv 2).
  • the white tumor mass was nicely encapsulated and seemed to compress of the neighbouring tissues.
  • Macroscopic observation showed a blood vessel connected to the normal salivary gland tissue.
  • the tumor and this likely normal salivary gland tissue were totally resected.
  • the other organs seemed normal in size and shape except for the bladder that presented a vesical globe with urine retention. We will focus on the bladder below since it appeared in the same way in male mice.
  • the tumor of the mmtv 59 mouse was slightly bigger, 2 cm by 1.5 cm.
  • the hemorrhagous tumor was not connected to the skin, was also encapsulated, and seemed to be connected to the left submandibular gland.
  • the tissue of the tumor was fixed in formalin 6%. Sections stained with hemalum-eosin revealed a mixed tissue pattern in a glandular tumor. Compact, as well as cystic, mucoid, myxoid and necrotic areas were present. No chondroid regions were found.
  • the tumor is encapsulated, compressing the surrounding normal salivary gland.
  • PLAG1 was expressed in several tissues by Northern Blot.
  • mmtv2 female mouse we detected PLAG1 mRNA in the lung, the small intestine, and slightly in the thymus and stomach.
  • adenocarcinoma's in the mammary glands of 5 mice -Mouse 1 (02 1182): mmtv 80, Female, 37 weeks Very big tumor, largely necrotic. On one side the tumor is adjacent to a few normal mammary gland structures. A connective tissue capsule, only partially visible on the slides because of tumor size, is surrounding the tumor. Numerous large blood vessels are seen with the tumor, and some of them are thrombotic. The tumoral tissue is composed of confluent strands of round or polymorphic poorly differentiated, basophilic epithelial cells. Numerous cysts with an empty lumen or filled with blood or necrotic material are associated with these solid areas.
  • Very big tumor developed in the dermis in the vicinity of the normal mammary gland tissue.
  • a capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structures.
  • the tumor has different lobules that show different growth patterns from one to another, and are separated by connective septa.
  • acinar areas cuboid epithelial pale cells with round nuclei are organized in small irregular acinar structures embedded in a loose myxomatous stroma. These areas show empty cystic structures lined by a flat epithelium. Numerous cells undergo a sebaceous differentiation.
  • Fusiform myoepithelial cells are a part of these areas.
  • Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells associated with residual acinar structures. Several cells among basophilic cells show an obvious sebaceous differentiation. The tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is very high. In some places, one observes squamous metaplasia with an atypical keratinisation or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules. This tumor seems to be a mixed tumor, previously called adenomyoepithelioma of the mammary gland.
  • Big tumor adjacent to a small piece of normal mammary gland tissue The tumor is arranged in thin (one cell-thick) ribbons or in nodules of epithelial cells with a cubic cytoplasm and round nucleus.
  • Cells are polymorphic with an high anisocytosis. They form sometimes tubular structures with or without mucoid material inside. A sebaceous differentiation is seen in a few cells. Mitotic index is moderate.
  • a capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structure.
  • Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells. A great number of cells among basophilic cells show an obvious sebaceous differentiation.
  • the tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is high. In some places, one observes squamous metaplasia with an atypical keratinization or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules. In one part of the tumor, cells are arranged in small irregular acinar structures, embedded in a loose myxomatous stroma.
  • Very big tumor developed in the dermis in the vicinity of the normal mammary gland tissue.
  • a capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structures.
  • the tumor has different lobules that show different growth patterns from one to another, and are separated by connective septa.
  • acinar areas cuboid epithelial pale cells with round nuclei are organized in small irregular acinar structures embedded in a loose myxomatous stroma. These areas show empty cystic structures lined by a flat epithelium. Numerous cells undergo a sebaceous differentiation.
  • Fusiform myoepithelial cells are a part of these areas.
  • Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells associated with residual acinar structures. Several cells among basophilic cells show an obvious sebaceous differentiation. The tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is very high. In some places, one observes squamous metaplasia with an atypical keratinisation or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules.
  • overgrowth syndromes are associated with neoplasia is not surprising since rapidly dividing cells are a prerequisite for both processes. Mitotic activity, strong pronounced during intra-uterine life, is even more amplified in overgrowth syndromes. Neoplastic cells are vulnerable to structural changes in DNA, disrupted transcription to RNA, and altered translation into protein during mitotic activity. Mitosis is also required to produce clones of altered cells that make up neoplasms.
  • IGFII normally absent in adulthood
  • IGFII upregulation in pleomorphic adenoma overexpressing PLAG1.
  • IGFII is a target of PLAG1. Therefore IGFII seems to be the factor causing both the tumor and the overgrowth in PLAG1 transgenic mice.
  • IGFII stimulate cell proliferation through autocrine or paracrine mechanisms. Because the maternal allele of the IGFII gene is silenced by genomic imprinting, several different molecular errors can activate this allele and therefore increase the number of active copies of the IGFII gene. The nature and severity of the overgrowth might be dependent on the number and location of cells that carry the molecular defect.
  • Mutations or alterations in this region are associated with human diseases like Beckwith -Wiedeman syndrome (BWS) that is characterised by prenatal overgrowth and predisposition to tumors including embryonal tumors such as Wilms tumor, hepatoblastoma and rhabdomyosarcoma, as well as a variety of adult tumors.
  • BWS Beckwith -Wiedeman syndrome
  • At least ten imprinted genes in 11p15.5 have been identified and characterized including the paternally IGFII and the maternally IPL, p57 KIP2 and H19 transcribed genes and these and others are candidates for involvement in Wilms' tumorigenesis. These genes that are also target of PLAG1 can therefore contribute to the PLAG1 transgenic phenotypes.
  • Some of the imprinting genes in the 11p15.5 region, IGFII which is paternally transcribed showed loss of imprinting in 70 % of Wilms' tumors and in about 50% of all adult cancers.
  • Transgenic mice with upregulation of IGFII expression show features of BWS, but neither exomphalmos nor a predisposition to tumors.
  • H19 is maternally transcribed and codes for an RNA without an open reading frame. It can be growth suppressive in some cell types and shows epigenetic biallelic silencing in some Wilms' tumors with Lost of imprinting (LOI) of IGFII.
  • LOI lost of imprinting
  • P57KIP2 is a cyclin-dependent kinase inhibitor. This gene shows mutations in 5-17 % of the BWS patients and a reduced expression in some Wilms tumors. Targeted disruptions of P57KIP2 in mice exhibits some aspects of BWS resulting in abdominal muscle defects and kidney dysplasias, but does not show any features of Wilms' and other embryonic tumors. Therefore IGFII, H19, p57KIP2 can account for some Wilms' tumors and other tumors. IGF-II is located in an imprinting region in the chromosome 11p15.5. The gene is transcribed only from the paternal allele. Indeed the maternal allele is silent during the whole embryogenesis.
  • IGF-II upregulation of IGF-II in PLAG1 transfected cells is accompanied by an increase of the transcription of others genes, mainly IPL, p57 KlP2 and H19, located in the 11p15.5 region. These genes encompass a 1 Mb region where it has been postulated to be present an Imprinting Center. IGF-ll gene contains several promoters, among them E3 and E4 promoters, present 8 PLAG1 response elements; promoter E1 contains 6 of them. This high number of PLAG1 motifs could explain the upregulation of IGF-ll by PLAG1.
  • PLAG1 upregulation of the other genes in the 11p15.5 region is the result of the activation, by PLAG1, of each of the respective promoter. Indeed a search of PLAG1 response element failed to show the presence of these motifs beside the IGF-II promoters.
  • a common mechanism mainly imprinting, disturbs the transcription of the genes located in the region 11p15.5 including IGFII.
  • PLAG1 could affect directly or indirectly the methylation status of the Imprinting Center leading to the activation of the alleles that are normally silenced.
  • IGF-II heterozygous KO mice having only the paternal gene disrupted reach 60% of the normal birth weight.
  • IGF-II heterozygous KO mice having the maternal gene disrupted have a normal birth weight.
  • This epigenetic modification on the IGF-II gene allows us to validate our hypothesis. For that we first cross an IGF-II KO male with a female PLAG1 transgenic mouse. The overexpression of PLAG1 in this kind of KO mice reverts the dwarf phenotype only if PLAG1 is abolishing the methylation in the IGF-II maternal allele.
  • MMTV-Cre/PLAG1 transgenic mice presented an important retention of urine in the bladder as well as gastro-intestinal blockage due to faeces retention. This phenotype has been observed already in very young puppies and is severe in adulthood. Beside the tumor, the transgenic mice highly expressed PLAG1 transcripts in the bladder, thymus and duodenum. A lower expression was observed in the caecum. This phenotype can be the result of a neurological disorder at the level of the bladder and gastro-intestinal sphincters. It has been described that relaxation of the sphincter is mediated by acetylcholine through the muscarinic receptors M3.
  • EMG electromyography
  • the strategy used for the generation of the Plagl knockout mouse was the replacement of the complete open reading frame of Plagl by the LacZ reporter gene. Replacement the Plagl gene by the reporter gene allows us, in a relatively simple manner, to obtain more detailed knowledge about the expression pattern of the Plagl gene.
  • the DNA construct also contains the HSV-tk gene which lies outside the 5' and 3' homologous flanking regions. This construct was introduced in the R1 embryonic stem cell line (43) by transfection.
  • Mouse ES cells are pluripotent cells derived from the inner cell mass of a 3.5 day old mouse blastocyst.
  • the Plagl homologous flanking sequences enable targeted insertion into the Plagl gene and, consequently, the LacZ gene and the selectable marker replaces the original wild-type sequence. Since the frequency of homologous recombination is very low relative to random integration, a positive-negative selection procedure is used to select the ES cell clones in which the proper recombination has occurred. The cells that have integrated pKH23 will survive when grown in medium containing neomycin.
  • a negative selection step is used to kill the cells that contain randomly integrated pKH23 since cells harboring the HSV-tk gene will be killed by culturing them in medium containing gancyclovir. It should be noted that the HSV-tk gene will be lost during homologous recombination, but will be retained in cases of a random integration event.
  • the successfully targeted ES cell line is reintroduced into wild-type blastocysts isolated from Swiss Webster mice (Taconic) and, subsequently, these blastocysts are implanted into pseudopregnant foster mothers. Since these ES cells remain pluripotent following culture and in vitro manipulation, they can contribute in the development of all tissues of the embryo, including the germline.
  • chimeric animals may be born and these can be easily identified by their black and white spotted coat color.
  • the R1 ES cells are derived from a mouse with a dark coat color which were injected in blastocysts from mice with a white coat color. If the embryonic stem cells contributed to the development of the germ cells, the chimeric mouse can pass the mutated Plagl allele on to subsequent generations. Therefore, the chimeric mouse is mated to wild-type Swiss mice containing a white coat color. Germline transmission is easily identified since the result of it leads to dark pups. Finally, interbreeding of Plag1 +I" hemizygous siblings yields mice that are homozygous for the desired Plagl mutation.
  • Genomic clones containing the Plagl gene were initially isolated from a commercially available genomic library constructed in the pBeloBACH vector (Genome systems) with DNA from the 129SvJ mouse strain which is isogenic with the available ES cell line (R1) used in our experiments. Evidence has been presented that the use of isogenic DNA is a determining factor in the observed frequency of recombination events. Screening the library with a human PLAG1 DBD probe (described in the Material and Methods section) yielded two independent clones containing sequences of the Plagl gene, i.e. BAC 450d6 and BAC 347b3.
  • Pulsed field gel electrophoresis was used to map a number of restriction sites and to determine the position and the relative orientation of the Plagl gene in the vector.
  • Complete digests with different restriction enzymes were analyzed by Southern blot analysis using cDNA probes corresponding to exon 4 (human PLAG1 DBD), exon 5 (human PLAG1 TAD) and exonl of PLAG1 (pEM 117).
  • the results of this analysis indicated that both BAC clones contained the 5'-end of the Plagl gene, including the promoter region, but only BAC 347b3 covered the complete gene. This clone was used for further analysis and in experiments involving homologous recombination in ES cells.
  • Suitable restriction fragments of BAC 347b3 were subcloned in the pGEM3Zf(+) vector using either EcoRI or Hindlll digests. Sequencing of these subclones and alignment of these sequences yielded a contig containing a partial mouse Plagl cDNA of 1575 bp (Genbank Accession N° AF057366).
  • the encoded protein, mouse Plagl consists of 500 amino acids. Comparison of this putative mouse Plagl protein to its human homologue reveals overall amino acid sequence identity of 95% (data not shown).
  • Plagl targeting vector for the generation of knockout mice, the following cloning strategy was followed as illustrated in Figure 2. From a p/ag/1 -containing BAC clone, a 4 kb Hindlll fragment, containing exon 3 to the first part of exon 5, was subcloned in the pGEM3Zf(+) vector (designated pKH13). An internal deletion, removing AA 2-130 of Plagl, was obtained via digestion of pKH13 with Mscl and Sail, subsequent creation of blunt ends with a fill in reaction using Klenow DNA polymerase and, finally, a religation reaction i (designated pKH17).
  • the LacZ reporter gene except for its first ATG, was fused in frame to the initiation codon of p/ag1 by ligating a Nrul/Kpnl fragment, isolated from the pSDKLacZpA vector (a gift from Dr. Janice Rossant, university of Toronto, Canada) in a blunt- ended Xbal/Kpnl site of pKH17, and this clone was designated pKH18.
  • this 5' Plagl targeting region containing the LacZ gene and 3 kb immediately upstream of the ATG of p/ag1 i was cloned as a blunt-ended Hindlll/Xhol fragment into the Hpal/Xhol site of the pKO scrambler vector (Lexicon Genetics, Texas) (designated pKH19).
  • neomycine (neo) resistance gene and a thymidine kinase(TK) gene were introduced as a positive and negative selection marker, respectively.
  • TK thymidine kinase
  • DNA of BAC 347b3 was used as starting material. From its insert DNA, a 3 kb Hindlll/Mscl fragment was obtained as the 5' homology region and a 3 kb Hindlll fragment, as the 3' homology region of Plagl. Both fragments were subcloned in the proper orientation in the pKO scrambler vector (Lexicon) and, subsequently, the LacZ reporter gene, without its ATG, was cloned in frame to the 5' homology region.
  • a positive selection marker the neomycin resistance cassette in which the neomycin phosphotransferase gene is driven by the PGK promoter (Lexicon), was placed in between the 5' and 3' homology region.
  • the HSV-tk gene (Lexicon) was used as a negative selection marker, and it was placed outside the 5' and 3' homologous flanking regions.
  • the targeting DNA construct Prior to introduction into ES cells, the targeting DNA construct was linearized at a unique Notl site and, thereafter, it was introduced into the cells by electroporation. Cells surviving electroporation were grown in selective medium containing neomycin and gancyclovir for about eight days. Of the surviving colonies, 250 were selected and further expanded. In the first screening round, all 250 colonies were tested by PCR analysis using sense primer mP1KH26- up, located outside the 5' recombination region, in combination with LacZ2-down, located in the coding region of LacZ. Only when proper homologous recombination had occurred, the PCR amplification generated a 4 kb fragment.
  • genomic DNA of the same clones was digested with Xbal and analyzed with a radiolabeled probe (pKH17 insert) located in the 5' flank of the vector which detects a 8 kb wild-type Xbal fragment and a 7 kb fragment corresponding to the targeted allele. All five clones showed the expected restriction pattern resulting from a homologous recombination, which equals an overall frequency of recombination of about 2%.
  • mice from two ES cell lines were injected independently into Swiss Webster blastocysts and both resulted in offspring consisting of chimeric mice based on their color coat.
  • 7 showed very low degree of chimerism, varying from 5% to 30%, and these were not able to transmit the targeted Plagl allele.
  • no germline transmission was obtained with three female chimeric mice.
  • Cells of one genetically engineered cell line produced one chimeric male which possessed a brown-white coat color of more than 80%.
  • Hemizygous Plag1 +I' mice were mated to obtain homozygous Plagl null mutant mice. Their offspring was genotyped three weeks after birth. In total, 214 pups of hemizygous Plagl *1' couples were analyzed by PCR analysis of tail tip genomic DNA. 55 Plagl * ' * (26%), 106 Plagl *1' (49%) and 53 Plagl '1' (25%) mice were identified, which reflects a normal Mendelian distribution. This result clearly indicated that inactivation of both alleles of the Plagl gene does not result in embryonic lethality. The mating of the Plagl* 1' mice demonstrated that six couples produced litter sizes of between 7 and 13 pups, with an average of 10 pups per litter. The sex ratio of the offspring was 46% males and 54% females.
  • Plagl expression was really absent in Plagf' ' null mutant mice during embryonic development.
  • PCR was performed on cDNA prepared from wild-type, Plagf' * hemizygous and Plagf' ' null mutant embryo's of 15.5 days post-coitum (dpc).
  • a primer pair was used (mPLAGI tail-up and low), flanking intron 4 of Plagf wich generates a 500 bp fragment on Plagl cDNA and a 1 kb fragment on genomic DNA. In this way, we could discriminate between Plagl expression and contamination of genomic DNA in the samples.
  • Plagf' ' null mutant mice failed to express the normal Plagl mRNA, while the endogenous Plagl transcript was easily detected in Plagl * '* and Plagf' * hemizygous mice.
  • the ⁇ - galactosidase transcript was only detected in the Plagf' ' null mutant mice and the Plagf + hemizygotes but was absent in wild-type mice (data not shown).
  • Homozygous Plagf 1' mice could also be recognized by the fact that they opened their eyes several days later after their Plagl * ' * or Plagf'* littermates, some even one week after weaning. Out of 53 homozygous Plagf 1' mutants, four mice died already; 3 of them between 4 and 7 weeks of age and one at 18 weeks of age. However, by examination, no macroscopic anomalies could be detected. In contrast, all 55 Plagl * '* mice are still alive. Apart from their small size, surviving Plagf' ' null mutant mice seem to be normal at first glance and have reached sexual maturity. Fertility of Plagf' ' mice
  • PLAG1 is mainly expressed during embryonic development and that expression could not be detected in adult tissues in this way.
  • PLAG1 expression was detected in several adult tissues like heart, placenta, spleen, prostate, testis, ovary and small intestine. Because the expression pattern of the gene is of major importance to understand its role in development, we have studied the expression of the Plagl gene in mouse by several approaches.
  • An alternative approach to evaluate the expression pattern of the P/ag7 gene is to study the LacZ expression pattern in the hemizygous P/ag7 mice, in which one P/ag7 allele was replaced by the LacZ gene in such a way that expression of the latter was under control of the P/ag7 promoter.
  • Expression of LacZ in a developing mouse embryo can be monitored by X-gal staining. Therefore, hemizygous P/ag7 males were crossed to wild-type Swiss females and the resulting embryos were assayed for LacZ expression by whole mount X-gal staining.
  • in situ hybridization analysis was also used as an additional approach to study P/ag7 expression.
  • Preliminary data were obtained from in situ hybridization studies of sections of wild-type mouse embryos at developmental stages of 11.5, 12.5, 15.5 and 16.5 days post-implantation. Sections were hybridized with a ⁇ S-labeled antisense RNA probe corresponding to the TAD of mouse P/ag7 fpKH3 insert). No significant signals were detected in control experiments using the sense probe (data not shown).
  • the data obtained from the in situ hybridization studies of sections of 11.5 and 12.5 dpc embryos confirmed the results of a widespread expression by whole mount LacZ staining.
  • PLAG10FF1 positive mice derived from PLAG1OFF1 or PLAG10FF2 were crossed with MMTV-LTR/Cre positive mice.
  • the cross involving PLAG10FF1 gave 38 males and 47 females double transgenic mice MMTV-LTR/Cre/PLAGI, out of 176 pups.
  • the cross involving ) PLAG10FF2 produced 5 males and 1 female double transgenic mice MMTV-LTR/Cre/PLAGI out of 23 pups.
  • LOT1 is a growth suppressor gene down- regulated by the epidermal growth factor receptor ligands and encodes a nuclear zinc-finger protein. Oncogene, 18, 6477-87.
  • Zad (Lot1) a potential tumor suppressor gene, and the gene for epsilon-sarcoglycan are maternally imprinted genes: identification by a subtractive screen of novel uniparental fibroblast lines. Mol Cell Biol, 20,
  • Pleomorphic adenoma gene 1 is expressed in cultured benign and malignant salivary gland tumor cells. Lab Invest, 79, 583-9. Saam, J.R. and Gordon, J.I. (1999) Inducible gene knockouts in the small intestinal and colonic epithelium. J Biol Chem, 274, 38071-82. Sadowski, P.D. (1993) Site-specific genetic recombination: hops, flips, and flops. Faseb J, 7,
  • hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc NatlAcad Sci U S A, 95, 8835-40.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Plag 1 and Plag L2, two members of the Plag gene family, have oncogenic capacity and expression of Plag1 is highly upregulated in pleomorphic salivary gland adenomas. The present invention discloses Plag transgenic mouse strains and Plag knockout mice and reveals that the Plag proteins are crucial targets to diagnose and/or treat urine/faeces retention, several neoplasms, infertility, heart failure and/or aberrant body weight.

Description

Use of Plag or Plag-inhibitors to diagnose and/or treat disease
Field of the invention Plag 1 and Plag L2, two members of the Plag gene family, have oncogenic capacity and expression of Plagl is highly upregulated in pleomorphic salivary gland adenomas. The present invention discloses Plag transgenic mouse strains and Plag knockout mice and reveals that the Plag nucleic acids and proteins are crucial targets to diagnose or treat several neoplasms, urine/faeces retention, infertility, heart failure and/or aberrant body weight.
Background of the invention
Pleomorphic adenoma of the salivary gland constitute benign epithelial tumors originating from the major and minor salivary glands, which only rarely undergo malignant transformation. The largest cytogenetic subgroup of pleomorphic adenoma of the salivary glands (40% of cases) carries chromosome 8q12 aberrations with 3p21 as preferential translocation partner. Kas et al. (1997) demonstrated that this t(3;8)(p21;q12), results in promoter swapping between PLAG1, a novel, developmental^ regulated zinc finger protein gene at 8q12, and the ubiquitously and constitutively expressed gene for beta-catenin, a protein interface functioning in cell adhesion and the Wnt signaling pathway. Fusions occur in the 5'-noncoding regions of both genes, exchanging regulatory elements while preserving the coding sequences. Due to the translocation, PLAG1 transcription is activated and expression levels of beta-catenin are reduced. Activation of PLAG1 was also observed in an adenoma with a variant translocation t(5;8). The latter translocation leads to ectopic expression of a chimeric transcript consisting of sequences from the ubiquitously and constitutively expressed gene for the leukemia inhibitory factor receptor (LIFR) and PLAG1 (Voz et al., 1998). As for the t(3;8), the fusions occurred in the δ'-noncoding regions of both genes, exchanging regulatory control elements while preserving the coding sequences. Also in salivary gland tumors without cytogenetically visible chromosomal alterations, promoter substitution or promoter swapping turns out to be responsible for PLAG1 activation, due to hidden translocations. The gene for elongation factor Sll as a new PLAG1 fusion partner gene has been also identified (Astrom ef al., 1999). Altogether, the results indicate that ectopic expression of PLAG1 under the control of constitutively active promoters of distinct translocation partner genes is a general pathogenic mechanism for pleomorphic adenomas with 8q12 aberrations.
The PLAG1 gene is the prototype member of a larger gene family to which also PLAGL1 and PLAGL2 belong (Kas et al., 1998). The PLAG1 protein contains seven canonical C2H2 zinc finger domains and a serine-rich carboxy-terminus. While the carboxy-terminal part of PLAGL1 shows strong overall transcriptional activity in the mesenchymal COS-1 cells and the epithelial 293 cells, both PLAG1 and PLAGL2 transactivate in COS-1 cells only if depleted from a repressing region. This effect is less profound in the 293 epithelial cells. These data suggest that the activation in pleomorphic adenomas of PLAG1, most likely results in uncontrolled activation of downstream target genes. All three members of the PLAG gene family appear to act as transcriptional regulators (Kas et al., 1998) and affect specific target genes. PLAG1 and PLAGL2 seem to share functional characteristics and are considered by us as candidate proto-oncogenes. PLAGL1, on the other hand, differs from the two other members. It has been isolated by Abdollahi et al. (1997) and Spengler et al. (1997) and is considered to be a candidate tumor suppressor gene (Bilanges et al., 1999; Varrault et al., 1998).
Voz et al. (2000) further showed that PLAG1 is a nuclear protein that binds DNA in a specific manner. The consensus PLAG1 binding site is a bipartite element containing a Core sequence, GRGGC, and a G-cluster, RGGK, separated by 7 random nucleotides. DNA binding is mediated mainly via three of the seven zinc fingers, with fingers 6 and 7 interacting with the Core and finger 3 with the G-cluster. In transient transactivation assays, PLAG1 specifically activates transcription from its consensus DNA binding site indicating that PLAG1 is a genuine transcription factor. Potential PLAG1 binding sites were found in promoter 3 of the human insulin-like growth factor 2 (IGF-II) gene. PLAG1 binds IGF-II promoter 3 and stimulates its activity. Moreover, IGF-II transcripts originating from the P3 promoter are highly expressed in salivary gland adenomas over-expressing PLAG1. In contrast, they are not detectable in adenomas without abnormal PLAG1 expression or in normal salivary gland tissue. This indicates a perfect correlation between PLAG1 and IGF-II expression.
With respect to PLAG1 and PLAGL2, more expression data are provided by Queimado ef al. (1999) and the involvement of PLAG1 in lipoblastoma is described by Astrom et al. (2000) and Hibbard et al. (2000). Lipoblastomas are pediatric neoplasms resulting from transformation of adipocytes. It is demonstrated that chromosome 8q12 rearrangements in lipoblastoma bring about promoter-swapping events in the PLAG1 proto-oncogene. It is shown that the hyaluronic acid synthase 2 (HAS2) or collagen 1 alpha 2 (COL1A2) gene promoter regions are fused to the entire PLAG1 coding sequence in each of four lipoblastomas that were studied.
The present invention discloses PLAG 1 and/or PLAGL2 transgenic mouse strains and PLAG 1 and/or PLAG L2 knockout mice and reveals that the PLAG nucleic acids and/or proteins encoded by said nucleic acids are crucial targets and/or therapeutic molecules to diagnose and/or treat disorders such as abdominal distention characterized by severe urine retention and/or faeces retention, several over-growth related neoplasms, mammary gland tumors, reduced fertility, heart failure and/or aberrant body weight. Brief description of Figures Figure 1 : Schematic overview of the genetic organization of the inducible PLAG1 transgenic construct
A) The Cre inducible PLAG1 transgene construct. We cloned a PGK promoter-Neomycine resistance cassette flanked by two loxP sites (shown by arrowhead) in between the actin promoter and the PLAG1 ORF. The stop codon of the Neomycine gene will prevent translation of PLAG 1.
B) A Cre-mediated intramolecular recombination event leads to the excision and circularization of the floxed Neomycine cassette. One LoxP site remains on each reaction product. As a result PLAG1 is placed under the control of the actin promoter again leading to high expression of PLAG1. The arrow represents the transcription initiation.
Figure 2: Disruption of the Plagl gene in ES cells
A) Restriction map of the plagl genomic fragment in Bac347b3. The map displays the position of three identified exons for plagl (blocks). The filled blocks represent the coding part and the hatched blocks represent non-coding exons. Most important restriction sites are indicated: EcoRI (E); Hindlll (H); BamHI (B); Xbal (X); Mscl (M) B) Restriction map of the targeting vector. Prior to electroporation the vector is linearised at the unique Notl site (N); C) Expected restriction map of the mutated plagl locus. The 2KB coding region is deleted and replaced by the LacZ reporter gene and the neomycin selection gene expressed from a PGK promoter (PGK-neo) (both together ± 5KB). The primer pair mP1KH26-up (®) and LacZ2-down (-■) used for the PCR screening of the ES cells is indicated. D) Southern blot analysis to identify heterozygous ES cells. Digesting genomic DNA with BamHI and subsequent hybridisation with the 3' probe detects a 9Kb WT fragment and a 6.5 Kb fragment of the mutant allele. Vice versa, when genomic DNA was digested with Xbal, hybridisation with the 5' probe identifies an 8Kb band corresponding to the WT allele and a 7Kb fragment of the mutated allele.
Aims and detailed description of the invention The PLAG gene family members appear to act as transcriptional regulators affecting expression of specific target genes. PLAG1 has further been suggested to be involved in the development of adenomas of the salivary gland and lipoblastomas.
However, a more detailed analysis and further functional characterization of the PLAG gene family members is of great interest with regard to both human and animal health. The present invention aims at providing such a detailed analysis and, as a consequence, aims at providing new diagnostic tools and therapeutic agents for certain specific diseases. Concerning said detailed analysis, the present invention aims at first instance to provide a non- human transgenic animal comprising the PLAG1 and/or PLAGL2 transgene(s). The term 'transgenic animal' refers to any non-human animal such as mice, rats, hamsters, goats, horses, dogs, cats, non-human primates or any other vertebrate and invertebrate animal containing genetic material into which nucleic acids, which are possibly but not necessarily derived from an unrelated organism, have been artificially (i.e. via recombinant gene technology or genetic engineering) introduced. The gene (or nucleic acids) which has been introduced into the genome of said non-human animal is denominated as 'the transgene' or 'heterologous gene' or 'exogenous gene'. The transgenes of the present invention, PLAG1 and/or PLAGL2, are disclosed in great detail in WO 98/07748 to Van De Ven et al. Methods to produce transgenic animals are well-known in the art; some of said methods are explained in detail in the 'Examples' section (see further).
More specifically, the present invention aims at providing a non-human transgenic animal as mentioned -above wherein the expression of said transgene(s) is regulated by the mouse mammary tumor virus promotor, the Mx1 promotor or a tetracycline inducible system.
Mouse mammary tumor virus (MMTN) is an endogenous retrovirus of mice which is causally associated with mammary carcinomas and whose transcription is regulated by steroid hormones. Expression of viral RΝA in the mouse appears to occur predominantly in lactating mammary glands. In this organ, new genomic copies of the virus result from reverse transcription of MMTV RΝA and reintegration of these sequences into novel chromosomal sites. The newly inserted proviruses may cause cellular transformation by activating the Int gene (Choi et al., 1987). Salivary gland hyperplasia and tumors have been observed in transgenic mice containing the mouse mammary tumor virus long terminal repeat (MMTV-LTR) driving the expression of activated Ras or Ras plus Myc, Wnt-1 , Wnt-3, Fgf-8, Νeu, or SV40 T antigen genes. The gland specificity of the pathologic changes is variable between these models. From the various models it could be concluded that the MMTV LTR is potentially active in all of the major salivary glands, possibly in multiple cell types (Dardick et al., 2000). The interpretation of the specific pathological effects in the transgenic animals of the present invention resulting from expression of the PLAG1 transgene is facilitated by the fact that several other oncogenes and proto-oncogenes have been introduced into mice under the control of the same MMTV regulation. Models of the mechanism of carcinogenesis by MMTV stress the importance of the regulatory regions of its LTR and this has been emphasized in recent reports on the biological effects of the MMTV LTR fused to oncogenes (Darbre ef a/., 1986). The mouse mammary tumor virus promoter located within the viral long terminal repeat is one of the most studied hormone-responsive promoters. MMTV expression is regulated by glucocorticoids, progestin, androgens (the MMTN LTR has been shown to contain androgen responsive elements and to be responsive to androgens in vitro) and tissue- specific factors (Donjacour ef al., 1998) and to a lesser extent, mineralocorticoids. Androgens have been demonstrated to induce the MMTV promoter along with the progestagens and glucocorticoids, while the estrogens have not (Mangues ef al., 1990). Androgens can act on the LTR of MMTV when the appropriate receptors are present in the cells, and this interaction can influence the expression of additional adjacent genes (Darbre ef al., 1986). The increased incidence of tumors in the mammary gland in breeding females can also be due to the hormonal regulation of the LTR. This fact is likely due to the higher expression of the transgene in the mammary glands with hormonal effects on the MMTV LTR, together with the cell proliferation induced by cycles of pregnancy (Daphna-lken et al., 1998). Thus, both the receptor status of the cells and hormonal enhancing effects of an LTR on heterologous promoters, enhancers or both of neighboring genes, are critical in determining hormonal regulation of the cell and hence the expression of the transgene under the control of this promoter.
By the use of an Mx1-Cre mouse in cross breeding, we have the opportunity to study the more general expression pattern of PLAG1 and/or PLAG L2 in tissues susceptible for PLAG1 and/or PLAGL2 transforming capacity. Mx1 , part of a defense mechanism to viral infections, is silent in healthy mice. The Mx1 promoter can be transiently activated to high amounts of transcription in many tissues upon application of interferon alpha or interferon beta or of synthetic double-stranded RNA [polyinosinic-poly-cytidylic acid (pl-pC): an interferon inducer]. Cre recombination in the liver and lymphocytes is 100 %. In other organs the recombination rate is variable, ranging from 94% in spleen, duodenum 72%, heart, lung, uterus and thymus around 50% to 8 % in brain (Kuhn etal., 1995).
A tetracycline-inducible (Tet-inducible) system allows PLAG1 and/or PLAGL2 overexpression independently in any organ. The development of a regulatory circuit based on the Tetracycline-resistance operon from E.coli transposon Tn10, opened a new approach to controlling transgene expression. In this system, a fusion-controlled trans-activator protein (tTA) composed of the Tet repressor and the activating domain of viral protein VP16 of herpes simplex virus strongly activates transcription from the minimal promoter from the human cytomegalovirus (hCMV) fused to Tet operator sequences (tetO-PhCMV). The tTA binds to the Tet operator sequences in the absence of Tetracycline but not in its presence. This results in repression of transcription upon introduction of Tetracycline. We used the rtTA system, which is identical to the tTA system with the exception of 4 amino acid exchanges in the TetR moiety. These changes convey a reverse phenotype to the repressor (rTetR). The resulting rtTA requires Tetracycline, or analogs such as Doxycycline for binding to TetO and thus transcription activation. In our mouse line, rtTA synthesis is controlled by PhCMV, and Doxycycline-regulated expression of the indicator genes is found in a number of tissues (Furth etal., 1994; Kistner et al., 1996). With this system we obtain rapid and reversible expression of the transgene. Highest activation has been obtained in the pancreas. This teaches us what overexpression of PLAG1 and/or PLAG L2 in the pancreas leads to. High activities are also measured in stomach and skeletal muscle. The different levels of activation in various organs reflect the activity of PhCMV in different cell types. We have created tri-transgenic mice that contain rtTA, TetOCre and PLAG1 and/or PLAG L2. The expression of Cre, and subsequent recombination of the target PLAG1 DNA, is entirely dependent on the administration of Doxycycline.
An elegant and often valuable approach to evaluate the function of a gene in vivo in a complete organism is to inactivate both alleles of the gene of interest and study the resulting phenotype. This can be achieved by using gene-targeting technology by homologous recombination between chromosomal DNA and a carefully selected genetic sequence, introduced into pluripotent mouse embryonic stem cells (ES). This technology allows the generation of mice carrying a mutation, i.e. from highly specific single base mutations to the complete deletion of a gene. The methodological and technical aspects have been the subject of many reviews and are well known in the art. From studies of human tissues, PLAG1 appeared to be mainly expressed during fetal development and not during adult life, suggesting a critical role during embryogenesis. We decided to analyze the in vivo function of Plag1and/or PLAG L2, by generating mice with non-functional Plagl alleles using homologous recombination in ES cells. The present invention thus also aims at providing a non-human animal wherein at least one allele of the gene(s) encoding for PLAG1 and/or PLAGL2 is (are) inactivated. More specifically, the present invention aims at providing a non-human, knockout animal wherein the complete open reading frame of PLAG 1 and/or PLAGL2 is replaced by a heterologous gene such as, but not limited to, the LacZ reporter gene. Phenotyping of the transgenic (T) animals and knock-out (KO) animals of the present invention revealed to our surprise that PLAG1 and/or PLAG L2 play(s) an essential role in the development of disease states such as heart problems resulting in premature death (KO), reduced body weight (KO), reduced fertility (KO), mammary gland tumors (adenocarcinomas) (T), overgrowth (T) and overgrowth-related tumors such as Wilms tumor, leukemia, osteosarcoma and tumors of the kidney, liver and adrenal gland (T) and abdominal distention characterized by severe urine and faeces retention (T). Consequently, the present invention aims at providing a new usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids for the manufacture of a diagnostic tool to diagnose urine/faeces retention, growth and/or growth-related disorders, mammary gland tumors (adenocarcinomas), heart disorders and/or reduced fertility, or, for the manufacture of a medicament to treat growth disorders, heart disorders and/or reduced fertility. The terms 'fragments or variants of said proteins or nucleic acids' refer to any fragment or any modified version or homologue of said protein or nucleic acid which retains enough specificity in order to be used to diagnose and/or treat the above-mentioned disorders. The terms 'diagnostic tool' also refers to the usage of anti-PLAG 1 and/or PLAGL2 antibodies or nucleic acids hybridizing with nucleic acids said encoding PLAG 1 and/or PLAGL2 proteins or fragments or variants of said antibodies or nucleic acids in a diagnostic method. Hence, the present invention provides a diagnostic method for determining if a subject bears modified (i.e. increased or decreased) PLAG1 and PLAGL2 expression comprising the steps of (1 ) providing a biological sample of said subject, and (2) detecting in said sample modified PLAG1 and PLAGL2 expression. As will be appreciated by one of ordinary skill in the art, the choice of diagnostic methods of the present invention will be influenced by the nature of the available biological samples to be tested and the nature of the information required. When the diagnostic assay is to be based upon nucleic acids from a sample, either mRNA or cDNA may be used. With either mRNA or cDNA, standard methods well known in the art may be used to detect the presence of a particular sequence either in situ or in vitro (see, e.g. Sambrook et al., eds. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). A significant advantage of the use of either DNA or mRNA is the ability to amplify the amount of genetic material using the polymerase chain reaction (PCR). Other nucleotide sequence amplification techniques may be used, such as ligation-mediated PCR, anchored PCR and enzymatic amplification as will be understood by those skilled in the art. PLAG1 and PLAGL2 protein levels can be measured by any method well known in the art. The term 'antibody' or 'antibodies' relates to an antibody characterized as being specifically directed against PLAG1 or PLAGL2 or any functional derivative thereof, with said antibodies being preferably monoclonal antibodies; or an antigen-binding fragment thereof, of the F(ab')2, F(ab) or single chain Fv type, or any type of recombinant antibody derived thereof. These antibodies of the invention, including specific polyclonal antisera prepared against PLAG1 or PLAGL2 or any functional derivative thereof, have no cross-reactivity to others proteins. The monoclonal antibodies of the invention can for instance be produced by any hybridoma liable to be formed according to classical methods from splenic cells of an animal, particularly of a mouse or rat immunized against PLAG1 or PLAGL2 or any functional derivative thereof, and of cells of a myeloma cell line, and to be selected by the ability of the hybridoma to produce the monoclonal antibodies recognizing PLAG1 or PLAGL2 or any functional derivative thereof which have been initially used for the immunization of the animals. The monoclonal antibodies according to this embodiment of the invention may be humanized versions of the mouse monoclonal antibodies made by means of recombinant DNA technology, departing from the mouse and/or human genomic DNA sequences coding for H and L chains or from cDNA clones coding for H and L chains. Alternatively the monoclonal antibodies according to this embodiment of the invention may be human monoclonal antibodies. Such human monoclonal antibodies are prepared, for instance, by means of human peripheral blood lymphocytes (PBL) repopulation of severe combined immune deficiency (SCID) mice as described in PCT/EP 99/03605 or by using transgenic non-human animals capable of producing human antibodies as described in US patent 5,545,806. Also fragments derived from these monoclonal antibodies such as Fab, F(ab)'2 and ssFv ("single chain variable fragment"), providing they have retained the original binding properties, form part of the present invention. Such fragments are commonly generated by, for instance, enzymatic digestion of the antibodies with papain, pepsin, or other proteases. It is well known to the person skilled in the art that monoclonal antibodies, or fragments thereof, can be modified for various uses. The antibodies involved in the invention can be labeled by an appropriate label of the enzymatic, fluorescent, or radioactive type.
In a specific embodiment the antibodies against PLAG1 or PLAGL2 can be derived from animals of the camelid family. In said family immunoglobulins devoid of light polypeptide chains are found. Heavy chain variable domain sequences derived from camelids are designated as VHH's. "Camelids" comprise old world camelids (Camelus bact anus and Camelus dromaderius) and new world camelids (for example Lama paccos, Lama glama and Lama vicugna). EP0656946 describes the isolation and uses of camelid immunoglobulins and is incorporated herein by reference.
The terms 'medicament to treat' relate to a composition comprising PLAG1 and PLAGL2 proteins or anti-PLAG1 or anti-PLAGL2 antibodies as described above and a pharmaceutically acceptable carrier or excipient (both terms can be used interchangeably) to 'treat' growth disorders as described above, heart disorders and reduced fertility or via said antibodies to treat urine/faeces retention, mammary gland tumors (adenocarcinomas), and growth-related neoplasms. Suitable carriers or excipients known to the skilled man are saline, Ringer's solution, dextrose solution, Hank's solution, fixed oils, ethyl oleate, 5% dextrose in saline, substances that enhance isotonicity and chemical stability, buffers and preservatives. Other suitable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids and amino acid copolymers. The 'medicament' may be administered by any suitable method within the knowledge of the skilled man. The preferred route of administration is parenterally. In parenteral administration, the medicament of this invention will be formulated in a unit dosage injectable form such as a solution, suspension or emulsion, in association with the pharmaceutically acceptable excipients as defined above. However, the dosage and mode of administration will depend on the individual. Generally, the medicament is administered so that the protein, polypeptide, peptide of the present invention is given at a dose between 1 μg/kg and 10 mg/kg, more preferably between 10 μg/kg and 5 mg/kg, most preferably between 0.1 and 2 mg/kg. Preferably, it is given as a bolus dose. Continuous infusion may also be used and includes continuous subcutaneous delivery via an osmotic minipump. If so, the medicament may be infused at a dose between 5 and 20 μg/kg/minute, more preferably between 7 and 15 μg/kg/minute. In another embodiment antibodies or functional fragments thereof can be used for the manufacture of a medicament for the treatment of the above-mentioned disorders. As a non-limiting example there are the antibodies described in US 5,843,633. In a specific embodiment said antibodies are humanized (Rader et al., 2000, J. Biol. Chem. 275, 13668. In yet another specific embodiment antibodies derived from camelids are used to manufacture a medicament. Another aspect of administration for treatment is the use of gene therapy to deliver nuclei acids encoding PLAG1 and/or PLAGL2 or anti-sense nucleic acids (see further). Gene therapy means the treatment by the delivery of therapeutic nucleic acids to patient's cells. This is extensively reviewed in Lever and Goodfellow 1995; Br. Med Bull. ,51, 1-242; Culver 1995; Ledley, F.D. 1995. Hum. Gene Ther. 6, 1129. To achieve gene therapy there must be a method of delivering genes to the patient's cells and additional methods to ensure the effective production of any therapeutic genes. There are two general approaches to achieve gene delivery; these are non-viral delivery and virus-mediated gene delivery. Also within the scope of the invention are oligoribonucleotide sequences, that include anti-sense nucleic acids that bind to said consensus binding motif or nucleic acids encoding PLAG1 or PLAGL2. Anti-sense nucleic acids of the invention may be prepared by any method known in the art for the synthesis of nucleic acids. These include techniques for chemically synthesizing oligodeoxyribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize anti-sense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. The present invention further relates to the usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids in a method to screen for molecules which interfere with PLAG 1 and/or PLAGL2 biological activity comprising the following steps:
-incubating a mixture comprising PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and at least one molecule,
-allowing binding between PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and said molecule,
-isolating said molecule binding to PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids, and
-determining the ability of said molecule to interfere with PLAG1 and/or PLAG L2 biological activity. The invention thus provides methods for identifying compounds or molecules which bind to PLAG1 or PLAGL2 or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and which interfere with (i.e. which prevent or suppress) PLAG 1 and/or PLAGL2 biological activity. With "interfering" or "suppression" it is understood that said suppression of biological activity can occur for at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% compared to non-suppressed biological activity.
The latter methods are also referred to as 'drug screening assays' or 'bioassays' and typically include the step of screening a candidate/test compound or agent for the ability to interact with PLAG1 or PLAGL2 or to nucleic acids encoding PLAG1 or PLAGL2. Candidate compounds or agents which have this ability, can be used as drugs to combat or prevent PLAG bioactivity. Candidate/test compounds such as small molecules, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries.
Typically, the assays are cell-free assays which include the steps of combining said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 and a candidate/test compound, e.g., under conditions which allow for interaction of (e.g. binding of) the candidate/test compound with said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 to form a complex, and detecting the formation of a complex, in which the ability of the candidate compound to interact with said PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 is indicated by the presence of the candidate compound in the complex. Formation of complexes between PLAG1 or PLAGL2 and the candidate compound can be quantitated, for example, using standard (immuno)assays. PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 employed in such a test may be free in solution, affixed to a solid support, borne on a cell surface, or located extracellularly or even intracellularly.
To perform the above described drug screening assays, it is feasible to immobilize PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 or its (their) target molecule(s) to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Interaction (e.g., binding of) of PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 to a target molecule, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, PLAG1 or PLAGL2 -His tagged can be adsorbed onto Ni-NTA microtitre plates, or PLAG1 or PLAGL2 -ProtA fusions adsorbed to IgG, which are then combined with the cell lysates (e.g., 35S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the plates are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of PLAG1 or PLAGL2 -binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques. Other techniques for immobilizing protein on matrices can also be used in the drug screening assays of the invention. For example, PLAG1 or PLAGL2 can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated PLAG1 or PLAGL2 can be prepared from biotin-NHS (N- hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, III.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Another technique for drug screening which provides for high throughput screening of compounds having suitable binding affinity to PLAG1 or PLAGL2 is described in detail in "Determination of Amino Acid Sequence Antigenicity" by Geysen HN, WO 84/03564, published on 13/09/84. In summary, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The protein test compounds are reacted with fragments of PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 and washed. Bound PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 is then detected by methods well known in the art. Purified PLAG1 or PLAGL2 can also be coated directly onto plates for use in the aforementioned drug screening techniques. Alternatively, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support. This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding PLAG1 or PLAGL2 specifically compete with a test compound for binding PLAG1 or PLAGL2. In this manner, the antibodies can be used to detect the presence of any protein, which shares one or more antigenic determinants with PLAG1 or PLAGL2.
According to the invention molecules that comprise a region specifically binding to PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2 which can be used for the manufacture of a medicament to prevent PLAG bioactivity can be chosen from the list comprising an antibody or any fragment thereof binding to PLAG1 or PLAGL2, a (synthetic) peptide, a protein, a small molecule specifically binding to PLAG1 or PLAGL2 or nucleic acids encoding PLAG1 or PLAGL2, anti-sense nucleic acids hybridising with said nucleic acids encoding PLAG1 or PLAGL2, and a ribozyme against nucleic acids encoding PLAG1 or PLAGL2. The term 'antibody' has been explained above. Small molecules, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries. Also within the scope of the invention are oligoribonucleotide sequences, that include anti-sense nucleic acids that bind to said nucleic acids encoding PLAG1 or PLAGL2. The term 'anti-sense nucleic acids' of the invention is explained above. The present invention further relates a method for the production of a pharmaceutical composition comprising the usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and further more mixing said molecule identified, or a derivative or homologue thereof, with a pharmaceutically acceptable carrier as is also stated above.
The present invention finally relates to the usage of compounds interfering with the expression of target genes of PLAG 1 and/or PLAGL2 or interfering with the biological activity of the proteins encoded by said target genes for the manufacture of a medicament to treat urine/faeces retention, mammary gland tumors (adenocarcinomas), and/or overgrowth-related disorders.
A non-limiting example of the latter compounds is carbachol which is further described in more detail.
Said target genes are genes encoding for the proteins chosen from the group consisting of: H19 (A view through the clouds of imprinting FASEB J. 2001 Aug; 15(10): 1694-703. Review) KIP2 (Algar, E.; Brickell, S.; Deeble, G.; Amor, D.; Smith, P.: Analysis of CDKN1C in Beckwith Wiedemann syndrome. Hum. Mutat. 15: 497-508, 2000)
ESP1/CRP2 (Tsui, S. K. W.; Chan, P. P. K.; Cheuk, C. W.; Liew, C. O; Waye, M. M. Y.; Fung, K. P.; Lee, C. Y.: A novel cDNA encoding for a LIM domain protein located at human chromosome 14q32 as a candidate for leukemic translocation. Biochem. Molec. Biol. Int. 39: 747-754, 1996.)
IPL (Qian N, Frank D, O'Keefe D, Dao D, Zhao L, Yuan L, Wang Q, Keating M, Walsh C, Tycko B.The IPL gene on chromosome 11p15.5 is imprinted in humans and mice and is similar to TDAG51 , implicated in Fas expression and apoptosis. Hum Mol Genet 1997 Nov;6(12):2021-9)
Svnapsin (De Jaco A, Augusti-Tocco G, Biagioni S. Muscarinic acetylcholine receptors induce neurite outgrowth and activate the synapsin I gene promoter in neuroblastoma clones. Neuroscience. 2002; 113(2):331-8)
Filamin (Indications for a novel muscular dystrophy pathway, gamma-filamin, the muscle- specific filamin isoform, interacts with myotilin. van der Ven PF, Wiesner S, Salmikangas P, Auerbach D, Himmel M, Kempa S, Hayess K, Pacholsky D, Taivainen A, Schroder R, Carpen O, Furst DO.J Cell Biol 2000 Oct 16;151(2):235-48
RNCC (Genes encoding three new members of the leukocyte antigen 6 superfamily and a novel member of Ig superfamily, together with genes encoding the regulatory nuclear chloride ion channel protein (hRNCC) and an N omega-N omega-dimethylarginine dimethylaminohydrolase homologue, are found in a 30-kb segment of the MHC class III region Ribas G, Neville M, Wixon JL, Cheng J, Campbell RD.J Immunol 1999 Jul 1;163(1):278-87) IGF-II (Insulin -like growth factors and cancer. Furstenberger G, Senn HJ. Lancet Oncol 2002
May;3(5):298-302)
HUMECK (cDNA cloning and characterization of eck, an epithelial cell receptor protein- tyrosine kinase in the eph/elk family of protein kinases. Lindberg RA, Hunter T. Mol Cell Biol
1990 Dec;10(12):6316-24)
Examples
1. Plagl and PlaqL2 are proto-oncoqenes
1.1 Generation of the PLAG1 and PLAGL2 retroviral expression constructs and production of recombinant retroviruses.
To generate replication-defective retroviruses able to express the PLAG1 or the PLAGL2 gene, we followed the following strategy. cDNA's encoding either PLAG1 or PLAGL2 with an amino- terminal FLAG tag were cloned in the Hpal site of the pMSCVpuro vector. The pMSCVpuro (murine stem cell virus) vector was derived from the Murine Embryonic Stem Cell Virus (MESV) and the LN retroviral vector (Hawley ef al., 1994). The vector also contains reverse transcription signals as well as sequences required for integration of the genetically engineered recombinant RNA transcripts into virus particles upon its expression in the selected host. Transient expression of the recombinant pMSCVpuro DNA is driven by the Long Terminal Repeat (LTR) sequences. Production of recombinant retroviruses containing sequences encoding PLAG1 or PLAGL2 involved co-transfection into HEK293T cells of DNA of the retroviral expression constructs together with DNA of the plK6.1 Ecopack vector, which codes for the three retroviral genes gag, pol, and env. Together the vectors and the cells can produce infectious but replication-defective recombinant retroviruses that contain the original gene of interest.
1.2 Infection of NIH-3T3 cells with PLAG1 or PLAGL2 containing retroviruses leads to expression of high levels of functional proteins and focus formation.
To investigate whether the FLAG-tagged PLAG1- and P 4GL2-encoded proteins in the infected NIH-3T3 cells are functional, the infected cells were transfected with (WT2)3-TKLuc or with a reporter construct where the DNA binding sites were mutated (mCOmCLU). The latter construct was used as a negative control since these mutations abolish the binding of PLAG1 to the bipartite DNA consensus motif and subsequently, the luciferase activation. PLAG1 or PLAGL2 overexpressing cells can stimulate the luciferase activity 27- or 10-fold, respectively. On the contrary, mock-infected cells only slightly induced the (WT2)3-Tk luc reporter construct (~ 2,5 fold). This induction is probably due to endogenous Plagl present in the NIH-3T3 cells.
To evaluate their oncogenic potential, the focus formation capacity of the PLAG1 and PLAGL proteins was studied. Therefore, NIH-3T3 cells were infected with the appropriate recombinant retrovirus and grown as a monolayer to confluence in medium containing either 1% or 10% fetal calf serum and the formation of foci was analyzed. Contact inhibition of growth appeared to be lost leading the cells to pile up and form foci. The PLAG1 protein seemed to possess a greater capacity in focus formation than the PLAGL2 protein.
In the evaluation of the oncogenic potential of the PLAG1 and PLAGL2 proteins, anchorage-independent growth was also studied. Cells infected with the appropriate recombinant retroviral were seeded in a soft agar suspension and colonies were counted 3 weeks after the seeding. The first microscopically detectable colonies appeared 10 days after seeding. Colonies of PLAG1 expressing cells remained small compared to colonies of cells expressing PLAGL2.
To determine whether the PLAG1 or PLAGL2 expressing NIH-3T3 cells are tumorigenic in nude mice, retrovirus-infected NIH-3T3 cells were injected subcutaneously into athymic nu/nu NMRI mice and examined every week for tumor development. PLAG1 expressing cells induced rapidly growing tumors at the site of inoculation within 3 weeks, while tumor formation originating from cells expressing PLAGL2 became apparent only a few days later. The mock- infected cells did not form any tumors during this time period.
1.3 lgf-ll is upregulated in NIH-3T3 cells expressing PLAG1 OR PLAGL2.
As can be concluded from the results of the luciferase assay experiments, PLAG1 as well as PLAGL2 have transcriptional properties as they can activate transcription via binding to the same DNA consensus sequence, although with different efficiencies. These observations suggest that PLAG1 and PLAGL2 could be transcription factors that regulate a similar spectrum of genes or at least some common genes. As IGF-II has been identified as a putative target gene of PLAG1 in human pleomorphic adenomas of the salivary glands [Voz, 2000 #89], lgf-ll expression was tested in PLAG1 as well as PLAGL2 overexpressing NIH-3T3 cells by Northern blot analysis. The results demonstrated a strong correlation between PLAG1, PLAGL2 and lgf-ll expression in this heterologous assay system, suggesting that lgf-ll could be a target gene not only for PLAG1 but also for PLAGL2.
1.4 PLAG1 and PLAGL2 are not able to transform R' cells.
It has been well documented that IGF-II is a peptide growth factor involved in carcinogenesis (Toretsky and Helman, 1996), therefore it could very well play a crucial role in the establishment and maintenance of the transformed phenotype we observed with the N1H-3T3 cells overexpressing PLAG1 or PLAGL2. It was hypothesized, therefore, that the transforming effect of lgf-ll in our heterologous system might be mainly mediated via the type 1 insulin-like growth factor receptor (Igfl-R). This prompted us to ask whether PLAG1 and PLAGL2 could transform R" cells. R" cells are mouse 3T3 cells derived from mouse embryos with a targeted disruption of the Igfl-R gene (Sell ef al., 1994; Sell ef al., 1993). In order to obtain R" cell lines overexpressing PLAG1 or PLAGL2, the same strategy of retroviral gene transfer was used. In control experiments, R- cells infected with the appropriate recombinant retrovirus preparations were found to express relatively high levels of transcripts of both of the PLAG genes and also their corresponding proteins. These cell lines, however, were not able to produce foci, suggesting that the PLAG1 as well as the PLAGL2 induced transformation in our heterologous system might, at least partially, be mediated via the lgf-ll pathway.
1.5 Expression profiles of pleomorphic adenomas in MMTV-Cre/PLAG1(MCP) transgenic mouse (see further example 2. 'PLAG1 and/or PLAGL2 transgenic mice') compared to normal salivary gland
To analyse the molecular processes involved in PLAG1 induced oncogenesis, we compared the expression profile obtained from a pleomorphic adenoma displaying PLAG1 ectopic expression of an MCP mouse to those from a normal salivary gland of a non-transgenic mouse of the same age, background and sex. We hybridised oligonucleotides microarrays (Affymetrix) with biotinylated cRNA obtained from two different samples, one normal salivary gland (mmtv 64) and one pleomorphic adenoma (mmtv 135). The mouse pleomorphic adenoma, overexpressing PLAG1 , presented the same features as the human pleomorphic adenoma. Comparison of the two samples uncovered a lot of genes significantly differentially expressed. Among the genes the highest upregulated are Dlk 1 (or Pref-1), Igf2 and H19, >63 times, 49 times and > 35 times upregulated, respectively. The upregulation of Igf2 gene is in perfect agreement with other micro-array experiments (cell lines overexpressing PLAG1 and human pleomorphic adenoma overexpressing PLAG1) showing this upregulation. Additionally, H19, located on distal chromosome 7, (syntenic region of human chromosome 11 p15.5 where also Igf2 is located, is upregulated and together with Igf2 reciprocally imprinted. These results are also in agreement with former results. Strikingly, DIM, the gene found the highest upregulated in our mouse micro-array experiments (>63 times) is also an imprinted gene (see Wylie et al.,GenomeRes. 2000 Nov;10(11):1711-8; Takada et al. Human Molecular Genetics, 2002, Vol 11 , n 1 : 77-86 and Moon et al. Mol. Cell Biol. 2002:5585)). DIM and Gtl2 (4, 10 and 6 times upregulated for three probes respectively) are reciprocally imprinted genes, located on mouse chromosome 12. Similarities between this domain and that of the well-characterized Igf2-H19 locus have been previously noted.
1.6 Identification of PLAG1 target genes in pleomorphic adenoma
In order to identify in the pool of genes differentially expressed in the pleomorphic adenoma and those directly under the control of PLAG1, we made a comparison of the mouse tumor target genes to expression profiles of a cell line experiment. In the cell line experiment, expression profiles were monitored shortly after induction of PLAG1 expression in genetically engineered human epithelial kidney 293 cell lines. Differentially expressed genes in clones that had stably integrated a DNA fragment enabling zinc-inducible expression of PLAG1 or of beta- galactosidase were studied. A first comparison of the mouse pleomorphic adenoma target genes these to this cell line results (47 genes significantly induced in all four comparative cell line evaluations) revealed 4 genes significantly and commonly upregulated in the PLAG1 expressing cells and in the mouse tumors (Igf2, Pigf, Crabp2, and SWISNF-related, matrix- associated, actin-dependent regulator of chromatin). A second comparison is done between genes differentially expressed in human pleomorphic adenoma and the mouse pleomorphic adenoma. Igf2, Crabp2 and SWISNF- related, matrix-associated, actin-dependent regulator of chromatin, are thus commonly upregulated in human pleomorphic adenoma, cell lines overexpressing PLAG1 and mouse pleomorphic adenoma.
2. PLAG1 and/or PLAGL2 transgenic mice 2.1 Material and Methods
Design and creation of a DNA construct enabling inducible PLAG1 expression in genetically engineered mice.
The objective was to design and create a DNA construct that allows controlled induction of PLAG1 gene expression in genetically engineered mice. To obtain such a DNA construct, the complete PLAG1 ORF, including a C-terminal HA tag, has been ligated as a blunt ended fragment into the blunt ended EcoRI site of pCAGGS [Niwa, 1991 #110] (pCB55). Afterwards, a LoxP/PGK-Neo/LoxP DNA fragment, isolated as a blunt ended Xhol/Xbal fragment from pHR68 (a kind gift of An Zwijsen of the laboratory of Cell Growth, Differentiation and Development K.U.Leuven, VIB), was cloned in the blunt ended EcoRI site of pCB55 (PIW13/PIW14). The DNA of the construct was sequenced to confirm its design. Nucleotide sequence analysis was performed directly on the plasmids using the dideoxy chain termination method (Sanger ef al., 1977) and the AutoRead sequencing kit (Amersham Pharmacia Biotech) in presence of specifically designed fluorescence-labeled primers. Samples were processed and analyzed by PAGE on denaturing gels on the Automated Laser Fluorescent DNA Sequencer system from Pharmacia Biotech, Brussels. Generated sequences were analyzed using the Lasergene software package (DNASTAR).
PIVV13 was subsequently linearized with a Sail and Sfil double digest to obtain a 6.0 kb DNA insert containing the PLAGHHA-tag DNA under the expression control of a modified CMV promoter, a 3X end DNA fragment of the gene encoding beta globin and the LoxP-Neo-LoxP DNA fragment (see 'Strategy'). Western Blotting Analysis
Into 293T cells, PIVV13 was co-transfected with DNA encoding the Cre enzyme using Fugene to evaluate transient expression of the PLAG1 protein by Western blotting analysis. Co- transfection of PIW13 with the empty pCAGGS vector, and cells transfected with pCB55 alone were used as negative controls; PEM 148 (PLAG1 ORF sense orientation in the pCAGGS vector) was used as a positive control. Cells were harvested the next day in PBS/EDTA. The cell pellets were lysed in SDS-PAGE sample buffer (60 mM TRIS-HCL pH 6.8, 12% glycerol, 4% SDS), and the lysate was sonicated, subsequently. Samples containing equal protein amounts were heated at 95°C for 5 min. and proteins were size-fractionated by electrophoresis in a 10% polyacrylamide gel. Thereafter, proteins were blotted onto nitrocellulose membranes. HA-tagged PLAG1 was detected upon incubation with a mouse monoclonal anti-HA antibody (dilution 1/5000) followed by a peroxidase-labeled goat α-mouse polyclonal antibody (PROSAN, DAKO) (1/2000). Protein patterns on the blots were visualized using the Renaissance detection kit (NEN Life Science products) according to the supplier's instructions. Micro-injection
Gene transfer by microinjection of DNA directly into the male pronucleus of prenuclear mouse embryos is used widely and successfully (Hammer ef al., 1985). The manipulated eggs are re- implanted by transfer to the oviduct of foster mice and allowed to develop to term. Briefly, FVB donor females were superovulated and after injection of the pronuclei with the DNA, surviving embryos were reimplanted into pseudopregnant F1 mice.
Linearized DNA constructs were purified by QIAquick gel extraction Kit (Qiagen, Germany, catn. 28706) followed by QIAquick PCR Purification Kit (Qiagen, Germany, catn. 28106). Concentration of the DNA was determined on agarose gel; OD was measured and different dilutions were made. Genotyping of transgenic mice
Genomic DNA prepared from the tail tips of the offspring has been genotyped by PCR and Southern blot analysis to identify transgenic founders. One transgenic founder male was mated with two FVB/N female mice (virgin female of 8 weeks old, TACONIC). Every two weeks the single male rotated among sets of two FVB females.
Isolation of genomic DNA from tail tips of mice Briefly, tails were cut at the age of weaning (21 days). Tail tips (about 0.5 cm) were incubated in 400 ml of proteinase K-solution overnight at 55 °C (proteinase K solution consists of proteinase K (1 mg/ml) in 0.5% SDS, 0.1 M NaCI, 0.05 M Tris HCI, 1 mM EDTA, pH8). Upon incubation, genomic DNA was precipitated with 0.7 M NaOH and 1 ml of EtOH, the DNA pellet was washed with 70% and 100% EtOH and finally dissolved in 300 μl TE. Afterwards the genomic DNA was purified further by phenol/chloroform extraction and the DNA was finally precipitated with EtOH and dissolved in 200μl TE.
Genotyping PLAG1 transgenic mice by PCR To genotype the PLAG1 transgenic mice, standard conditions were used for the PCR reaction. To detect the transgene, a set of two primers were used with as forward primer, POS1599-F (5 TCTCAAGCATCGTCATCAT3') which corresponds to a region encoding the TAD of PLAG1 and as reverse primer, β-globin-low (5'-AAAATTCCAACACACTATTGC-3') which corresponds to the β-globin 3' region of the construct. Such a PCR amplification reaction generates a 520 bp DNAfragment. Different Cre-recombinase expressing mice were crossed with PLAG1 transgenic mice. The resulting double and triple transgenic mice are genotyped as follows.
To genotype the Mx1Cre/PLAG1 double transgenic mouse, we did an additional PCR. One can detect Cre with the forward primer Cre1 (δ'-CCTGTTTTGCACGTTCACCG-S') and the reverse primer Cre3 (5' ATGCTTCTGTCCGTTTGCCG 3'). To genotype triple TetOCre/rtTA/PLAG transgenic mouse, the PLAG1, and the Cre - primer sets must be used. Furthermore, the presence of the reverse tetracyclin transactivator (rtTA) could be detected by PCR with the primer pairs 447739 (5'-AATGAGGTCGGAATCGAAGG-3 ) and 447740 (5'- TAGCTTGTCGTAATAATGGCGG-3').
Southern blot analysis 10 μg of genomic DNA was digested with the required restriction enzyme for 24 hours at 37 °C. The DNA fragments were separated by electrophoresis at 2 V/cm for 18 hours in 1% agarose gels. Gels were stained with ethidium bromide, depurinated in 0.24 % HCI followed by capillary transfer of the DNA to nylon membranes in 0.6 M NaOH transfer buffer.
Labeling of DNA probes As human PLAG1 probe, an Nhel/Xhol DNA fragment of pKH26 containing the complete ORF of the gene was used. Molecular DNA probes were radiolabeled with -32P-dCTP using the megaprime DNA labelling system (Amersham). Cre-recombinase expressing mice
Generation of conditional transgenic mice is usually used as an approach to study the effect of temporally and/or spatially regulated expression of a particular gene on the wild-type phenotype. The use of the Cre-LoxP system is very well suited to generate such mice and this system has been used widely and successfully (Nagy, 2000). In our studies, we have used three types of genetically engineered Cre-mice, including MMTV-Cre, Mx1-Cre and Tet-O- Cre/rTta.
1. MMTV-Cre
Mice with an MMTV-Cre homozygous genotype [B6129-TgN(MMTN-Cre)] were obtained from Jackson's Laboratory, USA (stock number JR 3551 ), described by Wagner et al. (Wagner ef al., 1997). A homozygous male and female were crossed to obtain offspring.
2. Mxl-Cre
The MxCre mouse was a kind gift of Anton Roebroek (CME, KULeuven) (Kuhn ef al., 1995). This mouse has an interferon-responsive promoter controlling the expression of Cre- recombinase. Kuhn described the use of this mouse model for the first time. (Collet and Secombes, 2001 ; Kuhn et al., 1995)
Figure imgf000019_0001
The double transgenic mouse strain Tet-0-Cre/rtTA was generated by crossing mice transgenic for tet-O-Cre (kind gift of Dr. J.Gordon, Washington) with mice transgenic for the reverse tetracyclin transactivator (rtTA) (a kind gift of Dr Bujard, Heidelberg, Germany) Doxycycline-inducible, rtTA-regulated Cre expression allows a floxed gene to be disrupted at any point during development (Kistner ef a/., 1996; Saam and Gordon, 1999). Northern Blot analysis
Northern blot analysis was performed according to standard procedures (Sambrook et al 1989). 15 μg of total RNA was size fractionated through a 1 % agarose gel containing 6% formaldehyde and run for 5 hours at 5 Volt/cm in 1X MOPS buffer (MOPS 10X running buffer: 0.2 M MOPS, 50 mM NaAc, 10 mM EDTA). Capillary transfer of the RNA to nylon membranes (Hybond N, Amersham) was performed overnight in 10XSSC transfer buffer (438.25 gram NaCI, and 220.5 gram tri sodium citrate for 5 liters). RNA was fixed to the membranes by baking for 2 hours at 80 °C. Northern blot hybridisation
Filters are prehybridized for 3 hours at 42 °C in 5XSSPE (20X solution: 175.3 g NaCI, 27.6 g NaH2P04, 7.4 g EDTA pH 7.4), 10Xdenhardts (50X Denhards: 5g Ficoll-Type 400, Pharmacia- 5g polyvinylpyrrolidone, 5g bovine serum albumin - Fraction V; Sigma- in 500ml H20), 100 μg/ml denaturated salmon sperm DNA, 50% formamide, 2% SDS and hybridized in the same solution overnight at 42° C after the addition of 1 to 2 million cpm per ml of the indicated radiolabelled probe. Histological and immunohistological analysis
Routinely, 5-μm frozen serial sections from tumors were used in the study. Routine hematoxylin and eosin staining confirmed the histopathological diagnosis. Polyclonal rabbit anti-PLAG1 (PEM 190 and PEM 195; dilution 1/60) antibodies were used in an indirect peroxidase procedure. In short, the frozen sections were dried overnight and fixed, in cold, buffered 4.0% paraformaldehyde. After fixation, tissue sections were pretreated with either swine or mouse serum for 7 min, followed by incubation with selected primary antibodies. Then, peroxidase-conjugated swine anti-rabbit (SWAR/PO, DAKO; 1/100) or rabbit anti-mouse Ig (RAM/PO, DAKO; 1/50) was applied as a secondary antibody, in PBS (10XPBS: 80 g NaCI, 2 g KCI, 14.4 g Na2HP04, 2.4 g KH2P04, pH7.4 with HCI in 1 liter H20), pH 7.2, containing 10% normal human AB-serum. Each incubation with antibody was performed for 30 min at room temperature and was followed by three washes using PBS, pH 7.2. Finally, sections were incubated for 10 min in 0.05 M acetate buffer (pH 4.9) containing 0.05 % 3-amino-9- ethylcarbozole and 0.01 % H202, resulting in a red precipitate, and were lightly counterstained with Mayer's Haemalum stain. Production of a conditional PLAG1 transgenic mouse
To study the pathogenic role of PLAG1 in vivo, a transgenic mouse model is a powerful tool. We firstly generated a transgenic mouse carrying a PLAG1 transgene under the control of a modified actin promoter fused to the CMV enhancer. Characterization of the fifty descendants obtained after micro-injection revealed that only one founder transgenic mouse contains the PLAG1 transgene and moreover in a very low copy number, suggesting that overexpression of PLAG1 during embryonic development could have a toxic effect on the embryo. We subsequently opted for a strategy where the transgene is maintained in a silent configuration during development by utilizing the bacteriophage P1 -derived Cre/LoxPsystemJSternberg and Hamilton, 1981). The CRE recombinase (Causes REcombination) is a protein classified as a member of the λ integrase superfamily of site-specific recombinases (Argos et al., 1986; Sadowski, 1993) and belongs to the few members of the family which do not require cofactors or accessory proteins for recombination (Abremski and Hoess, 1984; Kilby ef al., 1993; Stark et al., 1992). The loxP sequence consists of two 13 bp inverted repeats interrupted by an 8 bp non-palindromic sequence which dictates the orientation (Hoess and Abremski, 1984; Hoess et al., 1982). When two loxP sites are placed in the same orientation on a linear DNA molecule, a CRE-mediated intramolecular recombination event results in the excision of the loxP-flanked (or floxed) sequence as a circular molecule with one loxP site left on each DNA molecule.
For the generation of the CRE-inducible PLAG1 transgenic construct we cloned a Neomycin resistance cassette (Neo cassette) flanked by two loxP sites with the same orientation between the modified actin promoter and PLAG1 cDNA (Figure 1). Because the stop codon of the Neo cassette should terminate translation, the transgenic mice obtained after microinjection will not express PLAGL To allow PLAG1 expression, the cassette can be excised simply by breeding with CRE recombinase transgenic mice.
In one of our models, the PLAG1 transgene will be activated in the organs where Cre is transcribed under the control of the MMTV LTR. Cre expression under control of the MMTV LTR has been reported to result in Cre-induced recombination in many tissues (Wagner et al., 1997). Expression of a transgene under such a control was found to be high in mammary tissue of lactating females, but it is also found in other secretory organs, such as the salivary gland, the Harderian gland, seminal vesicles and lymphoid cells. In adult MMTV-Cre mice, Cre expression and activity is detected in the salivary and mammary gland. Expression in salivary gland tissue was confined to the striated ducts. Because we were interested in the involvement of PLAG1 in salivary gland tumorigenesis and to study the pathogenetic role of PLAG1 in vivo, the MMTN LTR-Cre was our initial method of choice to get an experimental animal model. Because low level of expression of the MMTV Cre transgene in this system could not be ruled out fully and in light of the fact that such expression would lead to induction of PLAG1 expression during embryonic development, which is thought to be toxic for the embryo, we have also generated inducible, conditional transgenic mice (see below). We first crossed our PLAG1 transgenic mouse, containing PLAG1 in the OFF status with an MMTV-Cre transgenic mouse that target the expression of PLAG1 to the glandular tissue in which Cre is expressed, including the mammary gland and the salivary gland.
2.2 Results
1. Transgenic mice
We tested the expression of PLAG1 in HEK293T cells by cotransfecting the plW13 plasmids and the Cre expression vector. Western blot analysis revealed a high level of PLAG1 when these latter plasmids were cotransfected.. This was in contrast to the faint expression of PLAG1 when non-transfected cells or cells transfected with plVV13 in absence of the Cre vector. PLAG1 under the control of a strong CMV promoter is used as a positive control.
Pronuclear injection of the PLAG1 transgene was performed in two independent experiments. Potential founder animals were analyzed by PCR and Southern blot analysis on tail DNA, as described above. In the first experiment, we obtained three mice among which, one founder male (PLAG10FF1) displayed PLAG1 expression based upon PCR analysis. From the second zygote injection, a founder male (PLAG10FF2) out of 14 mice that was PLAG 1 -positive in PCR analysis. The 2 founder mice were subsequently bred to establish two independent lines of PLAG1 transgenic mouse.
PLAG10FF1 and PLAG10FF2 were independently mated with two FVB/N female mice (virgin female of 8 weeks old, TACONIC). Every two weeks each single male rotated among sets of two FVB females. This resulted in a large family of PLAG 1 -positive mice. An overview is given in the Table 1.
To induce expression of PLAG1 , LoxpNeoLoxpPLAGI -positive mice were crossed with 3 different Cre-recombinase expressing mice: MMTV-Cre, MxlCre, and Tet-O-Cre/rTta.
MMTV-CrePLAG1 line
FVB/N PLAG 1 -positive mice were crossed with offspring of the homozygous parents MMTV- LTR Cre. The offspring were tested for PLAG1 and Cre positivity by PCR (see Methods). An overview of the offspring generated until now is given in the Table 2.
Because MMTV-Cre mice express Cre preferentially in the salivary and mammary gland, double transgenic mouse theoretically should express PLAG1 at least in both of these organs. We first investigated macroscopic abnormalities and performed histological examination of these mice. 2. Pathoqenetic evaluation of the phenotype of the MMTVCrePLAGI transgenic mouse strain
1. HEAD and NECK TUMORS
We generated three virgin female mice (mmtv 2, mmtv 59 and mmtv 84) with a tumor mass at the level of the head and neck region. The first female (mmtv 2), presented with the tumor at 67 days old. It was a solid mass, estimated of 1 cm by 1.5 cm. The tumor seemed to slightly increase one week later, at 74 days old (mmtv 2). The mouse was sacrificed at that time and we observed that the female had an excitated and aggressive behaviour. Two other mice presented at 73 days (mmtv59) and 56 days (mmtv84) old had the same kind of head and neck tumor.
A solid tumor of 1 cm by 1.5 cm was resected from the neck (mmtv 2). The white tumor mass was nicely encapsulated and seemed to compress of the neighbouring tissues. Macroscopic observation showed a blood vessel connected to the normal salivary gland tissue. The tumor and this likely normal salivary gland tissue were totally resected. The other organs seemed normal in size and shape except for the bladder that presented a vesical globe with urine retention. We will focus on the bladder below since it appeared in the same way in male mice. The tumor of the mmtv 59 mouse was slightly bigger, 2 cm by 1.5 cm. The hemorrhagous tumor was not connected to the skin, was also encapsulated, and seemed to be connected to the left submandibular gland.
The tissue of the tumor was fixed in formalin 6%. Sections stained with hemalum-eosin revealed a mixed tissue pattern in a glandular tumor. Compact, as well as cystic, mucoid, myxoid and necrotic areas were present. No chondroid regions were found. The tumor is encapsulated, compressing the surrounding normal salivary gland.
We diagnosed a malignant salivary gland tumor of undetermined type. The necrotic areas are the consequence of a fast growth of this tumor: the blood supply seemed not be able to follow the tumor growth or they were secondary to vessel thrombosis in the tumor. We did not see metastasis at the macroscopic level.
We further evaluate the expression pattern of PLAG1 in several tissues by Northern Blot. In the mmtv2 female mouse we detected PLAG1 mRNA in the lung, the small intestine, and slightly in the thymus and stomach.
2. MAMMARY GLAND TUMORS
We did notice tumor formation in other organs including the mammary gland as the MMTV- LTR promoter also target this organ.
We distinguished the following histological description of adenocarcinoma's in the mammary glands of 5 mice: -Mouse 1 (02 1182): mmtv 80, Female, 37 weeks Very big tumor, largely necrotic. On one side the tumor is adjacent to a few normal mammary gland structures. A connective tissue capsule, only partially visible on the slides because of tumor size, is surrounding the tumor. Numerous large blood vessels are seen with the tumor, and some of them are thrombotic. The tumoral tissue is composed of confluent strands of round or polymorphic poorly differentiated, basophilic epithelial cells. Numerous cysts with an empty lumen or filled with blood or necrotic material are associated with these solid areas.
Several cells among basophilic cells show an obvious sebaceous differentiation. Mitotic figures are numerous.
-Mouse 2 (02 1187): mmtv 162, Female, 34 weeks
Very big tumor, developed in the dermis in the vicinity of the normal mammary gland tissue. A capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structures. The tumor has different lobules that show different growth patterns from one to another, and are separated by connective septa.
In acinar areas, cuboid epithelial pale cells with round nuclei are organized in small irregular acinar structures embedded in a loose myxomatous stroma. These areas show empty cystic structures lined by a flat epithelium. Numerous cells undergo a sebaceous differentiation.
Fusiform myoepithelial cells are a part of these areas.
Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells associated with residual acinar structures. Several cells among basophilic cells show an obvious sebaceous differentiation. The tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is very high. In some places, one observes squamous metaplasia with an atypical keratinisation or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules. This tumor seems to be a mixed tumor, previously called adenomyoepithelioma of the mammary gland.
-Mouse 3 (02 1229): mmtv 25, Female, 45 weeks
Big tumor adjacent to a small piece of normal mammary gland tissue. The tumor is arranged in thin (one cell-thick) ribbons or in nodules of epithelial cells with a cubic cytoplasm and round nucleus. Cells are polymorphic with an high anisocytosis. They form sometimes tubular structures with or without mucoid material inside. A sebaceous differentiation is seen in a few cells. Mitotic index is moderate.
- Mouse 4 (02 1230): mmtvT32.2.1, Female, 33 weeks
Big tumor adjacent on one side to a few normal mammary gland structures. A capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structure.
Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells. A great number of cells among basophilic cells show an obvious sebaceous differentiation. The tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is high. In some places, one observes squamous metaplasia with an atypical keratinization or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules. In one part of the tumor, cells are arranged in small irregular acinar structures, embedded in a loose myxomatous stroma.
- Mouse 5 (02 1277): mmtv 80, Female, 39 weeks
Very big tumor, developed in the dermis in the vicinity of the normal mammary gland tissue. A capsule of connective tissue surrounds partially the tumor, but is locally infiltrated by tumoral structures. The tumor has different lobules that show different growth patterns from one to another, and are separated by connective septa.
In acinar areas, cuboid epithelial pale cells with round nuclei are organized in small irregular acinar structures embedded in a loose myxomatous stroma. These areas show empty cystic structures lined by a flat epithelium. Numerous cells undergo a sebaceous differentiation.
Fusiform myoepithelial cells are a part of these areas.
Solid areas are composed of confluent strands or nodules of round to pleomorphic poorly differentiated, more basophilic, cells associated with residual acinar structures. Several cells among basophilic cells show an obvious sebaceous differentiation. The tumoral cells are also fusiform with an elongated pale nucleus. Mitotic index is very high. In some places, one observes squamous metaplasia with an atypical keratinisation or a comedo pattern, characterized by the central necrosis of central areas of tumor nodules.
3. OVERGROWTH
In the sixth litter we noticed a big difference in size between the littermates. Some mice developed a proportional overgrowth. Our suspicion was confirmed by weighting the littermates of all the litters at different time points: every three days in the pre-weaning stage, and once a week in the post-weaning stage. Individual and mean growth curves were made to evaluate the gain of weight, the beginning of this process and the speed of the weight increase. We also investigate if the growth onset occurs prenatally or postnatally. In addition, the overgrowth can be the result of an hypertrophy or /and to an hyperplasia at the organ level. It has been reported that PLAG1 is involved in lipoblastomas. Therefore we cannot rule out that the overgrowth is the result of an increase of adipose tissue and we measure and weigh all organs of the mice, and compare them to reference values obtained from the organs of the non-transgenic mice. We also determine the level of sugar blood, insuline calcium, lipids and cholesterol levels to explore for metabolic imbalances e.g Beckwith- Wiedemann syndrome is a disorder with both hypoglycemia (based on hyperplastic pancreatomegaly involving the islets) and overgrowth. Hypocalcemia, hypercholesterolemia and hyperlipidemia have been reported in these patients. 4. NEOPLASIA, OVERGROWTH AND IGFII
The fact that overgrowth syndromes are associated with neoplasia is not surprising since rapidly dividing cells are a prerequisite for both processes. Mitotic activity, strong pronounced during intra-uterine life, is even more amplified in overgrowth syndromes. Neoplastic cells are vulnerable to structural changes in DNA, disrupted transcription to RNA, and altered translation into protein during mitotic activity. Mitosis is also required to produce clones of altered cells that make up neoplasms.
In human diseases the association of increased body size and neoplasia has been documented in:
- Wilms tumors in association with high birth weight
- Leukemia in association with increased birth weight
- Osteosarcoma in tall persons
- Specific neoplasms have been reported with Beckwith - Wiedemann syndrome, hemihyperplasia and Sotos syndrome: especially tumors of the kidney, liver and adrenal gland
IGFII (normally absent in adulthood) is a fetal growth factor that has been reported to be upregulated in a growing number of tumors. We showed IGFII upregulation in pleomorphic adenoma overexpressing PLAG1. Indeed IGFII is a target of PLAG1. Therefore IGFII seems to be the factor causing both the tumor and the overgrowth in PLAG1 transgenic mice. In fact it is well known that IGFII stimulate cell proliferation through autocrine or paracrine mechanisms. Because the maternal allele of the IGFII gene is silenced by genomic imprinting, several different molecular errors can activate this allele and therefore increase the number of active copies of the IGFII gene. The nature and severity of the overgrowth might be dependent on the number and location of cells that carry the molecular defect.
In our transgenic mouse model, we look for circulating IGFII amounts in the mouse serum to confirm its overexpression and secretion. In all the organs we study the correlations of IGFII and PLAG1 expression by Northern Blot. The lack of link between some syndromes (Beckwith -Wiedeman syndrome, Prader Willy syndrome and Neoplasm) and IGFII upregulation can be due to the mechanism of imprinting. Many imprinted genes are clustered and constitute a relatively large imprinted chromosomal domain. The human chromosome 11 syntemic to the mouse chromosome 7. The region 11p15.5 is well known to be imprinted. Mutations or alterations in this region are associated with human diseases like Beckwith -Wiedeman syndrome (BWS) that is characterised by prenatal overgrowth and predisposition to tumors including embryonal tumors such as Wilms tumor, hepatoblastoma and rhabdomyosarcoma, as well as a variety of adult tumors. At least ten imprinted genes in 11p15.5 have been identified and characterized including the paternally IGFII and the maternally IPL, p57 KIP2 and H19 transcribed genes and these and others are candidates for involvement in Wilms' tumorigenesis. These genes that are also target of PLAG1 can therefore contribute to the PLAG1 transgenic phenotypes. Some of the imprinting genes in the 11p15.5 region, IGFII which is paternally transcribed, showed loss of imprinting in 70 % of Wilms' tumors and in about 50% of all adult cancers.
Transgenic mice with upregulation of IGFII expression show features of BWS, but neither exomphalmos nor a predisposition to tumors.
H19, is maternally transcribed and codes for an RNA without an open reading frame. It can be growth suppressive in some cell types and shows epigenetic biallelic silencing in some Wilms' tumors with Lost of imprinting (LOI) of IGFII.
P57KIP2, is a cyclin-dependent kinase inhibitor. This gene shows mutations in 5-17 % of the BWS patients and a reduced expression in some Wilms tumors. Targeted disruptions of P57KIP2 in mice exhibits some aspects of BWS resulting in abdominal muscle defects and kidney dysplasias, but does not show any features of Wilms' and other embryonic tumors. Therefore IGFII, H19, p57KIP2 can account for some Wilms' tumors and other tumors. IGF-II is located in an imprinting region in the chromosome 11p15.5. The gene is transcribed only from the paternal allele. Indeed the maternal allele is silent during the whole embryogenesis. Our previous experiments on DNA microarrays have shown that upregulation of IGF-II in PLAG1 transfected cells is accompanied by an increase of the transcription of others genes, mainly IPL, p57KlP2 and H19, located in the 11p15.5 region. These genes encompass a 1 Mb region where it has been postulated to be present an Imprinting Center. IGF-ll gene contains several promoters, among them E3 and E4 promoters, present 8 PLAG1 response elements; promoter E1 contains 6 of them. This high number of PLAG1 motifs could explain the upregulation of IGF-ll by PLAG1. Nevertheless, it is unlikely that the upregulation of the other genes in the 11p15.5 region is the result of the activation, by PLAG1, of each of the respective promoter. Indeed a search of PLAG1 response element failed to show the presence of these motifs beside the IGF-II promoters. We believe that a common mechanism, mainly imprinting, disturbs the transcription of the genes located in the region 11p15.5 including IGFII. PLAG1 could affect directly or indirectly the methylation status of the Imprinting Center leading to the activation of the alleles that are normally silenced.
Because IGF-II gene is only expressed from the paternal allele, IGF-II heterozygous KO mice having only the paternal gene disrupted, reach 60% of the normal birth weight. On the contrary IGF-II heterozygous KO mice having the maternal gene disrupted have a normal birth weight. This epigenetic modification on the IGF-II gene allows us to validate our hypothesis. For that we first cross an IGF-II KO male with a female PLAG1 transgenic mouse. The overexpression of PLAG1 in this kind of KO mice reverts the dwarf phenotype only if PLAG1 is abolishing the methylation in the IGF-II maternal allele.
In addition we perform parallel studies of the imprinting status of IPL, p57κιp2 and H19 by checking for their biallelic expression in PLAG1 transgenic mice. For that we cross-inbred mice having different polymorphisms at the level of these three genes. In our transgenic mouse model, the tumors are analysed for PLAG1 expression as well as PLAG1 targets expression on northern blot analysis. Micro-array experiments on these tumors confirm upregulation of PLAG1 targets in vivo.
5. ABDOMINAL DISTENSION
Beside the salivary gland tumor, MMTV-Cre/PLAG1 transgenic mice presented an important retention of urine in the bladder as well as gastro-intestinal blockage due to faeces retention. This phenotype has been observed already in very young puppies and is severe in adulthood. Beside the tumor, the transgenic mice highly expressed PLAG1 transcripts in the bladder, thymus and duodenum. A lower expression was observed in the caecum. This phenotype can be the result of a neurological disorder at the level of the bladder and gastro-intestinal sphincters. It has been described that relaxation of the sphincter is mediated by acetylcholine through the muscarinic receptors M3. We investigate if the muscles of these sphincters are not responding to nerve stimulation by performing an electromyography (EMG) test. This test evaluates the sphincter muscle weakness and determines if the weakness is related to the muscles themselves or a problem with the nerves that supply the muscles. We inject the mice with carbachol, an agonist of acetylcholine. This relaxes the sphincter muscles allowing urine and faeces evacuation. Carbachol, which is an unsubstituted carbamoyl ester, is totally resistant to hydrolysis by either acetylcholinesterases or nonspecific cholinesterases; their half- lives are thus sufficiently long that they are distributed to areas of low blood flow. In addition, among the acetylcholine agonist, carbachol acts with some selectivity on gastrointestinal tract and urinary bladder motility.
3. Generation and characterization of PLAG 1 and/or PLAG L2 knockout mice General strategy to generate the Plagl knockout mouse
The strategy used for the generation of the Plagl knockout mouse was the replacement of the complete open reading frame of Plagl by the LacZ reporter gene. Replacement the Plagl gene by the reporter gene allows us, in a relatively simple manner, to obtain more detailed knowledge about the expression pattern of the Plagl gene. A targeting DNA construct, carrying the LacZ gene and a selectable marker (the neomycine resistance gene) flanked by sequences homologous to the genomic Plagl gene, was constructed (pKH23). For more details of the design and generation of the construct, see below. The DNA construct also contains the HSV-tk gene which lies outside the 5' and 3' homologous flanking regions. This construct was introduced in the R1 embryonic stem cell line (43) by transfection. Mouse ES cells are pluripotent cells derived from the inner cell mass of a 3.5 day old mouse blastocyst. The Plagl homologous flanking sequences enable targeted insertion into the Plagl gene and, consequently, the LacZ gene and the selectable marker replaces the original wild-type sequence. Since the frequency of homologous recombination is very low relative to random integration, a positive-negative selection procedure is used to select the ES cell clones in which the proper recombination has occurred. The cells that have integrated pKH23 will survive when grown in medium containing neomycin. A negative selection step is used to kill the cells that contain randomly integrated pKH23 since cells harboring the HSV-tk gene will be killed by culturing them in medium containing gancyclovir. It should be noted that the HSV-tk gene will be lost during homologous recombination, but will be retained in cases of a random integration event. The successfully targeted ES cell line is reintroduced into wild-type blastocysts isolated from Swiss Webster mice (Taconic) and, subsequently, these blastocysts are implanted into pseudopregnant foster mothers. Since these ES cells remain pluripotent following culture and in vitro manipulation, they can contribute in the development of all tissues of the embryo, including the germline. As a result of this all, chimeric animals may be born and these can be easily identified by their black and white spotted coat color. This results from the fact that the R1 ES cells are derived from a mouse with a dark coat color which were injected in blastocysts from mice with a white coat color. If the embryonic stem cells contributed to the development of the germ cells, the chimeric mouse can pass the mutated Plagl allele on to subsequent generations. Therefore, the chimeric mouse is mated to wild-type Swiss mice containing a white coat color. Germline transmission is easily identified since the result of it leads to dark pups. Finally, interbreeding of Plag1+I" hemizygous siblings yields mice that are homozygous for the desired Plagl mutation.
Molecular cloning of mouse genomic DNA containing the Plagl gene
Genomic clones containing the Plagl gene were initially isolated from a commercially available genomic library constructed in the pBeloBACH vector (Genome systems) with DNA from the 129SvJ mouse strain which is isogenic with the available ES cell line (R1) used in our experiments. Evidence has been presented that the use of isogenic DNA is a determining factor in the observed frequency of recombination events. Screening the library with a human PLAG1 DBD probe (described in the Material and Methods section) yielded two independent clones containing sequences of the Plagl gene, i.e. BAC 450d6 and BAC 347b3. Pulsed field gel electrophoresis was used to map a number of restriction sites and to determine the position and the relative orientation of the Plagl gene in the vector. Complete digests with different restriction enzymes were analyzed by Southern blot analysis using cDNA probes corresponding to exon 4 (human PLAG1 DBD), exon 5 (human PLAG1 TAD) and exonl of PLAG1 (pEM 117). The results of this analysis indicated that both BAC clones contained the 5'-end of the Plagl gene, including the promoter region, but only BAC 347b3 covered the complete gene. This clone was used for further analysis and in experiments involving homologous recombination in ES cells.
Suitable restriction fragments of BAC 347b3 were subcloned in the pGEM3Zf(+) vector using either EcoRI or Hindlll digests. Sequencing of these subclones and alignment of these sequences yielded a contig containing a partial mouse Plagl cDNA of 1575 bp (Genbank Accession N° AF057366). The encoded protein, mouse Plagl, consists of 500 amino acids. Comparison of this putative mouse Plagl protein to its human homologue reveals overall amino acid sequence identity of 95% (data not shown).
The Plagl gene targeting vector to generate knockout mice.
To generate a Plagl targeting vector for the generation of knockout mice, the following cloning strategy was followed as illustrated in Figure 2. From a p/ag/1 -containing BAC clone, a 4 kb Hindlll fragment, containing exon 3 to the first part of exon 5, was subcloned in the pGEM3Zf(+) vector (designated pKH13). An internal deletion, removing AA 2-130 of Plagl, was obtained via digestion of pKH13 with Mscl and Sail, subsequent creation of blunt ends with a fill in reaction using Klenow DNA polymerase and, finally, a religation reaction i (designated pKH17). Afterwards, the LacZ reporter gene, except for its first ATG, was fused in frame to the initiation codon of p/ag1 by ligating a Nrul/Kpnl fragment, isolated from the pSDKLacZpA vector (a gift from Dr. Janice Rossant, university of Toronto, Canada) in a blunt- ended Xbal/Kpnl site of pKH17, and this clone was designated pKH18. Finally, this 5' Plagl targeting region, containing the LacZ gene and 3 kb immediately upstream of the ATG of p/ag1 i was cloned as a blunt-ended Hindlll/Xhol fragment into the Hpal/Xhol site of the pKO scrambler vector (Lexicon Genetics, Texas) (designated pKH19). Subsequently, the 3' Plagl targeting region was inserted into pKH19 To achieve this, a 3 kb Hindlll fragment extending from the beginning of the 3' untranslated region of Plagl, was isolated from the same BAC and cloned in the Hindlll site of the recombinant pKO scrambler vector pKH19, described above.
) Subsequently, a neomycine (neo) resistance gene and a thymidine kinase(TK) gene were introduced as a positive and negative selection marker, respectively. Prior to electroporation of the targeting vector DNA, the construct was linearised at a unique Notl site and purified with the Qiagen gel extraction kit (Qiagen).
5 Targeting of the Plagl gene in ES cells
To generate the targeting construct, DNA of BAC 347b3 was used as starting material. From its insert DNA, a 3 kb Hindlll/Mscl fragment was obtained as the 5' homology region and a 3 kb Hindlll fragment, as the 3' homology region of Plagl. Both fragments were subcloned in the proper orientation in the pKO scrambler vector (Lexicon) and, subsequently, the LacZ reporter gene, without its ATG, was cloned in frame to the 5' homology region. A positive selection marker, the neomycin resistance cassette in which the neomycin phosphotransferase gene is driven by the PGK promoter (Lexicon), was placed in between the 5' and 3' homology region. The HSV-tk gene (Lexicon) was used as a negative selection marker, and it was placed outside the 5' and 3' homologous flanking regions.
Prior to introduction into ES cells, the targeting DNA construct was linearized at a unique Notl site and, thereafter, it was introduced into the cells by electroporation. Cells surviving electroporation were grown in selective medium containing neomycin and gancyclovir for about eight days. Of the surviving colonies, 250 were selected and further expanded. In the first screening round, all 250 colonies were tested by PCR analysis using sense primer mP1KH26- up, located outside the 5' recombination region, in combination with LacZ2-down, located in the coding region of LacZ. Only when proper homologous recombination had occurred, the PCR amplification generated a 4 kb fragment. By this criterion, 5 out of the 250 ES cell lines targeted at the Plagl gene were obtained. A confirmative screening of these 5 colonies was performed by Southern blot analysis. Ten microgram of genomic DNA was digested with BamHI and analyzed with a radiolabeled probe (pKH15 insert) located in the 3' flank of the targeting vector. This probe hybridizes to a 9 kb BamHI fragment of the wild-type Plagl allele and a 6.5 kb fragment of the targeted Plagl allele. In addition, genomic DNA of the same clones was digested with Xbal and analyzed with a radiolabeled probe (pKH17 insert) located in the 5' flank of the vector which detects a 8 kb wild-type Xbal fragment and a 7 kb fragment corresponding to the targeted allele. All five clones showed the expected restriction pattern resulting from a homologous recombination, which equals an overall frequency of recombination of about 2%.
Germline transmission of the targeted Plagl gene
To obtain mouse strains in which one Plagl allele was altered by the homologous recombination, cells from two ES cell lines were injected independently into Swiss Webster blastocysts and both resulted in offspring consisting of chimeric mice based on their color coat. Of 8 male chimeric mice obtained, seven showed very low degree of chimerism, varying from 5% to 30%, and these were not able to transmit the targeted Plagl allele. In addition, no germline transmission was obtained with three female chimeric mice. Cells of one genetically engineered cell line produced one chimeric male which possessed a brown-white coat color of more than 80%. Breeding this chimeric mouse with a wild-type Swiss Webster revealed that, based on coat color, it was a 100% transmitter. A total of 49 agouti pups were analyzed by PCR on tail tip genomic DNA with primers located in the LacZ gene and the wild-type Plagl gene (see Material and Methods). This led to the identification of 13 male and 11 female hemizygous Plagl*1' m\ce, which displayed no immediately obvious major aberrations in their phenotype.
Viability of Plagf'' mice
Hemizygous Plag1+I' mice were mated to obtain homozygous Plagl null mutant mice. Their offspring was genotyped three weeks after birth. In total, 214 pups of hemizygous Plagl*1' couples were analyzed by PCR analysis of tail tip genomic DNA. 55 Plagl*'* (26%), 106 Plagl*1' (49%) and 53 Plagl'1' (25%) mice were identified, which reflects a normal Mendelian distribution. This result clearly indicated that inactivation of both alleles of the Plagl gene does not result in embryonic lethality. The mating of the Plagl*1' mice demonstrated that six couples produced litter sizes of between 7 and 13 pups, with an average of 10 pups per litter. The sex ratio of the offspring was 46% males and 54% females.
At this moment, we have observed that the Plagl'1' mice die earlier than their wild-type counterparts but not all at a particular time in their life. 21% of the Plagl-/- mice already died during the first 7 months after birth compared to 0% of the wild-type mice. We suspect that particular heart problems may be a possible cause of this phenomenon and this is currently under investigation.
Verification of the absence of Plagl expression in homozygous Plagf1' null mutant mice To ensure that Plagl expression was really absent in Plagf'' null mutant mice during embryonic development, PCR was performed on cDNA prepared from wild-type, Plagf'* hemizygous and Plagf'' null mutant embryo's of 15.5 days post-coitum (dpc). A primer pair was used (mPLAGI tail-up and low), flanking intron 4 of Plagf wich generates a 500 bp fragment on Plagl cDNA and a 1 kb fragment on genomic DNA. In this way, we could discriminate between Plagl expression and contamination of genomic DNA in the samples. The results indicated that Plagf'' null mutant mice failed to express the normal Plagl mRNA, while the endogenous Plagl transcript was easily detected in Plagl*'* and Plagf'* hemizygous mice. In contrast, the β- galactosidase transcript was only detected in the Plagf'' null mutant mice and the Plagf +hemizygotes but was absent in wild-type mice (data not shown).
Phenotype of Plagf'' mice
Plagf'' mice are reduced in body weight
Among the progeny of hemizygous Plagl*1' breeding couples, there were animals with considerably smaller body size. Genotyping the mice revealed that the normal sized pups were all Plagl*'* and Plagl*'' mice, whereas the smaller pups were all homozygous for the disrupted
P/ag7 allele. The postnatal growth curves of the Plagl*1* and Plagf'' null mutant mice showed that, at the moment of birth, the Plagf'' null mutants exhibited a 30% decrease in body weight as compared to the Plagl*1* mice. In addition, the rate of weight gain of the homozygous null mutants was lower as compared to that of the other littermates, and by 21 days, their body weight was only half that of the controls. However, after weaning, the growth rate returned to normal but the weight of the adult mice remained lower than normal (60%). Homozygous Plagf1' mice could also be recognized by the fact that they opened their eyes several days later after their Plagl*'* or Plagf'* littermates, some even one week after weaning. Out of 53 homozygous Plagf1' mutants, four mice died already; 3 of them between 4 and 7 weeks of age and one at 18 weeks of age. However, by examination, no macroscopic anomalies could be detected. In contrast, all 55 Plagl*'* mice are still alive. Apart from their small size, surviving Plagf'' null mutant mice seem to be normal at first glance and have reached sexual maturity. Fertility of Plagf'' mice
We further determined whether, in addition to retarded growth, a reduced fertility at the Plagf'' null mutants could be observed. After 8 weeks of age, male and female Plagf'' null mutants were challenged for mating with P/ag7+ "hemizygous or Plagf'' homozygous mutant partners. Out of 3 breeding pairs, composed of Plagl "'" males with Plagf' females, only 1 litter of 5 pups was obtained in a time period of 4 months. In the same time period, 2 breeding pairs, composed of Plagf'' females with Plagl*1' males, could only produce 2 litters with litter sizes ranging between 7 and 8 pups. In addition, 3 homozygous Plagf1' breeding couples failed to reproduce any litters in the same time period of 4 months. Although these results are still preliminary, they tentatively suggest a reduced fertility in Plagf'" null mutants. However, further studies are needed to firmly establish this phenotypic aspect.
Evaluation of offspring after breeding of Plag -/- mice in a 129SveV genetic background To allow evaluation of the contribution of the variable genetic background to the phenotype observed so far, Plagf'' mutant mice were bred in the homogenous and known genetic background of the 129/Sv strain. Therefore, the 80% chimeric male has been mated to wild- type 129/SvEv females. At present, we have obtained 9 Plagf' hemizygous pups and this allowed us to select 3 breeding pairs, each composed of a Plagf' hemizygous male and female. Genotyping the still limited number of only 22 pups of the F2 generation at 21 days of age, demonstrated a small distortion of the Mendelian inheritance of the null allele, with only 18% rather than the expected 25% of Plagf1' mice recovered. Whether or not some of the Plagf'' null mutant mice die before or shortly after birth still needs to be investigated. However, we have to be very careful with the interpretation of these results since there is a distinct possibility that the total number of pups analyzed so far is too limited. Importantly, the surviving Plagf1' mice in these experiments also showed a retarded growth, with the weight of the adult P/ag7"A mice 40% lower than normal Plagf* wild-type mice. Analysis of Plagl expression in vivo
A restricted number of human adult and fetal tissues were previously studied for PLAG1 expression using Northern blot analysis. These results indicated that PLAG1 is mainly expressed during embryonic development and that expression could not be detected in adult tissues in this way. However, it should be noted that in a contradictory rapport PLAG1 expression was detected in several adult tissues like heart, placenta, spleen, prostate, testis, ovary and small intestine. Because the expression pattern of the gene is of major importance to understand its role in development, we have studied the expression of the Plagl gene in mouse by several approaches.
Northern blot analysis
To establish in general terms whether Plagl is also mainly expressed during mouse embryonic development, total RNA was prepared from embryos in various stages of development, i.e. of 9.5 dpc until birth. Within the sensitivity of Northern blot analysis, a 7.5 kb transcript was detected as early as 11.5 dpc and this expression was found in all embryos tested until birth. After birth, overall expression of Plagl declined readily. When a variety of tissues of adult mice were tested by Northern blot analysis for P/ag7 expression, weak expression was observed in heart, testis and ovarium, while expression in other tissues remained under the detection level or might be absent. These results are not completely consistent with the human data. In conclusion, this relatively high level of expression of P/ag7 during mouse embryonic development confirms the hypothesis that the gene might have an important role in mammalian development.
Evaluation of the LacZ expression pattern in the genetically engineered hemizygous Plagl mice
An alternative approach to evaluate the expression pattern of the P/ag7 gene is to study the LacZ expression pattern in the hemizygous P/ag7 mice, in which one P/ag7 allele was replaced by the LacZ gene in such a way that expression of the latter was under control of the P/ag7 promoter. Expression of LacZ in a developing mouse embryo can be monitored by X-gal staining. Therefore, hemizygous P/ag7 males were crossed to wild-type Swiss females and the resulting embryos were assayed for LacZ expression by whole mount X-gal staining. Whole mount analysis was performed on embryos of developmental stages ranging between 8.5 dpc (4-15 somite stage of embryogenesis) and 14.5 dpc (late organogenesis). Our results revealed that, apparently, a general widespread expression occurs based on the observed, persisted staining through all stages of development. Despite the general expression at 8.5 dpc, a clear staining of the somites and the notochord could be visualized. In embryonic stages ranging from 9.5 dpc to 11.5 dpc, intense staining was detected in all tissues. However, staining for a shorter period indicated that LacZ expression levels were not uniform throughout the embryo at the stages of 10.5 and 11.5 dpc. In embryos of 10.5 dpc, a slightly more intense staining was observed in the lens pit, the limb buds and the first and second branchial arch. At 11.5 dpc, staining was clearly detected in the telencephalic vesicle, the snout, the limb buds inclusive the apical ectodermal ridge, dorsal ganglia and neural tube (data not shown). The same pattern of expression persisted in the embryonic stages of 12.5 dpc, 13.5 dpc, and 14.5 dpc. In addition to the weak general expression of LacZ, more pronounced expression was observed in cartilage of the ear, the snouth including the follicles of the vibrissa, mesenchymal cells surrounding the eye, the developing limbs, the genital tubercle, and the tail. Interestingly, P/ag7 is also strongly expressed at sites where hair follicles begin to form at stage 13.5- 14.5dpc. A more detailed photograph of the forelimb reveals strong P/ag7 expression in the hand plate, the cartilage primordia of the developing bones in the digits, and the apical ectodermal ridge. It should be noted that these whole mount results should be substantiated by further experiments in which the LacZ expression pattern is studied by X-gal staining of embryonic sections.
RNA in situ hybridizations
In addition to Northern blot analysis and whole mount LacZ staining, in situ hybridization analysis was also used as an additional approach to study P/ag7 expression. Preliminary data were obtained from in situ hybridization studies of sections of wild-type mouse embryos at developmental stages of 11.5, 12.5, 15.5 and 16.5 days post-implantation. Sections were hybridized with a ^S-labeled antisense RNA probe corresponding to the TAD of mouse P/ag7 fpKH3 insert). No significant signals were detected in control experiments using the sense probe (data not shown). The data obtained from the in situ hybridization studies of sections of 11.5 and 12.5 dpc embryos confirmed the results of a widespread expression by whole mount LacZ staining. Besides this, a more pronounced expression was observed in the mesonephros, duodenum, lung, cartilage primordium of vertebra, and the mouth region at 11.5 dpc. At 12.5 dpc, additional stronger expression was observed in the notochord, ependymal layer, lung, limbs and the tail. Despite the rather general P/ag7 expression pattern during early embryogenesis, the expression became more restricted to different organs in later stages of development. At 15.5 dpc, P/ag7 was more expressed in the pituitary, thymus, oesophagus, primordia of follicles of the vibrissae, and the tip of the tongue. At 16.5 dpc, strong expression was observed in primordia of follicles of the vibrissae, primordia of the teeth, ovarium, and the interdigital mesenchyme. However, more sections need to be evaluated to more fully establish the expression pattern of P/ag7. Tables
Table 1. Overview of PLAG1 -positive mice from the two zygote injection experiments
Figure imgf000036_0002
Table 2. Overview of MMTN-Cre/PLAG1 -positive mice
Figure imgf000036_0003
Figure imgf000036_0001
FVB/Ν PLAG1 positive mice derived from PLAG1OFF1 or PLAG10FF2 were crossed with MMTV-LTR/Cre positive mice. The cross involving PLAG10FF1 gave 38 males and 47 females double transgenic mice MMTV-LTR/Cre/PLAGI, out of 176 pups. The cross involving ) PLAG10FF2 produced 5 males and 1 female double transgenic mice MMTV-LTR/Cre/PLAGI out of 23 pups. References
Abdollahi, A., Bao, R. and Hamilton, T.C. (1999) LOT1 is a growth suppressor gene down- regulated by the epidermal growth factor receptor ligands and encodes a nuclear zinc-finger protein. Oncogene, 18, 6477-87. Abdollahi, A., Godwin, A.K., Miller, P.D., Getts, LA, Schultz, D.C., Taguchi, T., Testa, J.R. and Hamilton, T.C. (1997a) Identification of a gene containing zinc-finger motifs based on lost expression in malignantly transformed rat ovarian surface epithelial cells. Cancer Res,
57, 2029-34. Abdollahi, A., Roberts, D., Godwin, A.K., Schultz, D.C., Sonoda, G., Testa, J.R. and Hamilton,
T.C. (1997b) Identification of a zinc-finger gene at 6q25: a chromosomal region implicated in development of many solid tumors. Oncogene, 14, 1973-9. Abremski, K. and Hoess, R. (1984) Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein. J Biol Chem, 259, 1509-14. Adams, J.M. and Cory, S. (1991 ) Transgenic models of tumor development. Science, 254,
1161-7. Argos, P., Landy, A., Abremski, K., Egan, J.B., Haggard-Ljungquist, E., Hoess, R.H., Kahn,
Ml., Kalionis, B., Narayana, S.V., Pierson, L.S., 3rd and et al. (1986) The integrase family of site-specific recombinases: regional similarities and global diversity. Embo J, 5, 433-40. Astrom, A., D'Amore, E.S., Sainati, L., Panarello, O, Morerio, C, Mark, J. and Stenman, G.
(2000) Evidence of involvement of the PLAG1 gene in lipoblastomas. Int J Oncol, 16, 1107-
10. Astrom, A.K., Voz, M.L., Kas, K., Roijer, E., Wedell, B., Mandahl, N., Van de Ven, W., Mark, J. and Stenman, G. (1999) Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SI I as a new fusion partner gene [In Process Citation]. Cancer Res, 59, 918-23. Bilanges, B., Varrault, A., Basyuk, E., Rodriguez, C, Mazumdar, A., Pantaloni, O, Bockaert,
J., Theillet, O, Spengler, D. and Journot, L. (1999) Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors. Oncogene, 18,
3979-88. Choi, Y.W., Henrard, D., Lee, I. and Ross, S.R. (1987) The mouse mammary tumor virus long terminal repeat directs expression in epithelial and lymphoid cells of different tissues in transgenic mice. J Virol, 61 , 3013-9. Collet, B. and Secombes, C.J. (2001) The rainbow trout (Oncorhynchus mykiss) Mx1 promoter. Structural and functional characterization. EurJ Biochem, 268, 1577-84. Daphna-lken, D., Shankar, D.B., Lawshe, A., Ornitz, D.M., Shackleford, G.M. and MacArthur,
CA. (1998) MMTN-Fgfδ transgenic mice develop mammary and salivary gland neoplasia and ovarian stromal hyperplasia. Oncogene, 17, 2711-7. Darbre, P., Page, M. and King, R.J. (1986) Androgen regulation by the long terminal repeat of mouse mammary tumor virus. Mol Cell Biol, 6, 2847-54. Dardick, I., Ho, J., Paulus, M., Mellon, P.L. and Mirels, L. (2000) Submandibular gland adenocarcinoma of intercalated duct origin in Smgb- Tag mice. Lab Invest, 80, 1657-70. Donjacour, A.A., Thomson, A.A. and Cunha, G.R. (1998) Enlargement of the ampullary gland and seminal vesicle, but not the prostate in int-2/Fgf-3 transgenic mice. Differentiation, 62,
227-37. Furth, P.A., St Onge, L., Boger, H., Gruss, P., Gossen, M., Kistner, A., Bujard, H. and
Hennighausen, L. (1994) Temporal control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc NatlAcad Sci U S A, 91 , 9302-6. Hammer, R.E., Pursel, V.G., Rexroad, C.E., Jr., Wall, R.J., Bolt, D.J., Ebert, K.M., Palmiter,
R.D. and Brinster, R.L. (1985) Production of transgenic rabbits, sheep and pigs by microinjection. Nature, 315, 680-3. Hawley, R.G., Lieu, F.H., Fong, A.Z. and Hawley, T.S. (1994) Versatile retroviral vectors for potential use in gene therapy. Gene Ther, 1, 136-8. Hibbard, M.K., Kozakewich, H.P., Dal Cin, P., Sciot, R., Tan, X., Xiao, S. and Fletcher, J.A.
(2000) PLAG1 fusion oncogenes in lipoblastoma. Cancer Res, 60, 4869-72. Hinrichs, S.H., Fontes, J.D., Bills, N.D. and Schneider, P.D. (1991) Transgenic models of human cancer. Princess Takamatsu Symp, 22, 259-74. Hoess, R.H. and Abremski, K. (1984) Interaction of the bacteriophage P1 recombinase Cre with the recombining site loxP. Proc NatlAcad Sci U SA, 81 , 1026-9. Hoess, R.H., Ziese, M. and Sternberg, N. (1982) P1 site-specific recombination: nucleotide sequence of the recombining sites. Proc NatlAcad Sci U SA, 79, 3398-402. Huang, S.M. and Stallcup, M.R. (2000) Mouse Zad , a transcriptional coactivator and repressor for nuclear receptors. Mol Cell Biol, 20, 1855-67. Kas, K., Voz, M.L., Hensen, K., Meyen, E. and Van de Ven, W.J.M. (1998) Transcriptional activation capacity of the novel PLAG family of zinc finger proteins [In Process Citation]. J
Biol Chem, 273, 23026-32. Kas, K., Voz, M.L., Roijer, E., Astrom, A.K., Meyen, E., Stenman, G. and Van de Ven, W.J.
(1997) Promoter swapping between the genes for a novel zinc finger protein and beta- catenin in pleiomorphic adenomas with t(3;8)(p21 ;q12) translocations. Nat Genet, 15, 170-
4. Kilby, N.J., Snaith, M.R. and Murray, J.A. (1993) Site-specific recombinases: tools for genome engineering. Trends Genet, 9, 413-21. Kistner, A., Gossen, M., Zimmermann, F., Jerecic, J., Ullmer, O, Lubbert, H. and Bujard, H.
(1996) Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc NatlAcad Sci U SA, 93, 10933-8. Kuhn, R., Schwenk, F., Aguet, M. and Rajewsky, K. (1995) Inducible gene targeting in mice.
Science, 269, 1427-9. Mangues, R., Seidman, I., Pellicer, A. and Gordon, J.W. (1990) Tumorigenesis and male sterility in transgenic mice expressing a MMTV/N- ras oncogene. Oncogene, 5, 1491-7. Nagy, A. (2000) Cre recombinase: the universal reagent for genome tailoring. Genesis, 26, 99-
109. Piras, G., El Kharroubi, A., Kozlov, S., Escalante-Alcalde, D., Hernandez, L., Copeland, N.G.,
Gilbert, D.J., Jenkins, N.A. and Stewart, C.L. (2000) Zad (Lot1), a potential tumor suppressor gene, and the gene for epsilon-sarcoglycan are maternally imprinted genes: identification by a subtractive screen of novel uniparental fibroblast lines. Mol Cell Biol, 20,
3308-15. Queimado, L., Lopes, O, Du, F., Martins, O, Bowcock, A.M., Soares, J. and Lovett, M. (1999)
Pleomorphic adenoma gene 1 is expressed in cultured benign and malignant salivary gland tumor cells. Lab Invest, 79, 583-9. Saam, J.R. and Gordon, J.I. (1999) Inducible gene knockouts in the small intestinal and colonic epithelium. J Biol Chem, 274, 38071-82. Sadowski, P.D. (1993) Site-specific genetic recombination: hops, flips, and flops. Faseb J, 7,
760-7. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc NatlAcad Sci U SA, 74, 5463-7. Sell, O, Dumenil, G., Deveaud, O, Miura, M., Coppola, D., DeAngelis, T., Rubin, R.,
Efstratiadis, A. and Baserga, R. (1994) Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol Cell
Biol, 14, 3604-12. Sell, O, Rubini, M., Rubin, R., Liu, J.P., Efstratiadis, A. and Baserga, R. (1993) Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulin-like growth factor receptor. Proc Natl Acad Sci U S A, 90, 11217-21. Spengler, D., Villalba, M., Hoffmann, A., Pantaloni, O, Houssami, S., Bockaert, J. and Journot,
L. (1997) Regulation of apoptosis and cell cycle arrest by Zad , a novel zinc finger protein expressed in the pituitary gland and the brain. Embo J, 16, 2814-25. Stark, W.M., Boocock, M.R. and Sherratt, D.J. (1992) Catalysis by site-specific recombinases.
Trends Genet, 8, 432-9. Sternberg, N. and Hamilton, D. (1981) Bacteriophage P1 site-specific recombination. I.
Recombination between loxP sites. J Mol Biol, 150, 467-86. Toretsky, J.A. and Hel an, L.J. (1996) Involvement of IGF-II in human cancer. J Endocrinol,
149, 367-72. Varrault, A., Ciani, E., Apiou, F., Bilanges, B., Hoffmann, A., Pantaloni, C, Bockaert, J., Spengler, D. and Journot, L. (1998) hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc NatlAcad Sci U S A, 95, 8835-40.
Voz, M.L., Agten, N.S., Van de Ven, W.J. and Kas, K. (2000) PLAG1 , the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II. Cancer Res, 60, 106-13.
Voz, M.L., Astrom, A.K., Kas, K., Mark, J., Stenman, G. and Van de Ven, W.J. (1998) The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter. Oncogene, 16, 1409-16.
Wagner, K.U., Wall, R.J., St-Onge, L, Gruss, P., Wynshaw-Boris, A., Garrett, L, Li, M., Furth, P.A. and Hennighausen, L. (1997) Cre-mediated gene deletion in the mammary gland. Nucleic Acids Res, 25, 4323-30.

Claims

Claims
1. A non-human transgenic animal comprising the PLAG1 and/or PLAGL2 transgene(s).
2. A non-human transgenic animal according to claim 1 wherein the expression of said transgene(s) is regulated by the mouse mammary tumor virus promotor, the Mx1 promotor or a tetracycline inducible system.
3. A non-human animal wherein at least one allele of the gene(s) encoding for PLAG1 and/or PLAGL2 is (are) inactivated.
4. A non-human animal according to claim 3 wherein the complete open reading frame of PLAG 1 and/or PLAGL2 is replaced by a heterologous gene.
5. A non-human animal according to claims 1-4 wherein said animal is a mouse.
6. Use of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids for the manufacture of a diagnostic tool to diagnose urine/faeces retention, growth and/or growth-related disorders, mammary gland tumors, heart disorders and/or reduced fertility.
7. Use of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids for the manufacture of a medicament to treat growth disorders, heart disorders and/or reduced fertility.
8. Use of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids in a method to screen for molecules which interfere with PLAG 1 and/or PLAGL2 biological activity comprising the following steps:
-incubating a mixture comprising PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and at least one molecule,
-allowing binding between PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids and said molecule,
-isolating said molecule binding to PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids, and
-determining the ability of said molecule to interfere with PLAG1 and/or PLAG L2 biological activity.
9. A method for the production of a pharmaceutical composition comprising the usage of PLAG 1 and/or PLAGL2 proteins or nucleic acids encoding said proteins or fragments or variants of said proteins or nucleic acids according to claim 7 and further more mixing said molecule identified, or a derivative or homologue thereof, with a pharmaceutically acceptable carrier.
10. Use of compounds interfering with the expression of target genes of PLAG 1 and/or PLAGL2 or interfering with the biological activity of the proteins encoded by said target genes for the manufacture of a medicament to treat urine/faeces retention, mammary gland tumors and/or overgrowth-related disorders.
11. Use according to claim 10 wherein said target genes are genes encoding for the proteins chosen from the group consisting of: RNCC, H19, IGF-II, KIP-2, HUMECK, Filamin, ESP1/CRP2, IPL and Synapsin.
PCT/EP2003/050404 2002-09-12 2003-09-12 Use of plag or plag-inhibitors to diagnose and/or treat disease WO2004023869A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003296309A AU2003296309A1 (en) 2002-09-12 2003-09-12 Use of plag or plag-inhibitors to diagnose and/or treat disease

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP02078803.0 2002-09-12
EP02078803 2002-09-12
EP02079700 2002-11-08
EP02079700.7 2002-11-08

Publications (1)

Publication Number Publication Date
WO2004023869A1 true WO2004023869A1 (en) 2004-03-25

Family

ID=31995532

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/050404 WO2004023869A1 (en) 2002-09-12 2003-09-12 Use of plag or plag-inhibitors to diagnose and/or treat disease

Country Status (2)

Country Link
AU (1) AU2003296309A1 (en)
WO (1) WO2004023869A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117965638A (en) * 2024-01-31 2024-05-03 复旦大学附属中山医院 Construction method and application of spontaneous hyperuricemia model of UOX gene knockout mouse

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0825198A1 (en) * 1996-08-22 1998-02-25 K.U. Leuven Research & Development Plag gene family and tumorigenesis
WO2003073105A2 (en) * 2002-02-28 2003-09-04 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Use of plag1 and plagl2 in cancer diagnosis and drug screening

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0825198A1 (en) * 1996-08-22 1998-02-25 K.U. Leuven Research & Development Plag gene family and tumorigenesis
WO2003073105A2 (en) * 2002-02-28 2003-09-04 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Use of plag1 and plagl2 in cancer diagnosis and drug screening

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HENSEN K ET AL: "The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, BALTIMORE, MD, US, vol. 62, no. 5, 1 March 2002 (2002-03-01), pages 1510 - 1517, XP002259273, ISSN: 0008-5472 *
HENSEN KAREN ET AL: "Analysis of the oncogenic function of the pleomorphic adenoma gene PLAG1", 2002, INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, VOL. 10, NR. SUPPLEMENT 1, PAGE(S) S103, 7TH WORLD CONGRESS ON ADVANCES IN ONCOLOGY AND THE 5TH INTERNATIONAL SYMPOSIUM ON MOLECULAR MEDICINE; HERSONISSOS, CRETE, GREECE; OCTOBER 10-12, 2002, ISSN: 1107-3756, XP009024750 *
KAS K ET AL: "Transcriptional activation capacity of the novel PLAG family of zinc finger proteins", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 273, no. 36, 4 September 1998 (1998-09-04), pages 23026 - 23032, XP002259275, ISSN: 0021-9258 *
SAUER B: "Inducible Gene Targeting in Mice Using the Cre/loxSystem", METHODS : A COMPANION TO METHODS IN ENZYMOLOGY, ACADEMIC PRESS INC., NEW YORK, NY, US, vol. 14, no. 4, April 1998 (1998-04-01), pages 381 - 392, XP004466618, ISSN: 1046-2023 *
VOZ M L ET AL: "PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, BALTIMORE, MD, US, vol. 60, no. 1, 1 January 2000 (2000-01-01), pages 106 - 113, XP002259271, ISSN: 0008-5472 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117965638A (en) * 2024-01-31 2024-05-03 复旦大学附属中山医院 Construction method and application of spontaneous hyperuricemia model of UOX gene knockout mouse

Also Published As

Publication number Publication date
AU2003296309A1 (en) 2004-04-30

Similar Documents

Publication Publication Date Title
US11279948B2 (en) Genetically modified non-human animal with human or chimeric OX40
US11317611B2 (en) Genetically modified non-human animal with human or chimeric PD-L1
US10945418B2 (en) Genetically modified non-human animal with human or chimeric PD-L1
US11505806B2 (en) Genetically modified non-human animal with human or chimeric OX40
US11071290B2 (en) Genetically modified non-human animal with human or chimeric CTLA-4
WO2018041121A1 (en) Genetically modified non-human animal with human or chimeric ctla-4
Chen et al. Generation of a Twist1 conditional null allele in the mouse
van der Weyden et al. Null and conditional semaphorin 3B alleles using a flexible puroΔtk loxP/FRT vector
JP4832299B2 (en) Chimeric cancer model
JP5075641B2 (en) Genetically modified animals and uses thereof
JP2001211782A (en) Tob gene deletion knock out non-human mammal
US6642433B1 (en) Fgl-2 knockout mice
US6821759B1 (en) Methods of performing homologous recombination based modification of nucleic acids in recombination deficient cells and use of the modified nucleic acid products thereof
AU2003218236B2 (en) Transgenic non-human mammals expressing constitutively activated tyrosine kinase receptors
US20100107265A1 (en) Double-muscling in mammals
WO2004023869A1 (en) Use of plag or plag-inhibitors to diagnose and/or treat disease
US10470446B2 (en) Engineered cell comprising a recombinant pro-methylation cis-element construct that resides in a regulatory region of a target gene
WO2022253280A1 (en) Genetically modified non-human animal with human or chimeric bcma
US8980627B2 (en) Method for enabling stable expression of transgene
EP1912494B1 (en) Isolation of T-complex distorters and applications thereof
JP4217782B2 (en) Mice exhibiting characteristics of Rossmond-Thomson syndrome and method for producing the same
JP2007508814A (en) Transgenic rodents that selectively express human B1 bradykinin receptor protein
EP2946663A1 (en) Genetically engineered murine animal as a model for Primary Membraneous Nephropathy
Yin Expression and developmental requirement for transcription factor Sp2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP