WO2004013070A2 - Multi-step synthesis of templated molecules - Google Patents
Multi-step synthesis of templated molecules Download PDFInfo
- Publication number
- WO2004013070A2 WO2004013070A2 PCT/DK2003/000516 DK0300516W WO2004013070A2 WO 2004013070 A2 WO2004013070 A2 WO 2004013070A2 DK 0300516 W DK0300516 W DK 0300516W WO 2004013070 A2 WO2004013070 A2 WO 2004013070A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- template
- codon
- molecule
- templated
- building block
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
Definitions
- the present invention relates to a method for the manufacture of a library of complexes.
- Each complex in the library comprises a templated molecule attached to the template which directed the synthesis thereof.
- the library of the invention is useful in the quest for new biologicar active compounds, such as drugs.
- the central dogma of biology describes the one-way flow of information from DNA to RNA to protein.
- methods such as phage display, peptides- on-plasmids, ribosome display and mRNA-protein fusion have been developed, allowing the transfer of information from the level of protein/peptide to RNA or DNA.
- This has enabled the use of molecular evolution to be applied on huge numbers of peptides that are exposed to an enrichment process, where after the enriched pool of molecules (enriched for a particular feature, such as binding to receptor protein) are amplified, by exploiting information flow from the peptide to DNA and then amplifying the DNA.
- a partitioning with respect to affinity towards the target is conducted and the identifier oligonucleotide part of the bifunctional molecule is amplified by means of PCR.
- the PCR amplicons are sequenced and decoded for identification of the biochemical polymer.
- Halpin and Harbury have in WO 00/23458 suggested an improvement to the approach stipulated immediately above, wherein the molecules formed are not only identified but also directed by the nucleic acid tag.
- the approach is based on the traditional split-and-combine strategy for synthesis of combina- torial libraries comprising two or more synthetic steps.
- Plurality nucleic acid templates are used, each having at one end a chemical reactive site and dispersed throughout the stand a plurality of codons regions, each of said codon regions in turn specifying different codons.
- each of the strands, identified by a first codon region is reacted at the chemical reaction sites with specific selected reagents.
- the split- and-combine method is conducted an appropriate number of times to produce a library of typically between 10 3 and 10 6 different compounds.
- the split-and-combine method is cumbersome and generates only a relatively small library.
- the present invention aims at obtaining a library of compounds which are not only encoded by a suitable tag attached to each compound, but also directed.
- the directed synthesis of the compounds of the library allows for renewed synthesis of templated molecules following a selection round.
- Fur- thermore the present invention increases the probability of connection of molecular entities eventually appearing in the templated molecule due to a higher local concentration of the reactive groups involved in the formation of the connection.
- the present invention relates to a method for the manufacture of a library of complexes comprising templated molecules, said method comprises the steps of a) providing a plurality of different templates comprising a number of cod- ing regions and a reactive group, wherein each coding region of a specific template specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of a template, and the functional entity comprises at least one reactive group, c) contacting the plurality of different templates with a subset of the plurality of different building blocks, said subset having anti-codons which complement the unique codons of a specific coding region, said con- tacting being performed under conditions which allow specific hybridisation of the anti-codons to the unique codons of the templates, d) reacting the reactive group of the template and the reactive group of the
- the present invention allow for a multi-step templated synthesis of a library of molecules without the need for a laborious and time consuming split step of the traditional split and-mix-method.
- the method furthermore provides for the possibility of bringing the functional entities of building blocks in close proximity, thus allowing facilitated connection of functional entities in the vicinity of each other.
- the bringing in close proximity of building blocks provide for an increased local concentration of the active chemical groups, thus increasing the probability that two reactive groups will be so close that a reaction actu- ally will occur.
- the various templates of the present invention are in general constructed to follow a general scheme.
- a number of coding regions are provided on the template.
- each of the coding regions speci- fies one or more unique codons.
- a specific template comprises a given number of unique codons.
- the plurality of templates can, taken as a whole, be characterized as a library comprising the total amount of the different combinations of unique codons possible, or any subset thereof.
- the coding regions are suitable positioned in a linear sequence, such that the individual coding regions are positioned immediately next to each other. In some embodiments, it may be of advantage to use a branched template to ensure proximity of reactive groups, the introduction of catalysts in the vicinity of the reactive groups or the introduction of as third reactant.
- the templates used in the present invention in- elude a reactive group.
- the reactive group comprised by the template may be covalently or non-covalently attached to the template. Covalent attachment may be preferred when the templated molecule is to be effectively attached to the template, because a covalent bonding will allow affinity selection using more harsh conditions.
- the covalent attachment of the reactive group may be done at a terminal region of the template or at a central region thereof.
- the reactive group is non-covalently attached to the template using a complementing element hybridised to the template. More particularly, it is preferred that the reactive group of the template is part of a building block hybridised to the template.
- the coding regions may be spaced with a suitable spacer region.
- the spacer region may be an indentifier for the coding region of may be a region not carrying any information but serving to bring the functional entities into the desired proximity or to provide the template with a desired physical characteris- tic like a stiff connection of coding regions, or alternative, a flexible connection between two coding regions.
- the template may comprise flanking regions.
- One of the flanking regions can in an aspect of the invention serve to immobilize the template to a surface of a solid support.
- the flanking region can encompasses a signal group, such a flourophor or a radio active group, to allow a direct detection of the presence of the template.
- the plurality of templates used in the present invention may in one embodi- ment be represented by the general formula:
- Coding region 1 through Coding region n independently specifies m unique codons, F and F' are optional flanking regions,
- S 1 to S n are optional spacing groups, n is an integer of at least 2, and m is an integer of at least 1.
- the unique codons of the templates are preferably composed of a sequence of nucleic acid monomers, such as nucleotides. Each codon is unique in the sense that within the same coding region no other codons have an identical sequence and length of nucleic acid monomers. Preferably, a unique codon does not have a corresponding sequence anywhere in the plurality of tem- plates. To avoid hybridisation between individual templates it is also desirable to design each of the unique codons such that the complementary sequence thereof does not exist on any other templates.
- the number of coding regions may be selected in accordance with inter alia the number of the desired final templated compounds, the building blocks available and the envisaged structure of the templated compound. According to the invention the number of coding regions is preferably at least 3 to achieve the desired diversity. The upper limit for the number of coding regions has not yet been elucidated; however it is believed that a number ex- ceeding 100 may give practical problems. Generally, it is preferred to use templates having between 3 and 50 coding regions, more preferably between 3 and 30 and still more preferred between 4 and 15.
- the number of unique codons may be se- lected according to the need for diversity.
- the number of unique codons in each of the coding regions may be similar or different.
- the number of unique codons can be as low as one. This may be the choice when a so-called scaf- fold is involved in the evolving templated molecule.
- the upper limit for the number of unique codons may be chosen quit high as long as specific hybridisation of oligonucleotides of the anti-codons to their complements on the templates occurs.
- An example of an upper limit may be 10,000, but may be chosen below this limit or above according to the need.
- the building blocks essential for the present invention are generally composed of three elements, viz. an anti-codon, a functional entity, and a linker which connects the anti-codon and the functional entity.
- the anti-codon is a sequence of nucleic acid monomers complementary to the sequence of a unique codon on at least one of the plurality of templates.
- building blocks are provided which possesses anti-codons complementing all the unique codons of the variety of templates.
- some of the building blocks carrying anti-codons for selected unique codons are not present. The latter situation may occur when termination of the synthesis is desired at different stages or when the absences of certain functional entities on the templated molecule are desirable.
- anti-codons not associated with any functional entity may be present for steric reasons or to avoid unintended hybridisation events.
- the design of the anti-codons and the complementing unique codons may be aimed at obtaining essentially the same annealing temperature for all or some of the codon:anti-codon hybrids to ensure that all the anti-codons have been annealed to the template before the functional entities are connected to each other through a chemical reaction.
- the annealing temperature of the codon:anti-codon hybrids within the same coding region is designed to have different annealing temperature. The separate reaction may be accompliced by initially raising the temperature above the annealing temperature for all the hybrids and slowly decreasing the tempera- ture until the first set of anti-codons anneal to its templates.
- the temperature is decreased sufficient for allowing an- other building blocks to anneal to a coding region in the vicinity.
- a further design involves annealing temperatures different for each of the coding regions but similar within a specific coding region.
- a connection between the functional entities and the other functional entities or nascent templated molecules is performed.
- a new building block is annealed to the template and a subsequent connection is performed.
- the functional entity of the building block serves the function of being a precursor for the structural entity eventually incorporated into the templated molecule.
- the functional entity is designed to be capable of being connected to a functional entity of another building block or a nascent templated molecule.
- the connection is aided by one or more reactive groups of the functional entity.
- the number of reactive groups which appear on the functional entity is suita- bly one to ten.
- a building block featuring only one reactive group is used i.a. in the end positions of polymers or scaffolds, whereas building blocks having two reactive groups are suitable for the formation of the body part of a polymer or scaffolds capable of being reacted further. Two or more reactive groups intended for the formation of connections, are typically present on scaffolds.
- a scaffold is a core structure, which forms the basis for the creation of multiple variants.
- the variant forms of the scaffold is typically formed through reaction of reactive groups of the scaffold with reactive groups of other building blocks, optionally mediated by fill-in groups or catalysts, under the creation of a connection between the entities.
- the functional entities to be connected to the scaffold may contain one, two or several reactive groups able to form connections.
- linkers are durable during the entire synthesis to ensure the connection between the scaffolded molecule and the template. It is essential for the invention that at least one linker is maintained in order to ensure the coupling of the templated molecule to the template which directed the synthesis thereof. In a final state of the production of the templated molecule the at least one linker emanating from a building block may be substituted by another entity securing the adherence of the template molecule to the tem- plate.
- the durable linkers are preferably cleavable at a final stage to separate the templated molecule from the template or a complementary template. Therefore, the durable linkers may be referred to as selectively cleavable linkers.
- the linkers of the building blocks are also cleavable during the synthesis of the templated molecule, i.e. the functional entity may be released from the building block to allow the synthesis of the templated molecule.
- the linker may be attached to the anti-codon at a central area thereof or at one of the ends.
- the anti-codon and the linker is a contiguous oligonucleotide, i.e. a part of the nucleotide complements a sequence of the template and another part is non-complementing avoiding the hybridisation of the oligonucleotide part to the template.
- This design of the building blocks is a convenient way of design as no separate reaction step is required for the attachment of the linker to the anti-codon.
- the linker is attached to a central part of the anti- codon to allow for the ligation of neighbouring anti-codons using suitable en- zymes to produce a complementary template.
- the linker can be attached to the functional entity according to the functionalities desired.
- the linker is attached to the functional entity through a reactive group capable of forming a connection to another func- tional entity or a nascent templated molecule.
- suitable reactive groups are imine groups (-NH-) and disulfide groups (-S-S-).
- the bonding of the functional entity to the linker can be cleaved simultaneously with the reaction of the inter-spacing reactive group or the cleavage can be performed in a separate step.
- linkers connected to a functional entity through a reactive group which is cleaved simultaneously with the formation of the connection are referred to as translocating linkers.
- Translocating linkers allow for the production of templated polymers, which are connected to the template that directed the synthesis thereof via the terminal building block, when a reactive group on a functional entity in the vicinity reacts to form a connection.
- the separate formation of the connection between a functional entity and another functional entity or evolving templated molecule and the cleavage of the linker is an advantage because more than one connection may be formed prior to the cleavage.
- a subset of the building blocks is contacted with the plurality of templates in the initial phase of the production of the library.
- the subset of the total amount of building blocks is selected to have anti-codons which complement unique codons of a specific coding region on the template. It may be of advantage to have the building blocks in the vicinity of the reactive group of the template. In the event, the reactive group of the template is a part of a building block, it is preferred that the building blocks to be linked together is at- tached in the vicinity of each other to ensure a sufficient proximity of the functional entities.
- the subset comprises building blocks having anti- codons which form hybrids with unique codons in two neighbouring coding regions.
- the subset may be provided by adding the building blocks separately, or alternatively, by adding all the building blocks or a major portion thereof and then direct the annealing of the individual building blocks by proper design of the codon :anti-codon hybrids, as depicted above.
- the conditions which allow specific hybridisation of the unique codons and the anti-codons are influenced by a number of factors including temperature, salt concentration, type of puffer, and acidity. It is within the capabilities of the person skilled in the art to select appropriate conditions to ensure that the contacting between the templates and the building blocks are performed at hybridisation conditions.
- connection between two functional entities usually occurs by a reaction between reactive groups present on each functional entity. It may, however, be desirable to make the bridging between two reactive groups on separate functional entities through a suitable fill-in group. The latter situation may occur, for example, when two similar reactive groups, such as a two amine groups, are not able to react with each other directly.
- the two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings.
- one of the linkers connected thereto may be cleaved. However, this step is optional. It is possible to continue with the incorporation of further building blocks without this cleaving step.
- the connection of the functional entities and the cleavage of one of the linkers occur simultaneously. This aspect of the invention is of particular relevance when the reactive group able to react with another reactive group of a functional entity in the vicinity thereof, is the bridging group to the linker.
- the propagation part of the method is initiated by contacting the plurality of different templates harbouring the nascent templated compound with a further subset of the plurality of building blocks, said subset having anti-codons complementary to the unique codons of a coding region in the vicinity of the coding region(s) harbouring the nascent templated molecules.
- it can be suitable to hybridise the further building blocks to a coding region neighbouring the building block(s) harbouring the nascent templated molecule.
- the subset of building blocks may be provided by adding building blocks separately which hybridise to a specific coding region.
- different stringency conditions combined with appropriate design of the individual codon:anti-codon hybrids can be selected to allow the predominate annealing of a subset of building blocks to selected codon regions.
- the alternative way of forming a subset has the advantage that all or at least a major part of the building blocks can be added to the reaction vessel.
- An example of directing the annealing is to design the first two coding regions such that they have a relatively high annealing temperature, whereas the subsequent building blocks to be annealed have a gradually decreasing annealing temperature.
- the functional entity of the further building block is allowed to form a chemical connection to the nascent templated molecule.
- the formation of the chemical connection normally proceeds by reaction between reactive groups present on the functional entity and the nascent templated molecule, respectively. It may, however, be desirable to make the bridging between two reactive groups through a suitable spacer group. The latter situation may for example occur when two similar reactive groups, such as a two amine groups, are not able to react with each other directly.
- the two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings.
- one or more of the linkers may optionally be cleaved, however ensuring that at least one linker is durable.
- the propagation part of the method may be repeated a desired number of times to evolve the templated molecule. Each repetition of the propagation is initiated by contacting the templated with a new subset of further building blocks.
- the attachment of the templated molecule or the complementary template is different.
- none of the linkers are cleaved during the synthesis, which is when the optional cleavage of linkers of step g) is not performed. This may lead to a templated molecule attached to a number of linker similar to the number of building blocks involved in the synthesis.
- the complexes obtained in step i) comprise templated molecules attached to the template which templated the syntheses thereof via the linker of a single building block.
- the number of linkers may be anywhere between these two extremes in the templated molecule.
- the templated molecule it is of advantage to have more than one linker, e.g. when the conformation of the templated molecule can be stabilized or even altered. In general, it is sufficient for the templated molecule to be attached to the template through a single linker to allow the subsequent enrichment process to proceed efficiently.
- the attachment via a building block involves the use of hydrogen bondings between the codon and the anti-codon to ensure the coupling of the template and the templated molecule. As is well-known within the art, hydrogen bondings are weak bondings that may easily be disrupted.
- the building block finally harbouring the templated molecule may be attached to the template through a codon.anti-codon hybrid having a higher annealing temperature than the other codon:anti-codon hybrids of the template.
- the templated molecule is connected with the template which directed the syntheses thereof via a covalent link.
- the covalent link may be in addition to the hydrogen bondings or the covalent link may be a substitution. The presence of a covalent link allows for a more harsh chemical treatment of the complex.
- the covalent link is selectively cleavable to provide for a separation of the templated molecule from the complementary template.
- the method according to the present invention may involve the further step of cleaving all but one linker after the formation of the templated molecule.
- This further step implies that some or all of the linkers in step g) are not cleaved during the synthesis of the templated molecule.
- the method according to the invention may, as a further step, involve the transfer of the templated molecule to an anchorage point on the template, or a sequence complementing the template, to establish an effective chemical connection between the template and the templated molecule.
- An effective coupling of the templated molecule to the template or a sequence complementary to the template can be desirable to allow for denaturing enrichment conditions or denaturing post-templating modification of the manufactured molecule.
- the anchorage may involve the presence of a reactive group on the templated molecule and a reaction partner on the template, whereby the reaction between these reactive groups will establish a covalent link.
- the anchorage point may be present on a complementary sequence hybridised to the template.
- the complementing sequence has a higher annealing temperature than one or more of the building blocks, notably the terminal building block, to enable usage of a higher stringency during enrichment and , optionally, clearance of used building blocks.
- the anti-codons can, after the cleavage of the linker, remain hybridised to the unique codons or can be detached from the template. When it is chosen to detach the anti-codons, they are preferably cleared from the solution to avoid any re-hybridisation or interference with nucleic acids intended to participate in an hybridisation event.
- the anti-codons following the cleavage of the linker attached thereto remain hybridised to the unique codons because the anti-codons attached to the templates can be ligated together to create a complementary template.
- the ligation of the anti- codons may be performed after all or the majority of building blocks have been incorporated or, in the alternative, the ligation can be performed after the incorporation of each new building block. Furthermore, in some occasions, it may be of advantage to ligate the anti-codons together prior to the cleavage of the linkers.
- the ligation of the all the anti-codons provide a direct covalent link between the complementing template and the templated mole- cule.
- the covalent link is preferably designed to allow the separation of the templated molecule from the complementing template. The separation of the templated molecule will in general during an enrichment process appear as one of the later steps.
- the covalent link is selectively cleavable, i.e. cleavable under certain chemi- cal conditions not used in the prior steps of enrichment.
- the templated molecule is released by the use of enzymes.
- restriction nucleases may be used by the incorporation of a restriction site close to the templated molecule.
- Another example is to use a phos- phodiesterase to perform a total or partly digest of the template or comple- menting template.
- the use of ligation also have another advantage, because it is possible to use anti-codons having a shorter sequence of nucleotides.
- An example of a typically anti-codon will have 15 to 25 nucleotides in sequence to obtain an appropriate annealing temperature of around 40 to 70°C.
- a ligase or a chemical crosslink By ligating building blocks in the vicinity of each other using a ligase or a chemical crosslink, it becomes possible to incorporate very small anti-codons (e.g. 4-10 nucleotides) with high specificity and efficiency.
- the ligation of a small anti-codon to another anti-codon or a complementing template increases the total annealing temperature.
- a result of using smaller anti-codons is that, the local con- centration of functional entities is increased, and therefore, the efficiency of the reaction between the reactive groups becomes more efficient.
- Another way to increase the proximity further is to provide building blocks intended to interact with each other, with a reversible interacting molecule pair.
- the molecule pair allows a building block to form a reversible coupling to another building block in the vicinity thereof through the interaction of the two parts of the pair situated on each building block.
- the molecule pair is also termed a dimerisation domain and is located in the functional entity or is a portion of the linker that is close to the functional entity.
- the dimer- isation domains of two building blocks intended to react with each other are designed to have an affinity to each other. Examples of dimerisation domains include leucine-rich areas, coiled-coil structures, antibody-antigen pairs, complementing sequences of nucleotides, ect.
- the affinity of the dimerisation of two building blocks are preferably lower than the affinity between the codon and the anti-codon to allow for shifting dimerisation partners though performing temperature cycles.
- the dimerisation domains of two building blocks intended to interact are sequences of nucleotides, the length of the sequences may be chosen to obtain an annealing temperature below room temperature but preferably above 5°C, e.g. between 10°C and 20°C.
- the dimerisation domain includes two complementing oligonucleotides, the domain is also referred to as a "zipper box".
- a suitable temperature scheme for the propagation step of the present invention is to add a building block to the template at a temperature above the annealing temperature for said building block.
- the temperature is lowered below the annealing temperature to allow the new building block as well as the building block harbouring the nascent templated molecule to find and bind to their respective parts of the template. Excess building blocks and debris are then preferably washed away. Then the temperature is decreased below the annealing temperature of the dimerisation domain and consequently the probability that the functional entities are connected is increased. Potentially, the conditions in the reaction vessel, other than the temperature, may be changed to provide for the connection. Following the connection between the functional entities/templated molecules, the temperature is raised and the temperature scheme is repeated.
- a method of increasing the proximity further is to apply a "rigid" linker attached to the anti-codon with molecular hinges.
- a result of using a rigid linker is that a smaller three dimensional space is sampled by the functional entity. Thereby the probability is increased that two functional entities in the vicinity of each other and attached to a rigid linker will be close enough to each other for a reaction to proceed.
- a rigid linker may be prepared by various methods available to the skilled person in the art. An example is to use a double stranded oligonucleotide.
- the anti-codon and the linker is performed of a contiguous oligonucleotide, wherein the anti- codon domain of the oligonucleotide is able to hybridise to a unique codon of a template and a suffer domain is able to hybridise to a further oligonucleotide complementary thereto.
- the hinges may be provided by any group allowing essentially unhindered rotation about at least one bonding.
- a hinge may be provided in the above preferred embodiment by separation of the anti- codon domain and the stiffer domain with at least one nucleotide.
- a hinge may be provided by a single stranded region positioned between the double stranded unique codon:anti-codon hybrid and the double stranded rigid linker.
- the template is covalently connected to the complementing template. The connection may be performed by covalently bonding the two hybridised strings to each other.
- the template may at one end be designed with a hair pin loop to enable the ligation of the template end to an anti-codon.
- the templated molecule will be linked to a double stranded template.
- the double stranded template may be an advantage because it is more stable allowing more versatile chemical reactions.
- a library of complexes is obtainable from the above methods.
- the library may be used for a variety of applications, including the search for compounds for use in therapeutic or diagnostic methods and plant protection compounds, like pesticides, fungicides ect.
- the library may comprise any number of complexes according to the invention. At one extreme, the library consists of only two complexes. At the other extreme, the library can consist of up to 10 18 complexes. Usually, the number of complexes is to be selected between these to extremes.
- an enrichment of a library of complexes comprising templated molecules with respect to a predetermined activity comprises the steps of: i) establishing a first library of complexes comprising templated molecules, said library being obtainable according to any of the methods of the invention, ii) exposing the library to conditions enriching the library with complexes having the predetermined activity, iii) amplifying the complexes of the enriched library, iv) optionally, repeating step ii) to iii), and v) obtaining an enriched library having a higher ratio of complexes comprising templated molecules with the predetermined activity.
- the amplification of the complexes of the enriched library comprises the steps of contacting the library of complexes with amplification means, amplifying the templates or the complementing templates, and conducting the method according to the invention using the amplification product as templates.
- the amplification means can be any of the nucleic acid amplification means suitable for the amplification of the template, such as PCR.
- the amplification of the complex comprises a 10 1 to 10 15 -fold amplification.
- the steps ii) and iii) are repeated at least 2, 3, 5 times, such as at least 10 times, such as at least 15 times.
- the complexes may be identified after the completion of each cycle or may be only be identified after the last cycle. There is no explicit need for intermediate identifications as the amplification can be performed without knowing the sequence of the template or a sequence complementing the template, if the template or the complement thereof is provided with suitable primer regions.
- the identification after the enrichment process involves the determination of the sequence of the template and/or the structural determination of the templated molecule and/or the entire complex having the predetermined activity.
- the conditions enriching the library comprise contacting a binding partner to the templated molecules of interest.
- the binding partner may be in solution or may be directly or indirectly immobilised on a support.
- the enrichment is in general performed using an affinity or activity assay.
- the enrichment is conducted by screening for complexes having an affinity for - or an effect on - a target molecule or a target entity.
- the enrichment is conducted by selection for catalytic activity.
- the conditions enriching the library involves any one or more of electrophoretic separation, gelfiltration, immunoprecipitation, isoelectric focusing, centrifugation, and immobilization.
- the enrichment process can involve cells.
- the conditions enriching the library comprises providing cells capable of internalising the templated molecule, or performing an interaction with the templated molecule having the desired predetermined activity.
- the invention also entails to a method for the manufacture of a complex of a templated molecule attached to the template which directed the synthesis thereof, said method comprises the steps of a) providing a template comprising a number of coding regions and a re- active group, wherein each coding region specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of the template, and the functional entity comprises at least one reactive group, c) contacting the template with a building block having an anti-codon which complements the unique codon of a specific coding region, said contacting being per ormed under conditions which allow specific hybridisation of the anti-codon
- the templated molecule can be obtained from the complex by cleaving the linker(s) of the one or more building blocks to release the templated molecule from the template.
- the codons occurring in nature consist of a sequence of three nucleic acid monomers.
- the length of the codon sequence may be of the same order in accordance with the present invention but is preferably longer to obtain a suitable annealing temperature.
- the sequence is selected to produce an annealing temperature above normal room temperature.
- annealing temperature and melting temperature may be used interchangeably said temperature being defined as the maximum of the first derivative of the absorbance vs. temperature curve.
- the different codons need no to be of the same lengths, that is to comprise the same number of nucleic acid monomers. However, a typically number of nucleic acid monomers in the codon sequence is normally above 6 but below 25.
- Each nucleic acid monomer is normally composed of three parts, namely a nucleobase moiety, a sugar moiety and a intemucleoside linker.
- nucleobase moiety may be selected among naturally occurring nucleo- bases as well as non-naturally occurring nucleobases. It should be clear to the person skilled in the art that various nucleobases which previously have been considered “nonnaturally occurring” have subsequently been found in nature. Thus, “nucleobase” includes not only the known purine and pyrimi- dine hetero-cycles, but also heterocyclic analogues and tautomers thereof.
- nucleobases are adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N 6 -methyladenine, 7- deazaxanthine, 7-deazaguanine, N 4 ,N 4 -ethanocytosin, N 6 ,N 6 -ethano-2,6- diamino-purine, 5-methylcytosine, 5-(C 3 -C 6 )-alkynylcytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocy- tosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S.
- nucleobase is intended to cover every and all of these examples as well as analogues and tautomers thereof.
- Especially interesting nucleobases are adenine, guanine, thymine, cytosine, 5-methylcytosine, and uracil, which are considered as the naturally occurring nucleobases in relation to therapeutic and diagnostic application in humans.
- the sugar moiety is suitably a pentose but may be the appropriate part of an PNA.
- Suitable examples of possible pentoses include ribose, 2'-deoxyribose,
- nucleobase is attached to the 1' position of the pentose entity.
- An intemucleoside linker connects the 3' end of preceding monomer to a 5' end of a succeeding monomer.
- the intemucleoside linkage may be the natu- ral occurring phospodiester linkage or a derivative thereof. Examples of such derivatives include phosphorothioate, methylphosphonate, phosphoramidate, phosphotriester, and phosphodithioate.
- the intemucleoside linker can be any of a number of non-phosphorous-containing linkers known in the art.
- Preferred nucleic acid monomers include naturally occurring nucleosides forming part of the DNA as well as the RNA family connected through phos- phodiester linkages.
- the members of the DNA family include de- oxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine.
- the members of the RNA family include adenosine, guanosine, uridine, cytidine, and inosine.
- Each codon is complemented by an anti-codon.
- the anticodon has the ability specifically to engage with the codon which it complements.
- the affinity between the codon and the complementing anti-codon is affected through hydrogen bondings following the well-known Watson-Crick base pairing system.
- the anti-codon may be composed of the same kind of nucleic acid monomers as the codon itself.
- Linkers connecting the anti-codon and functional entity of building blocks may be selected from a variety of possibilities.
- Linkers may include one or more reactive groups in order to obtain a selectively cleavable linker, a cleavable linker, and a translocating linkers.
- Suitable linkers may be selected from but are not limited to, the group comprising: carbohydrides and substituted car- bohydrides; vinyl, polyvinyl and substituted polyvinyl; acetylene, polyacety- lene; aryl/hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl; ethers, polyethers such as e.g.
- polyethylenglycol and substituted polyethers amines, polyamines and substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides and substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides; and polyamides and natural and un- natural polypeptides and substituted polyamides and natural and unnatural polypeptides.
- the functional entity may comprise one or more functional groups, i.e. groups which eventually form part of the templated molecule.
- the templated molecule may comprise one or more of the following functional groups either alone or in combination:
- Drugs e.g., taxol moiety, acyclovir moiety, "natural products"
- Supramolecular structures e.g. nanoclusters
- Oligonucleotides e.g., PNA, LNA, mor- pholinos
- Reactive groups relates among other things to groups which form part of the functional entity and are capable of participating in a reaction that form a connection between two functional entities, either directly or via a suitable bridging molecular entity. Examples of reactive groups are listed below:
- N-carboxyanhydrides NCA
- N-thiocarboxyanhydrides (NTA) 3. Amines
- esters 10.Thioesters 11. conjugated system of double bonds
- UDP-activated saccharides 18.Sulfides 19.Cyanates 20.CarbonylimidazoIe
- alpha-, beta-, gamma-, and omega-peptides Mono-, di- and tri-substituted peptides; L- and D-form peptides; Cyclohexane- and cyclopentane-backbone modified beta-peptides; Vinylogous polypeptides; glycopolypeptides; polyamides; vinylogous sulfonamide peptide; polysulfonamide; conjugated peptide (i.e., having prosthetic groups); polyesters; polysaccharides; polycarbamates; polycarbonates; polyureas; poly-peptidylphosphonates; azatides; peptoids (oligo N-substituted glycines); polyethers; ethoxyformacetal oligomers; poly- thioethers; polyethylene glycols (PEG); polyethylenes; polydisulfides; pol- yarylene sulfides; polynucleotides; PNAs
- Selection or screening, commonly referred to as enrichment, of the library of complexes comprising templated molecules with respect to desired activities may be performed according to any standard proto- col.
- affinity selections may be performed according to the principles used for phage displayed, polysome-displayed or mRNA-protein fusion displayed peptides.
- Selection for catalytic activity may be performed by affinity selections on transition-state analogue affinity columns (Baca et al. , Proc. Natl. Acad. Sci USA. 1997; 94(19):10063-8), or by function-based selection schemes (Pedersen et al., Proc. Natl. Acad. Sci. USA. 1998, 95(18):10523-8).
- Screening for a desired characteristic may be performed according to standard microtiter plate-based assays, or by FACS-sorting assays.
- affinity selections involve the immobilisation of a target or a binding partner on a solid support, such as a column.
- the complex manufactured according to the invention is added to the column under condi- tions allowing a part of the complexes to bind to the target.
- the complexes not bound to the target is eluted out of the column and discharged.
- the part of the complexes attached to the target may be amplified using the template or complementing template associated with the templated molecule.
- oligonucleotides can be amplified by any state of the art method. These methods include, but is not limited to the polymerase chain reaction (PCR); as wells as e.g. nucleic acid sequence-based amplification (e.g. Compton, Nature 350, 91-92 (1991)), amplified anti-sense RNA (e.g. van Gelder et al., PNAS 85: 77652-77656 (1988)); self-sustained sequence replication system (e.g. Gnatelli et al., PNAS 87: 1874-1878 (1990)); polymerase independent amplification as described in e.g.
- PCR polymerase chain reaction
- nucleic acid sequence-based amplification e.g. Compton, Nature 350, 91-92 (1991)
- amplified anti-sense RNA e.g. van Gelder et al., PNAS 85: 77652-77656 (1988)
- self-sustained sequence replication system e
- Ligase-mediated amplification methods may also be used, e.g., LCR (Ligase Chain Reaction).
- non-natural nucleotides the choices of efficient amplification procedures are fewer.
- non-natural nucleotides per definition can be incorporated by certain enzymes including polymerases, it will be possible to perform manual polymerase chain reaction by adding the polymerase during each extension cycle.
- oligonucleotides containing nucleotide analogs For oligonucleotides containing nucleotide analogs, fewer methods for amplification exist. One may use non-enzyme mediated amplification schemes (Schmidt et al., NAR 25: 4797-4802 (1997)). For backbone- modified oligonucleotide analogs such as PNA and LNA, this amplification method may be used. Before or during amplification the templates or complementing templates may be mutagenized or recombined in order to create a larger diversity for the next round of selection or screening.
- the method according to the invention is conducted using the amplification product as the templates.
- the result is a reduced or enriched library of complexes of a template attached to a template molecule.
- the selection and amplification steps may be repeated if considered neces- sary to further enrich the library.
- the binding step involving the target and the complexes is preferably performed under more strict conditions ensuring that only a part of the complexes adhere to the target.
- the enrichment cycles may be performed 2 to 15 times or even more with enrichment in each cycle of 10 to 1000 times.
- the starting library amounts to 10 14 complexes.
- the complex with the highest affinity to the target should, theoretically, be obtained.
- the template contains natural nucleotides
- it is a standard routine to optionally PCR amplify the isolated templates if the template is an RNA molecule, it is necessary to use reverse transcriptase to produce cDNA prior to the PCR-amplification), and then clone the DNA fragments into for example plasmids, transform these and then sequence individual plasmid- clones containing one or multiple tandem DNA sequences.
- Sequencing can be done by the standard dideoxy chain termination method, or by more classical means such as Maxam-Gilbert sequencing.
- the template contains non-natural nucleotides, it may not be feasible to clone individual sequences by transfer through a microbial host.
- bead populations where each bead carries one oligonucleotide sequence, it is possible to clone in vitro, where after all the nucleotides attached to a specific bead may be optionally amplified and then sequenced (Brenner et al., 2000, Proc. Natl. Acad. Sci. USA 97, 1665-1670).
- one may dilute the population of isolates adequately, and then aliquot into microtiter plates so that the wells on average contain for example 0.1 templates.
- By amplifying the single templates by for example PCR it will now be possible to sequence using standard methods. Of course, this requires that the non-natural nucleotides are substrates for the thermostable polymerase used in the PCR.
- the starting template may be designed so as to contain restriction sites on either side of the encoding/templating region of the template.
- the templates can be restricted, to obtain a short oligonucleotide encoding the templated polymer, and then these short oligonucleotides can be applied to various analytical procedures.
- the population of isolates can be sequenced as a whole, to obtain a consensus sequence for the population as a whole.
- the present invention is also directed to approaches that allow selection of small molecules capable of binding to different targets.
- the template- displaying molecule technology contains a built-in function for direct selection and amplification.
- the binding of the selected molecule should be selective in that they only coordinate to a specific target and thereby prevent or induce a specific biological effect.
- these binding molecules should be possible to use e.g. as therapeutic agents, or as diagnostic agents.
- Template-displaying molecule libraries can easily be combined with screen- ings, selections, or assays to assess the effect of binding of a molecule ligand on the function of the target.
- the template-displaying method provides a rapid means for isolating and identifying molecule ligands which bind to supra-molecular, macro-supra-molecular, macro-molecular and low-molecular structures (e.g. nucleic acids and pro- teins, including enzymes, receptors, antibodies, and glycoproteins); signal molecules (e.g. cAMP, inositol triphosphate, peptides, prostaglandins); and surfaces (e.g. metal, plastic, composite, glass, ceramics, rubber, skin, tissue).
- supra-molecular, macro-supra-molecular, macro-molecular and low-molecular structures e.g. nucleic acids and pro- teins, including enzymes, receptors, antibodies, and glycoproteins
- signal molecules
- selection or partitioning in this context means any process whereby the template-displaying molecule complex bound to a target molecule, the complex-target pair, can be separated from template-displaying molecules not bound to the target molecule. Selection can be accomplished by various methods known in the art.
- the selection strategy can be carried out so it allows selection against almost any target. Importantly, no steps in this selection strategy need any detailed structural information of the target or the molecules in the libraries. The entire process is driven by the binding affinity involved in the specific recognition/coordination of the molecules in the library to a given target. However, in some applications, if needed, functionality can also be included analogous to selection for catalytic activity using phage display (Soumillion et al. (1994) J. Mol. Biol. 237: 415-22; Pedersen et al. (1998) PNAS. 18: 10523-10528). Example of various selection procedures are described below.
- This built-in template-displaying molecule selection process is well suited for optimizations, where the selection steps are made in series starting with the selection of binding molecules and ends with the optimized binding molecule.
- the single procedures in each step are possible to automate using various robotic systems. This is because there is a sequential flow of events and where each event can be performed separately.
- a suitable template-displaying molecule library and the target molecule are supplied to a fully automatic system which finally generates the optimized binding molecule. Even more preferably, this process should run without any need of external work outside the robotic system during the entire procedure.
- the libraries of template-displayed molecules will contain molecules that could potentially coordinate to any known or unknown target.
- the region of binding on a target could be into a catalytic site of an enzyme, a binding pocket on a receptor (e.g. GPCR), a protein surface area involved in protein- protein interaction (especially a hot-spot region), and a specific site on DNA (e.g. the major groove).
- the template-displaying molecule technology will primarily identify molecules that coordinate to the target molecule.
- the natural function of the target could either be stimulated (agonized) or reduced (antagonized) or be unaffected by the binding of the template-displaying molecules. This will be dependent on the precise binding mode and the par- ticular binding-site the template-displaying molecules occupy on the target.
- the template-displaying molecule technology of the invention will permit selection procedures analogous to other display methods such as phage dis- play (Smith (1985) Science 228: 1315-1317). Phage display selection has been used successfully on peptides (Wells & Lowman. (1992) Curr. Op. Struct. Biol. 2, 597-604) proteins (Marks et al. (1992) J. Biol. Chem. 267: 16007-16010) and antibodies (Winter et al. (1994) Annu. Rev. Immunol. 12: 433-455). Similar selection procedures are also exploited for other types of display systems such as ribosome display (Mattheakis et al. (1994) Proc. Natl. Acad. Sci.
- the template-displaying molecule technology of the invention will for the first time allow direct selection of target-specific small non-peptide molecules independently of the translation process on the ribosome complex.
- the necessary steps included in this invention are the amplification of the templates and incorporation and reaction of the monomer building blocks. The amplification and incorporation and the incorporation and reaction are either done in the same step or in a sequential process.
- the linkage between the templated molecule (displayed molecule) and DNA replication unit (coding template) allows a rapid identification of binding molecules using various selection strategies.
- This invention allows a broad strategy in identifying binding molecules against any known target.
- this technology will also allow discovery of novel unknown targets by isolating binding molecules against unknown antigens (epitopes) and use these bind- ing molecules for identification and validation (see section "Target identification and validation").
- selection of binding molecules from the template- displaying molecule libraries can be performed in any format to identify optimal binding molecules.
- a typical selection procedure against a purified target will include the following major steps: Generation of a template-displaying molecule library: Immobilization of the target molecule using a suitable immobilization approach; Adding the library to allow binding of the template- displayed molecules; Removing of the non-binding template-displayed molecules; Elution of the template-displayed molecules bound to the immobilized target; Amplification of enriched template-displaying molecules for identification by sequencing or to input for the next round of selection.
- the general steps are schematically shown in Figure 27.
- a standard selection protocol using a template- displaying molecule library is to use the bio-panning method.
- the target e.g. protein or peptide conjugate
- the template-displayed molecules that potentially coordi- nate to the target are the ones that are selected and enriched.
- the selection procedure requires that the bound template-displayed molecules can be separated from the unbound ones, i.e. those in solution. There are many ways in which this might be accomplished as known to ordinary skilled in the art.
- the first step in the affinity enrichment cycle (one round as described in Figure 27) is when the template-displayed molecules showing low affinity for an immobilized target are washed away, leaving the strongly binding template- displayed molecules attached to the target.
- the enriched population remain- ing bound to the target after the stringent washing, is then eluted with, e.g. acid, chaotropic salts, heat, competitive elution with the known ligand or proteolytic release of the target/template molecules.
- the eluted template- displayed molecules are suitable for PCR, leading to many orders of amplification, i.e. every single template-displayed molecule enriched in the first selection round participates in the further rounds of selection at a greatly increased copy number.
- Immobilisation of the target (peptide, protein, DNA or other antigen) on beads might be useful where there is doubt that the target will adsorb to the tube (e.g. unfolded targets eluted from SDS-PAGE gels).
- the derivatised beads can then be used to select from the template-displaying molecules, simply by sedimenting the beads in a bench centrifuge. Alternatively, the beads can be used to make an affinity column and the template-displaying libraries suspension recirculated through the column.
- There are many reactive matrices available for immobilizing the target molecule including for instance attachment to -NH 2 groups and -SH groups.
- Magnetic beads are essentially a vari- ant on the above; the target is attached to magnetic beads which are then used in the selection.
- Activated beads are available with attachment sites for -NH 2 or -COOH groups (which can be used for coupling).
- the target can be also be blotted onto nitrocellulose or PVDF. When using a blotting strategy, it is important to make sure the strip of blot used is blocked after immobilization of the target (e.g. with BSA or similar protein).
- the selection or partitioning can also be performed using for example: Immunoprecipitation or indirect immunoprecipitation were the target molecule is captured together with template-displaying binding molecules; affinity column chromatography were the target is immobilized on a column and the template-displaying libraries are flowed through to capture target-binding molecules; gel-shift (agarose or polyacrylamide) were the selected template-displaying molecules migrate together with the target in the gel; FACS sorting to localize cells that coordinates template-displaying molecules; CsCI gradient centrifugation to isolate the target molecule together template-displaying binding molecules; Mass spectroscopy to identify target molecules which are labelled with template-displaying molecules; etc., without limitation. In general, any method where the template-displaying molecule/target complex can be separated from template-displaying molecules not bound to the target is useful.
- Table 1 Examples of selection method possible to use to identify binding molecules using the template-displaying technology.
- Soluble receptors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
- Enzyme inhibitors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
- Elution of template-displayed molecules can be performed in different ways.
- the binding molecules can be released from the target molecule by denatu- ration, acid, or chaotropic salts and then transferred to another vial for amplification.
- the elution can be more specific to reduce the background.
- Elution can be accomplished using proteolysis to cleave a linker between the target and the immobilizing surface or between the displaying molecule and the template.
- elution can be accomplished by competition with a known ligand.
- the PCR reaction can be performed directly in the washed wells at the end of the selection reaction.
- a possible feature of the invention is the fact that the binding molecules need not be elutable from the target to be selectable since only the encoding template DNA is needed for further amplification or cloning, not the binding molecule itself. It is known that some selection procedure can bind the most avid ligands so tightly as to be very difficult to elute. However the method of the invention can successfully be practiced to yield avid ligands, even covalent binding ligands.
- Alternative selection protocol includes a known ligand as fragment of each displayed molecule in the library. That known ligand will guide the selection by coordinate to a defined part on the target molecule and focus the selection to molecules that binds to the same region. This could be especially useful for increasing the affinity for a ligand with a desired biological function but with a too low potency.
- a further aspect of the present invention relates to methods of increasing the diversity or complexity of a single or a mixture of selected binding molecules.
- the enriched molecules can be altered to further increase the chemical diversity or complexity of the displayed molecules. This can be performed using various methods known to the art. For example, using synthesized randomized oligonucleotides, spiked oligonucleotides or random mutagenesis. The randomization can be focused to allow preferable codons or localized to a predetermined portion or sub-sequence of the template nucleotide sequence.
- the cells particle themselves can be used as the selection agent.
- cells lacking the specific target should be used to do one or more rounds of negative selection or be present in large excess in the selection process.
- irrelevant template-displayed molecules are removed.
- the negative selection would be against the untransformed cells.
- This approach is also called subtraction selection and has successfully been used for phage display on antibody libraries (Hoogenboom et al. (1998) Immunotech. 4: 1-20).
- a specific example of a selection procedure can involve selection against cell surface receptors that become internalized from the membrane so that the receptor together with the selected binding molecule can make its way into the cell cytoplasm or cell nucleus. Depending on the dissociation rate constant for specific selected binding molecules, these molecules largely reside after uptake in either the cytoplasm or the nucleus.
- the selection process can be performed in any setup where the target is used as the bait onto which the template-displaying molecules can coordinate.
- the selection methods of the present invention can be combined with secondary selection or screening to identify molecule ligands capable of modifying target molecule function upon binding.
- the methods described herein can be employed to isolate or produce binding molecules which bind to and modify the function of any protein or nucleic acid.
- the method of the present invention can be employed to identify, isolate or produce binding molecules which will affect catalytic activity of target enzymes, i.e., inhibit catalysis or modifying substrate binding, affect the functionality of protein receptors, i.e., inhibit binding to receptors or modify the specificity of binding to receptors; affect the formation of protein multimers, i.e., disrupt quaternary structure of protein subunits; and modify transport properties of protein, i.e., disrupt transport of small molecules or ions by proteins.
- a still further aspect of the present invention relates to methods allowing functionality in the selection process can also be included. For example, when enrichment against a certain target have been performed generation a number of different hits, these hits can then directly be tested for functionality (e.g. cell signalling). This can for example be performed using fluorescence- activated cell sorting (FACS).
- FACS fluorescence- activated cell sorting
- the altered phenotype may be detected in a wide variety of ways.
- the changed phenotype is detected using, for example: microscopic analysis of cell morphology; standard cell viability assays, including both increased cell death and increased cell viability; standard labelling assays such as fluorometric indicator assays for the presence of level of particular cell or molecule, including FACS or other dye staining techniques; biochemical de- tection of the expression of target compounds after killing the cells; etc.
- standard labelling assays such as fluorometric indicator assays for the presence of level of particular cell or molecule, including FACS or other dye staining techniques
- biochemical de- tection of the expression of target compounds after killing the cells etc.
- specific signalling pathways can be probed using various reporter gene constructs.
- Secondary selection methods that can be combined with template-displaying molecule technology include among others selections or screens for enzyme inhibition, alteration or substrate binding, loss of functionality, disruption of structure, etc. Those of ordinary skill in the art are able to select among various alternatives of selection or screening methods that are compatible with the methods described herein.
- the binding molecules of the invention can be selected for other properties in addition to binding, For example, during selection; stability to certain conditions of the desired working environment of the end product can be included as a selection criterion. If binding molecules which are stable in the presence of a certain protease is desired, that protease can be part of the buffer medium used during selection. Similarly, the selection can also be performed in serum or cell extracts or any type of media. As will be understood, when util- izing this template-displaying approach, conditions which disrupt or degrade the template should be avoided to allow amplification. Other desired properties can be incorporated, directly into the displaying molecules as will be understood by those skilled in the art. For example, membrane affinity can be included as a property by employing building blocks with high hydrophobicity.
- Molecules selected by the template-displaying molecule technology can be produced by various synthetic methods. Chemical synthesis can be accomplished since the structure of selected binding molecules is readily obtained form the nucleic acid sequence of the coding template. Chemical synthesis of the selected molecules is also possible because the building blocks that compose the binding molecules are also known in addition to the chemical reactions that assemble them together.
- the selected binding molecules is synthesized and tested in various appropriate in vitro and in vivo testing to verify the selected candidates for biological effects and potency. This may be done in a variety of ways, as will be appreciated by those in the art, and may depend on the composition of the bioactive molecule.
- the present invention provides methods to identify or isolate targets that are involved in pathological processes or other biological events.
- the target molecules are again preferably proteins or nucleic acids, but can also include, among others, carbohydrates and various molecules to which specific molecule ligand binding can be achieved.
- the template-displaying molecule technology could be used to select for specific epitopes on antigens found on cells, tissues or in vivo. These epitopes might belong to a target that is involved in important biological events. In addition, these epitopes might also be involved in the biological function of the target. Phage display with antibodies and peptide libraries has been used numerous times successfully in identifying new cellular antigens, (e.g. Pasqualini et al.
- the stability of the template in vivo will be important for amplification and identification.
- the template can be stabilised using various nucleotide derivatives in a similar way as have been used to stabilise aptamers for in vivo applications (Nolte (1996) Nature Biotechnol. 14: 1116-1121; Pagratis et al. (1997) Nature Biotechnol. 15: 68-72).
- nolte (1996) Nature Biotechnol. 14: 1116-1121; Pagratis et al. (1997) Nature Biotechnol. 15: 68-72).
- Other types of protection are also possible where the template molecule is shielded for the solution using various methods. This could include for example liposomes, pegylation, binding proteins or other sorts of protection.
- the template molecule could also be integrated into another designed structure that protects the template form external manipulation.
- the linker can be design to be incorporated in vesicles to position the templates inside the vesicle and the displaying molecules on the outside. The arrangement will protect the template molecules from external manipulate and at the same time allow exposure of the displaying molecules to permit selection.
- the antibody molecule is a large macromolecule (150 KDa) which will sterically reduce the access for a number of different antigens (e.g. on a cell surface).
- the template-displaying technology should be able to access and recognize epitopes inaccessible to antibodies.
- the small binding molecules will be able to bind into active sites, grooves and other areas on an antigen.
- the coding template element is also smaller that an antibody which will increase the physical access of the template-binding molecule par.
- the diversity and complexity of the template-displaying molecule libraries will be much greater compare to peptide libraries.
- the template-displaying molecule technology has the potential to identify novel antigens which is not possible to identify with antibodies or peptides.
- One of ordinary skill in the art will acknowledge that various types of cells can be used in the selection procedure. It will also be understood that the selection for new antigens can be performed using subtraction methods as described previously.
- Another aspect of the present invention relates to methods to validate the identified target.
- the identified binding molecules can directly be used if they change the biological response of the target. This can be done either in vitro using any direct or cell-based assay or directly in vivo studying any phenotypic response. The strength of this approach is that the same molecules are used both for identification and validation of various targets. Most favourable, the binding molecules could also directly be used as therapeutic agents.
- the template-displaying molecules are used to pull out the target molecules. This can for instance be achieved by selection against a cDNA library expressed on bacteriophage (libraries vs. libraries). By mixing a template-displaying molecule library with a cDNA library it will be possible to find binding pairs between the small molecules in the template-displaying molecule library and proteins from the cDNA library.
- One possibility is to mix a phage display library with a template display library and do a selection for either the phage or template library. The selected library is then plated to localized phage clones and the DNA coding for the phage and template displayed molecules can then be identified using PCR.
- Other types of libraries than cDNA could also be used such as nucleic acids, carbohydrates, synthetic polymer.
- the template-displaying molecule technology can be used to account for in vivo and in vitro drug metabolism. That could include both phase I (activation) and phase II (detoxification) reac- tions.
- the major classes of reactions are oxidation, reduction, and hydrolysis.
- Other enzymes catalyze conjugations. These enzymes could be used as targets in a selection process to eliminate displayed molecule that are prone to coordinate to these enzymes.
- the templates corresponding to these displayed molecules could subsequently be used to compete or eliminate these molecules when making template-displaying molecule libraries. These obtained libraries will then be free of molecules that will have a tendency of binding to enzymes involved in phase l-ll and possible be faster eliminated.
- cytochrome P450 enzymes flavin monooxygenase, monoamine oxidase, esterases, amidases, hydrolases, reductases, dehydrogenases, oxidases UDP-glucuronosyltransferases, glutathione S-transferases as well as other relevant enzymes could be performed to identify these binding molecules that are prone to coordinate to these metabolic enzymes.
- Inhibitors are easily selected for due to their binding affinity but substrates need at least micro molar affinity to be identified.
- Another interesting embodiment of this invention is the possibility to directly select for molecules that passively or actively becomes transported across epithelial plasma membrane, or other membranes.
- One possible selection assay is to use CaCO-2 cells, a human colon epithelial cell line, which is general, accepted as a good model for the epithelial barrier in the gastroin- testinal guts.
- the CaCO-2 assay involves growing a human colon epithelial cell line on tissue culture well inserts, such that the resultant monolayer forms a biological barrier between apical and basolateral compartments.
- the template-displaying molecule libraries are placed either side of the cell monolayer and the molecules that can permeate the cell monolayer is col- lected and amplified. This process can be repeated until active molecules have been identified.
- Other cell line or setup of this assay is possible and is obvious for skill in the art.
- a still further aspect of the present invention relates methods of selecting for stability of the selected molecules. This could be performed by subjecting an enriched pool of binding molecules to an environment that will possibly degrade or change the structure of the binding molecules.
- Various conditions could be certain proteases or a mixture of protease, cell extract, and various fluids from for example the gastrointestinal gut. Other conditions could be various salts or acid milieu or elevated temperature.
- Another possibility is to generate a library of known ligands and subject that library to stability tests and selection to identify stable molecules under certain conditions as describe above.
- the template-displaying molecule technology of the invention may be used for blocking or stimulating various targets.
- a therapeutically relevant target is a substance that is known or suspected to be involved in a regulating process that is malfunctioning and thus leads to a disease state. Examples of such processes are receptor-ligand interaction, transcription-DNA in- teraction, and cell-cell interaction involving adhesion molecules, cofactor- enzyme interaction, and protein-protein interaction in intracellular signalling.
- Target molecule means any compound of interest for which a molecule ligand is desired.
- target can, for example, include a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds, a biological macromolecule, such as DNA or mRNA, a bacteriophage peptide display library, a ribosome peptide display library, an extract made from biological materials such as bacteria, plants, fungi, or animal (e.g. mammalian) cells or tissue, protein, fusion protein, peptide, enzyme, receptor, receptor ligand, hormone, antigen, antibody, drug, dye, growth factor, lipid, substrate, toxin, virus, or the like etc., without limitation.
- Other examples of targets include, e.g. a whole cell, a whole tissue, a mixture of related or unrelated proteins, a mixture of viruses or bacterial strains or the like, etc., without limitation.
- Therapeutic drug targets can be divided into different classes according to function; receptors, enzymes, hormones, transcription factors, ion channels, nuclear receptors, DNA, (Drews, J. (2000) Science 287:1960-1964).
- receptors, nuclear receptors, and metabolic enzymes constitute overwhelmingly the majority of known targets for existing drugs.
- G Protein-Coupled Receptors (GPCR) constitutes one of the most important classes of drug targets together with proteases for pharmacological intervention.
- the present invention employing the template-displaying molecule technology can be utilized to identify agonists or antagonists for all these classes of drug targets, dependent on the specific properties each target holds. Most of the targets are possible to obtain in a purified form for direct selection procedures. Other targets have to be used when they are in their native environments such as imbedded cell surface receptors. In those situations the selec- tion using the template-displaying molecule libraries can be performed using subtraction-selection described previously.
- One specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as antagonists, where the molecules block the interaction between a receptor and one or more ligands.
- Another application includes cell targeting.
- the generated molecules recognizing specific surface proteins or receptors will be able to bind to certain cell types.
- Such molecules may in addition carry another therapeutic agent to increase the potency and reduce the side- effects (for example cancer treatment).
- Applications involving antiviral agents are also included.
- a generated molecule, which binds strongly to epitopes on the virus particle may be useful as an antiviral agent.
- Another specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as agonists, where the molecules stimulate or activate a receptor to initiate a cellular signalling pathway.
- Fig. 1 shows the general principle for one embodiment of the present inven- tion for the multi-step synthesis of templated molecules.
- Fig. 2 shows the general structure of templates useful in the generation of a library.
- Fig. 3 shows an example of design of templates fro the generation of a library.
- Fig. 4 shows examples of building blocks for use in the preparation of a library of templated molecules.
- Fig. 5 shows further examples of building blocks.
- Fig. 6 shows examples of the preparation of building blocks.
- Fig. 7 shows examples of the preparation of building blocks starting from a 5'-NH 2 derivatized oligonucleotide.
- Fig. 8 shows a general procedure of performing one embodiment for the for- mation of the templated molecule.
- Fig. 8 shows an example of the embodiment shown in Fig. 8 involving light induced reaction between symmetrical building blocks.
- Fig. 9 shows a general procedure of performing one embodiment for the formation of the templated molecule.
- Fig. 10 shows a general procedure of performing one embodiment of the invention for the formation of a mixed polymer templated molecule.
- Fig. 10, example 1 shows examples of simultaneous reaction and cleavage of neighbouring of functional entities for the formation of (A) and alpha- peptide and (C) a polyamine.
- Fig. 10, example 2 shows examples of simultaneous reaction and cleavage of neighbouring functional entities for the formation of (A) a peptoid, or an ⁇ - or ⁇ -peptide, and (B) a hydrazino peptide.
- Fig. 11 depicts a templated synthesis of a polymer, using non-simultaneous reaction and cleavage.
- Fig. 12 depicts formation of a templated molecule due to activation of reactive groups and partly release of the templated molecule for the template by ring-opening.
- Fig. 13 shows the connection of two functional entities by the fill-in of connecting moiety.
- Fig. 13, example 1 discloses an exemplification of Fig. 13, in which an imine is formed by a fill-in reaction.
- Fig. 13, example 2 shows an exemplification of Fig. 13, in which an amide is formed.
- Fig. 13, example 3 shows an exemplification of Fig. 13, in which an urea bonding is formed.
- Fig. 13, example 3.1 shows an exemplification of Fig. 13 in which functional entities 13.3.1.A and 13.3.1. B are synthesised.
- Fig. 13, example 4 shows the formation of chiral and achiral templated molecules.
- Fig. 13, example 5 shows the formation of a phosphodiester bond by symmetric fill-in.
- Fig. 13, example 6 shows the formation of a phosphodiester bond by a fill-in reaction, wherein the building block comprises a single reactive group.
- Fig. 13, example 7 shows a pericyclic fill-in reaction.
- Fig. 13, example 7.1 shows an exemplification of Fig. 13 in which functional entities 13.7.1. A and 13.7.1.B are synthesised.
- Fig 14 shows a schematic representation of a fill-in reaction using asymmetric monomers.
- Fig. 14, example 1 shows an asymmetric fill-in reaction using modified Staudinger ligation and ketone-hydrazide reaction.
- Fig. 15 shows a schematic representation of a templated synthesis of a non- linear molecule.
- Fig. 16 shows a representation of the templated synthesis of a non-linear molecule employing reactive groups of different classes and non- simultaneous reaction and cleavage.
- Fig. 17 depicts a templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold.
- Fig. 18 shows examples of the templated synthesis of non-linear molecules.
- Fig. 19 shows a schematic representation of a templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.
- Fig. 20 shows examples of various reactions types allowing simultaneous reaction and cleavage.
- Fig. 21 shows examples of pairs of reactive groups (X) and (Y), and the resulting bond (XY).
- Fig. 22 shows a schematic representation (panel A) of the zipper box principle and an example (panel B) of two building block.
- Fig. 23 shows a schematic representation of various methods for increasing the proximity of functional entities of different building blocks.
- Fig. 24 shows examples of the chemical constitution of a linker to be able to be cleaved.
- Fig. 25 schematically shows the templated synthesis by generating a new reactive group.
- Fig. 25, example 1 shows a method in which reactive groups generated in a first round subsequently are reacted with introduced reactive groups.
- Fig. 26 shows examples of post-templating modifications of the templated molecule.
- a long horizontal line symbolizes a template.
- Coding region 1 symbolizes sequences that anneal to type 1 building blocks. Building blocks are symbolized as shown in figures 4-7.
- X/Y, S/T and P/Q represent pairs of reactive groups (where the reactive groups of one pair (e.g. X and Y) are partly or fully orthogonal to the reactive groups of other pairs (e.g. S/T, P/Q)).
- R-i, R 2 , .., R x symbolize functional groups.
- L and Li, L 2 , L 3l ... represent cleavable linkers, where linkers of one group (e.g., Li-linkers) are cleavable under conditions where linkers of other groups (L 2 , L 3 , .7) are not cleaved, or are cleaved less efficiently.
- linkers of one group e.g., Li-linkers
- linkers of other groups L 2 , L 3 , .
- the proximity effect that results from incorporating two building blocks on the same template, or alternatively, as a result of incorporating a building block on a template to which is attached a reactive group, may be enhanced by any of the methods described above or below that increases this effect.
- the proximity effect may be increased by the introduction of zipper boxes in most of the general concepts described here.
- the templated molecule may be coupled to the template through the non-covalent interaction of a monomer building block with the template, or alternatively, through covalent or non-covalent coupling to the template, and may be located at either of the ends of the template, or anywhere on the template.
- the coupling reaction to the template may be performed before, during or after the synthesis of the templated molecule. For clarity, in some of the figures only the reaction step, not the cleavage step, has been included.
- Fig. 1 The protocol for an embodiment of a multi-step templated synthesis is shown in Fig. 1 and involves a number of steps that each result in the addition of one or more molecular moieties to a growing molecule that eventually be- comes the templated molecule. Each of these steps can be divided into sub- steps.
- a number of templates also called a library of templates
- Each of the templates comprises a plurality of unique codons and a reactive group.
- a plurality of different building blocks are provided, each of the building blocks comprises a functional entity separated from an anti- codon with a suitable linker.
- the anti-codon of a specific building block complements a unique codon of a template and is, therefore, capable under proper hybridisation conditions to anneal to the unique codon.
- the incorporation of building blocks is initiated by contacting the plurality of different templates with a subset of the entire amount of building blocks.
- the subset car- ries anti-codons which hybridise to unique codons of a distinct coding region.
- a connection between the reactive group of the template and the functional entity of the building blocks is obtained.
- the reactive group of the template is part of a building block (building block 1) and the said building block is hybridised to the template.
- the building block 1 comprising the reactive group of the template and the second build- ing block are contacted with the template simultaneously to allow for an efficient connection between the functional entities.
- the line between FEi and FE 2 symbolise a direct connection between the functional entities or an indirect connection via a bridging molecule entity.
- the molecule part formed by a connection of FEi to FE 2 is a nascent templated molecule, which may be added further functional entities resulting in a growing nascent templated molecule.
- the propagation part of the method starts with the incorporation of a further building block (building block 3).
- the incorporation involves the hybridisation of a subset of the building blocks to the plurality of templates bearing the nascent templated molecule.
- the subset of building blocks is selected to have anti-codons which complement unique codons of the templates, said unique codons being in the vicinity of, preferably neighbouring to, unique codons hybridised to the building block(s) bearing the templated molecule.
- the functional entity of the further building block is able to form a chemical connection to the nascent templated molecule through the reaction of a reactive group attached to the functional entity.
- the linkage between one or more of the functional entities and the corresponding anti-codons may be cleaved if desired and the incorporation of a new building block may be performed.
- the propagation step may be conducted as many times as appropriate to obtain the desired templated compound.
- the linkers connecting functional entities/templated molecule and anti-codons may be cleaved.
- the complex comprising the templated molecules (specific compositions or sequences of molecular moieties, the identity of which is determined by the template) attached to the templates that templated their synthesis, can now be taken through a screening process. This process leads to an enrichment of templated molecules complexes with appropriate characteristics.
- the isolated complexes may now be enriched by amplification of the templates, and a new round of templated synthesis and screening can be performed.
- the templated molecules may be identified by characterization of the corresponding templates.
- the stages of the process involving incorporation of building blocks may be mediated by chemicals, or enzymes such as polymerase or ligase.
- the anti-codon part of the building blocks may be nucleotide- derivatives that are incorporated by a polymerase. Incorporation may also be solely by hybridization of building blocks to the template.
- the template is a DNA molecule
- the template may comprise primer binding sites at one or both ends (allowing the amplification of the template by e.g. PCR).
- the remaining portion of the templates may be of random or partly random sequence.
- the reaction stage of the method involves reactions between the incorporated building blocks, thereby forming chemical connections between the functional entities.
- the chemical connection can be a direct chemical bond or the connection can be established through a suitable bridging molecule.
- the optional cleavage step involves cleaving some, all but one, or all of the linkers that connect the functional entities and anti-codons.
- Fig. 1 the templated molecule is displayed by cleaving the linkers of the second and third functional entities, while maintaining the linker from the first building block.
- a selection is performed.
- the selection or screening involves enriching the population of template-templated molecule pairs for a desired property. For example, passing a library of templated molecule-template complexes over a solid phase to which a protein target has been immobilized, and washing unbound complexes off, will enrich for complexes that are able to bind to the protein.
- the selection may be performed more than once, for example with increasing stringency. Between each selection it is in general preferable to perform an amplification.
- the amplification involves producing more of the template- templated molecule complexes, by amplification of the template or complementing template, and producing more of the template-templated molecule pairs, for further rounds of selection/screening, or for sequencing or other characterization.
- the template is a DNA strand
- the template may be amplified by PCR, where after the templated synthesis can be performed using the amplified DNA, as described above.
- Cloning and sequencing may also be useful techniques and involve the cloning of the isolated templates or complementing templates, followed by characterization. In some cases, it may be desirable to sequence the population of isolated templates or complementing templates, wherefore cloning of individual sequences is not required.
- Fig. 2 in the upper part of the figure, the general structure of a template is shown.
- the templates comprise x coding regions. Each coding region has a unique sub-structure which differentiates it from some or all of the other coding regions.
- Shown below the general structure of a template are specific templates.
- a given specific template carries a specific set of x unique codons.
- a unique codon specifies (by way of interaction with a specific anticodon of a building block) a specific functional entity.
- coding region 1 sequences are all examples of coding region 1 sequences.
- the general design of the templates therefore enables the templated incorporation of building blocks, in the sense that a sub-set of building blocks can be added that will only be incorporated at the same position on the template (i.e., coding region 1 if the building blocks have anti-codons that are complementary to the unique codons of codon region 1).
- Fig. 3 Shows an example of a design of templates and anti-codons for oligonucleotide-based building blocks.
- Section A discloses the general structure of a set of templates carrying 6 coding regions, each containing a partly random sequence (X specifies either C or G), and a constant sequence that is identical for all sequences in the group (e.g., all coding region 1 sequences carries a central ATATTT sequence).
- C and G only or, alternatively, A and T only
- the building blocks that are complementary to coding regions 1 have very similar annealing temperatures wherefore mis- annealing is insignificant.
- the attachment point of the linker that connects the anti-codon and the functional entity is not specified in the figure. Ideally, the linker is attached to the constant region of the anti-codon, in order to avoid bias in the annealing process.
- Section B of Fig. 3 shows examples of codon and anti-codon sequences.
- Example codon 1 and codon 6 sequences are shown.
- the example codon 1 sequence represents one specific sequence out of 1024 different sequences that anneal specifically to the complementary anti-codon 1 sequences;
- the example codon 6 sequence represents one specific sequence out of 128 different sequences that anneal to the complementary anti-codon 6 sequences.
- FIG. 4 illustrates different general designs of building blocks.
- a building block comprises or essentially consists of a functional entity, connected through a (cleavable) linker to an anti-codon.
- Panel A shows a building block with one reactive group (X), connecting the functional group (R x ) with the anti-codon.
- This type of building block may be used for the simultaneous reaction and cleavage protocol (e.g. figures 9 and 15).
- the functional entity in this example comprises one reactive group, and a functional group R x , also called a functionality.
- the reactive groups typically become part of the templated molecule.
- Panel B shows a building block with two reactive groups (X and Y), connecting the anti-codon and the functional group (R x ).
- the functional entity in this example comprises two reactive groups that are both part of the moiety that links the anti-codon and functional group, R x .
- Panel C shows a building block with a reactive group (X) connecting R x and the anti-codon, and a reactive group (Y) attached to the R x group. This type of building block may be used in the simultaneous reaction and cleavage protocol (e.g., Fig. 9 and 10).
- the functional entity comprises two reactive groups X and Y, where X is part of the linker, and Y is attached to the functional group R x .
- Panel D shows a building block with one reactive group (X). The reactive group (X) does not link the functional group (Rx) and the complementing element.
- a cleavable linker (L) is provided in order to release the functional entity from the anti-codon.
- This type of building block may be used in protocols that require cleavage of the linker after the reactive groups of the functional entities have reacted (e.g., Fig. 12).
- Panel E disclose a building block with four reactive groups and a functional group Rx.
- the four reactive groups and the functional group R x may serve as a scaffold, onto which substituents (encoded by building blocks bound to codons on the same template) are coupled through reaction of reactive groups (X) of other building blocks with the reactive groups (Y) (e.g., figure 15).
- no cleavable linker is indicated. Therefore, after the templating reactions the templated molecule is attached to the template through the linker of this building block.
- Building block A comprises an anti-codon (horizontal line), which may be an oligonucleotide, to which a linker carrying the functional entity is attached to the central part.
- the portion of the linker marked “a” may represent a oligonucleotide sequence to which a single stranded nucleotide may be annealed in order to make the linker more rigid, or alternatively, "a" may represent a zipper box sequence of nucleotides or other type of zipper box moiety.
- the vertical line may represent a PEG (polyethylene glycol) linker, oligonucleotide linker, or any other linker that provides the functional entity with the appropriate freedom interact productively with a functional entity of a building block annealed to the same template during the templating process.
- the linker is attached to the terminus of the anti-codon.
- the anti-codon and the linker may be one continuous strand of an oligonucleotide.
- the horizontal part here represents the anti-codon, and the vertical part represents the linker.
- the linker may contain a moiety "a" that functions as a zipper box (see Fig. 22), a rigid linker, or an annealing site for another entity that rigidities the linker upon annealing.
- the linker and anti-codon may be a continuous strand of an oligonucleotide. Attached to the linker is a nucleophile "Nu" which may react with a functional entity. This may be used as an anchorage point for the templated molecule. Building block C may preferably be used as the starting or the terminal building block. When used in the initial stage of the production of the complex comprising the templated molecule, building block C may provide the template with a reactive group to which the functional entities may be attached in the growing templated molecule. In a further embodiment of the invention "Nu" of building block C represents any reactive group able to participate in a reaction resulting in the formation of a connection to a functional entity of a building block.
- Fig. 6 shows five different general methods for the preparation of building blocks.
- the general methods involves the coupling of the functional entities to oligonucleotide-based building blocks. Reactions and reagents are shown that may be used for the coupling of functional entities to modified oligonucleotides (modified with thiol, carboxylic acid, halide, or amine), without significant reaction with the unmodified part of the oligonucleotide.
- the functional entity may be synthesized as phosphoramidite precursor, which can then be used for oligonucleotide synthesis by standard methods, resulting in an oligonucleotide-derivative carrying a functional entity.
- Fig. 7 shows the design and synthesis of exemplary building blocks.
- Panel A shows a general synthesis scheme for building blocks using DNA oligonucleotide as codon, and coupling amines and carboxylic esters.
- the oligonucleotide is purchased with an amine coupled to e.g. the base at a terminal position of the oligo.
- EDC 1-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
- NHS N- hydroxysuccinimide
- Fig. 8 illustrates an embodiment for the templated synthesis of a polymer.
- X and Y are reactive groups of the functional entity.
- X and Y may be different kinds of reactive groups (e.g., amine and carboxylic acid), of the same kind but different (e.g., different primary amines or a primary amine and a secondary amine), or identical.
- Reaction of X with Y to form XY either happens spontaneously when the building block has been incorporated, or is induced by a change of conditions (e.g. pH), or by the addition of an inducing factor (chemical or UV exposure, for example)
- Fig. 8, ex.1. shows light-induced reaction between symmetric coumarin- derivatives. Light-induced reaction of the coumarin units, followed by cleavage of the linker, result in a ring structure. Examples of functional groups (phosphate and carboxylic acid) are shown. The building blocks are said to be symmetric because the two reactive groups, two coumarin units, are of the same reactivity (in fact, in this example are identical).
- Fig. 9 shows an embodiment for templated synthesis of a polymer.
- a population of templates, each carrying four codons are incubated with two sets of building blocks (carrying anti-codons 1 and 2, respectively), at a temperature that ensures efficient and specific annealing of anti-codons type
- a third monomer (with anti-codon type 3) is added, and after annealing to coding region 3, excess building block is removed, and the reaction between X and Y now leads to the formation of a trimeric polymer, coupled to the building block annealed to coding region 3. Once more, the process is repeated with building blocks of type 4, resulting in the formation of a tetrameric polymer.
- the reactive groups X and Y used in this scheme thus have two functions: i) reaction between X and Y leads to coupling of the corresponding functionalities (e.g., R1 and R2), and simultaneously, ii) the linker between R1 and the anti-codon is cleaved.
- Examples of reactive groups X and Y with such characteristics i.e., the ability to simultaneously react and cleave are shown in Fig. 20.
- the nucleophilic attack of the amine on the ester leads to transfer of the upstream functionality (e.g., R to the downstream building block (e.g., carrying anti-codon type 2). This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).
- the templated polymer may be coupled to the template through the non-covalent interaction of a building block with the template (in the example given, through the interaction of building block 4 with the template), or alternatively, through covalent coupling to a reactive group on the template, located at either of the ends of the template, or anywhere on the template sequence.
- the coupling reaction to the template may be performed before, during or after the synthesis of the polymer.
- Fig. 10 shows the templated synthesis of a mixed polymer.
- the most noticeable difference, when compared to the embodiment shown in Fig. 9 is that the reactive groups on the individual building blocks are different.
- the pairs of reactive groups (X/Y, S/T, and P/Q) are chosen so that the reaction of X and Y, S and T, P and Q, respectively, results in transfer of a functional group from one building block to another (i.e., the reaction both mediates the coupling of the two functional groups and the cleavage of the linker that initially connects one of the functional groups to the anti-codon).
- Example pairs of reactive groups that mediate this simultaneous reaction and cleavage are shown in Fig. 20.
- example 1 shows two methods of obtaining different classes of compounds using simultaneous reaction and cleavage.
- panel A the formation of an alpha-peptide is disclosed and in panel C the synthesis of a polyamine is shown.
- two building blocks are incorporated by hybridization to the template.
- One of the building blocks is an oligonucleotide to which has been appended a thioester.
- the other building block is an oligonucleotide to which has been appended an amino acid thioester.
- the amine of the latter building block attacks the carbonyl of the other building block. This results in formation of an amide bond, which extends the peptide one unit.
- this may attack the thioester carbonyl, resulting in cleavage of the dipeptide from the anti-codon, to form a tripeptide. This process is repeated until the desired peptide has been generated.
- the geometry of the nucleophilic attack remains unchanged.
- the reactivity of the amine with the ester may be tuned in several ways. Parameters that will affect the reactivity include: (i) pH and temperature, (ii) nature of ester (thio-, phospho-, or hydroxy-ester); (iii) the nature of the substituent on the sulfur (see panel B below).
- the general scheme presented here can be applied to most nucleophilic reactions, including formation of various types of peptides, amides, and amide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea), using similar functional entities.
- amides e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea
- Panel B shows four different thioesters with different substituents on the sulphur and therefore different reactivity towards nucleophiles.
- Panel C relates to the formation of a polyamine. Using the same principle as in (A), a polyamine is formed.
- example 2 shows simultaneous reaction and cleavage for two reactions.
- reaction A a peptoid or an ⁇ - or ⁇ -peptide is formed, and in reaction B a hydrazino peptide is formed.
- reaction A two building blocks are initially incorporated, one of which carries both a nucleophile (an amino group) and an electrophile (e.g. an ester); the other building block only carries an electrophile (e.g. a thioester).
- the nucleophilic amine will attack the electrophile of the building block attached to the same template.
- a dimeric structure is formed, linked to building block that initially carried the amine.
- the linear structure grows, and eventually the desired templated molecule (a peptoid or an ⁇ - or ⁇ -peptide) has been formed.
- reaction B follows the same line as in A, except that hydrazine-peptide precursor building blocks are used, leading to the formation of hydrazino peptides.
- Fig. 11 shows a general reaction scheme for templated synthesis of a polymer, using non-simultaneous reaction and cleavage.
- the reaction of the reactive groups e.g., X and Y
- the reactive groups X and Y does not in itself lead to cleavage, wherefore the functional entity is coupled to the anti-codon via a cleavable linker. Therefore, each addition of a subunit to the growing polymer involves two steps. First, the reactive groups X and Y react to form a bond XY. Then, in a separate step, a cleavable linker L is cleaved, which releases one of the functional entities from the anti-codon.
- cleavable linkers By alternating between two types of cleavable linkers (cleavable under different conditions) one may achieve migration of the nascent polymer down the template, like described in fig. 9 and 10. This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).
- Example reactions that do not mediate simultaneous reaction and cleavage are shown in fig. 21. Any combination of cleavable and non-cleavable linkers may be used, dependent on the nature of the reactive groups in the functional entities (e.g., dependent on whether the reaction involves a release from the anti-codon).
- Fig. 12 relates to activation of reactive groups and release from anti-codon by ring-opening.
- Fig. 12 example 1. Ring-opening of N-thiocarboxyanhydrides, to form ⁇ - peptides.
- the initiator is activated, for example by deprotection or by an increase in pH.
- the primary amine then attacks the carbonyl of the N-thiocarboxyanhydride (NTA) unit. As a result, CSO is released, and a primary amine is generated.
- NTA N-thiocarboxyanhydride
- peptides and peptide-like polymers e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea
- ⁇ -peptides can be made by polymerization of 5-membered carboxyanhydride rings.
- Fig. 13 shows the principle of symmetric fill-in (symmetric XX building blocks). The fill-in reaction occurs between the reactive groups ("X” in the figure) and bridging molecules "Y-Y” in figure).
- X represents the reactive groups of the functional entity.
- Y-Y is added to the mixture before, during or after incorporation of the building blocks.
- Fig. 13, ex.1 shows imine formation by fill-in reaction. Dialdehyde is added in excess to incorporated diamines. As a result, an imine is formed.
- the templated molecule carries the following functional groups: cyclopentadienyl and hydroxyl.
- example 2 shows an example of amide formation using symmetric fill-in.
- non-incorporated building blocks may be removed.
- EDC 1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide
- dicarboxylic acid is added in excess to the primary amines of the building blocks.
- a di-(N-hydroxy- succinimide ester) may be added in excess.
- excess reagents may be removed by dialysis, precipitation of the building blocks and template, gel filtration or by other means that separate the reagents from the building blocks.
- the linkers (L) may be cleaved, and, if functional groups have been masked by protection groups (PG), these functional groups can be deprotected to expose the functional groups.
- PG protection groups
- Appropriate protecting groups would be for example Boc-, Fmoc, benzyloxycarbonyl (Z, cbz), trifluoracetyl, phthaloyl, or other amino protecting groups described e.g. in (T. W. Green and Peter G. M. Wuts (1991), Protective Groups in Organic Synthesis).
- amide-bonded functional entities would be to incorporate building blocks carrying di-carboxylic acids, and then add diamines, NHS and EDC.
- the building blocks could carry N- hydroxy-succinimidyl (NHS) esters, which would react with the added amines without the need to add EDC and NHS.
- NHS N- hydroxy-succinimidyl
- example 3 shows an example of urea-bond formation.
- the functional entities of the incorporated building blocks react with phosgen or a phosgen-equivalent such as CDI to form a polyurea.
- Formaldehyde may also be used.
- the linkers are cleaved and the protected hydroxyl is deprotected.
- Appropriate leaving groups (Lv) are chloride, imidazole, nitrotriazole, or other good leaving groups.
- example 4 shows the formation of chiral and achiral templated molecules.
- the functional group Rx is used as a cleavable linker, that generates the desired functional group upon activation.
- reaction A and reaction B a urea-bond is formed.
- reaction A the functional group is attached to the backbone via a chiral carbon.
- the hydrogen on this carbon is drawn to emphasize this.
- the reactive groups the amines
- the phosgen equivalent e.g., a carbonyldiimidazole
- the building blocks may be inserted in either of two orientations (as indicated by the position of the hydrogen, left or right).
- reaction B the chiral carbon of reaction A has been replaced by a nitrogen.
- the resulting templated molecule is achiral, i.e. the template encodes one specific structure.
- example 5 shows the formation of a phosphodiester bond by the principle of symmetric fill-in.
- the incorporated building blocks react with the activated fill-in molecule to form a phosphodiester bond.
- the linkers are cleaved, releasing the templated molecule from its template.
- An example of an appropriate leaving group (Lv) is imidazole.
- example 6 shows phosphodiester formation with one reactive group in each building block.
- example 7 shows the an example of a pericyclic fill-in reaction.
- two building blocks are incorporated.
- 1 ,4-benzoquinone is added in excess, resulting in the formation of a polycyclic compound.
- a third building block is added, reacted with the 1 ,4-benzoquinone, and this process is repeated a number of times until the desired templated molecule has been generated.
- all but one of the linkers that connect the templated molecule to the anti-codon are cleaved.
- Fig. 14 relates to asymmetric fill-in using XS building blocks.
- a fill-in reaction between reactive groups (X and S) and bridging molecules (T-Y) is shown. For clarity, only the reaction (not linker cleavage) is shown.
- X and S represent the reactive groups of the functional entity. In this case the two reactive groups are not of the same kind.
- T-Y is added to the mixture before, during or after incorporation of the building blocks.
- significant reaction between X and Y, and between S and T may take place during or after incorporation of the building blocks.
- example 1 shows an example of asymmetric fill-in by modified Staudinger ligation and ketone-hydrazide reaction.
- the reactive groups X and S of the building blocks are azide and hydrazide.
- the added molecule that fills the gaps between the building blocks carry a ketone and a phosphine moiety.
- the reactions between a ketone and a hydrazide, and between an azide and a phosphine, are very chemoselective. Therefore, most functional groups Rx can be employed without the need for protection during the reactions. Examples for the molecular moieties R, R1 , X and Y may be found in (Mahal et al. (1997), Science 276, pp. 1125-1128; Saxon et al. (2000), Organic Letters 2, pp. 2141-2143).
- Fig. 15 shows a general reaction scheme for templated synthesis of a nonlinear molecule.
- a template carrying four codons is mixed with two building blocks.
- the functional entity of one building block comprises a reactive group X and a functional group R-i.
- the other building block comprises three reactive groups Y and a functional group R 2 .
- the building block bound to codon 2 is here called the scaffold, as the functional groups are transferred to this building block during the templating process.
- X is brought to react with one of the reactive groups Y, for example by changing the conditions, by deprotecting X or Y, or by simply exploiting the pronounced proximity of X and Y groups when the building blocks are bound to the template.
- X and Y have been chosen so as to allow simultaneous reaction and cleavage.
- the substituent group (functional group) Ri is transferred to the scaffold.
- Example reactive groups X and Y that mediate simultaneous reaction and cleavage are given in figure 20. Any pair of reactive groups X and Y that mediates simultaneous reaction and cleavage can be used in this scheme, i.e., different X/Y pairs may be used at each substituent position.
- Figure 16 shows templated synthesis of a non-linear molecule, employing reactive groups of different kinds, and non-simultaneous reaction and cleavage.
- the reactive groups X, S, P and Y, T, Q may be of different kinds, and the bonds formed (XY, ST, and PQ) therefore may be of different kinds.
- the substituent (functional group) R1 is transferred to the second building block (the scaffold).
- the second building block the scaffold.
- an additional step of linker cleavage is required.
- a scaffolded molecule After repeating the processes of annealing, reacting and cleavage a number of times, a scaffolded molecule has been formed carrying encoded substituents. The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached.
- the position of the substituents are determined by the identity of the reactive groups Y, T and Q of the scaffold, and therefore indirectly determined by the identity of the codon to which the scaffold building block anneals. Therefore, in this set-up, the identity and position of the substituents, as well as the identity of the scaffold, is determined by the sequence of the template.
- Fig. 17 discloses the principle of templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold.
- the templated molecule migrates down the template as it is being synthesized. This is made possible by the use two different linkers L x and L y , cleavable under different conditions. As a result, a high proximity is maintained throughout the templating process, as the building blocks that react in each reaction step are bound to adjacent coding regions on the template.
- Fig. 18 shows the templated synthesis of various non-linear molecules.
- Each building block comprises an activated ester (reactive group, (X)) where the ester moiety carries a functional group Rx.
- Rx reactive group
- the nucleophilic amine (covalently attached to the template) attacks the ester carbonyl of the building block bound to coding region 3; the amine of the third monomer attacks the thioester of the next incorporated building block, and after incorporation of the third building block, the Homer-Wittig Emmans reagent of the building block reacts with the aldehyde of the third monomer under alkaline conditions. This forms the templated molecule.
- the double bond may be post-templating modified by hydrogenation to form a saturated bond, or alternatively, submitted to a Michael addition.
- the incorporated building block acylates one of the primary amines.
- the aryliodide undergoes a Suzuki coupling by reaction with the next building block, and the benzylic amine is acylated by last incorporated building block.
- Fig. 19 shows a general procedure of templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.
- the reaction step may be desirable to perform the reaction step (or one of the other steps) under conditions where annealing of building blocks is in-efficient.
- one may covalently link the incorporated building blocks, either chemically or by using a ligase (when the anti-codon comprises an oligonucleotide) or a polymerase (when the anti-codon is e.g. a nucleotide).
- the template is designed to fold back on itself.
- the two incorporated building blocks are incorporated and may be ligated together, and be linked to the template, during or after their incorporation. If desired, the conditions may now be changed to increase the efficiency of the reaction step that follows.
- step 2 the reactive groups X and Y are brought to react. Because the building blocks are covalently attached to each other (and to the template), the reaction can be performed under conditions where annealing of the building blocks to the template is inefficient. Reaction conditions that may not be compatible with efficient annealing and double helix structure include organic solvents, low salt and high temperature, all of which may be used with the set-up described in this figure.
- step 2 the conditions are changed again, in order to allow efficient incorporation and covalent linkage of the next building block (step 3).
- This cycling between conditions that allow incorporation and ligation, and that allow reaction, is continued until the desired number of building blocks have been incorporated and reacted.
- some of the linkers are cleaved to give the templated molecule.
- the covalent coupling of the building blocks to each other allows the reaction between their reactive groups to be performed under more diverse conditions than would otherwise be possible.
- covalent coupling between building blocks makes it possible to use anti-codons comprising shorter recognition sequences.
- the anti-codon comprises an oligonucleotide
- it is generally preffered to use an oligonucleotide of at least fifteen nucleotides during incorporation, in order to obtain high efficiency of incorporation.
- a ligase or chemical is used to covalently couple the building blocks
- the templates may be attached to a solid phase material (e.g., streptavidin beads if the templates are biotinylated), or the templates (with the building blocks associated to them) may be precipitated and resuspended in appropriate buffer during the steps of incorporation and reaction.
- a solid phase material e.g., streptavidin beads if the templates are biotinylated
- Fig. 20 shows various reaction types allowing simultaneous reaction and activation. Different classes of reactions are shown which mediate translocation of a functional group from one monomer building block to another, or to an anchorage point. The reactions have been grouped into three different classes: Nucleophilic substitutions, addition-elimination reactions, and transition metal catalyzed reactions These reactions are compatible with simultaneous reaction and activation.
- S Reaction between aliphatic boronates and arylhalides, whereby the alkyl group is translocated to yield an alkylarene.
- T Transition metal catalysed alpha-alkylation through reaction between an enolether and an aryihallide, thereby translocating the aliphatic part.
- U Condensations between e.g. enamines or enolethers with aldehydes leading to formation of alpha-hydroxy carbonyls or alpha, beta- unsaturated carbonyls. The reaction translocates the nucleophilic part.
- V Alkylation of alkylhalides by e.g. enamines or enolethers.
- the reaction translocates the nucleophilic part.
- W [2+4] cycloadditions, translocating the diene-part.
- X [2+4] cycloadditions, translocating the ene-part.
- Y [3+2] cycloadditions between azides and alkenes, leading to triazoles by translocation of the ene-part.
- Z [3+2] cycloadditions between nitriloxides and alkenes, leading to isoxazoles by translocation of the ene-part.
- Fig. 21 shows pairs of reactive groups (X) and (Y), and the resulting bond
- cleavage may be required (e.g., see fig. 8).
- Fig. 22 shows a method of increasing the proximity effect of the template: The Zipper-box.
- Panel A discloses linkers carrying oligonucleotide zipper boxes (a) and (b) that are complementary. By operating at a temperature that allows transient interaction of (a) and (b), the reactive groups X and Y are brought into close proximity during multiple annealing and strand-melting events, which has the effect of keeping X and Y in close proximity in a larger fraction of the time than otherwise achievable.
- one may cycle the temperature between a low temperature (where the zipper boxes pairwise interact stably), and a higher temperature (where the zipper boxes are apart, but where the anti-codon remains stably attached to the codon of the template).
- the temperature may be kept appropriately low that the two strands of the zipper-box (a and b) are stably associated.
- the building blocks must be added to the reaction mix at an appropriately high temperature where the interaction between the codon and anti-codon is specific. Once the building blocks have been specifically associated with the template, the temperature can be lowered, and the alternative protocols described above followed, in order to achieve a high reaction efficiency.
- the anti-codon is an oligonucleotide (e.g., DNA, RNA) or oligonucleotide analog (e.g., PNA, LNA), it may be practical to use a continuous nucleotide strand, comprising both the anti-codon, linker and zipper-box (see (B) below).
- oligonucleotide e.g., DNA, RNA
- oligonucleotide analog e.g., PNA, LNA
- Panel B shows sequences of two DNA oligo-based building blocks.
- the anticodon ("annealing region"), linker and zipper-box are indicated.
- one linear DNA molecule constitutes the anti-codon, the linker that connects the functional entity and the anti-codon, and the zipper-box.
- the reactive groups X (a carboxylic acid) and Z (an amine) are coupled to the 3'- end of DNA oligo 1 and the 5'-end of DNA oligo 2, respectively.
- a template sequence to which oligo 1 and oligo 2 would anneal might contain the follow- ing sequence: 5'-CCGATGCAATCCAGAGGTCG- GCTGGATGCTCGACAGGTC.
- Fig. 23 shows three methods of how the proximity effect can be increased: (A) Helix stacking, (B) Ligation and (C) Rigid linkers.
- Two building blocks with oligonucleotide-based anti- codons anneal to their respective codons (in the figure, the left building block is a "scaffold" that carries four reactive groups, and the right building block carries a functional entity with e.g. one reactive group, i.e., the latter building block may carry the substituent that will become attached to the scaffold.
- Double helices tend to stack, especially if the sequence of the opposing ends of the helices has been designed so as to optimize this interaction (for example by the presence of the sequence GGG at the ends of the duplex structures). This stacking tendency will bring the two building blocks into closer proximity, in turn increasing reaction efficiency between the functional entities.
- the substituent building block may be removed after its reaction with the scaffold building block, before the next building block is incorporated. In this way, the template region between two reacting building blocks may be kept single stranded, allowing this region to loop out and let the two duplex structures stack during the reaction between the two building blocks.
- the anti-codons of two building blocks may be chemically or enzymatically ligated together. Coupling of two anti-codons will increase the annealing efficiency. Therefore, smaller anti-codons can be used if ligated together with the previously incorporated building block.
- a building block or just an 20-nucleotide DNA oligo
- a melting temperature e.g. 60 °C.
- another building block e.g., with a 8-nucleotide DNA anti-codon
- the second building block will become firmly attached to the template, despite its short length of just 8 nucleotides.
- ligation allows the use of shorter anti- codons, which in turn brings the reactive groups into closer proximity.
- (C) Rigid linkers By using linkers comprising one or more flexible regions ("hinges”) and one or more rigid regions, the probability of two functional entities getting into reactive contact may be increased, a. Symbol used for building block with a rigid part and two flexible hinges. b. A building block with the characteristics described in (a). The building block contains a continuous oligonucleotide -strand, constituting both the anti-codon (horizontal line), and linker (vertical line) connecting the functional entity (FE) with the anti-codon. Annealing of a complementary sequence to the central part of the linker leads to formation of a rigid double helix; at either end of the linker a single-stranded region remains, which constitutes the two flexible hinges.
- Fig. 24 discloses various cleavable linkers. A number of cleavable linkers are shown, as well as the agents that cleave them and the products of the cleavage-reaction. In addition, catalysts including enzymes and ribozymes, may also be used to cleave the linker. Exemplary enzymes are proteases (e.g. chymotrypsin), nucleases, esterases and other hydrolases.
- Fig. 25 shows two different ways of templated synthesis by generating a new reactive group.
- the reaction of X and Y leads to formation of a new reactive group Z
- this may be exploited to increase the diversity of the templated molecule, by incorporating building blocks carrying reactive groups Q that react with Z.
- the templated molecules may be very compact structures, and thus, this approach describes a method to make highly substituted (functionalized and diverse) libraries of molecules of relatively low molecular weight.
- A First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond.
- both the reaction of X with Y, and of Z with Q are reactions that involve simultaneous reaction and cleavage.
- Fig. 25, example 1 shows a templated synthesis by generating a new reactive group.
- the reaction of the functional entities of the first three building blocks leads to formation of two double bonds, which may react with two hydroxylamines carried in by the building blocks added in the latter steps, and leads to formation of an ester, which may react with the hydroxylamine, encoded by a building block.
- the linkers are cleaved, generating the templated molecule.
- Fig. 26 shows different methods of performing post-templating modifications on templated molecule. After the templating process has been performed, the templated molecules may be modified to introduce new characteristics. This list describes some of these post-templating modificiations.
- Fig. 27 illustrates one preferred method for selection of template-displaying molecules.
- Figure 28 shows the proposed complexes that may form when a reaction step is performed using set-ups that allow for stacking of DNA duplexes.
- Figure 29 shows a autoradiography of a polyacrylamide gel analysis of the reaction between building blocks.
- Figure 30 shows the Feuston 3 functional entity as well as the Feuston 5 ligand.
- Figure 31 shows the structure of the pentenoyl protected aspartate.
- Figure 32 shows the use of allylglycine building blocks.
- Figure 33 shows the autoradiography of a polyacrylamide gel.
- Figure 34 shows an Elisa analysis of the product of the two-step encoding process.
- building blocks which contain a zipper box adjacent to the functional entity.
- the zipper box sequences are underlined below.
- the following buffers and protocols are used in the same three examples.
- the samples are mixed with formamide dye 1:1 (98% formamide, 10 mM EDTA, pH 8, 0,025 % Xylene Cyanol, 0,025% Bromphenol Blue), incubated at 80°C for 2 minutes, and run on a denaturing 10% polyacrylamide gel.
- formamide dye 1:1 98% formamide, 10 mM EDTA, pH 8, 0,025 % Xylene Cyanol, 0,025% Bromphenol Blue
- the polyacrylamide gel analysis showed that a more efficient reaction results from alternating the temperature between 10 °C and 35 °C, rather than performing the reaction at a constant temperature of 15°C, 17,8°C, 22,7°C, 28,3°C, 31,0°C, or 35,0°C.
- AH138 5'- TCTTGCCTGAACGTAGTCGTAGGTCGATCCGCGTTACCAGAGCTG-
- Figure 28,1 and Figure 29, lane 1 Reference reaction between two building blocks annealed to adjacent sites on the template. As expected an efficient reaction is observed. In this set-up, the two building blocks anneal to the template and thereby form DNA duplexes that can stack onto each other.
- Figure 28,2 and Figure 29, lane 2 In this set-up, the two building blocks anneal to adjacent sites on the template. However, the two DNA-duplexes stack onto each other, basically forming one long DNA duplex. This rigid duplex does not allow the two building blocks to bend around the flexible hinge that might otherwise be present at the connection point between the two duplexes (i.e. the position of the nick in the DNA). Consequently, no significant reaction between the two building blocks is observed.
- Figure 28, 5 and Figure 29, lane 5; and Figure 28, 6 and Figure 29, lane 6 The annealing sites and separation between them are identical to those of the experiment described above ( Figure 28, 3 and 4; Figure 29, lanes 3 and 4).
- a short oligo (10 nucleotides) has been annealed to the cen- tral region of the template. This result in a drastic decrease in reaction efficiency for the building blocks with the short linkers (lane 5); the reaction efficiency of the building blocks with the long linkers is only slightly affected if at all by the annealing of the short oligo.
- Figure 28, 7 and Figure 29, lane 7; and Figure 28, 8 and Figure 29, lane 8 As immediately above, except that a 20 nucleotide long oligo is annealed to the central region of the template. In this case none of the linkers (short or long) can reach across the extended duplexes, and as a result no or little reaction is observed.
- the building blocks are oriented the "other way", i.e. the linker connecting the complementing element and the functional entity is near the ends of the template.
- the complementing element of the left building block contains a 5-nucleotide sequence that is complementary to other right end of the template.
- the building block should be capable of circularizing the template, as depicted in Figures 27, 9-11. These circular structures should also be stabilized by an extended duplex structure across the ends of the template.
- AH136 5'- AGCTGGATGCTCGACAGGTCTCTTGCCTGAACGTAGTCG- TCCGATGCAATCCAGAGGTCG AH 174: 5'-TACGTTCAGGCAAGAGT6CCAGTTAC7
- three functional entities are transferred to an amino modified scaffold oligo by a three step reaction, and analyzed by a denaturing acryla- mide gel using radio labelling.
- the loading was done by incubating each of the oligos with 10 mM ⁇ - AlaOMe AG, 75 mM DMT-MM in 150 mM Hepes-OH buffer, pH 7,5 to a final volume of 50 ⁇ l at 25°C shaking overnight. Then adding 5 ⁇ l 1 M NH 4 - acetate, incubated at 25°C for 10 min, then spin column purified with ddH 2 O equilibrated columns (Micro Bio-Spin chromatography columns P-6, Bio- Rad). The deprotection of the methyl group protected acid was done by adding 0,5 ⁇ l 2M NaOH to the oligos and incubating for 10 min at 80°C. Lastly the oligos were spin column purified and loadings confirmed by mass spec- trophotometry.
- the scaffold oligo [MDL251 5'amino-C6 dT-ACC TGT CGA GCA TCC AGC T 3'] was radioactively labelled in the 3' end. 50 pmol of the oligo was labelled with 10 ⁇ l ddATP ⁇ P32 (Amersham Biosciences) by adding 4 ⁇ l 10X NEbuffer 4, 4 ⁇ l 10X CoCI2 and 35 units of terminal deoxynucleotide transferase (New England Biolabs) and water to a final volume of 40 ⁇ l. Mixture incubated at 37°C for 1 hour. Labeled oligo purified using ddH2O equilibrated spin column.
- the oligos were annealed by heating to 80°C and slowely going down to 20°C (1 min) using a thermocy- cler (Eppendorf, Mastergradient) Following the annealing 5 ⁇ l 0,5M DMT- MM was added. Sample crosslinked, see figure 32 overnight cycling at 10°C 10 sec/35°C 1 sec. The sample was spin column purified and the crosslinked product cleaved to give first transfer of ⁇ -Ala to scaffold oligo amine by adding 10 ⁇ l 25 mM 12 dissolved in 1:1 tetrahydrofuran:H2O and incubated at 37°C for 1,5 hours.
- step 1 crosslinking efficiency (step 1) was approximately 50% ( Figure 33, lane 1). This was followed by an al- most 100%) efficient cleavage (lane 2), which results in the transfer of the ⁇ - Ala moiety onto the scaffold. This is followed by the crosslinking/cleavage of step 2 and 3 (lanes 3+4, 5+6) to generate the final product on the scaffold oligo.
- the product thus contains the three transferred ⁇ -Ala moieties.
- two entities are transferred to a scaffold oligo by a two-step reaction to produce a ligand, Feuston 5 (see Figure 30) that binds to the ⁇ V ⁇ 3 integrin receptor.
- the product of the two-step process was analyzed by Elisa.
- Feuston 3 is a derivative of the Feuston 5 ligand see fig 30 (F3OMeAG) and AH 272 (see above) loaded with glycine allylglycine (GlyO- MeAG) according to the above protocol (example Xa) for loadings of allylglycine functional entities to carboxylic acid modified oligos. 10 nmoles of each was loaded in two reactions each.
- the loading was done by mixing 25 ⁇ l 150 mM EDC (N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide hydrochloride, Fluka), 25 ⁇ l NHS (N- hydroxysuccinimide, Sigma) and 5 ⁇ l 100 mM of the pentenoyl protected aspartate functional entity, all reagents were dissolved in N,N- dimethylformamide, DMF. Incubated at 25°C for 40 min. To this mixture 5 nmol of the scaffold oligo, AH 270 resuspended in 30 ⁇ l 150 mM Hepes-OH pH 7,5 was added and this incubated shaking over night at 25°C.
- the amine pentenoyl protection group was deprotected by adding 20 ⁇ l 25 mM 12 dissolved in 1 :1 tetrahydrofuran: water and incubated at 37°C for 2 hours. Followinged by spin column purification, and loading confirmed by mass spectrum analysis.
- the transfers were done in the same manner as described above, but using larger amounts of oligo to ensure there being enough ligand created to give a sufficient signal in the ELISA.
- the first round the following amounts were used: 850 pmol loaded scaffold oligo; AH 270, 7500 pmol loaded building block oligo; AH 272 and 3250 pmol template oligo AH 140 [ 5' AGC TGG ATG CTC GAC AGG TCA GGT CGA TCC GCG TTA CCA GTC TTG CCT GAA CGT AGT CGT CCG ATG CAA TCC AGA GGT CG 3'].
- the second round adding 7500 pmol loaded building block oligo AH 155 for a transfer.
- the created Feuston 5 ligand on the scaffold oligo still had a methyl group protected acid on the aspartate, which was deprotected just as described before.
- the sample prepared above containing the displayed Feuston 5 ligand on a scaffold oligo was added to a well, control for the experiment being a 20 mer oligo loaded with the RGD peptide, a well known and well described ligand for this integrin receptor (loaded according to above described method for the pentenoyl and methyl protected aspartate functional entity).
- the incubation with these ligands was done in ligand binding buffer containing PBS, 1 mM MnCI2, 1 mg/mL BSA at room temperature for one hour. Washed in washing buffer 5 * 300 ⁇ l. Incubated with 100 ⁇ l horseradish peroxidase-streptavidine (Endogen) diluted 1 :10000 times in wash buffer, incubated for one hour at room temperature.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Catalysts (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
Abstract
Description
Claims
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES03766117T ES2572203T3 (en) | 2002-08-01 | 2003-07-30 | Complex library comprising small non-peptide molecules and double stranded oligonucleotides for molecule identification |
| SI200332480A SI1539980T1 (en) | 2002-08-01 | 2003-07-30 | Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules |
| AU2003247266A AU2003247266A1 (en) | 2002-08-01 | 2003-07-30 | Multi-step synthesis of templated molecules |
| EP03766117.0A EP1539980B1 (en) | 2002-08-01 | 2003-07-30 | Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules |
| DK03766117.0T DK1539980T3 (en) | 2002-08-01 | 2003-07-30 | Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides that identify the molecules |
| US10/523,006 US10730906B2 (en) | 2002-08-01 | 2003-07-30 | Multi-step synthesis of templated molecules |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US39969202P | 2002-08-01 | 2002-08-01 | |
| US60/399,692 | 2002-08-01 | ||
| DKPA200201171 | 2002-08-01 | ||
| DKPA200201171 | 2002-08-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004013070A2 true WO2004013070A2 (en) | 2004-02-12 |
| WO2004013070A3 WO2004013070A3 (en) | 2004-03-25 |
Family
ID=31496949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2003/000516 Ceased WO2004013070A2 (en) | 2002-08-01 | 2003-07-30 | Multi-step synthesis of templated molecules |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US10730906B2 (en) |
| EP (1) | EP1539980B1 (en) |
| AU (1) | AU2003247266A1 (en) |
| WO (1) | WO2004013070A2 (en) |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004074429A3 (en) * | 2003-02-21 | 2004-09-30 | Nuevolution As | Method for producing second-generation library |
| WO2004074501A3 (en) * | 2003-02-21 | 2004-09-30 | Nuevolution As | A method for obtaining structural information about an encoded molecule |
| WO2004039825A3 (en) * | 2002-10-30 | 2004-10-28 | Nuevolution As | Method for the synthesis of a bifunctional complex |
| WO2004083427A3 (en) * | 2003-03-20 | 2005-02-17 | Nuevolution As | Ligational encoding of small molecules |
| WO2005090566A3 (en) * | 2004-03-22 | 2006-03-09 | Nuevolution As | Ligational encoding using building block oligonucleotides |
| US7070928B2 (en) | 2001-03-19 | 2006-07-04 | President And Fellows Of Harvard College | Evolving new molecular function |
| WO2006079061A3 (en) * | 2005-01-21 | 2006-09-28 | Harvard College | Free reactant use in nucleic acid-templated synthesis |
| US7413854B2 (en) | 2002-03-15 | 2008-08-19 | Nuevolution A/S | Method for synthesising templated molecules |
| US7727713B2 (en) | 2001-06-20 | 2010-06-01 | Nuevolution A/S | Templated molecules and methods for using such molecules |
| US7935658B2 (en) | 2003-12-17 | 2011-05-03 | Praecis Pharmaceuticals, Inc. | Methods for synthesis of encoded libraries |
| US7972994B2 (en) | 2003-12-17 | 2011-07-05 | Glaxosmithkline Llc | Methods for synthesis of encoded libraries |
| US7989395B2 (en) | 2005-10-28 | 2011-08-02 | Glaxosmithkline Llc | Methods for identifying compounds of interest using encoded libraries |
| EP2396459A1 (en) | 2009-02-13 | 2011-12-21 | X-Chem, Inc. | Methods of creating and screening dna-encoded libraries |
| AU2011226815B2 (en) * | 2002-10-30 | 2014-09-25 | Nuevolution A/S | Enzymatic encoding |
| EP2748357B1 (en) | 2011-09-07 | 2018-04-04 | X-Chem, Inc. | Methods for tagging dna-encoded libraries |
| EP2872680B1 (en) | 2012-07-13 | 2018-04-04 | X-Chem, Inc. | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
| EP3083957B1 (en) | 2013-12-20 | 2018-05-23 | Philochem AG | Production of encoded chemical libraries |
| US10730906B2 (en) | 2002-08-01 | 2020-08-04 | Nuevolutions A/S | Multi-step synthesis of templated molecules |
| US10731151B2 (en) | 2002-03-15 | 2020-08-04 | Nuevolution A/S | Method for synthesising templated molecules |
| US11118215B2 (en) | 2003-09-18 | 2021-09-14 | Nuevolution A/S | Method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| US11225655B2 (en) | 2010-04-16 | 2022-01-18 | Nuevolution A/S | Bi-functional complexes and methods for making and using such complexes |
| US11702652B2 (en) | 2005-12-01 | 2023-07-18 | Nuevolution A/S | Enzymatic encoding methods for efficient synthesis of large libraries |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004016767A2 (en) | 2002-08-19 | 2004-02-26 | The President And Fellows Of Harvard College | Evolving new molecular function |
| WO2004028682A2 (en) * | 2002-09-27 | 2004-04-08 | Carlsberg A/S | Spatially encoded polymer matrix |
| ATE450609T1 (en) | 2002-12-19 | 2009-12-15 | Nuevolution As | SYNTHESIS METHOD GUIDED BY QUASI-RANDOM STRUCTURES AND FUNCTIONS |
| US8017323B2 (en) * | 2003-03-26 | 2011-09-13 | President And Fellows Of Harvard College | Free reactant use in nucleic acid-templated synthesis |
| EP1723255B1 (en) * | 2004-02-17 | 2010-12-29 | Nuevolution A/S | Method for enrichment involving elimination by mismatch hybridisation |
| EP3050878B1 (en) | 2013-09-24 | 2021-10-27 | FUJIFILM Corporation | Novel nitrogen-containing compound or salt thereof, or metal complex thereof |
| US20180340174A1 (en) | 2014-11-11 | 2018-11-29 | Nanocore Aps | Method for identification of molecules with desired characteristics |
| US11186836B2 (en) | 2016-06-16 | 2021-11-30 | Haystack Sciences Corporation | Oligonucleotide directed and recorded combinatorial synthesis of encoded probe molecules |
| US11795580B2 (en) | 2017-05-02 | 2023-10-24 | Haystack Sciences Corporation | Molecules for verifying oligonucleotide directed combinatorial synthesis and methods of making and using the same |
| US11391734B2 (en) * | 2017-09-25 | 2022-07-19 | California Institute Of Technology | Surface-immobilized bistable polynucleotide devices for the sensing and quantification of molecular events |
| US11214795B2 (en) | 2017-09-25 | 2022-01-04 | California Institute Of Technology | Bistable polynucleotide devices for the sensing and quantification of molecular events |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990005785A1 (en) | 1988-11-18 | 1990-05-31 | The Regents Of The University Of California | Method for site-specifically incorporating unnatural amino acids into proteins |
| DE19646372C1 (en) | 1995-11-11 | 1997-06-19 | Evotec Biosystems Gmbh | Conjugates of polypeptide and encoding nucleic acid |
| WO1998031700A1 (en) | 1997-01-21 | 1998-07-23 | The General Hospital Corporation | Selection of proteins using rna-protein fusions |
| WO2000032823A1 (en) | 1998-12-02 | 2000-06-08 | Phylos, Inc. | Dna-protein fusions and uses thereof |
| WO2000061775A1 (en) | 1999-04-08 | 2000-10-19 | Pavel Sergeev | Synthesis of biologically active compounds in cells |
Family Cites Families (215)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS53104797A (en) * | 1977-02-22 | 1978-09-12 | Japan Tobacco Inc | Preparation of expanded veins and stalks of tobacco leaves |
| US6040166A (en) * | 1985-03-28 | 2000-03-21 | Roche Molecular Systems, Inc. | Kits for amplifying and detecting nucleic acid sequences, including a probe |
| US4822731A (en) * | 1986-01-09 | 1989-04-18 | Cetus Corporation | Process for labeling single-stranded nucleic acids and hybridizaiton probes |
| US5047519A (en) * | 1986-07-02 | 1991-09-10 | E. I. Du Pont De Nemours And Company | Alkynylamino-nucleotides |
| DE3788914T2 (en) | 1986-09-08 | 1994-08-25 | Ajinomoto Kk | Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers. |
| US5449602A (en) | 1988-01-13 | 1995-09-12 | Amoco Corporation | Template-directed photoligation |
| US5025388A (en) | 1988-08-26 | 1991-06-18 | Cramer Richard D Iii | Comparative molecular field analysis (CoMFA) |
| US5324829A (en) | 1988-12-16 | 1994-06-28 | Ortho Diagnostic Systems, Inc. | High specific activity nucleic acid probes having target recognition and signal generating moieties |
| ES2118066T3 (en) | 1989-10-05 | 1998-09-16 | Optein Inc | SYNTHESIS AND ISOLATION, EXEMPTED FROM CELLS, FROM NEW GENES AND POLYPEPTIDES. |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US6005087A (en) | 1995-06-06 | 1999-12-21 | Isis Pharmaceuticals, Inc. | 2'-modified oligonucleotides |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| CA2039517C (en) | 1990-04-03 | 2006-11-07 | David Segev | Dna probe signal amplification |
| US5723289A (en) | 1990-06-11 | 1998-03-03 | Nexstar Pharmaceuticals, Inc. | Parallel selex |
| US5723286A (en) | 1990-06-20 | 1998-03-03 | Affymax Technologies N.V. | Peptide library and screening systems |
| US5650489A (en) | 1990-07-02 | 1997-07-22 | The Arizona Board Of Regents | Random bio-oligomer library, a method of synthesis thereof, and a method of use thereof |
| WO1992002536A1 (en) | 1990-08-02 | 1992-02-20 | The Regents Of The University Of Colorado | Systematic polypeptide evolution by reverse translation |
| US5843701A (en) * | 1990-08-02 | 1998-12-01 | Nexstar Pharmaceticals, Inc. | Systematic polypeptide evolution by reverse translation |
| US5432272A (en) * | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| AU2313392A (en) | 1991-08-01 | 1993-03-02 | University Research Corporation | Systematic polypeptide evolution by reverse translation |
| US5474796A (en) | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| JP2780572B2 (en) | 1991-09-13 | 1998-07-30 | 株式会社島津製作所 | Enzymatic synthesis of oligonucleotides and use of oligonucleotides as primers |
| US5639603A (en) * | 1991-09-18 | 1997-06-17 | Affymax Technologies N.V. | Synthesizing and screening molecular diversity |
| DK0604552T3 (en) * | 1991-09-18 | 1997-08-04 | Affymax Tech Nv | Process for the synthesis of different assemblies of oligomers |
| US6197556B1 (en) * | 1991-12-20 | 2001-03-06 | The University Of Chicago | Nucleic acid amplification using modular branched primers |
| US5424413A (en) * | 1992-01-22 | 1995-06-13 | Gen-Probe Incorporated | Branched nucleic acid probes |
| US5573905A (en) | 1992-03-30 | 1996-11-12 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
| US5541061A (en) | 1992-04-29 | 1996-07-30 | Affymax Technologies N.V. | Methods for screening factorial chemical libraries |
| US5565324A (en) * | 1992-10-01 | 1996-10-15 | The Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| US6503759B1 (en) * | 1992-10-01 | 2003-01-07 | The Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| EP0665897B1 (en) | 1992-10-01 | 2003-07-09 | The Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| US5684169A (en) | 1992-11-27 | 1997-11-04 | Ensuiko Sugar Refining Co., Ltd. | Cyclodextrin inclusion complex of taxol, and method for its production and its use |
| EP0675873A4 (en) | 1992-12-11 | 2000-03-29 | Chiron Corp | Synthesis of encoded polymers |
| US5681943A (en) * | 1993-04-12 | 1997-10-28 | Northwestern University | Method for covalently linking adjacent oligonucleotides |
| WO1994024143A1 (en) | 1993-04-12 | 1994-10-27 | Northwestern University | Method of forming oligonucleotides |
| US5840485A (en) | 1993-05-27 | 1998-11-24 | Selectide Corporation | Topologically segregated, encoded solid phase libraries |
| WO1994028028A1 (en) * | 1993-05-27 | 1994-12-08 | Selectide Corporation | Topologically segregated, encoded solid phase libraries |
| JPH09500378A (en) | 1993-07-02 | 1997-01-14 | リンクス セラピューティクス,インコーポレイティド | Focused synthesis of branched and intricately linked polymeric structures |
| US5473060A (en) | 1993-07-02 | 1995-12-05 | Lynx Therapeutics, Inc. | Oligonucleotide clamps having diagnostic applications |
| US5571903A (en) | 1993-07-09 | 1996-11-05 | Lynx Therapeutics, Inc. | Auto-ligating oligonucleotide compounds |
| US6087186A (en) | 1993-07-16 | 2000-07-11 | Irori | Methods and apparatus for synthesizing labeled combinatorial chemistry libraries |
| GB9315847D0 (en) | 1993-07-30 | 1993-09-15 | Isis Innovation | Tag reagent and assay method |
| DK96093D0 (en) | 1993-08-25 | 1993-08-25 | Symbicom Ab | IMPROVEMENTS IN MOLECULAR MODELING AND DRUG DESIGN |
| CN1525171A (en) | 1993-10-01 | 2004-09-01 | ŦԼ�и��ױ��Ǵ�ѧ���� | Multiple combinatorial chemistry libraries encoded with markers |
| US5503805A (en) * | 1993-11-02 | 1996-04-02 | Affymax Technologies N.V. | Apparatus and method for parallel coupling reactions |
| US6165778A (en) | 1993-11-02 | 2000-12-26 | Affymax Technologies N.V. | Reaction vessel agitation apparatus |
| BR9407947A (en) | 1993-11-02 | 1996-11-26 | Affymax Tech Nv | Process for synthesizing diverse molecules on a plurality of substrates and a labeled molecular collection to perform copulation reactions on beads in parallel to screen a labeled molecular collection to detect the presence of one or more different labels and to determine the sequence of synthesis apparatus for reactions parallel copulation devices on solid supports optical alignment block for use with an optical detector delivery systems for dispensing device reagents |
| WO1995016788A1 (en) * | 1993-12-17 | 1995-06-22 | Cubicciotti Roger S | Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices |
| WO1995019567A1 (en) * | 1994-01-13 | 1995-07-20 | The Trustees Of Columbia University In The City Of New York | Synthetic receptors, libraries and uses thereof |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| US5449613A (en) * | 1994-03-01 | 1995-09-12 | The University Of Iowa Research Foundation | Reacting an enzyme in a non-aqueous solvent by adding a lyophilizate of enzyme and salt to the solvent |
| US6936477B2 (en) * | 1994-04-13 | 2005-08-30 | The Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| US5643722A (en) | 1994-05-11 | 1997-07-01 | Trustees Of Boston University | Methods for the detection and isolation of proteins |
| JPH08268A (en) | 1994-06-16 | 1996-01-09 | Koichi Nishigaki | Method of producing ligated double-stranded dna |
| US5663046A (en) | 1994-06-22 | 1997-09-02 | Pharmacopeia, Inc. | Synthesis of combinatorial libraries |
| JPH10507160A (en) * | 1994-06-23 | 1998-07-14 | アフィマックス テクノロジーズ エヌ.ブイ. | Photoactive compounds and methods of using the same |
| MX9700725A (en) | 1994-07-26 | 1997-05-31 | Scripps Research Inst | Soluble combinatorial libraries. |
| US5846719A (en) * | 1994-10-13 | 1998-12-08 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
| US5604097A (en) | 1994-10-13 | 1997-02-18 | Spectragen, Inc. | Methods for sorting polynucleotides using oligonucleotide tags |
| US5695934A (en) | 1994-10-13 | 1997-12-09 | Lynx Therapeutics, Inc. | Massively parallel sequencing of sorted polynucleotides |
| US6045671A (en) | 1994-10-18 | 2000-04-04 | Symyx Technologies, Inc. | Systems and methods for the combinatorial synthesis of novel materials |
| US5985356A (en) | 1994-10-18 | 1999-11-16 | The Regents Of The University Of California | Combinatorial synthesis of novel materials |
| WO1996024847A1 (en) | 1995-02-10 | 1996-08-15 | Smithkline Beecham Corporation | A process for identifiying pharmaceutically active agents using an epitope-tagged library |
| US5843650A (en) | 1995-05-01 | 1998-12-01 | Segev; David | Nucleic acid detection and amplification by chemical linkage of oligonucleotides |
| US5679519A (en) | 1995-05-09 | 1997-10-21 | Oprandy; John J. | Multi-label complex for enhanced sensitivity in electrochemiluminescence assay |
| US6210900B1 (en) * | 1995-05-23 | 2001-04-03 | Smithkline Beecham Corporation | Method of encoding a series of combinatorial libraries and developing structure activity relationships |
| US5830658A (en) | 1995-05-31 | 1998-11-03 | Lynx Therapeutics, Inc. | Convergent synthesis of branched and multiply connected macromolecular structures |
| US5824471A (en) | 1995-06-05 | 1998-10-20 | Brigham And Women's Hospital | Detection of mismatches by cleavage of nucleic acid heteroduplexes |
| US5958792A (en) | 1995-06-07 | 1999-09-28 | Chiron Corporation | Combinatorial libraries of substrate-bound cyclic organic compounds |
| EP0832287B1 (en) | 1995-06-07 | 2007-10-10 | Solexa, Inc | Oligonucleotide tags for sorting and identification |
| WO1997004131A1 (en) | 1995-07-21 | 1997-02-06 | Forsyth Dental Infirmary For Children | Single primer amplification of polynucleotide hairpins |
| US5780613A (en) * | 1995-08-01 | 1998-07-14 | Northwestern University | Covalent lock for self-assembled oligonucleotide constructs |
| US5795976A (en) * | 1995-08-08 | 1998-08-18 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of nucleic acid heteroduplex molecules by denaturing high-performance liquid chromatography and methods for comparative sequencing |
| US5723320A (en) * | 1995-08-29 | 1998-03-03 | Dehlinger; Peter J. | Position-addressable polynucleotide arrays |
| AU7247896A (en) | 1995-09-29 | 1997-04-17 | Scripps Research Institute, The | Protein signature analysis |
| US5763175A (en) * | 1995-11-17 | 1998-06-09 | Lynx Therapeutics, Inc. | Simultaneous sequencing of tagged polynucleotides |
| AU7564296A (en) | 1995-11-17 | 1997-06-11 | Ciba-Geigy Ag | Solid phase synthesis of heterocyclic compounds and combinatorial compound library |
| US5763263A (en) * | 1995-11-27 | 1998-06-09 | Dehlinger; Peter J. | Method and apparatus for producing position addressable combinatorial libraries |
| US6537776B1 (en) * | 1999-06-14 | 2003-03-25 | Diversa Corporation | Synthetic ligation reassembly in directed evolution |
| JP2002515738A (en) | 1996-01-23 | 2002-05-28 | アフィメトリックス,インコーポレイティド | Nucleic acid analysis |
| US6613508B1 (en) * | 1996-01-23 | 2003-09-02 | Qiagen Genomics, Inc. | Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques |
| US5880972A (en) | 1996-02-26 | 1999-03-09 | Pharmacopeia, Inc. | Method and apparatus for generating and representing combinatorial chemistry libraries |
| WO1997035198A1 (en) | 1996-03-22 | 1997-09-25 | Ontogen Corporation | Methods for spatially-dispersed positionally-encoded combinatorial library synthesis |
| US6294325B1 (en) | 1996-07-05 | 2001-09-25 | The Mount Sinai School Of Medicine Of The City University Of New York | Cloning and expression of thermostable multi genes and proteins and uses thereof |
| US5821356A (en) * | 1996-08-12 | 1998-10-13 | The Perkin Elmer Corporation | Propargylethoxyamino nucleotides |
| US6355490B1 (en) | 1996-09-13 | 2002-03-12 | Jill Edie Hochlowski | Attached tags for use in combinatorial chemistry synthesis |
| DE19642751A1 (en) | 1996-10-16 | 1998-04-23 | Deutsches Krebsforsch | Saccharide library |
| EP0962527B1 (en) | 1996-10-17 | 2004-08-04 | Mitsubishi Chemical Corporation | Molecule that homologizes genotype and phenotype and utilization thereof |
| US5954874A (en) | 1996-10-17 | 1999-09-21 | Hunter; Charles Eric | Growth of bulk single crystals of aluminum nitride from a melt |
| US6261804B1 (en) | 1997-01-21 | 2001-07-17 | The General Hospital Corporation | Selection of proteins using RNA-protein fusions |
| US6127533A (en) | 1997-02-14 | 2000-10-03 | Isis Pharmaceuticals, Inc. | 2'-O-aminooxy-modified oligonucleotides |
| US5739314A (en) | 1997-04-25 | 1998-04-14 | Hybridon, Inc. | Method for synthesizing 2'-O-substituted pyrimidine nucleosides |
| ATE250668T1 (en) * | 1997-05-28 | 2003-10-15 | Discerna Ltd | RIBOSOME COMPLEXES AS SELECTION PARTICLES FOR IN VITRO DISPLAY AND EVOLUTION OF PROTEINS |
| US6969584B2 (en) | 1997-06-12 | 2005-11-29 | Rigel Pharmaceuticals, Inc. | Combinatorial enzymatic complexes |
| WO1998058256A1 (en) | 1997-06-16 | 1998-12-23 | The University Of North Carolina At Chapel Hill | PEPTIDO OLIGONUCLEOTIDES (PONs) AND THEIR COMBINATORIAL LIBRARIES |
| US6607878B2 (en) * | 1997-10-06 | 2003-08-19 | Stratagene | Collections of uniquely tagged molecules |
| US6348322B1 (en) | 1997-10-17 | 2002-02-19 | Duke University | Method of screening for specific binding interactions |
| US20030004122A1 (en) * | 1997-11-05 | 2003-01-02 | Leonid Beigelman | Nucleotide triphosphates and their incorporation into oligonucleotides |
| US6232066B1 (en) * | 1997-12-19 | 2001-05-15 | Neogen, Inc. | High throughput assay system |
| AU2871299A (en) | 1998-02-21 | 1999-09-06 | Alan W. Schwabacher | One dimensional chemical compound arrays and methods for assaying them |
| US6316616B1 (en) | 1998-04-02 | 2001-11-13 | President And Fellows Of Harvard College | Parallel combinatorial approach to the discovery and optimization of catalysts and uses thereof |
| EP1068356B8 (en) | 1998-04-03 | 2007-01-03 | Adnexus Therapeutics, Inc. | Addressable protein arrays |
| EP1073730A1 (en) | 1998-04-17 | 2001-02-07 | Whitehead For Biomedical Research | Use of a ribozyme to join nucleic acids and peptides |
| EP1068216B1 (en) * | 1998-05-15 | 2003-12-10 | Isis Innovation Limited | Libraries of oligomers labelled with different tags |
| US6287765B1 (en) * | 1998-05-20 | 2001-09-11 | Molecular Machines, Inc. | Methods for detecting and identifying single molecules |
| US6096875A (en) * | 1998-05-29 | 2000-08-01 | The Perlein-Elmer Corporation | Nucleotide compounds including a rigid linker |
| US5948648A (en) * | 1998-05-29 | 1999-09-07 | Khan; Shaheer H. | Nucleotide compounds including a rigid linker |
| JP2002517474A (en) | 1998-06-10 | 2002-06-18 | グリコデザイン インコーポレイテッド | Directed combinatorial compound libraries and high-throughput assays for screening them |
| AU6502599A (en) | 1998-10-05 | 2000-04-26 | Lynx Therapeutics, Inc. | Enzymatic synthesis of oligonucleotide tags |
| AU6295999A (en) | 1998-10-09 | 2000-05-01 | Pharmacopeia, Inc. | Selecting codes to be used for encoding combinatorial libraries |
| US6175001B1 (en) | 1998-10-16 | 2001-01-16 | The Scripps Research Institute | Functionalized pyrimidine nucleosides and nucleotides and DNA's incorporating same |
| AU1318400A (en) | 1998-10-19 | 2000-05-08 | Board Of Trustees Of The Leland Stanford Junior University | Dna-templated combinatorial library chemistry |
| AU6188699A (en) | 1998-10-28 | 2000-05-15 | Novozymes A/S | Method for generating a gene library |
| US5942609A (en) * | 1998-11-12 | 1999-08-24 | The Porkin-Elmer Corporation | Ligation assembly and detection of polynucleotides on solid-support |
| US6209546B1 (en) * | 1998-11-30 | 2001-04-03 | Truman W. Ellison | Apparatus and method for improved hydrate formation and improved efficiency of recovery of expansion agent in processes for expanding tobacco and other agricultural products |
| US6087112A (en) | 1998-12-30 | 2000-07-11 | Oligos Etc. Inc. | Arrays with modified oligonucleotide and polynucleotide compositions |
| EP1141301A4 (en) | 1999-01-08 | 2003-04-02 | Ceres Inc | DNA FRAGMENTS DETERMINED ACCORDING TO THEIR SEQUENCE AND CORRESPONDING POLYPEPTIDES CODED BY SAID FRAGMENTS |
| EP2360270B1 (en) * | 1999-05-20 | 2016-11-09 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| EP1198591B1 (en) | 1999-06-25 | 2011-03-16 | Nanosphere, Inc. | Nanoparticles having oligonucleotides attached thereto and uses therefor |
| IL147037A0 (en) | 1999-07-27 | 2002-08-14 | Phylos Inc | Peptide acceptor ligation methods |
| GB9920194D0 (en) | 1999-08-27 | 1999-10-27 | Advanced Biotech Ltd | A heat-stable thermostable DNA polymerase for use in nucleic acid amplification |
| WO2001016151A1 (en) * | 1999-08-27 | 2001-03-08 | Japan Science And Technology Corporation | Reversible photocoupling nucleic acid and phosphoroamidite |
| US20020048760A1 (en) * | 1999-12-10 | 2002-04-25 | Hyseq, Inc. | Use of mismatch cleavage to detect complementary probes |
| AU783689B2 (en) | 2000-01-24 | 2005-11-24 | Adnexus Therapeutics, Inc. | Sensitive, multiplexed diagnostic assays for protein analysis |
| AU2001234779A1 (en) | 2000-02-03 | 2001-08-14 | Nanoscale Combinatorial Synthesis, Inc. | Structure identification methods using mass measurements |
| US20020127598A1 (en) * | 2000-03-27 | 2002-09-12 | Wenqiang Zhou | Solution-phase combinatorial library synthesis and pharmaceutically active compounds produced thereby |
| US7682837B2 (en) * | 2000-05-05 | 2010-03-23 | Board Of Trustees Of Leland Stanford Junior University | Devices and methods to form a randomly ordered array of magnetic beads and uses thereof |
| CA2409305C (en) | 2000-05-19 | 2011-01-11 | Richard B. Williams | In vitro evolution of nucleic acids and encoded polypeptide |
| US7244560B2 (en) | 2000-05-21 | 2007-07-17 | Invitrogen Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites |
| JP2003536073A (en) * | 2000-06-05 | 2003-12-02 | カイロン コーポレイション | Microarrays for performing proteomics analysis |
| US20020115068A1 (en) * | 2000-06-23 | 2002-08-22 | Ian Tomlinson | Matrix screening method |
| JP2004502705A (en) | 2000-07-03 | 2004-01-29 | メルク エンド カムパニー インコーポレーテッド | Coding methods in combinatorial libraries |
| JP2002024382A (en) | 2000-07-05 | 2002-01-25 | Nec Corp | System and method for medical treatment in home care |
| US6811977B2 (en) | 2000-07-27 | 2004-11-02 | California Institute Of Technology | Rapid, quantitative method for the mass spectrometric analysis of nucleic acids for gene expression and genotyping |
| US20020072887A1 (en) | 2000-08-18 | 2002-06-13 | Sandor Szalma | Interaction fingerprint annotations from protein structure models |
| US7718600B2 (en) | 2000-09-29 | 2010-05-18 | The Trustees Of Princeton University | IAP binding compounds |
| DE10051427C1 (en) * | 2000-10-17 | 2002-06-13 | Adam Mueller | Process for the production of an extract containing tetrahydrocannabinol and cannabidiol from cannabis plant material and cannabis extracts |
| US20020146723A1 (en) | 2000-10-25 | 2002-10-10 | Krontiris Theodore G. | Candidate region mismatch scanning for genotyping and mutation detection |
| JP2002315577A (en) | 2000-11-14 | 2002-10-29 | Gencom Co | Method for constructing nucleic acid library |
| US7678554B2 (en) | 2001-03-19 | 2010-03-16 | President And Fellows Of Harvard College | Nucleic acid shuffling |
| US7070928B2 (en) * | 2001-03-19 | 2006-07-04 | President And Fellows Of Harvard College | Evolving new molecular function |
| WO2002083951A1 (en) | 2001-04-10 | 2002-10-24 | Northeastern University | Multiplexed ligand/protein binding assays with pna labels |
| CA2446206A1 (en) * | 2001-05-03 | 2002-11-14 | Warnex Research Inc. | A molecular tag code for monitoring a product and process using same |
| WO2004059289A2 (en) * | 2001-05-22 | 2004-07-15 | Epicentre Technologies | Target-dependent transcription using deletion mutants of n4 rna polymerase |
| WO2002099078A2 (en) | 2001-06-05 | 2002-12-12 | Irm Llc | Functional proteomic profiling |
| CN1539014A (en) * | 2001-06-20 | 2004-10-20 | ŦΤ¬ɭ��˾ | Modulated molecules and methods of using such molecules |
| EP1401850A1 (en) * | 2001-06-20 | 2004-03-31 | Nuevolution A/S | Nucleoside derivatives for library preparation |
| US20060234231A1 (en) | 2001-06-20 | 2006-10-19 | Nuevolution A/S | Microarrays displaying encoded molecules |
| US20040161741A1 (en) * | 2001-06-30 | 2004-08-19 | Elazar Rabani | Novel compositions and processes for analyte detection, quantification and amplification |
| DE10145226A1 (en) | 2001-09-13 | 2003-04-10 | Lifebits Ag | Manufacture of carrier-bound molecules |
| GB0122284D0 (en) | 2001-09-14 | 2001-11-07 | Ici Plc | Method for roller coating rough surfaces |
| CA2466164A1 (en) * | 2001-10-30 | 2003-05-08 | Nanomics Biosystems Pty, Ltd. | Device and methods for directed synthesis of chemical libraries |
| WO2003062417A1 (en) | 2002-01-22 | 2003-07-31 | Mitsubishi Chemical Corporation | Rna-dna ligation product and utilization thereof |
| WO2003078445A2 (en) | 2002-03-15 | 2003-09-25 | Nuevolution A/S | A building block forming a c=c double bond upon reaction |
| DK1483585T3 (en) | 2002-03-08 | 2009-06-22 | Eidgenoess Tech Hochschule | Encoded, self-assembling chemical libraries (ESACHEL) |
| AU2003218630A1 (en) | 2002-03-15 | 2003-09-29 | Nuevolution A/S | A building block capable of functional entity transfer to nucleophil |
| DE60324778D1 (en) * | 2002-03-15 | 2009-01-02 | Nuevolution As | AN IMPROVED METHOD FOR SYNTHESIS OF MATTRESS-RELATED MOLECULES |
| US20050221318A1 (en) | 2002-03-15 | 2005-10-06 | Gouliaev Alex H | Building block forming a c-c bond upon reaction |
| US20050247001A1 (en) | 2002-03-15 | 2005-11-10 | Nuevolution A/S | Building block forming a c-c or a c-hetero atom bond uponreaction |
| EP1488009A4 (en) | 2002-03-22 | 2007-07-11 | Univ Emory | MODEL DRIVEN METHODS FOR SYNTHESIZING POLYMERS AND COMPONENTS RELATING THERETO |
| GB0213816D0 (en) | 2002-06-14 | 2002-07-24 | Univ Aston | Method of producing DNA and protein libraries |
| EP1520040A2 (en) | 2002-06-20 | 2005-04-06 | Nuevolution A/S | Microarrays displaying encoded molecules |
| WO2004009814A1 (en) | 2002-07-23 | 2004-01-29 | Nuevolution A/S | Gene shuffling by template switching |
| WO2004013070A2 (en) | 2002-08-01 | 2004-02-12 | Nuevolution A/S | Multi-step synthesis of templated molecules |
| WO2004016767A2 (en) | 2002-08-19 | 2004-02-26 | The President And Fellows Of Harvard College | Evolving new molecular function |
| US20040197845A1 (en) | 2002-08-30 | 2004-10-07 | Arjang Hassibi | Methods and apparatus for pathogen detection, identification and/or quantification |
| EP1539953A2 (en) | 2002-09-12 | 2005-06-15 | Nuevolution A/S | Proximity-aided synthesis of templated molecules |
| JP2006500959A (en) * | 2002-09-30 | 2006-01-12 | パラレル バイオサイエンス, インコーポレイテッド | Polynucleotide synthesis and labeling by dynamic sampling binding |
| DK3299463T3 (en) * | 2002-10-30 | 2020-12-07 | Nuevolution As | ENZYMATIC CODING |
| WO2004039962A2 (en) | 2002-10-30 | 2004-05-13 | Pointilliste, Inc. | Methods for producing polypeptide-tagged collections and capture systems containing the tagged polypeptides |
| WO2004050899A2 (en) | 2002-12-03 | 2004-06-17 | Archemix Corporation | Method for in vitro selection of 2’-substituted nucleic acids |
| ATE450609T1 (en) | 2002-12-19 | 2009-12-15 | Nuevolution As | SYNTHESIS METHOD GUIDED BY QUASI-RANDOM STRUCTURES AND FUNCTIONS |
| CA2513889A1 (en) * | 2003-01-29 | 2004-08-19 | 454 Corporation | Double ended sequencing |
| US20070026397A1 (en) * | 2003-02-21 | 2007-02-01 | Nuevolution A/S | Method for producing second-generation library |
| EP1597394A2 (en) | 2003-02-21 | 2005-11-23 | Nuevolution A/S | A method for obtaining structural information about an encoded molecule |
| JP4054871B2 (en) | 2003-02-24 | 2008-03-05 | 独立行政法人産業技術総合研究所 | Thermostable DNA ligase |
| US7915201B2 (en) * | 2003-03-20 | 2011-03-29 | Nuevolution A/S | Ligational encoding of small molecules |
| WO2004099441A2 (en) | 2003-05-09 | 2004-11-18 | Hyscite Discovery As | Selection and evolution of chemical libraries |
| WO2004110964A2 (en) | 2003-06-16 | 2004-12-23 | Nuevolution A/S | Encoded molecules by translation (emt) |
| WO2005003778A2 (en) | 2003-07-02 | 2005-01-13 | Nuevolution A/S | A method for identifying a synthetic molecule having affinity towards a target |
| EP1652123A2 (en) | 2003-07-03 | 2006-05-03 | Biogen Idec MA Inc. | STRUCTURAL INTERACTION FINGERPRINT (SIFt) |
| EP1533385A1 (en) | 2003-09-05 | 2005-05-25 | Nuevolution A/S | Templated compounds for generation of encoded molecules and directional methods using such compounds |
| WO2005026387A1 (en) | 2003-09-18 | 2005-03-24 | Nuevolution A/S | A method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| RU2470077C2 (en) | 2003-12-17 | 2012-12-20 | ГЛЭКСОСМИТКЛАЙН ЭлЭлСи | Biologically active compound containing coding oligonucleotide (versions), method for synthesis thereof, library of compounds (versions), method for synthesis thereof, and method of searching for compound bound with biological target (versions) |
| US7972994B2 (en) * | 2003-12-17 | 2011-07-05 | Glaxosmithkline Llc | Methods for synthesis of encoded libraries |
| EP1723255B1 (en) * | 2004-02-17 | 2010-12-29 | Nuevolution A/S | Method for enrichment involving elimination by mismatch hybridisation |
| WO2005090566A2 (en) | 2004-03-22 | 2005-09-29 | Nuevolution A/S | Ligational encoding using building block oligonucleotides |
| WO2005116213A2 (en) | 2004-04-15 | 2005-12-08 | President And Fellows Of Harvard College | Directed evolution of proteins |
| CA2587010C (en) | 2004-11-08 | 2017-08-15 | Vipergen Aps | Structural nucleic acid guided chemical synthesis |
| EP1828381B1 (en) | 2004-11-22 | 2009-01-07 | Peter Birk Rasmussen | Template directed split and mix systhesis of small molecule libraries |
| KR20120127754A (en) | 2004-12-20 | 2012-11-23 | 제넨테크, 인크. | Pyrrolidine inhibitors of iap |
| JP4969459B2 (en) | 2005-01-21 | 2012-07-04 | プレジデント アンド フェロウズ オブ ハーバード カレッジ | Free reactants used in nucleic acid template synthesis |
| US7968289B2 (en) | 2005-05-03 | 2011-06-28 | Ensemble Therapeutics Corporation | Turn over probes and use thereof for nucleic acid detection |
| CA2610027A1 (en) | 2005-05-26 | 2006-11-30 | Ensemble Discovery Corporation | Biodetection by nucleic acid-templated chemistry |
| US20090163371A1 (en) | 2005-05-31 | 2009-06-25 | Stern Andrew M | Anchor-Assisted Fragment Selection and Directed Assembly |
| WO2006133312A2 (en) | 2005-06-07 | 2006-12-14 | President And Fellows Of Harvard College | Ordered multi-step synthesis by nucleic acid-mediated chemistry |
| WO2006135654A2 (en) | 2005-06-07 | 2006-12-21 | President And Fellows Of Harvard College | Polymer evolution via templated synthesis related applications |
| NZ564545A (en) | 2005-06-09 | 2011-03-31 | Praecis Pharm Inc | Methods for synthesis of encoded libraries |
| US20090035824A1 (en) * | 2005-06-17 | 2009-02-05 | Liu David R | Nucleic acid-templated chemistry in organic solvents |
| US8183178B2 (en) | 2005-06-17 | 2012-05-22 | President And Fellows Of Harvard College | Iterated branching reaction pathways via nucleic acid-mediated chemistry |
| WO2007011722A2 (en) | 2005-07-15 | 2007-01-25 | President And Fellows Of Harvard College | Reaction discovery system |
| WO2007016488A2 (en) | 2005-07-29 | 2007-02-08 | Ensemble Discovery Corporation | Analysis of encoded chemical libraries |
| EP1940755A2 (en) | 2005-10-28 | 2008-07-09 | Praecis Pharmaceuticals Inc. | Methods for identifying compounds of interest using encoded libraries |
| LT2336315T (en) | 2005-12-01 | 2017-11-10 | Nuevolution A/S | Enzymatic encoding methods for efficient synthesis of large libraries |
| WO2007124758A1 (en) | 2006-05-03 | 2007-11-08 | Vipergen Aps | A method for preparing compounds by nucleic acid directed synthesis |
| WO2008014238A2 (en) | 2006-07-24 | 2008-01-31 | Tetralogic Pharmaceuticals Corporation | Dimeric iap inhibitors |
| WO2008036273A2 (en) | 2006-09-18 | 2008-03-27 | Ensemble Discovery Corporation | Receptor family profiling |
| EP2066813A2 (en) | 2006-09-28 | 2009-06-10 | Ensemble Discovery Corporation | Compositions and methods for biodetection by nucleic acid-templated chemistry |
| US8383370B2 (en) | 2007-01-30 | 2013-02-26 | The Rockefeller University | Modified RNA ligase for efficient 3′ modification of RNA |
| CN101952719A (en) | 2007-07-27 | 2011-01-19 | 通信改革公司 | Detection assay method and uses thereof |
| WO2009077173A2 (en) | 2007-12-19 | 2009-06-25 | Philochem Ag | Dna-encoded chemical libraries |
| TW201011006A (en) | 2008-06-16 | 2010-03-16 | Nuevolution As | IAP binding compounds |
| CN101963939A (en) | 2009-07-23 | 2011-02-02 | 鸿富锦精密工业(深圳)有限公司 | Embedded electronic device and calibration method of program execution in embedded electronic device |
| WO2011089872A1 (en) | 2010-01-22 | 2011-07-28 | パナソニック株式会社 | Image management device, image management method, program, recording medium, and integrated circuit |
| CA2832672A1 (en) | 2010-04-16 | 2011-10-20 | Nuevolution A/S | Bi-functional complexes and methods for making and using such complexes |
-
2003
- 2003-07-30 WO PCT/DK2003/000516 patent/WO2004013070A2/en not_active Ceased
- 2003-07-30 US US10/523,006 patent/US10730906B2/en active Active
- 2003-07-30 EP EP03766117.0A patent/EP1539980B1/en not_active Expired - Lifetime
- 2003-07-30 AU AU2003247266A patent/AU2003247266A1/en not_active Abandoned
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990005785A1 (en) | 1988-11-18 | 1990-05-31 | The Regents Of The University Of California | Method for site-specifically incorporating unnatural amino acids into proteins |
| DE19646372C1 (en) | 1995-11-11 | 1997-06-19 | Evotec Biosystems Gmbh | Conjugates of polypeptide and encoding nucleic acid |
| WO1998031700A1 (en) | 1997-01-21 | 1998-07-23 | The General Hospital Corporation | Selection of proteins using rna-protein fusions |
| WO2000032823A1 (en) | 1998-12-02 | 2000-06-08 | Phylos, Inc. | Dna-protein fusions and uses thereof |
| WO2000061775A1 (en) | 1999-04-08 | 2000-10-19 | Pavel Sergeev | Synthesis of biologically active compounds in cells |
Non-Patent Citations (7)
| Title |
|---|
| BAIN ET AL.: "Biosynthetic site-specific incorporation of a non-natural amino acid into a polypeptide", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 111, no. 20, 1989, pages 8013 - 8014 |
| GARTNER ET AL.: "The generality of DNA-templated synthesis as a basis for evolving non-natural small molecules", JOURNAL OF AMERICAN CHEMICAL SOCIETY, UNITED STATES, vol. 123, no. 28, 18 July 2001 (2001-07-18), pages 6961 - 6963, XP002265222, DOI: doi:10.1021/ja015873n |
| KEILER ET AL.: "Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA", SCIENCE; UNITED STATES, vol. 271, no. 5251, 16 February 1996 (1996-02-16), pages 990 - 993, XP002265223, DOI: doi:10.1126/science.271.5251.990 |
| KURZ ET AL.: "cDNA - protein fusions: covalent protein - gene conjugates for the in vitro selection of peptides and proteins", CHEMBIOCHEM - EUROPEAN JOURNAL OF CHEMICAL BIOLOGY, vol. 2, no. 9, 3 September 2001 (2001-09-03), pages 666 - 672, XP002415941, DOI: doi:10.1002/1439-7633(20010903)2:9<666::AID-CBIC666>3.0.CO;2-# |
| NAZARENKO ET AL.: "Nucleic Acids Research", vol. 25, 1 January 1997, OXFORD UNIVERSITY PRESS, article "A closed tube format for amplification and detection of DNA based energy transfer", pages: 2516 - 2521 |
| NOREN ET AL.: "A general method for site-specific incorporation of unnatural amino acids into protein", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, vol. 244, 14 April 1989 (1989-04-14), pages 182 - 188 |
| YAMANE ET AL.: "Discrimination between D- and L-tyrosyl transfer ribonucleic acids in peptide chain elongation", BIOCHEMISTRY, vol. 20, no. 25, 8 December 1981 (1981-12-08), pages 7059 - 7064 |
Cited By (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7070928B2 (en) | 2001-03-19 | 2006-07-04 | President And Fellows Of Harvard College | Evolving new molecular function |
| US7727713B2 (en) | 2001-06-20 | 2010-06-01 | Nuevolution A/S | Templated molecules and methods for using such molecules |
| US10669538B2 (en) | 2001-06-20 | 2020-06-02 | Nuevolution A/S | Templated molecules and methods for using such molecules |
| US7413854B2 (en) | 2002-03-15 | 2008-08-19 | Nuevolution A/S | Method for synthesising templated molecules |
| US10731151B2 (en) | 2002-03-15 | 2020-08-04 | Nuevolution A/S | Method for synthesising templated molecules |
| US10730906B2 (en) | 2002-08-01 | 2020-08-04 | Nuevolutions A/S | Multi-step synthesis of templated molecules |
| US11001835B2 (en) | 2002-10-30 | 2021-05-11 | Nuevolution A/S | Method for the synthesis of a bifunctional complex |
| AU2003273792B2 (en) * | 2002-10-30 | 2011-07-07 | Nuevolution A/S | Method for the synthesis of a bifunctional complex |
| WO2004039825A3 (en) * | 2002-10-30 | 2004-10-28 | Nuevolution As | Method for the synthesis of a bifunctional complex |
| US10077440B2 (en) | 2002-10-30 | 2018-09-18 | Nuevolution A/S | Method for the synthesis of a bifunctional complex |
| AU2011226815B2 (en) * | 2002-10-30 | 2014-09-25 | Nuevolution A/S | Enzymatic encoding |
| EP2348125A3 (en) * | 2002-10-30 | 2012-07-04 | Nuevolution A/S | Method for the synthesis of a bifunctional complex |
| EP2348124A3 (en) * | 2002-10-30 | 2012-03-21 | Nuevolution A/S | Synthesis of a bifunctional complex |
| WO2004074501A3 (en) * | 2003-02-21 | 2004-09-30 | Nuevolution As | A method for obtaining structural information about an encoded molecule |
| WO2004074429A3 (en) * | 2003-02-21 | 2004-09-30 | Nuevolution As | Method for producing second-generation library |
| US7915201B2 (en) | 2003-03-20 | 2011-03-29 | Nuevolution A/S | Ligational encoding of small molecules |
| WO2004083427A3 (en) * | 2003-03-20 | 2005-02-17 | Nuevolution As | Ligational encoding of small molecules |
| EP2236606A3 (en) * | 2003-03-20 | 2010-10-20 | Nuevolution A/S | Ligational encoding of small molecules |
| US11965209B2 (en) | 2003-09-18 | 2024-04-23 | Nuevolution A/S | Method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| US11118215B2 (en) | 2003-09-18 | 2021-09-14 | Nuevolution A/S | Method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| US7972994B2 (en) | 2003-12-17 | 2011-07-05 | Glaxosmithkline Llc | Methods for synthesis of encoded libraries |
| US7972992B2 (en) | 2003-12-17 | 2011-07-05 | Praecis Pharmaceuticals, Inc. | Methods for synthesis of encoded libraries |
| US7935658B2 (en) | 2003-12-17 | 2011-05-03 | Praecis Pharmaceuticals, Inc. | Methods for synthesis of encoded libraries |
| US8410028B2 (en) | 2003-12-17 | 2013-04-02 | Glaxosmithkline Llc | Methods for synthesis of encoded libraries |
| WO2005090566A3 (en) * | 2004-03-22 | 2006-03-09 | Nuevolution As | Ligational encoding using building block oligonucleotides |
| US7704925B2 (en) | 2004-03-22 | 2010-04-27 | Nuevolution A/S | Ligational encoding using building block oligonucleotides |
| CN101107357B (en) * | 2005-01-21 | 2013-01-02 | 哈佛大学校长及研究员协会 | Free reactants used in nucleic acid-templated syntheses |
| AU2006206219B2 (en) * | 2005-01-21 | 2012-07-26 | President And Fellows Of Harvard College | Free reactant use in nucleic acid-templated synthesis |
| WO2006079061A3 (en) * | 2005-01-21 | 2006-09-28 | Harvard College | Free reactant use in nucleic acid-templated synthesis |
| JP2008528000A (en) * | 2005-01-21 | 2008-07-31 | プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ | Free reactants used in nucleic acid template synthesis |
| US7989395B2 (en) | 2005-10-28 | 2011-08-02 | Glaxosmithkline Llc | Methods for identifying compounds of interest using encoded libraries |
| US11702652B2 (en) | 2005-12-01 | 2023-07-18 | Nuevolution A/S | Enzymatic encoding methods for efficient synthesis of large libraries |
| US12606817B2 (en) | 2009-02-13 | 2026-04-21 | X-Chem, Inc. | Methods of creating and screening DNA-encoded libraries |
| JP2017201991A (en) * | 2009-02-13 | 2017-11-16 | エックス−ケム インコーポレイテッド | Methods for making and screening DNA-encoded libraries |
| EP3653763A1 (en) * | 2009-02-13 | 2020-05-20 | X-Chem, Inc. | Methods of creating and screening dna-encoded libraries |
| EP2396459B1 (en) | 2009-02-13 | 2017-05-03 | X-Chem, Inc. | Methods of creating and screening dna-encoded libraries |
| US9359601B2 (en) | 2009-02-13 | 2016-06-07 | X-Chem, Inc. | Methods of creating and screening DNA-encoded libraries |
| CN102317513B (en) * | 2009-02-13 | 2018-01-02 | X-化学有限公司 | Methods of generating and screening DNA-encoded libraries |
| EP3211126B1 (en) | 2009-02-13 | 2020-10-21 | X-Chem, Inc. | Methods of creating and screening dna-encoded libraries |
| CN102317513A (en) * | 2009-02-13 | 2012-01-11 | X-化学有限公司 | Methods of generating and screening DNA-encoded libraries |
| US11168321B2 (en) | 2009-02-13 | 2021-11-09 | X-Chem, Inc. | Methods of creating and screening DNA-encoded libraries |
| EP2396459A1 (en) | 2009-02-13 | 2011-12-21 | X-Chem, Inc. | Methods of creating and screening dna-encoded libraries |
| US11225655B2 (en) | 2010-04-16 | 2022-01-18 | Nuevolution A/S | Bi-functional complexes and methods for making and using such complexes |
| EP2748357B1 (en) | 2011-09-07 | 2018-04-04 | X-Chem, Inc. | Methods for tagging dna-encoded libraries |
| US10865409B2 (en) | 2011-09-07 | 2020-12-15 | X-Chem, Inc. | Methods for tagging DNA-encoded libraries |
| EP3351631B1 (en) | 2011-09-07 | 2020-11-04 | X-Chem, Inc. | Methods for tagging dna-encoded libraries |
| EP3392338B1 (en) | 2012-07-13 | 2020-12-09 | X-Chem, Inc. | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
| US11674135B2 (en) | 2012-07-13 | 2023-06-13 | X-Chem, Inc. | DNA-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
| EP2872680B1 (en) | 2012-07-13 | 2018-04-04 | X-Chem, Inc. | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
| EP3083957B1 (en) | 2013-12-20 | 2018-05-23 | Philochem AG | Production of encoded chemical libraries |
Also Published As
| Publication number | Publication date |
|---|---|
| US10730906B2 (en) | 2020-08-04 |
| AU2003247266A8 (en) | 2004-02-23 |
| WO2004013070A3 (en) | 2004-03-25 |
| AU2003247266A1 (en) | 2004-02-23 |
| EP1539980B1 (en) | 2016-02-17 |
| US20060121470A1 (en) | 2006-06-08 |
| EP1539980A2 (en) | 2005-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10730906B2 (en) | Multi-step synthesis of templated molecules | |
| US7413854B2 (en) | Method for synthesising templated molecules | |
| US10669538B2 (en) | Templated molecules and methods for using such molecules | |
| EP2305808B1 (en) | Templated molecules and methods for using such molecules | |
| KR102242879B1 (en) | Methods for tagging dna-encoded libraries | |
| EP1539953A2 (en) | Proximity-aided synthesis of templated molecules | |
| KR20200100206A (en) | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases | |
| DK1539980T3 (en) | Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides that identify the molecules | |
| US10731151B2 (en) | Method for synthesising templated molecules | |
| DK2186897T3 (en) | An improved method for the synthesis of templated molecules | |
| ZA200406941B (en) | An improved method for synthesising templated molecules. | |
| Class et al. | Patent application title: TEMPLATED MOLECULES AND METHODS FOR USING SUCH MOLECULES | |
| JP2005521365A6 (en) | An improved method for synthesizing templated molecules. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2003766117 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003766117 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2006121470 Country of ref document: US Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10523006 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10523006 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: JP |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |


