WO2004013335A1

WO2004013335A1 - Herbicide screening target

Info

Publication number: WO2004013335A1
Application number: PCT/GB2003/003165
Authority: WO
Inventors: Ian Graham; Elizabeth Rylott
Original assignee: The University Of York
Priority date: 2002-08-01
Filing date: 2003-07-23
Publication date: 2004-02-12
Also published as: AU2003254477A1

Abstract

The invention relates to a screening method to identify agents with plant growth inhibitory properties and to a transgenic plant with altered germination and lipid storage content.

Description

HERBICIDE SCREENING TARGET

The lipid content of a plant has been traditionally modified by plant breeding to add and remove traits which influence lipid content, particularly seed oil content. The development of transgenic technology has enabled an alternative approach to modulating or regulating plant cell lipid content.

The ability to be able to manipulate gene expression to alter lipid content is valuable. Firstly, alteration in lipid content means that plants can be cultivated which contain increase concentrations of essential fatty acids which have an impact on the nutritional value of said plant. For example, the generation of a plant rich in long chain fatty acids (C18 and longer) has value both nutritionally, medically and as an additive to industrial products. Linoleic acid (18:2. δ.9, 12) and α-linoleic acid (18:3. δ.9, 12, 15) are essential fatty acids found in plant seeds. The levels of these fatty acids have been successfully manipulated in transgenic oil seed crops (see, Topfer et al, 1995, Science 268: 681-686).

Secondly, plants use lipid as a storage reserve to fuel germination and seedling establishment. The ability to be able to manipulate germination is valuable to farmers who wish to regulate when crop plants germinate. In addition, genes involved in lipid metabolism are prime targets for the development of herbicidal agents since, for the most part, the mobilisation of storage lipid during seed germination is an essential process and any agents which interfere with this likely result in failure of a plant to establish and grow.

As mentioned above, genetic manipulation has become a preferred means to alter lipid content and seed germination is plants. The technique provides a means to generate plants with altered lipid content and lipid yield. For example, EP0787801, discloses a means to increase storage lipid content by reduction in the activity of cytosolic pyruvate kinase and phosphoenolpyruvate kinase in a transgenic seed. US5959175 discloses a seed specific promoter derived from the sunflower albumin gene. The patent describes the use of the promoter to alter oil seed content by linking expression by the promoter to nucleic acids encoding polypeptides involved in fatty acid biosynthesis. The examples describe the linking of the albumin promoter to a δ 6-desaturase gene. Transgenic plants show an increase in λ linoleic acid. US5977436 discloses a seed specific promoter derived from the Arabidopsis oleosin gene and its use to direct expression of genes encoding polypeptides involved in lipid biosynthesis and, in particular, genes involved in the synthesis of λ linoleic acid. As with US5959175, the expression of the δ 6-desaturase gene is regulated by operably linking the gene to the oleosin gene promoter.

It will be apparent that prior art attempts, as detailed above, to modify lipid content of plant cells have introduced lipid biosynthetic genes into plants to increase the content of fatty acids. We have taken an alternative approach to this by altering fatty acid breakdown to increase the lipid content of plant cells, particularly but not exclusively, to increase the content of unsual long chain fatty acids in plants.

Crop plants, such as oilseed rape, sunflower and corn, are valuable agronomically as sources of oils which can be used for many purposes ranging from use as industrial feed stocks to use in margarine manufacture and even as potential alternatives to fossil fuels. The production of naturally occurring oils in oil producing plants has been augmented using conventional breeding techniques. Typically, it is the seeds of oil producing plants which are harvested and then processed for their oil content, the rest of the plant generally being left as waste.

Recently, it has been proved that recombinant DNA technology can be used, for example, on oil seed rape to produce fatty acids which are not found naturally in the non-transformed plant. Voelker et al. Plant Journal (1996) 9: 229-241 succeeded in engineering lauric acid production into oil seed rape. Laurie acid is a fatty acid not normally found in any significant quantity in oil seed rape.

Although, the production of lauric acid in oil seed rape was achieved, it has been found that the presence of lauric acid also plays a part in activating fatty acid catabolism (β-oxidation pathway), thus creating a so-called "futile cycle" wherein lauric acid is produced which in turn plays a role in initiating its own catabolism and resulting in decreased yields of lauric acid in such plants (Eccleston N. S. et al., Planta (1996) 198:46-53).

There exists a need to improve the overall yield of fatty acids and/or lipids in oil seed bearing plants. Typically, oil bearing plants are plants which are agronomically attractive for their fatty acid and/or lipid generating potential and/or capacity, i particular, there exists a need to modify the β-oxidation pathway in plants, thereby improving overall yield of naturally occurring fatty acids or non-naturally occurring fatty acids (i.e., fatty acid production as a result of recombinant DΝA manipulation) in oil seed bearing plants.

We described an essential gene encoding a multi-functional protein (MFP2) which is involved in fatty acid breakdown and seed germination in Arabidopsis. The present invention relates to, amongst other things, to plant cells exhibiting a lower rate of the β-oxidation of fatty acids.

During germination and early post-germinative growth in oilseed seedlings, storage lipid is mobilised by peroxisomal β-oxidation to produce sucrose for seedling growth and establishment. The MFP2 gene catalyses the second and third steps of peroxisomal fatty acid β-oxidation with 2-trans-enoyl-CoA hydratase and L-3- hydroxyacyl-CoA dehydrogenase activities, hi Arabidopsis there are two MFP genes, AIM1 and MFP2. We have isolated and characterised a mutant containing a T-DΝA insert 1808bp from the 5' end of the MFP2 gene, between the 2-tr ns-enoyl-CoA hydratase and L-3-hydroxyacyl-CoA dehydrogenase domains. In two-day old mjp2 seedlings both hydratase and dehydrogenase regions of the transcript are transcribed, however, dehydrogenase activity is reduced by >98%, whereas hydratase activity is unchanged from wild-type levels.

Both lipid catabolism and seedling establishment are compromised in the mfp2 mutant, which requires an exogenous supply of sucrose for seedling establishment to occur. Acyl-CoA measurements on germinating wild type and mfp2 seedlings over the first 5 days of seedling growth indicate that long chain acyl-CoA substrates accumulate. Despite the reduction in storage lipid breakdown through β-oxidation in mfp2, the mutant is not resistant to the compound 2,4-dichlorophenoxybutryric acid, which is also catabolised to the herbicide and auxin 2,4-dichlorophenoxyacetic acid by β-oxidation. We have demonstrated that MFP2 is the gene predominantly responsible for long chain acyl-CoA dehydrogenase activity in Arabidopsis in vivo and is essential for seedling establishment.

MFP2 is therefore a screening target for the identification of agents which affect plant viability and/or growth and also a target for the manipulation of lipid content in plants through modulation of MFP2 activity.

According to an aspect of the invention there is provided the use of a polypeptide, or sequence variant thereof, encoded by the nucleic acid sequence as represented by Figure 6a, as a screening target for the identification of agents which inhibit plant growth and/or viability.

According to an aspect of the invention there is provided a screening method for the identification an agent with the ability to inhibit plant growth and/or viability comprising the steps of: i) providing a polypeptide encoded by the nucleic acid molecule selected from the following group; a) a nucleic acid molecule represented by the nucleic acid sequence in Figure 6a ; b) nucleic acids which hybridise to the sequences of (i) above and which have L-3-hydroxylacyl-CoA dehydrogenase activity; and c) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (a) and (b) above; ii) providing at least one candidate agent; iii) forming a preparation which is a combination of (i) and (ii); iv) determining the interaction of the polypeptide and said candidate agent; and v) testing the effect of the agent on the growth and/or viability of plants.

i a preferred method of the invention said agent has herbicidal activity.

In a preferred method of the invention said polypeptide is encoded the nucleic acid sequence represented by Fig 6a.

hi a further preferred method of the invention said polypeptide is represented by the amino acid sequence in Figure 6b, or active fragment thereof.

According to a further aspect of the invention there is provided an agent identified by the screening method according to the invention.

In a preferred embodiment of the invention said agent is a herbicide.

According to a further aspect of the invention there is provided a method for inhibiting the growth of undesired vegetation comprising applying an agent identified by the method according to the invention.

According to a further aspect of the invention there is provided a transgenic plant cell characterised in that the genome of said cell is modified such that the activity of L-3- hydroxyacyl-CoA dehydrogenase is reduced when compared to a non-transgenic reference cell of the same species. Preferably said cell has altered fatty acid beta-oxidation activity.

i a preferred embodiment of the invention said activity is reduced by at least 10%. Preferably said activity is reduced by between about 10% - 98%. Preferably said activity is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 98%o when compared to a non-transgenic reference cell of the same species.

a preferred embodiment of the invention said cell is transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter which promoter transcribes said nucleic acid molecule to produce an antisense nucleic acid molecule, said sequence selected from the group consisting of: i) a sequence, or part thereof, as represented in Figure 6a; ii) sequences which hybridise to the sense sequence presented in Figure 6a and have of L-3-hydroxyacyl-CoA dehydrogenase activity.

In an alternative preferred embodiment of the invention said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of L-3-hydroxyacyl-CoA dehydrogenase wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

A technique to specifically ablate gene function is through the introduction of double stranded RNA, also referred to as inhibitory RNA (RNAi), into a cell which results in the destruction of mRNA complementary to the sequence included in the RNAi molecule. The RNAi molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The RNAi molecule is typically derived from exonic or coding sequence of the gene which is to be ablated. Only a few molecules of RNAi are required to block gene expression which implies the mechanism is catalytic. The site of action appears to be nuclear as little if any RNAi is detectable in the cytoplasm of cells indicating that RNAi exerts its effect during mRNA synthesis or processing. In a preferred embodiment of the invention said nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of:

i) a nucleic acid sequence, or part thereof, represented by the sequence in Figure

6a; ii) a nucleic acid sequence, or part thereof, which hybridizes to the sequence in

Figureδa and encodes at least part of a L-3-hydroxyacyl-CoA dehydrogenase polypeptide; and iii) a nucleic acid sequence which is degenerate as a result of the genetic code to the sequences in (i) and (ii).

In a further preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.

In a further preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

An alternative embodiment of RNAi involves the synthesis of so called "stem loop RNAi" molecules which are synthesised from expression cassettes carried in vectors. The DNA molecule encoding the stem-loop RNA is constructed in two parts, a first part which is derived from a gene the regulation of which is desired. The second part is provided with a DNA sequence which is complementary to the sequence of the first part. The cassette is typically under the control of a promoter which transcribes the DNA into RNA. The complementary nature of the first and second parts of the RNA molecule results in base pairing over at least part of the length of the RNA molecule to form a double stranded hairpin RNA structure or stem-loop. The first and second parts can be provided with a linker sequence. Stem loop RNAi has been successfully used in plants to ablate specific mRNA's and thereby affect the phenotype of the plant , see, Smith et al (2000) Nature 407, 319-320.

hi a preferred embodiment of the invention said first and second parts are linked by at least one nucleotide base. In a further preferred embodiment of the invention said first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases. In a yet further preferred embodiment of the invention said linker is at least 10 nucleotide bases.

h a further preferred embodiment of the invention the length of the RNA molecule or antisense RNA is between 10 nucleotide bases (nb) and lOOOnb. Preferably said RNA molecule or antisense RNA is lOOnb; 200nb; 30Onb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length. More preferably still said RNA molecule or antisense RNA is at least lOOOnb in length.

More preferably still the length of the RNA molecule or antisense RNA is at least lOnb; 20nb; 30nb; 40nb; 50nb; 60nb; 70nb; 80nb; or 90nb in length.

More preferably still said RNA molecule is 21nb in length.

It will be apparent that the ability to be able to regulate the expression of the MFP2 gene provides the opportunity to regulate the fatty acid beta-oxidation potential of a plant cell and thereby affect both qualitatively and quantitatively lipid content of a plant.

In a further preferred embodiment of the invention said expression cassette is part of a vector. Preferably the nucleic acid in the vector is operably linked to an appropriate promoter or other regulatory elements for transcription in a host plant cell. By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells.

Constitutive promoters include, for example CaMN 35S promoter (Odell et al (1985) 31,3 9810-812); rice actin (McElroy et al (1990) Plant Cell 2: 163-171); ubiquitin (Christian Nature et al . (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.

Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellie et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline- repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by reference. Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al (1996) Plant Physiol. 112(3): 1331-1341; Nan Camp et al (1996) Plant Physiol. 112(2): 525-535; Canevascni et al (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al (1993) Proc. Νatl. Acad. Sci. USA 90(20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.

"Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DΝA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.

In a preferred embodiment the promoter is an inducible promoter or a developmentally regulated promoter. Of particular preference are seed specific promoters.

Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148). Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).

Vectors may also include selectable genetic marker such as those that confer selectable phenotypes such as resistance to herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate). According to a further aspect of the invention there is provided a plant comprising a cell according to the invention.

hi a preferred embodiment of the invention there is provided a plant selected from the group consisting of: com (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium αestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solarium tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Cirrus' spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indicά), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia inter grifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables.

Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea), and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean,sorghum, and flax (linseed).

Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, ornamental plants.

Particularly preferred species are those oil-seed plants which include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Grain plants that provide seeds of interest include leguminous plants. Seeds of interest include grain seeds, such as com, wheat, barley, rice, sorghum, rye, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.

According to a yet further aspect of the invention there is provided a seed comprising a cell according to the invention.

According to a further aspect of the invention there is provided a method to regulate L-3-hydroxyacyl-CoA dehydrogenase activity in a plant comprising the steps of: i) transfecting a plant cell with an expression cassette or vector according to the invention; ii) regenerating said cell into a plant; iii) monitoring L-3-hydroxyacyl-CoA dehydrogenase activity of said plant.

In a preferred method of the invention said plant has altered lipid content. Preferably said plant has elevated long chain fatty acids.

According to a further aspect of the invention there is provided a method to regulate seed germination comprising the steps of: i) providing a seed according to the invention wherein said seed is transformed with at least one regulatable copy of a MFP2 gene; and ii) contacting said plant with a sugar sufficient to rescue said phenotype.

In a preferred method of the invention said sugar is sucrose.

An embodiment of the invention will now be described by example only and with reference to the following Figures and Tables: Figure 1 is a physical map of the mfp2 gene and predicted protein. The 18 exons (E) of the MFP2 gene are shown as black boxes. Locations of primers used for PCR amplification are shown as arrows, LB is the T-DNA left border;. Nucleotide sequence shows terminal 128 nucleotides of exon 9 (in lower case), 21 nucleotides of unidentified sequence (lower case, bold) and 113 nucleotides of adjoining left border T-DNA sequence (uppercase), including the sequence of JL202 (upper case, bold). Primers 1 and 6 were used to demonstrate presence of the wild type allele in the wild- type and heterozygous mfp2 segregate and the absence of the wild type allele in the homozygous mfp2 mutant. Primers 1 and JL202, were used to demonstrate presence of the T-DNA in the homozygous and heterozygous mutant only ; The amino acid sequences show the predicted carboxy-terminal amino acid sequence of MFP2 (upper case) including the putative PTS1 targeting signal (underlined) and the predicted amino acid sequence of mfp2 (uppercase, bold)

Figure 2. RT-PCR on mfp2 2 day old seedling cDNA using the following primer combinations, lane 1, act2a and act2s; lane2, P2 and P3 primers to the hydratase region of MFP2; lane 3, P4 and P5 primers to the dehydrogenase region of MFP2; lane 4, P2 and P5 primers spanning the T-DNA insert in mfp2;

Figure 3. Enzyme activity in wild type and mfp2 seedlings grown on 20 mM sucrose, 0-5 days after imbibition (DAI). (A) 2-trans-enoyl-CoA hydratase (B) L-3- hydroxacyl-CoA dehydrogenase activity. Wild type (•) mfp2 (O). Values are the mean ±SE of measurements made on three separate protein extracts;

Figure 4. Hypocotyl length in 5 day old dark grown wild-type and mfp2 seedlings grown in the absence of sucrose, homozygous (HH);

Figure 5. Fatty acid levels in wild type and mfp2 seedlings grown in 20 mM sucrose, 0-5 days after imbibition (DAI) (A) and leaf tissue. (B) acyl-CoA levels in seedlings 0-5 D.A.I. (C); Figure 6a is the DNA sequence encoding MFP2; Figure 6b is the amino acid sequence of the MFP2 protein; and

Table 1. Targeting of mfp2 hydratase protein to the peroxisome. Values are the mean ±SE of four measurements made on each of three separate protein extracts, from seedlings grown from separate seed batches. The experiment was repeated twice.

Materials and Methods

Mutant Isolation

We screened the T-DNA¹ mutagenized Arabidopsis thaliana (ecotype Wassilewskij a) population at University of Wisconsin-Madison Biotechnology Center http://www.biotech.wisc.edu/Arabidopsis/ (Sussman et al, 2000). Using primers to the MFP2 gene 5'-ATC CTC CCG TCA ATT CTC TAT CCT TCG AC-3' and 5'-GGG AGC GCT CTG TAA TAC AAA TGG AAG AA-3'. The population consists of 60,480 Arabidopsis (ecotype WS) lines (Krysan et al., 1999) transformed with a derivative of T-DNA vector ρD991:pD991-AP3 http://www. dartmouth.edu/~tjack/ - pD991. Sequence flanking the left border of the T-DNA insert was sequenced using the left border primer JL202 5' CATTTTATAATAACGCTGCGGACATCTAC 3'.

Plant material and growth conditions

Seeds were surface sterilised and germinated in continuous light on 0.8% (w/v) agar plates containing half strength Murashige and Skoog media (Murashige and Skoog, 1962) (plus 20 mM sucrose where indicated) at 20°C following four days imbibition at 4°C in the dark. For experiments with etiolated seedlings plates were transferred back to the dark at 20 °C after 1 h exposure to white light. RT-PCR

Total RNA from various tissues was isolated using the RNAeasy isolation kit (Qiagen). CDNA was made using Gibco reverse transcriptase and reagents. For RT- PCR the primers used were act2a 5' -CTT ACA ATT TCC CGC TCT GC- 3'; act 2s 5' -GTT GGG ATG AAC CAG AAG GA- 3*; PI, 5' -ATC CTC CCG TCA ATT CTC TAT CCT TCG AC- 3'; P2, 5' -TTG CTA TGG CTT GTC ATG CT- 3'; P3, 5' - GTG GCA CCA CAG CAT CAA T- 3'; P4, 5' -GATCGAATTGTTGGAGCACA- 3'; P5' -ACACCAAATCCAACCAGGTC -3'; P6, 5' -GGG AGC GCT CTG TAA TAG AAA TGG AAG AA- 3'. PCR conditions were 95oC 2' then 40 cycles of 94oC 15', 30' 60oC and 1' 72oC, followed by 10' at 72oC.

Tissue extraction and sub-cellular fractionation

Tissue extracts for were prepared from approximately 50mg samples of seedlings as described by Hooks et al., (1999). For crude sub-cellular fractionation experiments approximately 200 mg of two-day old seedlings were homogenised in 1.5 ml of a medium containing: 150 Tricine/KOH pH 7.5, 1 mM EDTA, 0.5 M sucrose using a bench top homogeniser (PowerGene 700, Fisher Scientific). The homogenate was centrifuged at 300g for 10 min then the supernatant centrifuged at 30,000g for 30 min and the supernatant and pellet assayed.

Enzyme assays and fatty acid measurement

2-trans-enoyl-CoA hydratase and L-3-hydroxacyl-CoA dehydrogenase were assayed using crotonyl-CoA and acetoacetyl-CoA , respectively, as substrates, according to the method of Binstock and Schulz (1981). Thiolase and ICL according to the method of Cooper and Beevers (1969) with modifications for thiolase as described in Gerhardt (1983). ACX assays were performed according to the method of Hryb and Hogg (1979) using 50 μM acyl-CoAs as substrate. PEPCK was assayed according to the method of Walker at al 1995. Fatty acids were measured using the method of Browse et al., (1986) and acyl-CoAs measured using the method of Larson et al. (2001).

EXAMPLE 1

Genotypic Characterisation

The mφ2 mutant was backcrossed and the FI population shown to segregate 3:1 for kanamycin resistance (data not shown). Sequencing of the left border revealed the T- DNA is situated in an exon 1880bp 3' of the ATG (Figure 1) between the hydratase and dehydrogenase domains. We were unable to sequence the right border using any right border primer. Using RT-PCR, we were able to amplify both the hydratase and dehydrogenase regions 5' and 3' of the T-DNA insert respectively, from mφ2 cDNA (Figure 2). This indicates that the transcript is not truncated in mφ2but continues spanning across the T-DNA insert and the dehydrogenase region.

EXAMPLE 2

Activity of AtMFP2

To investigate whether the mφ2 mutant displayed any alteration in either 2-trans- enoyl-CoA hydratase or L-3-hydroxacyl-CoA dehydrogenase activity, these enzymes were measured in two-day old germinating seedlings. Whilst 2-trans-enoyl-CoA hydratase was unaltered from wild-type levels in the mφ2 mutant, the L-3- hydroxacyl-CoA dehydrogenase activity was greatly decreased (<1% of wild type) Figure 3A and 3B.

EXAMPLE 3

Phenotypic analysis

To investigate if the disruption of the MFP2 gene impaired the germination or post- germinative growth, mφ2 seedlings were grown in the light and dark in the absence of exogenous sucrose. In the light-grown seedlings, germination occurred, with greening of the cotyledons, however, the cotyledons failed to expand and seedling growth arrested 2-3 days after germination. No true leaves were produced. In dark grown mφ2 seedlings, the hypocotyl growth was significantly reduced in the absence of exogenous sucrose (Figure 4). Both light and dark grown mφ2 seedling phenotypes could be rescued by transferring the seedlings to media containing 20 mM sucrose. To determine whether this decrease in post-germinative growth was due to a reduction in lipid breakdown, we measured lipid and acyl CoA levels in germinating mφ2 seedlings, and also in mature leaf tissue. Whilst lipid levels do decrease in the mφ2 seedlings, the rate of lipid catabolism is greatly reduced (Figure 5A). In mature leaf, lipid profiles are altered, with a decrease in 16:0 and increase in C16:3 (Figure 5B). h addition, long-chain acyl-CoAs accumulate in mφ2 seedlings (Figure 5C).

The pedl mutant is disrupted in the thiolase gene of β-oxidation and exhibits enlarged and abnormal peroxisomes in the cotyledons (Germain et al., 2001). To investigate if the ultrastructure in the mφ2 mutant was also perturbed, EM sections were taken through 5-day-old cotyledons of wild type and mφ2 mutants (results not shown).

The compound 2, 4-dichlorophenoxybutyric acid (2, 4 -DB) is converted to the auxin analogue and herbicide 2,4 dichlorophenoxyacetic acid (2,4-D) by β-oxidation. Arabidopsis mutants in β-oxidation genes are compromised in their ability to metabolise 2,4 DB and display resistance to the 2,4 DB precursor. Seedlings of pedl, acx3 and the MFP1 mutant, aiml all show varying levels of resistance to 2,4-DB. hitriguingly,, mfp2 seedlings were no more resistant to 2,4-DB than wild type seedlings (results not shown).

Despite the disruption of the MFP2 gene, which is expressed throughout plant development and is the predominantly expressed MFP2 gene during early-post germinative lipid catabolism, no visible phenotype was observed throughout the life cycle of mφ2 plants.

EXAMPLE 4

Targeting of the truncated MFP2

The MFP2 protein contains a putative PTS1 targeting signal, -SRL, which has been demonstrated to target GFP to the peroxisome (Fransen et at 1999). However, we have demonstrated that both transcript and enzyme activity for the hydratase portion of the MFP2 gene is unaltered from wild-type levels. We investigated whether the hydratase activity was in the peroxisome or cytosol using centrifugation techniques to obtain crude fractions enriched for cytosolic and peroxisomal fractions.

Phosphoenolpymvate carboxykinase (PEPCK) and isocitrate lyase (ICL) activities were used as cytosolic and peroxisomal markers, respectively. As shown in Table 1, 2-trans-enoyl-CoA hydratase activity co-localised with that of ICL indicating that the majority of the truncated mφ2 protein is located in the peroxisome. Whilst the activities of ICL and 2-trans-enoyl-CoA hydratase were unaltered in the mφ2 seedlings, the activity of PEPCK was reduced in the mφ2 mutant to only 53 > of wild type levels. The levels of the β-oxidation enzymes thiolase and ACOX (assayed with C6:0 substrate) were unchanged from wild type levels (results not shown).

References Broun, P., Boddupalli, S. and Somerville, CR. (1998) A bifunctional oleate 12- hydroxylase: desaturase from Lesquerella fendleri. Plant J. 13, 201-210

Browse, J., Mc Court, P.J. and Somerville, CR. (1986) Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue Anal. Biochem. 152, 141-145 Eastmond, PJ. and Graham, LA. (2000) The multifunctional protein AtMFP2 is coordinately expressed with other genes of fatty acid β-oxidation during seed gennination in Arabidopsis fhaliana. Biochem. Soc. Trans. 28, 95-99

Eastmond, P.J., Germain, V., Lange, P.R., Bryce, J.H., Smith, S.M. and Graham, LA. (2O00) Postgerminative growth and lipid catabolism in oilseeds lacking the glyoxylate cycle. Proc. Natl. Acad. Sci. USA 97, 5669-5674

Gerhardt, B. (1985) Substrate specificity of peroxisomal acyl-CoA oxidase Phytochemistry 24, 351 -352

Graham, LA., Smith, L.M., Leaver, C.J. and Smith, S.M. (1990) Developmental regulation of expression of the malate synthase gene in transgenic plants. Plant Mol. Biol. 15, 539-549

Graham LA, Eastmond PJ. (2002) Pathways of straight and branched chain fatty acid catabolism in higher plants. Prog Lipid Res. 41, 156-81

Hayashi, H., De Bellis, L., Ciurli, A., Kondo, M., Hayashi, M. and Nishimura, M. (1999) A novel acyl-CoA oxidase that can oxidize short-chain acyl-CoA in plant peroxisomes. J. Biol. Chem. 274, 12715-12721

Hayashi, H., De Bellis, L., Hayashi, M., Yamaguchi, K., Kato, A. and Nishimura, M. (1998) Molecular characterization of a glyoxysomal long chain acyl-CoA oxidase that is synthesized as a precursor of higher molecular mass in pumpkin. J. Biol. Chem. 273, 8301-8307

Hayashi, H., Toriyama, K., Kondo, M. and Nishimura, M. (1998) 2,4- Dichlorophenoxybutyric acid-resistant mutants of Arabidopsis have defects in glyoxysomal fatty acid beta-oxidation. Plant Cell 10, 183-195 Hooks, M.A., Bode, K. and Couee, I. (1995) Regulation of acyl-CoA oxidases in maize seedlings. Phytochemistry 40, 657-660

Hooks, M.A., Bode, K. and Couee, I. (1996) Higher-plant medium- and short-chain acyl-CoA oxidases: identification, purification and characterization of two novel enzymes of eukaryotic peroxisomal beta-oxidation. Biochem. J. 320, 607-614

Hooks, M.A., Fleming, Y., Larson, T.R. and Graham, LA. (1999) No induction of beta-oxidation in leaves of Arabidopsis that over-produce lauric acid. Planta 207, 385-392

Hooks, M.A., Kellas, F. and Graham, LA. (1999) Long-chain acyl-CoA oxidases of Arabidopsis. Plant J. 19, 1-13

Hryb, D.J. and Hogg, J.F. (1979) Chain length specificities of peroxisomal and mitochondrial β-oxidation in rat liver. Biochem. Biophys. Res. Comm. 87, 1200

Keller, H., Dreyer, C, Medin, J., Mahfoudi, A., Ozato, K. and Wahli, W. (1993) Fatty acids and retinoids control lipid metabolism through activation of peroxisome proliferator-activated receptor-retinoid X receptor heterodimers. Proc. Natl. Acad. Sci. U.S.A. 90, 2160-2164

Kindl, H. (1987) β-oxidation of fatty acids by specific organelles. In The biochemistry of plants, (Stu pf P.K. ed) Academic press, New York, Vol. 9, pp. 31- 50

Krysan PJ, Young JC, Sussman MR. (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell. 11, 2283-90 Lange, P.R., Hooks, M.A., Ahmed, M., Rylott, EX., Eastmond, PJ. and Graham, LA. (1998) in Advances in Plant Lipid Research (Sanchez J., ed) Secretariado de Publicaciones, Universidad de Sevilla, pp. 343-345

Larson TR, Graham IA. Technical Advance: a novel technique for the sensitive quantification of acyl CoA esters from plant tissues. Plant J. 2001 Jan;25(l):l 15-25

Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant. 15, 473-496

Richmond, T.A. and Bleecker, A.B. (1999) A defect in beta-oxidation causes abnormal inflorescence development in Arabidopsis. Plant Cell 11, 1911-1923

Rylott EL, Hooks MA, Graham IA (2001) Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana. Biochem Soc Trans. 29, 283-7

Sussman MR, Amasino RM, Young JC, Krysan PJ, Austin-Phillips S. (2000) The Arabidopsis knockout facility at the University of Wisconsin-Madison. Plant Physiol. 124, 1465-7.

Claims

1. A transgenic plant cell characterised in that the genome of said cell is modified such that the activity of L-3-hydroxyacyl-CoA dehydrogenase is reduced when compared to a non-transgenic reference cell of the same species.

2. A cell according to Claim 1 wherein said cell has altered fatty acid beta- oxidation activity.

3. A cell according to Claim 1 or 2 wherein said activity is reduced by at least 10%.

4. A cell according to Claim 1 or 2 wherein said activity is reduced by between about 10% - 98%.

5. A cell according to Claim 4 wherein said activity is reduced by at least 20%, 30%, 40%, 5O%, 60%, 70%, 80%, 90% or at least 98% when compared to a non- transgenic reference cell of the same species.

6. A cell according to any of Claims 1-5 wherein said cell is transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter which promoter transcribes said nucleic acid molecule to produce an antisense nucleic acid molecule, said sequence selected from the group consisting of: i) a sequence, or part thereof, as represented in Figure 6a; ii) sequences which hybridise to the sense sequence presented in Figure

6a and have of L-3-hydroxyacyl-CoA dehydrogenase activity.

7. A cell according to any of Claims 1-5 wherein said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of L-3-hydroxyacyl-CoA dehydrogenase wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

8. A cell according to Claim 7 wherein said nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid sequence, or part thereof, represented by the sequence in Figure

Figure6a and encodes at least part of a L-3-hydroxyacyl-CoA dehydrogenase polypeptide; and iii) a nucleic acid sequence which is degenerate as a result of the genetic code to the sequences in (i) and (ii).

9. A cell according to Claim 7 or 8 wherein said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.

10. A cell according to Claim 7 wherein said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

11. A cell according to Claim 10 wherein said first and second parts are linked by at least one nucleotide base.

12. A cell according to Claim 11 wherein said first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases.

13. A cell according to Claim 11 wherein said linker is at least 10 nucleotide bases.

14. A cell according to any of Claims 11-13 wherein the length of said RNA molecule is between 10 nucleotide bases (nb) and lOOOnb.

15. A cell according to Claim 14 wherein said RNA molecule is at least lOOnb; 200nb; 300nb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length.

16. A cell according to Claim 11 wherein said RNA molecule is greater than lOOOnb in length.

17. A cell according to Claim 13 or 14 wherein said RNA molecule is at least lOnb; 20nb; 30nb; 40nb; 50nb; 60nb; 70nb; 80nb; or 90nb in length.

18 A cell according to Claim 17 wherein said RNA molecule is 21nb in length.

19. A cell according to any of Claims 7-18 wherein said expression cassette is part of a vector.

20. A plant comprising a cell according to any of Claims 1-19.

21 A seed comprising a cell according to any of Claims 1-19.

22. A method to regulate L-3 -hydroxyacyl-Co A dehydrogenase activity in a plant comprising the steps of: i) a plant cell according to any of Claims 1-19; ii) regenerating said cell into a plant; iii) monitoring L-3 -hydroxyacyl-Co A dehydrogenase activity of said plant.

23. A method according to Claim 22 wherein said plant has altered lipid content.

24. A method according to Claim 23 wherein said plant has elevated long chain fatty acids.

25. A method to regulate seed germination comprising the steps of: i) providing a seed according to Claim 21 wherein said seed is transformed with at least one regulatable copy of a MFP2 gene; and ii) contacting said plant with a sugar sufficient to rescue said phenotype.

26. A method according to Claim 25 wherein said sugar is sucrose.

27. A screening method for the identification an agent with the ability to inhibit plant growth and/or viability comprising the steps of: i) providing a polypeptide encoded by the nucleic acid molecule selected from the following group; a) a nucleic acid molecule represented by the nucleic acid sequence in Figure 6a; b) nucleic acids which hybridise to the sequences of (i) above and which have L-3-hydroxylacyl-CoA dehydrogenase activity; and c) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (a) and (b) above; ii) providing at least one candidate agent; iii) forming a preparation which is a combination of (i) and (ii); iv) determining the interaction of the polypeptide and said candidate agent; and v) testing the effect of the agent on the growth and/or viability of plants.

28. A method according to Claim 27 wherein said polypeptide is encoded the nucleic acid sequence represented by Fig 6a.

29. A method according to Claim 27 wherein said polypeptide is represented by the amino acid sequence in Figure 6b, or active fragment thereof.

30. An agent identified by the screening method according to any of Claims 27- 29.

31. A method for inhibiting the growth of undesired vegetation comprising applying an agent according to Claim 30.

32. The use of a polypeptide, or sequence variant thereof, encoded by the nucleic acid sequence as represented by Figure 6a, as a screening target for the identification of agents which inhibit plant growth and/or viability.