WO2004013634A2 - Dna damage repair polypeptide and uses thereof - Google Patents

Abstract

This invention relates to the identification of a polypeptide component of the ATM-dependent DNA damage signalling pathway which interacts with other DNA damage response factors, including the MRE11 complex and 53BP1. Modulation of the interactions of this polypeptide, which is termed MDC1 (mediator of DNA damage checkpoint protein 1), may have therapeutic applications, for example in the treatment of cancer or viral infection.

Description

DNA Damage Repair Polypeptide and Uses Thereof

This invention relates to the identification of a component of the ATM-dependent DNA damage-signalling pathway which interacts with other DNA damage response factors, including the MREll complex. Modulation of these interactions may have therapeutic applications, for example in the treatment of cancer or viral infection.

The MREll complex (composed of MREll, RAD50 and NBS1) is part of the ATM-dependent DNA damage signalling pathway and is involved in various cellular events such as DNA repair, DNA replication and telomeric length maintenance. The MREll complex also functions in the ATM dependent and ATR dependent pathways of the DNA damage signalling (reviewed by D'A ours D & Jackson S (2002) Nat. Rev. Mol . Cell. Biol. 3 317-327 and references therein and Abraham 2001 Genes Dev. 15 2177-2196)

In response to DNA damage, the function of the MREll complex is regulated by its phosphorylation by the ATM (ataxia-telangiectasia (AT) mutated) protein (Li DS et al (2000) Nature 404 613-617, Gatei M et al (2000) Nat. Genet. 25 115-119, Zhao S et al (2000) Nature 405 473-

477, Wu X et al (2000) Nature 405 477-482) and by related kinases such as ATR (Abraham (2001) Genes & Dev 15 2177- 2196) and DNA-PK (DNA-dependent protein kinase) (Paull TT et al (2000) Curr Biol. 10 886-895).

Mutations within the ATM, MREll and NBS1 genes cause AT, AT-like disorder (AT-LD) and Nij egen breakage syndrome (NBS), respectively (Savitsky K, (1995) Science 268 1749- 1753, Stewart GS et al (1999) Cell 99 577-587, Carney JP, (1998) Cell 93 477-486, Matsuura S, (1998) Nat. Genet. 19 179-181, Varon R, (1998) Cell 93 467-476) . All these disorders are associated with increased cancer predisposition and share similar cellular phenotypes, including chromosomal instability, radiosensitivity and defects in checkpoint responses (reviewed by Shiloh et al

(1997) Annu Rev Genet 31 635-662) .

The present inventors have identified a 226 kDa polypeptide which is shown to interact with the MREll complex. This polypeptide, which was previously termed ^λMRIPl'-^' (MREll complex interacting protein 1) , is now called MDCl (mediator of DNA damage checkpoint protein

!>^•

The MDCl protein is composed of 2089 amino acids and is encoded by the cDNA KIAA0170, which was first isolated from human immature myeloid cell line KG-1 (Nagase T et al (1996)DNA Res 3 17-24). The KIAA0170 gene product was initially reported to be a transcription factor termed nuclear factor with BRCT domain 1_ (NFBDl) (Ozaki et al

2000 DNA & Cell Biol. 19 8 475-485).

The MDCl protein is shown herein to bind to sites of DNA damage and to recruit the MREll complex to such sites. Modulation of the activity of MDCl may therefore be useful in modulating cellular responses to such double stranded DNA breaks (DSBs) .

Aspects of the present invention provide methods for identifying and/or obtaining compounds which modulate the activity of the MDCl protein, for example by modulating the interaction of the MDCl protein with the MREll complex or other factors involved in cellular responses to DNA damage .

A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) polypeptide, which method may comprise:

(a) bringing into contact a MDCl polypeptide and a test compound; and,

(b) determining the activity of said MDCl polypeptide in the presence of said test compound.

Activity of the .MDCl polypeptide may be determined by determining the binding of said polypeptide to one or more of the following: a factor involved in the cellular DNA damage response, including 53BP1 and members of the MREll complex, a site of DNA damage within a cell and a DNA molecule. More preferably, activity may be determined by determining the binding of said polypeptide to one or more of the following: a factor involved in the cellular DNA damage response, including 53BP1 and components of the MREll complex and a site of DNA damage within a cell.

Standard methodologies may be used for the determination of binding. Suitable methodologies are further discussed below.

MDCl polypeptide activity may also be determined functionally, for example by determining the localisation of MDCl or the MREll complex at sites of DNA damage within the cell, by determining the formation of irradiation induced MREll foci (MRE11-IRIF) , by determining the repair of DNA damage or by determining the activity of the ATM-dependent or ATR dependent DNA damage signalling pathway. The activity of the ATM dependent DNA damage signalling pathway may be determined, for example, by determining the DNA damage-induced changes to components of the pathway, such as changes to the sub-cellular distribution or post-translational modification of such components, or by determining cellular read-outs such as changes in the arrest of cell cycle progression or entry into apoptosis following DNA damage.

These may be determining by conventional techniques, such as immunofluorescence as described below.

An MDCl polypeptide may comprise or consist of an a ino acid sequence encoded by the nucleic acid sequence of KIAA070 (see Genbank Ace No:D79992), for example the amino acid sequence of XM_165734 (see also BAA11487) or an MDCl polypeptide may be an allele or variant of such a sequence.

A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) polypeptide, which method may .comprise:

(a) bringing into contact a MDCl polypeptide and a cellular DNA damage response factor in the presence of a test compound; and,

(b) determining binding between the MDCl polypeptide and said one or more components.

An increase or decrease in binding in the presence, relative to the absence, of the test compound is indicative that the test compound affects said binding and may therefore modulate the activity of MDCl. Such a compound may thereby modulate cellular responses to DNA DSBs, for example by modulating the ATM dependent or ATR dependent DNA damage signalling pathways.

A decrease in binding is indicative of the test compound being an inhibitor of activity, and an increase in binding is indicative of the test compound being an enhancer of activity.

A test compound which stabilises the interaction between the MDCl polypeptide and the DNA damage response factor, and which may up-regulate MDCl activity, may be obtained using conditions that are too harsh for the MDCl polypeptide to bind to the factor in the absence of the compound.

A test compound which disrupts the interaction and which may down-regulate activity may be obtained under conditions in which the MDCl polypeptide normally binds to the factor.

A factor involved in the cellular response to DNA damage may include one or more polypeptides of the MREll complex or a 53BP1 polypeptide.

One or more components of the MREll complex for use in methods described herein may include one or more, (i.e. any one, any two or all three) polypeptides selected from the group consisting of MREll, RAD50 and NBS1.

An MREll polypeptide may comprise or consist of an amino acid sequence encoded by a nucleic acid sequence of U37359, for example the amino acid sequence of AAC78721 or an MREll polypeptide may be an allele or variant of such a sequence. An RAD50 polypeptide may comprise or consist of an amino acid sequence encoded by a nucleic acid sequence of 5032016, for example the amino acid sequence of NP_005723 or an RAD50 polypeptide may be an allele or variant of such a sequence.

An NBS1 polypeptide may comprise or consist of an amino acid sequence encoded by a nucleic acid sequence of AF058696, for example the amino acid sequence of BAA28616 or an NBS1 polypeptide may be an allele or variant of such a sequence.

The MREll complex or components thereof may have nuclease activity and may specifically localise to sites of DNA damage within a cell. The nuclease activity provided by this complex forms part of the DNA repair process and activates the recognition of damaged DNA by the ATM/ATR signalling pathways.

An 53BP1 polypeptide may comprise or consist of an amino acid sequence encoded by a nucleic acid sequence of NM___005657, for example the amino acid sequence of NP__005648.1 or an 53BP1 polypeptide may be an allele or variant of such a sequence.

MDCl is shown herein to bind to sites of DNA damage within a cell .

A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) polypeptide, which method may comprise:

(a) contacting an MDCl polypeptide and a site of DNA damage in the presence of a test 'compound; and, (b) determining the binding of said MDCl polypeptide to said site of DNA damage.

A site of DNA damage is a point in the chromatin at which damage to the DNA duplex has occurred, for example through irradiation. The lesion in the duplex is preferably a double-strand break (DSB) . DNA DSBs can be detected by various techniques including the comet assay (Schindewolf 2000 Mammalian Genome 11 552-554) . Sites of DSB can also be readily identified by their co- localisation with phosphorylated histone H2AX (Paull et al (2000) Curr Biol. 10 886-895 and references therein), and with a range of DNA damage signalling proteins, such as 53BP1 (Schultz et al 2000 J. Cell Biol. 151 1381- 1390) .

An allele of variant may have an amino acid sequence which differs from a given sequence, by one or more of addition, substitution, deletion and insertion of one or more amino acids but which still has substantially the same sequence as the given sequence. Such an addition, substitution, deletion or insertion may represent a natural variation which occurs between individuals within a species and which has no phenotypic effect.

In the present specification, a residue may be denoted by a number that indicates its position relative to the initiating methionine residue, which is numbered 1.

A polypeptide which is an amino acid sequence variant or allele may comprise an amino acid sequence which differs from a given amino acid sequence, but which shares greater than about 50% sequence identity with such a sequence, greater than about 60%,, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%. A variant or allelic sequence may share greater than about 60% similarity, greater than about 70% similarity, greater than about 80% similarity or greater than about 90% similarity with a given amino acid sequence.

Amino acid similarity and homology are generally defined with reference to the algorithm GAP (GCG Wisconsin Package™, Accelrys, San Diego CA) . GAP uses the Needleman & Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps. Generally, the default parameters are used, with a gap creation penalty = 12 and gap extension penalty = 4. Use of GAP may be preferred but other algorithms may be used, e.g. BLAST or TBLASTN (which use the method of Altschul et al . (1990) J. Mol . Biol . 215: 405-410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85: 2444-2448) , or the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol Biol . 147: 195-197), generally employing default parameters .

Similarity allows for "conservative variation", i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine.

Particular amino acid sequence alleles or variants may differ from that a given sequence by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30 or 30-50 amino acids ., A MDCl polypeptide preferably comprises an _.FHA_. domain (Durocher & Jackson 2002 FEBS Letts 513 58-66) , which resides within the residues encoded by the bases 150 to 400 of the MDCl coding sequence (XM_165734) and/or a BRCT domain (Bork et al 1997 FASB J. 11 68-76), which resides within the region encoded by bases 5500 to 6100 of the MDCl coding sequence.

The FHA domain is shown herein to be responsible for the binding of MDCl to the phosphorylated form of 53BP1.

The MDCl coding sequence comprises a repeat region between residues 978-1809. Although there is some variation within the repeat region, the consensus sequence of the 38 amino acid repeat motif is as follows; PSTSTDQPVTPEPTSQATRGRTNRSSVKTPETVVPTAP .

An MDCl polypeptide may comprise one or more copies of the repeat motif or an allele or variant thereof as described above or, more preferably, two, three or four or more. A polypeptide may, for example, comprise the entire repeat region consisting of residues 978-1809 of the MDCl sequence.

It is not necessary to use the entire full length proteins for methods of the invention, whether in vitro or in vivo . Polypeptide fragments which retain the activity of the full-length protein may be generated and used in any suitable way known to those of skill in the art. Suitable ways of generating fragments include, but are not limited to, recombinant expression of a fragment from encoding DNA. For example, fragments may be generated by taking encoding DNA,., identifying suitable restriction enzyme recognition sites either side of the portion to be expressed, and cutting out said portion from the DNA. The portion may then be operably linked to a suitable promoter in a standard commercially available expression system.

Another recombinant approach is to amplify the relevant portion of the DNA with suitable PCR primers'. Small fragments (e.g. up to about 20 or 30 amino acids) may also be generated using peptide synthesis methods which are well known in the art as further described below.

A polypeptide for use in methods of the invention may comprise or consist of a fragment of a full-length sequence. For example, a MDCl polypeptide may consist of a portion, segment or fragment of the sequence of XM_165734 of a variant or allele thereof.

A "fragment", "portion" or "segment" of a polypeptide generally means a stretch of amino acid residues which is shorter than the full length amino acid sequence, for example, in the case of MDCl, less than 2089 amino acids, less than 2080 amino acids, less than 2050 amino acids, less than 2020 amino acids, less than 2000 amino acids, less than 1500 amino acids or less than 1000 amino acids.

A fragment will generally consist of at least 35 amino acids, for example, at least 40 amino acids, at least 50 amino acids, at least 70 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, at least 250 amino acids, at least 300 amino acids or at least 350 amino acids. Preferred fragments are less than the full-length sequence (i.e. consist of fewer amino acid residues), but retain one or more activities of the full-length sequence as described herein.

A suitable fragment of MDCl may comprise the N terminal domain of the full-length MDCl sequence, for example an FHA domain which is contained within amino acids 50 to 125, the C terminal domain of the full-length MDCl sequence, for example a BRCT domain which is contained within amino acids 1800 to 2050 and/or the repeat region, for example, residues 978-1809.

A suitable MDCl fragment may comprise both N and C terminal domains as described above and may contain a deletion in the region 125 to 1800 of the full-length MDCl sequence.

Another aspect of the present invention provides an MDCl polypeptide which has an N terminal at the N terminal end of the FHA domain of the full-length MDCl amino. acid sequence .

The N-terminal residue of the FHA domain of MDCl is at about residue 50 in the full-length sequence, for example residue 53 or residue 56. Determination of the boundaries of the FHA domain may be performed using standard sequence analysis techniques.

An MDCl polypeptide may also comprise one or more additional heterogeneous (i.e. non-natural) amino acid residues. These additional residues may for example form a signal sequence, a purification tag (such as a 6His tag) or a detectable label (such ..as a FLAG^tm sequence) . An MDCl polypeptide according to this aspect preferably has an activity of the wild-type MDCl sequence i.e. one or more activities selected from the group consisting of binding to the MREll complex, binding to sites of DNA damage and binding to other DNA damage response factors, including 53BP1.

As described above, a convenient way of producing polypeptide molecules, which may full-length sequences or fragments thereof, for use in methods of the invention, is to express nucleic acid encoding it, by use of nucleic acid in an expression system.

Peptide fragments may also be generated wholly or partly by chemical synthesis. The compounds of the present invention can be readily prepared according to well- established, standard liquid or, preferably, solid-phase peptide synthesis methods, general descriptions of which are broadly available (see, for example, in J.M. Stewart and J.D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, . Springer Verlag, New York (1984); and Applied Biosystems 430A Users Manual, ABI Inc., Foster City, California) , or they may be prepared in solution, by the liquid phase method or by any combination of solid-phase, liquid phase and solution chemistry, e.g. by first completing the respective peptide portion and then, if desired and appropriate, after removal of any protecting groups being present, by introduction of the residue X by reaction of the respective carbonic or sulfonic acid or a reactive derivative thereof. Methods according to the present invention may be in vivo cell-based methods, or in vitro non-cell-based. methods . The precise format for performing methods of the invention may be varied by those of skill in the art using routine skill and knowledge. Methodologies for identifying or obtaining compounds which modulate the interaction between two proteins are well-known in the art and include techniques such as radioimmunosassay, scintillation proximetry assay and ELISA methods.

For example, interaction between an MDCl polypeptide and one or more components of the MREll complex may be studied in vitro by labelling one with a detectable label and bringing it into contact with the other which has been immobilised on a solid support.

This may be ^'performed in the presence of a test compound.

Suitable detectable labels, especially for peptidyl substances include ³⁵S-methionine which may be incorporated into recombinantly produced peptides and polypeptides. Recombinantly produced peptides and polypeptides may also be expressed as a fusion protein containing an epitope which can be labelled with an antibody.

In a scintillation proximetry assay, a biotinylated protein fragment may be bound to streptavidin coated scintillant - impregnated beads (produced by Amersham) . Binding of radiolabelled peptide is then measured by determination of radioactivity induced scintillation as the radioactive peptide binds to the immobilized fragment. Agents which intercept this are inhibitors of the interaction. A polypeptide may be immobilized using an antibody against that polypeptide which is bound to a solid support or via other technologies which are known per se . A preferred in vi tro interaction may utilise a fusion protein including glutathione-S-transferase (GST) . This may be immobilized on glutathione agarose beads. In an in vi tro format, a test compound can be assayed by determining its ability to diminish the amount of labelled peptide or polypeptide which binds to the immobilized GST-fusion polypeptide. This may be determined by fractionating the glutathione-agarose beads by SDS-polyacrylamide gel electrophoresis .

Alternatively, the beads may be rinsed to remove unbound protein and the amount of protein which has bound can be determined by counting the amount of label present in, for example, a suitable scintillation counter.

Of course, the person skilled in the art will design any appropriate control experiments with which to compare results obtained in methods of the invention.

Methods of the invention may also take the form of in vivo methods . In vivo methods may be performed in a cell line such as a yeast strain, insect or mammalian cell line, for example CHO, HeLa or COS cells, in which the relevant polypeptides or peptides are expressed from one or more vectors introduced into the cell.

The ability of a test compound to modulate interaction between MDCl and a DNA damage response factor, such as a component of the MREll complex, may, for example, be determined using a so-called two-^hybrid assay method. A polypeptide or fragment of MDCl or a component of the MREll complex as the case may be, may be fused to a DNA binding domain such as that of the yeast transcription factor GAL4. The GAL4 transcription factor includes two functional domains. These domains are the DNA binding domain (GAL4DBD) and the GAL4 transcriptional activation domain (GAL4TAD) . By fusing one polypeptide or peptide to one of those domains and another polypeptide or peptide to the respective counterpart, a functional GAL4 transcription factor is restored only when two polypeptides or peptides of interest interact. Thus, interaction of the polypeptides or peptides may be measured by the use of a reporter gene probably linked to a GAL4 DNA binding site which is capable of activating transcription of said reporter gene. This assay format is described by Fields and Song, 1989, Nature 340; 245- 246 and may ^'be used in both mammalian cells and in yeast.

Other combinations of DNA binding domain and transcriptional activation domain are available in the art and may be preferred, such as the LexA DNA binding domain and the VP60 transcriptional activation domain. For example, the MDCl polypeptide or MREll complex component may be employed as a fusion with (e.g.) the LexA DNA binding domain, and the counterpart (e.g.) MREll complex component or MDCl polypeptide or peptide as a fusion with (e.g.) VP60. A third expression cassette, which may be on a separate expression vector, is used to express a peptide or a library of peptides of diverse and/or random sequence. A reduction in reporter gene expression (e.g. in the case of β-galactosidase a weakening of the blue colour) results from the presence of a peptide which disrupts the MDC1/MRE11 complex (for example) interaction, which interaction is required for transcriptional activation of the β-galactosidase gene.

Where a test compound is not peptidyl and may not be expressed from encoding nucleic acid within a said third expression cassette, a similar system may be employed with the test compound supplied exogenously.

Prior to or as well as being screened for modulation of binding between MDCl and components of the MREll complex, test compounds or substances may be screened for ability to interact with the MDCl polypeptide itself, e.g. in a yeast two-hybrid system (which requires that both the MDCl polypeptide and the test compound can be expressed in yeast from encoding nucleic acid) . This may be used as a coarse screen prior to testing a test compound for actual ability to modulate the interaction of MDCl with the MREll complex.

A method may further comprise determining the ability of said test compound to inhibit or enhance the ATM- dependent DNA damage signalling pathway, the ATR dependent DNA damage signalling pathway or other cellular responses to DNA DSBs .

That a test compound is inhibitory of DNA DSB repair, of the ATM-dependent DNA damage signalling pathway or the ATR dependent DNA damage signalling pathway may be verified by one or more of the following; hypersensitivity of mammalian cells to ionising radiation, by rejoining of double-strand breaks (e.g. in a plasmid or in chromosomal DNA) in vivo (e.g. a Comet assay: Schindewolf 2000 Mammalian Genome 11 552-554), defects in the slowing or arrest Of cell cycle progression following DNA damage, defects in the slowing or arrest of entry into the apoptotic program in response to DNA damage or defects in the phosphorylation or other modification of proteins in response to DNA damage. Biochemical methods, such as PCR or nucleic acid hybridisation/detection methods, may be used, e.g. to detect the chemical structure of integration products. Retroviral integration and/or retrotransposition may be scored for example by detection using standard genetic, biochemical or histological techniques, or by the use of retroviral vectors with selectable or readily scorable marker genes.

Test compounds may be natural or synthetic chemical compounds used in drug screening programmes. Extracts of plants which contain several characterised or uncharacterised components may also be used.

Combinatorial library technology (Schultz, JS (1996) Biotechnol. Prog. 12:729-743) provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.

The amount of test substance or compound which may be added to an assay of the invention will normally be determined by trial and error depending upon the type of compound used. Typically, from about 0.1 to 100 :M concentrations of putative inhibitor compound may be used, for example from 1 to 10 :M. When cell-based methods are employed, the test substance or compound is desirably membrane permeable in order to access the interacting polypeptides. One class of putative inhibitor compounds can be derived from the MDCl polypeptide and/or the component . of the MREll complex which binds to it. Membrane permeable peptide fragments of from 5 to 40 amino acids, for example, from 6 to 10 amino acids may be tested for their ability to disrupt such interaction or activity. Especially preferred peptide fragments may comprise amino acids 50 to 125, amino acids 1800 to 2050 of the MDCl sequence and/or one or more repeat motifs from the repeat region between residues 978 and 1809, more preferably the entire repeat region.

The inhibitory properties of a peptide fragment as described above may be increased by the addition of one of the following groups to the C terminal: chloromethyl ketone, aldehyde and boronic acid.' These groups are transition state analogues for serine, cysteine and threonine proteases. The N terminus of a peptide fragment may be blocked with carbobenzyl to inhibit aminopeptidases and improve stability (Proteolytic

Enzymes 2nd Ed, Edited by R. Beynon and J. Bond, Oxford University Press, 2001) .

Antibodies directed to the site of interaction in either the MDCl polypeptide or its binding partner, which might be a member of the MREll complex, a chromosomal DNA damage target, 53BP1 or other member of the cellular DNA damage response as described herein, form a further class of putative inhibitor compounds. Candidate inhibitor antibodies may be characterised and their binding regions determined to provide single chain antibodies and fragments thereof which are responsible for disrupting the interaction. Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al . , 1992, Nature 357: 80-82).

Isolation of antibodies and/or antibody-producing cells from an animal may be accompanied by a step of sacrificing the animal.

As an alternative or supplement to immunising a mammal with a peptide, an antibody specific for a protein may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047. The library may be naive, that is constructed from sequences obtained from an organism which has not been immunised with any of the proteins (or fragments) , or may be one constructed using sequences obtained from an organism which has been exposed to the antigen of interest.

Antibodies according to the present invention may be modified in a number of ways. Indeed, the term "antibody" should be construed as covering any binding substance having a binding domain with the required specificity. Thus the invention covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including synthetic molecules and molecules whose shape mimicks that of an antibody enabling it to bind an antigen or epitope.

Example antibody fragments, capable of binding an antigen or other binding partner are the Fab fragment consisting of the VL, VH, Cl and CHI domains; the Fd fragment consisting of the VH and CHI domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab')2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region. Single chain Fv fragments are also included.

The reactivities of antibodies on a sample may be determined by any appropriate mean^'s. Tagging with individual reporter molecules is one possibility. The reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals. The linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non- covalently. Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule. The mode of determining binding is not 'a feature of the present invention and those skilled in the art are able to choose a suitable mode according to their preference and general knowledge.

Antibodies may also be used in purifying and/or isolating a polypeptide or peptide for use in the present methods, for instance following production of the polypeptide or peptide by expression from encoding nucleic acid therefor. Antibodies may be useful in a therapeutic context (which may include prophylaxis) to disrupt MDCl interactions with cellular DNA damage response factors or sites of DNA damage with a view to inhibiting MDCl activity.

Antibodies can for instance be micro-injected into cells, e.g. at a tumour site, subject to radio- and/or chemotherapy (as discussed already above) . Antibodies may be employed in accordance with the present invention for other therapeutic and non-therapeutic purposes which are discussed elsewhere herein.

Other candidate inhibitor compounds may be based on modelling the 3-dimensional structure of a polypeptide or peptide fragment and using rational drug design to provide potential modulator (for example, inhibitor) compounds with particular molecular shape, size and charge characteristics.

A potential modulator compound may be a "functional analogue" of a peptide or other compound which modulates MDC1/MRE11 binding in a method of the invention. A functional analogue has the same functional activity as the peptide or other compound in question, i.e. it may interfere with the binding between MDCl and a DNA damage response factor, such as one or more members of the MREll complex. Examples of such analogues include chemical compounds which are modelled to resemble the three dimensional structure of the MDCl domain in the contact area, and in particular the arrangement of the key amino acid residues as they appear in MDCl.

MDCl polypeptides and binding partners, including components of the MREll complex and 53BP1 polypeptides, may be used in methods of designing mimetics of these molecules suitable for inhibiting MDCl activity.

Accordingly, the present invention provides a method of designing mimetics of MDCl polypeptides and its binding partners, including components of the MREll complex having the biological activity of activity of modulating, e.g. inhibiting, the MDCl/ MREll complex interaction, activity of the MREll complex or the ATM or ATR dependent DNA damage signalling pathways and/or interactions with other targets such as 53BP1, said method comprising: (i) analysing a substance having the biological activity to determine the amino acid residues essential and important for the activity to define a pharmacophore; and,

(ii) modelling the pharmacophore to design and/or screen candidate mimetics having the biological activity.

Suitable modelling techniques are known in the art. This includes the design of so-called "mimetics" which involves the study of the functional interactions of the molecules and the design of compounds which contain functional groups arranged in such a manner that they could reproduced those interactions.

The modelling and modification of a ^Λlead'_. compound to optimise its properties, including the production of mimetics, is further described below.

As described above, the activity or function of MDCl may be inhibited, as noted, by means of a substance that interferes in some way with the interaction of MDCl with other factors described herein. An alternative approach to inhibition employs regulation ..at the nucleic acid level to inhibit activity or function by down-regulating production of MDCl.

For instance, expression of a gene may be inhibited using anti-sense or RNAi technology. The use of these approaches to down-regulate gene expression is now well-established in the art.

Anti-sense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of MDCl polypeptide so that its expression is reduced or completely or substantially completely prevented. In addition to targeting coding sequence, antisense techniques may be used to target control sequences of a gene, e.g. in the 5' flanking sequence, whereby the antisense oligonucleotides can interfere with expression^' control sequences. The construction of antisense sequences and their use is described for example in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990) and Crooke, Ann. Rev. Pharmacol. Toxicol., 32:329-376, (1992) .

Oligonucleotides may be generated in vitro or ex vivo for administration or anti-sense RNA may be generated in vivo within cells in which down-regulation is desired. Thus, double-stranded DNA may be placed under the control of a promoter in a "reverse orientation" such that transcription of the anti-sense strand of the DNA yields RNA which is complementary to normal mRNA transcribed from the sense strand of the target gene. The complementary anti-sense RNA sequence is thought then to bind with mRNA to form a duplex, inhibiting translation of the endogenous mRNA from the target gene into protein. Whether or not this is the actual mode of action is still uncertain. However, it is established fact that the technique works.

The complete sequence corresponding to the coding sequence in reverse orientation need not be used. For example fragments of sufficient length may be used. It is a routine matter for the person skilled in the art to screen fragments of various sizes and from various parts of the coding or flanking sequences of a gene to optimise the level of anti-sense inhibition. It may be advantageous to include the initiating methionine ATG codon, and perhaps one or more nucleotides upstream of the initiating codon. A suitable fragment may have about 14-23 nucleotides, e.g. about 15, 16 or 17.

An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co- suppression; Angell & Baulcombe (1997) The EMBO Journal 16,12:3675-3684; and Voinnet & Baulcombe (1997) Nature 389: pg 553) . Double stranded RNA (dsRNA) has been found to be even more effective in gene silencing than both sense or antisense strands alone (Fire A. et al Nature, Vol 391, (1998) ) . dsRNA mediated silencing is gene specific and is often termed RNA interference (RNAi) .

RNA interference is a two-step process. First, dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs (~2nt) . The siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001) RNAi may be also be efficiently induced using chemically synthesized siRNA duplexes of the same structure with 3'- overhang ends (Zamore PD et al Cell, 101, 25-33, (2000)). Synthetic siRNA duplexes have been shown to specifically suppress expression of endogenous and heterologeous genes in a wide range of mammalian cell lines (Elbashir SM. et al. Nature, 411, 494-498, (2001)).

Another possibility is that nucleic acid is used which on transcription produces a ribozyme, able to cut nucleic acid at a specific site - thus also useful in influencing gene expression. Background references for ribozymes include Kashani-Sabet and Scanlon, 1995, Cancer Gene Therapy, 2(3): 213-223, and Mercola and Cohen, 1995, Cancer Gene Therapy, 2(1), 47-59.

Thus, a modulator of MDCl activity and thus a modulator of the ATM dependent DNA damage pathway and cellular responses to DNA damage may comprise a nucleic acid molecule comprising all or part of the MDCl coding sequence or the complement thereof

Such a molecule may suppress the expression of MDCl polypeptide and may comprise a sense or anti-sense MDCl coding sequence or may be an MDCl specific ribozyme, according to the type of suppression to be employed.

The type of suppression will also determine whether the molecule is double or single stranded and whether it is RNA or DNA. Examples of the use of siRNA to reduce or • abolish MDCl expression are provided below.

Methods of the invention may comprise the step of identifying a test compound, for example a candidate modulator as described above, as a modulator of binding between the MDCl polypeptide and one or more of the factors discussed above. The test compound may be further identified as a modulator of the ATM dependent DNA damage signalling pathway or DNA double strand break repair.

Following identification of such a compound, the compound may be investigated further. A method may comprise, for example, isolating and/or synthesising said test compound.

Following identification of a compound as described above, a method may further comprise modifying the compound to optimise the pharmaceutical properties thereof.

The modification of a ^Λlead' compound identified as biologically active is a known approach to the development of pharmaceuticals and may be desirable where the active compound is difficult or expensive to synthesise or where it is unsuitable for a particular method of administration, e.g. peptides are not well suited as active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal. Modification of a known active compound (for example, to produce a mimetic) may be used to avoid randomly screening large number of molecules for a target property.

Modification of a lead' compound to optimise its pharmaceutical properties commonly comprises several steps. Firstly, the particular parts of the compound that are critical and/or important in determining the target property are determined. .In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. These parts or residues constituting the active region of the compound are known as its "pharmacophore".

Once the pharmacophore has been found, its structure is modelled to according its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, X-ray diffraction data and NMR.

Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process.

In a variant of this approach, the three-dimensional structure of the ligand and its binding partner are modelled. This can be especially useful where the ligand and/or binding partner change conformation on binding, allowing the model to take account of this in the optimisation of the lead compound.

A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted on to it can conveniently be selected so that the modified compound is easy to synthesise, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. The modified compounds found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Modified compounds include mimetics of the lead compound-

Further optimisation or modification can then be carried out to arrive at one or more final compounds for in vivo or clinical testing.

The test compound may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals, e.g. for any of the purposes discussed elsewhere herein.

A method of the invention may comprise formulating said test compound in a pharmaceutical composition with a pharmaceutically ■ acceptable excipient, vehicle or carrier as discussed further below.

For therapeutic treatment, an active compound may be used in combination with any other active substance, e.g. for anti-tumour therapy, another anti-tumour compound or therapy, such as radiotherapy or chemotherapy. In such a case, a method, when conducted in vivo, may comprise determining the effect of the test compound identified as a modulator of MDCl activity on DNA repair, cell viability and hypersensitivity, cell killing (e.g. in the presence and absence of radio- and/or chemo-therapy) , and/or retroviral integration.

Another aspect of the present invention provides a method of producing a pharmaceutical composition comprising; identifying a compound which modulates the activity of an MDCl polypeptide using a method described herein; and, admixing the compound identified thereby with a pharmaceutically acceptable carrier.

The formulation of compositions with pharmaceutically acceptable carriers is described further below.

Another aspect of the invention provides a method for preparing a pharmaceutical composition, for example, for the treatment of a condition which is ameliorated by the modulation (i.e. inhibition or enhancement) of cellular responses to DNA damage, comprising; i) identifying a compound which is an agonist or antagonist of a MDCl polypeptide ii) synthesising the identified compound, and; iii) incorporating the compound into a pharmaceutical composition.

The identified compound may be synthesised using conventional chemical synthesis methodologies. Methods for the development and optimisation of synthetic routes are well known to persons skilled in this field.

The compound may be modified and/or optimised as described above.

Incorporating the compound into a pharmaceutical composition may include admixing the synthesised compound with a pharmaceutically acceptable carrier or excipient.

Another aspect of the present invention provides a modulator, for example an inhibitor, of MDCl activity, or composition comprising such a modulator, which is isolated and/or obtained by a method described herein.

Suitable modulators may include small chemical entities, peptide fragments, antibodies or mimetics as described above.

Another aspect of the invention provides a pharmaceutical composition comprising a modulator as described herein and a pharmaceutically acceptable excipient, vehicle or carrier.

Another aspect of the invention provides a method of producing a MDCl polypeptide which comprises: (a) causing expression from nucleic acid which encodes a MDCl polypeptide in a suitable expression system to produce the polypeptide recombinantly;

(b) testing the recombinantly produced polypeptide for MDCl activity.

The determination of MDCl activity is described above.

Methods for the production of a recombinant polypeptide from encoding nucleic acid are well-known in the art. Nucleic acid sequences encoding a MDCl polypeptide may be readily prepared by the skilled person using the information and references contained herein and techniques known in the art (for example, see Sambrook, Fritsch and Maniatis, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989, and

Ausubel et al, Short Protocols in Molecular Biology, John Wiley and Sons, 1992), given the nucleic acid sequence and clones available. These techniques include (i) the use of the polymerase chain reaction (PCR) to amplify samples of such nucleic acid, e.g. from genomic sources, (ii) chemical synthesis, or (iii) preparing cDNA sequences. DNA encoding MDCl polypeptides may be generated and used in any suitable way known to those of skill in the art, including by taking encoding DNA, identifying suitable restriction enzyme recognition sites either side of the portion to be expressed, and cutting out said portion from the DNA. The portion may then be operably linked to a suitable promoter in a standard commercially available expression system. Another recombinant approach is to amplify the relevant portion of the DNA with suitable PCR primers.

In order to obtain expression of the nucleic acid sequences, the sequences can be incorporated in a vector having one or more control sequences operably linked to the nucleic ^'acid to control its expression. The vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the polypeptide or peptide is produced as a fusion and/or nucleic acid encoding secretion signals so that the polypeptide produced in the host cell is secreted from the cell. Polypeptide can then be obtained by transforming the vectors into host cells in which the vector is functional, culturing the host cells so that the polypeptide is produced and recovering the polypeptide from the host cells or the surrounding medium. Prokaryotic and eukaryotic cells are used for this purpose in the art, including strains of E. coli, yeast, and eukaryotic cells such as COS or CHO cells.

Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. Suitable host cells include bacteria, eukaryotic cells such as mammalian and yeast, and baculovirus systems. Mammalian cell lines available in the art for expression of a' heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells, COS cells and many others. A common, preferred bacterial host is E. coli .

Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al . , 1989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al. eds . , John Wiley & Sons, 1992..

A polypeptide may be tested for MDCl activity by determining the binding of said polypeptide to one or more of the following: a factor involved in the cellular DNA damage response, including 53BP1 and members of the MREll complex, a site of DNA damage within a cell and a DNA molecule, more preferably, one or more of the following: a factor involved in the cellular DNA damage response, including 53BP1 and members of the MREll complex and a site of DNA damage within a cell. Standard methodologies may be used for the determination of binding. Suitable methodologies are further discussed below.

A polypeptide may be further tested for MDCl activity by determining the localisation of MDCl or the MREll complex at sites of DNA damage within the cell, by determining the formation of irradiation induced MREll foci (MRE11- IRIF) or by determining the DNA DSB repair capacity or the activity of the ATM- dependent or ATR dependent DNA damage signalling pathways, as described above.

Another aspect of the invention provides the use of a modulator as described herein in the manufacture of a composition for treatment of a condition which is a condition which is ameliorated by the modulation (i.e. inhibition or enhancement) of cellular responses to DNA damage as described below.

Another aspect of the invention provides a method comprising administration of a composition as described herein to a patient for treatment of a condition which is ameliorated by the modulation (i.e. inhibition or enhancement) of cellular responses to DNA damage.

A condition which may be ameliorated by the modulation of cellular responses to DNA^' damage may include a condition for which activation or inhibition of DNA DSB repair or of the ATM dependent or ATR dependent DNA damage signalling pathways is beneficial (i.e. produces clinical improvements in an individual suffering from the condition) , for example cancer, aging or viral infection. Viral infection may include adenoviral infection (Stracker et al Nature 418 p348-352) and retroviral infection including HIV infection.

Activators and enhancers of MDCl obtained using the present methods may be used, for example, to inhibit cell proliferation by activating cell cycle checkpoint arrest in the absence of cellular damage, which may be used in the treatment of tumours, cancer, psoriasis, arteriosclerosis and other hyper-proliferative disorders.

Cancer radiotherapy and chemotherapy may be augmented using inhibitors of MDCl obtained using the present methods. Ionising radiation (IR) and radiomimetic drugs are used commonly to treat cancers, and kill cancer cells predominantly via inflicting DNA damage. Cells deficient in ATM or the MREll complex (D'Amours et al supra) are hypersensitive to ionising radiation and radiomimetics . Thus, inhibitors of the ATM dependent DNA damage signalling pathway or its components, including MDCl, 53BP1 and the MREll complex, will hypersensitise cells to the killing effects of ionising radiation and radiomimetics. Such inhibitors may thus be used as adjuncts in cancer radiotherapy and chemotherapy.

Whether it is a polypeptide, antibody, peptide, anti- sense, sense or siRNA nucleic acid molecule, small molecule, mimetic or other pharmaceutically useful compound according to the present invention that is to be given to an individual, administration is preferably in a "prophylactically effective amount" or a "therapeutically effective amount" (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors.

A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.

Pharmaceutical compositions according to the present invention, and for use in accordance with the present invention, may include, in addition to active ingredient, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. S.uch materials should be non-toxic and should not interfere with the efficacy of the active ingredient. ^' The precise nature of the carrier or other ^• material will depend on the route of administration, which may be oral, or by injection, e.g. cutaneous, subcutaneous or intravenous.

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.

Liposomes, particularly cationic liposomes, may be used in carrier formulations.

Examples of techniques and protocols mentioned above can be found in Remington=s Pharmaceutical Sciences, 16th edition, Osol, A. (ed) , 1980.

The agent may be administered in a localised manner to a tumour site or other desired site or may be delivered in a manner in which it targets tumour or other cells.

Targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell . specific ligands. Targeting may be desirable for a variety of reasons, for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.

Aspects of the present invention will now be illustrated with reference to the accompanying figures described below and experimental exemplification, by way of example and not limitation. Further aspects and embodiments will be apparent to those of ordinary .-skill in the art. All documents mentioned in this specification are hereby incorporated herein by reference.

Figure 1 shows a schematic representation of MDCl (KIAA0170 gene product) . The N-terminal FHA domain, repeat region and the two C-terminal BRCT domains are highlighted.

Figure 2 shows dose dependence of MDCl foci formation.

Cells were mock treated (0 Gy) or irradiated as indicated and 30 minutes after irradiation they were stained by immunofluorescence with MDClAb#889. The number of foci per cell in about 100 cells from each condition was analysed.

Figure 3 shows the abrogation of MRE11-IRIF formation in MDCl-depleted cells. Histogram bars correspond to average numbers of NBS1-IRIF from three experiments (6 h after irradiation) . Counting was carried out blind with only the NBSl-staining channel active and MDCl siRNA data were corrected so that cells that still expressed MDCl did not contribute to the results.

Figure 4 shows the_, radio-resistant DNA synthesis (RDS) phenotype in cells in which MDCl was downregulated. siRNA-transfected cells were assessed for DNA synthesis 45 min after irradiation.

Figure 5 shows the RDS phenotype in cells overexpressing MCD1-FHA-GFP. HeLa cells were transfected with MDC1-FHA- GFP, MDCl-FHA-m-GFP or GFP plasmids irradiated with 10 Gy. Experimental

Materials and Methods Identification of MDCl

Anti-MREll and anti-RAD50 sheep polyclonal antibodies were raised against purified (His) ₆-tagged fragments of the proteins (amino acid residues 183-583 of MREll and 480-724 of RAD50) and were affinity purified on a column prepared from the same fragments coupled to SulfoLink™ resin (Pierce) . 400μl HeLa cell nuclear extract (Computer Cell Culture Centere, Mons, Belgium; 3.5 mg total protein) were diluted with 400μl PBS and adsorbed to 50μl affinity purified anti-MREll or anti-RAD50 antibodies that had previously been linked to Cyanogen Bromide activated Sepharose 4B (Amersham Pharmacia Biotech) according to the manufacturer's instructions. The resin was washed several times with w-buffer (50 mM HEPES pH 7.4, 250 mM^'NaCl, 0.5% NP40) and bound proteins were eluted with 40μl of e-buffer (50 mM TrisHCl pH 6.8, 20% (v/v) glycerol, 2% (w/v) SDS) by heating the suspension to 80% for 2 minutes. For SDS-PAGE analysis, lμl of the eluate was separated on a 8% SDS polyacrylamide gel and stained with silver. For identification of proteins by mass spectrometry, 25μl of the eluate were separated on a. 6% SDS-polyacrylamide gel and stained with Coomassie blue. After excision of individual bands,, proteins were digested in-gel with trypsin. After overnight incubation at 30 °C, a 0.5-μl sample from the digest was spotted on the MALDI1 target for fingerprinting. The remaining digest was purified using C18 Zip-Tips prior .to electrospray ionization mass spectrometry. Peptide mass fingerprints were taken with a MALDI instrument (Micromas) fitted with delayed extraction, using - cyanocinnamic acid dissolved in 50% acetonitrile, 0.1% trifluoroacetic acid as matrix. Collision-induced decomposition fragmentation spectra from peptides were taken with an ion-trap instrument (LCQ-Decca) from ThermoQuest. Protein databases were searched with the mass spectrometry data using the programs Mascot (matrixscience.com, mass fingerprinting and fragmentation spectra) and Profound (129.85.19.192, mass fingerprinting data) .

Plasmids

MDC1-FHA-GST and MDC1-FHA-GFP correspond to MDCl residues 2-220 fused to GST and GFP, respectively; MDCl-FHA-m-GST and MDCl-FHA-m-GFP contain MDCl residues 2-220 Arg58Ala) ; MDC1-BRCT-GST contains MDCl residues 1883-2089; MDC1-RM- GST contains MDCl residues 1459-1500; Ki67-FHA-GST contains Ki67 residues 1-134.

Immunoprecipitation and Immunoblotting Polyclonal antibodies MDClAb#889 and MDClAb#3835 were raised in rabbit and sheep, respectively, against a purified GST-MDC1 FHA domain (residues 2-220) fusion protein that was over-expressed in E. coli . MDClAb#1987 polyclonal antibodies were raised in rabbit against a peptide composed of residues 1387-1401 of MDCl.

Anti NBS1 polyclonal- rabbit serum was raised against a purified (His) e-tagged fragment (residues 200-351) of human NBS1. Cellular proteins were separated on 6-8% SDS polyacrylamide gels and transferred to Immobilon-P (Millpore) or nitrocellulose membrane (Schleicher and Schuell) . Secondary antibodies used in western blots were horse radish peroxidase anti-sheep, anti-rabbit and anti- mouse (DAKO) . GST pull-downs were done with bacterially expressed and purified MDCl fragments and with HeLa nuclear extracts. For co-immunoprecipitation, HeLa cell nuclear extract (1-2 mg) (l-2mg) , prepared from undamaged cells and from cells treated with 10 Gy of IR (Faxitron Cabinet X-ray system, model 43855D; Faxitron X-Ray Corporation) , were incubated with primary antibodies in the presence of lOmgml^"1 ethidium bromide for 2 hours at 4°C. Immuno- complexes were precipitated with protein-G Sepharose (Amersham Pharmacia Biotech) . Nuclear extracts (lOOmg) were incubated at 30°C with 400 units of phosphatase (New England BioLabs) in the present of Mn²⁺ for 30min before immunoblot analyses. In controls, 50mM EDTA was added to inhibit the phosphatase.

Cell lines, cell extraction and siRNA transfection HeLa, MRC5, ^'NBSl-LBI, M059J and M059K cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) . ATT21JE-T FT-ρEBS7 (empty vector) and ATT21JET FT-pEBYZ5 (+ATM) cells were cultured in DMEM supplemented with 10% FBS and 100 μg/ml Hygromycin B (Invitrogen Life Technologies) Faxitron Cabinet X-ray system (model 43855D) was the IR source. Cell nuclear extracts were prepared according to known methods (Jackson SP: Gene Transcription: A Practical Approach . (B. D. Hames & S. J. Higgins Eds) Oxford University Press 189-242 (1993)). Mild extraction to monitor nuclear retention was preformed by resuspending cells in me-buffer (50 mM TrisHCl, pH 7.4; 250 mM NaCl; 1% NP40) , followed by incubation on ice for 5 minutes. The extracts were then centrifuged and the supernatant was carefully decanted. The insoluble fraction was resuspended in SDS-PAGE loading buffer and sonicated briefly to solubilise the chromatin prior to western-blot analysis .

siRNA duplexes were synthesized by Dharmacon. The coding strands for MDCl, 53BP1, ATR and GFP siRNAs were AATCCTGAGACCTCCTAAGGTTT, AAGCCAGGTTCTAGAGGATGATT, AAGACGGTGTGCTCATGCGGC and AACACTTGTCACTACTTTCTC, respectively.

Transfection of HeLa with siRNA duplex was carried out as described by Elbashir SM, (2001) supra. At the indicated time after transfection, cells were fixed and examine by immunostaining or immunoblotting, or were subjected to IR and were left to recover for the indicated time before fixation.

Immunofluorescence Microscopy:

Cells were plated on poly-L-lysine (Sigma) coated glass coverslips 24 hours before fixation or DNA-damage induction. When the cells were subjected to DNA damage they were left to recover for the indicated time before fixation. For single immunostaining of MDCl, the cells were fixed with 2% paraformaldehyde (w/v) in PBS for 10 min, washed twice with PBS and permeabilised with 0.5% NP-40 in PBS for 10 min. For dual immunostaining of MDCl and MREll, cells were fixed with ice-cold methanol for 20 min at -20°C, and permeabilized in ice-cold acetone for 20s. Coverslips were washed three times with PBS and blocked in 10% FBS in PBS for 30 min. After incubation for 2 hours at RT or overnight at 4°C with primary antibody (as indicated in figure legend) in 5% FCS in PBS, cells were washed with PBS. For single immunostaining, fluorescein isothiocyanate (FITC)- conugated antibodies (anti-sheep: Jackson Laboratories; anti-rabbit or anti-mouse: Amersham Life Science), were added for 1 hour at RT. Coverslips were washed three times with PBS and mounted with Vectashield mounting medium containing propidium iodide (PI) (Vector

Laboratories) . For dual immunostaining FITC-conjugated antibodies, rhodamine-conjugated antibodies ,(anti-sheep, anti-rabbit or anti-mouse (Jackson Laboratories) were added for lh at RT . Coverslips were washed three times with PBS and mounted with Vectashield mounting medium (Vector Laboratories) . Slides were view with a Biorad laser scanning confocal microscope, using an oil immersion 60 X objective, by sequential scanning of emission channels used (488 nm for FITC, and 514 nm for propidium iodide rhodamine) . Images were processed with Adobe PhotoShop.

RDS assay

48 h after siRNA-transfection, HeLa cells were labelled for 24 h with 20 nCi ml^"1 [¹⁴C] thy idine, followed by another 24 h incubation in non-radioactive medium. Cells were irradiated with 0, 5, 10 or 20Gy; 45 mins later, [³H] thymidine (2.5mCi ml^-1) was added. For FHA domain overexpression studies, HeLa cells were transfected using the Lipofectin and PLUS reagents as recommended by the manufacturer (Invitrogen) .

[¹⁴C] Thymidine (20 nCi ml^-1) was added at the time of transfection, washed away 24 h later, and fresh medium was added. After another 24 h, the cells were irradiated (lOGy) . After a further 45 min, [³H] thymidine (2.5mCi ml^{" 1}) was added for 15 min. Inhibition of DNA synthesis was then measured using standard methods (Falck, J. et al Nature Genet. 30, 290-294 (2002)) Results

MREll and RAD50 affinity-purified antibodies were used for immunopurification of the MREll complex from HeLa nuclear extract. In addition to the known members of the complex, several other proteins were retrieved from the extract. One of these ran as a band of about 250 kDa on silver stained SDS-PAGE gel (p250) . p250 was sequenced by mass spectrometry and was identified as the gene product of KIAA0170.

Antibodies raised against various regions of the KIAA0170 protein were used, together with antibodies directed against MREll, RAD50 and NBS1, in co-immunoprecipitation studies. It was confirmed that KIAA0170 protein is co- immunoprecipitated with MREll, RAD50 and NBS1 from HeLa nuclear extfact and that antibodies raised against KIAA0170 protein co-i munoprecipitated all three members of the MREll complex. The interaction was still detected in the presence of ethidium bromide, indicating that the interaction is not mediated via DNA. The KIAA0170 protein was named MDCl for Mediator of DNA damage checkpoint protein 1.

The MDCl sequence was found to contain a forkhead- associated (FHA) domain at its N-terminus and two BRCA1 C-terminal (BRCT) domains at its C-terminus (Figure 1) (Durocher D, & Jackson SP (2002) FEBS Lett 513 58-66, Bork P et al (1997) FASEB J. 11 68-76) .

Pull-down experiments using the FHA domain of MDCl fused to GST against a HeLa cell mitotic extract retrieved a band of about 230 kDa on SDS-gel stained with silver. This band was identified as 53BP1. The interaction between 53BP1 and MDCl was shown to be phospho-dependent as it was abrogated when λ-phosphatase was added to the reaction i.e. the FHA domain of MDCl only binds to the phosphorylated form of 53BP1.

Similar pull-down results were obtained using unsynchronised HeLa extract.

To investigate the sub-cellular distribution of MDCl,

Mrc5 cells were mock treated (0 Gy; M) or irradiated with 20 Gy and stained 15 minutes (15') or 12 hours (12h) post-irradiation with MDClAb#889. By immunofluorescence, antibodies against different regions of MDCl showed diffuse nuclear MDCl staining in undamaged cells.

Following the induction of DNA DSBs by ionizing radiation (IR) or phleomycin, MDCl rapidly re-localised to distinct nuclear foci. MDCl foci appeared within 15 minutes after the induction of DNA DSBs and were detected for up to 12 hours after the damage. 24 hours post irradiation the cells were indistinguishable from undamaged cells. MDCl foci formation was found to be dose dependent since an increase in the number of foci per cell was observed as the IR dose was increased (Figure 2) . This provided further evidence that MDCl foci represent sites of DNA DSBs. Moreover, it was observed that MDCl becomes resistant to salt extraction after the induction of DNA DSBs by IR. In undamaged cells, the majority of MDCl was readily extracted, whereas, following exposure of the cells to IR, the majority of MDCl was converted to a less extractable form. MDCl thus becomes more stably associated with chromatin in response to the induction of DNA DSB, indicating that it binds to a factor situated at the site of DNA damage. Immunofluorescence was then used to investigate whether MDCl and the MREll complex co-localise in vivo . In undamaged cells, the MREll complex is distributed throughout the nucleus. After induction of DNA DSBs, the complex relocalises to nuclear foci (Maser RS et al (1997) Mol. Cell Biol. 17 6087-6096, Mirzoeva OK, (2001) Mol. Cell Biol. 21 281-288). Two distinct types of MREll complex foci appear in response to IR. Small, granular foci, which can only be detected after in si tu extraction of the cells, appear immediately after exposure of the cell^'s to IR (Mirzoeva OK, (2001) supra) and large foci, also known as IR-induced foci (IRIF) , start to appear 4 hours after the damage induction, they are bigger, fewer and brighter than the early foci (Maser RS, 1997 supra,

Mirzoeva OK, 2001 supra) . The MREll complex IRIF (MRE11- IRIF) have been shown to colocalise with phosphorylated histone H2AX (Serl39; γ-H2AX) and 53BP1 ( [Schultz LB et al (2000) J. Cell Biol. 151 1381-1390, Paull TT et al (2000) Curr Biol 10 886-895) . Co-immunofluorescence studies using MDCl antibodies, together with MREll or NBS1 antibodies, showed that in undamaged cells MDCl and the MREll complex both localised in the nucleus. A few cells contained small MREll dots, which did not overlap with MDCl staining and that most likely represent PML bodies (Mirzoeva OK, 2001 supra) .

After irradiation of the cells, clear co-localisation was detected between MRE11-IRIF and MDCl foci. Maximal co- localisation was seen 4-8 hours post irradiation. Since MREll-IRIF formation was shown to be abrogated in NBS cells (Carney JP et al (1998) Cell 93 477-486), it was investigated whether MDCl foci formed normally in these cells. MDCl foci appeared in the •^■NBS cell line as in control MRC5 cells, demonstrating that formation of MDCl foci is independent of the presence of intact NBS1.

To further characterise the role of MDCl in the cellular response to DNA DSBs, it was investigated whether RAD51, phosphorylated histone H2AX and 53BP1, which function in cellular responses to DNA DSBs (Haaf T, (1995) PNAS USA 92 2298-2302, Schultz LB, 2000 supra, Paull T.T., 2000 supra) , co-localised with MDCl foci after damage induction. No co-localisation was detected between MDCl and RAD51 foci 4 hours after IR. This confirms the finding that MDCl foci co-localised with MREll-IRIF and previous findings that MREll-IRIF do not co-localise with RAD51 foci (Maser RS, 1997 supra, Mirzoeva OK, 2001 supra) .

MDCl foci were found to co-localise with both γ-H2AX and 53BP1 foci shortly after irradiation. Thus, MDCl is present at sites of DNA DSBs (Rogakou EP et al (1999) J. Cell Biol. 146 905-916).

MREll complex, γ-H2AX and 53BP1 foci formation is at least partly regulated by ATM, DNA-PK (DNA-dependent protein kinase) or ATR (ATM and Rad3 related) (Paull TT et al (2000) Curr Biol. 10 886-895, Schultz LB et al (2000) J. Cell Biol. 151 1381-1390, Maser RS et al (1997) Mol.

Cell. Biol. 17 6087-6096, Burma S et al (2001) J. Biol. Chem. 276 42467). All of these proteins show homology to the phosphatidylinositol (PI) 3-kinases and have been shown to act early in the DNA damage response (Smith et al (1999) Genes Dev 13 916-934; Abraham (2001) supra) . It was investigated whether the formation of the MDCl foci requires the activity of these kinases. MRC5 cells were pre-treated with 200μM wort annin, which has been shown to inhibit all three kinases at a concentration of 200μM (Sarkaria JN et al (1998) Cancer Res 58 4375-4382) or a mock treatment with DMSO, 30 minutes before 10 Gy irradiation. The cells were then stained by immunofluorescence with MDClAb#889, 30 minutes after irradiation.

Diffuse nuclear MDCl staining was observed in wortmannin treated cells. This indicates that MDCl foci formation was inhibited under these conditions.

Given the effect of wortmannin on MDCl foci formation, MDCl foci formation was studied in AT cells, which lack functional ATM, and in M059J cells, which are deficient in DNA-PK and have low levels of ATM (Chan DW et al

(1998) Int J. Radiat. Biol. 74 217-224, Lees-Miller SP, 1995 Science 267 1183-1185) .

M059K and M059J cells were irradiated (10 Gy) and stained by immunofluorescence with MDClAb#889, 30 minutes after irradiation. ATT21JET FT-pEBYZ5 (AT cells + ATM) and ATT21JE-T FT-pEBS7 (AT cells + vector) were irradiated (5 Gy) and stained by immunofluorescence with MDClAb#889 20 minutes after irradiation.

MDCl was observed to form foci in AT and M059J cells after the induction of DNA DSBs. The same was shown for 53BP1 and γ-H2AX in M059J cells and for 53BP1 in AT cells. Taken together with the wortmannin data above, these results provide indication that more than one member of the PI 3-kinase family regulates MDCl foci formation.

Our findings show that MDCl associates with sites of DNA DSBs in vivo and that this association requires the activity of one or several members of the PI 3-kinase family. Moreover, the late appearance of the MREll-IRIF compared to MDCl foci provides indication of a requirement for MDCl for the active recruitment of the MREll complex into the MREll-IRIF.

The distribution of MREll-IRIF was examined in cells in which MDCl expression was down regulated by transfection of siRNA duplexes specific to MDCl sequences (Elbashir SM, 2001 Nature 411 494-498) to determine whether MDCl is essential for the formation of MREll-IRIF.

HeLa cells were transfected with MDCl siRNA duplexes and were analysed 96 hours after transfection for MDCl down regulation. Western blotting of control and MDCl siRNA duplex treated cells were then analysed on an 8% SDS- polyacrylamide gel. Proteins were transferred to a nitrocellulose membrane and the upper third of the membrane was blotted with MDClAb#889 while the lower part was blotted with a monoclonal poly (ADP-ribose) polymerase (PARP) antibody as a loading control.

The efficiency of MDCl down-regulation by siRNA was found to be 80-90%.

Immunofluorescence studies of control and MDCl siRNA duplexes (siRNA) transfected cells confirmed the western blot results and showed that in most cells MDCl could not be detected, although in a few cells MDCl expression levels were comparable to that in the control cells. MDCl down-regulation was observed from about 72 hours after the transfection of the siRNA up to more than 150 hours . MREll-IRIF formation was then analysed in the absence of MDCl. HeLa cells were transfected with siRNA GFP or MDCl duplexes, after 90 hours the cells were mock treated or irradiated (15 Gy) and left for recovery for 6 hours. The cells were stained by immunofluorescene with MDClAb#3835 and p95NBSl (Ab-1) (Oncogene Research Products) antibodies .

NBS1 staining in undamaged cells, which had been transfected with GFP siRNA or MDCl siRNA, was nuclear and gave a generally diffuse staining pattern. 6 hours post irradiation NBS1 foci were detected in a large proportion of the cells that had been transfected with GFP siRNA. In cells in which MDCl was down-regulated (MDCl siRNA transfected) , there was a marked reduction in MREll-IRIF formation after irradiation (using antibodies directed against MREll or NBS1) (see Figure 3) . These results clearly show that depletion of MDCl abrogates MREll-IRIF formation. This shows that MDCl acts to recruit the MREll complex to sites of DNA DSBs.

Next, the requirement for MDCl in the formation of γ-H2AX and 53BP1 foci in response to irradiation (IR) was investigated. Histone H2AX is required for the recruitment of MREll complex and 53BP1 to the IRIF in response to IR (Celeste A et al (2002) Science 296 922- 927) .

HeLa cells were transfected with siRNA MDCl duplexes, and, after 90 hours, the cells were irradiated (15 Gy) and left for 30 minutes. The cells were stained by immunofluorescence with MDClAb#889 and 53BP1 antibodies or with MDClAb#3835 and γ-H2AX antibodies. Both γ-H2AX and 53BP1 foci were observed to form in MDCl down regulated cells .

The effect of over expressing the MDCl FHA domain in cells as a GFP fusion was tested. Over expression of the wild-type FHA domain markedly reduced IRIF formation by both MDCl and the MREll complex (88% and 66%, respectively) , as compared with untransfected cells, whereas over expression of the FHA domain mutant reduced foci formation to a lesser degree (82% for MDCl foci and 48% for NBS1 foci) . By contrast, over expression of the MDCl FHA domain did not impair focus formation by γ-H2AX or 53BP1. The over expressed MDCl FHA domain did not form foci on its own, indicating that this domain does not bind directly to γ-H2AX.

Cells in which MDCl was down regulated by siRNA were found to show a clear radio-resistant DNA synthesis (RDS) phenotype at low and high IR doses (Fig. 4) . RDS was also induced by the over expression of the wild-type MDCl FHA domain and, to a lesser degree, by the FHA domain mutant (Fig. 5) . These findings provide indication that the rapid, MDCl-mediated recruitment of the MREll complex to sites of DNA damage is an essential step for the efficient induction and/or propagation of the intra-S- phase checkpoint, and show that the MDCl FHA domain has a key role in these events.

Although downregulation of MDCl led to RDS, it did not impair the phosphorylation of NBS1, as detected by examining NBS1 electrophoretic mobility or by testing for reactivity against an antibody specific for NBS1 phosphorylated on Ser343. Notably, IR-induced phosphorylation of CHK2 on Thr68, degradation of CDC25A, and SMCl phosphorylation on Ser966 and Ser957 were still observed in MDCl-depleted cells. These data provide indication that CDC25A degradation and the phosphorylation of NBS1, CHK2 and SMCl are required but not sufficient for the intra-S- phase checkpoint response.

In conclusion, MDCl has been shown to interact with the MREll complex. This is a multifunctional protein complex which is part of the cellular apparatus for responding to DNA DSBs. Following induction of DNA DSBs in human cells, MDCl rapidly relocalises to distinct nuclear foci that also contain the MREll complex, γ-H2AX and 53BP1. This relocalisation is inhibited by the PI3-kinase specific inhibitor wortmannin, which provides indication that the process is dependent on PI3-kinase mediated signalling.

It has previously been suggested that the KIAA0170 gene product acts as nuclear transcriptional transactivator (Ozaki T et al (2000) DNA Cell Biol. 19 475-485) .

However, our findings demonstrate that MDCl acts, in higher eukaryotes, in the early steps of the detection of DNA DSBs and the subsequent induction of the cellular responses to this type of. damage.

One of the physiological functions of MDCl is to recruit the MREll complex into IRIF. This is demonstrated by the loss -of recruitment of MREll to MRE11-IRIRF when MDCl protein expression is down-regulated by siRNA, whilst γ- H2AX and 53BP1 recruitment is unaffected.

New insights are provided by the experiments disclosed herein into the mechanism of sub-nuclear translocations of factors that are involved in the cellular response to DNA DSBs. This process has been shown to be defective in cells derived from patients with AT, NBS or ATLD, which are syndromes characterised by chromosomal instability and cancer predisposition.

The present findings on MDCl highlight the link between defects in sub-nuclear localisation of repair factors ' and genomic instability associated with the predisposition to malignancy and provide the basis for generating novel therapeutic agents which modulate the DNA damage response .

Claims

CLAIMS :

1. A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) x polypeptide, which method may comprise:

(a) bringing into contact a MDCl polypeptide and a test compound; and,

(b) determining the activity of said MDCl polypeptide in the presence of said test compound.

2. A method according to claim 1 wherein said activity is determined by determining the binding of said polypeptide to a DNA damage response factor and/or a site of DNA damage within a cell.

3. A method according to claim 1 wherein said DNA damage response factor may include 53BP1 or a member of the MREll complex.

4. A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) polypeptide, which method may comprise:

(a) bringing into contact a MDCl polypeptide and a cellular DNA damage response factor in the presence of a test compound; and,

(b) determining binding between the MDCl polypeptide and said one or more components.

5. A method according to claim 4 wherein the cellular DNA damage response factor includes one or more polypeptides of the MREll complex or a 53BP1 polypeptide.

6. A method according to claim 5 wherein said one or more components of the MREll complex are selected from the group consisting of MREll, RAD50 and NBS1.

7. A method for obtaining a modulator of a MDCl (mediator of DNA damage checkpoint protein 1) polypeptide, which method may comprise: (a) contacting an MDCl polypeptide and a site of DNA damage in the presence of a test compound; and, (b) determining the binding of said MDCl polypeptide to said site of DNA damage.

8. A method according to any one of the preceding claims further comprising determining one or more of the following in the presence of the test compound: localisation of MDCl or the MREll complex at sites of DNA damage within the cell, the formation of irradiation induced MREll foci (MREll-IRIF) , DNA DSB repair activity and the activity of the ATM-dependent DNA damage signalling pathway or the ATR-dependent DNA damage signalling pathway.

9. A method according to any one of the preceding claims comprising identifying said test compound as a modulator of MDCl activity.

10. A method according to claim 9 comprising isolating said test compound.

11. A method according to claim 10 comprising formulating said test compound in a pharmaceutical composition with a pharmaceutically acceptable excipient, vehicle or carrier.

12. A modulator of MDCl activity obtained by a method of any one of claims 1 to 11.

13. A modulator according to claim 12 comprising a peptide fragment of a MDCl polypeptide.

14. A method of producing a pharmaceutical composition comprising; identifying a compound which modulates the activity of an MDCl polypeptide using a method according to any one of claims 1 to 8; and, admixing the compound identified thereby with a pharmaceutically acceptable carrier.

15. A method according to claim 14 comprising the step of modifying the compound to optimise the pharmaceutical properties thereof.

16. A method for preparing a pharmaceutical composition for treating a condition which is ameliorated by the modulation of cellular responses to DNA damage, comprising; i) identifying an agonist or antagonist of a MDCl polypeptide ii) synthesising the identified compound, and; iii) incorporating the compound into a pharmaceutical composition.

17. A method of producing a MDCl polypeptide comprising: (a) causing expression from nucleic acid which encodes a

MDCl polypeptide in a suitable expression system to produce the polypeptide recombinantly;

(b) testing the recombinantly produced polypeptide for MDCl activity.

18. A pharmaceutical composition comprising a modulator according to claim 12 or claim 13 and a pharmaceutically acceptable excipient, vehicle or carrier.

_' 19. Use of a modulator according to claim 12 or claim 13 in the manufacture of a composition for treatment of a condition which is ameliorated by the modulation (i.e. inhibition or enhancement) of cellular responses to DNA damage .

20. Use according to claim 19 wherein the condition is cancer or viral infection.

21. A method comprising administration of a composition according to claim 18 to a patient for treatment of a condition which is ameliorated by the modulation of cellular responses to DNA damage.

22. A method according to claim 21 wherein the condition is cancer or viral infection.