WO2004020609A9 - Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection - Google Patents

Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection

Info

Publication number
WO2004020609A9
WO2004020609A9 PCT/US2003/027401 US0327401W WO2004020609A9 WO 2004020609 A9 WO2004020609 A9 WO 2004020609A9 US 0327401 W US0327401 W US 0327401W WO 2004020609 A9 WO2004020609 A9 WO 2004020609A9
Authority
WO
WIPO (PCT)
Prior art keywords
streptococcus
rlra
polypeptide
pneumoniae
streptococcus pneumoniae
Prior art date
Application number
PCT/US2003/027401
Other languages
French (fr)
Other versions
WO2004020609A3 (en
WO2004020609A2 (en
Inventor
Andrew Camilli
David L Hava
Original Assignee
Univ Tufts
Andrew Camilli
David L Hava
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Tufts, Andrew Camilli, David L Hava filed Critical Univ Tufts
Priority to AU2003268353A priority Critical patent/AU2003268353A1/en
Publication of WO2004020609A2 publication Critical patent/WO2004020609A2/en
Publication of WO2004020609A9 publication Critical patent/WO2004020609A9/en
Publication of WO2004020609A3 publication Critical patent/WO2004020609A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • Virulence determinants of pathogens can either be essential for virulence, or not essential yet still play a role in the infection process. This distinction arises because some virulence determinants are partially or fully redundant with other determinants, and thus a mutation that prevents expression of one such determinant does not cause a noticeable attenuation of virulence because the other determinants can compensate for the missing activity/function. For example, the ability to obtain iron during infection of human tissues is a critical requirement for the virulence of most bacterial pathogens. However, many well studied pathogens have been found to employ multiple, independent systems to obtain iron from a variety of host iron- containing molecules such as heme, hemoglobin or lactoferrin. Inhibiting the function of one pathway, for example the uptake of herne, may not cause an attenuation in virulence because the pathway for lactoferrin remains intact.
  • U.S. published application 20030091577A1 discloses potentially protective protein antigens which contain signal sequences and/or LPXTG motifs. These proteins are predicted to be exported outside the bacteria and anchored onto the surface, respectively. While this patent does test a small set of peptides for protective efficacy in a mouse immunization and challenge model, only a marginal protective effect is seen for only three of the peptides tested. Thus, it is likely that the majority of these nucleic acids will fail to encode useful protective antigens if tested in the same model system.
  • the present invention provides isolated nucleic acid molecules, having the nucleic acid sequences shown in Table 6 as SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55-56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96-97, 99-105, 107-110, 112-114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173- 184, 187-191, 193-217, 219-222, 224-227, 229-230, and 232-237.
  • the present invention also provides isolated polynucleotides encoding the S.
  • Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a) or (b) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a) or (b) above.
  • This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
  • Additional nucleic acid embodiments of the invention relate to isolated nucleic acid molecules comprising polynucleotides which encode the amino acid sequences of epitope-bearing portions of an S. pneumoniae polypeptide having an amino acid sequence in (a) above.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using these vectors for the production of S pneumoniae polypeptides or peptides by recombinant techniques.
  • the invention further provides isolated S. pneumoniae polypeptides having an amino acid sequence selected from the group consisting of an amino acid sequence of any of the polypeptides as claimed in the present invention, as shown in as claimed in the present invention in Table 6.
  • polypeptides of the present invention also include polypeptides having an amino acid sequence with at least 10% similarity, and more preferably at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% similarity to those described in as claimed in the present invention in Table 6, as well as polypeptides having an amino acid sequence at least 70%> identical, more preferably at least 75% identical, and still more preferably 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to those above; as well as isolated nucleic acid molecules encoding such polypeptides.
  • the present invention further provides a vaccine, preferably a multi- component vaccine comprising one or more of the S. pneumoniae polynucleotides or polypeptides described as claimed in the present invention in Table 6, or fragments thereof, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the S. pneumoniae polypeptide(s) are present in an amount effective to elicit an immune response to members of the Streptococcus genus in an animal.
  • a vaccine preferably a multi- component vaccine comprising one or more of the S. pneumoniae polynucleotides or polypeptides described as claimed in the present invention in Table 6, or fragments thereof, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the S. pneumoniae polypeptide(s) are present in an amount effective to elicit an immune response to members of the Streptococcus genus in an animal.
  • pneumoniae polypeptides of the present invention may further be combined with one or more immunogens of one or more other streptococcal or non-streptococcal organisms to produce a multi-component vaccine intended to elicit an immunological response against members of the Streptococcus genus and, optionally, one or more non-streptococcal organisms.
  • the vaccines of the present invention can be administered in a DNA form, e.g., "naked" DNA, wherein the DNA encodes one or more streptococcal polypeptides and, optionally, one or more polypeptides of a non-streptococcal organism.
  • the DNA encoding one or more polypeptides may be constructed such that these polypeptides are expressed fusion proteins.
  • the vaccines of the present invention may also be administered as a component of a genetically engineered organism.
  • a genetically engineered organism which expresses one or more S. pneumoniae polypeptides may be administered to an animal.
  • a genetically engineered organism may contain one or more S. pneumoniae polypeptides of the present invention intracellularly, on its cell surface, or in its periplasmic space. Further, such a genetically engineered organism may secrete one or more S. pneumoniae polypeptides.
  • the vaccines of the present invention may be co-administered to an animal with an immune system modulator (e.g., CD86 and GM-CSF).
  • an immune system modulator e.g., CD86 and GM-CSF.
  • the invention further relates to antibodies elicited in an animal by the administration of one or more S. pneumoniae polypeptides of the present invention and to methods for producing such antibodies.
  • the invention also provides diagnostic methods for detecting the expression of genes of members of the Streptococcus genus in an animal.
  • One such method involves assaying for the expression of a gene encoding S pneumoniae peptides in a sample from an animal. This expression may be assayed either directly (e.g., by assaying polypeptide levels using antibodies elicited in response to amino acid sequences described as claimed in the present invention in Table 6) or indirectly (e.g., by assaying for antibodies having specificity for amino acid sequences described as claimed in the present invention in Table 6).
  • An example of such a method involves the use of the polymerase chain reaction (PCR) to amplify and detect Streptococcus nucleic acid sequences.
  • PCR polymerase chain reaction
  • the invention further relates to a method of detecting one or more Streptococcus nucleic acids in a biological sample obtained from an animal, said one or more nucleic acids encoding Streptococcus polypeptides, comprising: (a) contacting the sample with one or more of the above-described nucleic acid probes, under conditions such that hybridization occurs, and (b) detecting hybridization of said one or more probes to the Streptococcus nucleic acid present in the biological sample.
  • the invention also includes immunoassays, including an immunoassay for detecting Streptococcus, preferably at least isolates of the S.
  • a pharmaceutical composition for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy and/or for treating Streptococcus pneumoniae infections comprising the human monoclonal antibody secreted by the hybridoma cell.
  • administration of this pharmaceutical composition can be used for the treatment of Streptococcus pneumoniae infections, to reduce the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy, being an anti viral agent.
  • the present invention provides for the use of the Streptococcus pneumoniae nucleic acids and polypeptides for the development of novel anti-microbial agents, and the use of such agents in the treatment and prophylaxis of Streptococcus pneumoniae infection.
  • Figure 4 depicts the rlrA pathogenicity islet.
  • the 12 kb locus includes a positive regulator, three surface proteins, and three sortase homologues.
  • the four genes that are required for virulence in one or more animal models are shown in white (10).
  • a riboprobe that differentially recognizes the two rlrA transcripts in AC 1278 was used to determine if RlrA is autoregulatory.
  • the larger fragment in each lane represents the mRNA from the native rlrA pathogenicity islet promoter.
  • Lanes marked with (+) are RNA samples that were harvested from cells grown in the presence of maltose.
  • DNasel units used were: lane 1 and 2 - 0.5U, lane 3 - 1U, lane 4 and 5 - 2U. Brackets indicate areas protected by RlrA-His 6 (His tag shown in SEQ ID NO: 550).
  • Figure 9B depicts the rlrA and rrgA promoter regions. The oligonucleotide fragments are shown in SEQ ID NOS 535, 559 and 560, respectively, in order of appearance. RlrA binding sites are indicated in bold and the consensus binding site is underlined.
  • the present invention takes advantage of signature tagged mutagenesis to identify novel virulence determinants of S. pneumoniae.
  • Such essential proteins are excellent candidates for vaccine development and/or antimicrobial drug development, because these proteins are required for the survival and growth of the pathogen during infection.
  • Virulence determinants of pathogens can either be essential for virulence, or not essential yet still play a role in the infection process.
  • Virulence determinants that can be shown to be essential in their own right are preferential targets for vaccine development and/or antimicrobial drug development. This is because the inhibition of the function of an essential determinant, for example by antibody binding or drug targeting, will reduce the potential of the pathogen to cause disease in the host.
  • a drug that targets and inactivates a non-essential virulence determinant will not reduce the virulence of the pathogen.
  • Such a non-essential virulence determinant may still be targeted as a protective antigen for vaccine development, however in the face of immunological pressure, given time, the pathogen may lose the factor (by mutation) or alter the antigenicity of the non-essential determinant.
  • the present invention provides isolated nucleic acid molecules which were identified as genes essential for lung infection by S. pneumoniae in a mouse model, as described below in Example 1.
  • the present invention provides isolated nucleic acid molecules comprising polynucleotides encoding the S. pneumoniae polypeptides described as claimed in the present invention in Table 6 which were determined by signature-tagged mutagenesis (STM).
  • STM signature-tagged mutagenesis
  • Table 6 below, provides information describing 237 open reading frames (ORFs) which encode potentially antigenic polypeptides of S. pneumoniae of the present invention.
  • ORFs open reading frames
  • the table lists the ORF identifier assigned by the TIGR4 sequencing group, which consists of the letters SP, which denote S.
  • each ORF identifier with a sequence identification number (SEQ ID NOs:l - 237).
  • SEQ ID NOs:l - 237 sequence identification number
  • each ORF of the present invention is described in Table 6 first by its TIGR designation, then by the SEQ ID NO assigned to the corresponding nucleic acid sequence, SEQ ID NOs: 1 - 237, and then by the SEQ ID NO assigned to the corresponding amino acid sequence, SEQ ID NOs: 238 - 474.
  • the actual nucleotide or amino acid sequence of each ORF identifier is also shown in the attached Sequence Disclosure under the corresponding SEQ ID NO.
  • a single insertion or deletion in a dete ⁇ ned nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising a nucleotide sequence described as claimed in the present invention in Table 6 and shown as SEQ ID NOs: 1 - 237; DNA molecules comprising the coding sequences for the polypeptides described as claimed in the present invention in Table 6 and shown as SEQ ID NOs:238 - 474; and DNA molecules which comprise sequences substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the S. pneumoniae polypeptides described as claimed in the present invention in Table 6.
  • the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants.
  • polynucleotides hybridizing to a larger portion of the reference polynucleotide are also useful as probes according to the present invention, as are polynucleotides corresponding to most, if not all, of a nucleotide sequence as identified in Table 6.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., a nucleotide sequences as described in Table 6).
  • the present invention also includes genetic fusions wherein the S. pneumoniae nucleic acid sequences coding sequences identified as claimed in the present invention in Table 6 are linked to additional nucleic acid sequences to produce fusion proteins.
  • These fusion proteins may include epitopes of streptococcal or non- streptococcal origin designed to produce proteins having enhanced immunogenicity.
  • the fusion proteins of the present invention may contain antigenic determinants known to provide helper T-cell stimulation, peptides encoding sites for post-translational modifications which enhance immunogenicity (e.g., acylation), peptides which facilitate purification (e.g., histidine "tag"), or amino acid sequences which target the fusion protein to a desired location (e.g., a heterologous leader sequence).
  • antigenic determinants known to provide helper T-cell stimulation
  • peptides encoding sites for post-translational modifications which enhance immunogenicity e.g., acylation
  • peptides which facilitate purification e.g., histidine "tag”
  • amino acid sequences which target the fusion protein to a desired location e.g., a heterologous leader sequence.
  • an N-terminal methionine residue is added. In many cases, however, the N-terminal methionine residues is cleaved off post-translationally.
  • the present invention includes genetic fusions wherein a S pneumoniae claimed nucleic acid sequence identified in Table 6 is linked to a nucleotide sequence encoding another amino acid sequence.
  • These other amino acid sequences may be of streptococcal origin (e.g., another claimed sequence selected from Table 6) or non-streptococcal origin.
  • Such variants include those produced by nucleotide substitutions, deletions or additions.
  • the substitutions, deletions or additions may involve one or more nucleotides.
  • These variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non- conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the S. pneumoniae polypeptides disclosed herein or portions thereof.
  • Silent substitution are most likely to be made in non-epitopic regions. Guidance regarding those regions containing epitopes is provided herein, for example, in Table 2. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to: (a) a nucleotide sequence encoding any of the amino acid sequences of the polypeptides identified as claimed in the present invention in Table 6; and (b) a nucleotide sequence complementary to any of the nucleotide sequences in (a) above.
  • nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the subject S. pneumoniae polypeptide.
  • nucleotides within some of the nucleic acid sequences shown in Table 6 were ambiguous upon sequencing. Completely unknown sequences are shown as an "N”. Other unresolved nucleotides are known to be either a purine, shown as “R”, or a pyrimidine, shown as "Y”. Accordingly, when determining identity between two nucleotide sequences, identity is met where any nucleotide, including an "R”, “Y” or “N”, is found in a test sequence and at the corresponding position in the referece sequence (from Table 6).
  • an A, G or "R” in a test sequence is identical to an "R” in the reference sequence; and a T, C or “Y” in a test sequence is identical to a "Y” in the reference sequence.
  • a nucleotide sequence described in Table 6 can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
  • Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)), to find the best segment of homology between two sequences.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence identified as claimed in the present invention in Table 6 will encode the same polypeptide.
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of S. pneumoniae polypeptides or fragments thereof by recombinant techniques.
  • the vectors provide for specific expression, which may be inducible and/or cell type-specific. Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagernids.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A available from Stratagene; pET series of vectors available from Novagen; and ⁇ trc99a, ⁇ KK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • known bacterial promoters suitable for use in the present invention include the E. coli lad and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promoters and the tip-promoter.
  • Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I, promoter.
  • retroviral LTRs such as those of the Rous sarcoma virus (RSV)
  • metallothionein promoters such as the mouse metallothionein-I, promoter.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, D ⁇ A ⁇ -dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals (for example, Davis, et al., Basic Methods In Molecular Biology (1986)).
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and ⁇ adenovirus enhancers.
  • secretion signals may be incorporated into the expressed polypeptide.
  • the signals may be endogenous to the polypeptide or they may be heterologous signals.
  • peptide and oligopeptide are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least two amino acids coupled by peptidyl linkages.
  • polypeptide is used herein for chains containing more than ten amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus.
  • polypeptides of the present invention include: (a) an amino acid sequence of any of the polypeptides described as claimed in the present invention in Table 6; and (b) an amino acid sequence of an epitope-bearing portion of any one of the polypeptides of (a); as well as polypeptides with at least 70% similarity, and more preferably at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% similarity to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence at least 70% identical, more preferably at least 75% identical, and still more preferably 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to those above.
  • %> similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711) and the default settings for determining similarity. Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)) to find the best segment of similarity between two sequences.
  • a polypeptide having an amino acid sequence at least, for example, 95%o "identical" to a reference amino acid sequence of a S. pneumoniae polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid sequence.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • amino acid sequences shown as claimed in the present invention in Table 6 may have one or more "X" residues. "X” represents unknown. Thus, for purposes of defining identity, if any amino acid is present at the same position in a reference amino acid sequence (shown in Table 6) where an X is shown, the two sequences are identical at that position.
  • any particular polypeptide is at least 70%o, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to, for instance, an amino acid sequence shown in Table 6 as claimed in the present invention, can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting Streptococcal protein expression.
  • an antigenic determinant or "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes (Geysen, et al., Proc. Natl. Acad. Sci. USA 81 :3998-4002 (1983)).
  • Predicted antigenic epitopes are shown in Table 2, below.
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals. Peptides that are extremely hydrophobic and those of six or fewer residues generally are ineffective at inducing antibodies that bind to the mimicked protein; longer, peptides, especially those containing proline residues, usually are effective (Sutcliffe, et al., p. 661).
  • 18 of 20 peptides designed according to these guidelines containing 8-39 residues covering 75% of the sequence of the influenza virus hemagglutinin HA1 polypeptide chain, induced antibodies that reacted with the HA1 protein or intact virus; and 12/12 peptides from the MuLV polymerase and 18/18 from the rabies glycoprotein induced antibodies that precipitated the respective proteins.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention.
  • a high proportion of hybridomas obtained by fusion of spleen cells from donors immunized with an antigen epitope- bearing peptide generally secrete antibody reactive with the native protein (Sutcliffe, et al., p. 663).
  • the antibodies raised by antigenic epitope-bearing peptides or polypeptides are useful to detect the mimicked protein, and antibodies to different peptides may be used for tracking the fate of various regions of a protein precursor which undergoes post-translational processing.
  • the peptides and anti-peptide antibodies may be used in a variety of qualitative or quantitative assays for the mimicked protein, for instance in competition assays since it has been shown that even short peptides (e.g., about 9 amino acids) can bind and displace the larger peptides in immunoprecipitation assays (for instance, Wilson, et al., Cell 31:161-118 (1984) p. 777).
  • the anti-peptide antibodies of the invention also are useful for purification of the mimicked protein, for instance, by adsorption chromatography using methods well known in the art.
  • Antigenic epitope-bearing peptides and polypeptides of the invention designed according to the above guidelines preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • peptides or polypeptides comprising a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention also are considered epitope-bearing peptides or polypeptides of the invention and also are useful for inducing antibodies that react with the mimicked protein.
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate Streptococcal-specific antibodies include portions of the amino acid sequences identified in Table 6 as claimed in the present invention.
  • the polypeptide fragments disclosed in Table 6 are believed to be antigenic regions of the S. pneumoniae polypeptides described in Table 6.
  • the invention further includes isolated peptides and polypeptides comprising an amino acid sequence of an epitope shown in Table 6 and polynucleotides encoding said polypeptides.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means for making peptides or polypeptides including recombinant means using nucleic acid molecules of the invention.
  • an epitope-bearing amino acid sequence of the present invention may be fused to a larger polypeptide which acts as a carrier during recombinant production and purification, as well as during immunization to produce anti-peptide antibodies.
  • Epitope-bearing peptides also may be synthesized using known methods of chemical synthesis.
  • Houghten has described a simple method for synthesis of large numbers of peptides, such as 10-20 mg of 248 different 13 residue peptides representing single amino acid variants of a segment of the HA1 polypeptide which were prepared and characterized (by ELISA-type binding studies) in less than four weeks (Houghten, R. A. Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985)).
  • This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Pat. No. 4,631,211 to Houghten and coworkers (1986).
  • animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine may be coupled to carrier using a linker such as m-maleimidobenzoyl-N- hydroxysuccinimide ester (MBS), while other peptides may be coupled to carrier using a more general linking agent such as glutaraldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ g peptide or carrier protein and Freund's adjuvant. Several booster injections may be ' needed, for instance, at intervals of about two weeks, to provide a useful titer of anti- peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
  • the immunologically important epitope in the coat protein of foot-and-mouth disease virus was located by Geysen et al. with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the entire 213 amino acid sequence of the protein. Then, a complete replacement set of peptides in which all 20 amino acids were substituted in turn at every position within the epitope were synthesized, and the particular amino acids conferring specificity for the reaction with antibody were determined.
  • peptide analogs of the epitope-bearing peptides of the invention can be made routinely by this method.
  • the present invention is useful for monitoring progression or regression of the disease state whereby patients exhibiting enhanced Streptococcus gene expression will experience a worse clinical outcome relative to patients expressing these gene(s) at a lower level.
  • test for Streptococcal infection in an animal via detection of genes encoding Streptococcal polypeptides is intended qualitatively or quantitatively measuring or estimating the level of one or more Streptococcus polypeptides or the level of nucleic acid encoding Streptococcus polypeptides in a first biological sample either directly (e.g., by detenriining or estimating absolute protein level or nucleic level) or relatively (e.g., by comparing to the Streptococcus polypeptide level or mRNA level in a second biological sample).
  • biological sample any biological sample obtained from an animal, cell line, tissue culture, or other source which contains Streptococcus polypeptide, mRNA, or DNA.
  • Biological samples include body fluids (such as plasma and synovial fluid) which contain Streptococcus polypeptides, and muscle, skin, and cartilage tissues. Methods for obtaining tissue biopsies and body fluids are well known in the art.
  • the present invention is useful for detecting diseases related to Streptococcus infections in animals.
  • Preferred animals include monkeys, apes, cats, dogs, cows, pigs, mice, horses, rabbits and humans. Particularly preferred are humans.
  • Total RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate -phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987).
  • mRNA encoding Streptococcus polypeptides having sufficient homology to the nucleic acid sequences identified as claimed in the present invention in Table 6 to allow for hybridization between complementary sequences are then assayed using any appropriate method. These include Northern blot analysis, SI nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR).
  • PCR poly
  • pnuemoniae polypeptide DNA sequence shown in Table 6 as claimed in the present invention labeled according to any appropriate method is used as probe. After hybridization overnight, the filter is washed and exposed to x-ray film. DNA for use as probe according to the present invention is described in the sections above and will preferably at least 15 bp in length.
  • levels of mRNA encoding Streptococcus polypeptides are assayed using the RT-PCR method described in Makino et al., Technique 2:295-301 (1990).
  • the radioactivities of the "amplicons" in the polyacrylamide gel bands are linearly related to the initial concentration of the target mRNA.
  • this method involves adding total RNA isolated from a biological sample in a reaction mixture containing a RT primer and appropriate buffer. After incubating for primer annealing, the mixture can be supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and reverse transcriptase.
  • RNA After incubation to achieve reverse transcription of the RNA, the RT products are then subject to PCR using labeled primers.
  • a labeled dNTP can be included in the PCR reaction mixture.
  • PCR amplification can be performed in a DNA thermal cycler according to conventional techniques. After a suitable number of rounds to achieve amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide gel. After drying the gel, the radioactivity of the appropriate bands (corresponding to the mRNA encoding the Streptococcus polypeptides)) is quantified using an imaging analyzer.
  • RT and PCR reaction ingredients and conditions, reagent and gel concentrations, and labeling methods are well known in the art. Variations on the RT- PCR method will be apparent to the skilled artisan.
  • Tissues can also be extracted, e.g., with urea and neutral detergent, for the liberation of Streptococcus polypeptides for Western-blot or dot/slot assay (Jalkanen, M., et al, J. Cell. Biol. 101:976-985 (1985); jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987)).
  • quantitation of a Streptococcus polypeptide can be accomplished using an isolated Streptococcus polypeptide as a standard. This technique can also be applied to body fluids.
  • a Streptococcus polypeptide-specific monoclonal antibodies can be used both as an immunoabsorbent and as an enzyme-labeled probe to detect and quantify a Streptococcus polypeptide.
  • the amount of a Streptococcus polypeptide present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm.
  • ELISA for detecting a tumor antigen is described in Iacobelli et al., Breast Cancer Research and Treatment 11 :19- 30 (1988).
  • two distinct specific monoclonal antibodies can be used to detect Streptococcus polypeptides in a body fluid. In this assay, one of the antibodies is used as the immunoabsorbent and the other as the enzyme-labeled probe.
  • the above techniques may be conducted essentially as a "one-step” or "two-step” assay.
  • the "one-step” assay involves contacting the Streptococcus polypeptide with immobilized antibody and, without washing, contacting the mixture with the labeled antibody.
  • the "two-step" assay involves washing before contacting the mixture with the labeled antibody.
  • Other conventional methods may also be employed as suitable. It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed from the sample.
  • Streptococcus polypeptide-specific antibodies for use in the present invention can be raised against an intact S. pneumoize polypeptide of the present invention or fragment thereof. These polypeptides and fragments may be administered to an animal (e.g., rabbit or mouse) either with a carrier protein (e.g., albumin) or, if long enough (e.g., at least about 25 amino acids), without a carrier.
  • a carrier protein e.g., albumin
  • antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab') 2 fragments) which are capable of specifically binding to a Streptococcus polypeptide.
  • Fab and F(ab') fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
  • the antibodies of the present invention may be prepared by any of a variety of methods.
  • the S. pneumoniae polypeptides identified in Table 6 as claimed in the present invention, or fragments thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
  • a preparation of a S. pneumoniae polypeptide of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of high specific activity.
  • Suitable cells can be recognized by their capacity to bind anti-Streptococcus polypeptide antibody.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP 20), available from the American Type Culture Collection, Rockville, Md.
  • SP 20 myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)).
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the Streptococcus polypeptide antigen administered to immunized animal.
  • additional antibodies capable of binding to Streptococcus polypeptide antigens may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody.
  • Streptococcus polypeptide-specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the Streptococcus polypeptide-specific antibody can be blocked by a Streptococcus polypeptide antigen.
  • Such antibodies comprise anti-idiotypic antibodies to the Streptococcus polypeptide-specific antibody and can be used to immunize an animal to induce formation of further Streptococcus polypeptide-specific antibodies.
  • Fab and F(ab ') 2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
  • Streptococcus polypepti de-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • Antibodies to Streptococcus polypeptide antigens which are produced in humans, or are "humanized” (i.e., non- immunogenic in a human) by recombinant or other teclmology.
  • Humanized antibodies may be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies) (Robinson, R. R. et al, International Patent Publication PCT/US86/02269; Akira, K. et al., European Patent Application 184, 187; Taniguchi, M., European Patent * Application 171,496; Morrison, S. L. et al., European Patent Application 173,494; Neuberger, M. S. et al., PCT Application WO 86101533; Cabilly, S. et al., European Patent Application 125,023; Better, M.
  • Suitable enzyme labels include, for example, those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate.
  • Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available.
  • Activity of an oxidase label may be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody/substrate reaction.
  • other suitable labels include
  • suitable labels for the Streptococcus polypeptide-specific antibodies of the present invention are provided below.
  • suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5 -steroid isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine esterase.
  • radioisotopic labels examples include 3 H, ⁇ n In, 125 1, 131 1, 32 P, 35 S, I4 C, 51 Cr, 57 To, 58 Co, 59 Fe, 75 Se, I52 Eu, 90 Y, 67 Cu, 217 Ci, 211 At, 212 Pb, 47 Sc, !09 Pd, etc.
  • this radionucleotide has a more favorable gamma emission energy for imaging (Perkins et al, Eur. J. Nucl. Med.
  • Examples of suitable non-radioactive isotopic labels include 157 Gd, 55 Mn, I62 Dy, 52 Tr, and 56 Fe.
  • Examples of suitable fluorescent labels include an I5 Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, and a fluorescamine label.
  • Suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.
  • chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, and an aequorin label.
  • nuclear magnetic resonance contrasting agents examples include heavy metal nuclei such as Gd, Mn, and iron.
  • the invention includes a diagnostic kit for use in screening serum containing antibodies specific against S. pneumoniae infection.
  • a kit may include an isolated S. pneumoniae antigen comprising an epitope which is specifically immunoreactive with at least one anti-S. -pneumoniae antibody.
  • Such a kit also includes means for detecting the binding of said antibody to the antigen.
  • the kit may include a recombinantly produced or chemically synthesized peptide or polypeptide antigen. The peptide or polypeptide antigen may be attached to a solid support.
  • the detecting means of the above- described kit includes a solid support to which said peptide or polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labelled anti-human antibody. In this embodiment, binding of the antibody to the S. pneumoniae antigen can be detected by binding of the reporter labelled antibody to the anti-S. pneumoniae antibody.
  • the invention includes a method of detecting S. pneumoniae infection in a subject. This detection method includes reacting a body fluid, preferably serum, from the subject with an isolated S. pneumoniae antigen, and examining the antigen for the presence of bound antibody.
  • the method includes a polypeptide antigen attached to a solid support, and serum 'is reacted with the support. Subsequently, the support is reacted with a reporter-labeled anti-human antibody. The support is then examined for the presence of reporter- labeled antibody.
  • the solid surface reagent employed in the above assays and kits is prepared by known teclmiques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plates or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
  • One preferred embodiment of the present invention provides human monoclonal antibodies to Streptococcus pneumoniae antigens. Methods for , producing human monoclonal antibodies in human/mouse chimeras are known in the art, for example in U.S. Patent No. 6,254,867, which is hereby incorporated by reference herein.
  • the present invention provides for generating hybridoma cell lines that secrete human monoclonal antibodies that specifically bind to any of the S. pneumoniae polypeptides, or fragments thereof, described in Table 6 as claimed in the present invention.
  • the antigen for example may be prepared as a suspension adsorbed on aluminum hydroxide.
  • the present invention also provides vaccines comprising one or more polypeptides of the present invention.
  • Heterogeneity in the composition of a vaccine may be provided by combining S. pneumoniae polypeptides of the present invention.
  • Multi-component vaccines of this type are desirable because they are likely to be more effective in eliciting protective immune responses against multiple species and strains of the Streptococcus genus than single polypeptide vaccines.
  • a multi-component vaccine of the present invention may contain one or more, preferably 2 to about 20, more preferably 2 to about 15, and most preferably 3 to about 8, of the S. pneumoniae polypeptides identified in Table 6 as claimed in the present invention, or fragments thereof.
  • Multi-component vaccines are known in the art to elicit antibody production to numerous immunogenic components. Decker, M. and Edwards, K., J. Infect. Dis. 11 A: S270-275 (1996).
  • a hepatitis B, diphtheria, tetanus, pertussis tetravalent vaccine has recently been demonstrated to elicit protective levels of antibodies in human infants against all four pathogenic agents. Aristegui, J. et al., Vaccine 15:7-9 (1997).
  • whole cell and whole viral vaccines are produced recombinantly and involve the expression of one or more of the S. pneumoniae polypeptides described in Table 6 as claimed in the present invention.
  • the S. pneumoniae polypeptides of the present invention may be either secreted or localized intracellular, on the cell surface, -or in the periplasmic space.
  • the S. pneumoniae polypeptides of the present invention may, for example, be localized in the viral envelope, on the surface of the capsid, or internally within the capsid.
  • Whole cells vaccines which employ cells expressing heterologous proteins are known in the art.
  • a multi-component vaccine can also be prepared using techniques known in the art by combining one or more S.
  • pneumoniae polypeptides of the present invention or fragments thereof, with additional non-streptococcal components (e.g., diphtheria toxin or tetanus toxin, and/or other compounds known to elicit an immune response).
  • additional non-streptococcal components e.g., diphtheria toxin or tetanus toxin, and/or other compounds known to elicit an immune response.
  • Such vaccines are useful for eliciting protective immune responses to both members of the Streptococcus genus and non-streptococcal pathogenic agents
  • the vaccines of the present invention also include DNA vaccines. DNA vaccines are currently being developed for a number of infectious diseases. Boyer, J et al., Nat. Med. 3:526-532 (1997); reviewed in Spier, R., Vaccine 14:1285-1288 (1996).
  • the vaccines of the present invention may be co-administered with either nucleic acids encoding immune modulators or the immune modulators themselves.
  • immune modulators include granulocyte macrophage colony stimulating factor (GM-CSF) and CD86.
  • the vaccines of the present invention are used to confer resistance to streptococcal infection through passive immunization
  • the vaccine is provided to a host animal (e.g., human, dog, or mouse), and the antisera elicited by this antisera is recovered and directly provided to a recipient suspected of having an infection caused by a member of the Streptococcus genus.
  • a host animal e.g., human, dog, or mouse
  • the ability to label antibodies, or fragments of antibodies, with toxin molecules provides an additional method for treating streptococcal infections when passive immunization is conducted.
  • pneumoniae polypeptides disclosed herein, or fragments thereof, as well as other Streptococcus proteins are labeled with toxin molecules prior to their administration to the patient.
  • toxin derivatized antibodies bind to Streptococcus cells, toxin moieties will be localized to these cells and will cause their death.
  • the present invention thus concerns and provides a means for preventing or attenuating a streptococcal infection resulting from organisms which have antigens that are recognized and bound by antisera produced in response to the polypeptides of the present invention.
  • a vaccine is said to prevent or attenuate a disease if its administration to an animal results either in the total or partial attenuation (i.e., suppression) of a symptom or condition of the disease, or in the total or partial immunity of the animal to the disease.
  • the administration of the vaccine may be for either a "prophylactic" or "therapeutic" purpose.
  • the compound(s) are provided in advance of any symptoms of streptococcal infection.
  • the prophylactic administration of the compound(s) serves to prevent or attenuate any subsequent infection.
  • the compound(s) is provided upon or after the detection of symptoms which indicate that an animal may be infected with a member of the Streptococcus genus.
  • the therapeutic administration of the compound(s) serves to attenuate any actual infection.
  • the S. pneumoniae polypeptides, and fragments thereof, of the present invention may be provided either prior to the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
  • a composition is said to be "pharmacologically acceptable” if its administration can be tolerated by a recipient animal and is otherwise suitable for administration to that animal.
  • Such an agent is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
  • the vaccine of the present invention when it is provided to an animal, it may be in a composition which may contain salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition.
  • Adjuvants are substances that can be used to specifically augment a specific immune response. These substances generally perform two functions: (1) they protect the antigen(s) from being rapidly catabolized after administration and (2) they nonspecifically stimulate immune responses. [00152] Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the animal being immunized. Adjuvants can be loosely divided into several groups based upon their composition.
  • compositions of the present invention can be administered parenterally by injection, rapid infusion, nasopharyngeal absorption (intranasopharangeally), dermoabsorption, or orally.
  • the compositions may alternatively be administered intramuscularly, or intravenously.
  • Compositions for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.
  • Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form.
  • Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water.
  • inert diluents such as purified water.
  • such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents.
  • Therapeutic compositions of the present invention can also be administered in encapsulated form.
  • Encapsulated vaccines of the present invention can be administered by a variety of routes including those involving contacting the vaccine with mucous membranes (e.g., intranasally, intracolonicly, intraduodenally). Many different techniques exist for the timing of the immunizations when a multiple administration regimen is utilized. It is possible to use the compositions of the invention more than once to increase the levels and diversities of expression of the immunoglobulin repertoire expressed by the immunized animal. Typically, if multiple immunizations are given, they will be given one to two months apart. [00155] According to the present invention, an "effective amount" of a therapeutic composition is one which is sufficient to achieve a desired biological effect. Generally, the dosage needed to provide an effective amount of the composition will vary depending upon such factors as the animal's or human's age, condition, sex, and extent of disease, if any, and other variables which can be adjusted by one of ordinary skill in the art.
  • Signature-tags were PCR amplified from a plasmid preparation of pUTmTn5Km2 (Hensel et al, 1995) using primers P6 and P7.
  • PCR amplification conditions were as follows: 30 cycles of 96°C for 30 s, 94°C for 20 s, 52°C for 45 s, and 72°C for 10 s, followed by a final dwell at 72 °C for 15 minutes.
  • PCR products were ethanol precipitated and resuspended in Bgl II buffer (New England Biolabs), and digested with Bgl II overnight at 37°C. Plasmid pEMcat was digested overnight with Bgl II.
  • Both the linearized plasmid and the signature- tags were gel purified, and the former was dephosphorylated using shrimp alkaline phosphatase according to the manufacturer's instructions (Boehringer Mannheim). Purified signature-tags were ligated into the vector overnight with T4 DNA ligase (New England Biolabs) and the ligation mixture was introduced into E. coli DH5 ⁇ pir via electroporation. Transformants were selected on Luria-bertani (LB) agar plates supplemented with Cm.
  • LB Luria-bertani
  • Transformants that contained uniquely tagged mini-transposons on pEMcat were isolated as follows. Colony purified transformants were grown overnight in four microtiter plates, each plate comprised a pool. Next, 4 ⁇ l of each well was spotted onto Duralon nitrocellulose membranes, one pool per membrane (Stratagene). Membranes (one per pool) were transferred onto filter paper (Whatman) saturated in denaturation solution (0.5N NaOH, 1.5M NaCl) for 10 minutes (mins), 0.1% SDS for 3 min, and lastly, neutralization solution [1.0M Tris HC1 (pH 7.5), 1.5M NaCl] for 3 min, at which time, DNA was cross-linked to membranes in a UV Stratalinker (Stratagene).
  • the membranes were incubated in 3X SSC, 0.1% SDS for lh, and cellular debris was gently removed from the membranes by rubbing with Kimwipes (Kimberly-Clarke).
  • Probe was generated from each pool using primers P6 and P7 by dioxygenin(DIG)-dUTP labeling PCR as described by the manufacturer (Roche).
  • Cross-reacting signature-tags were eliminated between each of the pools by successive hybridizations of probe from one pool to blots with tags from another pool. From these hybridizations, 129 strains that did not cross-hybridize were randomly assembled into two new pools, and screened for cross-hybridizing signature-tags as above.
  • Cells were washed in sterile dH 0, resuspended in 200 ⁇ l of lysis buffer (0.1% deoxycholate, 0.01% SDS, 0.15M NaCl) and incubated at 37°C for 10 min. Next, 0.9 ml of SSC was added and samples were incubated an additional 10 min at 65°C. The cell lysate was phenol extracted, chloroform extracted and ethanol precipitated. Precipitated DNA was washed in 70% ethanol, and resuspended in 200 ⁇ l of 50mM Tris-HCl (pH 7.5), 5mM CaCl 2 .
  • Magellan5 transposon insertions into the rlrA locus were generated identically to the magellan2 mutagenesis, except that two different 7 kb PCR products were used as target DNA.
  • PCR products were amplified from AC353 with primer sets TNPAB-F/REG2-R and REG2-F/PFL-R (Table 4) and purified using the Qiagen PCR purification kit according to manufacturers guidelines. In vitro transposition, gap repair, and natural transformation were carried out exactly as for magellanl.
  • mice In all animal infections 6 - 10 week-old female Swiss Webster mice were used (Taconic Labs). Mice were provided with continuous food and water, and housed according to the Tufts University Department of Lab Animal Medicine guidelines. Pools were prepared for infection by resuspending —1 ⁇ l of frozen cells in 25 ⁇ l of THY, and plating 5 ⁇ l of each strain as a discrete spot on a blood agar plate [Blood Agar Base No. 2 (Difco) and 5% defibrinated sheep blood] supplemented with Cm and Sm.
  • Blood Agar Base No. 2 (Difco) and 5% defibrinated sheep blood supplemented with Cm and Sm.
  • each resuspended pool was inoculated intranasally into two lightly anesthetized mice using methoxyflurane inhalation. The infections were carried out for 44 h at which time, mice were sacrificed by CO asphyxiation. Both lungs from each animal were aseptically removed, and homogenized in 5 ml of THY- glycerol (20% v/v) and stored at -75°C.
  • the ratio of mutant to wild-type bacteria, for both in vitro and in vivo competitions was determined by first plating recovered bacteria on TSA blood plates with Sm, and subsequently replica-plating colonies to plates with Sm or Sm and Cm.
  • Competitive indices were calculated as the ratio of mutant to wild-type bacteria recovered from each animal (in vivo CI) or from THY broth (in vitro CI) adjusted by the input ratio.
  • the site of the magellanS transposon insertions in the rlrA locus were first determined by PCR using either TNPAB-F or PFLA-R with the primer MarOUT, which anneals to either end of the mini-mariner transposons, followed by gel electrophoresis. Select PCR products were then purified with the Qiagen PCR purification and the DNA sequence of the transposon junction was determined using MarOUT by the Tufts University Core Sequencing Facility.
  • chromosomal DNA was prepared from strain AC353, a streptomycin-resistant derivative of TIGR4 (Tettelin et al., 2001), and mutagenized by in vitro transposition with magellan2.
  • Magellan! a mini-transposon derivative of mariner, inserts into the pneumococcal chromosome in a highly random manner (data not shown), requiring only a TA dinucleotide at the insertion site (Lampe et al, 1996).
  • Transposon mutagenesis was performed as described (Akerley et ah, 1998), except that 63 magellanl derivatives, each containing a unique 40 basepair (bp) signature tag were used. Following transposition, mutagenized DNA was transformed into naturally competent AC353 as described (Bricker and Camilli, 1999). Approximately 100 insertion strains were sequentially collected from each of the 63 magellan2 derivatives into the wells of microtiter plates, resulting in 100 pools of 63 signature tagged insertion strains for STM screening. Determination of colonization bottlenecks
  • a pool complexity of 63 strains administered at 2 x 10 7 CFU/mouse results in all 63 strains having an equal opportunity to adhere and multiply in the mouse lung, and strains that fail to be recovered after 44 h are attenuated.
  • the pool complexity used here is intermediate to that chosen for two prior STM screens in S. pneumoniae.
  • Polissi et al. (Polissi et al., 1998) used a pool complexity of 50 strains, mutagenized by plasmid insertion-duplication, to infect BALB/c mice in a murine model of pneumonia.
  • Lau et al. Lau et al. (Lau et al., 2001) used a pool complexity of 96 strains, also mutagenized by plasmid insertion-duplication, to infect CD- 1 mice in murine models of pneumonia and bacteremia.
  • Bacteria were enumerated from the lungs at 44 h and after 5 h from THY broth by plating serial dilutions on media selective for both wild-type and test strains, and then replica plating the colonies to media selective for only the test strain.
  • the in vivo competitive index (CI) was calculated by dividing the ratio of mutant to wild-type bacteria recovered from the lungs by the ratio of mutant to wild- type bacteria that were inoculated into each animal.
  • the in vitro CI was calculated using THY broth cultures in order to assess general growth defects.
  • the geometric means of the CIs for each strain are listed in Table 2; a mean CI of less than 1 indicates a defect in virulence (or growth in vitro) of the test strain.
  • rofA regulates the expression of a divergently transcribed gene coding for Protein F, a factor that mediates attachment to fibronectin (Fogg et al, 1994).
  • the pneumococcal rofA homologue herein named rlrA, for rof ⁇ -like regulator, is divergently transcribed from six genes (SP0462 to SP0468), three of which have very weak homology to microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), and three that have homology to sortases ( Figure 1).
  • Sortases are enzymes that catalyze the covalent linkage of a family of secreted proteins that contain an LPXTG (SEQ ID NO: 530) motif to the bacterial cell wall (Mazmanian et al, 2001). Although these three S. pneumoniae sortases were apparent from the genome sequence (Pallen et al, 2001; Tettelin et al, 2001), no experimental data to characterize these has been reported. In work to be reported elsewhere, RlrA was found to regulate the transcription of these six genes, and thus the three putative MSCRAMMs have been named rrgA, rrgB, and rrgC for RlrA-regulated gene.
  • transposon insertion was coarsely mapped by PCR using a template specific primer and a transposon specific primer, and the junction sequence of the transposon/m ge/ZcmJ junctions in selected strains was determined by DNA sequencing. Transposon insertions were obtained throughout the locus, including numerous insertions in each gene in the locus, thus demonstrating that neither the sortase genes, nor the rrg genes are essential for growth of S. pneumoniae in vitro.
  • the extracellular polysaccharide capsule plays an absolute role in the pathogenesis of S. pneumoniae.
  • the majority of the biosynthetic genes coding for the serotype 4 capsule appear to be organized into a single operon of approximately 15 kilobases (kb), representing about 0.7 % of the TIGR4 genome.
  • kb kilobases
  • the insertion in strain STM237 could potentially have polar effects on hkll/rrll.
  • Four of these five strains were tested in competition assays. Three strains were attenuated in competition assays in the lung, but they each had different phenotypes in the bacteremia model; zmpR was not attenuated, rrOl was attenuated 4-fold, and STM237 was attenuated 14-fold. Additionally, rrOl was severely outcompeted by the wild-type strain during nasopharyngeal colonization, making it the only one of the three TCSTSs tested that was required in all three models.
  • Throup et al (Throup et al, 2000) used the respiratory tract infection (RTI) model to test TCSTS mutants for virulence defects, which employs single strain infections and relies on the titer of the mutant strain compared to the wild-type strain following 48 h of infection to determine the virulence phenotype.
  • RTI respiratory tract infection
  • mutations in rrOl and zmpR each attenuated virulence, which is consistent with our findings, however, a mutation in hklllrrll did not.
  • Lange et al. (Lange et al, 1999) examined mutant TCSTS strains for defects during systemic infection by determining the mean survival time of mice infected with each strain.
  • the sequencing project of the TIGR4 strain identified a small number of loci that are not conserved in two other pneumococcal strains (Tettelin et al, 2001).
  • One such locus encodes rlrA (SP0461), a ro A-like transcriptional regulator, and six divergently transcribed genes including three putative MSCRAMM surface proteins.
  • the present screen identified two genes in this locus, rlrA and srtD, and subsequently tested the other five genes for roles during infection.
  • rrgA, rrgB, and rrgC code for putative surface proteins that are homologous to MSCRAMM family members, and thus it is predicted that they may be involved in the attachment of S. pneumoniae to mucosal surfaces. Consistent with this hypothesis, the rrgA strain was attenuated in both the pneumonia and the nasopharynx carriage model, but not the bacteremia model.
  • RrgA, RrgB, and RrgC have sorting signals that are characteristic of proteins that are anchored to the gram- positive cell wall by sortases (Mazmanian et al, 2001).
  • the sorting signal is composed of a C-terminal sequence consisting of an LPXTG motif (SEQ ID NO: 530), followed by a stretch of hydrophobic residues, and a series of charged residues (Schneewind et al, 1993).
  • RrgA, RrgB, and RrgC each have these characteristics, except that the leucine is replaced by a tyrosine, isoleucine and valine, respectively ( Figure IB).
  • sortases are transpeptidases that anchor target proteins by cleaving the peptide bond between the threonine and glycine of the LPXTG (SEQ ID NO: 530) and covalently anchoring the threonine to the cell wall.
  • TIGR4 genomic sequence also contains a fourth sortase, srtA. SrtA is found in at least two other S.
  • sortases fall into at least two different groups, one group that contains the commpn sortases to many Gram-positive bacteria and a second group containing specialized sortases.
  • SrtA anchors the majority of the LPXTG (SEQ ID NO: 530) containing proteins
  • SrtB has only been shown to anchor a single protein that contains an asparagine substituted for the leucine in the LPXTG motif (SEQ ID NO: 530).
  • srtB is transcriptionally regulated in response to changing iron conditions, rather than being expressed constitutively (Mazmanian et al, 2002).
  • S. suis five sortase homologues have been identified, and as in S.
  • SrtA is susptected to anchor most LPXTG (SEQ ID NO: 530) containing proteins in S. pneumoniae, and the remaining sortases may then anchor a specific set of surface proteins in different environmental conditions in response to different environmental cues. It is plausible to speculate that the role for SrtB, SrtC, and SrtD proteins in TIGR4 is to anchor the (L)PXTG-motif (SEQ ID NO: 530) proteins RrgA, RrgB, and RrgC, which are coded by the genes flanking srtBCD.
  • EXAMPLE 2 Transcriptional Regulation in the Streptococcus pneumoniae rlrA Pathogenicity Islet by RlrA
  • the bacterial strains and plasmids used in this study are listed in Table 1.
  • the parental strain for all S. pneumoniae genetic manipulations was AC353, a streptomycin resistant (Sm R ) derivative of TIGR4 (10).
  • S. pneumoniae strains were grown in Todd-Hewitt broth plus 5% yeast extract (THY), and supplemented with 0.8%) maltose when indicated.
  • the antibiotic concentrations used in this study were as follows: Sm lOO ⁇ g/ml, chloramphenicol (Cm) 4 ⁇ g/ml, and spectinomycin (Spc) 200 ⁇ g/ml for S.
  • rlrA was PCR amplified from AC353 with the primer set RLRAFR/RLRARX.
  • the Shine-Dalgarno sequence of the S. pneumoniae rpoB was engineered into the RLRAFR sequence to allow optimal translation efficiency of rlrA at the maltose locus.
  • Each of these fragments were subcloned separately into pCR-Script Amp SK(+) (Stratagene) and subsequently inserted into pAClOOO, to generate pCH84.
  • pAClOOO is a derivative of pEVP3 (3) that was created by PCR amplifying the pEVP3 vector backbone using the primer set PEVPF1/PEVPR1 to delete the promoterless lacZ gene in pEVP3.
  • the resulting product was digested with BamHI, gel purified, and ligated overnight at 4°C.
  • the final construct contains the ⁇ -malM sequence and the 5'-malP sequence flanking the rlrA coding sequence and the cat gene.
  • the S pneumoniae strain overexpressing rlrA, pCH84 was linearized by digestion with.Y7z ⁇ E and the gel- purified fragment was transformed into naturally competent AC353 as described (10). The double recombination event was selected by plating on Cm and confirmed by PCR and DNA sequencing.
  • RPAs Ribonuclease protection assays
  • the resulting products were purified using the QIAquick PCR purification kit, subsequently cloned into pGEM-T (Promega), and confirmed by PCR using both an SP6 or T7 primer and a primer specific to the cloned insert.
  • These plasmids (AC 1279 - AC 1286, AC 1293; Table 1) were used as templates for the generation of riboprobes as described (19).
  • Synthesized probes were gel purified on a 4%> denaturing polyacrylamide gel containing 7M urea. Ribonuclease protection assays were carried out as described by the manufacturer using the RPAII kit (Ambion).
  • the protected fragments were visualized by exposing each gel to a phosphor imaging screen (Kodak) and analyzed using a Storm 860 scanner and IQMac VI.2 imaging software. The relative amount of each protected fragment in each assay was normalized to the amount of rpoB protected RNA in each lane. [00204] Northern blotting
  • Primer extension reactions were earned out using the AMV primer extension reverse transcriptase system (Promega).
  • RNA was isolated from AC 1278 as described above.
  • a primer corresponding to 5 ' end of each coding sequence was end labeled with [ ⁇ -P 32 ]-ATP using T4 polynucleotidekinase (PNK) for 10 min. at 37°C.
  • the primers used were: RLRAPE2, RRGAP2, RRGBPE, RRGCPE, SRTBPB, SRTCPE, and SRTDPE (Table 1). End labeled primers were annealed to total RNA extracted from AC1278 by incubation at 58°C for 20 minutes followed by cooling to room temperature for 10 min.
  • DNA fragments predicted to contain promoter regions in the islet were PCR amplified from AC353 using the following primer sets: RLRA2/RRGA2, RRGB2/RRGBR1, RRGC2/RRGBF2, SRTBP1/SRTBP2, and SRTCD1/SRTCD2.
  • PCR products were purified using the Stratagene PCR purification kit according to the provided protocol (Stratagene) and purified products were subsequently cloned into pGEM-T (Promega) to generate plasmids AC1287, AC1288, AC1289, AC1290, and AC 1291, respectively.
  • DNA sequencing of rlrA pathogenicity islet promoter regions was performed using the Sequenase 2.0 DNA sequencing kit according to the manufacturers specifications (USB). Briefly, strains AC1287, AC1288, AC1289, AC 1290, and AC 1291 were grown in 4mL of LB broth and plasmid DNA was purified using the Qiagen mini plasmid prep system (Qiagen). Plasmid DNA was resuspended in lOO ⁇ L of TE [10 mM Tris pH 8.0, 1 mM EDTA] and subsequently denatured by the addition of 25 ⁇ L of IN NaOH, lOmM EDTA and incubation at 37°C for 30 min.
  • TE 10 mM Tris pH 8.0, 1 mM EDTA
  • Single stranded DNA was ethanol precipitated by the addition of 1/10 vol of 3M sodium acetate (pH 5.2) and 2 vol 100% ethanol.
  • Precipitated DNA was resuspended in IX Sequenase reaction buffer and 60pmol of the appropriate primer was annealed by incubation at 37°C for 30 min.
  • Sequencing reactions were performed by the addition of Sequenase 2.0 reaction mix containing [ ⁇ S 35 ]-dATP and incubation at room temperature for 5 min.
  • 3.5 ⁇ L of each reaction was added to 2.5 ⁇ L of each dideoxynucleotide at 37°C and the termination reaction was incubated for 5 min, at which time the reaction was stopped by the addition of stop solution.
  • the predicted coding sequence of RlrA was PCR amplified from AC353 using primers RLRAC1/RLRAC2, subcloned into pGEM-T, and liberated by digestion with Ncol and Bglll. The liberated fragment was ligated into similarly digested pQE60 to create AC 1292.
  • the resulting strain containing the coding sequence for RlrA with a C-terminal His 6 tag (SEQ ID NO: 550) was grown in 2 mL of LB containing Ap to an OD 6 oo of 0.5 and expression of RlrA was induced by the addition of IPTG to ImM for 2 h.
  • RlrA-His 6 (His tag shown in SEQ ID NO: 550) was assessed by separation of induced and uninduced culture cell extracts by SDS-PAGE and subsequently by Western blotting using anti-His 6 (His tag shown in SEQ ID NO: 550) antibody (Roche) according to the ECL Western blotting protocol (Amersham Pharmacia Biotech).
  • RlrA-His 6 His tag shown in SEQ ID NO: 550
  • 2L of AC 1292 was grown as above and induced with IPTG for 2h.
  • RlrA-His 6 His tag shown in SEQ ID NO: 550
  • RlrA-His 6 His tag shown in SEQ ID NO: 550
  • RlrA-His 6 His tag shown in SEQ ID NO: 550
  • fractions were combined and concentrated using Centricon centrifugation filters (Amicon) to a final concentration of 800 nM.
  • Gel shift binding reactions were carried out using 5000 cpm of each probe with increasing concentrations of RlrA-His 6 (His tag shown in SEQ ID NO: 550) at 30°C for 15 min in gel shift binding buffer [20mM Tris (pH 8.0), 50 mM KC1, 2mM MgCl 2 , ImM EDTA, ImM DTT, 0.05% Nonidet P-40, 5%» glycerol] supplemented with l ⁇ g of (poly-dl-poly-dC)-(poly-dl-poly-dC) and bovine serum albumin as non-specific inhibitors.
  • Gel shift binding buffer [20mM Tris (pH 8.0), 50 mM KC1, 2mM MgCl 2 , ImM EDTA, ImM DTT, 0.05% Nonidet P-40, 5%» glycerol] supplemented with l ⁇ g of (poly-dl-poly-dC)-(poly-d
  • binding reactions were performed as above, chilled on ice, and incubated with 0.5 ⁇ g of anti-His 6 (His tag shown in SEQ ID NO: 550) antibody (Roche) for 30 min on ice. Reactions were subsequently separated on 5% non-denaturing polyacrylamide gel (Protogel; National Diagnostics) and visualized as described above.
  • DNasel footprinting experiments were carried out using the gel-shift protocol with 2 x 10 4 cpm of each probe. Following protein binding, the concentration of MgCl 2 and CaCl was adjusted to 5mM and lOmM and each reaction was incubated of DNasel (0.5 to 2U) for 1 minute at room temperature. Reactions were stopped by the addition of stop solution (200mM NaCl, 30mM EDTA, 1% SDS) and the digested products were extracted with an equal volume of phenol and chloroform and subsequently ethanol precipitated.
  • stop solution 200mM NaCl, 30mM EDTA, 1% SDS
  • Precipitated DNA was resuspended in loading buffer (98%o formamide, lOmM EDTA, 0.1% bromophenol blue, 0.1%) xylene cyanol) and separated on a 5% polyacrylamide/7M urea sequencing gel (National Diagnostics). Sequencing reactions of the footprinted region were performed as described above using primers specific to the region.
  • the consensus RlrA binding site was determined by PRETTY (GCG Software package) using the four RlrA binding sites determined by DNasel footprinting.
  • the resulting consensus sequence was used to query the complete TIGR4 genomic sequence using FINDPATTERNS (GCG Software package). The resulting sequences were analyzed to determine if the sequences were present in regions likely to contain S. pneumoniae promoters. RESULTS
  • RlrA a putative transcriptional regulator identified by STM
  • RlrA a homologue of RofA and Nra from Streptococcus pyogenes (6, 22).
  • rlrA has been shown to be one of seven genes in a pathogenicity islet of approximately 12 kb (see Figure 4)(10), which is not highly conserved in other S. pneumoniae strains (26).
  • LPXTG SEQ ID NO: 530
  • rrgA, rrgB, rrgC cell wall anchored surface proteins
  • RrgA, RrgB, and RrgC have C-terminal sorting signals that are characteristic of LPXTG (SEQ ID NO: 530) containing proteins, except that the leucine of the LPXTG (SEQ ID NO: 530) is deviant in each protein.
  • RrgB and RrgC have conservative changes to isoleucine and valine respectively, whereas RrgA has a change to tyrosine.
  • the C-terminal sorting signals predicts that these proteins are covalently anchored to the cell wall by sortases, which are transpeptidases found in most Gram-positive bacteria (15, 20).
  • srtD was also identified as an essential virulence gene through STM, and each was confirmed to be essential to the survival of S. pneumoniae during lung infection by testing strains with transposon insertions in each gene in competition assays against the wild-type parental strain (10).
  • the rlrA gene was also found to be essential for colonization of the nasopharynx, but not bacteremia, whereas srtD was dispensable in both of these models (10).
  • RlrA is required for wild-type levels of expression of each gene in the islet [00218]
  • RPAs were performed using RNA isolated from wild-type AC353 or AC1213, a strain that harbors a transposon insertion in rlrA.
  • the rpoB gene which codes for the ⁇ -subunit of RNA polymerase, was used to probe the same RNA preparations as the rlrA islet probes to serve as a loading control in each experiment.
  • the srtB probe protected three differently sized messages, suggesting the possibility that there are multiple transcriptional start sites within the sequence of the riboprobe.
  • a riboprobe specific to the srtA coding sequence was generated.
  • an RPA was performed using total RNA harvested from either AC353 or AC1213.
  • Figure 5B there was no difference in the amount of protected srtA message in either strain, indicating that srtA transcription occurs independently of RlrA.
  • RlrA is autoregulatorv [00220] In S. pyogenes, RofA positively regulates its own expression (5).
  • a merodiploid strain that overexpressed rlrA from an inducible promoter was constructed (AC1278). This strain contained two copies of rlrA; one present in the rlrA pathogenicity islet and a second copy integrated into the maltose utilization operon downstream of malM (24). In the latter case, expression of rlrA was under the control of the malM promoter (P réelle M/M ) 5 and thus its expression was inducible by the addition of maltose to the growth media (1).
  • this mRNA is predicted to be the rrgBC message that terminates immediately upstream of srtB coding sequence.
  • RlrA-HiSfi acts at the rrgA and rlrA promoters
  • RlrA-His 6 His tag shown in SEQ ID NO: 550
  • RlrA-His 6 retarded the mobility of the probe evinced by the presence of multiple species that migrated more slowly on the gel than the probe alone (data not shown).
  • RlrA-His 6 retains DNA binding activity, and indicates that it binds to multiple sequences between rrgA and rlrA.
  • the rlrA gene was initially identified as an essential gene for the colonization of S. pneumoniae in the murine nasopharynx and for its ability to infect the murine lung (10).
  • several genes that are divergently transcribed from rlrA and lie within a 12 kb stretch of DNA that is flanked by two insertion elements have also been shown to be essential for either or both of these two models ( Figure 4).
  • the rrgA gene codes for a predicted cell wall anchored protein of the LPXTG (SEQ ID NO: 530) family of Gram-positive surface proteins (10, 20).
  • the LPXTG motif (SEQ ID NO: 530) is part of a larger C-terminal sorting signal that targets the protein to a specific pathway that ultimately covalently anchors the protein to the cell wall (16).
  • the enzymes that anchor proteins to the cell wall in this manner are called sortases.
  • Sortases are transpeptidases that cleave between the threonine and glycine of the LPXTG motif (SEQ ID NO: 530) resulting in the anchoring of the N-terminal half of the protein by a peptide bond between the threonine and the cell wall.
  • srtBCD also divergently transcribed from rlrA are three sortase homologues, srtBCD ( Figure A). Two of these three genes have been shown to have a role during in vivo survival; srtD is essential for lung infection and srtB is essential for colonization of the nasopharynx (10).
  • RlrA exhibits amino acid sequence similarity to a number of S. pyogenes transcriptional regulators, including RofA and Nra, a positive and negative regulator, respectively. Both RofA and Nra regulate their own expression, as well as, a number of different surface proteins that interact with eukaryotic extracellular matrices, and thus are important to the pathogenesis of S. pyogenes (6, 8, 22). In each case, the gene divergently transcribed from the regulator is one target of regulation. [00232] To determine if RlrA was a regulator of neighboring genes and of its own transcription, RPAs were used to measure the steady-state levels of transcription of each gene in the rlrA pathogenicity islet.
  • RlrA was demonstrated to directly bind to four sites within the rlrA-rrgA intergenic region; two sites upstream of rlrA and two sites upstream of rrgA. In each case, there is a smaller RlrA binding site near the transcriptional start site and a larger binding site at a more distal location.
  • the srtBCD genes represent three of the four sortase homologues in the TIGR4 S. pneumoniae genome.
  • the presence of multiple sortase homologues is a common occurrence in Gram-positive bacteria genomes.
  • the role of sortases in the anchoring of surface proteins important for the pathogenicity of various organisms is well documented. To our knowledge, however, prior to the finding that srtBCD are regulated by RlrA, only one other sortase has been shown to be regulated at the transcriptional level (17).
  • the m vivo CI for each individual animal was calculated as the ratio of mutant to wild-type divided by the input ratio of mutant to wild-type bacteria
  • the geometric mean of the CIs is shown, and the number of animals infected in each experiment is indicated in parentheses
  • the number 1 as substituted as the numerator in determining the in vivo ratio for that animal, and thus thein vivo mean CI is denoted as less than the calculated value
  • Each m vivo competition was tested for statistical significance by the Student two-tailed t-test p -values ⁇ 0 05 were considered significant and the co ⁇ espo ⁇ dmg mean is shown in bold b
  • the in vitro CI was calculated as the ratio of mutant to wild-type bacte ⁇ a after 5 h of growth in THY broth adjusted by the input ratio of mutant to wild-type bacte ⁇ a c This gene desc ⁇ ption is provided in the present work Table 3. Relevant strains
  • ARB1 GGCCACGCGTGCACTAGTAC( ) ⁇ oTACNG (Merrell et al., ) ARB2 GGCCACGCGTGCACTAGTAC (Merrell et ah, ) MAG2F3 GGAATCATTTGAAGGTTGGTA This work MAG2F4 ACTAGCGACGCCATCTATGTG This work CPSF1 GCAGATAGTAAAAATAAAGGTGTAGAC This work CPSR1 TGCACTGAAGCCGAAGGCGACAAATGC This work TNPAB-F GCCTCTTCCTGAGATTATGTCCTG This work REG2-R ATTGCCGGTGTTATGTTCGTTTGG This work REG2-F ATTTGTCCAAACGAACATAACACC This work PFL-R TGAAAAATCTCTTGACTGGTTGAC This work marOUT CCGGGGACTTATCAGCCAACC This work Table 4. Strains and plasmids used in this study
  • RRGBR1 TAATACGACTCACTATAGGGGCATTGCCCTGAGAGTTTA 490
  • RRGCR2 TAATACGACTCACTATAGGGGTCATCTCAAACGAAGTCT 492
  • RRGAP2 ACGGATTACTTATGTTCTGAT 504
  • RLRAC2 AGATCTTAACAAATAGTGAGCCTTTTTA 519 REGF1 TCTAGACATGTGTGTCTCCCTGTT 520

Abstract

The present invention relates to recombinant antigenic S. pneumoniae polypeptides and fragments thereof. The invention also relates to methods for using these polypeptides to produce immunological responses and to confer immunological protection to disease caused by members of the genus Streptococcus, at least isolates of the S. pneumoniae genus. The invention further relates to nucleic acid sequences which encode antigenic S. pneumoniae polypeptides and to methods for detecting S. pneumoniae nucleic acids and polypeptides in biological samples. The invention also relates to S. pneumoniae-specific antibodies and methods for detecting such antibodies produced in a host animal.

Description

Docket No. 700355-052941 -PCT Express Mail Label No. EL 948181553 US
STREPTOCOCCUS PNEUMONIAE ANTIGENS FOR DIAGNOSIS, TREATMENT AND PREVENTION OF ACTIVE INFECTION
GOVERNMENT SUPPORT
[001] This invention was supported by National Institutes of Health training grant A 107422-08 and the government of the United States has certain rights thereto.
SEQUENCE LISTING
[002] The instant application contains a "lengthy" Sequence Listing which has been submitted via triplicate CD-R in lieu of a printed paper copy, and is hereby incorporated by reference in its entirety. Said CD-R, recorded on August 20, 2003, are labeled "CRF", "Copy 1" and "Copy 2", respectively, and each contains only one identical 1.38 Mb file (700941 PC. APP).
FIELD OF THE INVENTION
[003] The present application is directed to Streptococcus pneumoniae antigens for the detection of Streptococcus, prevention of Streptococcus, and attenuation of disease caused by Streptococcus.
BACKGROUND OF THE INVENTION
[004] Streptococcus pneumoniae remains a major cause of morbidity and mortality in the undeveloped and developed world and resistance to common antibiotics is prevalent (2, A, 27). S. pneumoniae is a component of the normal flora in the nasopharynx of approximately 50% of all adults, where it coexists with other microflora in a nonpathogenic state. In iimtiunocompromised people, the elderly, and young children, S. pneumoniae that initially colonize the nasopharynx may spread to distal sites, such as the inner ear, lower respiratory tract, or bloodstream, and cause diseases ranging from otitis media to pneumonia to meningitis (7, 18). Factors that lead to the spread from the nasopharynx to other sites of infection are not understood.
[005] Since its isolation more than 100 years ago, Streptococcus pneumoniae has been one of the most intensively studied microbes. For example, much of our early understanding that DNA is, in fact, the genetic material was predicated on the work of Griffith and of Avery, Macleod and McCarty using this microbe. Despite the vast amount of research with Streptococcus pneumoniae, however, few proteins have been identified as virulence factors involved in determining its pathogenicity.
[006] The identification of novel virulence determinants can facilitate the development of new vaccines and drug treatments, which are especially needed for organisms in which antibiotic resistance is prevalent. Antibiotic resistance is emerging rapidly in the respiratory pathogen Streptococcus pneumoniae (81), which is the causative agent of a number of diseases ranging in severity from normally benign otitis media to highly lethal meningitis. The major virulence factor required for all pneumococcal disease is the extracellular polysaccharide capsule, which protects colonizing or infecting bacteria from phagocytosis. In addition to the polysaccharide capsule, many surface exposed protein factors have been implicated in pneumococcal disease, however, knowledge of precise roles of many of these proteins in different in vivo niches is limited (21, 31).
[007] Virulence determinants of pathogens can either be essential for virulence, or not essential yet still play a role in the infection process. This distinction arises because some virulence determinants are partially or fully redundant with other determinants, and thus a mutation that prevents expression of one such determinant does not cause a noticeable attenuation of virulence because the other determinants can compensate for the missing activity/function. For example, the ability to obtain iron during infection of human tissues is a critical requirement for the virulence of most bacterial pathogens. However, many well studied pathogens have been found to employ multiple, independent systems to obtain iron from a variety of host iron- containing molecules such as heme, hemoglobin or lactoferrin. Inhibiting the function of one pathway, for example the uptake of herne, may not cause an attenuation in virulence because the pathway for lactoferrin remains intact.
[008] Virulence determinants that can be shown to be essential in their own right are preferential targets for vaccine development and/or antimicrobial drug development. This is because the inhibition of the function of an essential determinant, for example by antibody binding or drug targeting, will reduce the potential of the pathogen to cause disease in the host. In contrast, a drug that targets and inactivates a non-essential virulence determinant will not reduce the virulence of the pathogen. Such a non-essential virulence determinant may still be targeted as a protective antigen for vaccine development, however in the face of immunological pressure, given time, the pathogen may lose the factor (by mutation) or alter the antigenicity of the non-essential determinant.
[009] Despite recent progress in indentifying genes of Streptococcus pneumoniae, relatively few virulence factors have been identified. Gene identification efforts include sequencing the S. pneumoniae serotype 4 genome. For example, U.S. 6,159,469 and U.S. 6,573,082 disclose certain S. pneumoniae nucleic acids potentially useful as antigens and vaccines. However, the basis for targeting these nucleic acids is merely the presence of certain sequence motifs; no data related to the biological function of the encoded proteins is provided. These nucleic acids were apparently selected as encoding proteins with signal sequences (secreted outside the cell or anchored in the membrane), lipoprotein motifs (anchored to the cell membrane), or LPXTG motifs (anchored to the cell wall outside the cell membrane).
[0010] U.S. published application 20030091577A1 discloses potentially protective protein antigens which contain signal sequences and/or LPXTG motifs. These proteins are predicted to be exported outside the bacteria and anchored onto the surface, respectively. While this patent does test a small set of peptides for protective efficacy in a mouse immunization and challenge model, only a marginal protective effect is seen for only three of the peptides tested. Thus, it is likely that the majority of these nucleic acids will fail to encode useful protective antigens if tested in the same model system.
[0011] More detailed analysis has been performed on several other proposed virulence factors. For example, WO 03/051916 A2 discloses NAD+ synthetase and paralogs as an essential protein for targeting antimicrobial drugs. WO 03/054007 discloses detailed deletion and fusion analysis to identify the most antigenic parts of two protective peptides, BVH-3 and BNH-11.
[0012] Thus, despite recent advances in sequencing by efforts, there remains a need to identify additional S. pneumoniae virulence factors. Signature-tagged mutagenesis (STM) represents one of several recently developed techniques for the identification of genes essential for infection (82). Several studies have identified S. pneumoniae virulence factors that are essential to the survival of the bacterium in different host environments by Signature-tagged mutagenesis (STM) using murine models of infection (10, 13, 23). A subset of these factors has been shown to be specific to certain host environments (10), and therefore these genes code for proteins that have tissue specific roles during infection and colonization. Among these are a number of putative transcriptional regulators, which may regulate tissue specific virulence factors in response to different host environments. However, the STM studies which have been reported are limited in terms of both the serotypes which have been screened, and the number of mutants which have been isolated. For example, two STM screens in S. pneumoniae have been reported, one in a serotype 19 and one in a serotype 3 strain, and have identified some virulence factors while screening only a limited number of mutants (66, 76).
[0013] Accordingly, there is a need for identification of additional Streptococcus pneumoniae virulence factors, from a variety of serotypes, including the isolation of the genes encoding the virulence factors, the proteins they encode, and the development of therapeutic uses of such virulence factors.
SUMMARY OF THE INVENTION
[0014] The present invention provides isolated nucleic acid molecules, having the nucleic acid sequences shown in Table 6 as SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55-56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96-97, 99-105, 107-110, 112-114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173- 184, 187-191, 193-217, 219-222, 224-227, 229-230, and 232-237. The present invention also provides isolated polynucleotides encoding the S. pneumoniae polypeptides described in Table 6, and having the amino acid sequences shown in Table 6 as SEQ ID NOs.: 238-244, 247-250, 252, 254-273, 275-282, 284-286, 288, 292-293, 295-309, 311, 313-315, 317-319, 321, 323-325, 327-331, 333-334, 336-342, 344-347, 349-351, 353-359, 361-363, 365, 368-371, 373-374, 377-402, 404-407, 410- 421, 424-428, 430-454, 456-459, 461-464, 466-467, and 469-474. Thus, one aspect of the invention provides isolated nucleic acid molecules comprising polynucleotides having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding any of the amino acid sequences of the polypeptides shown as claimed in the present invention in Table 6; and (b) a nucleotide sequence complementary to any of the nucleotide sequences in (a).
[0015] Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a) or (b) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a) or (b) above. This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues. Additional nucleic acid embodiments of the invention relate to isolated nucleic acid molecules comprising polynucleotides which encode the amino acid sequences of epitope-bearing portions of an S. pneumoniae polypeptide having an amino acid sequence in (a) above.
[0016] The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using these vectors for the production of S pneumoniae polypeptides or peptides by recombinant techniques.
The invention further provides isolated S. pneumoniae polypeptides having an amino acid sequence selected from the group consisting of an amino acid sequence of any of the polypeptides as claimed in the present invention, as shown in as claimed in the present invention in Table 6.
[0017] The polypeptides of the present invention also include polypeptides having an amino acid sequence with at least 10% similarity, and more preferably at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% similarity to those described in as claimed in the present invention in Table 6, as well as polypeptides having an amino acid sequence at least 70%> identical, more preferably at least 75% identical, and still more preferably 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to those above; as well as isolated nucleic acid molecules encoding such polypeptides.
[0018] The present invention further provides a vaccine, preferably a multi- component vaccine comprising one or more of the S. pneumoniae polynucleotides or polypeptides described as claimed in the present invention in Table 6, or fragments thereof, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the S. pneumoniae polypeptide(s) are present in an amount effective to elicit an immune response to members of the Streptococcus genus in an animal. The S. pneumoniae polypeptides of the present invention may further be combined with one or more immunogens of one or more other streptococcal or non-streptococcal organisms to produce a multi-component vaccine intended to elicit an immunological response against members of the Streptococcus genus and, optionally, one or more non-streptococcal organisms.
[0019] The vaccines of the present invention can be administered in a DNA form, e.g., "naked" DNA, wherein the DNA encodes one or more streptococcal polypeptides and, optionally, one or more polypeptides of a non-streptococcal organism. The DNA encoding one or more polypeptides may be constructed such that these polypeptides are expressed fusion proteins.
[0020] The vaccines of the present invention may also be administered as a component of a genetically engineered organism. Thus, a genetically engineered organism which expresses one or more S. pneumoniae polypeptides may be administered to an animal. For example, such a genetically engineered organism may contain one or more S. pneumoniae polypeptides of the present invention intracellularly, on its cell surface, or in its periplasmic space. Further, such a genetically engineered organism may secrete one or more S. pneumoniae polypeptides.
The vaccines of the present invention may be co-administered to an animal with an immune system modulator (e.g., CD86 and GM-CSF).
[0021 ] The invention also provides a method of inducing an immunological response in an animal to one or more members of the Streptococcus genus, preferably one or more isolates of the S. pneumoniae genus, comprising administering to the animal a vaccine as described above. The invention further provides a method of inducing a protective immune response in an animal, sufficient to prevent or attenuate an infection by members of the Streptococcus genus, preferably at least S. pneumoniae, comprising administering to the animal a composition comprising one or more of the polynucleotides or polypeptides described as claimed in the present invention in Table 6, or fragments thereof. Further, these polypeptides, or fragments thereof, may be conjugated to another immunogen and/or administered in admixture with an adjuvant.
[0022] The invention further relates to antibodies elicited in an animal by the administration of one or more S. pneumoniae polypeptides of the present invention and to methods for producing such antibodies.
[0023] The invention also provides diagnostic methods for detecting the expression of genes of members of the Streptococcus genus in an animal. One such method involves assaying for the expression of a gene encoding S pneumoniae peptides in a sample from an animal. This expression may be assayed either directly (e.g., by assaying polypeptide levels using antibodies elicited in response to amino acid sequences described as claimed in the present invention in Table 6) or indirectly (e.g., by assaying for antibodies having specificity for amino acid sequences described as claimed in the present invention in Table 6). An example of such a method involves the use of the polymerase chain reaction (PCR) to amplify and detect Streptococcus nucleic acid sequences.
[0024] The present invention also relates to nucleic acid probes having all or part of a nucleotide sequence described as claimed in the present invention in Table 6 (i.e. SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55-56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96-97, 99-105, 107-110, 112-114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173-184, 187-191, 193-217, 219-222, 224-227, 229-230, and 232-237) which are capable of hybridizing under stringent conditions to Streptococcus nucleic acids. The invention further relates to a method of detecting one or more Streptococcus nucleic acids in a biological sample obtained from an animal, said one or more nucleic acids encoding Streptococcus polypeptides, comprising: (a) contacting the sample with one or more of the above-described nucleic acid probes, under conditions such that hybridization occurs, and (b) detecting hybridization of said one or more probes to the Streptococcus nucleic acid present in the biological sample. [0025] The invention also includes immunoassays, including an immunoassay for detecting Streptococcus, preferably at least isolates of the S. pneumoniae genus, comprising incubation of a sample (which is suspected of being infected with Streptococcus) with a probe antibody directed against an antigen/epitope of S. pneumoniae, to be detected under conditions allowing the formation of an antigen- antibody complex; and detecting the antigen-antibody complex which contains the probe antibody. An immunoassay for the detection of antibodies which are directed against a Streptococcus antigen comprising the incubation of a sample (containing antibodies from a mammal suspected of being infected with Streptococcus) with a probe polypeptide including an epitope of S. pneumoniae , under conditions that allow the formation of antigen-antibody complexes which contain the probe epitope containing antigen.
[0026] Some aspects of the invention pertaining to kits are those for: investigating samples for the presence of polynucleotides derived from Streptococcus which comprise a polynucleotide probe including a nucleotide sequence selected from the sequences shown as claimed in the present invention in Table 6 or a fragment thereof of approximately 15 or more nucleotides, in an appropriate container; analyzing the samples for the presence of antibodies directed against a Streptococcus antigen made up of a polypeptide which contains a S. pneumoniae epitope present in the polypeptide, in a suitable container; and analyzing samples for the presence of Streptococcus antigens made up of an anti-S. pneumoniae antibody, in a suitable container.
[0027] In one preferred embodiment, the present invention provides a hybridoma cell secreting a human monoclonal antibody which specifically binds to a polypeptide at least 70% identical to a sequence selected from the group consisting of an amino acid sequence of any of the polypeptides, or fragments thereof, described as claimed in the present invention in Table 6. The present invention also provides a method for generating such hybridoma cells.
[0028] In another preferred embodiment, a pharmaceutical composition is provided for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy and/or for treating Streptococcus pneumoniae infections comprising the human monoclonal antibody secreted by the hybridoma cell. Preferably, administration of this pharmaceutical composition can be used for the treatment of Streptococcus pneumoniae infections, to reduce the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy, being an anti viral agent.
[0029] In another preferred embodiment, the human monoclonal antibody secreted by the hybridoma cell can be used for the diagnosis of Streptococcus pneumoniae infections in a body fluid sample.
[0030] In another preferred embodiment, the present invention provides for the use of the Streptococcus pneumoniae nucleic acids and polypeptides for the development of novel anti-microbial agents, and the use of such agents in the treatment and prophylaxis of Streptococcus pneumoniae infection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figures 1A-B describe the S. pneumoniae rlrA locus. Figure 1A shows a schematic representation of the S. pneumoniae rlrA locus. rlrA is divergently transcribed from at least six different genes indicated by black arrows, and the entire locus is flanked by two IS 1167 elements. The left element contains a frameshift mutation and is therefore predicted to be inactive. The sites of magellan2 insertions identified by STM in rlrA and srtD is shown as open triangles and the magellan5 insertions generated by in vitro transposition and used in additional animal experiments are show as black triangles. In Figure IB, the predicted C-terminal sorting signals of RrgA, RrgB, and RrgC are listed (SEQ ID NOs: 527, 528, and 529, respectively). The LPXTG motif (SEQ ID NO: 530) of each of the proteins is conserved, with the exception of the first amino acid. All three proteins have a stretch of hydrophobic residues (underlined) and a charged tail, characteristic of proteins that are anchored to the cell wall by sortases.
[0032] Figures 2A-B show analysis of rlrA locus mutants in animal models. Figure 2 A shows analysis of rlrA locus mutants in animal models of lung infection, and Figure 2B shows analysis of rlrA locus mutants in animal models nasopharyngeal carriage and bacteremia. The in vivo competitive index (CI) was calculated as described in the text; each circle represents the CI for a single mouse in each set of competitions. A CI of less than one indicates a virulence defect. Open circles indicate that no mutant bacteria were recovered from that animal and therefore 1 was substituted in the numerator when calculating the CI. The geometric mean of the CIs for all mice in a set of competitions is shown as a solid line and statistically significant data are indicated with a symbol (* p<0.05, # p<0.07). The in vitro competition results for each of the tested strains are as follows: rrgA - 1.06, rrgB -
0.50, rrgC- 0.75, srtB - 0.94, srtC- 0.69, and srtD - 0.93.
[0033] Figure 3 shows a phylogenetic tree of select sortase homologues. Protein sequences of sortase homologues were aligned and a phylogenetic tree was constructed based on neighbor joining analysis. The bacterial species and, when available, the protein name are given. Bootstrap values from 100 replications are indicated at each branchpoint.
[0034] Figure 4 depicts the rlrA pathogenicity islet. The 12 kb locus includes a positive regulator, three surface proteins, and three sortase homologues. The four genes that are required for virulence in one or more animal models are shown in white (10).
[0035] Figures 5A-C show ribonuclease protection assays (RPA) performed to analyze the steady- state mRNA levels of each gene in the rlrA pathogenicity islet in both wild-type (AC353) and rlrA mutant strain (AC1213) backgrounds. In Figure 5A, riboprobes to each gene in the islet, as well as, to rpoB were generated and hybridized to 10 μg of total S. pneumoniae RNA from either the wild-type or mutant strain. In Figure 5B, riboprobes to srtA and rpoB were hybridized to the same samples in Figure 5 A. In Figure 5C, a riboprobe that differentially recognizes the two rlrA transcripts in AC 1278 was used to determine if RlrA is autoregulatory. The larger fragment in each lane represents the mRNA from the native rlrA pathogenicity islet promoter. Lanes marked with (+) are RNA samples that were harvested from cells grown in the presence of maltose.
[0036] Figures 6A-B show primer extension analysis. In Figure 6A, transcriptional start sites of promoters upstream of rlrA (SEQ ID NOS 531, 551 and 552, respectively, in order of appearance), rrgA (SEQ ID NOS 532, 553 and 554, respectively, in order of appearance), rrgB (SEQ ID NOS 533, 555 and 556, respectively, in order of appearance), and srtB (srtD) (SEQ ID NOS 534, 557 and 558, respectively, in order of appearance) were mapped by primer extension analysis (SEQ ID NOs: 531, 532, 533, and 534. The arrow indicates primer extension products. Figure 6B is a graphical depiction of the four rlrA pathogenicity islet promoters. A rightward arrow indicates the +1 start site. When present, -10 and -35 σ70 consensus sequences and predicted Shine-Dalgarno sequences are underlined and bold.
[0037] Figures 7A-B show Northern blot analysis of rlrA pathogenicity islet mRNAs. Riboprobes to selected genes were synthesized and used to hybridize to total RNA recovered from AC1278 (Lane 1) or AC1213 (Lane 2) grown under maltose inducing conditions. In Figure 7A, Northern blots were probed with rrgB and rrgC riboprobes. In Figure 7B, Northern blots were probed with srtB, srtC, and srtD riboprobes.
[0038] Figures 8A-C show gel shift analysis using RlrA-Hϊs6 (His tag shown in SEQ ID NO: 550). In Figure 8A, the four 32P labeled probes that span the rrgA-rlrA intergenic region and were used in gel-shift analyses are depicted. The sizes of the PCR fragments were: API - 522 bp, AP 3 - 250 bp, AP4 - 139 bp, AP5 - 163 bp, and AP7 - 290 bp. Figure 8B gel shift analysis of AP4 and AP5. 32P labeled probes were incubated with increasing concentrations of RlrA- His6 (His tag shown in SEQ ID NO: 550). The protein concentration used in each lane was: lanes 1 and 8 - 0, lanes 2 and 9 - 0.25 nM, lanes 3 and 10 - 1 nM, lanes 4 and 11 - 4 nM, lanes 5 and 12 - 16.4 nM, lanes 6 and 13 - 33 nM, and lanes 7 and 14 - 66 nM. An arrow indicates shifted species. Figure 8C shows supershift of RlrA-His6 (His tag shown in SEQ ID NO: 550) complexes by the addition of anti-His6 (His tag shown in SEQ ID NO: 550) antibody to the binding reaction. The concentration of protein used in each lane was: lane 1 and 4 - no protein, lane 2 and 5 - 16.4 nM RlrA-His6 (His tag shown in SEQ ID NO: 550), and lane 3 and 6 - 16.4 nM RlrA-His6 (His tag shown in SEQ ID NO: 550), 0.5 μg anti-His6 (His tag shown in SEQ ID NO: 550) antibody.
[0039] Figures 9 A-B show analysis of the rrgA-rlrA promoter regions. Figures 9A shows DNasel footprinting analysis of the rrgA-rlrA promoter regions. The 32P labeled AP7 probe was incubated with increasing amounts of RlrA-His6 (His tag shown in SEQ ID NO: 550) and subsequently treated with DNasel. Protein concentration used in each lane was: lane 1 - 0, lane 2 - 0.5nM, lane 3 - 2.05nM, lane 4 - 8.2nM, and lane 5 - 32.8nM. DNasel units used were: lane 1 and 2 - 0.5U, lane 3 - 1U, lane 4 and 5 - 2U. Brackets indicate areas protected by RlrA-His6 (His tag shown in SEQ ID NO: 550). Figure 9B depicts the rlrA and rrgA promoter regions. The oligonucleotide fragments are shown in SEQ ID NOS 535, 559 and 560, respectively, in order of appearance. RlrA binding sites are indicated in bold and the consensus binding site is underlined.
DETAILED DESCRIPTION
[0040] The present invention relates to recombinant antigenic S. pneumoniae polypeptides and fragments thereof. The invention also relates to methods for using these polypeptides to produce immunological responses and to confer immunological protection to disease caused by members of the genus Streptococcus, at least isolates of the S. pneumoniae genus. The invention further relates to nucleic acid sequences which encode antigenic S. pneumoniae polypeptides and to methods for detecting S. pneumoniae nucleic acids and polypeptides in biological samples. The invention also relates to S. pnewnoniae-specific antibodies and methods for detecting such antibodies produced in a host animal.
[0041 ] The present invention takes advantage of signature tagged mutagenesis to identify novel virulence determinants of S. pneumoniae. Such essential proteins are excellent candidates for vaccine development and/or antimicrobial drug development, because these proteins are required for the survival and growth of the pathogen during infection. Virulence determinants of pathogens can either be essential for virulence, or not essential yet still play a role in the infection process. Virulence determinants that can be shown to be essential in their own right are preferential targets for vaccine development and/or antimicrobial drug development. This is because the inhibition of the function of an essential determinant, for example by antibody binding or drug targeting, will reduce the potential of the pathogen to cause disease in the host. In contrast, a drug that targets and inactivates a non-essential virulence determinant will not reduce the virulence of the pathogen. Such a non-essential virulence determinant may still be targeted as a protective antigen for vaccine development, however in the face of immunological pressure, given time, the pathogen may lose the factor (by mutation) or alter the antigenicity of the non-essential determinant.
[0042] The present invention provides isolated nucleic acid molecules which were identified as genes essential for lung infection by S. pneumoniae in a mouse model, as described below in Example 1. Thus, the present invention provides isolated nucleic acid molecules comprising polynucleotides encoding the S. pneumoniae polypeptides described as claimed in the present invention in Table 6 which were determined by signature-tagged mutagenesis (STM). Table 6, below, provides information describing 237 open reading frames (ORFs) which encode potentially antigenic polypeptides of S. pneumoniae of the present invention. The table lists the ORF identifier assigned by the TIGR4 sequencing group, which consists of the letters SP, which denote S. pneumoniae, followed immediately by a four digit numeric code, which was used to arbitrarily number the S. pneumoniae genes. The table further correlates each ORF identifier with a sequence identification number (SEQ ID NOs:l - 237). Thus, each ORF of the present invention is described in Table 6 first by its TIGR designation, then by the SEQ ID NO assigned to the corresponding nucleic acid sequence, SEQ ID NOs: 1 - 237, and then by the SEQ ID NO assigned to the corresponding amino acid sequence, SEQ ID NOs: 238 - 474. The actual nucleotide or amino acid sequence of each ORF identifier is also shown in the attached Sequence Disclosure under the corresponding SEQ ID NO.
[0043] Thus, for example, the designation "SP0023" refers to both the nucleotide and amino acid sequences of S. pneumoniae polypeptide number numbered 23 by the TIGR4 sequencing group. Further, "SP0023" correlates with the nucleotide sequence shown as SEQ ID NO: 1 and with the amino acid sequence shown as SEQ ID NO: i 238 as is described in Table 6.
[0044] Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of DNA sequences determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a deteπ ned nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
[0045] Unless otherwise indicated, each "nucleotide sequence" set forth herein is presented as a sequence of deoxyribonucleotides (abbreviated A, G , C and T). However, by "nucleotide sequence" of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U). For instance, reference to an RNA molecule having a sequence described in Table 6 set forth using deoxyribonucleotide abbreviations is intended to indicate an RNA molecule having a sequence in which each deoxyribonucleotide A, G or C described in Table 6 has been replaced by the corresponding ribonucleotide A, G or C, and each deoxyribonucleotide T has been replaced by a ribonucleotide U.
[0046] Nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
[0047] By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment. For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically. [0048] Isolated nucleic acid molecules of the present invention include DNA molecules comprising a nucleotide sequence described as claimed in the present invention in Table 6 and shown as SEQ ID NOs: 1 - 237; DNA molecules comprising the coding sequences for the polypeptides described as claimed in the present invention in Table 6 and shown as SEQ ID NOs:238 - 474; and DNA molecules which comprise sequences substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the S. pneumoniae polypeptides described as claimed in the present invention in Table 6. Of course, the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants.
[0049] The invention also provides nucleic acid molecules having sequences complementary to any one of those described as claimed in the present invention in Table 6. Such isolated molecules, particularly DNA molecules, are useful as probes for detecting expression of Streptococcal genes, for instance, by Northern blot analysis or the polymerase chain reaction (PCR).
[0050] The present invention is further directed to fragments of the isolated nucleic acid molecules described herein. By a fragment of an isolated nucleic acid molecule having a nucleotide sequence described in Table 6, is intended fragments at least about 15 nt, and more preferably at least about 17 nt, still more preferably at least about 20 nt, and even more preferably, at least about 25 nt in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-100 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of a nucleotide sequence described in Table 6. By a fragment at least 20 nt in length, for example, is intended fragments which include 20 or more contiguous bases of a nucleotide sequence as described in Table 6. Since the nucleotide sequences identified in Table 6 are provided as SEQ ID NOs:l - 237, generating such DNA fragments would be routine to the skilled artisan. For example, such fragments could be generated synthetically.
[0051 ] Preferred nucleic acid fragments of the present invention also include nucleic acid molecules comprising nucleotide sequences encoding epitope-bearing portions of the S. pneumoniae polypeptides identified as claimed in the present invention in Table 6. Such nucleic acid fragments of the present invention include, for example, nucleotide sequences encoding polypeptide fragments comprising from about the amino terminal residue to about the carboxy terminal residue of each fragment shown in Table 2. The above referred to polypeptide fragments are antigenic regions of the S. pneumoniae polypeptides identified as claimed in the present invention in Table 6.
[0052] In another aspect, the invention provides isolated nucleic acid molecules comprising polynucleotides which hybridize under stringent hybridization conditions to a portion of a polynucleotide in a nucleic acid molecule of the invention described above, for instance, a nucleic acid sequence identified as claimed in the present invention in Table 6. By "stringent hybridization conditions" is intended overnight incubation at 42° C. in a solution comprising: 50%) formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10%) dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65° C.
[0053] By polynucleotides which hybridize to a "portion" of a polynucleotide is intended polynucleotides (either DNA or RNA) which hybridize to at least about 15 nucleotides (nt), and more preferably at least about 17 nt, still more preferably at least about 20 nt, and even more preferably about 25-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
[0054] Of course, polynucleotides hybridizing to a larger portion of the reference polynucleotide, for instance, a portion 50-100 nt in length, or even to the entire length of the reference polynucleotide, are also useful as probes according to the present invention, as are polynucleotides corresponding to most, if not all, of a nucleotide sequence as identified in Table 6. By a portion of a polynucleotide of "at least 20 nt in length," for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., a nucleotide sequences as described in Table 6). As noted above, such portions are useful diagnostically either as probes according to conventional DNA hybridization techniques or as primers for amplification of a target sequence by PCR, as described in the literature (for instance, in Molecular Cloning, A Laboratory Manual, 2nd. edition, Sambrook, J., Fritsch, E. F. and Maniatis, T., eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), the entire disclosure of which is hereby incorporated herein by reference). [0055] Since nucleic acid sequences encoding the S. pneumoniae polypeptides of the present invention are identified as claimed in the present invention in Table 6 and provided as SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55-56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96-97, 99-105, 107-110, 112-114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173-184, 187-191, 193-217, 219-222, 224- 227, 229-230, and 232-237, generating polynucleotides which hybridize to portions of these sequences would be routine to the skilled artisan. For example, the hybridizing polynucleotides of the present invention could be generated synthetically according to known techniques.
[0056] As indicated, nucleic acid molecules of the present invention which encode S. pneumoniae polypeptides of the present invention may include, but are not limited to those encoding the amino acid sequences of the polypeptides by themselves; and additional coding sequences which code for additional amino acids, such as those which provide additional functionalities. Thus, the sequences encoding these polypeptides may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described by Gentz and colleagues (Proc. Natl. Acad. Sci. USA 86:821-824 (1989)), for instance, hexa- histidine provides for convenient purification of the resulting fusion protein.
[0057] Thus, the present invention also includes genetic fusions wherein the S. pneumoniae nucleic acid sequences coding sequences identified as claimed in the present invention in Table 6 are linked to additional nucleic acid sequences to produce fusion proteins. These fusion proteins may include epitopes of streptococcal or non- streptococcal origin designed to produce proteins having enhanced immunogenicity. Further, the fusion proteins of the present invention may contain antigenic determinants known to provide helper T-cell stimulation, peptides encoding sites for post-translational modifications which enhance immunogenicity (e.g., acylation), peptides which facilitate purification (e.g., histidine "tag"), or amino acid sequences which target the fusion protein to a desired location (e.g., a heterologous leader sequence). [0058] In all cases of bacterial expression, an N-terminal methionine residue is added. In many cases, however, the N-terminal methionine residues is cleaved off post-translationally. Thus, the invention includes polypeptides shown in as claimed in the present invention in Table 6, with and without an N-termainal methionine.
[0059] The present invention thus includes nucleic acid molecules and sequences which encode fusion proteins comprising one or more S. pneumoniae polypeptides of the present invention fused to an amino acid sequence which allows for post- translational modification to enhance immunogenicity. This post-translational modification may occur either in vitro or when the fusion protein is expressed in vivo in a host cell. An example of such a modification is the introduction of an amino acid sequence which results in the attachment of a lipid moiety.
[0060] Thus, as indicated above, the present invention includes genetic fusions wherein a S pneumoniae claimed nucleic acid sequence identified in Table 6 is linked to a nucleotide sequence encoding another amino acid sequence. These other amino acid sequences may be of streptococcal origin (e.g., another claimed sequence selected from Table 6) or non-streptococcal origin.
[0061] The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the S. pneumoniae polypeptides described as claimed in the present invention in Table 6. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985)). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
[0062] Such variants include those produced by nucleotide substitutions, deletions or additions. The substitutions, deletions or additions may involve one or more nucleotides. These variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non- conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the S. pneumoniae polypeptides disclosed herein or portions thereof. Silent substitution are most likely to be made in non-epitopic regions. Guidance regarding those regions containing epitopes is provided herein, for example, in Table 2. Also especially preferred in this regard are conservative substitutions.
[0063] Further embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to: (a) a nucleotide sequence encoding any of the amino acid sequences of the polypeptides identified as claimed in the present invention in Table 6; and (b) a nucleotide sequence complementary to any of the nucleotide sequences in (a) above.
[0064] By a polynucleotide having a nucleotide sequence at least, for example, 95%) "identical" to a reference nucleotide sequence encoding a S. pneumoniae polypeptide described as claimed in the present invention in Table 6, is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the subject S. pneumoniae polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
[0065] Certain nucleotides within some of the nucleic acid sequences shown in Table 6 were ambiguous upon sequencing. Completely unknown sequences are shown as an "N". Other unresolved nucleotides are known to be either a purine, shown as "R", or a pyrimidine, shown as "Y". Accordingly, when determining identity between two nucleotide sequences, identity is met where any nucleotide, including an "R", "Y" or "N", is found in a test sequence and at the corresponding position in the referece sequence (from Table 6). Likewise, an A, G or "R" in a test sequence is identical to an "R" in the reference sequence; and a T, C or "Y" in a test sequence is identical to a "Y" in the reference sequence. [0066] As a practical matter, whether any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, a nucleotide sequence described in Table 6 can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
[0067] The present application is directed to nucleic acid molecules at least 90%o, 95%o, 96%o, 91%, 98%) or 99%> identical to a nucleic acid sequences described as claimed in the present invention in Table 6. One of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention include, inter alia, (1) isolating Streptococcal genes or allelic variants thereof from either a genomic or cDNA library and (2) Northern Blot or PCR analysis for detecting Streptococcal mRNA expression.
[0068] Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence identified as claimed in the present invention in Table 6 will encode the same polypeptide. In fact, since degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
[0069] It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode proteins having antigenic epitopes of the S. pneumoniae polypeptides of the present invention. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect the antigenicity of a polypeptide (e.g., replacement of an amino acid in a region which is not believed to form an antigenic epitope). For example, since antigenic epitopes have been identified which contain as few as six amino acids (see Harlow, et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988), page 76), in instances where a polypeptide has multiple antigenic epitopes the alteration of several amino acid residues would often not be expected to eliminate all of the antigenic epitopes of that polypeptide. This is especially so when the alterations are in regions believed to not constitute antigenic epitopes. Vectors and Host Cells
[0070] The present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of S. pneumoniae polypeptides or fragments thereof by recombinant techniques.
[0071] Recombinant constructs may be introduced into host cells using well known techniques such as infection, transduction, transfection, transvection, electroporation and transformation. The vector may be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
[0072] The polynucleotides may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
[0073] Preferred are vectors comprising cis-acting control regions to the polynucleotide of interest. Appropriate trans-acting factors may be supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
In certain preferred embodiments in this regard, the vectors provide for specific expression, which may be inducible and/or cell type-specific. Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives. [0074] Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagernids.
[0075] The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating site at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
[0076] As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
[0077] Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A available from Stratagene; pET series of vectors available from Novagen; and ρtrc99a, ρKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to the skilled artisan. [0078] Among known bacterial promoters suitable for use in the present invention include the E. coli lad and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promoters and the tip-promoter. Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I, promoter.
[0079] Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DΕAΕ-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals (for example, Davis, et al., Basic Methods In Molecular Biology (1986)).
[0080] Transcription of DNA encoding the polypeptides of the present invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type. Examples of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and ι adenovirus enhancers.
[0081] For secretion of the translated polypeptide into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the expressed polypeptide. The signals may be endogenous to the polypeptide or they may be heterologous signals.
[0082] The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art. A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins. For example, EP-A- O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
[0083] On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous mam er described. This is the case when Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations. In drug discovery, for example, human proteins, such as, hIL5-receptor has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See Bennett, D. et al., J. Molec. Recogn. 8:52-58 (1995) and Johanson, K. et al., J. Biol. Chem. 270 (16): 9459-9471 (1995).
[0084] The S. pneumoniae polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chiOmatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography and high performance liquid chromatography ("HPLC") is employed for purification. Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells.
Polypeptides and Fragments
[0085] The invention further provides isolated polypeptides having the amino acid sequences described as claimed in the present invention in Table 6, and shown as SEQ ID NOs.: 238-244, 247-250, 252, 254-273, 275-282, 284-286, 288, 292-293, 295-309, 311, 313-315, 317-319, 321, 323-325, 327-331, 333-334, 336-342, 344-347, 349-351, 353-359, 361-363, 365, 368-371, 373-374, 377-402, 404-407, 410-421, 424- 428, 430-454, 456-459, 461-464, 466-467, and 469-474, and peptides or polypeptides comprising portions of the above polypeptides. The terms "peptide" and "oligopeptide" are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least two amino acids coupled by peptidyl linkages. The word "polypeptide" is used herein for chains containing more than ten amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus.
[0086] Some amino acid sequences of the S. pneumoniae polypeptides described as claimed in the present invention in Table 6 can be varied without significantly effecting the antigenicity of the polypeptides. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the polypeptide which determine antigenicity. In general, it is possible to replace residues which do not form part of an antigenic epitope without significantly effecting the antigenicity of a polypeptide. Guidance for such alterations is given in Table 2 wherein epitopes for each polypeptide is delineated.
[0087] The polypeptides of the present invention are preferably provided in an isolated form. By "isolated polypeptide" is intended a polypeptide removed from its native environment. Thus, a polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention. Also intended as an "isolated polypeptide" is a polypeptide that has been purified, partially or substantially, from a recombinant host cell. For example, recombinantly produced versions of the S. pneumoniae polypeptides described in Table 6 can be substantially purified by the one-step method described by Smith and Johnson (Gene 67:31-40 (1988)).
[0088] The polypeptides of the present invention include: (a) an amino acid sequence of any of the polypeptides described as claimed in the present invention in Table 6; and (b) an amino acid sequence of an epitope-bearing portion of any one of the polypeptides of (a); as well as polypeptides with at least 70% similarity, and more preferably at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% similarity to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence at least 70% identical, more preferably at least 75% identical, and still more preferably 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to those above.
[0089] By "%> similarity" for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711) and the default settings for determining similarity. Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)) to find the best segment of similarity between two sequences.
[0090] By a polypeptide having an amino acid sequence at least, for example, 95%o "identical" to a reference amino acid sequence of a S. pneumoniae polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
[0091] The amino acid sequences shown as claimed in the present invention in Table 6 may have one or more "X" residues. "X" represents unknown. Thus, for purposes of defining identity, if any amino acid is present at the same position in a reference amino acid sequence (shown in Table 6) where an X is shown, the two sequences are identical at that position.
[0092] As a practical matter, whether any particular polypeptide is at least 70%o, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to, for instance, an amino acid sequence shown in Table 6 as claimed in the present invention, can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95%) identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
[0093] As described below, the polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting Streptococcal protein expression.
[0094] In another aspect, the invention provides peptides and polypeptides comprising epitope-bearing portions of the S. pneumoniae polypeptides of the invention. These epitopes are immunogenic or antigenic epitopes of the polypeptides of the invention. An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein or polypeptide is the immunogen. These immunogenic epitopes are believed to be confined to a few loci on the molecule. On the other hand, a region of a protein molecule to which an antibody can bind is defined as an "antigenic determinant" or "antigenic epitope." The number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes (Geysen, et al., Proc. Natl. Acad. Sci. USA 81 :3998-4002 (1983)). Predicted antigenic epitopes are shown in Table 2, below.
[0095] As to the selection of peptides or polypeptides bearing an antigenic epitope (i.e., that contain a region of a protein molecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein (for instance, Sutcliffe, J., et al, Science 219:660- 666 (1983)). Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals. Peptides that are extremely hydrophobic and those of six or fewer residues generally are ineffective at inducing antibodies that bind to the mimicked protein; longer, peptides, especially those containing proline residues, usually are effective (Sutcliffe, et al., p. 661). For instance, 18 of 20 peptides designed according to these guidelines, containing 8-39 residues covering 75% of the sequence of the influenza virus hemagglutinin HA1 polypeptide chain, induced antibodies that reacted with the HA1 protein or intact virus; and 12/12 peptides from the MuLV polymerase and 18/18 from the rabies glycoprotein induced antibodies that precipitated the respective proteins.
[0096] Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. Thus, a high proportion of hybridomas obtained by fusion of spleen cells from donors immunized with an antigen epitope- bearing peptide generally secrete antibody reactive with the native protein (Sutcliffe, et al., p. 663). The antibodies raised by antigenic epitope-bearing peptides or polypeptides are useful to detect the mimicked protein, and antibodies to different peptides may be used for tracking the fate of various regions of a protein precursor which undergoes post-translational processing. The peptides and anti-peptide antibodies may be used in a variety of qualitative or quantitative assays for the mimicked protein, for instance in competition assays since it has been shown that even short peptides (e.g., about 9 amino acids) can bind and displace the larger peptides in immunoprecipitation assays (for instance, Wilson, et al., Cell 31:161-118 (1984) p. 777). The anti-peptide antibodies of the invention also are useful for purification of the mimicked protein, for instance, by adsorption chromatography using methods well known in the art.
[0097] Antigenic epitope-bearing peptides and polypeptides of the invention designed according to the above guidelines preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention. However, peptides or polypeptides comprising a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention, also are considered epitope-bearing peptides or polypeptides of the invention and also are useful for inducing antibodies that react with the mimicked protein. Preferably, the amino acid sequence of the epitope- bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence includes relatively hydrophilic residues and highly hydrophobic sequences are preferably avoided); and sequences containing proline residues are particularly preferred.
[0098] Non-limiting examples of antigenic polypeptides or peptides that can be used to generate Streptococcal-specific antibodies include portions of the amino acid sequences identified in Table 6 as claimed in the present invention. The polypeptide fragments disclosed in Table 6 are believed to be antigenic regions of the S. pneumoniae polypeptides described in Table 6. Thus the invention further includes isolated peptides and polypeptides comprising an amino acid sequence of an epitope shown in Table 6 and polynucleotides encoding said polypeptides.
[0099] The epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means for making peptides or polypeptides including recombinant means using nucleic acid molecules of the invention. For instance, an epitope-bearing amino acid sequence of the present invention may be fused to a larger polypeptide which acts as a carrier during recombinant production and purification, as well as during immunization to produce anti-peptide antibodies. Epitope-bearing peptides also may be synthesized using known methods of chemical synthesis. For instance, Houghten has described a simple method for synthesis of large numbers of peptides, such as 10-20 mg of 248 different 13 residue peptides representing single amino acid variants of a segment of the HA1 polypeptide which were prepared and characterized (by ELISA-type binding studies) in less than four weeks (Houghten, R. A. Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985)). This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Pat. No. 4,631,211 to Houghten and coworkers (1986). In this procedure the individual resins for the solid- phase synthesis of various peptides are contained in separate solvent-permeable packets, enabling the optimal use of the many identical repetitive steps involved in solid-phase methods. A completely manual procedure allows 500-1000 or more syntheses to be conducted simultaneously (Houghten, et al., p. 5134). [00100] Epitope-bearing peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art (for instance, Sutcliffe, et al.; Wilson, et al.; Chow, M., et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J., et al., J. Gen. Virol. 66:2347-2354 (1985)). Generally, animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing cysteine may be coupled to carrier using a linker such as m-maleimidobenzoyl-N- hydroxysuccinimide ester (MBS), while other peptides may be coupled to carrier using a more general linking agent such as glutaraldehyde. Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 μg peptide or carrier protein and Freund's adjuvant. Several booster injections may be ' needed, for instance, at intervals of about two weeks, to provide a useful titer of anti- peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
[00101] Immunogenic epitope-bearing peptides of the invention, i.e., those parts of a protein that elicit an antibody response when the whole protein is the immunogen, are identified according to methods known in the art. For instance, Geysen, et al., discloses a procedure for rapid concurrent synthesis on solid supports of hundreds of peptides of sufficient purity to react in an enzyme-linked immunosorbent assay. Interaction of synthesized peptides with antibodies is then easily detected without removing them from the support. In this manner a peptide bearing an immunogenic epitope of a desired protein may be identified routinely by one of ordinary skill in the art. For instance, the immunologically important epitope in the coat protein of foot-and-mouth disease virus was located by Geysen et al. with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the entire 213 amino acid sequence of the protein. Then, a complete replacement set of peptides in which all 20 amino acids were substituted in turn at every position within the epitope were synthesized, and the particular amino acids conferring specificity for the reaction with antibody were determined. Thus, peptide analogs of the epitope-bearing peptides of the invention can be made routinely by this method. U.S. Pat. No. 4,708,781 to Geysen (1987) further describes this method of identifying a peptide bearing an immunogenic epitope of a desired protein. [00102] Further still, U.S. Pat. No. 5,194,392, to Geysen (1990), describes a general method of detecting or determining the sequence of monomers (amino acids or other compounds) which is a topological equivalent of the epitope (i.e., a "mimotope") which is complementary to a particular paratope (antigen binding site) of an antibody of interest. More generally, U.S. Pat. No. 4,433,092, also to Geysen (1989), describes a method of detecting or determining a sequence of monomers which is a topographical equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest. Similarly, U.S. Pat. No. 5,480,971 to Houghten, R. A. et al. (1996) discloses linear CrC -alkyl peralkylated oligopeptides and sets and libraries of such peptides, as well as methods for using such oligopeptide sets and libraries for determining the sequence of a peralkylated oligopeptide that preferentially binds to an acceptor molecule of interest. Thus, non-peptide analogs of the epitope-bearing peptides of the invention also can be made routinely by these methods.
[00103] The entire disclosure of each document cited in this section on "Polypeptides and Fragments" is hereby incorporated herein by reference. [00104] As one of skill in the art will appreciate, the polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half- life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 0,394,827; Traunecker et al., Nature 331 :84-86 (1988)). Fusion proteins that have a disulfide- linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than a monomeric S. pneumoniae polypeptide or fragment thereof alone (Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)).
Diagnostic Assays
[00105] The present invention further relates to a method for assaying for Streptococcal infection in an animal via detecting the expression of genes encoding Streptococcal polypeptides (e.g., the polypeptides described as claimed in the present invention Table 6). This method comprises analyzing tissue or body fluid from the animal for Streptococcus-specific antibodies or Streptococcal nucleic acids or proteins. Analysis of nucleic acid specific to Streptococcus can be done by PCR or hybridization techniques using nucleic acid sequences of the present invention as either hybridization probes or primers (cf. Molecular Cloning: A Laboratory Manual, second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, 1989; Eremeeva et al, J. Gin. Microbiol. 32:803-810 (1994) which describes differentiation among spotted fever group Rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA). Methods for detecting B. burgdorferi nucleic acids via PCR are described, for example, in Chen et al., J. Gin. Microbiol. 32:589-595 (1994).
[00106] Where diagnosis of a disease state related to infection with Streptococcus has already been made, the present invention is useful for monitoring progression or regression of the disease state whereby patients exhibiting enhanced Streptococcus gene expression will experience a worse clinical outcome relative to patients expressing these gene(s) at a lower level.
By "assaying for Streptococcal infection in an animal via detection of genes encoding Streptococcal polypeptides" is intended qualitatively or quantitatively measuring or estimating the level of one or more Streptococcus polypeptides or the level of nucleic acid encoding Streptococcus polypeptides in a first biological sample either directly (e.g., by detenriining or estimating absolute protein level or nucleic level) or relatively (e.g., by comparing to the Streptococcus polypeptide level or mRNA level in a second biological sample). The Streptococcus polypeptide level or nucleic acid level in the second sample used for a relative comparison may be undetectable if obtained from an animal which is not infected with Streptococcus. When monitoring the progression or regression of a disease state, the Streptococcus polypeptide level or nucleic acid level may be compared to a second sample obtained from either an animal infected with Streptococcus or the same animal from which the first sample was obtained but taken from that animal at a different time than the first. As will be appreciated in the art, once a standard Streptococcus polypeptide level or nucleic acid level which corresponds to a particular stage of a Streptococcus infection is known, it can be used repeatedly as a standard for comparison.
[00107] By "biological sample" is intended any biological sample obtained from an animal, cell line, tissue culture, or other source which contains Streptococcus polypeptide, mRNA, or DNA. Biological samples include body fluids (such as plasma and synovial fluid) which contain Streptococcus polypeptides, and muscle, skin, and cartilage tissues. Methods for obtaining tissue biopsies and body fluids are well known in the art.
[00108] The present invention is useful for detecting diseases related to Streptococcus infections in animals. Preferred animals include monkeys, apes, cats, dogs, cows, pigs, mice, horses, rabbits and humans. Particularly preferred are humans. [00109] Total RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate -phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). mRNA encoding Streptococcus polypeptides having sufficient homology to the nucleic acid sequences identified as claimed in the present invention in Table 6 to allow for hybridization between complementary sequences are then assayed using any appropriate method. These include Northern blot analysis, SI nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR).
[00110] Northern blot analysis can be performed as described in Harada et al., Cell 63:303-312 (1990). Briefly, total RNA is prepared from a biological sample as described above. For the Northern blot, the RNA is denatured in an appropriate buffer (such as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected to agarose gel electrophoresis, and transferred onto a nitrocellulose filter. After the RNAs have been linked to the filter by a UV linker, the filter is prehybridized in a solution containing formamide, SSC, Denhardt's solution, denatured salmon sperm, SDS, and sodium phosphate buffer. A S. pnuemoniae polypeptide DNA sequence shown in Table 6 as claimed in the present invention labeled according to any appropriate method (such as the 32P-multiprimed DNA labeling system (Amersham)) is used as probe. After hybridization overnight, the filter is washed and exposed to x-ray film. DNA for use as probe according to the present invention is described in the sections above and will preferably at least 15 bp in length.
[00111] SI mapping can be performed as described in Fujita et al., Cell 49:357- 367 (1987). To prepare probe DNA for use in SI mapping, the sense strand of an above-described S. pnuemoniae DNA sequence of the present invention is used as a template to synthesize labeled antisense DNA. The antisense DNA can then be digested using an appropriate restriction endonuclease to generate further DNA probes of a desired length. Such antisense probes are useful for visualizing protected bands corresponding to the target mRNA (i.e., mRNA encoding Streptococcus polypeptides).
[00112] Preferably, levels of mRNA encoding Streptococcus polypeptides are assayed using the RT-PCR method described in Makino et al., Technique 2:295-301 (1990). By this method, the radioactivities of the "amplicons" in the polyacrylamide gel bands are linearly related to the initial concentration of the target mRNA. Briefly, this method involves adding total RNA isolated from a biological sample in a reaction mixture containing a RT primer and appropriate buffer. After incubating for primer annealing, the mixture can be supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and reverse transcriptase. After incubation to achieve reverse transcription of the RNA, the RT products are then subject to PCR using labeled primers. Alternatively, rather than labeling the primers, a labeled dNTP can be included in the PCR reaction mixture. PCR amplification can be performed in a DNA thermal cycler according to conventional techniques. After a suitable number of rounds to achieve amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide gel. After drying the gel, the radioactivity of the appropriate bands (corresponding to the mRNA encoding the Streptococcus polypeptides)) is quantified using an imaging analyzer. RT and PCR reaction ingredients and conditions, reagent and gel concentrations, and labeling methods are well known in the art. Variations on the RT- PCR method will be apparent to the skilled artisan.
[00113] Assaying Streptococcus polypeptide levels in a biological sample can occur using any art-known method. Preferred for assaying Streptococcus polypeptide levels in a biological sample are antibody-based techniques. For example, Streptococcus polypeptide expression in tissues can be studied with classical immunohistological methods. In these, the specific recognition is provided by the primary antibody (polyclonal or monoclonal) but the secondary detection system can utilize fluorescent, enzyme, or other conjugated secondary antibodies. As a result, an immunohistological staining of tissue section for pathological examination is obtained. Tissues can also be extracted, e.g., with urea and neutral detergent, for the liberation of Streptococcus polypeptides for Western-blot or dot/slot assay (Jalkanen, M., et al, J. Cell. Biol. 101:976-985 (1985); jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987)). In this technique, which is based on the use of cationic solid phases, quantitation of a Streptococcus polypeptide can be accomplished using an isolated Streptococcus polypeptide as a standard. This technique can also be applied to body fluids.
[00114] Other antibody-based methods useful for detecting Streptococcus polypeptide gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). For example, a Streptococcus polypeptide-specific monoclonal antibodies can be used both as an immunoabsorbent and as an enzyme-labeled probe to detect and quantify a Streptococcus polypeptide. The amount of a Streptococcus polypeptide present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm. Such an ELISA for detecting a tumor antigen is described in Iacobelli et al., Breast Cancer Research and Treatment 11 :19- 30 (1988). In another ELISA assay, two distinct specific monoclonal antibodies can be used to detect Streptococcus polypeptides in a body fluid. In this assay, one of the antibodies is used as the immunoabsorbent and the other as the enzyme-labeled probe. [00115] The above techniques may be conducted essentially as a "one-step" or "two-step" assay. The "one-step" assay involves contacting the Streptococcus polypeptide with immobilized antibody and, without washing, contacting the mixture with the labeled antibody. The "two-step" assay involves washing before contacting the mixture with the labeled antibody. Other conventional methods may also be employed as suitable. It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed from the sample. Streptococcus polypeptide-specific antibodies for use in the present invention can be raised against an intact S. pneumoize polypeptide of the present invention or fragment thereof. These polypeptides and fragments may be administered to an animal (e.g., rabbit or mouse) either with a carrier protein (e.g., albumin) or, if long enough (e.g., at least about 25 amino acids), without a carrier.
[00116] As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) which are capable of specifically binding to a Streptococcus polypeptide. Fab and F(ab') fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
[00117] The antibodies of the present invention may be prepared by any of a variety of methods. For example, the S. pneumoniae polypeptides identified in Table 6 as claimed in the present invention, or fragments thereof, can be administered to an animal in order to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of a S. pneumoniae polypeptide of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of high specific activity.
[00118] In the most preferred method, the antibodies of the present invention are monoclonal antibodies. Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., In: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., (1981) pp. 563-681). In general, such procedures involve immunizing an animal (preferably a mouse) with a S. pneumoniae polypeptide antigen of the present invention. Suitable cells can be recognized by their capacity to bind anti-Streptococcus polypeptide antibody. Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 μg/ml of streptomycin. The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP 20), available from the American Type Culture Collection, Rockville, Md. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the Streptococcus polypeptide antigen administered to immunized animal. [00119] Alternatively, additional antibodies capable of binding to Streptococcus polypeptide antigens may be produced in a two-step procedure through the use of anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, Streptococcus polypeptide-specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the Streptococcus polypeptide-specific antibody can be blocked by a Streptococcus polypeptide antigen. Such antibodies comprise anti-idiotypic antibodies to the Streptococcus polypeptide-specific antibody and can be used to immunize an animal to induce formation of further Streptococcus polypeptide-specific antibodies. [00120] It will be appreciated that Fab and F(ab ')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') fragments). Alternatively, Streptococcus polypepti de-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry. [00121] Of special interest to the present invention are antibodies to Streptococcus polypeptide antigens which are produced in humans, or are "humanized" (i.e., non- immunogenic in a human) by recombinant or other teclmology. Humanized antibodies may be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies) (Robinson, R. R. et al, International Patent Publication PCT/US86/02269; Akira, K. et al., European Patent Application 184, 187; Taniguchi, M., European Patent * Application 171,496; Morrison, S. L. et al., European Patent Application 173,494; Neuberger, M. S. et al., PCT Application WO 86101533; Cabilly, S. et al., European Patent Application 125,023; Better, M. et al., Science 240:1041-1043 (1988); Liu, A. Y. et al, Proc. Natl. Acad. Sci. USA 84:3439-3443 (1987); Liu, A. Y. et al., J. Immunol. 139:3521-3526 (1987); Sun, L. K. et al., Proc. Natl. Acad. Sci. USA 84:214- 218 (1987);>Nishimura, Y. et al., Cane. Res. 47:999-1005 (1987); Wood, C. R. et al., Nature 314:446-449 (1985)); Shaw et al, J. Natl. Cancer Inst. 80:1553-1559 (1988). General reviews of "humanized" chimeric antibodies are provided by Morrison, S. L. (Science, 229:1202-1207 (1985)) and by Oi, V. T. et al., BioTechniques 4:214 (1986)). Suitable "humanized" antibodies can be alternatively produced by CDR or CEA substitution (Jones, P. T. et al., Nature 321 :552-525 (1986); Verhoeyan et al., Science 239:1534 (1988); Beidler, C. B. et al., J. Immunol. 141 :4053-4060 (1988)). [00122] Suitable enzyme labels include, for example, those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate. Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available. Activity of an oxidase label may be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody/substrate reaction. Besides enzymes, other suitable labels include
19^ 191 λ A "X^> ' radioisotopes, such as iodine ( I, I), carbon ( C), sulphur ( S), tritium ( H), indium (] 12 In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
[00123] Further suitable labels for the Streptococcus polypeptide-specific antibodies of the present invention are provided below. Examples of suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5 -steroid isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine esterase.
[00124] Examples of suitable radioisotopic labels include 3H, ι nIn, 1251, 1311, 32P, 35S, I4C, 51Cr, 57To, 58Co, 59Fe, 75Se, I52Eu, 90Y, 67Cu, 217Ci, 211At, 212Pb, 47Sc, !09Pd, etc. In is a preferred isotope where in vivo imaging is used since its avoids the problem of dehalogenation of the 125I or 131I-labeled monoclonal antibody by the liver. In addition, this radionucleotide has a more favorable gamma emission energy for imaging (Perkins et al, Eur. J. Nucl. Med. 10:296-301 (1985); Carasquillo et al., J. Nucl. Med. 28:281-287 (1987)). For example, l nIn coupled to monoclonal antibodies with l-(P-isothiocyanatobenzyl)-DPTA has shown little uptake in non-tumorous tissues, particularly the liver, and therefore enhances specificity of tumor localization (Esteban et al., J. Nucl. Med. 28:861-870 (1987)).
[00125] Examples of suitable non-radioactive isotopic labels include 157Gd, 55Mn, I62Dy, 52Tr, and 56Fe. [00126] Examples of suitable fluorescent labels include an I5 Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, and a fluorescamine label.
[00127] Examples of suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.
[00128] Examples of chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, and an aequorin label.
[00129] Examples of nuclear magnetic resonance contrasting agents include heavy metal nuclei such as Gd, Mn, and iron.
[00130] Typical techniques for binding the above-described labels to antibodies are provided by Kennedy et al., Gin. Chim. Acta 70:1-31 (1976), and Schurs et al., Gin. Chim. Acta 81 : 1-40 (1977). Coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, the m- maleimidobenzyl-N-hydroxy-succinimide ester method, all of which methods are incorporated by reference herein.
[00131] In a related aspect, the invention includes a diagnostic kit for use in screening serum containing antibodies specific against S. pneumoniae infection. Such a kit may include an isolated S. pneumoniae antigen comprising an epitope which is specifically immunoreactive with at least one anti-S. -pneumoniae antibody. Such a kit also includes means for detecting the binding of said antibody to the antigen. In specific embodiments, the kit may include a recombinantly produced or chemically synthesized peptide or polypeptide antigen. The peptide or polypeptide antigen may be attached to a solid support.
[00132] In a more specific embodiment, the detecting means of the above- described kit includes a solid support to which said peptide or polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labelled anti-human antibody. In this embodiment, binding of the antibody to the S. pneumoniae antigen can be detected by binding of the reporter labelled antibody to the anti-S. pneumoniae antibody. [00133] In a related aspect, the invention includes a method of detecting S. pneumoniae infection in a subject. This detection method includes reacting a body fluid, preferably serum, from the subject with an isolated S. pneumoniae antigen, and examining the antigen for the presence of bound antibody. In a specific embodiment, the method includes a polypeptide antigen attached to a solid support, and serum 'is reacted with the support. Subsequently, the support is reacted with a reporter-labeled anti-human antibody. The support is then examined for the presence of reporter- labeled antibody.
[00134] The solid surface reagent employed in the above assays and kits is prepared by known teclmiques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plates or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
Human Monoclonal Antibodies
[00135] One preferred embodiment of the present invention provides human monoclonal antibodies to Streptococcus pneumoniae antigens. Methods for , producing human monoclonal antibodies in human/mouse chimeras are known in the art, for example in U.S. Patent No. 6,254,867, which is hereby incorporated by reference herein.
[00136] The present invention provides for generating hybridoma cell lines that secrete human monoclonal antibodies that specifically bind to any of the S. pneumoniae polypeptides, or fragments thereof, described in Table 6 as claimed in the present invention.
[00137] The antigen used for immunizing the chimeric rodent is preferably any one or more of the S. pneumoniae polypeptides, or fragments thereof, described in
Table 6 as claimed in the present invention. The antigen for example may be prepared as a suspension adsorbed on aluminum hydroxide.
Therapeutics and Modes of Administration [00138] The present invention also provides vaccines comprising one or more polypeptides of the present invention. Heterogeneity in the composition of a vaccine may be provided by combining S. pneumoniae polypeptides of the present invention. Multi-component vaccines of this type are desirable because they are likely to be more effective in eliciting protective immune responses against multiple species and strains of the Streptococcus genus than single polypeptide vaccines. Thus, as discussed in detail below, a multi-component vaccine of the present invention may contain one or more, preferably 2 to about 20, more preferably 2 to about 15, and most preferably 3 to about 8, of the S. pneumoniae polypeptides identified in Table 6 as claimed in the present invention, or fragments thereof. [00139] Multi-component vaccines are known in the art to elicit antibody production to numerous immunogenic components. Decker, M. and Edwards, K., J. Infect. Dis. 11 A: S270-275 (1996). In addition, a hepatitis B, diphtheria, tetanus, pertussis tetravalent vaccine has recently been demonstrated to elicit protective levels of antibodies in human infants against all four pathogenic agents. Aristegui, J. et al., Vaccine 15:7-9 (1997).
[00140] The present invention thus also includes multi-component vaccines. These vaccines comprise more than one polypeptide, immunogen or antigen. An example of such a multi-component vaccine would be a vaccine comprising more than one of the S. pneumoniae polypeptides described in Table 6 as claimed in the present invention. A second example is a vaccine comprising one or more, for example 2 to 10, of the S. pneumoniae polypeptides identified in Table 6 as claimed in the present invention, and one or more, for example 2 to 10, additional polypeptides of either streptococcal or non-streptococcal origin. Thus, a multi-component vaccine which confers protective immunity to both a Streptococcal infection and infection by another pathogenic agent is also within the scope of the invention.
[00141] Further within the scope of the invention are whole cell and whole viral vaccines. Such vaccines may be produced recombinantly and involve the expression of one or more of the S. pneumoniae polypeptides described in Table 6 as claimed in the present invention. For example, the S. pneumoniae polypeptides of the present invention may be either secreted or localized intracellular, on the cell surface, -or in the periplasmic space. Further, when a recombinant virus is used, the S. pneumoniae polypeptides of the present invention may, for example, be localized in the viral envelope, on the surface of the capsid, or internally within the capsid. Whole cells vaccines which employ cells expressing heterologous proteins are known in the art. See, e.g., Robinson, K. et al., Nature Biotech. 15:653-657 (1997); Sirard, J. et al., Infect. Immun. 65:2029-2033 (1997); Chabalgoity, J. et al., Infect. Immun. 65:2402- 2412 (1997). These cells may be administered live or may be killed prior to administration. Chabalgoity, J. et al., for example, report the successful use in mice of a live attenuated Salmonella vaccine strain which expresses a portion of a platyhelminth fatty acid-binding protein as a fusion protein on its cells surface. [00142] A multi-component vaccine can also be prepared using techniques known in the art by combining one or more S. pneumoniae polypeptides of the present invention, or fragments thereof, with additional non-streptococcal components (e.g., diphtheria toxin or tetanus toxin, and/or other compounds known to elicit an immune response). Such vaccines are useful for eliciting protective immune responses to both members of the Streptococcus genus and non-streptococcal pathogenic agents The vaccines of the present invention also include DNA vaccines. DNA vaccines are currently being developed for a number of infectious diseases. Boyer, J et al., Nat. Med. 3:526-532 (1997); reviewed in Spier, R., Vaccine 14:1285-1288 (1996). Such DΝA vaccines contain a nucleotide sequence encoding one or more S. pneumoniae polypeptides of the present invention oriented in a manner that allows for expression of the subject polypeptide. The direct administration of plasmid DΝA encoding B. burgdorgeri OspA has been shown to elicit protective immunity in mice against borrelial challenge. Luke, C. et al, J. Infect. Dis. 175:91-97 (1997). [00143] The present invention also relates to the administration of a vaccine which is co-administered with a molecule capable of modulating immune responses. Kim, J. et al., Nature Biotech. 15:641-646 (1997), for example, report the enhancement of immune responses produced by DΝA immunizations when DΝA sequences encoding molecules which stimulate the immune response are co-administered. In a similar fashion, the vaccines of the present invention may be co-administered with either nucleic acids encoding immune modulators or the immune modulators themselves. These immune modulators include granulocyte macrophage colony stimulating factor (GM-CSF) and CD86.
[00144] The vaccines of the present invention may be used to confer resistance to streptococcal infection by either passive or active immunization. When the vaccines of the present invention are used to confer resistance to streptococcal infection through active immunization, a vaccine of the present invention is administered to an animal to elicit a protective immune response which either prevents or attenuates a streptococcal infection. When the vaccines of the present invention are used to confer resistance to streptococcal infection through passive immunization, the vaccine is provided to a host animal (e.g., human, dog, or mouse), and the antisera elicited by this antisera is recovered and directly provided to a recipient suspected of having an infection caused by a member of the Streptococcus genus. [00145] The ability to label antibodies, or fragments of antibodies, with toxin molecules provides an additional method for treating streptococcal infections when passive immunization is conducted. In this embodiment, antibodies, or fragments of antibodies, capable of recognizing the S. pneumoniae polypeptides disclosed herein, or fragments thereof, as well as other Streptococcus proteins, are labeled with toxin molecules prior to their administration to the patient. When such toxin derivatized antibodies bind to Streptococcus cells, toxin moieties will be localized to these cells and will cause their death.
[00146] The present invention thus concerns and provides a means for preventing or attenuating a streptococcal infection resulting from organisms which have antigens that are recognized and bound by antisera produced in response to the polypeptides of the present invention. As used herein, a vaccine is said to prevent or attenuate a disease if its administration to an animal results either in the total or partial attenuation (i.e., suppression) of a symptom or condition of the disease, or in the total or partial immunity of the animal to the disease.
[00147] The administration of the vaccine (or the antisera which it elicits) may be for either a "prophylactic" or "therapeutic" purpose. When provided prophylactically, the compound(s) are provided in advance of any symptoms of streptococcal infection. The prophylactic administration of the compound(s) serves to prevent or attenuate any subsequent infection. When provided therapeutically, the compound(s) is provided upon or after the detection of symptoms which indicate that an animal may be infected with a member of the Streptococcus genus. The therapeutic administration of the compound(s) serves to attenuate any actual infection. Thus, the S. pneumoniae polypeptides, and fragments thereof, of the present invention may be provided either prior to the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
[00148] The polypeptides of the invention, whether encoding a portion of a native protein or a functional derivative thereof, may be administered in pure form or may be coupled to a macromolecular carrier. Example of such carriers are proteins and carbohydrates. Suitable proteins which may act as macromolecular carrier for enhancing the immunogenicity of the polypeptides of the present invention include keyhole limpet hemacyanin (KLH) tetanus toxoid, pertussis toxin, bovine serum albumin, and ovalbumin. Methods for coupling the polypeptides of the present invention to such macromolecular carriers are disclosed in Harlow et al., Antibodies: A Labor atoiy Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988), the entire disclosure of which is incorporated by reference herein.
[00149] A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient animal and is otherwise suitable for administration to that animal. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
[00150] While in all instances the vaccine of the present invention is administered as a pharmacologically acceptable compound, one skilled in the art would recognize that the composition of a pharmacologically acceptable compound varies with the animal to which it is administered. For example, a vaccine intended for human use will generally not be co-administered with Freund's adjuvant. Further, the level of purity of the S. pneumoniae polypeptides of the present invention will normally be higher when administered to a human than when administered to a non-human animal.
[00151 ] As would be understood by one of ordinary skill in the art, when the vaccine of the present invention is provided to an animal, it may be in a composition which may contain salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. Adjuvants are substances that can be used to specifically augment a specific immune response. These substances generally perform two functions: (1) they protect the antigen(s) from being rapidly catabolized after administration and (2) they nonspecifically stimulate immune responses. [00152] Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the animal being immunized. Adjuvants can be loosely divided into several groups based upon their composition. These groups include oil adjuvants (for example, Freund's complete and incomplete), mineral salts (for example, AIK(SO4)2, AlNa(SO4) , AlNH (SO ), silica, kaolin, and carbon), polynucleotides (for example, poly IC and poly AU acids), and certain natural substances (for example, wax D from Mycobacterium tuberculosis, as well as substances found in Coiγnebacterium parλ'um, ox Bordetella pertussis, and members of the genus Brucella. Other substances useful as adjuvants are the saponins such as, for example, Quil A. (Superfos A/S, Denmark). Preferred adjuvants for use in the present invention include aluminum salts, such as AlK(SO4) , AINa(SO4) , and AINH (SO4). Examples of materials suitable for use in vaccine compositions are provided in Remington's Pharmaceutical Sciences (Osol, A, Ed, Mack Publishing Co, Easton, Pa., pp. 1324-1341 (1980), which reference is incorporated herein by reference).
[00153] The therapeutic compositions of the present invention can be administered parenterally by injection, rapid infusion, nasopharyngeal absorption (intranasopharangeally), dermoabsorption, or orally. The compositions may alternatively be administered intramuscularly, or intravenously. Compositions for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. [00154] Therapeutic compositions of the present invention can also be administered in encapsulated form. For example, intranasal immunization of mice against Bordetella pertussis infection using vaccines encapsulated in biodegradable microsphere composed of poly(DL-lactide-co-glycoIide) has been shown to stimulate protective immune responses. Shahin, R. et al., Infect. Immun. 63:1195-1200 (1995). Similarly, orally administered encapsulated Salmonella typhimurium antigens have also been shown to elicit protective immunity in mice. Allaoui-Attarki, K. et al., Infect. Immun. 65:853-857 (1997). Encapsulated vaccines of the present invention can be administered by a variety of routes including those involving contacting the vaccine with mucous membranes (e.g., intranasally, intracolonicly, intraduodenally). Many different techniques exist for the timing of the immunizations when a multiple administration regimen is utilized. It is possible to use the compositions of the invention more than once to increase the levels and diversities of expression of the immunoglobulin repertoire expressed by the immunized animal. Typically, if multiple immunizations are given, they will be given one to two months apart. [00155] According to the present invention, an "effective amount" of a therapeutic composition is one which is sufficient to achieve a desired biological effect. Generally, the dosage needed to provide an effective amount of the composition will vary depending upon such factors as the animal's or human's age, condition, sex, and extent of disease, if any, and other variables which can be adjusted by one of ordinary skill in the art.
[00156] The antigenic preparations of the invention can be administered by either single or multiple dosages of an effective amount. Effective amounts of the compositions of the invention can vary from 0.01-1,000 μg/ml per dose, more preferably 0.1-500 μg/ml per dose, and most preferably 10-300 μg/ml per dose. [00157] The present invention also provides methods for identifying potential antimicrobial agents capable of antagonizing, inhibiting or otherwise interfering with the function of a polypeptide of SEQ ID NO:238-474. One preferred method provides for inactivating the polypeptide in Streptococcus pneumoniae, exposing the strain to a candidate agent, and determining whether the Streptococcus pneumoniae is still viable in vitro or in vivo. Another preferred method for the identification of an agent that is effective in the treatment and/or diagnosis of Streptococcus pneumoniae infection, provides contacting a polypeptide of SEQ ID NO: 238-474 with a target agent, and selecting an agent that binds specifically to said nucleic acid or polypeptide. [00158] Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced.
[00159] Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means. In addition, known pharmacological agents may be subject to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc.
[00160] Having now generally described the invention, the same will be more readily understood through reference to the following example which is provided by way of illustration, and is not intended to be limiting of the present invention, unless specified.
EXAMPLES
EXAMPLE 1 : Large Scale Identification of Serotype 4 Streptococcus pneumoniae Virulence Factors
MATERIALS AND METHODS
Bacterial strains, plasmids, and DNA manipulations
[00161] Strains, plasmids, and primers used in this study are listed in Table 3. All S. pneumoniae strains used and constructed in this study are derivatives of TIGR4, a serotype 4 clinical isolate. Antibiotic concentrations used in this study were as follows: chloramphenicol (Cm) 4 μg ml"1, streptomycin (Sm) 100 μg ml"1, and spectinomycin (Spc) 200 μg ml"1 for S. pneumoniae; Cm 10 μg ml"1 and Spc 100 μg ml"1 for E. coli. All DNA manipulations were carried out according to standard protocols (Sambrook et al, 1998). Signature-tags were PCR amplified from a plasmid preparation of pUTmTn5Km2 (Hensel et al, 1995) using primers P6 and P7. PCR amplification conditions were as follows: 30 cycles of 96°C for 30 s, 94°C for 20 s, 52°C for 45 s, and 72°C for 10 s, followed by a final dwell at 72 °C for 15 minutes. PCR products were ethanol precipitated and resuspended in Bgl II buffer (New England Biolabs), and digested with Bgl II overnight at 37°C. Plasmid pEMcat was digested overnight with Bgl II. Both the linearized plasmid and the signature- tags were gel purified, and the former was dephosphorylated using shrimp alkaline phosphatase according to the manufacturer's instructions (Boehringer Mannheim). Purified signature-tags were ligated into the vector overnight with T4 DNA ligase (New England Biolabs) and the ligation mixture was introduced into E. coli DH5αλpir via electroporation. Transformants were selected on Luria-bertani (LB) agar plates supplemented with Cm.
[00162] Transformants that contained uniquely tagged mini-transposons on pEMcat were isolated as follows. Colony purified transformants were grown overnight in four microtiter plates, each plate comprised a pool. Next, 4 μl of each well was spotted onto Duralon nitrocellulose membranes, one pool per membrane (Stratagene). Membranes (one per pool) were transferred onto filter paper (Whatman) saturated in denaturation solution (0.5N NaOH, 1.5M NaCl) for 10 minutes (mins), 0.1% SDS for 3 min, and lastly, neutralization solution [1.0M Tris HC1 (pH 7.5), 1.5M NaCl] for 3 min, at which time, DNA was cross-linked to membranes in a UV Stratalinker (Stratagene). The membranes were incubated in 3X SSC, 0.1% SDS for lh, and cellular debris was gently removed from the membranes by rubbing with Kimwipes (Kimberly-Clarke). Probe was generated from each pool using primers P6 and P7 by dioxygenin(DIG)-dUTP labeling PCR as described by the manufacturer (Roche). Cross-reacting signature-tags were eliminated between each of the pools by successive hybridizations of probe from one pool to blots with tags from another pool. From these hybridizations, 129 strains that did not cross-hybridize were randomly assembled into two new pools, and screened for cross-hybridizing signature-tags as above. Finally, 93 strains were selected that did not cross-hybridize and that contained signature-tags were isolated that amplify well by PCR. To generate master dot blots for hybridization of input and output signature tags, the unique 40 bp signature-tag of each magellan2 transposon was purified and spotted onto membranes as described (Merrell et al, 2002). All membranes were stored at 4°C. In vitro transposon mutagenesis. DNA transformation, and pool construction
[00163] Plasmid DNA was purified from E. coli strains harboring each of the 93 uniquely tagged magellanl elements using Qiagen mini plasmid preparation kit according to the manufacturer's instructions (Qiagen). S. pneumoniae genomic DNA was isolated from AC353 as follows: AC353 was grown in 40 ml of THY (Todd Hewitt broth, 0.5% yeast extract) supplemented with Sm and 5 μl ml"1 Oxyrase (Oxyrase Inc.) statically in a candle extinction jar. Cells were washed in sterile dH 0, resuspended in 200 μl of lysis buffer (0.1% deoxycholate, 0.01% SDS, 0.15M NaCl) and incubated at 37°C for 10 min. Next, 0.9 ml of SSC was added and samples were incubated an additional 10 min at 65°C. The cell lysate was phenol extracted, chloroform extracted and ethanol precipitated. Precipitated DNA was washed in 70% ethanol, and resuspended in 200 μl of 50mM Tris-HCl (pH 7.5), 5mM CaCl2. 10 μl of proteinase K (10 mg ml"1) and 2 μl of RNase (100 mg ml"1) were added and the mixture was incubated at 37°C for 10 min. EDTA was added to lOmM to stop the reaction, and the lysate was again extracted with phenol and chloroform, and ethanol precipitated.
[00164] In vitro magellan2 transposition reactions were carried out with purified MarC9 transposase, 500 ng of target AC353 genomic DNA and 1 μg of each of pEMcat derivative separately, essentially as described (Lampe et al., 1999). Reactions were ethanol precipitated and resuspended in gap repair buffer [50mM Tris (pH 7.8), lOmM MgCl2, ImM DTT, lOOnM dNTP, and 50 ng of BSA]. Repair of transposition product gaps was performed as described (Akerley et al., 1998), except that E. coli DNA ligase (NEB) was used in place of T4 DNA ligase. Repaired transposition products were transformed into naturally competent AC353 as described (Bricker and Camilli, 1999). Of the 93 pEMcat derivatives used' in the above procedure, only 63 reproducibly yielded sufficient numbers of transformants. Therefore, CmR colonies were picked from these 63 transformations only, and statically grown to late logarithmic phase in 200 μl of THY in 96 well microtiter plates in candle extinction jars, and subsequently frozen after the addition of glycerol to 20% (v/v). This entire procedure was repeated three times to assemble 100 pools of 63 mutant strains to be used for STM screening as described below. For the assembly of 2° pools, 1 μl of frozen cells from the appropriate well was inoculated into 200 μl of THY in a 96 well microtiter plate and grown for 5 h to log phase as above. Glycerol was added to 20% (v/v) and the plates were stored at -75 °C.
[00165] Magellan5 transposon insertions into the rlrA locus were generated identically to the magellan2 mutagenesis, except that two different 7 kb PCR products were used as target DNA. PCR products were amplified from AC353 with primer sets TNPAB-F/REG2-R and REG2-F/PFL-R (Table 4) and purified using the Qiagen PCR purification kit according to manufacturers guidelines. In vitro transposition, gap repair, and natural transformation were carried out exactly as for magellanl.
Animal infections
[00166] In all animal infections 6 - 10 week-old female Swiss Webster mice were used (Taconic Labs). Mice were provided with continuous food and water, and housed according to the Tufts University Department of Lab Animal Medicine guidelines. Pools were prepared for infection by resuspending —1 μl of frozen cells in 25 μl of THY, and plating 5 μl of each strain as a discrete spot on a blood agar plate [Blood Agar Base No. 2 (Difco) and 5% defibrinated sheep blood] supplemented with Cm and Sm. Following overnight growth, the entire pool was resuspended in THY and adjusted to OD6oo « 0.85 (approximately 5 x 108 CFU ml"1), the remainder of this resuspension was saved and used to asses the complexity of the input population of bacteria (see below). In the determination of colonization bottlenecks, and the 1° and 2° STM screens, 40 μl of each resuspended pool was inoculated intranasally into two lightly anesthetized mice using methoxyflurane inhalation. The infections were carried out for 44 h at which time, mice were sacrificed by CO asphyxiation. Both lungs from each animal were aseptically removed, and homogenized in 5 ml of THY- glycerol (20% v/v) and stored at -75°C.
[00167] Serial dilutions of bacteria recovered from each mouse were plated on blood plates supplemented with Sm and Cm, such that a semiconfluent lawn of colonies was obtained. Bacteria were recovered with THY, genomic DNA from input and output bacteria were prepared using the DNAEasy Tissue kit according to the manufacturers tissue preparation protocol (Qiagen). Recovered genomic DNA was used as template for PCR amplification of the signature tags. DIG-dUTP was incorporated during the PCR as described above and signature-tag master blots were probed as described (Merrell et al., 2002).
Competition Experiments
[00168] Prior to competition experiments, magellan2 insertion mutations were back-crossed into AC353 as follows: Genomic DNA was prepared from each selected mutant strain as above, and was used to transform natural competent AC353 as described (Bricker and Camilli, 1999). Mutant and wild-type (AC353) strains were grown separately on blood agar plates with appropriate antibiotics, and recovered and prepared for infection identically to the input pools above. Prior to infection, mutant bacteria and AC353 were mixed in a 1:1 ratio, and inoculated at the following doses: 1 x 107 CFU for lung infections, 5 x 105 for i.p. infections, and 1 x 108 CFU for nasopharyngeal inoculation. I.p. infections were carried out for 20 h and nasopharyngeal carriage infections for 7 days. Bacteria from systemic infections were recovered from the bloodstream by cardiac puncture. Nasopharyngeal colonized bacteria were recovered by washing the nasopharynx with 400 μl of sterile phosphate buffered saline essentially as described (Wu et al, 1997). In conjunction with each in vivo competition, an in vitro competition was carried out as follows: 40 μl of each mixture was inoculated into 10 ml of THY supplemented with Sm (50 μg ml"1) and Oxyrase (5 μl ml"1) and grown (~9 doublings) to mid-log phase for 5 h. Following each experiment, the ratio of mutant to wild-type bacteria, for both in vitro and in vivo competitions, was determined by first plating recovered bacteria on TSA blood plates with Sm, and subsequently replica-plating colonies to plates with Sm or Sm and Cm. Competitive indices were calculated as the ratio of mutant to wild-type bacteria recovered from each animal (in vivo CI) or from THY broth (in vitro CI) adjusted by the input ratio.
Arbitrarv-primed PCR. DNA sequencing, and Sequence analysis
[00169] For each of the 387 strains determined to be highly attenuated by STM screening, we attempted to amplify one magellan21 g normc junctional sequence by arbitrary-primed PCR and determined its sequence as described (Merrell et a , 2002). The primer pairs used for the arbitrary-primed PCR reactions (ARB1/MAG2F3 and ARB2/MAGF4) are listed in Table 4. DNA sequencing of arbitrary primed PCR products was performed by the W.M. Keck Facility at Yale University. Obtained nucleotide sequence was used to identify the precise site of the magellan2 insertion in the TIGR4 genome sequence. The predicted protein sequence of each disrupted ORF was used to search the non-redundant NCBI protein database by BLASTP.
[00170] The site of the magellanS transposon insertions in the rlrA locus were first determined by PCR using either TNPAB-F or PFLA-R with the primer MarOUT, which anneals to either end of the mini-mariner transposons, followed by gel electrophoresis. Select PCR products were then purified with the Qiagen PCR purification and the DNA sequence of the transposon junction was determined using MarOUT by the Tufts University Core Sequencing Facility.
[00171] The protein sequences of sortase homologues were aligned using a ClustalW alignment in Mac Vector 7.0. Neighbor joining analysis based on the mean character distance was performed using PAUP* 4.0b 10, and bootstrap values were calculated from 100 replicates.
Construction of mutant pools
[00172] To generate a large number of S. pneumoniae transposon insertion strains, chromosomal DNA was prepared from strain AC353, a streptomycin-resistant derivative of TIGR4 (Tettelin et al., 2001), and mutagenized by in vitro transposition with magellan2. Magellan!, a mini-transposon derivative of mariner, inserts into the pneumococcal chromosome in a highly random manner (data not shown), requiring only a TA dinucleotide at the insertion site (Lampe et al, 1996). Transposon mutagenesis was performed as described (Akerley et ah, 1998), except that 63 magellanl derivatives, each containing a unique 40 basepair (bp) signature tag were used. Following transposition, mutagenized DNA was transformed into naturally competent AC353 as described (Bricker and Camilli, 1999). Approximately 100 insertion strains were sequentially collected from each of the 63 magellan2 derivatives into the wells of microtiter plates, resulting in 100 pools of 63 signature tagged insertion strains for STM screening. Determination of colonization bottlenecks
[00173] In an animal, not all bacteria in an inoculum are able to overcome barriers that limit or restrict the number of bacteria that survive initially and begin to multiply. This phenomenon is commonly referred to as a 'colonization bottleneck' (although 'colonization' is an inaccurate term in cases like pneumococcal pneumonia that are acute infections and of limited duration. Since STM depends on all strains in the starting inoculum having an equal opportunity to infect a particular tissue, the population dynamics of AC353 in the murine lung were analyzed to determine whether a bottleneck existed. To address this, a group of female Swiss Webster adult mice were infected with a single STM pool of 63 unique strains at a dose of 105 CFU administered mtranasally. At various times following inoculation, pairs of mice were euthanized and the number of CFU in the lungs from each animal was enumerated. After 12 h, the mice appeared healthy and no bacteria could be cultured from the lungs, suggesting that a severe bottleneck exists. In an attempt to circumvent this bottleneck, the inoculum was increased to 2 x 107 CFU and the number of CFU per mouse lung was determined as above. The larger inoculum resulted in the successful infection of all mice, as between 104 - 107 CFU were recovered from all animals at all time points until the mice became moribund after approximately 48 h. Accordingly, all subsequent lung infection experiments were performed with an inoculum of 2 x 107 CFU.
[00174] A second variable assessed, was the potential for a limited number of strains to out-grow all others after initial adherence, thus preventing all 63 strains from being equally represented at a late stage of infection. To test this possibility, four mice were infected with a single STM pool, and the complexity of the bacterial populations remaining in the lungs of each mouse at a late stage of infection was determined and compared. The presence or absence of each strain in the lungs was assessed by recovery of the signature tags and hybridization to a master signature tag dot blot as described in the Materials and Methods. The full input pool strain complexity was maintained in all four mice after 44 h of infection, with the exception of a few strains absent from all mice, which represent bonafide attenuated strains (data not shown). Therefore, a pool complexity of 63 strains administered at 2 x 107 CFU/mouse results in all 63 strains having an equal opportunity to adhere and multiply in the mouse lung, and strains that fail to be recovered after 44 h are attenuated. Of note, the pool complexity used here is intermediate to that chosen for two prior STM screens in S. pneumoniae. Polissi et al. (Polissi et al., 1998) used a pool complexity of 50 strains, mutagenized by plasmid insertion-duplication, to infect BALB/c mice in a murine model of pneumonia. In the other study, Lau et al. (Lau et al., 2001) used a pool complexity of 96 strains, also mutagenized by plasmid insertion-duplication, to infect CD- 1 mice in murine models of pneumonia and bacteremia.
[00175] Another potentially powerful application of STM is to track a population of bacteria that initially infect a single site, and subsequently spread to other sites in the animal. From such an analysis, it is possible to determine if a systemic infection is clonal or due to a larger founder population. If the latter was true for the case of S. pneumoniae spreading from the lung to the bloodstream, then two simultaneous STM screens could be conducted after intranasal inoculation; one in the lung and one in the blood. Instead, in mice infected with the same STM pool, the population of bacteria recovered from the bloodstream is randomly composed of only a few strains from the input inoculum (data not shown).
Selection ofavirulent strains
[00176] To identify pneumococcal genes essential for lung infection in mice, an STM screened was done. In total, 100 pools comprising 6149 strains were screened. Each pool was inoculated into two mice and the bacteria were recovered after 44 h by plating homogenized lung tissue from each animal on Tryptic-Soy Agar blood plates. Chromosomal DNA was purified from the combined outputs from each animal and used as template DNA for the PCR amplification of the signature tags as described in the Materials and Methods. A similar procedure was followed to obtain signature tags from the input population of bacteria. The amplified signature tags were used to probe nitrocellulose dot blots containing all 63 tags and attenuated strains were identified by visually examining output blots for spots exhibiting a decreased hybridization signal compared to the input blot.
[00177] In the primary ( 1 °) round of screening, 2101 candidate attenuated strains were identified in a non-stringent manner, i.e., all strains that gave a noticeably reduced signal on the output blot compared to the input blot were selected. A more stringent secondary (2°) screen was then done on 2080 of these candidate attenuated strains. For this, the 2080 strains were assembled into smaller 2° pools of 40 strains and each pool was inoculated intranasally into two mice at 2 x 107 CFU. After amplifying the signature tags from the input and output bacteria, and hybridization to the master dot blot membranes, 1265 strains were selected that had a highly reduced output signal relative to the input signal. These virulence attenuated strains represent 20%) of the total number of strains initially screened.
[00178] In order to narrow the focus of study, a re-examination of the 2° screen dot blot films was done to identify the subset of strains that were highly attenuated as determined by lack of any hybridization signal on the output blots. Through this analysis, 387 strains were identified, representing 6.3% of the total strains screened. The sites of transposon insertion in 337 of the 387 strains were determined by arbitrary-primed PCR and DNA sequencing of the magellan2l genome junctions essentially as described (Merrell et al, 2002). Table 1 lists these 337 strains, along with information on the gene disrupted in each and a functional classification based on the TIGR4 genome sequence release (Tettelin et al., 2001).
Quantification of virulence defects of selected mutants
[00179] To validate the results of the STM screen and to quantify the degree of virulence attenuation of individual strains, competition assays were done. The transposon insertion mutations from 17 of the 337 highly attenuated strains, including 12 strains with disruptions in putative transcriptional regulators, were backcrossed into the wild-type strain and tested by competition assay as follows. Each of the mutant strains was mixed with the wild-type strain at a 1 :1 ratio, and inoculated intranasally into four or more mice and simultaneously into Todd Hewitt- Yeast extract (THY) broth. Bacteria were enumerated from the lungs at 44 h and after 5 h from THY broth by plating serial dilutions on media selective for both wild-type and test strains, and then replica plating the colonies to media selective for only the test strain. The in vivo competitive index (CI) was calculated by dividing the ratio of mutant to wild-type bacteria recovered from the lungs by the ratio of mutant to wild- type bacteria that were inoculated into each animal. Similarly, the in vitro CI was calculated using THY broth cultures in order to assess general growth defects. The geometric means of the CIs for each strain are listed in Table 2; a mean CI of less than 1 indicates a defect in virulence (or growth in vitro) of the test strain. Of the 17 strains examined, 16 were attenuated for lung infection. Furthermore, 13 were outcompeted by greater than 10-fold, confirming that the selected strains are highly attenuated when tested against the wild-type parental strain. None of the 17 strains tested suffered gross defects in multiplication in broth in vitro. This analysis indicates that the majority of the 387 mutant strains identified by two successive rounds of STM screening are reproducibly attenuated in competition assays. Hence, the genes disrupted or whose expression is affected by the transposon insertion in these strains should be considered bonafide virulence factors.
Determination of virulence phenotypes in other infection models
[00180] After confirming the attenuation of virulence of the selected strains in the murine lung, we sought to determine if these strains have global virulence defects, or if they could be categorized into classes based on in vivo phenotypes in other animal assays. To this end, most of the set of confirmed lung attenuated strains, and many additional strains, were tested in competition assays in murine models of bacteremia and nasopharyngeal carriage. For each animal model, mutant and wild-type bacteria were prepared exactly as described for the lung infections, however, different inoculum sizes were utilized to assure proper representation of each strain. For the bacteremia model of infection, mice were inoculated with 106 CFU by intraperotineal injection (i.p.). Alternatively, 108 CFU were inoculated intranasally into mice using a small inoculum volume for the nasopharyngeal carriage model. After 20 h for bacteremia and 7 days for nasopharyngeal carriage, the bacteria were recovered from blood or nasopharyngeal washes respectively, and CIs were determined as described above.
[00181 ] Of the 24 strains that were tested in the bacteremia model, half were attenuated, albeit to varying degrees (Table 2). Four strains, two with insertions in transcriptional regulators (STM119 and STM210) and two with insertions in biosynthetic genes (STM4 and STM208), had severe virulence defects of greater than 40-fold. Of the remaining eight attenuated strains, three had intermediate defects (14 to 19-fold) and five were only slightly attenuated. The remaining 12 strains that were tested against the parental strain were not attenuated. Together, these data show that a set of tissue specific virulence factors have been identified, including several putative transcriptional regulators.
[00182] Thirteen strains that were attenuated for lung infection were tested for their ability to colonize the nasopharynx in competition with the wild-type strain. As in the bacteremia model, not all of the strains that were attenuated for lung infection were attenuated for colonization of the nasopharynx. Eight of the tested strains were deficient at colonizing the nasopharynx, and all eight exhibited greater than a 10-fold colonization defect. Interestingly, these 8 strains had differing phenotypes in lung infection and bacteremia. Five were attenuated in all three of the animal models (Class IV), including one mutant in a putative transcriptional regulator (STM38) and a second in the response regulator of a two-component signal transduction system (STM185). The remaining 3 strains were not attenuated when tested in the bacteremia model, but were each severely outcompeted by the wild-type strain in the two animal models of infection that involve interactions with mucosal surfaces.
Identification o rlrA and a sortase homologue required for infection
[00183] Of the transcriptional regulators identified by STM and tested in additional animal models, one (STM64) putatively codes for a protein with 49% similarity to RofA and Nra from S. pyogenes (Fogg et al., 1994; Podbielski et al, 1999). This mutant strain was outcompeted by the parental strain in both the pneumonia and nasopharyngeal carriage models, but not the bacteremia model. A greater virulence defect was observed in the nasopharynx, where the rlrA strain was outcompeted 14-fold (Table 2). These findings suggest that RlrA regulates one or more genes that are important for the interaction of S. pneumoniae with mucosal surfaces in the respiratory tract.
[00184] In some strains of S. pyogenes, rofA regulates the expression of a divergently transcribed gene coding for Protein F, a factor that mediates attachment to fibronectin (Fogg et al, 1994). The pneumococcal rofA homologue, herein named rlrA, for rofΛ-like regulator, is divergently transcribed from six genes (SP0462 to SP0468), three of which have very weak homology to microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), and three that have homology to sortases (Figure 1). Sortases are enzymes that catalyze the covalent linkage of a family of secreted proteins that contain an LPXTG (SEQ ID NO: 530) motif to the bacterial cell wall (Mazmanian et al, 2001). Although these three S. pneumoniae sortases were apparent from the genome sequence (Pallen et al, 2001; Tettelin et al, 2001), no experimental data to characterize these has been reported. In work to be reported elsewhere, RlrA was found to regulate the transcription of these six genes, and thus the three putative MSCRAMMs have been named rrgA, rrgB, and rrgC for RlrA-regulated gene. In addition, based on strong homology to sortases, the existence of a fourth sortase elsewhere in the chromosome, and the results below, the three flanking genes have been named srtB, srtC, srtD. Interestingly, one of the mutants identified in the STM screen mapped to srtD (STM65 in Table 1), the terminal gene in the locus.
[00185] Given that the rlrA and srtD strains were attenuated for infection and colonization of mucosal surfaces, it was determined whether any of the other genes in the locus were also attenuated in the same mouse tissues. Magellan5, a mini-mariner transposon conferring spectinomycin resistance, was used to create insertions by in vitro transposition into two PCR products spanning the entire rlrA locus. The transposition products were transformed into naturally competent AC353, and 55 transposon insertion strains were selected. Each transposon insertion was coarsely mapped by PCR using a template specific primer and a transposon specific primer, and the junction sequence of the transposon/m ge/ZcmJ junctions in selected strains was determined by DNA sequencing. Transposon insertions were obtained throughout the locus, including numerous insertions in each gene in the locus, thus demonstrating that neither the sortase genes, nor the rrg genes are essential for growth of S. pneumoniae in vitro.
[00186] Each of the transposon insertion strains shown in figure 1, except for rlrA, was tested by competition assay in the murine model of pneumonia, as described above. The results from these experiments are shown in Figure 2A. Of the six strains tested, only the rrgA and the srtD strains had a virulence defect in the murine lung, exhibiting a 18-fold and a 24-fold attenuation respectively (Figure 2A). The same six strains were also tested for colonization defects in the nasopharynx. In these assays, the rrgA strain was again attenuated, exhibiting a 5-fold defect, and the srtB strain had a modest 2-fold defect (Figure 2B). The other four genes were not required in either animal model. On the contrary, transposon insertions in srtC and rrgC resulted in a phenotype of hypercolonization in the nasopharynx. The basis by which these strains outcompete the wild-type strain was not investigated. In a further set of competition experiments, we tested the rrgA, srtB, and srtD strains for defects in survival during bacteremia. We found that none of these were attenuated in this model (Figure 2B). These data support the model whereby these factors are specific to the interaction of S. pneumoniae and mucosal surfaces.
Signature-tagged mutagenesis fails' to isolate virulence attenuated acapsular strains
[00187] The extracellular polysaccharide capsule plays an absolute role in the pathogenesis of S. pneumoniae. The majority of the biosynthetic genes coding for the serotype 4 capsule (SP0337 to SP0353) appear to be organized into a single operon of approximately 15 kilobases (kb), representing about 0.7 % of the TIGR4 genome. In our STM screen and in two smaller scale STM screens in S. pneumoniae (Lau et al, 2001; Polissi et al, 1998) virulence attenuated acapsular mutants were not found. Negative results led us to the hypothesis that, either the capsule was not required by TIGR4 for lung infection of Swiss Webster mice, or that magellan2 insertions into the capsular operon were deleterious to growth in vitro, and therefore could not be isolated.
[00188] To discern between these two possibilities, a 9.9 kb fragment of the capsule operon was amplified with primers cpsFl and cpsRl by PCR, and used as template DNA for in vitro magellaιι2 transposon mutagenesis. The transposition products were transformed into wild-type bacteria and transposon insertion strains were selected on media containing Cm. No transformants were recovered after the standard 24 h of growth, however, after an additional 24 h a small number of transformants appeared. In contrast, in a parallel experiment, transposition into a non- essential 10 kb segment of the genome yielded a large number of transformants after 24 h of growth (data not shown). Thus the conclusion is that disruption of the TIGR4 capsular operon by magellan2 is inhibitory to colony formation in the experimental conditions used, and that the failure to recover attenuated acapsular mutants is most likely due to the low plating efficiency of these strains following transformation. The growth rate of an acapsular mutant, AC846 (see below), was found to be equivalent to the wild-type strain when grown individually or in co-culture experiments in THY broth showing that the low frequency selection of these strains is not simply due a general growth defect. Whether a similar phenomenon occurred in the other two STM screens remains unknown.
[00189] Several of the acapsular mutants isolated after 48 h of growth in the above experiment were confirmed by mapping of the magellan2 insertion and by negative Quellung reactions (data not shown). An acapsular strain containing a disruption of cps4E (AC846, Table 3) was tested in competition assays in the murine lung and bacteremia models. In both instances the acapsular mutant was severely attenuated (CI < 0.04 and < 0.001 for pneumonia and bacteremia models, respectively), confirming the importance of serotype 4 capsule in these animal models.
[00190] Novel insights into the pathogenesis of S. pneumoniae axe likely to aid in the development of new antibiotic treatments and vaccines. Current knowledge of factors implicated in virulence have led to promising developments towards new protein based vaccines (Briles et α , 2000a; Briles et αl., 2000b), however, an understanding of how most of these factors contribute to and function during infection is still lacking. In this study, the knowledge base of genes that are essential for virulence in a murine model of pneumonia has been greatly expanded by completing an STM screen; the third of its kind in this organism, but by far the most extensive. [00191] Surprisingly, 20%o of the 6147 strains screened by STM had a noticeable virulence defect. The large percentage of attenuated strains isolated in this screen is much higher than the 1 to 7 % observed in similar screens in other Gram-positive pathogens (Autret et αl, 2001; Jones et αl., 2000; Mei et αl., 1991). Of note, however, each of the previous pneumococcal STM screens identified approximately 10%) of strains as attenuated (Lau et αl., 2001; Polissi et αl., 1998). The difference between prior pneumococcal STM screens and ours may result from more stringent cut-offs for selecting attenuated strains in the latter studies. Additionally, as has been suggested by others, it is conceivable that the use of a polar transposon mutagen may contribute to a higher percentage of attenuated strains within a library compared to mutants isolated by plasmid insertion-duplication (Paton and Giammarinaro, 2001). Insertion of a polar transposon into a genetic locus not only disrupts the gene harboring the insertion, but also downstream genes that are cotranscribed with that gene. With plasmid insertion-duplication, not all insertions will result in a gene or operon null mutation, as for example plasmids containing either the 5' end of a gene or containing a promoter region will likely regenerate a wild-type copy of the same gene or promoter following recombination.
[00192] The three independent STM screens in S. pneumoniae have resulted in the combined screening of over 8500 strains for virulence defects in a number of different assays. Remarkably, there is very little overlap in the sets of genes that have been identified as essential virulence factors in each of these screens. Only 10 of the 231 unique genes identified here were also reported in previous S. pneumoniae STM screens (Lau et al, 2001; Polissi et al., 1998). The lack of significant overlap between the three screens is likely the result of two factors; 1) the number of S. pneumoniae genes that are crucial to survival in vivo is probably large, such that the combined STM screens have not approached saturation yet, and 2) the different mutagenesis strategies employed (transposon versus plasmid insertion-duplication) are responsible for mostly distinct sets of genes being disrupted. Regardless of the underlying causes, the lack of significant overlap between the three STM screens suggests that many additional factors linked to virulence remain to be identified. [00193] To learn more about additional in vivo roles for some of the virulence genes identified herein, mutants were grouped based on their phenotypes in murine models of nasopharyngeal carriage and bacteremia. In total, 25 different strains were tested in multiple animal models using competition assays, and these are grouped by class in Table 2. From this a picture emerges of the tissue specificity that many S. pneumonia virulence factors play.
[00194] One striking feature of these classes is that many transcriptional regulators are found in each of the four classes, reinforcing the idea that tissue specific regulation of virulence factors is important for pneumococcal pathogenesis. Of the 16 putative transcriptional regulators identified in our screen, only two, smrC and SP2142 (STM119 and STM256) have been previously identified in S. pneumoniae, and thus most have unknown targets of regulation. Similarly, most of the two component signal transduction systems (TCSTS) in S. pneumoniae also have unknown targets of regulation. In this screen, roles for five of the 13 S. pneumoniae TCSTSs are implicated in lung infection (Lange et al, 1999; Throup et al, 2000). In addition to the insertions isolated in rrOl, rr07, zmpR, and comD (STM 185, STM29, STM90, and STM281), the insertion in strain STM237 could potentially have polar effects on hkll/rrll. Four of these five strains were tested in competition assays. Three strains were attenuated in competition assays in the lung, but they each had different phenotypes in the bacteremia model; zmpR was not attenuated, rrOl was attenuated 4-fold, and STM237 was attenuated 14-fold. Additionally, rrOl was severely outcompeted by the wild-type strain during nasopharyngeal colonization, making it the only one of the three TCSTSs tested that was required in all three models.
[00195] Mutants in most of the TCSTSs have been tested previously for avirulent phenotypes. comDE, which is involved in the induction of natural competence (Pestova et al, 1996), was previously shown to attenuate virulence in both lung infection and bacteremia (Bartilson et al, 2001; Lau et al, 2001). Two groups identified each of the S. pneumoniae TCSTS by sequence homology and tested mutant TCSTS strains in different animal models (Lange et al, 1999; Throup et al, 2000). Throup et al (Throup et al, 2000) used the respiratory tract infection (RTI) model to test TCSTS mutants for virulence defects, which employs single strain infections and relies on the titer of the mutant strain compared to the wild-type strain following 48 h of infection to determine the virulence phenotype. By this assay, mutations in rrOl and zmpR each attenuated virulence, which is consistent with our findings, however, a mutation in hklllrrll did not. Lange et al. (Lange et al, 1999) examined mutant TCSTS strains for defects during systemic infection by determining the mean survival time of mice infected with each strain. None of the TCSTS mutant strains tested by this assay were attenuated, which conflicts with the observed phenotype of an rrOl strain and STM237. These differences are best explained by the different animal assays used in each study. The previous experiments were done as single strain infections and used the survival of the animal to measure virulence defects, whereas our competition assays measure the ratio of the mutant and wild-type strain following coinfection to assess attenuation. Additionally, since our insertion in STM237 is upstream of the coding sequence for hkll/rrll in a putative ABC transporter, it is possible that this strain has a more severe phenotype than an insertion in either hkll or rrll alone. In light of these findings and those of others (Bartilson et al, 2001; Lau et al, 2001; Throup et al, 2000), it is interesting to speculate that these three two-component systems play important roles in the adaptation of S. pneumoniae to different host environments by sensing different extracellular signals that in turn result in differential virulence gene regulation.
[00196] The sequencing project of the TIGR4 strain identified a small number of loci that are not conserved in two other pneumococcal strains (Tettelin et al, 2001). One such locus encodes rlrA (SP0461), a ro A-like transcriptional regulator, and six divergently transcribed genes including three putative MSCRAMM surface proteins. The present screen identified two genes in this locus, rlrA and srtD, and subsequently tested the other five genes for roles during infection. Three of the flanking genes, rrgA, rrgB, and rrgC, code for putative surface proteins that are homologous to MSCRAMM family members, and thus it is predicted that they may be involved in the attachment of S. pneumoniae to mucosal surfaces. Consistent with this hypothesis, the rrgA strain was attenuated in both the pneumonia and the nasopharynx carriage model, but not the bacteremia model.
[00197] In addition to having homology to MSCRAMMs, RrgA, RrgB, and RrgC have sorting signals that are characteristic of proteins that are anchored to the gram- positive cell wall by sortases (Mazmanian et al, 2001). The sorting signal is composed of a C-terminal sequence consisting of an LPXTG motif (SEQ ID NO: 530), followed by a stretch of hydrophobic residues, and a series of charged residues (Schneewind et al, 1993). RrgA, RrgB, and RrgC each have these characteristics, except that the leucine is replaced by a tyrosine, isoleucine and valine, respectively (Figure IB). Since at least one cell-wall anchored protein (RrgA) is required for infection and colonization, one would predict that one or more sortases should also be required. Consistent with this hypothesis, we found that a mutation in srtD resulted in a severe defect in the ability of S. pneumoniae to infect the lung. Together with the observed phenotypes of other strains with mutations in the rlrA locus, these data suggest a specific role this locus in the interaction of S. pneumoniae with mucosal surfaces.
[00198] In S. aureus, it has been elegantly shown that sortases are transpeptidases that anchor target proteins by cleaving the peptide bond between the threonine and glycine of the LPXTG (SEQ ID NO: 530) and covalently anchoring the threonine to the cell wall. Through the genomic sequence analysis of numerous Gram-positive organisms it is evident that multiple sortase paralogues are common within single strains, including TIGR4. In addition to srtBCD, the TIGR4 genomic sequence also contains a fourth sortase, srtA. SrtA is found in at least two other S. pneumoniae strains, R6 and D39, which do not contain srtBCD (Hoskins et al, 2001). Given this, we hypothesize that srtA is the sortase orthologue common to all S. pneumoniae and other streptococci, whereas srtBCD may be 'specialized' sortases that have been acquired by only select strains to anchor specific proteins. To investigate this further, a phylogenetic tree was constructed using the four S. pneumoniae sortases and other sortase homologues from a number of Gram-positive bacteria (Figure 3). SrtA from both TIGR4 and R6 are found grouped in a clade with other SrtA orthologues including those from S. gordonii, S. pyogenes, and S. suis. SrtBCD, however, are rooted in two separate clades with non-SrtA sortase orthologues from S. suis and S. pyogenes. Together, these data indicate that sortases fall into at least two different groups, one group that contains the commpn sortases to many Gram-positive bacteria and a second group containing specialized sortases.
[00199] The role that multiple sortase paralogues play in protein anchoring has only been studied in two different species thus far. In S. aureus there are two known sortases, SrtA anchors the majority of the LPXTG (SEQ ID NO: 530) containing proteins, while SrtB has only been shown to anchor a single protein that contains an asparagine substituted for the leucine in the LPXTG motif (SEQ ID NO: 530). Furthermore, srtB is transcriptionally regulated in response to changing iron conditions, rather than being expressed constitutively (Mazmanian et al, 2002). In S. suis, five sortase homologues have been identified, and as in S. aureus, the majority of the anchored surface proteins are dependent upon a single sortase, SrtA. Given these findings, SrtA is susptected to anchor most LPXTG (SEQ ID NO: 530) containing proteins in S. pneumoniae, and the remaining sortases may then anchor a specific set of surface proteins in different environmental conditions in response to different environmental cues. It is tempting to speculate that the role for SrtB, SrtC, and SrtD proteins in TIGR4 is to anchor the (L)PXTG-motif (SEQ ID NO: 530) proteins RrgA, RrgB, and RrgC, which are coded by the genes flanking srtBCD. EXAMPLE 2: Transcriptional Regulation in the Streptococcus pneumoniae rlrA Pathogenicity Islet by RlrA
MATERIALS AND METHODS
Bacterial strains, plasmids, and primers
[00200] The bacterial strains and plasmids used in this study are listed in Table 1. The parental strain for all S. pneumoniae genetic manipulations was AC353, a streptomycin resistant (SmR) derivative of TIGR4 (10). S. pneumoniae strains were grown in Todd-Hewitt broth plus 5% yeast extract (THY), and supplemented with 0.8%) maltose when indicated. Unless otherwise stated, the antibiotic concentrations used in this study were as follows: Sm lOOμg/ml, chloramphenicol (Cm) 4μg/ml, and spectinomycin (Spc) 200 μg/ml for S. pneumoniae, and ampicillin (Ap) 100 μg/ml, Cm 10 μg/ml, Spc 100 μg/ml for E. coli. Primers used in this study are listed in Table 2. Unless otherwise noted, all PCR reactions were performed in reaction buffer containing lx Taq reaction buffer (Promega), 250μM dNTPs, lμM of each primer, and a 10:1 mix of Taq and Pfu DNA polymerases. Reaction conditions consisted of 25 cycles of 95°C - 30s, 50 to 52°C - 30s, and 72°C - 30s/kb of DNA, followed by a 5 min post-dwell at 72°C.
Construction of an rlrA overexpressing strain
[00201 ] To construct a strain that expressed rlrA from an inducible promoter, the coding sequence of rlrA was introduced into the S. pneumoniae maltose locus downstream of malM(2A). To this end, DNA fragments containing the 3' end of the malM gene and the 5 ' end of malP were PCR amplified from AC353 using the primer pairs MALFX/MALRP and MALPF2/MALPRP, respectively. Similarly, the cat gene, conferring Cm-resistance (Cm ) in both E. coli and S. pneumoniae, was PCR amplified from pAClOOO with the primer set PCATF1/PCATR1 and the coding sequence of rlrA was PCR amplified from AC353 with the primer set RLRAFR/RLRARX. In the latter case, the Shine-Dalgarno sequence of the S. pneumoniae rpoB was engineered into the RLRAFR sequence to allow optimal translation efficiency of rlrA at the maltose locus. Each of these fragments were subcloned separately into pCR-Script Amp SK(+) (Stratagene) and subsequently inserted into pAClOOO, to generate pCH84. pAClOOO is a derivative of pEVP3 (3) that was created by PCR amplifying the pEVP3 vector backbone using the primer set PEVPF1/PEVPR1 to delete the promoterless lacZ gene in pEVP3. The resulting product was digested with BamHI, gel purified, and ligated overnight at 4°C. The final construct contains the Υ-malM sequence and the 5'-malP sequence flanking the rlrA coding sequence and the cat gene. To generate AC 1278, the S pneumoniae strain overexpressing rlrA, pCH84 was linearized by digestion with.Y7zøE and the gel- purified fragment was transformed into naturally competent AC353 as described (10). The double recombination event was selected by plating on Cm and confirmed by PCR and DNA sequencing.
[00202] Ribonuclease protection assays (RPAs)
[00203] Total RNA was isolated from lOmL exponential phase S. pneumoniae using the Qiagen RNAeasy kit according to the manufacturers recommendations (Qiagen). Template DNA for the generation of riboprobes was PCR amplified using the following primer sets: RLRAF2/RLRAR7, RRGAF3/RRGAR3, RRGBF2/RRGBR1, RRGCF2/RRGCR2, SRTBF2/SRTBR1, SRTCF2/SRTCR2, SRTDF2/SRTDR2, SRTAF1/SRTAR1, and RPOBF3/RPOBR3. The resulting products were purified using the QIAquick PCR purification kit, subsequently cloned into pGEM-T (Promega), and confirmed by PCR using both an SP6 or T7 primer and a primer specific to the cloned insert. These plasmids (AC 1279 - AC 1286, AC 1293; Table 1) were used as templates for the generation of riboprobes as described (19). Synthesized probes were gel purified on a 4%> denaturing polyacrylamide gel containing 7M urea. Ribonuclease protection assays were carried out as described by the manufacturer using the RPAII kit (Ambion). The protected fragments were visualized by exposing each gel to a phosphor imaging screen (Kodak) and analyzed using a Storm 860 scanner and IQMac VI.2 imaging software. The relative amount of each protected fragment in each assay was normalized to the amount of rpoB protected RNA in each lane. [00204] Northern blotting
[00205] Northern blots were performed using the NorthernMax analysis kit (Ambion) exactly as described by the manufacturer using 5μg of total RNA. Riboprobes were synthesized as described above. Total RNA was separated on a 1%> formaldehyde agarose gel by electrophoresis and subsequently transferred to Hybond- N+ nitrocellulose membranes. Membranes were then probed with 10° cpm of gel purified riboprobe per mL of hybridization buffer, and washed as described (Ambion). Processed blots were exposed to a phosphor imaging screen (Kodak) and analyzed as described above. [00206] Primer extension and DNA sequencing
[00207] Primer extension reactions were earned out using the AMV primer extension reverse transcriptase system (Promega). RNA was isolated from AC 1278 as described above. A primer corresponding to 5 ' end of each coding sequence was end labeled with [γ-P32]-ATP using T4 polynucleotidekinase (PNK) for 10 min. at 37°C. The primers used were: RLRAPE2, RRGAP2, RRGBPE, RRGCPE, SRTBPB, SRTCPE, and SRTDPE (Table 1). End labeled primers were annealed to total RNA extracted from AC1278 by incubation at 58°C for 20 minutes followed by cooling to room temperature for 10 min. AMV extension mixture was added to each annealed primer, and cDNA synthesis was carried out at 42°C for 30 min. [00208] DNA fragments predicted to contain promoter regions in the islet were PCR amplified from AC353 using the following primer sets: RLRA2/RRGA2, RRGB2/RRGBR1, RRGC2/RRGBF2, SRTBP1/SRTBP2, and SRTCD1/SRTCD2. PCR products were purified using the Stratagene PCR purification kit according to the provided protocol (Stratagene) and purified products were subsequently cloned into pGEM-T (Promega) to generate plasmids AC1287, AC1288, AC1289, AC1290, and AC 1291, respectively. DNA sequencing of rlrA pathogenicity islet promoter regions was performed using the Sequenase 2.0 DNA sequencing kit according to the manufacturers specifications (USB). Briefly, strains AC1287, AC1288, AC1289, AC 1290, and AC 1291 were grown in 4mL of LB broth and plasmid DNA was purified using the Qiagen mini plasmid prep system (Qiagen). Plasmid DNA was resuspended in lOOμL of TE [10 mM Tris pH 8.0, 1 mM EDTA] and subsequently denatured by the addition of 25 μL of IN NaOH, lOmM EDTA and incubation at 37°C for 30 min. Single stranded DNA was ethanol precipitated by the addition of 1/10 vol of 3M sodium acetate (pH 5.2) and 2 vol 100% ethanol. Precipitated DNA was resuspended in IX Sequenase reaction buffer and 60pmol of the appropriate primer was annealed by incubation at 37°C for 30 min. Sequencing reactions were performed by the addition of Sequenase 2.0 reaction mix containing [αS35]-dATP and incubation at room temperature for 5 min. Next, 3.5 μL of each reaction was added to 2.5 μL of each dideoxynucleotide at 37°C and the termination reaction was incubated for 5 min, at which time the reaction was stopped by the addition of stop solution. [00209] Primer extension products and sequencing reactions were denatured for 10 min at 80°C prior to electrophoresis on a 5%o polyacrylamide/7M urea sequencing gel (National Diagnostics). Gels were run at 45W, dried using the Biorad model 853 gel drying apparatus, and analyzed as above. RlrA-Hisfi purification
[00210] The predicted coding sequence of RlrA was PCR amplified from AC353 using primers RLRAC1/RLRAC2, subcloned into pGEM-T, and liberated by digestion with Ncol and Bglll. The liberated fragment was ligated into similarly digested pQE60 to create AC 1292. The resulting strain containing the coding sequence for RlrA with a C-terminal His6 tag (SEQ ID NO: 550) was grown in 2 mL of LB containing Ap to an OD6oo of 0.5 and expression of RlrA was induced by the addition of IPTG to ImM for 2 h. Proper expression of RlrA-His6 (His tag shown in SEQ ID NO: 550) was assessed by separation of induced and uninduced culture cell extracts by SDS-PAGE and subsequently by Western blotting using anti-His6 (His tag shown in SEQ ID NO: 550) antibody (Roche) according to the ECL Western blotting protocol (Amersham Pharmacia Biotech).
[00211] For the purification of RlrA-His6 (His tag shown in SEQ ID NO: 550), 2L of AC 1292 was grown as above and induced with IPTG for 2h. RlrA-His6 (His tag shown in SEQ ID NO: 550) was subsequently purified on aNi2+-NTA agarose column according to the manufacturers protocols (Qiagen). RlrA-His6 (His tag shown in SEQ ID NO: 550) containing fractions were combined and concentrated using Centricon centrifugation filters (Amicon) to a final concentration of 800 nM. Gel shift assays of the rrgA-rlrA promoter region
[00212] Overlapping DNA fragments of the rrgA-rlrA intergenic region were amplified by PCR using the primer sets REGF1-AP3, IIR1-AP5, AP4-AP6, or IIR1- AP4 (AP7) and used in gel shift assays with RlrA-His6 (His tag shown in SEQ ID NO: 550). In each experiment, 60pmol of a selected primer was end-labeled using T4 PNK (New England Biolabs) and [γ-P32]-ATP (6000 Ci/mmol, 150 mCi/mL) for 30 minutes at 37°C. Labeled primers were ethanol precipitated with ammonium acetate twice, resuspended in lOμL of dH20, and used in PCR reactions using pAC1287 as template. Amplified products were separated on a 4% polyacrylamide gel, gel purified, and eluted overnight in gel shift elution buffer [0.5mM NH Ac, lOmM MgAc, ImM EDTA, 0.1% SDS] at 37°C. Gel shift binding reactions were carried out using 5000 cpm of each probe with increasing concentrations of RlrA-His6 (His tag shown in SEQ ID NO: 550) at 30°C for 15 min in gel shift binding buffer [20mM Tris (pH 8.0), 50 mM KC1, 2mM MgCl2, ImM EDTA, ImM DTT, 0.05% Nonidet P-40, 5%» glycerol] supplemented with lμg of (poly-dl-poly-dC)-(poly-dl-poly-dC) and bovine serum albumin as non-specific inhibitors. For the supershift experiments, binding reactions were performed as above, chilled on ice, and incubated with 0.5 μg of anti-His6 (His tag shown in SEQ ID NO: 550) antibody (Roche) for 30 min on ice. Reactions were subsequently separated on 5% non-denaturing polyacrylamide gel (Protogel; National Diagnostics) and visualized as described above.
DNasel footprinting
[00213] DNasel footprinting experiments were carried out using the gel-shift protocol with 2 x 104 cpm of each probe. Following protein binding, the concentration of MgCl2 and CaCl was adjusted to 5mM and lOmM and each reaction was incubated of DNasel (0.5 to 2U) for 1 minute at room temperature. Reactions were stopped by the addition of stop solution (200mM NaCl, 30mM EDTA, 1% SDS) and the digested products were extracted with an equal volume of phenol and chloroform and subsequently ethanol precipitated. Precipitated DNA was resuspended in loading buffer (98%o formamide, lOmM EDTA, 0.1% bromophenol blue, 0.1%) xylene cyanol) and separated on a 5% polyacrylamide/7M urea sequencing gel (National Diagnostics). Sequencing reactions of the footprinted region were performed as described above using primers specific to the region.
Determination of RlrA consensus binding sites
[00214] The consensus RlrA binding site was determined by PRETTY (GCG Software package) using the four RlrA binding sites determined by DNasel footprinting. The resulting consensus sequence was used to query the complete TIGR4 genomic sequence using FINDPATTERNS (GCG Software package). The resulting sequences were analyzed to determine if the sequences were present in regions likely to contain S. pneumoniae promoters. RESULTS
[00215] One putative transcriptional regulator identified by STM is RlrA (10), a homologue of RofA and Nra from Streptococcus pyogenes (6, 22). Through sequence analysis, rlrA has been shown to be one of seven genes in a pathogenicity islet of approximately 12 kb (see Figure 4)(10), which is not highly conserved in other S. pneumoniae strains (26). Of the six genes that are divergently transcribed from rlrA, three have homology to the LPXTG (SEQ ID NO: 530) family of cell wall anchored surface proteins (rrgA, rrgB, rrgC). RrgA, RrgB, and RrgC have C-terminal sorting signals that are characteristic of LPXTG (SEQ ID NO: 530) containing proteins, except that the leucine of the LPXTG (SEQ ID NO: 530) is deviant in each protein. RrgB and RrgC have conservative changes to isoleucine and valine respectively, whereas RrgA has a change to tyrosine. The C-terminal sorting signals predicts that these proteins are covalently anchored to the cell wall by sortases, which are transpeptidases found in most Gram-positive bacteria (15, 20). Interestingly, three of the four sortase homologues (srtB, srtC, and srtD) encoded in the TIGR4 genome lie within the rlrA pathogenicity islet, however, no proteins are known to be sorted by these sortases (see Figure 4) (10, 20, 26).
[00216] In addition to rlrA, srtD was also identified as an essential virulence gene through STM, and each was confirmed to be essential to the survival of S. pneumoniae during lung infection by testing strains with transposon insertions in each gene in competition assays against the wild-type parental strain (10). The rlrA gene was also found to be essential for colonization of the nasopharynx, but not bacteremia, whereas srtD was dispensable in both of these models (10). The generation of transposon insertion mutations in each of the remaining genes in the locus and subsequent analysis of each mutant strain in murine models of infection demonstrated that rrgA was also essential for colonization of the nasopharynx and lung infection, whereas srtB was essential for only for colonization of the nasopharynx (10).
[00217] Given the homology of RlrA to other Gram-positive transcriptional regulators, the organization of the islet, and the phenotypes of certain mutant strains in animal assays, we previously proposed a model of regulation in the rlrA pathogenicity islet in which RlrA positively regulates the transcription of each rlrA pathogenicity islet gene. In the present work, we confirm this model by demonstrating that transcription of each gene in the islet is dependent upon RlrA. Furthermore, RlrA is shown to act at four different promoters within the islet at a consensus sequence that is found elsewhere in the S. pneumoniae chromosome, suggesting that although the rlrA pathogenicity islet may function autonomously at the level of both transcription and the protein secretion levels, there may be additional targets of regulation in the TIGR4 chromosome.
RlrA is required for wild-type levels of expression of each gene in the islet [00218] To assess the effect of a rlrA mutation on the steady-state levels of mRNA for each gene in the islet, RPAs were performed using RNA isolated from wild-type AC353 or AC1213, a strain that harbors a transposon insertion in rlrA. Riboprobes specific to each islet gene, as well as to rpoB, were synthesized. The rpoB gene, which codes for the β-subunit of RNA polymerase, was used to probe the same RNA preparations as the rlrA islet probes to serve as a loading control in each experiment. In each case, the steady-state level of mRNA of each gene was decreased in the rlrA strain compared to the wild-type strain, albeit to differing degrees (Figure 5). The greatest decrease in message was observed for rrgB and rrgC, which were reduced by 10- and 11-fold, respectively. The rrgA message was only decreased by 2.5-fold in AC1213, suggesting that rrgA is transcribed from a promoter distinct from rrgB or rrgC. Lastly, srtB, srtC, and srtD mRNA was also dependent upon RlrA, with the observed decreases in mRNA levels being 6-, 7-, and 8-fold, respectively. Of note, the srtB probe protected three differently sized messages, suggesting the possibility that there are multiple transcriptional start sites within the sequence of the riboprobe. [00219] To test a possible role of RlrA in the regulation of srtA , the fourth sortase homologue in S. pneumoniae that is unlinked from the rlrA islet, a riboprobe specific to the srtA coding sequence was generated. As above, an RPA was performed using total RNA harvested from either AC353 or AC1213. As shown in Figure 5B, there was no difference in the amount of protected srtA message in either strain, indicating that srtA transcription occurs independently of RlrA.
RlrA is autoregulatorv [00220] In S. pyogenes, RofA positively regulates its own expression (5). To investigate the possibility that RlrA functions in a similar manner, a merodiploid strain that overexpressed rlrA from an inducible promoter was constructed (AC1278). This strain contained two copies of rlrA; one present in the rlrA pathogenicity islet and a second copy integrated into the maltose utilization operon downstream of malM (24). In the latter case, expression of rlrA was under the control of the malM promoter (P„M/M)5 and thus its expression was inducible by the addition of maltose to the growth media (1). In addition, the Shine-Dalgarno site of rpoB was engineered into the rlrA construct upstream of the rlrA initiation codon to assure maximal translation efficiency of RlrA from the maltose utilization locus. [00221] To determine if overexpression of rlrA (from VmaiM) activated transcription from the native rlrA promoter (P,-/;-Λ), RPAS were performed using a single riboprobe to rlrA that differentiated between the two transcripts. The riboprobe was completely complementary to the P,-/,-^ transcript, as it overlapped the coding sequence of rlrA and the 5' untranslated mRNA, resulting in a 409 bp protected band. Alternatively, the rlrA riboprobe was only partially complementary to the J'maiM transcript, and resulted in a smaller protected fragment since the sequence upstream of the rlrA coding sequence in this locus is different from that in the rlrA pathogenicity islet. Due to these differences, the two differently sized protected messages detected with the same riboprobe were used to assess the quantity of steady-state mRNA from either of these promoters.
[00222] As shown in Figure 5C, an increase in the amount of rlrA mRNA initiated from VrirA was observed in strain AC1278 compared to AC353 when each strain was grown in the absence of maltose. The increase observed in the absence of inducer compared to AC353 was due to the fact that AC1278 contained two copies of rlrA and transcription from Prafl/M is not completely repressed during growth in THY. A 6- fold increase in expression from P,./,^ was observed in strain AC 1278 compared to AC353 when each strain was grown in the presence of maltose. No increase in rlrA expression was observed when AC353 was grown in maltose compared to the same strain grown in THY, confirming that the increase in rlrA expression in AC 1278 is not due to simply to growth in the presence of maltose. Together these data show that RlrA is autoregulatory in addition to activating the expression of the 6 other genes in the rlrA pathogenicity islet. Transcription in the rlrA pathogenicity islet initiates at four different promoters [00223] The finding that AC1213 (rlrA: :magellan2) exhibited decreased levels of steady-state mRNA of different genes in the islet by differing levels led to the hypothesis that RlrA acts at numerous sites within the locus. To identify sites of transcription initiation, and thus sites of potential RlrA activity, a primer specific to each gene is the locus was synthesized and used in primer extension analysis. By this method, transcription initiation sites upstream of the rlrA, rrgA, rrgB, and srtB were identified (Figure 6). By analyzing the sequences upstream of the predicted transcriptional start sites, σ70 consensus -10 and -35 sequences were identified for rlrA, and an extended -10 sequence (25) was found for rrgA and rrgB, however, no such sequences were found for the srtB promoter (Figure 6A and 6B). These results support the model that there are multiple promoters within the islet, and thus multiple sites at which RlrA acts.
[00224] Efforts to identify transcriptional start sites upstream of the predicted open reading frames of rrgC, srtC, and srtD proved unsuccessful. This suggested that each of these genes was transcribed from a distal promoter and that each was cotranscribed with an upstream gene(s). To test this, Northern blots were carried out using total RNA extracted from either AC 1278 or AC1213 grown in THY-maltose Using the same riboprobes that were used for RPAs, we found that the rrgC probe hybridized to an mRNA of approximately 3.8 kb, the predicted size of a mRNA that would include both rrgC and rrgB. In support of this, a Northern blot probed with rrgB indicated a message of the same size (Figure 7A, lanes 1). No message corresponding to rrgC or rrgB could be detected in the rlrA mutant strain consistent with the RPA data that transcription of both genes is dependent upon RlrA (Figure 7A, lanes 2).
[00225] When the same RNA preps were probed with riboprobes complementary to srtB, srtC, and srtD, an mRNA of approximately 2.7 kb was detected with all three probes in the AC 1278 background (Figure 7B). A similar sized message was detected in AC1213 at sharply decreased levels, although the same amount of RNA was loaded in each lane as determined by the quantity of rRNA on ethidium bromide stained agarose gels (data not shown). An additional mRNA species of approximately 3.7 kb was also detected using the srtB probe that was not found with the srtC or srtD probe. Given the size of the message, its dependence on RlrA, and the position of the srtB riboprobe (which is predicted to overlap the rrgBC message), this mRNA is predicted to be the rrgBC message that terminates immediately upstream of srtB coding sequence.
RlrA-HiSfi acts at the rrgA and rlrA promoters
[00226] To deteπnine if RlrA directly acts at one or more of the promoters in the rlrA pathogenicity islet, a C-terminally His6-tagged (SEQ ID NO: 550) version of RlrA was purified from E. coli. To test if RlrA-His6 (His tag shown in SEQ ID NO: 550) was able to bind to rlrA pathogenicity islet promoter sequences, the noncoding sequence between rrgA and rlrA was amplified by PCR using the primer set REGF1/IIR1 using an end-labeled REGF1 primer (Figure 8 A). The resulting fragment was incubated with purified RlrA-His6 (His tag shown in SEQ ID NO: 550) and separated on a nondenaturing polyacrylamide gel. In this gel-shift assay, RlrA- His6 (His tag shown in SEQ ID NO: 550) retarded the mobility of the probe evinced by the presence of multiple species that migrated more slowly on the gel than the probe alone (data not shown). This results show that RlrA-His6 (His tag shown in SEQ ID NO: 550) retains DNA binding activity, and indicates that it binds to multiple sequences between rrgA and rlrA.
[00227] To more finely map the regions that the purified protein bound to, smaller overlapping fragments of same region of DNA were generated by PCR and used in gel shift experiments (Figure 8B). When incubated with the AP4 fragment, RlrA-His6 (His tag shown in SEQ ID NO: 550) retarded the mobility of the probe, resulting in a single band that increased in intensity as the concentration of protein was increased (35% mobility shift at 4nM and 10% mobility shift at 16nM). A similar result was observed when RlrA-His6 (His tag shown in SEQ ID NO: 550) was incubated with the AP5 fragment, however, as the concentrations of protein were increased, two retarded species were observed (50%> mobility shift at 4nM RlrA-His6 (His tag shown in SEQ ID NO: 550)). With both AP4 and AP5 probes, as well as, with the AP3 probe that spans the intergenic region downstream of the rrgA transcriptional start site, a retarded species running at the top of the gel was observed at high protein concentrations (RlrA-His6 (His tag shown in SEQ ID NO: 550)> 130nM). We believe that this band is the result of nonspecific binding of RlrA-His6 (His tag shown in SEQ ID NO: 550) at high concentrations, an idea supported by the binding of RlrA-His6 (His tag shown in SEQ ID NO: 550) to non-promoter regions of rrgA (AP3) and to two other S. pneumoniae promoters that are not regulated by RlrA (data not shown). [00228] To confirm that the retarded mobility of the probe was due to the binding of RlrA-His6 (His tag shown in SEQ ID NO: 550) and not a contaminating species in the purified protein prep, anti-His6 (His tag shown in SEQ ID NO: 550) antibody was added at the conclusion of the binding reaction to super-shift RlrA-His6 (His tag shown in SEQ ID NO: 550) specific species. Figure 8C shows that incubation of RlrA-His6 (His tag shown in SEQ ID NO: 550) bound complexes with anti-His6 (His tag shown in SEQ ID NO: 550) antibody results in the appearance of a third complex migrating higher on the gel. This tertiary complex demonstrates that it is indeed RlrA-His6 (His tag shown in SEQ ID NO: 550) that is bound to the AP4 and AP5 probes. Together, these data suggest that RlrA-His6 (His tag shown in SEQ ID NO: 550) specifically binds to three distinct sites between the rrgA and rlrA transcription initiation sites resulting the activation of transcription from both the rrgA and rlrA promoters.
Determination ofRlrA-His^ binding sites
[00229] DNasel footprinting was used to precisely map the sites of RlrA binding in the rrgA and rlrA promoter regions. RlrA-His6 (His tag shown in SEQ ID NO: 550) was incubated with the AP7 fragment as described above, and the resulting bound complexes were subjected to DNasel digestion. Consistent with the findings of the gel-shift experiments, RlrA-His6 (His tag shown in SEQ ID NO: 550) protected three discrete regions of DNA (Figure 9A). Two of these regions were present within 80 bp of the rlrA transcriptional start site (-34 to -49; -53 to -82 ) and a larger third region was present within 70 bp of the rrgA transcriptional start site [-36 to -76; (Figure 9 A and B)], which we believe constitutes two binding sites that are similar in arrangement to the rlrA binding sites. When the complementary strand of DNA was end-labeled and used in the same assay, the same binding patterns were identified for both the rlrA and rrgA promoters (data not shown). Alignment of the protected regions revealed that RlrA binds to AT rich regions close to the RNA polymerase binding site and transcriptional start site of each gene (Figure 9B). The four identified binding sites were aligned and a 15 bp RlrA consensus binding site was determined as RY(T/G)TTTTTR(T/A)(C/A)RA (SEQ ID NO:536). The resulting AT rich sequence was used to query the TIGR4 genome sequence for additional RlrA binding sites. This search resulted in the identification of 153 sequences, 27 of which were present in putative promoter regions, and 14 that are within 15 bp of the -35 sequence. These data suggest that RlrA may regulate additional genes outside of the rlrA pathogenicity islet.
[00230] The rlrA gene was initially identified as an essential gene for the colonization of S. pneumoniae in the murine nasopharynx and for its ability to infect the murine lung (10). In addition, several genes that are divergently transcribed from rlrA and lie within a 12 kb stretch of DNA that is flanked by two insertion elements have also been shown to be essential for either or both of these two models (Figure 4). The rrgA gene codes for a predicted cell wall anchored protein of the LPXTG (SEQ ID NO: 530) family of Gram-positive surface proteins (10, 20). The LPXTG motif (SEQ ID NO: 530) is part of a larger C-terminal sorting signal that targets the protein to a specific pathway that ultimately covalently anchors the protein to the cell wall (16). The enzymes that anchor proteins to the cell wall in this manner are called sortases. Sortases are transpeptidases that cleave between the threonine and glycine of the LPXTG motif (SEQ ID NO: 530) resulting in the anchoring of the N-terminal half of the protein by a peptide bond between the threonine and the cell wall. Interestingly, also divergently transcribed from rlrA are three sortase homologues, srtBCD (Figure A). Two of these three genes have been shown to have a role during in vivo survival; srtD is essential for lung infection and srtB is essential for colonization of the nasopharynx (10).
[00231] RlrA exhibits amino acid sequence similarity to a number of S. pyogenes transcriptional regulators, including RofA and Nra, a positive and negative regulator, respectively. Both RofA and Nra regulate their own expression, as well as, a number of different surface proteins that interact with eukaryotic extracellular matrices, and thus are important to the pathogenesis of S. pyogenes (6, 8, 22). In each case, the gene divergently transcribed from the regulator is one target of regulation. [00232] To determine if RlrA was a regulator of neighboring genes and of its own transcription, RPAs were used to measure the steady-state levels of transcription of each gene in the rlrA pathogenicity islet. We found that RlrA positively regulates the transcription of each gene (Figure 5). The fold decrease in each message was determined in the rlrA strain compared to the wild-type strain. From this analysis, rlrA dependent expression fell into three categories; expression of the rrgA gene was only slightly affected, srtBCD expression was decreased to an intermediate level, and rrgBC expression was drastically reduced. The role of RlrA in its own expression was analyzed using a merodiploid strain that expressed rlrA from the malM promoter, allowing inducible expression in the presence of maltose. Analysis of this strain revealed that RlrA positively regulates its own transcription. [00233] The different levels of expression of each gene in the islet suggest that RlrA regulates multiple promoters within the islet. Indeed, using primer extension analysis, we mapped transcripts initiating upstream of rlrA, rrgA, rrgB, and srtB. A consensus σ70 -35 and -10 binding site was found upstream of rlrA, indicating that rlrA is expressed constitutively, but may also be subject to positive autoregulation by increased RlrA levels under unknown conditions. In contrast, in three cases, rrgA, rrgB, and srtB σ70 consensus -35 boxes could not be identified upstream of the transcriptional start sites, however, extended -10 sequences were identified for rrgA and rrgB. Previous studies on other S. pneumoniae promoters have shown that consensus sequences cannot always be found within DNA fragments with known promoter activity (25). It is conceivable that genes such as those in the rlrA pathogenicity islet are transcribed by alternative σ factors, such as ComX, which regulates a subset of competence induced genes (14). Comparison of the sequences upstream of the srtB promoter to the consensus comX box did not reveal an obvious binding site (21), indicating this promoter is ComX independent and may be transcribed using an unknown sigma factor that is aided by RlrA binding. Alternatively, RlrA may enhance transcription by stimulating binding of σ -RNAP holoenzyme to the poor -35 elements in the rrgA, rrgB, and .srtR promoters. [00234] The identification of multiple promoters that are regulated by RlrA indicated that RlrA must bind multiple sites within the islet to regulate gene expression. This was indeed shown to be the case by gel shift analyses and DNasel footprinting. In these experiments, RlrA was demonstrated to directly bind to four sites within the rlrA-rrgA intergenic region; two sites upstream of rlrA and two sites upstream of rrgA. In each case, there is a smaller RlrA binding site near the transcriptional start site and a larger binding site at a more distal location. A 15 bp consensus sequence in present in all four sites, and we propose that it is this sequence that is bound directly by RlrA. It is curious that the smaller site in each promoter overlaps the -35 sequence in each promoter, which is expected to be bound by RNA 70 polymerase. As mentioned above, a consensus σ -35 promoter sequence could be identified in the rlrA promoter, but not the rrgA, rrgB, or srtB promoter. Thus, these data suggest that RlrA may compete with σ70 for the smaller binding site in the rlrA promoter, possibly when RlrA is expressed at high levels, resulting in repression of RlrA expression.
[00235] An interesting aspect to the biology of the rlrA pathogenicity islet is that it is not conserved among all pneumococcal serotypes (11, 26). Therefore, this islet may require a means of autonomous regulation as we demonstrate here. On the other hand, it may seem unlikely that RlrA would regulate chromosomal genes outside the islet. However, we identified a number of putative targets of rlrA regulation, outside the islet and scattered throughout the genome. It will be interesting to analyze these loci to see if they are indeed regulated by RlrA.
[00236] The srtBCD genes represent three of the four sortase homologues in the TIGR4 S. pneumoniae genome. The presence of multiple sortase homologues is a common occurrence in Gram-positive bacteria genomes. The role of sortases in the anchoring of surface proteins important for the pathogenicity of various organisms is well documented. To our knowledge, however, prior to the finding that srtBCD are regulated by RlrA, only one other sortase has been shown to be regulated at the transcriptional level (17). The finding here that three of the four pneumococcal sortases are under the coordinate regulation of a single regulator suggests that RlrA may indirectly regulate the expression of numerous cell wall anchored proteins by controlling sortase expression from a single promoter. It remains formally possible that the multiple sortase homologues in the rlrA pathogenicity islet do not have substrates that lie outside of the islet. In this case, the role of SrtB, SrtC, and SrtD may be to specifically anchor one or more of the Rrg proteins to the cell wall. This would add a second, post-translational level of autogenous regulation to the rlrA pathogenicity islet. Table 1. Streptococcus pneumoniae genes essential for lung infection
T1GR Gene
Designatio Strain Name Homologue1 ' Description Reference' n Name*
Amino acid biosynthesis
SP0445 STM60, STM61, ilvB lsolcucine and va ne biosynthesis STM62
SP0856 STM1 10 ilvE Isoleucine and valine biosynthesis
SP1377 STM16S aroD Aromatic amino acid biosynthesis
SP1544 STM 182 aspC Glutamate biosynthesis
SP1815 STM207 trpD Tryptophan biosynthesis
SP1816 STM208 trpG Tryptophan biosynthesis
SP1817 STM209 trpE Tryptophan biosynthesis
SP1970 STM233 asnA Asparigine biosynthesis
SP2210 STM277, STM278 c sM Cysteme biosynthesis
Biosynthesis i of cofactors, prosthetic groups, and carriers
SP0177 STM32 nbE Riboflavin biosynthesis
SP0586 STM77 Folic acid biosynthesis
SP0726 STM98 thiD Thiamin biosynthesis
SP2095 STM248 Folic acid biosynthesis
Cell envelope
SP0057 STM5 strH β-N-acetylglucosaminidase
SP0102 STM17 wbgfV Gly cosyl transferase
SP0136 STM22 BH3713 Glycos l transferase, family 2
SP1529 STM 180 Putative polysaccharide biosynthesis protein
SP1770 STM 197 Glycosyl transferase
SP1771 STM 198 Glycosyl transferase
SP1772 STM199, STM200, hsa Cell wall anchored protein STM201
SP2017 STM238, STM239 SPY0196 Membrane protein
SP2098 STM249 Membrane protein
SP2136 STM329 pcpA Choline binding protein (Sanchez-Beato ei al , 1998)
SP2145 STM260, STM261 smuD Cell wall surface anchor family (Lau er a/ , 2001)
SP2176 STM271. STM272, dltA Lipidteichoic acid biosynthesis STM273
Cellular Processes
SP0071 STM9, STM10, IgAl protease (Polissi era/ , 1998)
STM11
SP0117 STM19 pspA Choline binding protein (Berry and Paton, 2000. Hammerschmidt et al , 1999, Hollmgshead erα/ , 2000, Yother and White, 1994)
SP0268 STM44, STM45., spuA Pullulanase (Bongaerts et al , 2000, Zysk et STM46 al , 2000)
SP0314 STM52 Hyaluronate lyase (Berry et al , 1994)
SP0377 STM57 cbpC Choline binding protein
SP0498 STM72 N-endo-b-N-acetylglucosamidase (Zys era/ , 2000)
SP0641 STM86 prtA Seπne protemase (Wizemann et al , 2001. Zysk etal , 2000)
SP0648 STM88 bgaA β-galactosidase (Zysk era/ , 2000)
SP0690 STM95 divIB Cell division protein
SP0766 STM101 sodA Superoxide dismutase (Yesilkaya er a/ , 2000)
SP0966 STM 122 pvaA Pneumococcal vaccine antigen A (Wizemann etal , 2001)
SP0978 STM 123, STM 124 coiA Competence induced gene
SP1154 STM 146 iga IgAl Protease (Poulsen era/ , 1998)
SP1645 STM 187 relA GTP pyrophosphokinase S 1889 STM220 amiD Oligopeptide permease (Cundell e/ α/ , 1995)
SP1890 STM221 amiC Oligopeptide permease (Cundell etal , 1995)
SP1891 STM222. STM223, amiA Oligopeptide permease (Cundell t al , 1995) STM224, STM225
SP1923 STM226, STM22 7 ply Pneumolysin O (Berry and Paton, 2000, Walker et al , 1987)
SP1964 STM232 endA DNA uptake nuclease
SP1976 STM234 pflA Pyruvate formate lyase activating enz> me
SP2052 STM242 cglB Competence induced gene
SP2076 STM244 hexA DNA mismatch repair protein
SP2190 STM275 cbpA Choline binding protein (Rosenow er α/ , 1997)
SP2201 STM276 cbpD Choline binding protein (Gosin etal , 2000)
Glycerol dehydrogenase
SP0023 STM1 radA DNA repair
SP0274 STM47, STM48 polC DNA replication
SP0510 STM73 ecoAl Restriction modification
SP0886 STMH2, STM1 13 hsdht Methyltransferase
SP0887 STM1 14. STM1 15 MJ1218 Restriction modification
SP0892 STM1 16, STM1 I7 ecoKl Restriction modification
SP1040 STM 134 Site-specific recombmase
SP1202 STM 153 recN DNA repair
SP1431 STM 174 MXbal Restriction modification
Energy metabolism
SP0240 STM35 yjfF Phosphoglvcerate mutase family protein
SP0251 STM39 smmF Fermentation (Lau et al , 2001)
SP0265 STM42 bglA 2 Glycosyl hydrolase, Family 1
SP0312 STM51 xylS Glycosyl hydrolase, family 31
SP0829 STM 108 deoB Puπne salvage pathway
SP0916 STM118 cad Lysine decarboxylase
SP1118 STM 140 Pullulanase
SP1121 STM141 glg Glycogen biosynthesis
SP1 193 STM 152 lacA Lactose cataboiism
SP1382 STM 168 amy α-amylase
SP1855 STM213 ypjA Fermentation
SP1898 STM225 aga a-galactosidase
SP1998 STM235 asnB L-aspaπngase
SP2128 STM254 tkt Transketolase, Pentose phosphate pathway
SP 167 STM267 fucK L-fuculose kinase
Fatty acid and lipid metabolism
SP0199 STM34 els Lipid biosynthesis
SP0614 STM80 estA Tnbutyπn esterase
Hypothetical proetins
SP0095 STM 14 SPY0915 Conserved hypothetical
SP0100 STM15. STM16 SPY2I72 Conserved hypothetical
SPOΠO STM 18 Hypothetical
SP0145 STM24, STM25 dsg Conserved hypothetical
SP0146 STM26 yqfD Conserved hypothetical
SP0157 STM30 Hypothetical
SP0160 STM31 sdhB Conserved hypothetcial
SP0198 STM33 SA1341 Conserved hypothetcial
SP0298 STM49 Hιl038 Conserved hypothetical
SP0332 STM54 orβ Hypothetical
SP0385 STM58 SPY 1623 Conserved hypothetical
SP0454 STM63 MJ1577 Conserved hypothetical SP0492 STM69 Hypothetical
SP0595 STM78 Hypothetical
SP0633 STM84, STM85 Hypothetical
SP0663 STM91 spy 1898 Conserved hypothetical
SP0686 STM94 orfA Conserved hypothetical
SP0719 STM96 ykoE Conserved hypothetical
SP0728 STM99 Hypothetical
SP0767 STM 102 SPY1354 Conserved hypothetical
SP0774 STM 103 Hypothetical
SP0785 STM 104 SPY0836 Conserved hypothetical
SP0789 STM 105 yveF Conserved hypothetical
SP0939 STM 120 PM0632 Conserved hypothetical
SP0986 STM 126, STM 127 BH2069 Conserved hypothetical
SP1003 STM 129 phtD Conserved hypothetical (Adamou t al . 2001)
SP1045 STM135 SA1714 Conserved hypothetical
SP1 11 1 STM 137 BH1678 Conserved hypothetical
SP1 127 STM 142 SPY0729 Conserved hypothetical
SP1143 STM143. STM144 HI0660 Conserved hypothetical
SP1153 STM 145 Hypothetical
SP1 174 STM 148, STM 149, phtB Conserved hypothetical (Ada ou etal , 2001) STM 150
SP1175 STM151 phtA Conserved hypothetical (Adamou et al . 2001)
SP1281 STM 155 blpT Hypothetical
SP1344 STM 164 SC5A7 31 Conserved hypothetical
SP1378 STM 166, STM 167 SPY0808 Conserved hypothetical
SP1405 STM 173 SPY1249 Conserved hypothetical
SP1518 STM 179 SPY0348 Conserved hypothetical
SP1652 STM 189 SPY1255 Conserved hypothetical
SP1654 STM 190 smuB Conserved hypothetical (Lau etal , 2001)
SP1706 STM191 Hypothetical
SP1760 STM 194. STM195, Conserved h pothetical STM 196
SP1779 STM202 Hypothetical
SP1793 STM205 Hypothetical
SP1879 STM219 SPY0369 Conserved hypothetical
SP1952 STM230 Hypothetical
SP1956 STM231 orfA Hypothetical
SP2002 STM236, STM237 SA1 157 Conserved hypothetical
SP2039 STM241 sapR Conserved hypothetical
SP2105 STM251 Hypothetical
SP2143 STM257, STM258, ypdB Conserved hypothetical STM259
SP2146 STM262 XF0106 Conserved hypothetical
SP2159 STM263, STM264 Hypothetical
SP2182 STM274 Hypothetical
->ther catergories (46 Strains)
Protein fate
SP0150 STM27, STM28 SS02737 Peptidase M20 M25 M40 Family
SP0338 STM55, STM56 clpL ATP-dependent Clp protemase
SP0468 STM65 srtD Sortase-hke protein
SP0664 STM92 :mpB Metalloprotease (Polissi etal , 1998)
SP0797 STM 106 pepN Aminopeptidase N
SP0979 STM 125 pepF Ohgopeptidase F
SP1343 STM 163 Prolyl family ohgopeptidase
SP1538 STM181 SPY1619 Protein folding and stabilizauon
SP1591 STM 184 pepQ Prolme dipeptidase SP1780 STM203, STM204 pepF Oligoendopeptidase F
SP2060 STM243 pep Pyrro done-carboxylate peptidase
SP2239 STM282 htrA Serine protease
Protein synlb esis
SP0128 STM21 SPY 1873 Alanine acetyltransferase
SP0254 STM41 leuS Leucyl-tRNA synthetase
SP1029 STM 132 SPY 1346 RNA methyltransferase
Purines, pyrimidines, nucleosides, and nucleotides
SP0045 STM2 purl Purine biosynthesis (Polissi etal , 1998)
SP0050 STM4 purH Purine biosynthesis
SP0494 STM70. STM71 pyrG CTP synthase
SP0842 STM 109 pyn Pyπmidine-nucleoside phosphorylase
SP1018 STM 130 tdk Thymidine biosynthesis
SP1847 STM21 1 xpt Purine salvage pathway legulatorj ' functions
SP0141 STM23 mulR Transcription factor
SP0246 STM37 SPY2054 Transcription factor
SP0247 STM38 SPY2053 Transcription factor
SP0306 STM50 yjdC BglG family anttterminator
SP0461 STM64 rlrA Transcription factor
SP0807 STM107 SPY0728 FtsZ regulator
SP0927 STM1 19 smrC Transcription factor (Lau tal , 2001)
SP11 15 STM 139 mulR Transcription factor
SP1278 STM 154 pyrR Transcription factor
SP1433 STM175, STM330 Transcription factor
SP1800 STM206 dmgB Transcription factor
SP1830 STM 10 phoU Transcription factor
SP1854 STM 12 galR Transcription factor
SP1856 STM214. STM215 rmeA Transcription factor
SP2131 STM255 SPY0952 Transcription factor
SP2142 STM256 SPY1596 Transcription factor, ROK family (Polissi et al , 1998)
Signal transduction
SP0063 STM6, STM7, ptnD Sorbose family PTS System
STM8
SP0156 STM29 rr07 Response regulator (Lange etal , 1999, Throup et al , 2000)
SP0396 STM59 mtlF Mannitol PTS system
SP0474 STM66 Cellobiose family PTS System
SP0478 STM67 lacE Lactose PTS System
SP0645 STM87 SPY1711 Galacticol family PTS system
SP0661 STM90 zmpR Response regulator
SP0877 STM1 11 SPY0855 Fructose PTS system
SP1633 STM185 rrOl Response regulator (Lange etal , 1999, Throup et α/ , 2000)
SP2022 STM240 celB Cellobiose fTS System
SP2162 STM265 ptnC Mannose family PTS System
SP21 4 STM266 PM0834 Mannose family PTS system
SP2236 STM281 comD Histidine kinase (Bartilson et al .2001 , Lau et α/ , 2001)
Transcription SP1156 STM147 rhnB RNA degradation
SPI483 STM 178 deaD2 DEAD family-RNA Hehcase
Transport and binding proteins
SP0078 STM 12 trkB Potassium uptake system
SP0092 STM13 ypcG ABC transpoπer, substrate binding protein
SP0242 STM36 bitB Iron ABC transporter, ATP-binding protein
SP0479 STM68 trkH Potassium uptake system
SP0530 STM74, STM75 blpA BlpC transport SP0600 STM 79 veχ2 Peptide transport SP0655 STM89 ydiF Sodium ion antiporter SP0720 STM97 ABC transporter, ATP-binding protein
SP0729 STM 100 ctpA Cation transport SP1001 STM 128 SP Y0016 Amino acid permease SP1032 STM133, STM328 pιt2A Iron ABC transporter. Iron binding (Brown etal , 2001) protein
SP1286 STM 157 uraA Uracil permease SP1321 STM 160, STM 161 ntpK V-type Sodium ATPase, Subunit K
SP1328 STM 162 SA0303 Sodium solute symporter
SP1396 STM 169 pstB2 Phosphate ABC transport, ATP-binding
SP1398 STM 170 pstC Phosphate ABC transporter
SP1399 STM171 pstC2 Phosphate ABC transporter
SP1400 STM 172 pstS Phosphate ABC transporter
SP1434 STM 176 S A2 16 ABC transporter, ATP-binding/permease
SP1580 STM 183 msmK Multiple sugar transporter (Polissi etal , 1998)
SP1715 STM 192 smtH ABC transporter, ATP-binding protein (Lau etal , 2001)
SP1717 STM 193 ysdB ABC transporter, ATP binding
SP1859 STM216 Unknown substrate
SP1861 STM217 proV Choline transporter
SP1869 STM218 BH1205 Iron ABC transporter, permease protein
SP1896 STM224 msmF Multiple sugar transport
SP1939 STM228 dmF Damaged induced protein
SP2086 STM245, STM246, pstA Phosphate ABC transporter
STM247
SP2101 STM250 Cation transport ATPase
SP2108 STM252, STM253 malX Maltose binding protein
SP2170 STM268 adcB Zmc transport (Dmtilhac et al , 1997)
SP2175 STM269, STM270 dltB Lipidteichoic acid transport
SP2231 STM279, STM280 SPY2211 ABC transporter, Permease
Unknown function
SP0049 STM3 ykJ vanZ, putative SP0121 STM20 SPY 1846 metallo-β-lactamase family SP0267 STM43 Oxioreductase SP0320 STM53 idnO Oxioreductase SP0571 STM76 XF1657 Cell-filamentation protein SP0622 STM81. STM82, SPY 1069 NADH dehydrogenase
STM83
SP0665 STM93 pabB Choπsmate binding protein SP0943 STM121 gid Glucose inhibited divsion protein SP1023 STM131 SPY1144 GNAT family acetyltransferase SP1089 STM 136 SPY1119 Glutamate amidotransferase SP1112 STM138 SPY1493 Unknown function SP1285 STM 156 gidB Glucose inhibited division protein SP1292 STM 158, STM 159 SAP domain protein
SP1636 STM 186 ywmA Rrf2 familiy protein SP1646 STM 188 SPY0646 metallo-β-lactamase family SP1941 STM229 cinA Competence/damage induced protein
1 Indicates the gene name as assigned by the TIGR4 sequencing group The name of the gene that encodes the protein homologue, when available c References are given only for genes which have been assigned a role in virulence or encode protems with protective or immunogenic properties References refer to the article that describes the role in virulence as denoted by TIGR (http / www sciencemag org cgι/contentffulI/293/5529/498 DCl) Table 2 Competition analysis of virulence gene tissue specificity of selected mutants identified by STM
Pneumonia Model Bacteremia Model Nasopharyngeal Model
Gene
Strain TIGR ORF UCUIIIΠI IU ueonitHriC disrupted Geometric mean mean in vrvo in vitro CI in vitro CI mean in vivo in vitro CI in vivo CI
Class I
ST 1 SP0023 radA 0 76 (3) 1 02
STM23 SP0141 mutR 0.064 (3) 0 88
STM29 SP0156 rr07 0 14 (4) 0 76 1 (3) 793 040 (8) S 74
STM90 SP0661 zmpR <0.017 (4) 092 0 55 (7) 0 92
STM 108 SP0829 0 63 (7) 1 30
STM 135 SP1045 SA1714 0 82 (4) 097
STM 139 SPU 15 mutR <0.0079 (4) 1 91 0 95 (4) 0 76
STM241 SP2039 sapR <0.028 (7) 057 043 (3) 1 48 0 13 (5) 059
STM244 SP2076 hexA 1 6 (4) 095
STM256 SP2I42 SPY 1596 2 3 (3) 067
Class II
STM4 SP0050 purH <0.0067 (4) 0 54
STM1 19 SP0927 smrC <0.0081 (5) 0 34 <0.024 (8) 034 1 85 (4) 1 02
STM125 SP0979 pepF 0.21 (4) 1 83
STM 175 SP1433 <0.044 (4) 0 83 0-26 (8) 0 98
STM210 SP1830 phoU <0.011 (4) 2 66 0.019 (3) 046 <0086 (7) 2 66
STM237 SP2002 SA1157 0-3 (5) 0 72 <0.073 (3) 1 18
STM330 SP1433 <0.0092 (8) 2 47 <0.054 (6) 1 27 <0067 (3) 2 06
Class III
STM64 SP0461 rlrA c <0-30 (7) 1 90 0 74(4) 1 69 <0.071 (10) 1 10
STM 124 SP0978 coiA <0.11(4) 0 55 4 4 (3) 0 97 0.037 (6) 0 55
STM 154 SP1278 pyrR <0.0038 (4) 097 0 58 (3) 0 97 <0.0086 (4) 097
STM206 SP1800 dmgB <0.023 (4) 036 0 56 (3) 0 82 <0.0093 (6) 036
Class rV
STM38 SP0247 SPY2053 <0.08 (4) 1 34 0.25 (4) 041 <0.09 (7) 1 34
STM 185 SP1633 rrOl 0.24 (8) 063 <0.024(5) 063
STM208 SP1816 trpC <0.0022 (3) 1 54 O.0058 (4) 1 17 <0.0088 (5) 0 62
STM328 SP1032 pιt2A 021 (5) 085 021 (6) 078 <0.011 (4) 1 03
STM329 SP2136 pcpA <0.015 (8) 1 09 <0.07 (7) 1 09 <0.053 (12) 1 03
' The m vivo CI for each individual animal was calculated as the ratio of mutant to wild-type divided by the input ratio of mutant to wild-type bacteria The geometric mean of the CIs is shown, and the number of animals infected in each experiment is indicated in parentheses For competitions in which no mutant bacteπa were recovered from a particular animal the number 1 as substituted as the numerator in determining the in vivo ratio for that animal, and thus thein vivo mean CI is denoted as less than the calculated value Each m vivo competition was tested for statistical significance by the Student two-tailed t-test p -values < 0 05 were considered significant and the coπespoπdmg mean is shown in bold b The in vitro CI was calculated as the ratio of mutant to wild-type bacteπa after 5 h of growth in THY broth adjusted by the input ratio of mutant to wild-type bacteπa c This gene descπption is provided in the present work Table 3. Relevant strains, plasmids and primers used in this study
Strain Relevant Genotype or Phenotype Source or Reference
E. coli
DH5αλpir F" A(lacZYA-argF) U169 recAI endAl hsdRl supE44 thi-1 (Hanahan, 1983; olter et gyrA96 relAl
Figure imgf000087_0001
al., 1978)
S. pneumoniae TIGR4 Wild-type Type 4 encapsulated strain Ingeborg Aaberge AC353 Spontaneous SmR derivative of T1GR4 This work AC846 AC353 cps4E::magellan2 Cm R This work AC1213 AC353 rlrA::magellan2 CmR This work AC1214 AC353 srtD::magellan2 CmR This work AC1215 AC353 rrgA::magellan5 SpcR This work AC1216 AC353 rrgB::magellan5 SpcR This work AC1217 AC353 rrgC::magellan5 Spc R This work AC1218 AC353 srtBr.magellanδ Spc R This work AC1219 AC353 srtCr.magellanδ SpcR This work
Plasmids pEMCat Contains magellan2; Ap R, CmR (Akerley et α/., 1998) pEMSpc Contains magellanS; Ap R, SpcR (Martin et al, 2000)
Primers (5' to 3') P6 GCAGATCTACCTACAACCTCAAGCT This work P7 CGAGATCTACCCATTCTAACCAAGC This work
ARB1 GGCCACGCGTGCACTAGTAC( )ιoTACNG (Merrell et al., ) ARB2 GGCCACGCGTGCACTAGTAC (Merrell et ah, ) MAG2F3 GGAATCATTTGAAGGTTGGTA This work MAG2F4 ACTAGCGACGCCATCTATGTG This work CPSF1 GCAGATAGTAAAAATAAAGGTGTAGAC This work CPSR1 TGCACTGAAGCCGAAGGCGACAAATGC This work TNPAB-F GCCTCTTCCTGAGATTATGTCCTG This work REG2-R ATTGCCGGTGTTATGTTCGTTTGG This work REG2-F ATTTGTCCAAACGAACATAACACC This work PFL-R TGAAAAATCTCTTGACTGGTTGAC This work marOUT CCGGGGACTTATCAGCCAACC This work Table 4. Strains and plasmids used in this study
Relevant genotype or sequence Reference
Strains E. coli DH5αλpir F" A(lacZYA-argF) U169 recAI endAl hsdRl (9, 12) supE44 thi-1 gyrA96 relAl λr.pir
XL-1 Blue recAI endAl gyrA96 thi-1 hsdRl 7 , supE44 relAl Stratagene lac [Fp' roAB lacFZDM15 TnlO (Tef)J
AC1287 DH5αλpir, contains pAC1287 This work AC1288 DH5αλpir, contains pAC1288 This work AC1289 DH5αλpir, contains pAC1289 This work AC 1290 DH5αλpir, contains pAC1290 This work AC1291 DH5αλpir, contains pAC1291 This work AC 1292 XL-1 Blue, contains pAC1292 This work S. pneumoniae AC353 TIGR4 Smr derivative (10) AC1213 rlrA '::magellan2, Smr, Cmr (10) AC1278 malM: :rlrA: :cat: πnalP, Smr, Cmr This work
Plasmids pGΕM-T Cloning vector, Apr Promega pCR-Script Amp SK(+) Cloning vector, Apr Stratagene pQΕ60 His6 expression vector, Apr Qiagen pAClOOO S. pneumoniae suicide vector, Apr This work pCH84 pAClOOO malM: : rlrA:: cat: :malP', Smr, Cmr This work pAC1279 pGEM-T rlrA RPA probe, Apr This work pAC1280 pGEM-T rrgA RPA probe, Apr This work pAC1281 pGEM-T rrgB RPA probe, Apr This work pAC1282 pGEM-T rrgC RPA probe, Apr This work pAC1283 pGEM-T srtB RPA probe, Apr This work pAC1284 pGEM-T srtC RPA probe, Apr This work pAC1285 pGEM-T srtD RPA probe, Apr This work pAC1286 pGEM-T rpoB RPA probe, Apr This work pAC1287 pGEM-T rlrA-rrgA promoter fragment This work pAC1288 pGEM-T rrgB promoter fragment This work pAC1289 pGEM-T rrgC promoter fragment This work pAC1290 pGEM-T srtB promoter fragment This work pAC1291 pGEM-T srtC-srtD promoter fragment This work pAC1292 pQE60 r/r_4-His6, Apr This work PAC1293 pGEM-T srtA RPA probe This work Table 5. Sequences of the primers used in this study
Primer Sequence (5 ' to 3 *) SEQ ID NO:
MALFX CCCTCGAGTGAAAGCTATCGTGAGCAATT 475
MALRP CCGAGCTCAAGATCTGGATCCTTATTTCTTTAAATCTACC 476
MALPF2 CCCTCTAGAGAGCATGCGACAATAATCAGGAGACAAC 477
MALPRP CCGCGGCTCGAGTTCAAGAGGCCATTTTTCAAG 478
PCATF1 CCCGGTCTAGAGTCGACGGTATCGATAAGCT 479
PCATR1 CCGGCGCATGCTTATAAAAGCCAGTCATTAG 480
RLRAFR CGCGGATCCAAAGGAGAATCATCATGCTAAACAAATACATTGA 481
RLRARX CCCTCTAGATTATAACAAATAGTGAGCCTT 482
PEVPF1 GAGGATCCTATACCGCGGCCATGTCTGCCCGTATT 483
PENPR1 TTCACCACCTTTTCCCTAT 484
RLRAF2 TTACATGCTGTTTTATCAATAA 485
RLRAR7 AGTAGAAAGAAGCGGAGTATT 486
RRGAF3 CACTTTTATACGCTTTTGCTA 487
RRGAR3 TAATACGACTCACTATAGGTGCCATCCGTATTGTTTTTC 488
RRGBF2 AAACTATCATTGAAAGGGGAG 489
RRGBR1 TAATACGACTCACTATAGGGGCATTGCCCTGAGAGTTTA 490
RRGCF2 GGCTGCGATTATGGGTATT 491
RRGCR2 TAATACGACTCACTATAGGGGTCATCTCAAACGAAGTCT 492
SRTBF2 AGGACTGGGATTCTGATTTA 493
SRTBRl TAATACGACTCACTATAGGATCGCCACTCACTACATTATT 494
SRTCF2 GATTCTTTTATGGATTATTCG 495
SRTCR2 TAATACGACTCACTATAGGGACGCCTTTCTTTTTCTCTTG 496
SRTDF2 GCGGTCATCCTTCTCTTGCT 497
SRTDR2 TAATACGACTCACTATAGGGTCGTCAGACACTTGGTAAT 498
SRTAF1 AAAAGAAAAACAAGCGAAAAA 499
SRTAR1 TCCTTCTCCCATTACTTGCTC 500
RPOBF3 TGCTTATGACTTGGCAGCAG 501
RPOBR3 GGCTTTCAATGCTTTCAATC 502
RLRAPE2 AGTTAAAGTAGACAGTTCATC 503
RRGAP2 ACGGATTACTTATGTTCTGAT 504
RRGBPE GCTGAAAACAGGCTACTCGCT 505
RRGCPE CCATAACAAAGAAGATACGACTAAT 506
SRTBPB TTTTAAATCAGAATCCCAGTC 507
SRTCPE GCGAATCCTACTAAGAAAATC 508
SRTDPE TATCCCAATAAGGCTCGTAG 509
RLRA2 TGTGTGACCCAATCCATACTT 510
RRGA2 CCCTGTTTGTGGATACTGGTC 511
RRGB2 GGGTTACGAGTTTACGAATGA 512
RRGC2 CAATTGACTAACCACCTCCTG 513
SRTBP1 TCAGCAGTACCAGCATAAACC 514
SRTBP2 TTAAAAATAACAAGCGACCAC 515
SRTCD1 CCAAAACAATAAATAGGAATC 516
SRTCD2 CAAGTGGATCAAGTAAAGGTG 517
RLRAC1 CCATGGTTCTAAACAAATACATTGAAAAAA 518
RLRAC2 AGATCTTAACAAATAGTGAGCCTTTTTA 519 REGF1 TCTAGACATGTGTGTCTCCCTGTT 520
IIR1 TCTAGACATAGTTACCGAATCTTAGTT 521
AP2 AACAACTTCCATCACAATAGA 522
AP3 AGGATAGTTAATAGTAATACTATAC 523
AP4 TAACTATCCTAGTATAAATTAAAAC 524
AP5 TAAAACTCCACCAATACTCAT 525
AP6 ATGAGTATTGGTGGAGTTTTA 526
Table 6:
Figure imgf000091_0001
Figure imgf000092_0001
Figure imgf000093_0001
Figure imgf000094_0001
Figure imgf000095_0001
Figure imgf000096_0001
REFERENCES
The references cited herein are incorporated by reference.
1. Adamou, J.E., Heinrichs, J.H., Erwin, A.L., Walsh, W., Gayle, T., Dormitzer, M., Dagan, R., Brewah, Y.A., Barren, P., Lathigra, R., Langermann, S., Koenig, S. and Johnson, S. (2001) Identification and characterization of a novel family of pneumococcal proteins that are protective against sepsis. Infect Immun, 69, 949-958.
2. Akerley, B.J., Rubin, E.J., Camilli, A., Lampe, D.J., Robertson, H.M. and Mekalanos, J.J. (1998) Systematic identification of essential genes by in vitro mariner mutagenesis. Proc Natl Acad Sci U SA, 95, 8927-8932.
3. Autret, N., Dubail, I., Trieu-Cuot, P., Berche, P. and Charbit, A. (2001) Identification of new genes involved in the virulence of Listeria monocytogenes by signature-tagged transposon mutagenesis. Infect Immun, 69, 2054-2065.
4. Bartilson, M., Marra, A., Christine, J., Asundi, J.S., Schneider, W.P. and Hromockyj, A.E. (2001) Differential fluorescence induction reveals Streptococcus pneumoniae loci regulated by competence stimulatory peptide. Mol Microbiol, 39, 126-135.
5. Berry, A.M., Lock, R.A., Thomas, S.M., Rajan, D.P., Hansman, D. and Paton, J.C. (1994) Cloning and nucleotide sequence of the Streptococcus pneumoniae hyaluronidase gene and purification of the enzyme from recombinant Escherichia coli. Infect Immun, 62, 1101-1108. 6. Berry, A.M. and Paton, J.C. (2000) Additive attenuation of virulence of Streptococcus pneumoniae by mutation of the genes encoding pneumolysin and other putative pneumococcal virulence proteins. Infect Immun, 68, 133- 140.
7. Bongaerts, R.J., Heinz, H.P., Hadding, U. and Zysk, G. (2000) Antigenicity, expression, and molecular characterization of surface- located pullulanase of Streptococcus pneumoniae. Infect Immun, 68, 7141-7143.
8. Bricker, A.L. and Camilli, A. (1999) Transformation of a type 4 encapsulated strain of Streptococcus pneumoniae. FEMS Microbiol Lett, 172, 131-135.
9. Briles, D.E., Hollingshead, S., Brooks-Walter, A., Nabors, G.S., Ferguson, L., Schilling, M., Gravenstein, S., Braun, P., King, J. and Swift, A. (2000a) The potential to use PspA and other pneumococcal proteins to elicit protection against pneumococcal infection. Vaccine, 18, 1707-1711.
10. Briles, D.E., Hollingshead, S.K., Nabors, G.S., Paton, J.C. and Brooks-Walter, A. (2000b) The potential for using protein vaccines to protect against otitis media caused by Streptococcus pneumoniae. Vaccine, 19, S87-95.
11. Brown, J.S., Gilliland, S.M. and Holden, D.W. (2001) A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol, 40, 572-585.
12. Cundell, D.R., Pearce, B.J., Sandros, J., Naughton, A.M. and Masure, H.R. (1995) Peptide permeases from Streptococcus pneumoniae affect adherence to eucaryotic cells. Infect Immun, 63, 2493-2498. 13. Dintilhac, A., Alloing, G., Granadel, C. and Claverys, J.P. (1997) Competence and virulence of Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn resulting from inactivation of putative ABC metal permeases. Mol Microbiol, 25, 727-739.
14. Fogg, G.C., Gibson, CM. and Caparon, M.G. (1994) The identification of rofA, a positive-acting regulatory component of prtF expression: use of an m gamma delta-based shuttle mutagenesis strategy in Streptococcus pyogenes. Mol Microbiol, 11, 671-684.
15. Gosink, K.K., Mann, E.R., Guglielmo, C, Tuomanen, E.I. and Masure, H.R. (2000) Role of novel choline binding proteins in virulence of Streptococcus pneumoniae. Infect Immun, 68, 5690-5695.
16. Hammerschmidt, S., Bethe, G., Remane, P.H. and Chhatwal, G.S. (1999) Identification of pneumococcal surface protein A as a lactoferrin- binding protein of Streptococcus pneumoniae. Infect Immun, 67, 1683-1687.
17. Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol, 166, 557-580.
18. Hensel, M., Shea, J.E., Gleeson, C, Jones, M.D., Dalton, E. and Holden, D.W. (1995) Simultaneous identification of bacterial virulence genes by negative selection. Science, 269, 400-403.
19. Hollingshead, S.K., Becker, R. and Briles, D.E. (2000) Diversity of PspA: mosaic genes and evidence for past recombination in Streptococcus pneumoniae. Infect Immun, 68, 5889-5900. 20. Hoskins, J., Alborn, W.E., Jr., Arnold, J., Blaszczak, L.C., Burgett, S., DeHoff, B.S., Estrem, S.T., Fritz, L., Fu, D.J., Fuller, W., Geringer, C, Gilmour, R., Glass, J.S., Khoja, H., Kraft, A.R., Lagace, R.E., LeBlanc, D.J., Lee, L.N., Lefkowitz, E.J., Lu, J., Matsushima, P., McAhren, S.M., McHenney, M., McLeaster, K., Mundy, C.W., Nicas, T.I., Norris, F.H., O'Gara, M., Peery, R.B., Robertson, G.T., Rockey, P., Sun, P.M., Winkler, M.E., Yang, Y., Young-Bellido, M., Zhao, G., Zook, C.A., Baltz, R.H., Jaskunas, S.R., Rosteck, P.R., Jr., Skatrud, P.L. and Glass, J.I. (2001) Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol, 183, 5709- 5717.
21. Jedrzejas, M.J. (2001) Pneumococcal virulence factors: structure and function. Microbiol Mol Biol Rev, 65, 187-207 ; first page, table of contents.
22. Jones, A.L., Knoll, K.M. and Rubens, C.E. (2000) Identification of Streptococcus agalactiae virulence genes in the neonatal rat sepsis model using signature-tagged mutagenesis. Mol Microbiol, 37, 1444-1455.
23. Kolter, R., Inuzuka, M. and Helinski, D.R. (1978) Trans-complementation- dependent replication of a low molecular weight origin fragment from plasmid R6K. Ce//, 15, 1199-1208.
24. Lampe, D.J., Akerley, B.J., Rubin, E.J., Mekalanos, J.J. and Robertson, H.M. (1999) Hyperactive transposase mutants of the Himarl mariner transposon. Proc Natl Acad Sci USA, 96, 11428-11433. 25. Lampe, D.J., Churchill, M.E. and Robertson, H.M. (1996) A purified mariner transposase is sufficient to mediate transposition in vitro. Embo J, 15, 5470- 5479.
26. Lange, R., Wagner, C, de Saizieu, A., Flint, N., Molnos, J., Stieger, M., Caspers, P., Kamber, M., Keck, W. and Amrein, K.E. (1999) Domain organization and molecular characterization of 13 two-component systems identified by genome sequencing of Streptococcus pneumoniae. Gene, 237,
223-234.
27. Lau, G.W., Haataja, S., Lonetto, M., Kensit, S.E., Marra, A., Bryant, A.P., McDevitt, D., Morrison, D.A. and Holden, D.W. (2001) A functional genomic analysis of type 3 Streptococcus pneumoniae virulence. Mol Microbiol, 40, 555-571.
28. Martin, B., Prudhomme, M., Alloing, G., Granadel, C. and Claverys, J.P. (2000) Cross-regulation of competence pheromone production and export in the early control of transformation in Streptococcus pneumoniae. Mol Microbiol, 38, 867-878.
29. Mazmanian, S.K., Ton-That, H. and Schneewind, O. (2001) Sortase-catalysed anchoring of surface proteins to the cell wall of Staphylococcus aureus. Mol Microbiol, 40, 1049-1057.
30. Mazmanian, S.K., Ton-That, H., Su, K. and Schneewind, O. (2002) An iron- regulated sortase anchors a class of surface protein during Staphylococcus aureus pathogenesis. Proc Natl Acad Sci USA, 99, 2293-2298. 31. McCullers, J.A. and Tuomanen, E.I. (2001) Molecular pathogenesis of pneumococcal pneumonia. Front Biosci, 6, D877-889.
32. Mei, J.M., Nourbakhsh, F., Ford, C.W. and Holden, D.W. (1997) Identification of Staphylococcus aureus virulence genes in a murine model of bacteraemia using signature-tagged mutagenesis. Mol Microbiol, 26, 399-407.
33. Merrell, D.S., Hava, D.L. and Camilli, A. (2002) Identification of Novel Factors Involved in Colonization and Acid Tolerance of Vibrio cholerae. (in press).
34. Pallen, M.J., Lam, A.C., Antonio, M. and Dunbar, K. (2001) An embarrassment of sortases - a richness of substrates? Trends Microbiol, 9, 97- 101.
35. Paton, J.C. and Giammarinaro, P. (2001) Genome-based analysis of pneumococcal virulence factors: the quest for novel vaccine antigens and drug targets. Trends Microbiol, 9f, 515-518.
36. Pestova, E.N., Havarstein, L.S. and Morrison, D.A. (1996) Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol Microbiol, 21, 853-862.
37. Podbielski, A., Woischnik, M., Leonard, B.A. and Schmidt, K.H. (1999) Characterization of nra, a global negative regulator gene in group A streptococci. Mol Microbiol, 31, 1051-1064. 38. Polissi, A., Pontiggia, A., Feger, G., Altieri, M., Mottl, H., Ferrari, L. and Simon, D. (1998) Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect Immun, 66, 5620-5629.
39. Poulsen, K., Reinholdt, J., Jespersgaard, C, Boye, K., Brown, T.A., Hauge, M. and Kilian, M. (1998) A comprehensive genetic study of streptococcal immunoglobulin Al proteases: evidence for recombination within and between species. Infect Immun, 66, 181-190.
40. Rosenow, C, Ryan, P., Weiser, J.N., Johnson, S., Fontan, P., Ortqvist, A. and Masure, H.R. (1997) Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Mol Microbiol, 25, 819-829.
41. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1998) Molecular Cloning: A Laboratory Manual, Second Edition. Cold Spring Harbor Lab. Press, Plainview, NY.
42. Sanchez-Beato, A.R., Lopez, R. and Garcia, J.L. (1998) Molecular characterization of PcpA: a novel choline-binding protein of Streptococcus pneumoniae. FEMS Microbiol Lett, 164, 207-214.
43. Schneewind, O., Mihaylova-Petkov, D. and Model, P. (1993) Cell wall sorting signals in surface proteins of gram-positive bacteria. Embo J, 12, 4803-4811.
44. Tettelin, H., Nelson, K.E., Paulsen, I.T., Eisen, J.A., Read, T.D., Peterson, S., Heidelberg, J., DeBoy, R.T., Haft, D.H., Dodson, R.J., Durkin, A.S., Gwinn, M., Kolonay, J.F., Nelson, W.C., Peterson, J.D., Umayam, L.A., White, O., Salzberg, S.L., Lewis, M.R., Radune, D., Holtzapple, E., Khouri, H., Wolf, A.M., Utterback, T.R., Hansen, C.L., McDonald, L.A., Feldblyum, T.N., Angiuoli, S., Dickinson, T., Hickey, E.K., Holt, I.E., Loftus, B.J., Yang, F., Smith, H.O., Nenter, J.C, Dougherty, B.A., Morrison, D.A., Hollingshead, S.K. and Fraser, CM. (2001) Complete genome sequence of a vinilent isolate of Streptococcus pneumoniae. Science, 293, 498-506.
45. Throup, J.P., Koretke, K.K., Bryant, A.P., Ingraham, K.A., Chalker, A.F., Ge, Y., Marra, A., Wallis, Ν.G., Brown, J.R., Holmes, D.J., Rosenberg, M. and Burnham, M.K. (2000) A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol Microbiol, 35, 566-576.
46. Tomasz, A. (1999) New faces of an old pathogen: emergence and spread of multidrug- resistant Streptococcus pneumoniae. Am J Med, 107, 55S-62S.
47. Unsworth, K.E. and Holden, D.W. (2000) Identification and analysis of bacterial virulence genes in vivo. Philos Trans R Soc Lond B Biol Sci, 355, 613-622.
48. Walker, J.A., Allen, R.L., Falmagne, P., Johnson, M.K. and Boulnois, G.J. (1987) Molecular cloning, characterization, and complete nucleotide sequence of the gene for pneumolysin, the sulfhydryl-activated toxin of Streptococcus pneumoniae. Infect Immun, 55, 1184-1189.
49. Wizemann, T.M., Heinrichs, J.H., Adamou, J.E., Erwin, A.L., Kunsch, C, Choi, G.H., Barash, S.C, Rosen, C.A., Masure, H.R., Tuomanen, E., Gayle, A., Brewah, Y.A., Walsh, W., Barren, P., Lathigra, R., Hanson, M., Langermann, S., Johnson, S. and Koenig, S. (2001) Use of a whole genome approach to identify vaccine molecules affording protection against Streptococcus pneumoniae infection. Infect Immun, 69, 1593-1598.
50. Wu, H.Y., Nirolainen, A., Mathews, B., King, J., Russell, M.W. and Briles, D.E. (1997) Establishment of a Streptococcus pneumoniae nasopharyngeal colonization model in adult mice. Microb Pathog, 23, 127-137.
51. Yesilkaya, H., Kadioglu, A., Gingles, Ν., Alexander, J.E., Mitchell, TJ. and Andrew, P.W. (2000) Role of manganese-containing superoxide dismutase in oxidative stress and virulence of Streptococcus pneumoniae. Infect Immun, 68, 2819-2826.
52. Yother, J. and White, J.M. (1994) Novel surface attachment mechanism of the Streptococcus pneumoniae protein PspA. J Bacteriol, 176, 2976-2985.
53. Zysk, G., Bongaerts, R.J., ten Thoren, E., Bethe, G., Hakenbeck, R. and Heinz, H.P. (2000) Detection of 23 immunogenic pneumococcal proteins using convalescent- phase serum. Infect Immun, 68, 3740-3743.
54. Acebo, P., C. Nieto, M. A. Corrales, M. Espinosa, and P. Lopez. 2000. Quantitative detection of Streptococcus pneumoniae cells harbouring single or multiple copies of the gene encoding the green fluorescent protein. Microbiology 146:1267-1273.
55. Charpentier, E., and E. Tuomanen. 2000. Mechanisms of antibiotic resistance and tolerance in Streptococcus pneumoniae. Microbes Infect 2:1855-1864.
56. Claverys, J. P., A. Dintilhac, E. N. Pestova, B. Martin, and D. A. Morrison. 1995. Construction and evaluation of new drug-resistance cassettes for gene disruption mutagenesis in Streptococcus pneumoniae, using an ami test platform. Gene 164:123-128.
57. Crook, D. W., and B. G. Spratt. 1998. Multiple antibiotic resistance in Streptococcus pneumoniae. Br Med Bull 54:595-610.
58. Fogg, G. C, and M. G. Caparon. 1997. Constitutive expression of fibronectin binding in Streptococcus pyogenes as a result of anaerobic activation of rofA. J Bacteriol 179:6172-6180.
59. Fogg, G. C, C M. Gibson, and M. G. Caparon. 1994. The identification of rofA, a positive-acting regulatory component of prtF expression: use of an
mγδ-based shuttle mutagenesis strategy in Streptococcus pyogenes. Mol
Microbiol 11 :671-684.
60. Gillespie, S. H., and I. Balakrishnan. 2000. Pathogenesis of pneumococcal infection. J Med Microbiol 49:1057-1067.
61. Granok, A. B., D. Parsonage, R. P. Ross, and M. G. Caparon. 2000. The RofA binding site in Streptococcus pyogenes is utilized in multiple transcriptional pathways. J Bacteriol 182:1529-1540.
62. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557-580.
63. Hava, D. L., and A. Camilli. 2002. Identification of tissue-specific pneumococcal virulence factors. Molecular Microbiology (in press).
64. Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Klioja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young- Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183:5709-5717.
65. Kolter, R., M. Inuzuka, and D. R. Helinski. 1978. Trans-complementation- dependent replication of a low molecular weight origin fragment from plasmid R6K. Cell 15:1199-1208.
66. Lau, G. W., S. Haataja, M. Lonetto, S. E. Kensit, A. Marra, A. P. Bryant, D. McDevitt, D. A. Morrison, and D. W. Holden. 2001. A functional genomic analysis of type 3 Streptococcus pneumoniae virulence. Mol Microbiol 40:555-571.
67. Lee, M. S., and D. A. Morrison. 1999. Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation. J Bacteriol 181:5004-5016.
68. Mazmanian, S. K., G. Liu, H. Ton-That, and O. Schneewind. 1999. Staphylococcus aureus sortase, an enzyme that anchors surface proteins to the cell wall. Science 285:760-763.
69. Mazmanian, S. K., H. Ton-That, and O. Schneewind. 2001. Sortase-catalysed anchoring of surface proteins to the cell wall of Staphylococcus aureus. Mol Microbiol 40:1049-1057. 70. Mazmanian, S. K., H. Ton-That, K. Su, and O. Schneewind. 2002. An iron- regulated sortase anchors a class of surface protein during Staphylococcus aureus pathogenesis. Proc Natl Acad Sci U S A 99:2293-2298.
71. McCullers, J. A., and E. I. Tuomanen. 2001. Molecular pathogenesis of pneumococcal pneumonia. Front Biosci 6:D877-889.
72. Merrell, D. S., and A. Camilli. 2000. Regulation of Vibrio cholerae genes required for acid tolerance by a member of the "ToxR-like" family of transcriptional regulators. J Bacteriol 182:5342-5350.
73. Pallen, M. J., A. C Lam, M. Antonio, and K. Dunbar. 2001. An embarrassment of sortases - a richness of substrates? Trends Microbiol 9:97- 101.
74. Pestova, E. N., and D. A. Morrison. 1998. Isolation and characterization of three Streptococcus pneumoniae transformation-specific loci by use of a lacZ reporter insertion vector. J Bacteriol 180:2701-2710.
75. Podbielski, A., M. Woischnik, B. A. Leonard, and K. H. Schmidt. 1999. Characterization of nra, a global negative regulator gene in group A streptococci. Mol Microbiol 31 :1051-1064.
76. Polissi, A., A. Pontiggia, G. Feger, M. Altieri, H. Mottl, L. Ferrari, and D. Simon. 1998. Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect Immun 66:5620-5629. 77. Puyet, A., and M. Espinosa. 1993. Structure of the maltodextrm-uptake locus of Streptococcus pneumoniae. Correlation to the Escherichia coli maltose regulon. J Mol Biol 230:800-811.
78. Sabelnikov, A. G., B. Greenberg, and S. A. Lacks. 1995. An extended -10 promoter alone directs transcription of the DpnII operon of Streptococcus pneumoniae. J Mol Biol 250:144-155.
79. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Nenter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506.
80. Tomasz, A. 1997. Antibiotic resistance in Streptococcus pneumoniae. Clin Infect Dis 24:S85-88.
81. Tomasz, A. 1999. New faces of an old pathogen: emergence and spread of multidnig-resistant Streptococci. AM J Med. 107(1A):55S-62S.
82. Unsworth KE, Holden DW. 2000. Identification and analysis of bacterial virulence genes in vivo. Philos Trans R Soc Lond B Biol Sci. 355(1397):613-
22. All references cited herein and throughout the specification are hereby incorporated by reference in their entirety.

Claims

We claim:
1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of: (a) an isolated nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55- 56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96-97, 99-105, 107-110, 112- 114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173-184, 187-191, 193-217, 219-222, 224-227, 229-230, and 232-237; (b) a nucleotide sequence encoding an amino acid sequence set forth in a sequence selected from the group consisting of SEQ ID NOs.: 238-244, 247-250, 252, 254-273, 275-282, 284-286, 288, 292-293, 295-309, 311, 313-315, 317-319, 321, 323- 325, 327-331, 333-334, 336-342, 344-347, 349-351, 353-359, 361-363, 365, 368-371, 373-374, 377-402, 404-407, 410-421, 424-428, 430-454, 456-459, 461-464, 466-467, and 469-474; (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a); or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (b).
2. An isolated unique fragment of the isolated nucleotide sequence of claim 1.
3. An isolated nucleotide probe comprising a nucleotide sequence that is capable of hybridizing to the isolated nucleotide sequence of claim 1.
4. An isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a polypeptide having an amino acid sequence in (b) of claim 1.
5. An isolated recombinant vector comprising the nucleotide sequence of claim 1 , or a fragment thereof.
6. A recombinant host cell transformed with the vector of claim 5.
7. A method of producing a polypeptide comprising culturing the host cell of claim 6 under conditions favoring expressing the nucleotide sequence..
8. An isolated polypeptide encoded by a nucleic acid molecule comprising a sequence selected from the group consisting of: (a) an isolated nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-7, 10-13, 15, 17-36, 38-45, 47-49, 51, 55-56, 58-72, 74, 76-78, 80-82, 84, 86-88, 90-94, 96- 97, 99-105, 107-110, 112-114, 116-122, 124-126, 128, 131-134, 136-137, 140-165, 167-170, 173-184, 187-191, 193-217, 219-222, 224-227, 229-230, and 232-237; (b) a nucleotide sequence encoding an amino acid sequence set forth in a sequence selected from the group consisting of SEQ ID NOs.: 238- 244, 247-250, 252, 254-273, 275-282, 284-286, 288, 292-293, 295-309, 311, 313-315, 317-319, 321, 323-325, 327-331, 333-334, 336-342, 344-347, 349- 351, 353-359, 361-363, 365, 368-371, 373-374, 377-402, 404-407, 410-421, 424-428, 430-454, 456-459, 461-464, 466-467, and 469-474; (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a); or (d) a nucleotide sequence complementary to any of the nucleotide sequences in (b).
9. A unique fragment of the isolated polypeptide of claim 8.
10. An isolated polypeptide antigen comprising an amino acid sequence, or a fragment thereof, of the isolated polypeptide of claim 8.
11. An isolated nucleic acid molecule comprising a polynucleotide with a nucleotide sequence encoding the polypeptide of claim 8.
12. An isolated antibody that binds specifically to a polypeptide of claim 8.
13. A vaccine, comprising: at least one Streptococcus pneumoniae polypeptide of claim 8 or at least one nucleic acid molecule of claim 1, and a pharmaceutically acceptable diluent, carrier, or excipient; wherein said polypeptide is present in an amount effective to elicit protective antibodies in an animal to a member of the Streptococcus genus.
14. The vaccine composition of claim 13 further comprising an adjuvant.
15. A method of preventing or attenuating an infection caused by a member of the Streptococcus genus in an animal, comprising administering to said animal the vaccine of claim 13.
16. A method of detecting Streptococcus nucleic acids in a biological sample obtained from an animal comprising: (a) contacting the sample with one or more of the probes of claim 3, under conditions such that hybridization occurs, and (b) detecting hybridization of said one or more probes to the one or more Streptococcus nucleic acid sequences present in the biological sample.
17. A method of detecting Streptococcus nucleic acids in a biological sample obtained from an animal, comprising: (a) amplifying one or more Streptococcus nucleic acid sequences in said sample using polymerase chain reaction, (b) contacting the amplified Streptococcus nucleic acid sequence(s) with one or more of the probes of claim 3, under conditions such that hybridization occurs, and (c) detecting hybridization of said one or more probes to the one or more of the amplified Streptococcus nucleic acid sequences.
18. A kit for detecting Streptococcus antibodies in a biological sample obtained from an animal, comprising (a) a polypeptide of claim 8 attached to a solid support; and (b) detecting means.
19. A method of detecting Streptococcus antibodies in a biological sample obtained from an animal, comprising (a) contacting the sample with a polypeptide of claim 8; and (b) detecting antibody-antigen complexes.
20. A pharmaceutical composition for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy and/or for treating Streptococcus pneumoniae infections comprising the antibody of claim 12 and a pharmaceutically acceptable carrier.
21. A method for the treatment of Streptococcus pneumoniae infections comprising administering to an individual in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 20 to treat Streptococcus pneumoniae infection.
22. A method for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy, comprising administering to a population of individuals a pharmaceutical composition according to claim 20, to reduce the occurrence of Streptococcus pneumoniae infections in the population.
23. A method for the treatment of Streptococcus pneumoniae infections comprising administering to an individual in need a therapeutically effective amount of the antibody of claim 12 to treat Streptococcus pneumoniae infection.
24. A method for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy, comprising administering to a population of individuals an antibody of claim 12, to reduce the occurrence of Streptococcus pneumoniae infections in the population.
25. A pharmaceutical composition for reducing the occurrence of Streptococcus pneumoniae infections in a population of individuals by passive immunotherapy, and/or for treating Streptococcus pneumoniae infections comprising as an active ingredient at least one antibody in accordance with claim 12 in combination with at least one other active ingredient being an anti viral agent.
26. A method for the diagnosis of Streptococcus pneumoniae infections in a body fluid sample comprising: (a) contacting said sample with an antibody of claim 12 under conditions enabling the formation of antibody-antigen complexes; (b) determining the level of antibody-antigen complexes formed, wherein a determination of the presence of a level of antibody-antigen complexes significantly higher than that formed in a control sample indicates a Streptococcus pneumoniae infection in the tested body fluid sample.
27. A method for the identification of an agent that is effective in the treatment and/or diagnosis of Streptococcus pneumoniae infection, comprising contacting a polypeptide of SEQ ID NO: 238-474 with a target compound, and selecting a compound that binds specifically to said nucleic acid or polypeptide.
28. The use of the agent of claim 27 in the manufacture of a medicament for use in the treatment or prophylaxis of Streptococcus pneumoniae infection.
PCT/US2003/027401 2002-08-30 2003-09-02 Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection WO2004020609A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003268353A AU2003268353A1 (en) 2002-08-30 2003-09-02 Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US40708202P 2002-08-30 2002-08-30
US60/407,082 2002-08-30

Publications (3)

Publication Number Publication Date
WO2004020609A2 WO2004020609A2 (en) 2004-03-11
WO2004020609A9 true WO2004020609A9 (en) 2004-05-13
WO2004020609A3 WO2004020609A3 (en) 2004-07-15

Family

ID=31978415

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/027401 WO2004020609A2 (en) 2002-08-30 2003-09-02 Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection

Country Status (2)

Country Link
AU (1) AU2003268353A1 (en)
WO (1) WO2004020609A2 (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004072072A1 (en) 2003-02-14 2004-08-26 Pfizer Products Inc. Triazolo-pyridines as anti-inflammatory compounds
WO2006048753A2 (en) * 2004-11-05 2006-05-11 Pharmacia & Upjohn Company Llc Anti-bacterial vaccine compositions
WO2006048757A2 (en) * 2004-11-05 2006-05-11 Pharmacia & Upjohn Company Llc Anti-bacterial vaccine compositions
US8722055B2 (en) 2006-09-27 2014-05-13 St. Jude Children's Research Hospital Synthetic Streptococcus pneumoniae vaccine
GB0714963D0 (en) * 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
US8404457B2 (en) 2008-02-01 2013-03-26 Sanofi Pasteur Limited Assay for diagnosing Streptococcus pneumoniae
US10105412B2 (en) 2009-06-29 2018-10-23 Genocea Biosciences, Inc. Vaccines and compositions against Streptococcus pneumoniae
BR112013013702A2 (en) 2010-12-03 2016-09-13 Sanofi Pasteur Ltd composition for immunization against streptococcus pneumoniae
WO2012100234A1 (en) 2011-01-20 2012-07-26 Genocea Biosciences, Inc. Vaccines and compositions against streptococcus pneumoniae
CA2865028A1 (en) * 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
WO2017091707A1 (en) * 2015-11-25 2017-06-01 Wake Forest University Health Sciences Pneumococcal inhibitory factor compositions and methods of use thereof
TW202019470A (en) * 2018-09-12 2020-06-01 美商艾芬尼維克斯公司 Multivalent pneumococcal vaccines

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1770164B1 (en) * 1996-10-31 2010-09-01 Human Genome Sciences, Inc. Streptococcus pneumoniae antigens and vaccines

Also Published As

Publication number Publication date
WO2004020609A3 (en) 2004-07-15
AU2003268353A8 (en) 2004-03-19
WO2004020609A2 (en) 2004-03-11
AU2003268353A1 (en) 2004-03-19

Similar Documents

Publication Publication Date Title
US6929930B2 (en) Streptococcus pneumoniae SP042 polynucleotides
US20030232976A1 (en) Streptococcus antigens
US8642048B2 (en) Multiple antigenic peptides immunogenic against Streptococcus pneumonia
NZ553554A (en) Streptococcus antigens
IL143905A (en) Streptococcus antigens
WO1999053940A1 (en) PNEUMOCOCCAL SURFACE PROTEIN C(PspC), EPITOPIC REGIONS AND STRAIN SELECTION THEREOF, AND USES THEREFOR
US20060177465A1 (en) Streptococcus antigens
US20070218051A1 (en) Epitope peptides immunogenic against Streptococcus pneumoniae
US20080241181A1 (en) Environmentally regulated genes of Streptococcus suis
WO2004020609A9 (en) Streptococcus pneumoniae antigens for diagnosis, treatment and prevention of active infection
CN107312075B (en) Group A streptococcus multivalent vaccine
JP2011057691A (en) Multiple antigenic peptide immunogenic against streptococcus pneumoniae
US6887663B1 (en) Streptococcus pneumoniae SP036 polynucleotides
AU2001271935A1 (en) Multiple antigenic peptides immunogenic against streptococcus pneumoniae
US20060198852A1 (en) Collagen-binding MSCRAMMs of Bacillus anthracis and uses therefor
CZ148399A3 (en) Sequence of nucleic acids and amino acids connected with Helicobacter pylori and vaccine preparations

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
COP Corrected version of pamphlet

Free format text: PAGES 1/9-9/9, DRAWINGS, REPLACED BY NEW PAGES 1/11-11/11; DUE TO LATE TRANSMITTAL BY THE RECEIVINGOFFICE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP