WO2004022763A1 - Procedes et moyens d'amelioration de l'integration retrovirale - Google Patents

Procedes et moyens d'amelioration de l'integration retrovirale Download PDF

Info

Publication number
WO2004022763A1
WO2004022763A1 PCT/GB2003/003889 GB0303889W WO2004022763A1 WO 2004022763 A1 WO2004022763 A1 WO 2004022763A1 GB 0303889 W GB0303889 W GB 0303889W WO 2004022763 A1 WO2004022763 A1 WO 2004022763A1
Authority
WO
WIPO (PCT)
Prior art keywords
rad52
dna
cell
retroviral
cells
Prior art date
Application number
PCT/GB2003/003889
Other languages
English (en)
Inventor
Mark James O'connor
Alan Lau
Stephen Philip Jackson
Original Assignee
Kudos Pharmaceuticals Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB0220757.9A external-priority patent/GB0220757D0/en
Application filed by Kudos Pharmaceuticals Limited filed Critical Kudos Pharmaceuticals Limited
Priority to AU2003263335A priority Critical patent/AU2003263335A1/en
Publication of WO2004022763A1 publication Critical patent/WO2004022763A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the present invention relates to promoting retroviral integration in mammalian cells. It further relates to promoting retroviral integration in gene therapy, especially ex vivo.
  • the invention has arisen from the inventors' surprising finding that inhibiting RAD52 in mammalian cells allows for a substantial (e.g. 10 to 16-fold) increase in retroviral integration, despite the absence of any previously recognised severe phenotype being observed by knock-out of RAD52 in mammalian cells.
  • the newly observed effect was not predictable from the available art, as is now explained with reference to background art.
  • NHEJ non-homologous end-joining
  • Eukaryotes have both NHEJ and homologous recombination (HR) repair pathways that can repair DNA double-strand breaks (DSB) .
  • HR homologous recombination
  • DSB DNA double-strand breaks
  • significant differences have been found between the importance of HR in yeast and mammalian cells.
  • HR homologous recombination
  • the RAD52 epistasis group consists of 10 genes and encodes proteins that include the yeast proteins Rad51p and RAD52p (Paques and Haber, 1999) .
  • Knockout-out or loss of function of any of the RAD52 epistasis group members results in viable yeast and all show defects in HR and hypersensitivity to DNA damaging agents such as ionizing radiation (IR) .
  • IR ionizing radiation
  • yeast RAD51 mutants are viable, targeted deletion of RAD51 in mice leads to early embryonic lethality (Tsuzuki et al . , 1996; Lim et al . , 1996). Similarly, conditional RAD51 mutants in chicken DT40 cells show extensive genetic instability and rapid cell death. The high incidence of chromosomal breaks that occurred during mitosis in RAD51 mutant chicken cells suggests that, unlike yeast, Rad51 plays a critical role in mammalian HR and replication fork progression (Sonoda et al . , 1998).
  • Van Dyck et al found that RAD52, like Ku, binds double-strand breaks in DNA caused by ionizing radiation and proposed a model in which either Ku or RAD52 binds, with Ku directing double-strand breaks into the NHEJ repair pathway and RAD52 initiating repair by homologous recombination.
  • Ku and RAD52 direct entry into alternative pathways for repair, and further proposed that simultaneously overexpressing RAD52 while down- regulating or inactivating Ku would be useful in promoting the frequency of homologous gene targeting using linear DNA vectors .
  • the present invention arises from work in which the present inventors have created a number of mutations to knockout individually different components within the HR pathway in mammalian cells.
  • the inventors tested the various mutant and knockout cells for susceptibility to integration of retroviral DNA into the genome.
  • RAD51 is thought to be a critical component of the mammalian HR pathway and knockout of RAD51 results in cellular lethality.
  • the lack of viable RAD51 knockout cells prevents detailed analysis, however mammalian cells also contain several paralogs and regulators of Rad51 function.
  • Paralogs of Rad51 include the XRCC2 and XRCC3 proteins (Thomson and Schild, 2001) and the breast cancer associated protein, BRCA2, which is implicated in mediating HR (Davies et al . , 2001; Moynahan et al . , 2001).
  • Mammalian cells with loss of XRCC2, XRCC3 and BRCA2 are viable but show significantly reduced HR efficiency, chromosomal instability and sensitivity to DNA damaging agents (Takata et al . , 2001; Thomson and Schild, 2001) .
  • the inventors' experimental analysis of mammalian cells lacking functional XRCC2, XRCC3 or BRCA2 showed no effects on retroviral transduction efficiencies. This result indicates that the HR pathway, in stark contrast to what is observed for yeast TYl retrotransposition, is not directly involved in modulating the efficiency of retroviral integration in mammalian cells.
  • the inventors have demonstrated that the enhancement of retroviral integration in mammalian cells does not arise from defects in the general HR repair pathway. Loss of components in the HR pathway, apart from RAD52, did not show any effect. Furthermore, the inventors have demonstrated experimentally that the role of RAD52 in inhibiting retroviral integration is independent of the role it may play in HR and is likely mediated via its ability to bind DNA. Overexpression experiments described herein show that RAD52 alone is sufficient to repress retroviral transduction efficiency and this effect is consistent with the role RAD52 plays in modulating retroviral integration.
  • RNAi represents a preferred embodiment for inhibiting RAD52 production in mammalian cells in a reversible manner.
  • Figure 1 shows results demonstrating the sensitivity and broad utility of HIV-1 based luciferase integration assays (LUCIA) .
  • Figure 1A is a highly schematic representation of HIV-1 LUCIA. After virus attachment and entry, viral RNA is reverse transcribed into a dsDNA copy by HIV-1 reverse transcriptase (RT) . Viral dsDNA is then joined to host cell chromosomal DNA by HIV-1 integrase (IN) . The viral integration process results in chromosomal DNA strand breaks and cellular DNA repair pathways repair this damage. Successful integration and repair results in expression of the luciferase reporter gene.
  • RT HIV-1 reverse transcriptase
  • Figure IB shows results of HIV-1 LUCIA in Hela cells following infection with increasing quantities of packaged (VSVG + ) or non-packaged (VSVG " ) HIV vector.
  • Figure 1C shows results of HIV-1 LUCIA in Hela cells following infection with increasing quantities of integrase proficient (IN + ) or integrase defective (D64V IN " ) HIV vector. Data are given as the average luminescence (cps) from at least four wells of an opaque-white 96-well plate. In all cases the amount of IN + /VSVG + virus added is directly proportional to the luciferase signal generated.
  • Figure 2 shows results of experiments demonstrating that cells deficient in RAD52 show enhanced retroviral infection.
  • Figure 2A shows HIV-1 LUCIA results for XRCC2 (IRS1) and XRCC3 (IRS1-SF) defective hamster cell lines infected with HIV-1 IN+ retrovirus stocks.
  • Figure 2B shows HIV-1 LUCIA of BRCA2 deficient (Capan-1) human pancreatic cells infected with HIV-1 IN + retrovirus stocks.
  • Figure 2C shows HIV-1 LUCIA results for RAD52 deficient mouse ES cells infected with HIV-1 IN + retrovirus stocks. All data are given as the luciferase activity relative to wild type ( +/+ ) cells.
  • Figure 3 shows that over-expression of RAD52 impairs retroviral infection.
  • Figure 3A shows LUCIA results in the left graph and immunoblot analysis of the Hela cell clones in the right panel for parental Hela cells (HELA) , Hela cell clones stably transfected with vector DNA only (IRES-1 and -2) and Hela cell clones stably over-expressing HA-RAD52 (RAD52-1 through 5) infected with HIV-1 IN + retroviral stocks.
  • LUCIA results are expressed as luciferase activity relative to parental Hela cells.
  • Western blots of Hela cell clones were performed using antibodies raised against the HA-tag epitope, RAD52, Ku70, Ku80 and ⁇ -actin (loading control) .
  • Figure 3B shows PCR analysis of stably integrated HIV-1 DNA in RAD52 ⁇ ' ⁇ ES cells and HeLa cell clones overexpressing HA-Rad52 at 21 days after infection with HIV-1 luciferase retroviral stocks. The number of stable integration events was assessed by PCR of luciferase DNA (left panels) in relation to total genomic DNA as determined by PCR of GAPDH DNA (right panels) . Stably integrated HIV-1 luciferase DNA for RAD52 ⁇ ' ⁇ ES cells was compared to parental RAD52 +/+ ES and HA-Rad52 everexpressing HeLa cell clone RAD52-3 compared to that of the control HeLa: IRES-1 cell clone. PCRs were performed using 1:10 and 1:100 dilutions of high molecular weight genomic DNA to illustrate the linearity of the amplification.
  • Figure 4 shows siRNA mediated knockdown of Rad52 expression enhances HIV-1 vector transduction.
  • Figure 4A shows HEK-293 cells were transiently co-transfected with the HA-Rad52 expression plasmid and either a non-specific control (-) or Rad52 specific (+) siRNA. Specific knockdown of HA-Rad52 protein expression by the Rad52 siRNA was confirmed by immunoblot analysis with anti-HA tag antibodies. Blots were stripped and re-probed for ⁇ -actin and served as both loading and siRNA specficicity controls.
  • Figure 4B shows HIV-1 LUCIA results for HeLa and HA-Rad52 overexpressing clones RAD52-3 and RAD52-5 after transfection with the Rad52 siRNA. Knockdown of Rad52 expression led to an increase in HIV-1 luciferase transduction for all cell clones. Data are given as the average luminescence (cps) from at least six wells of a 96-well plate.
  • Figure 5 illustrates the finding that the DNA binding domain of RAD52 is required for inhibition of retroviral infection.
  • Figure 5A shows schematic diagrams of RAD52 and deletion mutants showing functional domains.
  • DNA DNA binding domain
  • RAD52 RAD52 self-association domain
  • RPA RPA binding domain
  • RAD51 Rad51 binding domain
  • NLS nuclear localization signal. Amino acid residues are numbered.
  • Figure 5B shows HIV LUCIA results in the left graph and immunoblot analysis of cell lysates in the right panel for HEK-293 cells transiently transfected with full-length (FL) RAD52 and RAD52 deletion mutant expression plasmids then infected with HIV-1 IN + retroviral stocks.
  • LUCIA results are expressed as luciferase activity relative to untransfected HEK-293 cells.
  • Western blots were performed using anti-HA tag antibodies then the blots stripped and re-probed for ⁇ -actin (loading control) .
  • Figure 5c shows chromosomal immunoprecipitation (ChlP) analysis of HEK-293 cells transiently transfected with FL- Rad52 or Rad52 deletion mutant expression plasmids and infected with HIV-1 luciferase retroviral stocks.
  • the level of HIV-1 DNA physically associated with HA-Rad52 was determined by immunoprecipitation with anti-HA antibodies and detected by PCR using primers against HIV-1 LTR sequences.
  • Non-specific control immunoprecipitations were performed using either no antibody (-) or an IgGl isotype control anti-FLAG tag antibody.
  • the total amount of HIV-1 LTR DNA formed during a typical infection is also shown (INPUT) .
  • PCRs were performed using 1:10 and 1:100 dilutions of ChlP DNA to illustrate the linearity of the amplification
  • FIG. 6 shows overexpression of Rad52 can compete with Ku for binding to HIV-1.
  • Figure 6A shows results of experiments in which HEK-293 cells were transiently transfected with an increasing amount of HA- Rad52 expression plasmid then infected with HIV-1 luciferase retroviral stocks.
  • HIV-1 luciferase transduction assay results are shown in the left graph and immunoblot analysis of cell lysates are shown in the right panel. Results are expressed as luciferase activity relative to untransfected HEK-293 cells. Immunoblots were performed using anti-HA tag antibodies then the blots stripped and re-probed for ⁇ -actin (loading control) .
  • FIG. 6B shows competitive PCR-ChIP analysis of HEK-293 cells transiently transfected with increasing amounts of HA-Rad52 expression plasmid and infected with HIV-1 luciferase retroviral stocks. Results show the amount of immunoprecipitated HIV-1 DNA as determined by PCR of 1:10 diluted DNA using specific primers against HIV-1 LTR sequences. HIV-1 DNA associated with either HA-Rad52 or Ku was immunoprecipitated using antibodies against the HA-tag or Ku80. Non-specific control immunoprecipitations were performed using no antibody (-) or an IgGl isotype control anti-FLAG tag antibody. PCR amplifications were normalised to the amount of HIV-1 LTR DNA used per ChlP (INPUT DNA) .
  • Figure 6C shows results of immunoblot analysis of input extracts used to perform the ChlP assays. The amount of HA- Rad52 or Ku80 protein used per ChlP analysis was determined by immunoblotting using anti-HA tag or anti-Ku
  • Figure 7 shows that unintegrated 2-LTR circle DNA formation is impaired by Rad52 expression.
  • the results show semi- quantitative PCR analysis of DNA extracted from HIV-1 infected cells with different levels of Ku70 or Rad52 expression. DNA was extracted at indicated times post virus addition and analysed for circular 2-LTR HIV-1 DNA. PCR of the housekeeping gene GAPDH was performed as controls. Southern blots were performed using HIV-1 LTR or GAPDH radiolabelled probes and bands quantified by densitometry. All PCR quantification results are expressed as a normalised ratio of 2-LTR DNA: GAPDH control DNA.
  • Figure 7A shows PCR analysis of wild type ⁇ KU70 ++ ; Jl) and KU70 ⁇ ' ⁇ mouse ES cells. The quantification of bands by densitometric analysis is shown in the graph and an example autoradiograph is shown below.
  • Figure 7B shows PCR analysis of wild type (RAD52 +/+ ; 1B10) and RAD52 ⁇ ' ⁇ mouse ES cells.
  • Figure 7C shows PCR analysis of HEK-293 cells transfected with either full length HA-Rad52 (Rad52 FL) or DNA-binding deletion mutant HA-Rad52 (Rad52 a43-177) expression plasmids
  • Figure 8 shows overexpression of Rad52 does not enhance HIV-1 mediated apoptosis.
  • MOI 10
  • At increasing time points after infection cells were harvested and the number of cells undergoing apoptosis quantified by annexin-V staining and flow cytometry. Live/dead cell discrimination was also performed by counter-staining with propidium idodide (PI) .
  • PI propidium idodide
  • Figure 8A shows flow-cytometric dot-plots of apoptotic cell populations at 38 hours after infection with mock or HIV-1 luciferase retrovirus stocks.
  • the lower right quandrant (high annexin-V, low PI) of each panel represents early apoptotic cells.
  • the upper right quandrant (high annexin-V, high PI) represents late apoptotic and dead cells. The percentage of cells in each quandrant is shown.
  • Figure 8B shows the percentage of cells undergoing the early stages of apoptosis at increasing time points after infection with HIV-1 luciferase retrovirus stocks.
  • Figure 8C shows the percentage of both dead and apoptotic cells (all high annexin-V stained cells) at increasing time points after HIV-1 luciferase retrovirus infection.
  • Figure 9 illustrates without limitation to the invention a model for the effects of RAD52 and Ku in modulating retroviral infection.
  • This model fits with our data. Should further work lead to modification of the model, this will not affect aspects and embodiments of the present invention that are supported by the data herein showing targeting of RAD52 activity to alter retroviral integration.
  • unintegrated linear viral DNA is the direct substrate for integration but may also be a signal for apoptosis. in addition to unintegrated linear viral DNA, apoptosis may also by signalled by excessive or unrepaired host cell DNA damage caused by integration.
  • linear viral DNA ends are bound by Ku, which activates NHEJ repair and results in the formation of 2- LTR DNA circles.
  • Removal of the apoptotic signal could be achieved through the physical elimination of the double- stranded viral DNA through circularisation, the phosphorylation activity of the DNA-PK kinase on down-stream signalling proteins, or both.
  • the NHEJ pathway In the absence of Ku, the NHEJ pathway is not activated, resulting in apoptosis of the host cell.
  • activation of the NHEJ pathway might be inhibited, possibly by interference of Rad52 with Ku binding to viral DNA ends, thus modulating the efficiency of 2-LTR circle DNA formation.
  • susceptibility towards apoptosis appears unchanged when Rad52 is bound to the ends of linear viral DNA this indicates that Rad52 binding is sufficient to suppress apoptosis.
  • a reduction in transduction efficiency may therefore result from the binding of Rad52 to linear viral DNA, inhibiting the association or recruitment of other protein factors, such as Inil, BAF, hRadl ⁇ and integrase, that are required for efficient integration. Loss or repression of Rad52 may remove this inhibition providing enhanced integration activity and a concomitant increase in retroviral infection efficiency.
  • Reverse transcription and integration of viral double-stranded DNA into a host cell's genome are essential steps in the retroviral lifecycle. These steps are mediated by the retroviral proteins reverse transcriptase (RT) and integrase (IN) respectively.
  • RT reverse transcriptase
  • IN integrase
  • the retroviral RNA is reverse transcribed by RT to produce a linear double-stranded DNA copy that includes directly repeated sequences at each end, known as long terminal repeats (LTR) .
  • LTR long terminal repeats
  • the linear retroviral cDNA is then 3' -recessed at both ends and joined to host cell chromosomal DNA via a direct trans-esterification reaction catalysed by IN.
  • Host cell DNA repair proteins must effectively repair these gapped DNA intermediates in order to complete the integration process.
  • Several host cell DNA repair proteins and pathways including Poly (ADP-ribose) -polymerase (PARP; Gaken et al . , 1996; Ha et al . , 2001), ataxia telangiectasia mutated (ATM; Daniel et al . , 2001), ATM-Rad3-related (ATR; Daniel et al . , 2003), hRadl8 (Mulder et al .
  • PARP Poly (ADP-ribose) -polymerase
  • ATM ATM-Rad3-related
  • ATR Daniel et al .
  • hRadl8 Meder et al .
  • linear retroviral cDNA In addition to linear retroviral cDNA, covalently closed circular molecules containing 1-LTR, or 2-LTR sequences (arranged in tandem) can also be detected in the nuclei of infected cells.
  • linear retroviral cDNAs are thought to be substrates for integration, with circular cDNA forms being unproductive by-products of infection (Coffin et al . , 1997).
  • 2-LTR circles often contain insertions or deletions and arise through end joining of the linear retroviral cDNA. Recent evidence has been provided suggesting that the NHEJ DNA repair pathway is responsible for 2-LTR DNA circle formation (Li et al . , 2001; Jeanson et al . , 2002).
  • Loss of the NHEJ DNA repair pathway renders mammalian cells susceptible to apoptotic cell death following retroviral infection.
  • Li et al . (2001) have suggested that excess double-stranded linear DNA product resulting from RT activity could by itself represent an apoptotic signal, rather like a DSB, that needs to be removed by the action of the NHEJ pathway and the concomitant formation of 2-LTR circles. This process should be IN independent; however, there is some uncertainty here, as Daniel et al . (1999) in their assay system suggested IN activity is required for retrovirally-induced apoptosis in NHEJ-deficient cells.
  • Retroviral intermediates stimulate a variety of different DNA damage signalling and repair pathways
  • retrovirally-induced products and intermediates in the absence of DNA repair could represent pro-apoptotic signals
  • integration As viral gene expression only occurs after a completed integration process (Naldini et al., 1996) , these various aspects of mammalian DNA damage response can easily be studied using retroviral-based vectors containing reporter genes
  • Integration as an essential step in the retroviral life cycle represents a potential target for the treatment of retroviral infections, such as HIV-1.
  • the repair of DNA DSBs can occur through either homologous recombination (HR) or non-homologous end-joining (NHEJ) DNA repair pathways (See Khanna and Jackson, 2001 review) .
  • HR homologous recombination
  • NHEJ non-homologous end-joining
  • Repair of DSBs by HR requires an undamaged homologous DNA sequence for use as a repair template to restore the break in the damaged DNA.
  • Homologous recombination-directed DSB repair proceeds through either gene conversion or single-strand annealing (SSA) pathways (Liang et al . , 1998; Paques and Haber, 1999) .
  • SSA single-strand annealing
  • SSA ho ology-directed DSB repair pathway
  • NHEJ DNA repair does not require an undamaged DNA partner or extensive sequence homology but joins the broken ends of a DSB together.
  • NHEJ DNA repair can occur in the absence of a sister chromatid template and often results in deletions or insertions at the DSB.
  • NHEJ repair requires the DNA-end binding activity of the Ku70/80 heterodimer, its interacting partner, the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) , and the complex between DNA ligase IV and XRCC4 (Van Gent et al . , 2001).
  • the choice of HR or NHEJ directed DNA repair is largely thought to be determined by cell cycle status, but a degree of overlap between DSB repair pathways occurs.
  • DNA repair pathway utilisation may also be influenced by competitive binding between HR and NHEJ DNA repair proteins to sites of DNA damage.
  • competition between Ku directed NHEJ and RAD52 directed HR DNA repair pathways have been proposed where the choice of which repair pathway is invoked is dependent upon whether Ku or Rad52 binds to the DNA end (Van Dyck et al . , 1999) and the presence of a two-ended DSB (Pierce et al . , 2001) .
  • Retroviruses are RNA viruses that must insert a DNA copy (cDNA) of their genome into the host chromosome in order to carry out a productive infection. When integrated, the virus is termed a provirus (Varmus, 1988) .
  • Some eukaryotic transposable DNA elements are related to retroviruses in that they transpose via an RNA intermediate. These elements, termed retrotransposons or retroposons, are transcribed into RNA, the RNA is copied into double-stranded (ds) DNA, and then the dsDNA is inserted into the genome of the host cell.
  • Retroviruses are of considerable risk to human and animal health, as evidenced by the fact that retroviruses cause diseases such as acquired immune deficiency syndrome (AIDS; caused by human immunodeficiency virus; HIV-1) , various animal cancers, and human adult T-cell leukaemia/lymphoma (Varmus, 1988) ; also retroviruses have been linked to a variety of other common disorders, including Type I diabetes and multiple sclerosis (Conrad et al . , 1997; Perron et al . 1997 and Benoist and Mathis, 1997) . In many but not all cases, cancer formation by certain animal retroviruses is a consequence of them carrying oncogenes.
  • AIDS acquired immune deficiency syndrome
  • HIV-1 human immunodeficiency virus
  • HIV-1 human immunodeficiency virus
  • Varmus human adult T-cell leukaemia/lymphoma
  • retroviruses have been linked to a variety of other common disorders, including Type I diabetes and multiple sclerosis (Con
  • retroviral integration and retrotransposition can result in mutagenic inactivation of genes at their sites of insertion, or can result in aberrant expression of adjacent host genes, both of which can have deleterious consequences for the host organism.
  • Various aspects and embodiments of the present invention are concerned with inhibiting retroviruses, with the aim of treatment and/or prevention of retroviral-associated disorders, including those listed here.
  • Retroviruses are also becoming more and more commonly used for gene delivery and are likely to play increasingly important roles in gene therapy (see e.g. Hawley 2001; Scherr and Eder 2002) .
  • retroviral vectors either in vivo or ex vivo, for example in cells removed from the body for treatment then subsequent return to the body.
  • Such cells may be haematopoietic stem cells (HSCs) .
  • the present invention provides a method of promoting retrovirus integration into the genome of a mammalian cell, by means of targeting RAD52 to reduce its activity in the cell, by inhibiting RAD52 protein interaction with DNA (double-stranded DNA ends) and/or by reducing the level of RAD52 protein within the cell - by eliminating protein if produced and/or inhibiting its production.
  • Activity of RAD52 may be modulated by targeting a product of another gene, e.g. a protein that affects RAD52 expression, stability or activity.
  • Methods of treatment of the human or animal body by way of therapy may be excluded.
  • a method of the invention may be carried out in vivo, for example in a method of therapy (which may be prophylactic) or in a non-therapeutic method.
  • a method of therapy which may be prophylactic
  • a non-therapeutic method Of particular interest is a method that may be carried out in vitro or ex vivo, e.g. on transplant material, such as cells or tissue removed from the body for subsequent return (for instance stem cells) .
  • Inhibition of RAD52 DNA-binding activity in particular binding to double-stranded DNA ends, may be achieved in any of numerous different ways, without limitation to the nature and scope of the present invention.
  • RAD52 is targeted for inhibition, that is to say binding of RAD52 with DNA itself or multimerisation between RAD52 subunits is inhibited by a substance that interferes with the binding or multimerisation.
  • a substance may inhibit binding by inhibiting physical interaction between RAD52 and DNA or between RAD52 subunits, or by binding in a way that has a steric effect on the conformation of binding site. Precisely how the RAD52 activity or function in inhibiting retroviral integration is inhibited need not be relevant to practising i the present invention.
  • the activity or function of RAD52 may be inhibited, as noted, by means of a substance that interacts in some way with the protein.
  • Another approach, and in some embodiments a ) preferred option employs regulation at the nucleic acid level to inhibit activity or function by down-regulating production of the component .
  • expression of a RAD52 gene may be inhibited using anti-sense technology.
  • anti-sense genes or partial gene sequences to down-regulate gene expression is well-established.
  • Anti-sense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of RAD52 so that its expression is reduced or completely or substantially completely prevented.
  • antisense techniques may be used to target control sequences of a gene, e.g. in the 5' flanking sequence, whereby the antisense oligonucleotides can interfere with expression control sequences.
  • the construction of antisense sequences and their use is described for example in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990) and Crooke, Ann. Rev. Pharmacol. Toxicol., 32:329-376, (1992).
  • Oligonucleotides may be generated in vi tro or ex vivo for administration or anti-sense RNA may be generated in vivo within cells in which down-regulation is desired.
  • double-stranded DNA may be placed under the control of a promoter in a "reverse orientation" such that transcription of the anti-sense strand of the DNA yields RNA which is complementary to normal mRNA transcribed from the sense strand of the target gene.
  • the complementary anti-sense RNA sequence is thought then to bind with mRNA to form a duplex, inhibiting translation of the endogenous mRNA from the target gene into protein. Whether or not this is the actual mode of action is still uncertain. However, it is established fact that the technique works .
  • the complete sequence corresponding to the coding sequence in reverse orientation need not be used. For example fragments of sufficient length may be used.
  • a suitable fragment may have about 14-23 nucleotides, e.g. about 15, 16 or 17.
  • RNA interference is a two-step process.
  • dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs ( ⁇ 2nt) .
  • siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001)
  • RNAi may be also be efficiently induced using chemically synthesized siRNA duplexes of the same structure with 3'- overhang ends (Zamore PD et al Cell, 101, 25-33, (2000)).
  • Synthetic siRNA duplexes have been shown to specifically suppress expression of endogenous and heterologous genes in a wide range of mammalian cell lines (Elbashir SM. et al. Nature, 411, 494-498, (2001)).
  • nucleic acid is used which on transcription produces a ribozyme, able to cut nucleic acid at a specific site - thus also useful in influencing gene expression.
  • Background references for ribozymes include Kashani-Sabet and Scanlon, 1995, Cancer Gene Therapy, 2(3): 213-223, and Mercola and Cohen, 1995, Cancer Gene Therapy, 2(1), 47-59.
  • the nucleic acid and protein sequences of RAD52 in humans and mouse are available from the GenBank database, under the following accession numbers: human RAD52 cDNA (U27516) ; human RAD52 protein (AAA87554); mouse RAD52 cDNA (AF004854); mouse RAD52 protein (AAB69174) .
  • Techniques targeting RAD52 expression are particularly useful in embodiments where it is desired temporarily to inhibit RAD52 DNA-binding activity in a cell, and thus promote retroviral integration. This is especially useful in ex vivo cell manipulation where a retroviral vector is introduced into a cell and integrated into the genome to encode and allow for production of a therapeutic gene product in the cell, then the cell is returned to the body. Release from temporary inhibition allows RAD52 to return to its normal functions in the cell.
  • Retroviral vectors may be introduced into cells using any suitable technique.
  • the introduction which may (particularly for in vi tro or ex vivo introduction) be generally referred to without limitation as "transformation", may employ any available technique.
  • suitable techniques may include calcium phosphate transfection, DEAE- Dextran, electroporation, liposome-mediated transfection and transduction using retroviruses.
  • a cell in which retroviral integration is promoted may be a stem cell.
  • a stem cell may be returned to the body of a donor from which it has been removed, after integration of a retroviral vector into the genome of the stem cell, e.g. for a therapeutic purpose.
  • non-human animals can be generated from mammalian non-human (e.g. mouse) embryonic stem (ES) cells into which a desired retroviral vector has been introduced. This may be for a research purpose, e.g. in generation of a model for study of a clinical disorder or disease. See for instance page 2 of WO97/05268 and the references cited there for specific background information.
  • Agents that promote retroviral integration into a cell such as a substance that binds RAD52 and/or inhibits RAD52 binding to DNA, or a substance that inhibits RAD52 production (e.g. RNA with nucleotide sequence complementary to a RAD52 gene sequence, which RNA is double-stranded RNA or antisense RNA, or a ribozyme specific for a RAD52 gene sequence) can be obtained using routine assay and screening techniques available in the art.
  • appropriate assays and screens can be used to obtain agents that inhibit retroviral integration by increasing RAD52 activity, especially binding to DNA.
  • the action of such an agent may be for example by potentiating or stabilising RAD52 binding to DNA, e.g. by reducing off-rate, or by increasing production of RAD52 in a cell, e.g. by increasing expression by acting on a promoter or other regulatory element controlling transcription or translation, or by stabilising RAD52 against degradation in the cell.
  • Substances identified as promoters or potentiators of RAD52 activity by action on the protein or a subunit or by facilitation or stabilisation of its binding to DNA, or by increasing its expression by upregulation of transcription of the gene or by stabilisation of encoding mRNA, represent an advance in the fight against retroviral diseases (for instance) , since they provide basis for design and investigation of therapeutics for in vivo use.
  • RAD52 binds DNA, specifically ends at DNA double- strand breaks (DSBs) .
  • DSBs DNA double- strand breaks
  • suitable e.g. synthetic preparations of DNA may be provided.
  • Retroviral integration and/or retrotransposition may be scored for example by detection using standard genetic, biochemical or histological techniques.
  • the RAD52 protein used in the assay may be human, or non-human mammalian, e.g. murine, mouse, rat, rabbit, guinea pig, sheep, goat, cow, pig, cat or dog.
  • RAD52 in an assay may be taken to refer to a derivative, variant or analogue of the relevant component which has the requisite, assayable property or activity, in particular ability to bind DNA ends (and thereby inhibit retroviral integration) .
  • test substances Prior to, as well as or instead of being screened for actual ability to affect RAD52 activity, test substances may be screened for ability to interact with or bind RAD52 e.g. in a yeast two-hybrid system (which requires that both the polypeptide component and the test substance can be expressed in yeast from encoding nucleic acid, see e.g. Evan et al . Mol . Cell . Biol . 5, 3610-3616 (1985); Fields & Song Nature 340, 245-246 (1989)). This may for example be used as a coarse screen prior to testing a substance for actual ability to modulate activity.
  • RAD52 protein or a DNA binding fragment thereof may then be tested for ability to affect RAD52 activity and/or retrovirus integration in a suitable test system, in vitro, ex vivo or in vivo.
  • the substance may be investigated further, in particular for its ability to promote or inhibit retroviral and/or retrotransposon integration. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.
  • the present invention extends in various aspects not only to a substance identified as inhibiting retroviral and/or retrotransposon activity in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of a retroviral disorder, use of such a substance in manufacture of a composition for administration, e.g. for treatment of a retroviral disorder, and a method of making a composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.
  • a substance for promoting or inhibiting retrovirus and/or retrotransposon integration in accordance with any aspect of the present invention may be formulated in a composition.
  • a composition may include, in addition to said substance, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or one or more other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form.
  • a tablet may include a solid carrier such as gelatin or an adjuvant.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
  • Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.
  • administration is preferably in a "prophylactically effective amount” or a "therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual.
  • a prophylaxis may be considered therapy
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington' s Pharmaceutical Sciences, 16th edition, Osol, A. (ed) , 1980.
  • Targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
  • these agents may be produced in the target cells by expression from an encoding gene introduced into the cells.
  • the vector may be targeted to the specific cells to be treated, or it may contain regulatory elements that are switched on more or less selectively by the target cells.
  • the agent may be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
  • a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • agents that promote retroviral integration may be substances that bind to RAD52 protein and/or interfere with RAD52 protein binding to DNA, e.g. antibody molecules, peptides (e.g. fragments of RAD52) or other molecules.
  • agents may be substances that inhibit production of RAD52 protein in cells, such as antisense RNA or siRNA.
  • Assays and methods of screening in which integration of a retroviral vector is determined may comprise direct detection of a reporter gene within the retrovirus.
  • Reporter genes used for the quantification of retroviral integration events may include antibiotic resistance genes, such as those coding for resistance to Neo ycin (G418), Puromycin, or Hygromycin.
  • Alternative reporters include autofluorescent reporters such as the green fluorescent protein GFP or variants thereof or enzymatic gene products such as ⁇ -galactosidase, or chlora phenicol acetyl transferase (CAT) .
  • the preferred reporter gene for retroviral integration assays may consist of genes coding for products capable of generating chemiluminescence .
  • the preferred reporter gene may be the firefly ⁇ Photinus pyralis) luciferase gene that provides both a high level of sensitivity and as a result of this, an ability to be used in high throughput assays.
  • Alternatives to the firefly luciferase gene include the Sea Pansy (Renilla renifor is) luciferase gene product.
  • An assay of retroviral integration into host cells may include; introducing a retroviral vector into host cells, e.g. by infection with a retrovirus, said retroviral vector containing a reporter gene encoding a chemiluminescent protein, causing or allowing expression of said reporter gene from integrated retroviruses; and determining luminescence generated by said chemiluminescent protein.
  • Host cells may be transduced/infected with retrovirus in the presence or absence of an agent of interest.
  • the effect of the agent of interest on retroviral integration may then be assessed by comparing the luminescent signals produced in the presence and absence of agent.
  • Assays may be conveniently carried out in a 96-well microtitre plate format.
  • Reagents and materials for generating and measuring a luminescent end point are well known in the art and are available commercially. Such reagents and materials may be used by a skilled person in accordance with the manufacturer's instructions as appropriate.
  • the retroviral luciferase integration assay represents a significant improvement on other currently available retroviral integration assays, including the colony formation assay (CFA) , which utilises drug resistance markers and takes significantly longer than LUCIA and which is not amenable to High Throughput Screening (HTS) , or assays utilising ⁇ - galactosidase activity which do not possess the inherent sensitivity of luciferase-based assays.
  • CFA colony formation assay
  • HTS High Throughput Screening
  • Such other assays are, however, useful in determination of retroviral integration where such determination is needed in accordance with an aspect or embodiment of the present invention.
  • RAD52 can modulate the outcome of retroviral infection (exemplified using recombinant HIV-1 vector) by markedly reducing the efficiency of productive integration events.
  • No major phenotype has previously been described for a RAD52 deficiency in mammalian cells. Mutations in other HR proteins (XRCC2, XRCC3 and BRCA2) do not affect retroviral transduction rates.
  • Our results provide indication that the HR repair pathway per se does not influence retroviral infection in mammalian cells.
  • this interference alone cannot adequately explain the effect Rad52 has on retroviral infection.
  • the mechanism of attenuation of retroviral infection by RAD52 appears to be based upon physical interference between Rad52 and the integration machinery, most likely through competitive binding of RAD52 to unintegrated retroviral cDNA ends.
  • Figure 1A and Materials and Methods To quantitatively assess retroviral vector transduction efficiency, we used single-step recombinant HIV-1 based vectors which contain the firefly luciferase reporter gene (see Figure 1A and Materials and Methods) .
  • Figure IB and Figure 1C provides an indication of the sensitivity and dynamic range of this HIV-1 luciferase integration assay, which we term LUCIA.
  • Figure IB shows that viral entry is required for luciferase expression, as recombinant viruses lacking the VSVG envelope glycoprotein (VSVG " ) give no signal in LUCIA.
  • Figure 1C shows that luciferase expression only occurs with recombinant viruses that contain a functional integrase protein (IN + ) .
  • Viruses that contain the D64V integrase mutation do not give rise to luciferase signals in LUCIA and demonstrates that gene expression only occurs after integration is completed.
  • D64V IN functional retroviral stocks
  • a direct positive correlation between the amount of virus added and the luciferase signal generated in LUCIA is observed.
  • Figure 2A and 2B shows HIV-1 LUCIA results of cells defective in the Rad51 paralogs, XRCC2 and XRCC3 ( Figure 2A) , or in BRCA2 ( Figure 2B) . Loss of these key components in the HR pathway in mammalian cells did not show any effect on retroviral transduction efficiencies.
  • figure 2C shows HIV-1 LUCIA results of isogenic mouse ES cells with targeted deletions of none (RAD52 +/+ ) , one [RAD52 +/ ⁇ ) or both ⁇ RAD52 ⁇ ' ⁇ ) RAD52 alleles.
  • the efficiency of retroviral transduction was increased by 16-fold. Integration efficiency was sensitive to the level of RAD52 gene dosage, since the deletion of one ) RAD52 allele resulted in a 10-fold increase.
  • Both RAD52 ⁇ / ⁇ ES cells and Rad52-overexpressing HeLa clones were transduced with the HIV-1 luciferase vectors and the level of stably integrated, proviral DNA in the cell population determined by PCR. Integrated, proviral DNA was detected by PCR for the presence of the luciferase reporter gene ( Figure 3B) . Analysis of total proviral DNA content, as determined by luciferase-directed PCR, in transduced ES cells shows that RAD52 ⁇ / ⁇ cells contain a greater amount of integrated proviral DNA than RAD52 +/+ cells. In contrast, the Rad52-overexpressing HeLa clone (RAD52-3) show a reduction in total integrated proviral DNA compared to control cells (IRES- 1) .
  • RNAi-mediated knockdown of Rad52 expression enhances retroviral infection
  • RNA interference RNA interference
  • siRNAs small interfering RNAs
  • HEK-293 cells were co-transfected with the HA-Rad52 expression vector and either a non-specific control or Rad52 siRNA. At various times after transfection cells were harvested and HA- Rad52 expression determined by immunoblotting ( Figure 4A) .
  • the Rad52 siRNA was used to knockdown Rad52 expression in both HeLa and Rad52-overexpressing clones RAD52-3 and Rad52-5. HIV-1 luciferase transduction assays were then performed on these cells.
  • the results in Figure 4B show that Rad52 siRNA- transfected cells demonstrate a significant increase in HIV-1 vector transduction efficiency when compared with cells transfected with the non-specific control siRNA.
  • Figure 1C Figure 1C
  • the DNA binding activity of RAD52 is required to inhibit HIV-1 infection
  • RAD52 interacts with two key proteins during HR, namely RPA and Rad51 (Shen et al . , 1996a and 1996b; Park et al . , 1996; Milne and Weaver, 1993) . Although both RPA and Rad51 are essential for HR, they compete for the same substrate. Rad51 forms a nucleoprotein filament on single-stranded DNA that arises after processing of a DSB (reviewed in Paques and Haber, 1999) . Subsequently, this nucleoprotein filament searches for homologous duplex DNA and mediates DNA strand exchange. In order to form a nucleoprotein filament on single-stranded DNA, Rad51 needs to displace the single-strand DNA binding protein RPA.
  • RPA is a more tenacious single-strand DNA binding protein than Rad51
  • the Rad51 protein cannot displace RPA by itself.
  • the RAD52 protein performs a mediator function that facilitates the displacement of RPA by Rad51. If the observed effect of RAD52 on retroviral transduction is indeed independent of its role in HR, then the domain of RAD52 that is required for its interaction with RPA and Rad51 should be dispensable for the repression of transduction.
  • the first mutant lacks amino acids 43 through 177, which span the RAD52 multimerisation and DNA binding domains ( Figure 5A) (Shen et al . , 1996a and 1996b).
  • the second mutant lacks amino acids 195 through 347, which contains the RPA and Rad51 interaction domains (Park et al . , 1996).
  • Plasmids expressing full-length RAD52 or either of the two deletion mutants were transiently transfected in HEK-293 cells. The expression of the RAD52- derivative was confirmed by immunoblotting ( Figure 5B) .
  • Figure 5C demonstrates that full length Rad52 is indeed associated with HIV-1 DNA ends as HIV-1 LTR DNA sequences were easily amplified from HA ChlPs but not with non-specific control ChlPs.
  • the Rad52 ⁇ 43-177 DNA binding mutant shows a greatly reduced affinity for HIV-1 DNA ends whereas the ⁇ 195-347 mutant still binds HIV-1 DNA ends readily.
  • PCR-ChIP assays were performed on HEK-293 cells transfected with increasing amounts of Rad52 expression plasmid DNA and transduced with the HIV-1 luciferase vector. ChlPs were performed using antibodies against Ha-tagged Rad52 and Ku80 and the amount of HIV-1 LTR DNA immunoprecipitated by each antibody was assessed by PCR ( Figure 6B) . PCR-ChIP analysis shows that in cells with high Rad52 expression (24 and 12 ⁇ g of expression plasmid) the amount of Rad52 associated HIV-1 LTR DNA (anti-HA ChlPs) is significantly greater than those with low levels of Rad52 expression ( ⁇ 6 ⁇ g) .
  • HIV-1 induced apoptosis is unaffected by Rad52 expression
  • Figure 8 shows that the extent of apoptosis between HeLa and the Rad52-overexpressing clones was not significantly different. Both early stage apoptosis (high annexin-V but low PI staining) and the total apoptotic/dead (all annexin-V positive cells) cell populations were not increased in either of the two Rad52-overexpressing HeLa clones as might be predicted.
  • apoptosis/cell death was also assessed using caspase-activation assays and trypan-blue staining. Identical results to annexin-V staining were obtained indicating no differences between the cell lines.
  • the pIRESneo2-HA mammalian expression vector was constructed by insertion of a HA epitope sequence into the EcoRI and Notl sites of pIRESneo2 (Clontech) .
  • Full-length human RAD52 cDNA was cloned in-frame with the HA epitope in pIRESneo2HA to yield an N-terminal HA-tagged .R ⁇ D52 expression plasmid, pIREsneo2-HA-iAD52.
  • the RAD52 deletion mutants ⁇ 43-177 and ⁇ 195-347 were made by restriction enzyme digestion of RAD52 cDNA with Bsu36I-HinDIII and Bglll-Xbal respectively, then blunt-ended with Klenow DNA polymerase and re-ligated back together. These deletions maintained the reading frame of RAD52. The deleted RAD52 fragments were then cloned into pIRESneo2-HA as described above.
  • RAD52 antibody H-300 was obtained from Santa Cruz Biotechnology
  • HA antibody (12CA5) was obtained from Boehringer Mannheim
  • the ⁇ -actin antibody (AC-15) was obtained from Sigma.
  • the Ku80 antibody (clone 111) was obtained from NeoMarkers-Labvision Corporation.
  • the FLAG (M2) and ⁇ -actin (AC-15) antibodies were obtained from Sigma. Antibodies against Ku70 were generated using routine techniques .
  • HELA and HEK-293 cells were grown in Dulbecco' s modified Eagle's medium (DMEM) with 10% foetal bovine serum (FBS) (Invitrogen) .
  • DMEM Dulbecco' s modified Eagle's medium
  • FBS foetal bovine serum
  • V79 (XRCC2 + ) and the XRCC2 defective derivative IRS1 (Jones et al . , 1995; Thacker et al . , 1995) and AA8 (XRCC3 + ) and its XRCC3 defective derivative IRSl-SF (Tebbs et al . , 1995) hamster cell lines were grown in DMEM with 10% FBS.
  • the BRCA2 defective cell line Capan-1 (Abbott et al . , 1998) and BxPC3 (BRCA2 + ) control human pancreatic cell lines were grown in RPMI1640 medium with 15% FBS.
  • HELA -IRES and HELA -RAD52 stable clones were made by transfection of HELA cells with pIRESneo2HA and pIRESneo2-HA- RAD52 plasmids respectively, using Lipofectamine plus reagent
  • RAD52 over-expressing clones were identified by immunoblot analysis with both anti-HA and anti-RAD52 antibodies .
  • the integrase D64V mutation was made by site directed mutagenesis of L ⁇ P2GPH using the Quikchange mutagenesis kit (Stratagene) .
  • Recombinant HIV-1 retroviral stocks were produced using a ) modification of the transient expression system described by Naldini et al . , 1996. Briefly, 6 xlO 6 human kidney 293T cells were co-transfected with 10 ⁇ g packaging construct L ⁇ P2GPH (IN+ or D64V IN-), 8 ⁇ g pHR' -Luc transfer vector and 5 ⁇ g VSV G envelope protein expression plasmids using Lipofectamine- 2000 reagent (Gibco-BRL) . 48 hours post transfection retrovirus-containing cell culture supernatants were harvested, filtered through 0.45 ⁇ M cellulose acetate membranes and stored at -80°C.
  • HIV-1 viral titres were estimated using the HIV-1 p24 gag antigen ELISA kit (Beckman- Coulter) .
  • pHR'-GFP GFP HIV-1 vectors
  • 1 ng VSV-G pseudotyped HIV-1 p24 gag corresponds to approximately 601 GFP-transducing units (TU) when titred on HeLa cells.
  • Rad52 siRNA was designed according to the rules available in the art and judged to be specific though BLAST searching. Rad52 siRNA (target sequence: AAAGACUACCUGAGAUCACUA - SEQ ID NO: 1) and non-specific control siRNA (AAATTCTATCACTAGCGTGAC - SEQ ID NO: 2) were synthesised and pre-duplexed.
  • target sequence AAAGACUACCUGAGAUCACUA - SEQ ID NO: 1
  • non-specific control siRNA AAATTCTATCACTAGCGTGAC - SEQ ID NO: 2
  • HEK-293 plasmid DNA-siRNA co-transfection experiments cells were transfected in 24-well plates as described above except that 0.5 ⁇ g plasmid DNA and 100 nM siRNA duplexes were used. 24, 48 and 72 hours after transfection cells were harvested, washed in PBS and whole cell extracts made by lysing directly in SDS-loading buffer.
  • HA-Rad52 protein expression was determined by immunoblot analysis with anti-HA and ⁇ -actin (control) antibodies.
  • siRNA transfection- retrovirus transduction assays HeLa cells were seeded at 1 xlO 5 cells per well in 6-well plates. 100 nM siRNA duplexes were transfected for 4 hours using Oligofectamine reagent (Invitrogen) . 24 hours later cells were then transfected again with 100 nM siRNA duplexes and left for a further 24 hours. Cells were trypsin-EDTA harvested, re-seeded into 96- well opaque-white tissue culture plates and incubated for 48 hours. 96-well plate HIV-1 luciferase transduction assays were then performed as described previously.
  • Cells were harvested, washed twice in Ix PBS and lysed in sonication buffer (50 mM Tris pH 8.0, 1% SDS, 10 mM EDTA, protease inhibitor cocktail (Boehringer Mannheim)) on ice for 10 minutes. Cell extracts were sonicated four-times in 10 second pulses and cell debris pelleted by centrifugation. Immunoprecipitation of protein- DNA complexes was performed using 2-4 mg of cell supernatants per antibody.
  • sonication buffer 50 mM Tris pH 8.0, 1% SDS, 10 mM EDTA, protease inhibitor cocktail (Boehringer Mannheim)
  • IP buffer 20 nM Tris pH8.0, 0.1% SDS, 2 mM EDTA, 1% Triton X-100, 50 mM NaCl, protease inhibitor cocktail
  • Protein-G-Sepharose beads Amersham-Pharmacia; 50% suspension with 300 ⁇ g/ml sssDNA, 0.5 mg/ml BSA in TE
  • Small aliquots were also taken at this point, protein and DNA extracted and these are referred to as "input" samples.
  • Appropriate antibodies were added at 2-4 ⁇ g per mg of pre- cleared cell supernatant and incubated at 4°C overnight.
  • Protein-G-Spharose beads were added and incubated for a further 2 hours at 4°C.
  • the sepharose-beads were pelleted by centrifugation, resuspended in IP buffer and were sequentially washed twice in low salt buffer (IP buffer + 150 mM NaCl) , twice in high salt buffer (IP buffer + 500 mM NaCl) , once in LiCl wash buffer (10 mM Tris pH 8.0, 1 mM EDTA, 0.5% NP-40, 0.5% sodium deoxycholate, 250 mM LiCl) and twice in TE.
  • Bound protein-DNA complexes were eluted in pre-warmed (65°C) Elution buffer (50 mM Tris pH8.0, 1% SDS, 100 mM NaHC0 3 10 mM EDTA). Protein-DNA cross links were reversed by adding NaCl to a final concentration of 200 mM and incubating at 65°C for 4 hours. DNA was purified by treatment with proteinase-K and phenol: chloroform: IAA extraction then ethanol precipitated in the presence of yeast tRNA carrier. The presence of HIV-1 LTR DNA ends was detected by PCR using primers LTR5 and LTR6 (von Schwedler et al . , 1993; Naldini et al . , 1996). To allow for semi-quantitative analyses, all PCR reactions were performed using 10-fold serially diluted DNA preparations (1, 10, 100- fold dilutions) and normalised to HIV-1 LTR PCRs of input DNA.
  • ES cells were seeded at 2 xlO 5 cells per well in gelatinised 6 well plates and allowed to attach for 24 hours.
  • MOI 0.5 in the presence of 8 ⁇ g/ml polybrene.
  • cells were washed in lx PBS and harvested by trypsin-EDTA treatment. Cells were washed in lx PBS then incubated in 300 ⁇ l lx PBS with 100 ⁇ g/ml RNase A (Sigma) at room temperature for 10 minutes.
  • GAPDH control PCRs were performed under the same conditions as for HIV-1 PCRs. All PCR reactions were limited to 20-26 cycles to ensure linearity of amplification. 1/lOth of the PCR reactions were separated on 2% agarose gels, transferred onto nitrocellulose membranes and Southern hybridised with 32 P-labelled (Rediprime kit, Amersham-Pharmacia) HIV-LTR or GAPDH cDNA probes using standard methods. Membranes were exposed to X-ray film at - 80°C and bands quantified by densitometry using the Cyclone phosphoimaging system (Packard) .
  • Transduced cells were propagated, without selection, for 21 days and high MW genomic DNA extracted using Qiagen Blood and Cell Culture (Genomic tip-20) DNA mini kit.
  • Integrated proviral DNA sequences were detected by PCR of the luciferase reporter gene using primers using primers LUC93F (GAGATACGCCCTGGTTCCTG - SEQ ID NO: 3) and LUC-597R (AGAGGAGTTCATGATCAGTGC - SEQ ID NO: 4) .
  • GAPDH control and 2- LTR PCRs were performed as previously described. At 21 days after transduction no 2-LTR (unintegrated) DNA could be detected in the DNA preparations. To enable accurate estimates of proviral copy number all PCR reactions were performed on 10-fold serially diluted DNA preparations (1, 10, 100, 1000-fold dilutions) and normalised to GAPDH control PCRs.
  • cells were typsin-EDTA harvested and apoptotic/dead cells stained by incubation with annexin-V and PI (BD Pharmingen) according to the manufacturers recommended conditions.
  • the number of live (annexin-V/PI negative) , early apoptotic (annexin-V postitive/PI negative) and late apoptotic/dead (annexin-V/PI positive) cells were quantified by flow cytometric analysis using a BD FACScalibur and CellQuest software.
  • Rad52 prevents the association of other retroviral cDNA end-binding proteins, in addition to Ku, that form part of the pre-integration complex (Bowerman et al . , 1989).
  • Candidate proteins could include integration co-factors such as Inil (hSNF5; Kalpana et al .
  • Ku does not exhibit the same inhibitory effects as Rad52 despite being an active part of the pre-integration complex.
  • Ku when bound internally onto the retroviral cDNA may not interfere with the association of other DNA-end binding proteins such as integrase. Indeed, studies have demonstrated that Ku does not affect the cleavage or strand-transfer activities of integrase in-vi tro (Li et al . , 2001).
  • NHEJ and HR DNA repair pathways may represent common cellular targets, hijacked by viruses to complete their infectious cycles. Modulation of NHEJ or HR DNA repair proteins therefore provides the potential to regulate viral infection. For example, by targeting the NHEJ pathway and its associated signalling pathways retroviral infection may be repressed. Alternatively, inhibition of RAD52 gene expression may be used to achieve a considerable enhancement of viral vector-based gene transduction, significantly increasing the potential of retroviral-based gene therapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés et des moyens d'amélioration de l'intégration rétrovirale. L'intégration rétrovirale est activée dans des cellules de mammifères par inhibition de l'activité de liaison de RAD52 ADN, p. ex. au moyen d'ARNi. Ces procédés et ces moyens sont utiles dans la thérapie génique, notamment ex vivo. L'intégration rétrovirale est inhibée par augmentation de l'activité de liaison RAD52 ADN de mammifères, utile dans l'inhibition de rétrovirus.
PCT/GB2003/003889 2002-09-06 2003-09-08 Procedes et moyens d'amelioration de l'integration retrovirale WO2004022763A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003263335A AU2003263335A1 (en) 2002-09-06 2003-09-08 Methods and means for improving retroviral integration

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US40930902P 2002-09-06 2002-09-06
US60/409,309 2002-09-06
GB0220757.9 2002-09-06
GBGB0220757.9A GB0220757D0 (en) 2002-09-06 2002-09-06 Methods and means for improving retroviral integration

Publications (1)

Publication Number Publication Date
WO2004022763A1 true WO2004022763A1 (fr) 2004-03-18

Family

ID=31980018

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/003889 WO2004022763A1 (fr) 2002-09-06 2003-09-08 Procedes et moyens d'amelioration de l'integration retrovirale

Country Status (2)

Country Link
AU (1) AU2003263335A1 (fr)
WO (1) WO2004022763A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003089573A2 (fr) * 2002-04-05 2003-10-30 Fishel Richard A Techniques d'identification de composes qui modulent une voie de reparation d'adn et/ou une infectivite retrovirale, composes et utilisation de ceux-ci

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003089573A2 (fr) * 2002-04-05 2003-10-30 Fishel Richard A Techniques d'identification de composes qui modulent une voie de reparation d'adn et/ou une infectivite retrovirale, composes et utilisation de ceux-ci

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
PARK MIN S: "Expression of Human RAD52 Confers Resistance to Ionizing Radiation in Mammalian Cells", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 26, 1995, pages 15467 - 15470, XP002265940, ISSN: 0021-9258 *
RIJKERS TONNIE ET AL: "Targeted inactivation of mouse RAD52 reduces homologous recombination but not resistance to ionizing radiation", MOLECULAR AND CELLULAR BIOLOGY, vol. 18, no. 11, November 1998 (1998-11-01), pages 6423 - 6429, XP002265937, ISSN: 0270-7306 *
VAN DYCK ERIC ET AL: "Binding of double-strand breaks in DNA by human Rad52 protein", NATURE (LONDON), vol. 398, no. 6729, 22 April 1999 (1999-04-22), pages 728 - 731, XP002265938, ISSN: 0028-0836 *
ZENTILIN LORENA ET AL: "Involvement of cellular double-stranded DNA break binding proteins in processing of the recombinant adeno-associated virus genome", JOURNAL OF VIROLOGY, vol. 75, no. 24, December 2001 (2001-12-01), pages 12279 - 12287, XP002265939, ISSN: 0022-538X *

Also Published As

Publication number Publication date
AU2003263335A1 (en) 2004-03-29

Similar Documents

Publication Publication Date Title
Mengwasser et al. Genetic screens reveal FEN1 and APEX2 as BRCA2 synthetic lethal targets
Rizzo et al. SIRT6 interacts with TRF2 and promotes its degradation in response to DNA damage
Parplys et al. RAD51AP1-deficiency in vertebrate cells impairs DNA replication
Lau et al. Suppression of retroviral infection by the RAD52 DNA repair protein
Ruis et al. Absence of XRCC4 and its paralogs in human cells reveal differences in outcomes for DNA repair and V (D) J recombination
Kulkarni et al. Effect of telomere proximity on telomere position effect, chromosome healing, and sensitivity to DNA double-strand breaks in a human tumor cell line
Fu et al. HIV-1 exploits the Fanconi anemia pathway for viral DNA integration
Smith et al. Evidence that the Nijmegen breakage syndrome protein, an early sensor of double-strand DNA breaks (DSB), is involved in HIV-1 post-integration repair by recruiting the ataxia telangiectasia-mutated kinase in a process similar to, but distinct from, cellular DSB repair
Romeo et al. BRCA1 is required for hMLH1 stabilization following doxorubicin-induced DNA damage
US20040197913A1 (en) Methods and means for improving retroviral integration
Anisenko et al. Role of cellular DNA repair systems in HIV-1 replication
WO2004022763A1 (fr) Procedes et moyens d'amelioration de l'integration retrovirale
CA2277483A1 (fr) Procedes et moyens lies a l'integration de retrovirus et de retrotransposon
GB2393183A (en) Methods and means for promoting retroviral integration comprising inhibiting rad52
US20050158724A1 (en) Methods, of identifying compounds that modulate a dna repair pathway and/or retroviral infectivity, the compounds, and uses thereof
US20040014701A1 (en) Inhibiting retrotransposon and retroviral integration by targeting the atm pathway
US20240043480A1 (en) Activating mitotic checkpoint control mechanisms
Brozkova The role of the human SMC5/6 complex in genome stability
Boleslavská Molecular mechanisms of genome integrity maintenance under conditions of replication stress
Rai et al. Telomeres cooperate with the nuclear envelope to maintain genome stability
VENEZIANO BROCCIA Role of RNA: DNA hybrids management in controlling mitotic chromosome structure in human cancer cells
Mao Interplay between regulation of promoter proximal pausing, BRCA1 and PARP inhibitor, and their effects on G-MiDS
Daniel DNA repair in HIV-1 infection: a case for inhibitors of cellular co-factors?
Shen Mechanistic evaluation of NSD3 in the pathogenesis of acute myeloid leukemia
Capper Targeting DNA Repair Mechanisms in MYC-Driven Cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP