WO2004013070A2 - Multi-step synthesis of templated molecules - Google Patents

Multi-step synthesis of templated molecules Download PDF

Info

Publication number
WO2004013070A2
WO2004013070A2 PCT/DK2003/000516 DK0300516W WO2004013070A2 WO 2004013070 A2 WO2004013070 A2 WO 2004013070A2 DK 0300516 W DK0300516 W DK 0300516W WO 2004013070 A2 WO2004013070 A2 WO 2004013070A2
Authority
WO
WIPO (PCT)
Prior art keywords
template
codon
molecule
templated
building block
Prior art date
Application number
PCT/DK2003/000516
Other languages
French (fr)
Other versions
WO2004013070A3 (en
Inventor
Henrik Pedersen
Original Assignee
Nuevolution A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nuevolution A/S filed Critical Nuevolution A/S
Priority to ES03766117T priority Critical patent/ES2572203T3/en
Priority to AU2003247266A priority patent/AU2003247266A1/en
Priority to SI200332480A priority patent/SI1539980T1/en
Priority to EP03766117.0A priority patent/EP1539980B1/en
Priority to US10/523,006 priority patent/US10730906B2/en
Priority to DK03766117.0T priority patent/DK1539980T3/en
Publication of WO2004013070A2 publication Critical patent/WO2004013070A2/en
Publication of WO2004013070A3 publication Critical patent/WO2004013070A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1068Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis

Definitions

  • the present invention relates to a method for the manufacture of a library of complexes.
  • Each complex in the library comprises a templated molecule attached to the template which directed the synthesis thereof.
  • the library of the invention is useful in the quest for new biologicar active compounds, such as drugs.
  • the central dogma of biology describes the one-way flow of information from DNA to RNA to protein.
  • methods such as phage display, peptides- on-plasmids, ribosome display and mRNA-protein fusion have been developed, allowing the transfer of information from the level of protein/peptide to RNA or DNA.
  • This has enabled the use of molecular evolution to be applied on huge numbers of peptides that are exposed to an enrichment process, where after the enriched pool of molecules (enriched for a particular feature, such as binding to receptor protein) are amplified, by exploiting information flow from the peptide to DNA and then amplifying the DNA.
  • a partitioning with respect to affinity towards the target is conducted and the identifier oligonucleotide part of the bifunctional molecule is amplified by means of PCR.
  • the PCR amplicons are sequenced and decoded for identification of the biochemical polymer.
  • Halpin and Harbury have in WO 00/23458 suggested an improvement to the approach stipulated immediately above, wherein the molecules formed are not only identified but also directed by the nucleic acid tag.
  • the approach is based on the traditional split-and-combine strategy for synthesis of combina- torial libraries comprising two or more synthetic steps.
  • Plurality nucleic acid templates are used, each having at one end a chemical reactive site and dispersed throughout the stand a plurality of codons regions, each of said codon regions in turn specifying different codons.
  • each of the strands, identified by a first codon region is reacted at the chemical reaction sites with specific selected reagents.
  • the split- and-combine method is conducted an appropriate number of times to produce a library of typically between 10 3 and 10 6 different compounds.
  • the split-and-combine method is cumbersome and generates only a relatively small library.
  • the present invention aims at obtaining a library of compounds which are not only encoded by a suitable tag attached to each compound, but also directed.
  • the directed synthesis of the compounds of the library allows for renewed synthesis of templated molecules following a selection round.
  • Fur- thermore the present invention increases the probability of connection of molecular entities eventually appearing in the templated molecule due to a higher local concentration of the reactive groups involved in the formation of the connection.
  • the present invention relates to a method for the manufacture of a library of complexes comprising templated molecules, said method comprises the steps of a) providing a plurality of different templates comprising a number of cod- ing regions and a reactive group, wherein each coding region of a specific template specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of a template, and the functional entity comprises at least one reactive group, c) contacting the plurality of different templates with a subset of the plurality of different building blocks, said subset having anti-codons which complement the unique codons of a specific coding region, said con- tacting being performed under conditions which allow specific hybridisation of the anti-codons to the unique codons of the templates, d) reacting the reactive group of the template and the reactive group of the
  • the present invention allow for a multi-step templated synthesis of a library of molecules without the need for a laborious and time consuming split step of the traditional split and-mix-method.
  • the method furthermore provides for the possibility of bringing the functional entities of building blocks in close proximity, thus allowing facilitated connection of functional entities in the vicinity of each other.
  • the bringing in close proximity of building blocks provide for an increased local concentration of the active chemical groups, thus increasing the probability that two reactive groups will be so close that a reaction actu- ally will occur.
  • the various templates of the present invention are in general constructed to follow a general scheme.
  • a number of coding regions are provided on the template.
  • each of the coding regions speci- fies one or more unique codons.
  • a specific template comprises a given number of unique codons.
  • the plurality of templates can, taken as a whole, be characterized as a library comprising the total amount of the different combinations of unique codons possible, or any subset thereof.
  • the coding regions are suitable positioned in a linear sequence, such that the individual coding regions are positioned immediately next to each other. In some embodiments, it may be of advantage to use a branched template to ensure proximity of reactive groups, the introduction of catalysts in the vicinity of the reactive groups or the introduction of as third reactant.
  • the templates used in the present invention in- elude a reactive group.
  • the reactive group comprised by the template may be covalently or non-covalently attached to the template. Covalent attachment may be preferred when the templated molecule is to be effectively attached to the template, because a covalent bonding will allow affinity selection using more harsh conditions.
  • the covalent attachment of the reactive group may be done at a terminal region of the template or at a central region thereof.
  • the reactive group is non-covalently attached to the template using a complementing element hybridised to the template. More particularly, it is preferred that the reactive group of the template is part of a building block hybridised to the template.
  • the coding regions may be spaced with a suitable spacer region.
  • the spacer region may be an indentifier for the coding region of may be a region not carrying any information but serving to bring the functional entities into the desired proximity or to provide the template with a desired physical characteris- tic like a stiff connection of coding regions, or alternative, a flexible connection between two coding regions.
  • the template may comprise flanking regions.
  • One of the flanking regions can in an aspect of the invention serve to immobilize the template to a surface of a solid support.
  • the flanking region can encompasses a signal group, such a flourophor or a radio active group, to allow a direct detection of the presence of the template.
  • the plurality of templates used in the present invention may in one embodi- ment be represented by the general formula:
  • Coding region 1 through Coding region n independently specifies m unique codons, F and F' are optional flanking regions,
  • S 1 to S n are optional spacing groups, n is an integer of at least 2, and m is an integer of at least 1.
  • the unique codons of the templates are preferably composed of a sequence of nucleic acid monomers, such as nucleotides. Each codon is unique in the sense that within the same coding region no other codons have an identical sequence and length of nucleic acid monomers. Preferably, a unique codon does not have a corresponding sequence anywhere in the plurality of tem- plates. To avoid hybridisation between individual templates it is also desirable to design each of the unique codons such that the complementary sequence thereof does not exist on any other templates.
  • the number of coding regions may be selected in accordance with inter alia the number of the desired final templated compounds, the building blocks available and the envisaged structure of the templated compound. According to the invention the number of coding regions is preferably at least 3 to achieve the desired diversity. The upper limit for the number of coding regions has not yet been elucidated; however it is believed that a number ex- ceeding 100 may give practical problems. Generally, it is preferred to use templates having between 3 and 50 coding regions, more preferably between 3 and 30 and still more preferred between 4 and 15.
  • the number of unique codons may be se- lected according to the need for diversity.
  • the number of unique codons in each of the coding regions may be similar or different.
  • the number of unique codons can be as low as one. This may be the choice when a so-called scaf- fold is involved in the evolving templated molecule.
  • the upper limit for the number of unique codons may be chosen quit high as long as specific hybridisation of oligonucleotides of the anti-codons to their complements on the templates occurs.
  • An example of an upper limit may be 10,000, but may be chosen below this limit or above according to the need.
  • the building blocks essential for the present invention are generally composed of three elements, viz. an anti-codon, a functional entity, and a linker which connects the anti-codon and the functional entity.
  • the anti-codon is a sequence of nucleic acid monomers complementary to the sequence of a unique codon on at least one of the plurality of templates.
  • building blocks are provided which possesses anti-codons complementing all the unique codons of the variety of templates.
  • some of the building blocks carrying anti-codons for selected unique codons are not present. The latter situation may occur when termination of the synthesis is desired at different stages or when the absences of certain functional entities on the templated molecule are desirable.
  • anti-codons not associated with any functional entity may be present for steric reasons or to avoid unintended hybridisation events.
  • the design of the anti-codons and the complementing unique codons may be aimed at obtaining essentially the same annealing temperature for all or some of the codon:anti-codon hybrids to ensure that all the anti-codons have been annealed to the template before the functional entities are connected to each other through a chemical reaction.
  • the annealing temperature of the codon:anti-codon hybrids within the same coding region is designed to have different annealing temperature. The separate reaction may be accompliced by initially raising the temperature above the annealing temperature for all the hybrids and slowly decreasing the tempera- ture until the first set of anti-codons anneal to its templates.
  • the temperature is decreased sufficient for allowing an- other building blocks to anneal to a coding region in the vicinity.
  • a further design involves annealing temperatures different for each of the coding regions but similar within a specific coding region.
  • a connection between the functional entities and the other functional entities or nascent templated molecules is performed.
  • a new building block is annealed to the template and a subsequent connection is performed.
  • the functional entity of the building block serves the function of being a precursor for the structural entity eventually incorporated into the templated molecule.
  • the functional entity is designed to be capable of being connected to a functional entity of another building block or a nascent templated molecule.
  • the connection is aided by one or more reactive groups of the functional entity.
  • the number of reactive groups which appear on the functional entity is suita- bly one to ten.
  • a building block featuring only one reactive group is used i.a. in the end positions of polymers or scaffolds, whereas building blocks having two reactive groups are suitable for the formation of the body part of a polymer or scaffolds capable of being reacted further. Two or more reactive groups intended for the formation of connections, are typically present on scaffolds.
  • a scaffold is a core structure, which forms the basis for the creation of multiple variants.
  • the variant forms of the scaffold is typically formed through reaction of reactive groups of the scaffold with reactive groups of other building blocks, optionally mediated by fill-in groups or catalysts, under the creation of a connection between the entities.
  • the functional entities to be connected to the scaffold may contain one, two or several reactive groups able to form connections.
  • linkers are durable during the entire synthesis to ensure the connection between the scaffolded molecule and the template. It is essential for the invention that at least one linker is maintained in order to ensure the coupling of the templated molecule to the template which directed the synthesis thereof. In a final state of the production of the templated molecule the at least one linker emanating from a building block may be substituted by another entity securing the adherence of the template molecule to the tem- plate.
  • the durable linkers are preferably cleavable at a final stage to separate the templated molecule from the template or a complementary template. Therefore, the durable linkers may be referred to as selectively cleavable linkers.
  • the linkers of the building blocks are also cleavable during the synthesis of the templated molecule, i.e. the functional entity may be released from the building block to allow the synthesis of the templated molecule.
  • the linker may be attached to the anti-codon at a central area thereof or at one of the ends.
  • the anti-codon and the linker is a contiguous oligonucleotide, i.e. a part of the nucleotide complements a sequence of the template and another part is non-complementing avoiding the hybridisation of the oligonucleotide part to the template.
  • This design of the building blocks is a convenient way of design as no separate reaction step is required for the attachment of the linker to the anti-codon.
  • the linker is attached to a central part of the anti- codon to allow for the ligation of neighbouring anti-codons using suitable en- zymes to produce a complementary template.
  • the linker can be attached to the functional entity according to the functionalities desired.
  • the linker is attached to the functional entity through a reactive group capable of forming a connection to another func- tional entity or a nascent templated molecule.
  • suitable reactive groups are imine groups (-NH-) and disulfide groups (-S-S-).
  • the bonding of the functional entity to the linker can be cleaved simultaneously with the reaction of the inter-spacing reactive group or the cleavage can be performed in a separate step.
  • linkers connected to a functional entity through a reactive group which is cleaved simultaneously with the formation of the connection are referred to as translocating linkers.
  • Translocating linkers allow for the production of templated polymers, which are connected to the template that directed the synthesis thereof via the terminal building block, when a reactive group on a functional entity in the vicinity reacts to form a connection.
  • the separate formation of the connection between a functional entity and another functional entity or evolving templated molecule and the cleavage of the linker is an advantage because more than one connection may be formed prior to the cleavage.
  • a subset of the building blocks is contacted with the plurality of templates in the initial phase of the production of the library.
  • the subset of the total amount of building blocks is selected to have anti-codons which complement unique codons of a specific coding region on the template. It may be of advantage to have the building blocks in the vicinity of the reactive group of the template. In the event, the reactive group of the template is a part of a building block, it is preferred that the building blocks to be linked together is at- tached in the vicinity of each other to ensure a sufficient proximity of the functional entities.
  • the subset comprises building blocks having anti- codons which form hybrids with unique codons in two neighbouring coding regions.
  • the subset may be provided by adding the building blocks separately, or alternatively, by adding all the building blocks or a major portion thereof and then direct the annealing of the individual building blocks by proper design of the codon :anti-codon hybrids, as depicted above.
  • the conditions which allow specific hybridisation of the unique codons and the anti-codons are influenced by a number of factors including temperature, salt concentration, type of puffer, and acidity. It is within the capabilities of the person skilled in the art to select appropriate conditions to ensure that the contacting between the templates and the building blocks are performed at hybridisation conditions.
  • connection between two functional entities usually occurs by a reaction between reactive groups present on each functional entity. It may, however, be desirable to make the bridging between two reactive groups on separate functional entities through a suitable fill-in group. The latter situation may occur, for example, when two similar reactive groups, such as a two amine groups, are not able to react with each other directly.
  • the two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings.
  • one of the linkers connected thereto may be cleaved. However, this step is optional. It is possible to continue with the incorporation of further building blocks without this cleaving step.
  • the connection of the functional entities and the cleavage of one of the linkers occur simultaneously. This aspect of the invention is of particular relevance when the reactive group able to react with another reactive group of a functional entity in the vicinity thereof, is the bridging group to the linker.
  • the propagation part of the method is initiated by contacting the plurality of different templates harbouring the nascent templated compound with a further subset of the plurality of building blocks, said subset having anti-codons complementary to the unique codons of a coding region in the vicinity of the coding region(s) harbouring the nascent templated molecules.
  • it can be suitable to hybridise the further building blocks to a coding region neighbouring the building block(s) harbouring the nascent templated molecule.
  • the subset of building blocks may be provided by adding building blocks separately which hybridise to a specific coding region.
  • different stringency conditions combined with appropriate design of the individual codon:anti-codon hybrids can be selected to allow the predominate annealing of a subset of building blocks to selected codon regions.
  • the alternative way of forming a subset has the advantage that all or at least a major part of the building blocks can be added to the reaction vessel.
  • An example of directing the annealing is to design the first two coding regions such that they have a relatively high annealing temperature, whereas the subsequent building blocks to be annealed have a gradually decreasing annealing temperature.
  • the functional entity of the further building block is allowed to form a chemical connection to the nascent templated molecule.
  • the formation of the chemical connection normally proceeds by reaction between reactive groups present on the functional entity and the nascent templated molecule, respectively. It may, however, be desirable to make the bridging between two reactive groups through a suitable spacer group. The latter situation may for example occur when two similar reactive groups, such as a two amine groups, are not able to react with each other directly.
  • the two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings.
  • one or more of the linkers may optionally be cleaved, however ensuring that at least one linker is durable.
  • the propagation part of the method may be repeated a desired number of times to evolve the templated molecule. Each repetition of the propagation is initiated by contacting the templated with a new subset of further building blocks.
  • the attachment of the templated molecule or the complementary template is different.
  • none of the linkers are cleaved during the synthesis, which is when the optional cleavage of linkers of step g) is not performed. This may lead to a templated molecule attached to a number of linker similar to the number of building blocks involved in the synthesis.
  • the complexes obtained in step i) comprise templated molecules attached to the template which templated the syntheses thereof via the linker of a single building block.
  • the number of linkers may be anywhere between these two extremes in the templated molecule.
  • the templated molecule it is of advantage to have more than one linker, e.g. when the conformation of the templated molecule can be stabilized or even altered. In general, it is sufficient for the templated molecule to be attached to the template through a single linker to allow the subsequent enrichment process to proceed efficiently.
  • the attachment via a building block involves the use of hydrogen bondings between the codon and the anti-codon to ensure the coupling of the template and the templated molecule. As is well-known within the art, hydrogen bondings are weak bondings that may easily be disrupted.
  • the building block finally harbouring the templated molecule may be attached to the template through a codon.anti-codon hybrid having a higher annealing temperature than the other codon:anti-codon hybrids of the template.
  • the templated molecule is connected with the template which directed the syntheses thereof via a covalent link.
  • the covalent link may be in addition to the hydrogen bondings or the covalent link may be a substitution. The presence of a covalent link allows for a more harsh chemical treatment of the complex.
  • the covalent link is selectively cleavable to provide for a separation of the templated molecule from the complementary template.
  • the method according to the present invention may involve the further step of cleaving all but one linker after the formation of the templated molecule.
  • This further step implies that some or all of the linkers in step g) are not cleaved during the synthesis of the templated molecule.
  • the method according to the invention may, as a further step, involve the transfer of the templated molecule to an anchorage point on the template, or a sequence complementing the template, to establish an effective chemical connection between the template and the templated molecule.
  • An effective coupling of the templated molecule to the template or a sequence complementary to the template can be desirable to allow for denaturing enrichment conditions or denaturing post-templating modification of the manufactured molecule.
  • the anchorage may involve the presence of a reactive group on the templated molecule and a reaction partner on the template, whereby the reaction between these reactive groups will establish a covalent link.
  • the anchorage point may be present on a complementary sequence hybridised to the template.
  • the complementing sequence has a higher annealing temperature than one or more of the building blocks, notably the terminal building block, to enable usage of a higher stringency during enrichment and , optionally, clearance of used building blocks.
  • the anti-codons can, after the cleavage of the linker, remain hybridised to the unique codons or can be detached from the template. When it is chosen to detach the anti-codons, they are preferably cleared from the solution to avoid any re-hybridisation or interference with nucleic acids intended to participate in an hybridisation event.
  • the anti-codons following the cleavage of the linker attached thereto remain hybridised to the unique codons because the anti-codons attached to the templates can be ligated together to create a complementary template.
  • the ligation of the anti- codons may be performed after all or the majority of building blocks have been incorporated or, in the alternative, the ligation can be performed after the incorporation of each new building block. Furthermore, in some occasions, it may be of advantage to ligate the anti-codons together prior to the cleavage of the linkers.
  • the ligation of the all the anti-codons provide a direct covalent link between the complementing template and the templated mole- cule.
  • the covalent link is preferably designed to allow the separation of the templated molecule from the complementing template. The separation of the templated molecule will in general during an enrichment process appear as one of the later steps.
  • the covalent link is selectively cleavable, i.e. cleavable under certain chemi- cal conditions not used in the prior steps of enrichment.
  • the templated molecule is released by the use of enzymes.
  • restriction nucleases may be used by the incorporation of a restriction site close to the templated molecule.
  • Another example is to use a phos- phodiesterase to perform a total or partly digest of the template or comple- menting template.
  • the use of ligation also have another advantage, because it is possible to use anti-codons having a shorter sequence of nucleotides.
  • An example of a typically anti-codon will have 15 to 25 nucleotides in sequence to obtain an appropriate annealing temperature of around 40 to 70°C.
  • a ligase or a chemical crosslink By ligating building blocks in the vicinity of each other using a ligase or a chemical crosslink, it becomes possible to incorporate very small anti-codons (e.g. 4-10 nucleotides) with high specificity and efficiency.
  • the ligation of a small anti-codon to another anti-codon or a complementing template increases the total annealing temperature.
  • a result of using smaller anti-codons is that, the local con- centration of functional entities is increased, and therefore, the efficiency of the reaction between the reactive groups becomes more efficient.
  • Another way to increase the proximity further is to provide building blocks intended to interact with each other, with a reversible interacting molecule pair.
  • the molecule pair allows a building block to form a reversible coupling to another building block in the vicinity thereof through the interaction of the two parts of the pair situated on each building block.
  • the molecule pair is also termed a dimerisation domain and is located in the functional entity or is a portion of the linker that is close to the functional entity.
  • the dimer- isation domains of two building blocks intended to react with each other are designed to have an affinity to each other. Examples of dimerisation domains include leucine-rich areas, coiled-coil structures, antibody-antigen pairs, complementing sequences of nucleotides, ect.
  • the affinity of the dimerisation of two building blocks are preferably lower than the affinity between the codon and the anti-codon to allow for shifting dimerisation partners though performing temperature cycles.
  • the dimerisation domains of two building blocks intended to interact are sequences of nucleotides, the length of the sequences may be chosen to obtain an annealing temperature below room temperature but preferably above 5°C, e.g. between 10°C and 20°C.
  • the dimerisation domain includes two complementing oligonucleotides, the domain is also referred to as a "zipper box".
  • a suitable temperature scheme for the propagation step of the present invention is to add a building block to the template at a temperature above the annealing temperature for said building block.
  • the temperature is lowered below the annealing temperature to allow the new building block as well as the building block harbouring the nascent templated molecule to find and bind to their respective parts of the template. Excess building blocks and debris are then preferably washed away. Then the temperature is decreased below the annealing temperature of the dimerisation domain and consequently the probability that the functional entities are connected is increased. Potentially, the conditions in the reaction vessel, other than the temperature, may be changed to provide for the connection. Following the connection between the functional entities/templated molecules, the temperature is raised and the temperature scheme is repeated.
  • a method of increasing the proximity further is to apply a "rigid" linker attached to the anti-codon with molecular hinges.
  • a result of using a rigid linker is that a smaller three dimensional space is sampled by the functional entity. Thereby the probability is increased that two functional entities in the vicinity of each other and attached to a rigid linker will be close enough to each other for a reaction to proceed.
  • a rigid linker may be prepared by various methods available to the skilled person in the art. An example is to use a double stranded oligonucleotide.
  • the anti-codon and the linker is performed of a contiguous oligonucleotide, wherein the anti- codon domain of the oligonucleotide is able to hybridise to a unique codon of a template and a suffer domain is able to hybridise to a further oligonucleotide complementary thereto.
  • the hinges may be provided by any group allowing essentially unhindered rotation about at least one bonding.
  • a hinge may be provided in the above preferred embodiment by separation of the anti- codon domain and the stiffer domain with at least one nucleotide.
  • a hinge may be provided by a single stranded region positioned between the double stranded unique codon:anti-codon hybrid and the double stranded rigid linker.
  • the template is covalently connected to the complementing template. The connection may be performed by covalently bonding the two hybridised strings to each other.
  • the template may at one end be designed with a hair pin loop to enable the ligation of the template end to an anti-codon.
  • the templated molecule will be linked to a double stranded template.
  • the double stranded template may be an advantage because it is more stable allowing more versatile chemical reactions.
  • a library of complexes is obtainable from the above methods.
  • the library may be used for a variety of applications, including the search for compounds for use in therapeutic or diagnostic methods and plant protection compounds, like pesticides, fungicides ect.
  • the library may comprise any number of complexes according to the invention. At one extreme, the library consists of only two complexes. At the other extreme, the library can consist of up to 10 18 complexes. Usually, the number of complexes is to be selected between these to extremes.
  • an enrichment of a library of complexes comprising templated molecules with respect to a predetermined activity comprises the steps of: i) establishing a first library of complexes comprising templated molecules, said library being obtainable according to any of the methods of the invention, ii) exposing the library to conditions enriching the library with complexes having the predetermined activity, iii) amplifying the complexes of the enriched library, iv) optionally, repeating step ii) to iii), and v) obtaining an enriched library having a higher ratio of complexes comprising templated molecules with the predetermined activity.
  • the amplification of the complexes of the enriched library comprises the steps of contacting the library of complexes with amplification means, amplifying the templates or the complementing templates, and conducting the method according to the invention using the amplification product as templates.
  • the amplification means can be any of the nucleic acid amplification means suitable for the amplification of the template, such as PCR.
  • the amplification of the complex comprises a 10 1 to 10 15 -fold amplification.
  • the steps ii) and iii) are repeated at least 2, 3, 5 times, such as at least 10 times, such as at least 15 times.
  • the complexes may be identified after the completion of each cycle or may be only be identified after the last cycle. There is no explicit need for intermediate identifications as the amplification can be performed without knowing the sequence of the template or a sequence complementing the template, if the template or the complement thereof is provided with suitable primer regions.
  • the identification after the enrichment process involves the determination of the sequence of the template and/or the structural determination of the templated molecule and/or the entire complex having the predetermined activity.
  • the conditions enriching the library comprise contacting a binding partner to the templated molecules of interest.
  • the binding partner may be in solution or may be directly or indirectly immobilised on a support.
  • the enrichment is in general performed using an affinity or activity assay.
  • the enrichment is conducted by screening for complexes having an affinity for - or an effect on - a target molecule or a target entity.
  • the enrichment is conducted by selection for catalytic activity.
  • the conditions enriching the library involves any one or more of electrophoretic separation, gelfiltration, immunoprecipitation, isoelectric focusing, centrifugation, and immobilization.
  • the enrichment process can involve cells.
  • the conditions enriching the library comprises providing cells capable of internalising the templated molecule, or performing an interaction with the templated molecule having the desired predetermined activity.
  • the invention also entails to a method for the manufacture of a complex of a templated molecule attached to the template which directed the synthesis thereof, said method comprises the steps of a) providing a template comprising a number of coding regions and a re- active group, wherein each coding region specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of the template, and the functional entity comprises at least one reactive group, c) contacting the template with a building block having an anti-codon which complements the unique codon of a specific coding region, said contacting being per ormed under conditions which allow specific hybridisation of the anti-codon
  • the templated molecule can be obtained from the complex by cleaving the linker(s) of the one or more building blocks to release the templated molecule from the template.
  • the codons occurring in nature consist of a sequence of three nucleic acid monomers.
  • the length of the codon sequence may be of the same order in accordance with the present invention but is preferably longer to obtain a suitable annealing temperature.
  • the sequence is selected to produce an annealing temperature above normal room temperature.
  • annealing temperature and melting temperature may be used interchangeably said temperature being defined as the maximum of the first derivative of the absorbance vs. temperature curve.
  • the different codons need no to be of the same lengths, that is to comprise the same number of nucleic acid monomers. However, a typically number of nucleic acid monomers in the codon sequence is normally above 6 but below 25.
  • Each nucleic acid monomer is normally composed of three parts, namely a nucleobase moiety, a sugar moiety and a intemucleoside linker.
  • nucleobase moiety may be selected among naturally occurring nucleo- bases as well as non-naturally occurring nucleobases. It should be clear to the person skilled in the art that various nucleobases which previously have been considered “nonnaturally occurring” have subsequently been found in nature. Thus, “nucleobase” includes not only the known purine and pyrimi- dine hetero-cycles, but also heterocyclic analogues and tautomers thereof.
  • nucleobases are adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N 6 -methyladenine, 7- deazaxanthine, 7-deazaguanine, N 4 ,N 4 -ethanocytosin, N 6 ,N 6 -ethano-2,6- diamino-purine, 5-methylcytosine, 5-(C 3 -C 6 )-alkynylcytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocy- tosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S.
  • nucleobase is intended to cover every and all of these examples as well as analogues and tautomers thereof.
  • Especially interesting nucleobases are adenine, guanine, thymine, cytosine, 5-methylcytosine, and uracil, which are considered as the naturally occurring nucleobases in relation to therapeutic and diagnostic application in humans.
  • the sugar moiety is suitably a pentose but may be the appropriate part of an PNA.
  • Suitable examples of possible pentoses include ribose, 2'-deoxyribose,
  • nucleobase is attached to the 1' position of the pentose entity.
  • An intemucleoside linker connects the 3' end of preceding monomer to a 5' end of a succeeding monomer.
  • the intemucleoside linkage may be the natu- ral occurring phospodiester linkage or a derivative thereof. Examples of such derivatives include phosphorothioate, methylphosphonate, phosphoramidate, phosphotriester, and phosphodithioate.
  • the intemucleoside linker can be any of a number of non-phosphorous-containing linkers known in the art.
  • Preferred nucleic acid monomers include naturally occurring nucleosides forming part of the DNA as well as the RNA family connected through phos- phodiester linkages.
  • the members of the DNA family include de- oxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine.
  • the members of the RNA family include adenosine, guanosine, uridine, cytidine, and inosine.
  • Each codon is complemented by an anti-codon.
  • the anticodon has the ability specifically to engage with the codon which it complements.
  • the affinity between the codon and the complementing anti-codon is affected through hydrogen bondings following the well-known Watson-Crick base pairing system.
  • the anti-codon may be composed of the same kind of nucleic acid monomers as the codon itself.
  • Linkers connecting the anti-codon and functional entity of building blocks may be selected from a variety of possibilities.
  • Linkers may include one or more reactive groups in order to obtain a selectively cleavable linker, a cleavable linker, and a translocating linkers.
  • Suitable linkers may be selected from but are not limited to, the group comprising: carbohydrides and substituted car- bohydrides; vinyl, polyvinyl and substituted polyvinyl; acetylene, polyacety- lene; aryl/hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl; ethers, polyethers such as e.g.
  • polyethylenglycol and substituted polyethers amines, polyamines and substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides and substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides; and polyamides and natural and un- natural polypeptides and substituted polyamides and natural and unnatural polypeptides.
  • the functional entity may comprise one or more functional groups, i.e. groups which eventually form part of the templated molecule.
  • the templated molecule may comprise one or more of the following functional groups either alone or in combination:
  • Drugs e.g., taxol moiety, acyclovir moiety, "natural products"
  • Supramolecular structures e.g. nanoclusters
  • Oligonucleotides e.g., PNA, LNA, mor- pholinos
  • Reactive groups relates among other things to groups which form part of the functional entity and are capable of participating in a reaction that form a connection between two functional entities, either directly or via a suitable bridging molecular entity. Examples of reactive groups are listed below:
  • N-carboxyanhydrides NCA
  • N-thiocarboxyanhydrides (NTA) 3. Amines
  • esters 10.Thioesters 11. conjugated system of double bonds
  • UDP-activated saccharides 18.Sulfides 19.Cyanates 20.CarbonylimidazoIe
  • alpha-, beta-, gamma-, and omega-peptides Mono-, di- and tri-substituted peptides; L- and D-form peptides; Cyclohexane- and cyclopentane-backbone modified beta-peptides; Vinylogous polypeptides; glycopolypeptides; polyamides; vinylogous sulfonamide peptide; polysulfonamide; conjugated peptide (i.e., having prosthetic groups); polyesters; polysaccharides; polycarbamates; polycarbonates; polyureas; poly-peptidylphosphonates; azatides; peptoids (oligo N-substituted glycines); polyethers; ethoxyformacetal oligomers; poly- thioethers; polyethylene glycols (PEG); polyethylenes; polydisulfides; pol- yarylene sulfides; polynucleotides; PNAs
  • Selection or screening, commonly referred to as enrichment, of the library of complexes comprising templated molecules with respect to desired activities may be performed according to any standard proto- col.
  • affinity selections may be performed according to the principles used for phage displayed, polysome-displayed or mRNA-protein fusion displayed peptides.
  • Selection for catalytic activity may be performed by affinity selections on transition-state analogue affinity columns (Baca et al. , Proc. Natl. Acad. Sci USA. 1997; 94(19):10063-8), or by function-based selection schemes (Pedersen et al., Proc. Natl. Acad. Sci. USA. 1998, 95(18):10523-8).
  • Screening for a desired characteristic may be performed according to standard microtiter plate-based assays, or by FACS-sorting assays.
  • affinity selections involve the immobilisation of a target or a binding partner on a solid support, such as a column.
  • the complex manufactured according to the invention is added to the column under condi- tions allowing a part of the complexes to bind to the target.
  • the complexes not bound to the target is eluted out of the column and discharged.
  • the part of the complexes attached to the target may be amplified using the template or complementing template associated with the templated molecule.
  • oligonucleotides can be amplified by any state of the art method. These methods include, but is not limited to the polymerase chain reaction (PCR); as wells as e.g. nucleic acid sequence-based amplification (e.g. Compton, Nature 350, 91-92 (1991)), amplified anti-sense RNA (e.g. van Gelder et al., PNAS 85: 77652-77656 (1988)); self-sustained sequence replication system (e.g. Gnatelli et al., PNAS 87: 1874-1878 (1990)); polymerase independent amplification as described in e.g.
  • PCR polymerase chain reaction
  • nucleic acid sequence-based amplification e.g. Compton, Nature 350, 91-92 (1991)
  • amplified anti-sense RNA e.g. van Gelder et al., PNAS 85: 77652-77656 (1988)
  • self-sustained sequence replication system e
  • Ligase-mediated amplification methods may also be used, e.g., LCR (Ligase Chain Reaction).
  • non-natural nucleotides the choices of efficient amplification procedures are fewer.
  • non-natural nucleotides per definition can be incorporated by certain enzymes including polymerases, it will be possible to perform manual polymerase chain reaction by adding the polymerase during each extension cycle.
  • oligonucleotides containing nucleotide analogs For oligonucleotides containing nucleotide analogs, fewer methods for amplification exist. One may use non-enzyme mediated amplification schemes (Schmidt et al., NAR 25: 4797-4802 (1997)). For backbone- modified oligonucleotide analogs such as PNA and LNA, this amplification method may be used. Before or during amplification the templates or complementing templates may be mutagenized or recombined in order to create a larger diversity for the next round of selection or screening.
  • the method according to the invention is conducted using the amplification product as the templates.
  • the result is a reduced or enriched library of complexes of a template attached to a template molecule.
  • the selection and amplification steps may be repeated if considered neces- sary to further enrich the library.
  • the binding step involving the target and the complexes is preferably performed under more strict conditions ensuring that only a part of the complexes adhere to the target.
  • the enrichment cycles may be performed 2 to 15 times or even more with enrichment in each cycle of 10 to 1000 times.
  • the starting library amounts to 10 14 complexes.
  • the complex with the highest affinity to the target should, theoretically, be obtained.
  • the template contains natural nucleotides
  • it is a standard routine to optionally PCR amplify the isolated templates if the template is an RNA molecule, it is necessary to use reverse transcriptase to produce cDNA prior to the PCR-amplification), and then clone the DNA fragments into for example plasmids, transform these and then sequence individual plasmid- clones containing one or multiple tandem DNA sequences.
  • Sequencing can be done by the standard dideoxy chain termination method, or by more classical means such as Maxam-Gilbert sequencing.
  • the template contains non-natural nucleotides, it may not be feasible to clone individual sequences by transfer through a microbial host.
  • bead populations where each bead carries one oligonucleotide sequence, it is possible to clone in vitro, where after all the nucleotides attached to a specific bead may be optionally amplified and then sequenced (Brenner et al., 2000, Proc. Natl. Acad. Sci. USA 97, 1665-1670).
  • one may dilute the population of isolates adequately, and then aliquot into microtiter plates so that the wells on average contain for example 0.1 templates.
  • By amplifying the single templates by for example PCR it will now be possible to sequence using standard methods. Of course, this requires that the non-natural nucleotides are substrates for the thermostable polymerase used in the PCR.
  • the starting template may be designed so as to contain restriction sites on either side of the encoding/templating region of the template.
  • the templates can be restricted, to obtain a short oligonucleotide encoding the templated polymer, and then these short oligonucleotides can be applied to various analytical procedures.
  • the population of isolates can be sequenced as a whole, to obtain a consensus sequence for the population as a whole.
  • the present invention is also directed to approaches that allow selection of small molecules capable of binding to different targets.
  • the template- displaying molecule technology contains a built-in function for direct selection and amplification.
  • the binding of the selected molecule should be selective in that they only coordinate to a specific target and thereby prevent or induce a specific biological effect.
  • these binding molecules should be possible to use e.g. as therapeutic agents, or as diagnostic agents.
  • Template-displaying molecule libraries can easily be combined with screen- ings, selections, or assays to assess the effect of binding of a molecule ligand on the function of the target.
  • the template-displaying method provides a rapid means for isolating and identifying molecule ligands which bind to supra-molecular, macro-supra-molecular, macro-molecular and low-molecular structures (e.g. nucleic acids and pro- teins, including enzymes, receptors, antibodies, and glycoproteins); signal molecules (e.g. cAMP, inositol triphosphate, peptides, prostaglandins); and surfaces (e.g. metal, plastic, composite, glass, ceramics, rubber, skin, tissue).
  • supra-molecular, macro-supra-molecular, macro-molecular and low-molecular structures e.g. nucleic acids and pro- teins, including enzymes, receptors, antibodies, and glycoproteins
  • signal molecules
  • selection or partitioning in this context means any process whereby the template-displaying molecule complex bound to a target molecule, the complex-target pair, can be separated from template-displaying molecules not bound to the target molecule. Selection can be accomplished by various methods known in the art.
  • the selection strategy can be carried out so it allows selection against almost any target. Importantly, no steps in this selection strategy need any detailed structural information of the target or the molecules in the libraries. The entire process is driven by the binding affinity involved in the specific recognition/coordination of the molecules in the library to a given target. However, in some applications, if needed, functionality can also be included analogous to selection for catalytic activity using phage display (Soumillion et al. (1994) J. Mol. Biol. 237: 415-22; Pedersen et al. (1998) PNAS. 18: 10523-10528). Example of various selection procedures are described below.
  • This built-in template-displaying molecule selection process is well suited for optimizations, where the selection steps are made in series starting with the selection of binding molecules and ends with the optimized binding molecule.
  • the single procedures in each step are possible to automate using various robotic systems. This is because there is a sequential flow of events and where each event can be performed separately.
  • a suitable template-displaying molecule library and the target molecule are supplied to a fully automatic system which finally generates the optimized binding molecule. Even more preferably, this process should run without any need of external work outside the robotic system during the entire procedure.
  • the libraries of template-displayed molecules will contain molecules that could potentially coordinate to any known or unknown target.
  • the region of binding on a target could be into a catalytic site of an enzyme, a binding pocket on a receptor (e.g. GPCR), a protein surface area involved in protein- protein interaction (especially a hot-spot region), and a specific site on DNA (e.g. the major groove).
  • the template-displaying molecule technology will primarily identify molecules that coordinate to the target molecule.
  • the natural function of the target could either be stimulated (agonized) or reduced (antagonized) or be unaffected by the binding of the template-displaying molecules. This will be dependent on the precise binding mode and the par- ticular binding-site the template-displaying molecules occupy on the target.
  • the template-displaying molecule technology of the invention will permit selection procedures analogous to other display methods such as phage dis- play (Smith (1985) Science 228: 1315-1317). Phage display selection has been used successfully on peptides (Wells & Lowman. (1992) Curr. Op. Struct. Biol. 2, 597-604) proteins (Marks et al. (1992) J. Biol. Chem. 267: 16007-16010) and antibodies (Winter et al. (1994) Annu. Rev. Immunol. 12: 433-455). Similar selection procedures are also exploited for other types of display systems such as ribosome display (Mattheakis et al. (1994) Proc. Natl. Acad. Sci.
  • the template-displaying molecule technology of the invention will for the first time allow direct selection of target-specific small non-peptide molecules independently of the translation process on the ribosome complex.
  • the necessary steps included in this invention are the amplification of the templates and incorporation and reaction of the monomer building blocks. The amplification and incorporation and the incorporation and reaction are either done in the same step or in a sequential process.
  • the linkage between the templated molecule (displayed molecule) and DNA replication unit (coding template) allows a rapid identification of binding molecules using various selection strategies.
  • This invention allows a broad strategy in identifying binding molecules against any known target.
  • this technology will also allow discovery of novel unknown targets by isolating binding molecules against unknown antigens (epitopes) and use these bind- ing molecules for identification and validation (see section "Target identification and validation").
  • selection of binding molecules from the template- displaying molecule libraries can be performed in any format to identify optimal binding molecules.
  • a typical selection procedure against a purified target will include the following major steps: Generation of a template-displaying molecule library: Immobilization of the target molecule using a suitable immobilization approach; Adding the library to allow binding of the template- displayed molecules; Removing of the non-binding template-displayed molecules; Elution of the template-displayed molecules bound to the immobilized target; Amplification of enriched template-displaying molecules for identification by sequencing or to input for the next round of selection.
  • the general steps are schematically shown in Figure 27.
  • a standard selection protocol using a template- displaying molecule library is to use the bio-panning method.
  • the target e.g. protein or peptide conjugate
  • the template-displayed molecules that potentially coordi- nate to the target are the ones that are selected and enriched.
  • the selection procedure requires that the bound template-displayed molecules can be separated from the unbound ones, i.e. those in solution. There are many ways in which this might be accomplished as known to ordinary skilled in the art.
  • the first step in the affinity enrichment cycle (one round as described in Figure 27) is when the template-displayed molecules showing low affinity for an immobilized target are washed away, leaving the strongly binding template- displayed molecules attached to the target.
  • the enriched population remain- ing bound to the target after the stringent washing, is then eluted with, e.g. acid, chaotropic salts, heat, competitive elution with the known ligand or proteolytic release of the target/template molecules.
  • the eluted template- displayed molecules are suitable for PCR, leading to many orders of amplification, i.e. every single template-displayed molecule enriched in the first selection round participates in the further rounds of selection at a greatly increased copy number.
  • Immobilisation of the target (peptide, protein, DNA or other antigen) on beads might be useful where there is doubt that the target will adsorb to the tube (e.g. unfolded targets eluted from SDS-PAGE gels).
  • the derivatised beads can then be used to select from the template-displaying molecules, simply by sedimenting the beads in a bench centrifuge. Alternatively, the beads can be used to make an affinity column and the template-displaying libraries suspension recirculated through the column.
  • There are many reactive matrices available for immobilizing the target molecule including for instance attachment to -NH 2 groups and -SH groups.
  • Magnetic beads are essentially a vari- ant on the above; the target is attached to magnetic beads which are then used in the selection.
  • Activated beads are available with attachment sites for -NH 2 or -COOH groups (which can be used for coupling).
  • the target can be also be blotted onto nitrocellulose or PVDF. When using a blotting strategy, it is important to make sure the strip of blot used is blocked after immobilization of the target (e.g. with BSA or similar protein).
  • the selection or partitioning can also be performed using for example: Immunoprecipitation or indirect immunoprecipitation were the target molecule is captured together with template-displaying binding molecules; affinity column chromatography were the target is immobilized on a column and the template-displaying libraries are flowed through to capture target-binding molecules; gel-shift (agarose or polyacrylamide) were the selected template-displaying molecules migrate together with the target in the gel; FACS sorting to localize cells that coordinates template-displaying molecules; CsCI gradient centrifugation to isolate the target molecule together template-displaying binding molecules; Mass spectroscopy to identify target molecules which are labelled with template-displaying molecules; etc., without limitation. In general, any method where the template-displaying molecule/target complex can be separated from template-displaying molecules not bound to the target is useful.
  • Table 1 Examples of selection method possible to use to identify binding molecules using the template-displaying technology.
  • Soluble receptors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
  • Enzyme inhibitors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
  • Elution of template-displayed molecules can be performed in different ways.
  • the binding molecules can be released from the target molecule by denatu- ration, acid, or chaotropic salts and then transferred to another vial for amplification.
  • the elution can be more specific to reduce the background.
  • Elution can be accomplished using proteolysis to cleave a linker between the target and the immobilizing surface or between the displaying molecule and the template.
  • elution can be accomplished by competition with a known ligand.
  • the PCR reaction can be performed directly in the washed wells at the end of the selection reaction.
  • a possible feature of the invention is the fact that the binding molecules need not be elutable from the target to be selectable since only the encoding template DNA is needed for further amplification or cloning, not the binding molecule itself. It is known that some selection procedure can bind the most avid ligands so tightly as to be very difficult to elute. However the method of the invention can successfully be practiced to yield avid ligands, even covalent binding ligands.
  • Alternative selection protocol includes a known ligand as fragment of each displayed molecule in the library. That known ligand will guide the selection by coordinate to a defined part on the target molecule and focus the selection to molecules that binds to the same region. This could be especially useful for increasing the affinity for a ligand with a desired biological function but with a too low potency.
  • a further aspect of the present invention relates to methods of increasing the diversity or complexity of a single or a mixture of selected binding molecules.
  • the enriched molecules can be altered to further increase the chemical diversity or complexity of the displayed molecules. This can be performed using various methods known to the art. For example, using synthesized randomized oligonucleotides, spiked oligonucleotides or random mutagenesis. The randomization can be focused to allow preferable codons or localized to a predetermined portion or sub-sequence of the template nucleotide sequence.
  • the cells particle themselves can be used as the selection agent.
  • cells lacking the specific target should be used to do one or more rounds of negative selection or be present in large excess in the selection process.
  • irrelevant template-displayed molecules are removed.
  • the negative selection would be against the untransformed cells.
  • This approach is also called subtraction selection and has successfully been used for phage display on antibody libraries (Hoogenboom et al. (1998) Immunotech. 4: 1-20).
  • a specific example of a selection procedure can involve selection against cell surface receptors that become internalized from the membrane so that the receptor together with the selected binding molecule can make its way into the cell cytoplasm or cell nucleus. Depending on the dissociation rate constant for specific selected binding molecules, these molecules largely reside after uptake in either the cytoplasm or the nucleus.
  • the selection process can be performed in any setup where the target is used as the bait onto which the template-displaying molecules can coordinate.
  • the selection methods of the present invention can be combined with secondary selection or screening to identify molecule ligands capable of modifying target molecule function upon binding.
  • the methods described herein can be employed to isolate or produce binding molecules which bind to and modify the function of any protein or nucleic acid.
  • the method of the present invention can be employed to identify, isolate or produce binding molecules which will affect catalytic activity of target enzymes, i.e., inhibit catalysis or modifying substrate binding, affect the functionality of protein receptors, i.e., inhibit binding to receptors or modify the specificity of binding to receptors; affect the formation of protein multimers, i.e., disrupt quaternary structure of protein subunits; and modify transport properties of protein, i.e., disrupt transport of small molecules or ions by proteins.
  • a still further aspect of the present invention relates to methods allowing functionality in the selection process can also be included. For example, when enrichment against a certain target have been performed generation a number of different hits, these hits can then directly be tested for functionality (e.g. cell signalling). This can for example be performed using fluorescence- activated cell sorting (FACS).
  • FACS fluorescence- activated cell sorting
  • the altered phenotype may be detected in a wide variety of ways.
  • the changed phenotype is detected using, for example: microscopic analysis of cell morphology; standard cell viability assays, including both increased cell death and increased cell viability; standard labelling assays such as fluorometric indicator assays for the presence of level of particular cell or molecule, including FACS or other dye staining techniques; biochemical de- tection of the expression of target compounds after killing the cells; etc.
  • standard labelling assays such as fluorometric indicator assays for the presence of level of particular cell or molecule, including FACS or other dye staining techniques
  • biochemical de- tection of the expression of target compounds after killing the cells etc.
  • specific signalling pathways can be probed using various reporter gene constructs.
  • Secondary selection methods that can be combined with template-displaying molecule technology include among others selections or screens for enzyme inhibition, alteration or substrate binding, loss of functionality, disruption of structure, etc. Those of ordinary skill in the art are able to select among various alternatives of selection or screening methods that are compatible with the methods described herein.
  • the binding molecules of the invention can be selected for other properties in addition to binding, For example, during selection; stability to certain conditions of the desired working environment of the end product can be included as a selection criterion. If binding molecules which are stable in the presence of a certain protease is desired, that protease can be part of the buffer medium used during selection. Similarly, the selection can also be performed in serum or cell extracts or any type of media. As will be understood, when util- izing this template-displaying approach, conditions which disrupt or degrade the template should be avoided to allow amplification. Other desired properties can be incorporated, directly into the displaying molecules as will be understood by those skilled in the art. For example, membrane affinity can be included as a property by employing building blocks with high hydrophobicity.
  • Molecules selected by the template-displaying molecule technology can be produced by various synthetic methods. Chemical synthesis can be accomplished since the structure of selected binding molecules is readily obtained form the nucleic acid sequence of the coding template. Chemical synthesis of the selected molecules is also possible because the building blocks that compose the binding molecules are also known in addition to the chemical reactions that assemble them together.
  • the selected binding molecules is synthesized and tested in various appropriate in vitro and in vivo testing to verify the selected candidates for biological effects and potency. This may be done in a variety of ways, as will be appreciated by those in the art, and may depend on the composition of the bioactive molecule.
  • the present invention provides methods to identify or isolate targets that are involved in pathological processes or other biological events.
  • the target molecules are again preferably proteins or nucleic acids, but can also include, among others, carbohydrates and various molecules to which specific molecule ligand binding can be achieved.
  • the template-displaying molecule technology could be used to select for specific epitopes on antigens found on cells, tissues or in vivo. These epitopes might belong to a target that is involved in important biological events. In addition, these epitopes might also be involved in the biological function of the target. Phage display with antibodies and peptide libraries has been used numerous times successfully in identifying new cellular antigens, (e.g. Pasqualini et al.
  • the stability of the template in vivo will be important for amplification and identification.
  • the template can be stabilised using various nucleotide derivatives in a similar way as have been used to stabilise aptamers for in vivo applications (Nolte (1996) Nature Biotechnol. 14: 1116-1121; Pagratis et al. (1997) Nature Biotechnol. 15: 68-72).
  • nolte (1996) Nature Biotechnol. 14: 1116-1121; Pagratis et al. (1997) Nature Biotechnol. 15: 68-72).
  • Other types of protection are also possible where the template molecule is shielded for the solution using various methods. This could include for example liposomes, pegylation, binding proteins or other sorts of protection.
  • the template molecule could also be integrated into another designed structure that protects the template form external manipulation.
  • the linker can be design to be incorporated in vesicles to position the templates inside the vesicle and the displaying molecules on the outside. The arrangement will protect the template molecules from external manipulate and at the same time allow exposure of the displaying molecules to permit selection.
  • the antibody molecule is a large macromolecule (150 KDa) which will sterically reduce the access for a number of different antigens (e.g. on a cell surface).
  • the template-displaying technology should be able to access and recognize epitopes inaccessible to antibodies.
  • the small binding molecules will be able to bind into active sites, grooves and other areas on an antigen.
  • the coding template element is also smaller that an antibody which will increase the physical access of the template-binding molecule par.
  • the diversity and complexity of the template-displaying molecule libraries will be much greater compare to peptide libraries.
  • the template-displaying molecule technology has the potential to identify novel antigens which is not possible to identify with antibodies or peptides.
  • One of ordinary skill in the art will acknowledge that various types of cells can be used in the selection procedure. It will also be understood that the selection for new antigens can be performed using subtraction methods as described previously.
  • Another aspect of the present invention relates to methods to validate the identified target.
  • the identified binding molecules can directly be used if they change the biological response of the target. This can be done either in vitro using any direct or cell-based assay or directly in vivo studying any phenotypic response. The strength of this approach is that the same molecules are used both for identification and validation of various targets. Most favourable, the binding molecules could also directly be used as therapeutic agents.
  • the template-displaying molecules are used to pull out the target molecules. This can for instance be achieved by selection against a cDNA library expressed on bacteriophage (libraries vs. libraries). By mixing a template-displaying molecule library with a cDNA library it will be possible to find binding pairs between the small molecules in the template-displaying molecule library and proteins from the cDNA library.
  • One possibility is to mix a phage display library with a template display library and do a selection for either the phage or template library. The selected library is then plated to localized phage clones and the DNA coding for the phage and template displayed molecules can then be identified using PCR.
  • Other types of libraries than cDNA could also be used such as nucleic acids, carbohydrates, synthetic polymer.
  • the template-displaying molecule technology can be used to account for in vivo and in vitro drug metabolism. That could include both phase I (activation) and phase II (detoxification) reac- tions.
  • the major classes of reactions are oxidation, reduction, and hydrolysis.
  • Other enzymes catalyze conjugations. These enzymes could be used as targets in a selection process to eliminate displayed molecule that are prone to coordinate to these enzymes.
  • the templates corresponding to these displayed molecules could subsequently be used to compete or eliminate these molecules when making template-displaying molecule libraries. These obtained libraries will then be free of molecules that will have a tendency of binding to enzymes involved in phase l-ll and possible be faster eliminated.
  • cytochrome P450 enzymes flavin monooxygenase, monoamine oxidase, esterases, amidases, hydrolases, reductases, dehydrogenases, oxidases UDP-glucuronosyltransferases, glutathione S-transferases as well as other relevant enzymes could be performed to identify these binding molecules that are prone to coordinate to these metabolic enzymes.
  • Inhibitors are easily selected for due to their binding affinity but substrates need at least micro molar affinity to be identified.
  • Another interesting embodiment of this invention is the possibility to directly select for molecules that passively or actively becomes transported across epithelial plasma membrane, or other membranes.
  • One possible selection assay is to use CaCO-2 cells, a human colon epithelial cell line, which is general, accepted as a good model for the epithelial barrier in the gastroin- testinal guts.
  • the CaCO-2 assay involves growing a human colon epithelial cell line on tissue culture well inserts, such that the resultant monolayer forms a biological barrier between apical and basolateral compartments.
  • the template-displaying molecule libraries are placed either side of the cell monolayer and the molecules that can permeate the cell monolayer is col- lected and amplified. This process can be repeated until active molecules have been identified.
  • Other cell line or setup of this assay is possible and is obvious for skill in the art.
  • a still further aspect of the present invention relates methods of selecting for stability of the selected molecules. This could be performed by subjecting an enriched pool of binding molecules to an environment that will possibly degrade or change the structure of the binding molecules.
  • Various conditions could be certain proteases or a mixture of protease, cell extract, and various fluids from for example the gastrointestinal gut. Other conditions could be various salts or acid milieu or elevated temperature.
  • Another possibility is to generate a library of known ligands and subject that library to stability tests and selection to identify stable molecules under certain conditions as describe above.
  • the template-displaying molecule technology of the invention may be used for blocking or stimulating various targets.
  • a therapeutically relevant target is a substance that is known or suspected to be involved in a regulating process that is malfunctioning and thus leads to a disease state. Examples of such processes are receptor-ligand interaction, transcription-DNA in- teraction, and cell-cell interaction involving adhesion molecules, cofactor- enzyme interaction, and protein-protein interaction in intracellular signalling.
  • Target molecule means any compound of interest for which a molecule ligand is desired.
  • target can, for example, include a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds, a biological macromolecule, such as DNA or mRNA, a bacteriophage peptide display library, a ribosome peptide display library, an extract made from biological materials such as bacteria, plants, fungi, or animal (e.g. mammalian) cells or tissue, protein, fusion protein, peptide, enzyme, receptor, receptor ligand, hormone, antigen, antibody, drug, dye, growth factor, lipid, substrate, toxin, virus, or the like etc., without limitation.
  • Other examples of targets include, e.g. a whole cell, a whole tissue, a mixture of related or unrelated proteins, a mixture of viruses or bacterial strains or the like, etc., without limitation.
  • Therapeutic drug targets can be divided into different classes according to function; receptors, enzymes, hormones, transcription factors, ion channels, nuclear receptors, DNA, (Drews, J. (2000) Science 287:1960-1964).
  • receptors, nuclear receptors, and metabolic enzymes constitute overwhelmingly the majority of known targets for existing drugs.
  • G Protein-Coupled Receptors (GPCR) constitutes one of the most important classes of drug targets together with proteases for pharmacological intervention.
  • the present invention employing the template-displaying molecule technology can be utilized to identify agonists or antagonists for all these classes of drug targets, dependent on the specific properties each target holds. Most of the targets are possible to obtain in a purified form for direct selection procedures. Other targets have to be used when they are in their native environments such as imbedded cell surface receptors. In those situations the selec- tion using the template-displaying molecule libraries can be performed using subtraction-selection described previously.
  • One specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as antagonists, where the molecules block the interaction between a receptor and one or more ligands.
  • Another application includes cell targeting.
  • the generated molecules recognizing specific surface proteins or receptors will be able to bind to certain cell types.
  • Such molecules may in addition carry another therapeutic agent to increase the potency and reduce the side- effects (for example cancer treatment).
  • Applications involving antiviral agents are also included.
  • a generated molecule, which binds strongly to epitopes on the virus particle may be useful as an antiviral agent.
  • Another specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as agonists, where the molecules stimulate or activate a receptor to initiate a cellular signalling pathway.
  • Fig. 1 shows the general principle for one embodiment of the present inven- tion for the multi-step synthesis of templated molecules.
  • Fig. 2 shows the general structure of templates useful in the generation of a library.
  • Fig. 3 shows an example of design of templates fro the generation of a library.
  • Fig. 4 shows examples of building blocks for use in the preparation of a library of templated molecules.
  • Fig. 5 shows further examples of building blocks.
  • Fig. 6 shows examples of the preparation of building blocks.
  • Fig. 7 shows examples of the preparation of building blocks starting from a 5'-NH 2 derivatized oligonucleotide.
  • Fig. 8 shows a general procedure of performing one embodiment for the for- mation of the templated molecule.
  • Fig. 8 shows an example of the embodiment shown in Fig. 8 involving light induced reaction between symmetrical building blocks.
  • Fig. 9 shows a general procedure of performing one embodiment for the formation of the templated molecule.
  • Fig. 10 shows a general procedure of performing one embodiment of the invention for the formation of a mixed polymer templated molecule.
  • Fig. 10, example 1 shows examples of simultaneous reaction and cleavage of neighbouring of functional entities for the formation of (A) and alpha- peptide and (C) a polyamine.
  • Fig. 10, example 2 shows examples of simultaneous reaction and cleavage of neighbouring functional entities for the formation of (A) a peptoid, or an ⁇ - or ⁇ -peptide, and (B) a hydrazino peptide.
  • Fig. 11 depicts a templated synthesis of a polymer, using non-simultaneous reaction and cleavage.
  • Fig. 12 depicts formation of a templated molecule due to activation of reactive groups and partly release of the templated molecule for the template by ring-opening.
  • Fig. 13 shows the connection of two functional entities by the fill-in of connecting moiety.
  • Fig. 13, example 1 discloses an exemplification of Fig. 13, in which an imine is formed by a fill-in reaction.
  • Fig. 13, example 2 shows an exemplification of Fig. 13, in which an amide is formed.
  • Fig. 13, example 3 shows an exemplification of Fig. 13, in which an urea bonding is formed.
  • Fig. 13, example 3.1 shows an exemplification of Fig. 13 in which functional entities 13.3.1.A and 13.3.1. B are synthesised.
  • Fig. 13, example 4 shows the formation of chiral and achiral templated molecules.
  • Fig. 13, example 5 shows the formation of a phosphodiester bond by symmetric fill-in.
  • Fig. 13, example 6 shows the formation of a phosphodiester bond by a fill-in reaction, wherein the building block comprises a single reactive group.
  • Fig. 13, example 7 shows a pericyclic fill-in reaction.
  • Fig. 13, example 7.1 shows an exemplification of Fig. 13 in which functional entities 13.7.1. A and 13.7.1.B are synthesised.
  • Fig 14 shows a schematic representation of a fill-in reaction using asymmetric monomers.
  • Fig. 14, example 1 shows an asymmetric fill-in reaction using modified Staudinger ligation and ketone-hydrazide reaction.
  • Fig. 15 shows a schematic representation of a templated synthesis of a non- linear molecule.
  • Fig. 16 shows a representation of the templated synthesis of a non-linear molecule employing reactive groups of different classes and non- simultaneous reaction and cleavage.
  • Fig. 17 depicts a templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold.
  • Fig. 18 shows examples of the templated synthesis of non-linear molecules.
  • Fig. 19 shows a schematic representation of a templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.
  • Fig. 20 shows examples of various reactions types allowing simultaneous reaction and cleavage.
  • Fig. 21 shows examples of pairs of reactive groups (X) and (Y), and the resulting bond (XY).
  • Fig. 22 shows a schematic representation (panel A) of the zipper box principle and an example (panel B) of two building block.
  • Fig. 23 shows a schematic representation of various methods for increasing the proximity of functional entities of different building blocks.
  • Fig. 24 shows examples of the chemical constitution of a linker to be able to be cleaved.
  • Fig. 25 schematically shows the templated synthesis by generating a new reactive group.
  • Fig. 25, example 1 shows a method in which reactive groups generated in a first round subsequently are reacted with introduced reactive groups.
  • Fig. 26 shows examples of post-templating modifications of the templated molecule.
  • a long horizontal line symbolizes a template.
  • Coding region 1 symbolizes sequences that anneal to type 1 building blocks. Building blocks are symbolized as shown in figures 4-7.
  • X/Y, S/T and P/Q represent pairs of reactive groups (where the reactive groups of one pair (e.g. X and Y) are partly or fully orthogonal to the reactive groups of other pairs (e.g. S/T, P/Q)).
  • R-i, R 2 , .., R x symbolize functional groups.
  • L and Li, L 2 , L 3l ... represent cleavable linkers, where linkers of one group (e.g., Li-linkers) are cleavable under conditions where linkers of other groups (L 2 , L 3 , .7) are not cleaved, or are cleaved less efficiently.
  • linkers of one group e.g., Li-linkers
  • linkers of other groups L 2 , L 3 , .
  • the proximity effect that results from incorporating two building blocks on the same template, or alternatively, as a result of incorporating a building block on a template to which is attached a reactive group, may be enhanced by any of the methods described above or below that increases this effect.
  • the proximity effect may be increased by the introduction of zipper boxes in most of the general concepts described here.
  • the templated molecule may be coupled to the template through the non-covalent interaction of a monomer building block with the template, or alternatively, through covalent or non-covalent coupling to the template, and may be located at either of the ends of the template, or anywhere on the template.
  • the coupling reaction to the template may be performed before, during or after the synthesis of the templated molecule. For clarity, in some of the figures only the reaction step, not the cleavage step, has been included.
  • Fig. 1 The protocol for an embodiment of a multi-step templated synthesis is shown in Fig. 1 and involves a number of steps that each result in the addition of one or more molecular moieties to a growing molecule that eventually be- comes the templated molecule. Each of these steps can be divided into sub- steps.
  • a number of templates also called a library of templates
  • Each of the templates comprises a plurality of unique codons and a reactive group.
  • a plurality of different building blocks are provided, each of the building blocks comprises a functional entity separated from an anti- codon with a suitable linker.
  • the anti-codon of a specific building block complements a unique codon of a template and is, therefore, capable under proper hybridisation conditions to anneal to the unique codon.
  • the incorporation of building blocks is initiated by contacting the plurality of different templates with a subset of the entire amount of building blocks.
  • the subset car- ries anti-codons which hybridise to unique codons of a distinct coding region.
  • a connection between the reactive group of the template and the functional entity of the building blocks is obtained.
  • the reactive group of the template is part of a building block (building block 1) and the said building block is hybridised to the template.
  • the building block 1 comprising the reactive group of the template and the second build- ing block are contacted with the template simultaneously to allow for an efficient connection between the functional entities.
  • the line between FEi and FE 2 symbolise a direct connection between the functional entities or an indirect connection via a bridging molecule entity.
  • the molecule part formed by a connection of FEi to FE 2 is a nascent templated molecule, which may be added further functional entities resulting in a growing nascent templated molecule.
  • the propagation part of the method starts with the incorporation of a further building block (building block 3).
  • the incorporation involves the hybridisation of a subset of the building blocks to the plurality of templates bearing the nascent templated molecule.
  • the subset of building blocks is selected to have anti-codons which complement unique codons of the templates, said unique codons being in the vicinity of, preferably neighbouring to, unique codons hybridised to the building block(s) bearing the templated molecule.
  • the functional entity of the further building block is able to form a chemical connection to the nascent templated molecule through the reaction of a reactive group attached to the functional entity.
  • the linkage between one or more of the functional entities and the corresponding anti-codons may be cleaved if desired and the incorporation of a new building block may be performed.
  • the propagation step may be conducted as many times as appropriate to obtain the desired templated compound.
  • the linkers connecting functional entities/templated molecule and anti-codons may be cleaved.
  • the complex comprising the templated molecules (specific compositions or sequences of molecular moieties, the identity of which is determined by the template) attached to the templates that templated their synthesis, can now be taken through a screening process. This process leads to an enrichment of templated molecules complexes with appropriate characteristics.
  • the isolated complexes may now be enriched by amplification of the templates, and a new round of templated synthesis and screening can be performed.
  • the templated molecules may be identified by characterization of the corresponding templates.
  • the stages of the process involving incorporation of building blocks may be mediated by chemicals, or enzymes such as polymerase or ligase.
  • the anti-codon part of the building blocks may be nucleotide- derivatives that are incorporated by a polymerase. Incorporation may also be solely by hybridization of building blocks to the template.
  • the template is a DNA molecule
  • the template may comprise primer binding sites at one or both ends (allowing the amplification of the template by e.g. PCR).
  • the remaining portion of the templates may be of random or partly random sequence.
  • the reaction stage of the method involves reactions between the incorporated building blocks, thereby forming chemical connections between the functional entities.
  • the chemical connection can be a direct chemical bond or the connection can be established through a suitable bridging molecule.
  • the optional cleavage step involves cleaving some, all but one, or all of the linkers that connect the functional entities and anti-codons.
  • Fig. 1 the templated molecule is displayed by cleaving the linkers of the second and third functional entities, while maintaining the linker from the first building block.
  • a selection is performed.
  • the selection or screening involves enriching the population of template-templated molecule pairs for a desired property. For example, passing a library of templated molecule-template complexes over a solid phase to which a protein target has been immobilized, and washing unbound complexes off, will enrich for complexes that are able to bind to the protein.
  • the selection may be performed more than once, for example with increasing stringency. Between each selection it is in general preferable to perform an amplification.
  • the amplification involves producing more of the template- templated molecule complexes, by amplification of the template or complementing template, and producing more of the template-templated molecule pairs, for further rounds of selection/screening, or for sequencing or other characterization.
  • the template is a DNA strand
  • the template may be amplified by PCR, where after the templated synthesis can be performed using the amplified DNA, as described above.
  • Cloning and sequencing may also be useful techniques and involve the cloning of the isolated templates or complementing templates, followed by characterization. In some cases, it may be desirable to sequence the population of isolated templates or complementing templates, wherefore cloning of individual sequences is not required.
  • Fig. 2 in the upper part of the figure, the general structure of a template is shown.
  • the templates comprise x coding regions. Each coding region has a unique sub-structure which differentiates it from some or all of the other coding regions.
  • Shown below the general structure of a template are specific templates.
  • a given specific template carries a specific set of x unique codons.
  • a unique codon specifies (by way of interaction with a specific anticodon of a building block) a specific functional entity.
  • coding region 1 sequences are all examples of coding region 1 sequences.
  • the general design of the templates therefore enables the templated incorporation of building blocks, in the sense that a sub-set of building blocks can be added that will only be incorporated at the same position on the template (i.e., coding region 1 if the building blocks have anti-codons that are complementary to the unique codons of codon region 1).
  • Fig. 3 Shows an example of a design of templates and anti-codons for oligonucleotide-based building blocks.
  • Section A discloses the general structure of a set of templates carrying 6 coding regions, each containing a partly random sequence (X specifies either C or G), and a constant sequence that is identical for all sequences in the group (e.g., all coding region 1 sequences carries a central ATATTT sequence).
  • C and G only or, alternatively, A and T only
  • the building blocks that are complementary to coding regions 1 have very similar annealing temperatures wherefore mis- annealing is insignificant.
  • the attachment point of the linker that connects the anti-codon and the functional entity is not specified in the figure. Ideally, the linker is attached to the constant region of the anti-codon, in order to avoid bias in the annealing process.
  • Section B of Fig. 3 shows examples of codon and anti-codon sequences.
  • Example codon 1 and codon 6 sequences are shown.
  • the example codon 1 sequence represents one specific sequence out of 1024 different sequences that anneal specifically to the complementary anti-codon 1 sequences;
  • the example codon 6 sequence represents one specific sequence out of 128 different sequences that anneal to the complementary anti-codon 6 sequences.
  • FIG. 4 illustrates different general designs of building blocks.
  • a building block comprises or essentially consists of a functional entity, connected through a (cleavable) linker to an anti-codon.
  • Panel A shows a building block with one reactive group (X), connecting the functional group (R x ) with the anti-codon.
  • This type of building block may be used for the simultaneous reaction and cleavage protocol (e.g. figures 9 and 15).
  • the functional entity in this example comprises one reactive group, and a functional group R x , also called a functionality.
  • the reactive groups typically become part of the templated molecule.
  • Panel B shows a building block with two reactive groups (X and Y), connecting the anti-codon and the functional group (R x ).
  • the functional entity in this example comprises two reactive groups that are both part of the moiety that links the anti-codon and functional group, R x .
  • Panel C shows a building block with a reactive group (X) connecting R x and the anti-codon, and a reactive group (Y) attached to the R x group. This type of building block may be used in the simultaneous reaction and cleavage protocol (e.g., Fig. 9 and 10).
  • the functional entity comprises two reactive groups X and Y, where X is part of the linker, and Y is attached to the functional group R x .
  • Panel D shows a building block with one reactive group (X). The reactive group (X) does not link the functional group (Rx) and the complementing element.
  • a cleavable linker (L) is provided in order to release the functional entity from the anti-codon.
  • This type of building block may be used in protocols that require cleavage of the linker after the reactive groups of the functional entities have reacted (e.g., Fig. 12).
  • Panel E disclose a building block with four reactive groups and a functional group Rx.
  • the four reactive groups and the functional group R x may serve as a scaffold, onto which substituents (encoded by building blocks bound to codons on the same template) are coupled through reaction of reactive groups (X) of other building blocks with the reactive groups (Y) (e.g., figure 15).
  • no cleavable linker is indicated. Therefore, after the templating reactions the templated molecule is attached to the template through the linker of this building block.
  • Building block A comprises an anti-codon (horizontal line), which may be an oligonucleotide, to which a linker carrying the functional entity is attached to the central part.
  • the portion of the linker marked “a” may represent a oligonucleotide sequence to which a single stranded nucleotide may be annealed in order to make the linker more rigid, or alternatively, "a" may represent a zipper box sequence of nucleotides or other type of zipper box moiety.
  • the vertical line may represent a PEG (polyethylene glycol) linker, oligonucleotide linker, or any other linker that provides the functional entity with the appropriate freedom interact productively with a functional entity of a building block annealed to the same template during the templating process.
  • the linker is attached to the terminus of the anti-codon.
  • the anti-codon and the linker may be one continuous strand of an oligonucleotide.
  • the horizontal part here represents the anti-codon, and the vertical part represents the linker.
  • the linker may contain a moiety "a" that functions as a zipper box (see Fig. 22), a rigid linker, or an annealing site for another entity that rigidities the linker upon annealing.
  • the linker and anti-codon may be a continuous strand of an oligonucleotide. Attached to the linker is a nucleophile "Nu" which may react with a functional entity. This may be used as an anchorage point for the templated molecule. Building block C may preferably be used as the starting or the terminal building block. When used in the initial stage of the production of the complex comprising the templated molecule, building block C may provide the template with a reactive group to which the functional entities may be attached in the growing templated molecule. In a further embodiment of the invention "Nu" of building block C represents any reactive group able to participate in a reaction resulting in the formation of a connection to a functional entity of a building block.
  • Fig. 6 shows five different general methods for the preparation of building blocks.
  • the general methods involves the coupling of the functional entities to oligonucleotide-based building blocks. Reactions and reagents are shown that may be used for the coupling of functional entities to modified oligonucleotides (modified with thiol, carboxylic acid, halide, or amine), without significant reaction with the unmodified part of the oligonucleotide.
  • the functional entity may be synthesized as phosphoramidite precursor, which can then be used for oligonucleotide synthesis by standard methods, resulting in an oligonucleotide-derivative carrying a functional entity.
  • Fig. 7 shows the design and synthesis of exemplary building blocks.
  • Panel A shows a general synthesis scheme for building blocks using DNA oligonucleotide as codon, and coupling amines and carboxylic esters.
  • the oligonucleotide is purchased with an amine coupled to e.g. the base at a terminal position of the oligo.
  • EDC 1-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
  • NHS N- hydroxysuccinimide
  • Fig. 8 illustrates an embodiment for the templated synthesis of a polymer.
  • X and Y are reactive groups of the functional entity.
  • X and Y may be different kinds of reactive groups (e.g., amine and carboxylic acid), of the same kind but different (e.g., different primary amines or a primary amine and a secondary amine), or identical.
  • Reaction of X with Y to form XY either happens spontaneously when the building block has been incorporated, or is induced by a change of conditions (e.g. pH), or by the addition of an inducing factor (chemical or UV exposure, for example)
  • Fig. 8, ex.1. shows light-induced reaction between symmetric coumarin- derivatives. Light-induced reaction of the coumarin units, followed by cleavage of the linker, result in a ring structure. Examples of functional groups (phosphate and carboxylic acid) are shown. The building blocks are said to be symmetric because the two reactive groups, two coumarin units, are of the same reactivity (in fact, in this example are identical).
  • Fig. 9 shows an embodiment for templated synthesis of a polymer.
  • a population of templates, each carrying four codons are incubated with two sets of building blocks (carrying anti-codons 1 and 2, respectively), at a temperature that ensures efficient and specific annealing of anti-codons type
  • a third monomer (with anti-codon type 3) is added, and after annealing to coding region 3, excess building block is removed, and the reaction between X and Y now leads to the formation of a trimeric polymer, coupled to the building block annealed to coding region 3. Once more, the process is repeated with building blocks of type 4, resulting in the formation of a tetrameric polymer.
  • the reactive groups X and Y used in this scheme thus have two functions: i) reaction between X and Y leads to coupling of the corresponding functionalities (e.g., R1 and R2), and simultaneously, ii) the linker between R1 and the anti-codon is cleaved.
  • Examples of reactive groups X and Y with such characteristics i.e., the ability to simultaneously react and cleave are shown in Fig. 20.
  • the nucleophilic attack of the amine on the ester leads to transfer of the upstream functionality (e.g., R to the downstream building block (e.g., carrying anti-codon type 2). This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).
  • the templated polymer may be coupled to the template through the non-covalent interaction of a building block with the template (in the example given, through the interaction of building block 4 with the template), or alternatively, through covalent coupling to a reactive group on the template, located at either of the ends of the template, or anywhere on the template sequence.
  • the coupling reaction to the template may be performed before, during or after the synthesis of the polymer.
  • Fig. 10 shows the templated synthesis of a mixed polymer.
  • the most noticeable difference, when compared to the embodiment shown in Fig. 9 is that the reactive groups on the individual building blocks are different.
  • the pairs of reactive groups (X/Y, S/T, and P/Q) are chosen so that the reaction of X and Y, S and T, P and Q, respectively, results in transfer of a functional group from one building block to another (i.e., the reaction both mediates the coupling of the two functional groups and the cleavage of the linker that initially connects one of the functional groups to the anti-codon).
  • Example pairs of reactive groups that mediate this simultaneous reaction and cleavage are shown in Fig. 20.
  • example 1 shows two methods of obtaining different classes of compounds using simultaneous reaction and cleavage.
  • panel A the formation of an alpha-peptide is disclosed and in panel C the synthesis of a polyamine is shown.
  • two building blocks are incorporated by hybridization to the template.
  • One of the building blocks is an oligonucleotide to which has been appended a thioester.
  • the other building block is an oligonucleotide to which has been appended an amino acid thioester.
  • the amine of the latter building block attacks the carbonyl of the other building block. This results in formation of an amide bond, which extends the peptide one unit.
  • this may attack the thioester carbonyl, resulting in cleavage of the dipeptide from the anti-codon, to form a tripeptide. This process is repeated until the desired peptide has been generated.
  • the geometry of the nucleophilic attack remains unchanged.
  • the reactivity of the amine with the ester may be tuned in several ways. Parameters that will affect the reactivity include: (i) pH and temperature, (ii) nature of ester (thio-, phospho-, or hydroxy-ester); (iii) the nature of the substituent on the sulfur (see panel B below).
  • the general scheme presented here can be applied to most nucleophilic reactions, including formation of various types of peptides, amides, and amide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea), using similar functional entities.
  • amides e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea
  • Panel B shows four different thioesters with different substituents on the sulphur and therefore different reactivity towards nucleophiles.
  • Panel C relates to the formation of a polyamine. Using the same principle as in (A), a polyamine is formed.
  • example 2 shows simultaneous reaction and cleavage for two reactions.
  • reaction A a peptoid or an ⁇ - or ⁇ -peptide is formed, and in reaction B a hydrazino peptide is formed.
  • reaction A two building blocks are initially incorporated, one of which carries both a nucleophile (an amino group) and an electrophile (e.g. an ester); the other building block only carries an electrophile (e.g. a thioester).
  • the nucleophilic amine will attack the electrophile of the building block attached to the same template.
  • a dimeric structure is formed, linked to building block that initially carried the amine.
  • the linear structure grows, and eventually the desired templated molecule (a peptoid or an ⁇ - or ⁇ -peptide) has been formed.
  • reaction B follows the same line as in A, except that hydrazine-peptide precursor building blocks are used, leading to the formation of hydrazino peptides.
  • Fig. 11 shows a general reaction scheme for templated synthesis of a polymer, using non-simultaneous reaction and cleavage.
  • the reaction of the reactive groups e.g., X and Y
  • the reactive groups X and Y does not in itself lead to cleavage, wherefore the functional entity is coupled to the anti-codon via a cleavable linker. Therefore, each addition of a subunit to the growing polymer involves two steps. First, the reactive groups X and Y react to form a bond XY. Then, in a separate step, a cleavable linker L is cleaved, which releases one of the functional entities from the anti-codon.
  • cleavable linkers By alternating between two types of cleavable linkers (cleavable under different conditions) one may achieve migration of the nascent polymer down the template, like described in fig. 9 and 10. This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).
  • Example reactions that do not mediate simultaneous reaction and cleavage are shown in fig. 21. Any combination of cleavable and non-cleavable linkers may be used, dependent on the nature of the reactive groups in the functional entities (e.g., dependent on whether the reaction involves a release from the anti-codon).
  • Fig. 12 relates to activation of reactive groups and release from anti-codon by ring-opening.
  • Fig. 12 example 1. Ring-opening of N-thiocarboxyanhydrides, to form ⁇ - peptides.
  • the initiator is activated, for example by deprotection or by an increase in pH.
  • the primary amine then attacks the carbonyl of the N-thiocarboxyanhydride (NTA) unit. As a result, CSO is released, and a primary amine is generated.
  • NTA N-thiocarboxyanhydride
  • peptides and peptide-like polymers e.g., mono-,di-, tri-, and tetra-substituted ⁇ -, ⁇ -, ⁇ -, and ⁇ -peptides, polyesters, polycarbonate, polycarbarmate, polyurea
  • ⁇ -peptides can be made by polymerization of 5-membered carboxyanhydride rings.
  • Fig. 13 shows the principle of symmetric fill-in (symmetric XX building blocks). The fill-in reaction occurs between the reactive groups ("X” in the figure) and bridging molecules "Y-Y” in figure).
  • X represents the reactive groups of the functional entity.
  • Y-Y is added to the mixture before, during or after incorporation of the building blocks.
  • Fig. 13, ex.1 shows imine formation by fill-in reaction. Dialdehyde is added in excess to incorporated diamines. As a result, an imine is formed.
  • the templated molecule carries the following functional groups: cyclopentadienyl and hydroxyl.
  • example 2 shows an example of amide formation using symmetric fill-in.
  • non-incorporated building blocks may be removed.
  • EDC 1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide
  • dicarboxylic acid is added in excess to the primary amines of the building blocks.
  • a di-(N-hydroxy- succinimide ester) may be added in excess.
  • excess reagents may be removed by dialysis, precipitation of the building blocks and template, gel filtration or by other means that separate the reagents from the building blocks.
  • the linkers (L) may be cleaved, and, if functional groups have been masked by protection groups (PG), these functional groups can be deprotected to expose the functional groups.
  • PG protection groups
  • Appropriate protecting groups would be for example Boc-, Fmoc, benzyloxycarbonyl (Z, cbz), trifluoracetyl, phthaloyl, or other amino protecting groups described e.g. in (T. W. Green and Peter G. M. Wuts (1991), Protective Groups in Organic Synthesis).
  • amide-bonded functional entities would be to incorporate building blocks carrying di-carboxylic acids, and then add diamines, NHS and EDC.
  • the building blocks could carry N- hydroxy-succinimidyl (NHS) esters, which would react with the added amines without the need to add EDC and NHS.
  • NHS N- hydroxy-succinimidyl
  • example 3 shows an example of urea-bond formation.
  • the functional entities of the incorporated building blocks react with phosgen or a phosgen-equivalent such as CDI to form a polyurea.
  • Formaldehyde may also be used.
  • the linkers are cleaved and the protected hydroxyl is deprotected.
  • Appropriate leaving groups (Lv) are chloride, imidazole, nitrotriazole, or other good leaving groups.
  • example 4 shows the formation of chiral and achiral templated molecules.
  • the functional group Rx is used as a cleavable linker, that generates the desired functional group upon activation.
  • reaction A and reaction B a urea-bond is formed.
  • reaction A the functional group is attached to the backbone via a chiral carbon.
  • the hydrogen on this carbon is drawn to emphasize this.
  • the reactive groups the amines
  • the phosgen equivalent e.g., a carbonyldiimidazole
  • the building blocks may be inserted in either of two orientations (as indicated by the position of the hydrogen, left or right).
  • reaction B the chiral carbon of reaction A has been replaced by a nitrogen.
  • the resulting templated molecule is achiral, i.e. the template encodes one specific structure.
  • example 5 shows the formation of a phosphodiester bond by the principle of symmetric fill-in.
  • the incorporated building blocks react with the activated fill-in molecule to form a phosphodiester bond.
  • the linkers are cleaved, releasing the templated molecule from its template.
  • An example of an appropriate leaving group (Lv) is imidazole.
  • example 6 shows phosphodiester formation with one reactive group in each building block.
  • example 7 shows the an example of a pericyclic fill-in reaction.
  • two building blocks are incorporated.
  • 1 ,4-benzoquinone is added in excess, resulting in the formation of a polycyclic compound.
  • a third building block is added, reacted with the 1 ,4-benzoquinone, and this process is repeated a number of times until the desired templated molecule has been generated.
  • all but one of the linkers that connect the templated molecule to the anti-codon are cleaved.
  • Fig. 14 relates to asymmetric fill-in using XS building blocks.
  • a fill-in reaction between reactive groups (X and S) and bridging molecules (T-Y) is shown. For clarity, only the reaction (not linker cleavage) is shown.
  • X and S represent the reactive groups of the functional entity. In this case the two reactive groups are not of the same kind.
  • T-Y is added to the mixture before, during or after incorporation of the building blocks.
  • significant reaction between X and Y, and between S and T may take place during or after incorporation of the building blocks.
  • example 1 shows an example of asymmetric fill-in by modified Staudinger ligation and ketone-hydrazide reaction.
  • the reactive groups X and S of the building blocks are azide and hydrazide.
  • the added molecule that fills the gaps between the building blocks carry a ketone and a phosphine moiety.
  • the reactions between a ketone and a hydrazide, and between an azide and a phosphine, are very chemoselective. Therefore, most functional groups Rx can be employed without the need for protection during the reactions. Examples for the molecular moieties R, R1 , X and Y may be found in (Mahal et al. (1997), Science 276, pp. 1125-1128; Saxon et al. (2000), Organic Letters 2, pp. 2141-2143).
  • Fig. 15 shows a general reaction scheme for templated synthesis of a nonlinear molecule.
  • a template carrying four codons is mixed with two building blocks.
  • the functional entity of one building block comprises a reactive group X and a functional group R-i.
  • the other building block comprises three reactive groups Y and a functional group R 2 .
  • the building block bound to codon 2 is here called the scaffold, as the functional groups are transferred to this building block during the templating process.
  • X is brought to react with one of the reactive groups Y, for example by changing the conditions, by deprotecting X or Y, or by simply exploiting the pronounced proximity of X and Y groups when the building blocks are bound to the template.
  • X and Y have been chosen so as to allow simultaneous reaction and cleavage.
  • the substituent group (functional group) Ri is transferred to the scaffold.
  • Example reactive groups X and Y that mediate simultaneous reaction and cleavage are given in figure 20. Any pair of reactive groups X and Y that mediates simultaneous reaction and cleavage can be used in this scheme, i.e., different X/Y pairs may be used at each substituent position.
  • Figure 16 shows templated synthesis of a non-linear molecule, employing reactive groups of different kinds, and non-simultaneous reaction and cleavage.
  • the reactive groups X, S, P and Y, T, Q may be of different kinds, and the bonds formed (XY, ST, and PQ) therefore may be of different kinds.
  • the substituent (functional group) R1 is transferred to the second building block (the scaffold).
  • the second building block the scaffold.
  • an additional step of linker cleavage is required.
  • a scaffolded molecule After repeating the processes of annealing, reacting and cleavage a number of times, a scaffolded molecule has been formed carrying encoded substituents. The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached.
  • the position of the substituents are determined by the identity of the reactive groups Y, T and Q of the scaffold, and therefore indirectly determined by the identity of the codon to which the scaffold building block anneals. Therefore, in this set-up, the identity and position of the substituents, as well as the identity of the scaffold, is determined by the sequence of the template.
  • Fig. 17 discloses the principle of templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold.
  • the templated molecule migrates down the template as it is being synthesized. This is made possible by the use two different linkers L x and L y , cleavable under different conditions. As a result, a high proximity is maintained throughout the templating process, as the building blocks that react in each reaction step are bound to adjacent coding regions on the template.
  • Fig. 18 shows the templated synthesis of various non-linear molecules.
  • Each building block comprises an activated ester (reactive group, (X)) where the ester moiety carries a functional group Rx.
  • Rx reactive group
  • the nucleophilic amine (covalently attached to the template) attacks the ester carbonyl of the building block bound to coding region 3; the amine of the third monomer attacks the thioester of the next incorporated building block, and after incorporation of the third building block, the Homer-Wittig Emmans reagent of the building block reacts with the aldehyde of the third monomer under alkaline conditions. This forms the templated molecule.
  • the double bond may be post-templating modified by hydrogenation to form a saturated bond, or alternatively, submitted to a Michael addition.
  • the incorporated building block acylates one of the primary amines.
  • the aryliodide undergoes a Suzuki coupling by reaction with the next building block, and the benzylic amine is acylated by last incorporated building block.
  • Fig. 19 shows a general procedure of templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.
  • the reaction step may be desirable to perform the reaction step (or one of the other steps) under conditions where annealing of building blocks is in-efficient.
  • one may covalently link the incorporated building blocks, either chemically or by using a ligase (when the anti-codon comprises an oligonucleotide) or a polymerase (when the anti-codon is e.g. a nucleotide).
  • the template is designed to fold back on itself.
  • the two incorporated building blocks are incorporated and may be ligated together, and be linked to the template, during or after their incorporation. If desired, the conditions may now be changed to increase the efficiency of the reaction step that follows.
  • step 2 the reactive groups X and Y are brought to react. Because the building blocks are covalently attached to each other (and to the template), the reaction can be performed under conditions where annealing of the building blocks to the template is inefficient. Reaction conditions that may not be compatible with efficient annealing and double helix structure include organic solvents, low salt and high temperature, all of which may be used with the set-up described in this figure.
  • step 2 the conditions are changed again, in order to allow efficient incorporation and covalent linkage of the next building block (step 3).
  • This cycling between conditions that allow incorporation and ligation, and that allow reaction, is continued until the desired number of building blocks have been incorporated and reacted.
  • some of the linkers are cleaved to give the templated molecule.
  • the covalent coupling of the building blocks to each other allows the reaction between their reactive groups to be performed under more diverse conditions than would otherwise be possible.
  • covalent coupling between building blocks makes it possible to use anti-codons comprising shorter recognition sequences.
  • the anti-codon comprises an oligonucleotide
  • it is generally preffered to use an oligonucleotide of at least fifteen nucleotides during incorporation, in order to obtain high efficiency of incorporation.
  • a ligase or chemical is used to covalently couple the building blocks
  • the templates may be attached to a solid phase material (e.g., streptavidin beads if the templates are biotinylated), or the templates (with the building blocks associated to them) may be precipitated and resuspended in appropriate buffer during the steps of incorporation and reaction.
  • a solid phase material e.g., streptavidin beads if the templates are biotinylated
  • Fig. 20 shows various reaction types allowing simultaneous reaction and activation. Different classes of reactions are shown which mediate translocation of a functional group from one monomer building block to another, or to an anchorage point. The reactions have been grouped into three different classes: Nucleophilic substitutions, addition-elimination reactions, and transition metal catalyzed reactions These reactions are compatible with simultaneous reaction and activation.
  • S Reaction between aliphatic boronates and arylhalides, whereby the alkyl group is translocated to yield an alkylarene.
  • T Transition metal catalysed alpha-alkylation through reaction between an enolether and an aryihallide, thereby translocating the aliphatic part.
  • U Condensations between e.g. enamines or enolethers with aldehydes leading to formation of alpha-hydroxy carbonyls or alpha, beta- unsaturated carbonyls. The reaction translocates the nucleophilic part.
  • V Alkylation of alkylhalides by e.g. enamines or enolethers.
  • the reaction translocates the nucleophilic part.
  • W [2+4] cycloadditions, translocating the diene-part.
  • X [2+4] cycloadditions, translocating the ene-part.
  • Y [3+2] cycloadditions between azides and alkenes, leading to triazoles by translocation of the ene-part.
  • Z [3+2] cycloadditions between nitriloxides and alkenes, leading to isoxazoles by translocation of the ene-part.
  • Fig. 21 shows pairs of reactive groups (X) and (Y), and the resulting bond
  • cleavage may be required (e.g., see fig. 8).
  • Fig. 22 shows a method of increasing the proximity effect of the template: The Zipper-box.
  • Panel A discloses linkers carrying oligonucleotide zipper boxes (a) and (b) that are complementary. By operating at a temperature that allows transient interaction of (a) and (b), the reactive groups X and Y are brought into close proximity during multiple annealing and strand-melting events, which has the effect of keeping X and Y in close proximity in a larger fraction of the time than otherwise achievable.
  • one may cycle the temperature between a low temperature (where the zipper boxes pairwise interact stably), and a higher temperature (where the zipper boxes are apart, but where the anti-codon remains stably attached to the codon of the template).
  • the temperature may be kept appropriately low that the two strands of the zipper-box (a and b) are stably associated.
  • the building blocks must be added to the reaction mix at an appropriately high temperature where the interaction between the codon and anti-codon is specific. Once the building blocks have been specifically associated with the template, the temperature can be lowered, and the alternative protocols described above followed, in order to achieve a high reaction efficiency.
  • the anti-codon is an oligonucleotide (e.g., DNA, RNA) or oligonucleotide analog (e.g., PNA, LNA), it may be practical to use a continuous nucleotide strand, comprising both the anti-codon, linker and zipper-box (see (B) below).
  • oligonucleotide e.g., DNA, RNA
  • oligonucleotide analog e.g., PNA, LNA
  • Panel B shows sequences of two DNA oligo-based building blocks.
  • the anticodon ("annealing region"), linker and zipper-box are indicated.
  • one linear DNA molecule constitutes the anti-codon, the linker that connects the functional entity and the anti-codon, and the zipper-box.
  • the reactive groups X (a carboxylic acid) and Z (an amine) are coupled to the 3'- end of DNA oligo 1 and the 5'-end of DNA oligo 2, respectively.
  • a template sequence to which oligo 1 and oligo 2 would anneal might contain the follow- ing sequence: 5'-CCGATGCAATCCAGAGGTCG- GCTGGATGCTCGACAGGTC.
  • Fig. 23 shows three methods of how the proximity effect can be increased: (A) Helix stacking, (B) Ligation and (C) Rigid linkers.
  • Two building blocks with oligonucleotide-based anti- codons anneal to their respective codons (in the figure, the left building block is a "scaffold" that carries four reactive groups, and the right building block carries a functional entity with e.g. one reactive group, i.e., the latter building block may carry the substituent that will become attached to the scaffold.
  • Double helices tend to stack, especially if the sequence of the opposing ends of the helices has been designed so as to optimize this interaction (for example by the presence of the sequence GGG at the ends of the duplex structures). This stacking tendency will bring the two building blocks into closer proximity, in turn increasing reaction efficiency between the functional entities.
  • the substituent building block may be removed after its reaction with the scaffold building block, before the next building block is incorporated. In this way, the template region between two reacting building blocks may be kept single stranded, allowing this region to loop out and let the two duplex structures stack during the reaction between the two building blocks.
  • the anti-codons of two building blocks may be chemically or enzymatically ligated together. Coupling of two anti-codons will increase the annealing efficiency. Therefore, smaller anti-codons can be used if ligated together with the previously incorporated building block.
  • a building block or just an 20-nucleotide DNA oligo
  • a melting temperature e.g. 60 °C.
  • another building block e.g., with a 8-nucleotide DNA anti-codon
  • the second building block will become firmly attached to the template, despite its short length of just 8 nucleotides.
  • ligation allows the use of shorter anti- codons, which in turn brings the reactive groups into closer proximity.
  • (C) Rigid linkers By using linkers comprising one or more flexible regions ("hinges”) and one or more rigid regions, the probability of two functional entities getting into reactive contact may be increased, a. Symbol used for building block with a rigid part and two flexible hinges. b. A building block with the characteristics described in (a). The building block contains a continuous oligonucleotide -strand, constituting both the anti-codon (horizontal line), and linker (vertical line) connecting the functional entity (FE) with the anti-codon. Annealing of a complementary sequence to the central part of the linker leads to formation of a rigid double helix; at either end of the linker a single-stranded region remains, which constitutes the two flexible hinges.
  • Fig. 24 discloses various cleavable linkers. A number of cleavable linkers are shown, as well as the agents that cleave them and the products of the cleavage-reaction. In addition, catalysts including enzymes and ribozymes, may also be used to cleave the linker. Exemplary enzymes are proteases (e.g. chymotrypsin), nucleases, esterases and other hydrolases.
  • Fig. 25 shows two different ways of templated synthesis by generating a new reactive group.
  • the reaction of X and Y leads to formation of a new reactive group Z
  • this may be exploited to increase the diversity of the templated molecule, by incorporating building blocks carrying reactive groups Q that react with Z.
  • the templated molecules may be very compact structures, and thus, this approach describes a method to make highly substituted (functionalized and diverse) libraries of molecules of relatively low molecular weight.
  • A First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond.
  • both the reaction of X with Y, and of Z with Q are reactions that involve simultaneous reaction and cleavage.
  • Fig. 25, example 1 shows a templated synthesis by generating a new reactive group.
  • the reaction of the functional entities of the first three building blocks leads to formation of two double bonds, which may react with two hydroxylamines carried in by the building blocks added in the latter steps, and leads to formation of an ester, which may react with the hydroxylamine, encoded by a building block.
  • the linkers are cleaved, generating the templated molecule.
  • Fig. 26 shows different methods of performing post-templating modifications on templated molecule. After the templating process has been performed, the templated molecules may be modified to introduce new characteristics. This list describes some of these post-templating modificiations.
  • Fig. 27 illustrates one preferred method for selection of template-displaying molecules.
  • Figure 28 shows the proposed complexes that may form when a reaction step is performed using set-ups that allow for stacking of DNA duplexes.
  • Figure 29 shows a autoradiography of a polyacrylamide gel analysis of the reaction between building blocks.
  • Figure 30 shows the Feuston 3 functional entity as well as the Feuston 5 ligand.
  • Figure 31 shows the structure of the pentenoyl protected aspartate.
  • Figure 32 shows the use of allylglycine building blocks.
  • Figure 33 shows the autoradiography of a polyacrylamide gel.
  • Figure 34 shows an Elisa analysis of the product of the two-step encoding process.
  • building blocks which contain a zipper box adjacent to the functional entity.
  • the zipper box sequences are underlined below.
  • the following buffers and protocols are used in the same three examples.
  • the samples are mixed with formamide dye 1:1 (98% formamide, 10 mM EDTA, pH 8, 0,025 % Xylene Cyanol, 0,025% Bromphenol Blue), incubated at 80°C for 2 minutes, and run on a denaturing 10% polyacrylamide gel.
  • formamide dye 1:1 98% formamide, 10 mM EDTA, pH 8, 0,025 % Xylene Cyanol, 0,025% Bromphenol Blue
  • the polyacrylamide gel analysis showed that a more efficient reaction results from alternating the temperature between 10 °C and 35 °C, rather than performing the reaction at a constant temperature of 15°C, 17,8°C, 22,7°C, 28,3°C, 31,0°C, or 35,0°C.
  • AH138 5'- TCTTGCCTGAACGTAGTCGTAGGTCGATCCGCGTTACCAGAGCTG-
  • Figure 28,1 and Figure 29, lane 1 Reference reaction between two building blocks annealed to adjacent sites on the template. As expected an efficient reaction is observed. In this set-up, the two building blocks anneal to the template and thereby form DNA duplexes that can stack onto each other.
  • Figure 28,2 and Figure 29, lane 2 In this set-up, the two building blocks anneal to adjacent sites on the template. However, the two DNA-duplexes stack onto each other, basically forming one long DNA duplex. This rigid duplex does not allow the two building blocks to bend around the flexible hinge that might otherwise be present at the connection point between the two duplexes (i.e. the position of the nick in the DNA). Consequently, no significant reaction between the two building blocks is observed.
  • Figure 28, 5 and Figure 29, lane 5; and Figure 28, 6 and Figure 29, lane 6 The annealing sites and separation between them are identical to those of the experiment described above ( Figure 28, 3 and 4; Figure 29, lanes 3 and 4).
  • a short oligo (10 nucleotides) has been annealed to the cen- tral region of the template. This result in a drastic decrease in reaction efficiency for the building blocks with the short linkers (lane 5); the reaction efficiency of the building blocks with the long linkers is only slightly affected if at all by the annealing of the short oligo.
  • Figure 28, 7 and Figure 29, lane 7; and Figure 28, 8 and Figure 29, lane 8 As immediately above, except that a 20 nucleotide long oligo is annealed to the central region of the template. In this case none of the linkers (short or long) can reach across the extended duplexes, and as a result no or little reaction is observed.
  • the building blocks are oriented the "other way", i.e. the linker connecting the complementing element and the functional entity is near the ends of the template.
  • the complementing element of the left building block contains a 5-nucleotide sequence that is complementary to other right end of the template.
  • the building block should be capable of circularizing the template, as depicted in Figures 27, 9-11. These circular structures should also be stabilized by an extended duplex structure across the ends of the template.
  • AH136 5'- AGCTGGATGCTCGACAGGTCTCTTGCCTGAACGTAGTCG- TCCGATGCAATCCAGAGGTCG AH 174: 5'-TACGTTCAGGCAAGAGT6CCAGTTAC7
  • three functional entities are transferred to an amino modified scaffold oligo by a three step reaction, and analyzed by a denaturing acryla- mide gel using radio labelling.
  • the loading was done by incubating each of the oligos with 10 mM ⁇ - AlaOMe AG, 75 mM DMT-MM in 150 mM Hepes-OH buffer, pH 7,5 to a final volume of 50 ⁇ l at 25°C shaking overnight. Then adding 5 ⁇ l 1 M NH 4 - acetate, incubated at 25°C for 10 min, then spin column purified with ddH 2 O equilibrated columns (Micro Bio-Spin chromatography columns P-6, Bio- Rad). The deprotection of the methyl group protected acid was done by adding 0,5 ⁇ l 2M NaOH to the oligos and incubating for 10 min at 80°C. Lastly the oligos were spin column purified and loadings confirmed by mass spec- trophotometry.
  • the scaffold oligo [MDL251 5'amino-C6 dT-ACC TGT CGA GCA TCC AGC T 3'] was radioactively labelled in the 3' end. 50 pmol of the oligo was labelled with 10 ⁇ l ddATP ⁇ P32 (Amersham Biosciences) by adding 4 ⁇ l 10X NEbuffer 4, 4 ⁇ l 10X CoCI2 and 35 units of terminal deoxynucleotide transferase (New England Biolabs) and water to a final volume of 40 ⁇ l. Mixture incubated at 37°C for 1 hour. Labeled oligo purified using ddH2O equilibrated spin column.
  • the oligos were annealed by heating to 80°C and slowely going down to 20°C (1 min) using a thermocy- cler (Eppendorf, Mastergradient) Following the annealing 5 ⁇ l 0,5M DMT- MM was added. Sample crosslinked, see figure 32 overnight cycling at 10°C 10 sec/35°C 1 sec. The sample was spin column purified and the crosslinked product cleaved to give first transfer of ⁇ -Ala to scaffold oligo amine by adding 10 ⁇ l 25 mM 12 dissolved in 1:1 tetrahydrofuran:H2O and incubated at 37°C for 1,5 hours.
  • step 1 crosslinking efficiency (step 1) was approximately 50% ( Figure 33, lane 1). This was followed by an al- most 100%) efficient cleavage (lane 2), which results in the transfer of the ⁇ - Ala moiety onto the scaffold. This is followed by the crosslinking/cleavage of step 2 and 3 (lanes 3+4, 5+6) to generate the final product on the scaffold oligo.
  • the product thus contains the three transferred ⁇ -Ala moieties.
  • two entities are transferred to a scaffold oligo by a two-step reaction to produce a ligand, Feuston 5 (see Figure 30) that binds to the ⁇ V ⁇ 3 integrin receptor.
  • the product of the two-step process was analyzed by Elisa.
  • Feuston 3 is a derivative of the Feuston 5 ligand see fig 30 (F3OMeAG) and AH 272 (see above) loaded with glycine allylglycine (GlyO- MeAG) according to the above protocol (example Xa) for loadings of allylglycine functional entities to carboxylic acid modified oligos. 10 nmoles of each was loaded in two reactions each.
  • the loading was done by mixing 25 ⁇ l 150 mM EDC (N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide hydrochloride, Fluka), 25 ⁇ l NHS (N- hydroxysuccinimide, Sigma) and 5 ⁇ l 100 mM of the pentenoyl protected aspartate functional entity, all reagents were dissolved in N,N- dimethylformamide, DMF. Incubated at 25°C for 40 min. To this mixture 5 nmol of the scaffold oligo, AH 270 resuspended in 30 ⁇ l 150 mM Hepes-OH pH 7,5 was added and this incubated shaking over night at 25°C.
  • the amine pentenoyl protection group was deprotected by adding 20 ⁇ l 25 mM 12 dissolved in 1 :1 tetrahydrofuran: water and incubated at 37°C for 2 hours. Followinged by spin column purification, and loading confirmed by mass spectrum analysis.
  • the transfers were done in the same manner as described above, but using larger amounts of oligo to ensure there being enough ligand created to give a sufficient signal in the ELISA.
  • the first round the following amounts were used: 850 pmol loaded scaffold oligo; AH 270, 7500 pmol loaded building block oligo; AH 272 and 3250 pmol template oligo AH 140 [ 5' AGC TGG ATG CTC GAC AGG TCA GGT CGA TCC GCG TTA CCA GTC TTG CCT GAA CGT AGT CGT CCG ATG CAA TCC AGA GGT CG 3'].
  • the second round adding 7500 pmol loaded building block oligo AH 155 for a transfer.
  • the created Feuston 5 ligand on the scaffold oligo still had a methyl group protected acid on the aspartate, which was deprotected just as described before.
  • the sample prepared above containing the displayed Feuston 5 ligand on a scaffold oligo was added to a well, control for the experiment being a 20 mer oligo loaded with the RGD peptide, a well known and well described ligand for this integrin receptor (loaded according to above described method for the pentenoyl and methyl protected aspartate functional entity).
  • the incubation with these ligands was done in ligand binding buffer containing PBS, 1 mM MnCI2, 1 mg/mL BSA at room temperature for one hour. Washed in washing buffer 5 * 300 ⁇ l. Incubated with 100 ⁇ l horseradish peroxidase-streptavidine (Endogen) diluted 1 :10000 times in wash buffer, incubated for one hour at room temperature.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Catalysts (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed is a method for the manufacture of a library of complexes. The complexes comprise templated molecules attached to the template which directed the synthesis thereof. The templated molecules are produced in a step-by-step fashion which provides for a high local concentration of reactive groups involved in the formation of connections between the individual components of the template molecule.

Description

Multi-step synthesis of templated molecules.
Technical Field
The present invention relates to a method for the manufacture of a library of complexes. Each complex in the library comprises a templated molecule attached to the template which directed the synthesis thereof. The library of the invention is useful in the quest for new biologicar active compounds, such as drugs.
Background art
The generation of molecules carrying new properties remains a challenging task. Recently, a number of procedures have been suggested that should allow a more efficient generation and screening of a larger number of mole- cules. The approaches taken involve the encoding and/or templating of molecules other than natural biopolymers such as peptide, RNA and DNA. These approaches allow the researcher to generate and screen a huge number of molecules in a short time. This should lead to better molecules carrying the desired properties.
The central dogma of biology describes the one-way flow of information from DNA to RNA to protein. Recently, methods such as phage display, peptides- on-plasmids, ribosome display and mRNA-protein fusion have been developed, allowing the transfer of information from the level of protein/peptide to RNA or DNA. This has enabled the use of molecular evolution to be applied on huge numbers of peptides that are exposed to an enrichment process, where after the enriched pool of molecules (enriched for a particular feature, such as binding to receptor protein) are amplified, by exploiting information flow from the peptide to DNA and then amplifying the DNA.
More recently, approaches have been developed that allow the encoding of polypeptides and other biochemical polymers. An example of this approach is disclosed in US 5,723,598, which pertains to the identification of a biochemical polymer that participates in a preselected binding interaction with a target to form a binding reaction complex. The prior art method encompasses the generation of a library of bifunctional molecules. One part of the bifunctional molecule is the biochemical polymer and the other part is an identifier oligonucleotide comprising a sequence of nucleotides which encodes and identifies the biochemical polymer. Following the generation of the library of the bifunctional molecules, a partitioning with respect to affinity towards the target is conducted and the identifier oligonucleotide part of the bifunctional molecule is amplified by means of PCR. Eventually, the PCR amplicons are sequenced and decoded for identification of the biochemical polymer. This approach suffers from the draw-back that it is necessary with a laborius decoding step following each round of selection. Thus the flow of information from the identifier sequence to the biochemical polymer is restrained.
Halpin and Harbury have in WO 00/23458 suggested an improvement to the approach stipulated immediately above, wherein the molecules formed are not only identified but also directed by the nucleic acid tag. The approach is based on the traditional split-and-combine strategy for synthesis of combina- torial libraries comprising two or more synthetic steps. Plurality nucleic acid templates are used, each having at one end a chemical reactive site and dispersed throughout the stand a plurality of codons regions, each of said codon regions in turn specifying different codons. Separately, each of the strands, identified by a first codon region, is reacted at the chemical reaction sites with specific selected reagents. Subsequently, all the strands are pooled and subjected to a second partitioning based on a second codon region. The split- and-combine method is conducted an appropriate number of times to produce a library of typically between 103 and 106 different compounds. The split-and-combine method is cumbersome and generates only a relatively small library.
SUBSTITUTE SHEET (RULE~5 ) The present invention aims at obtaining a library of compounds which are not only encoded by a suitable tag attached to each compound, but also directed. The directed synthesis of the compounds of the library allows for renewed synthesis of templated molecules following a selection round. Fur- thermore, the present invention increases the probability of connection of molecular entities eventually appearing in the templated molecule due to a higher local concentration of the reactive groups involved in the formation of the connection.
Disclosure of the invention
The present invention relates to a method for the manufacture of a library of complexes comprising templated molecules, said method comprises the steps of a) providing a plurality of different templates comprising a number of cod- ing regions and a reactive group, wherein each coding region of a specific template specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of a template, and the functional entity comprises at least one reactive group, c) contacting the plurality of different templates with a subset of the plurality of different building blocks, said subset having anti-codons which complement the unique codons of a specific coding region, said con- tacting being performed under conditions which allow specific hybridisation of the anti-codons to the unique codons of the templates, d) reacting the reactive group of the template and the reactive group of the building block to obtaining a chemical connection, e) contacting under conditions allowing specific hybridisation, the plurality of different templates harbouring the nascent templated molecules with a further subset of the plurality of building blocks, said subset having anti-codons complementary to the unique codons of a coding region in the vicinity of the coding region harbouring the nascent templated molecules, f) allowing the functional entities of the subset of further building blocks to form a chemical connection to the nascent templated molecules, g) optionally, cleaving one or more of the linkers, provided that at least one linker remains to connect the nascent templated molecule with the template which directed the synthesis thereof, h) optionally repeating steps e) through g), i) obtaining a templated molecule attached via the linker one or more building blocks to the template which directed the synthesis thereof.
The present invention allow for a multi-step templated synthesis of a library of molecules without the need for a laborious and time consuming split step of the traditional split and-mix-method. The method furthermore provides for the possibility of bringing the functional entities of building blocks in close proximity, thus allowing facilitated connection of functional entities in the vicinity of each other. The bringing in close proximity of building blocks provide for an increased local concentration of the active chemical groups, thus increasing the probability that two reactive groups will be so close that a reaction actu- ally will occur.
The various templates of the present invention are in general constructed to follow a general scheme. According to the scheme, a number of coding regions are provided on the template. In turn, each of the coding regions speci- fies one or more unique codons. Thus, a specific template comprises a given number of unique codons. The plurality of templates can, taken as a whole, be characterized as a library comprising the total amount of the different combinations of unique codons possible, or any subset thereof. The coding regions are suitable positioned in a linear sequence, such that the individual coding regions are positioned immediately next to each other. In some embodiments, it may be of advantage to use a branched template to ensure proximity of reactive groups, the introduction of catalysts in the vicinity of the reactive groups or the introduction of as third reactant.
Besides the coding regions, the templates used in the present invention in- elude a reactive group. The reactive group comprised by the template may be covalently or non-covalently attached to the template. Covalent attachment may be preferred when the templated molecule is to be effectively attached to the template, because a covalent bonding will allow affinity selection using more harsh conditions. The covalent attachment of the reactive group may be done at a terminal region of the template or at a central region thereof. In an aspect of the invention, the reactive group is non-covalently attached to the template using a complementing element hybridised to the template. More particularly, it is preferred that the reactive group of the template is part of a building block hybridised to the template.
The coding regions may be spaced with a suitable spacer region. The spacer region may be an indentifier for the coding region of may be a region not carrying any information but serving to bring the functional entities into the desired proximity or to provide the template with a desired physical characteris- tic like a stiff connection of coding regions, or alternative, a flexible connection between two coding regions.
The template may comprise flanking regions. One of the flanking regions can in an aspect of the invention serve to immobilize the template to a surface of a solid support. In another aspect of the invention the flanking region can encompasses a signal group, such a flourophor or a radio active group, to allow a direct detection of the presence of the template.
The plurality of templates used in the present invention may in one embodi- ment be represented by the general formula:
F-(Coding region 1)-(S1)-(Coding region 2)-(S2)... -(Coding region n)-(Sn)-F' Wherein
Each of Coding region 1 through Coding region n independently specifies m unique codons, F and F' are optional flanking regions,
S1 to Sn are optional spacing groups, n is an integer of at least 2, and m is an integer of at least 1.
The unique codons of the templates are preferably composed of a sequence of nucleic acid monomers, such as nucleotides. Each codon is unique in the sense that within the same coding region no other codons have an identical sequence and length of nucleic acid monomers. Preferably, a unique codon does not have a corresponding sequence anywhere in the plurality of tem- plates. To avoid hybridisation between individual templates it is also desirable to design each of the unique codons such that the complementary sequence thereof does not exist on any other templates.
The number of coding regions may be selected in accordance with inter alia the number of the desired final templated compounds, the building blocks available and the envisaged structure of the templated compound. According to the invention the number of coding regions is preferably at least 3 to achieve the desired diversity. The upper limit for the number of coding regions has not yet been elucidated; however it is believed that a number ex- ceeding 100 may give practical problems. Generally, it is preferred to use templates having between 3 and 50 coding regions, more preferably between 3 and 30 and still more preferred between 4 and 15.
Within each of the coding regions the number of unique codons may be se- lected according to the need for diversity. The number of unique codons in each of the coding regions may be similar or different. The number of unique codons can be as low as one. This may be the choice when a so-called scaf- fold is involved in the evolving templated molecule. The upper limit for the number of unique codons may be chosen quit high as long as specific hybridisation of oligonucleotides of the anti-codons to their complements on the templates occurs. An example of an upper limit may be 10,000, but may be chosen below this limit or above according to the need.
The building blocks essential for the present invention, are generally composed of three elements, viz. an anti-codon, a functional entity, and a linker which connects the anti-codon and the functional entity. The anti-codon is a sequence of nucleic acid monomers complementary to the sequence of a unique codon on at least one of the plurality of templates. In one aspect of the invention, building blocks are provided which possesses anti-codons complementing all the unique codons of the variety of templates. In another aspect, some of the building blocks carrying anti-codons for selected unique codons are not present. The latter situation may occur when termination of the synthesis is desired at different stages or when the absences of certain functional entities on the templated molecule are desirable. Furthermore, anti-codons not associated with any functional entity may be present for steric reasons or to avoid unintended hybridisation events.
The design of the anti-codons and the complementing unique codons may be aimed at obtaining essentially the same annealing temperature for all or some of the codon:anti-codon hybrids to ensure that all the anti-codons have been annealed to the template before the functional entities are connected to each other through a chemical reaction. In an aspect of the invention, the annealing temperature of the codon:anti-codon hybrids within the same coding region is designed to have different annealing temperature. The separate reaction may be accompliced by initially raising the temperature above the annealing temperature for all the hybrids and slowly decreasing the tempera- ture until the first set of anti-codons anneal to its templates. Following the connection of the functional entity to another functional entity or a nascent templated molecule, the temperature is decreased sufficient for allowing an- other building blocks to anneal to a coding region in the vicinity. The above design provides for the possibility that functional groups of different templates but within the same coding region are subjected to different reaction conditions.
A further design involves annealing temperatures different for each of the coding regions but similar within a specific coding region. Upon proper design it is possible step-wise to anneal the individual building blocks by gradually decreasing the temperature from above the annealing temperature for the total of the codon:anti-codon hybrids to a temperature at or below a temperature where all the codon: anti-codon hybrids have been formed within the same coding region. Subsequently or simultaneously with the temperature regime selected, a connection between the functional entities and the other functional entities or nascent templated molecules is performed. At each step of the step-wise decrease of the temperature, a new building block is annealed to the template and a subsequent connection is performed. This design allows for the simultaneous addition of all the building blocks to the plurality of templates and, thus, omitting the step-wise addition of building blocks.
It is within the capability of the skilled person in the art to construct the desired design. When a specific annealing temperature is desired it is a standard procedure to suggest appropriate compositions of nucleic acid monomers and the length thereof. The construction of an appropriate design may be assisted by software, such as Vector NTI Suite or the public database at the internet address http://www.nwfsc.noaa.gov/protocols/oligoTMcalc.html.
The functional entity of the building block serves the function of being a precursor for the structural entity eventually incorporated into the templated molecule. The functional entity is designed to be capable of being connected to a functional entity of another building block or a nascent templated molecule. The connection is aided by one or more reactive groups of the functional entity. The number of reactive groups which appear on the functional entity is suita- bly one to ten. A building block featuring only one reactive group is used i.a. in the end positions of polymers or scaffolds, whereas building blocks having two reactive groups are suitable for the formation of the body part of a polymer or scaffolds capable of being reacted further. Two or more reactive groups intended for the formation of connections, are typically present on scaffolds. A scaffold is a core structure, which forms the basis for the creation of multiple variants. The variant forms of the scaffold is typically formed through reaction of reactive groups of the scaffold with reactive groups of other building blocks, optionally mediated by fill-in groups or catalysts, under the creation of a connection between the entities. The functional entities to be connected to the scaffold may contain one, two or several reactive groups able to form connections.
Some of the linkers are durable during the entire synthesis to ensure the connection between the scaffolded molecule and the template. It is essential for the invention that at least one linker is maintained in order to ensure the coupling of the templated molecule to the template which directed the synthesis thereof. In a final state of the production of the templated molecule the at least one linker emanating from a building block may be substituted by another entity securing the adherence of the template molecule to the tem- plate. The durable linkers are preferably cleavable at a final stage to separate the templated molecule from the template or a complementary template. Therefore, the durable linkers may be referred to as selectively cleavable linkers. Preferably, some of the linkers of the building blocks are also cleavable during the synthesis of the templated molecule, i.e. the functional entity may be released from the building block to allow the synthesis of the templated molecule. The linker may be attached to the anti-codon at a central area thereof or at one of the ends. In one aspect of the invention, the anti-codon and the linker is a contiguous oligonucleotide, i.e. a part of the nucleotide complements a sequence of the template and another part is non-complementing avoiding the hybridisation of the oligonucleotide part to the template. This design of the building blocks is a convenient way of design as no separate reaction step is required for the attachment of the linker to the anti-codon. In another aspect of the invention the linker is attached to a central part of the anti- codon to allow for the ligation of neighbouring anti-codons using suitable en- zymes to produce a complementary template.
The linker can be attached to the functional entity according to the functionalities desired. In one aspect, the linker is attached to the functional entity through a reactive group capable of forming a connection to another func- tional entity or a nascent templated molecule. Examples of suitable reactive groups are imine groups (-NH-) and disulfide groups (-S-S-). The bonding of the functional entity to the linker can be cleaved simultaneously with the reaction of the inter-spacing reactive group or the cleavage can be performed in a separate step. In the following, linkers connected to a functional entity through a reactive group which is cleaved simultaneously with the formation of the connection, are referred to as translocating linkers. Translocating linkers allow for the production of templated polymers, which are connected to the template that directed the synthesis thereof via the terminal building block, when a reactive group on a functional entity in the vicinity reacts to form a connection. The separate formation of the connection between a functional entity and another functional entity or evolving templated molecule and the cleavage of the linker is an advantage because more than one connection may be formed prior to the cleavage.
A subset of the building blocks is contacted with the plurality of templates in the initial phase of the production of the library. The subset of the total amount of building blocks is selected to have anti-codons which complement unique codons of a specific coding region on the template. It may be of advantage to have the building blocks in the vicinity of the reactive group of the template. In the event, the reactive group of the template is a part of a building block, it is preferred that the building blocks to be linked together is at- tached in the vicinity of each other to ensure a sufficient proximity of the functional entities. Preferably, the subset comprises building blocks having anti- codons which form hybrids with unique codons in two neighbouring coding regions. The subset may be provided by adding the building blocks separately, or alternatively, by adding all the building blocks or a major portion thereof and then direct the annealing of the individual building blocks by proper design of the codon :anti-codon hybrids, as depicted above.
The conditions which allow specific hybridisation of the unique codons and the anti-codons are influenced by a number of factors including temperature, salt concentration, type of puffer, and acidity. It is within the capabilities of the person skilled in the art to select appropriate conditions to ensure that the contacting between the templates and the building blocks are performed at hybridisation conditions.
When two building blocks in the initial stage of the present method are hybridised to a template the functional entities of each of the building blocks are allowed to form a chemical connection. The connection between two functional entities usually occurs by a reaction between reactive groups present on each functional entity. It may, however, be desirable to make the bridging between two reactive groups on separate functional entities through a suitable fill-in group. The latter situation may occur, for example, when two similar reactive groups, such as a two amine groups, are not able to react with each other directly. The two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings. Following the successful connection of two entities for the formation of the nascent templated compound, one of the linkers connected thereto may be cleaved. However, this step is optional. It is possible to continue with the incorporation of further building blocks without this cleaving step. In one aspect of the invention, the connection of the functional entities and the cleavage of one of the linkers occur simultaneously. This aspect of the invention is of particular relevance when the reactive group able to react with another reactive group of a functional entity in the vicinity thereof, is the bridging group to the linker.
The propagation part of the method is initiated by contacting the plurality of different templates harbouring the nascent templated compound with a further subset of the plurality of building blocks, said subset having anti-codons complementary to the unique codons of a coding region in the vicinity of the coding region(s) harbouring the nascent templated molecules. To increase the proximity, it can be suitable to hybridise the further building blocks to a coding region neighbouring the building block(s) harbouring the nascent templated molecule. The subset of building blocks may be provided by adding building blocks separately which hybridise to a specific coding region. Alter- natively, different stringency conditions combined with appropriate design of the individual codon:anti-codon hybrids can be selected to allow the predominate annealing of a subset of building blocks to selected codon regions. The alternative way of forming a subset has the advantage that all or at least a major part of the building blocks can be added to the reaction vessel. An example of directing the annealing is to design the first two coding regions such that they have a relatively high annealing temperature, whereas the subsequent building blocks to be annealed have a gradually decreasing annealing temperature.
When the further building block is hybridised to a template also harbouring the evolving templated molecule, the functional entity of the further building block is allowed to form a chemical connection to the nascent templated molecule. The formation of the chemical connection normally proceeds by reaction between reactive groups present on the functional entity and the nascent templated molecule, respectively. It may, however, be desirable to make the bridging between two reactive groups through a suitable spacer group. The latter situation may for example occur when two similar reactive groups, such as a two amine groups, are not able to react with each other directly. The two amine groups may, however, be connected to each other through a di-carboxylic acid, such as oxalic acid, to create amide bondings.
After the connection between the nascent templated molecule and the further functional entity one or more of the linkers may optionally be cleaved, however ensuring that at least one linker is durable. The propagation part of the method may be repeated a desired number of times to evolve the templated molecule. Each repetition of the propagation is initiated by contacting the templated with a new subset of further building blocks.
After the propagation stage follows the termination stage. Depending on the degree of cleavage during the propagation, the attachment of the templated molecule or the complementary template, is different. At one extreme none of the linkers are cleaved during the synthesis, which is when the optional cleavage of linkers of step g) is not performed. This may lead to a templated molecule attached to a number of linker similar to the number of building blocks involved in the synthesis. At the other extreme, the complexes obtained in step i) comprise templated molecules attached to the template which templated the syntheses thereof via the linker of a single building block. The number of linkers may be anywhere between these two extremes in the templated molecule. In some applications it is of advantage to have more than one linker, e.g. when the conformation of the templated molecule can be stabilized or even altered. In general, it is sufficient for the templated molecule to be attached to the template through a single linker to allow the subsequent enrichment process to proceed efficiently. The attachment via a building block involves the use of hydrogen bondings between the codon and the anti-codon to ensure the coupling of the template and the templated molecule. As is well-known within the art, hydrogen bondings are weak bondings that may easily be disrupted. Therefore, in an aspect of the invention, the building block finally harbouring the templated molecule, may be attached to the template through a codon.anti-codon hybrid having a higher annealing temperature than the other codon:anti-codon hybrids of the template. Alternatively, and in some applications preferably, the templated molecule is connected with the template which directed the syntheses thereof via a covalent link. The covalent link may be in addition to the hydrogen bondings or the covalent link may be a substitution. The presence of a covalent link allows for a more harsh chemical treatment of the complex. In one aspect of the invention, the covalent link is selectively cleavable to provide for a separation of the templated molecule from the complementary template.
The method according to the present invention may involve the further step of cleaving all but one linker after the formation of the templated molecule. This further step implies that some or all of the linkers in step g) are not cleaved during the synthesis of the templated molecule.
The method according to the invention may, as a further step, involve the transfer of the templated molecule to an anchorage point on the template, or a sequence complementing the template, to establish an effective chemical connection between the template and the templated molecule. An effective coupling of the templated molecule to the template or a sequence complementary to the template can be desirable to allow for denaturing enrichment conditions or denaturing post-templating modification of the manufactured molecule. The anchorage may involve the presence of a reactive group on the templated molecule and a reaction partner on the template, whereby the reaction between these reactive groups will establish a covalent link. Alternatively, the anchorage point may be present on a complementary sequence hybridised to the template. In a preferred embodiment the complementing sequence has a higher annealing temperature than one or more of the building blocks, notably the terminal building block, to enable usage of a higher stringency during enrichment and , optionally, clearance of used building blocks.
The anti-codons can, after the cleavage of the linker, remain hybridised to the unique codons or can be detached from the template. When it is chosen to detach the anti-codons, they are preferably cleared from the solution to avoid any re-hybridisation or interference with nucleic acids intended to participate in an hybridisation event. In an aspect of the invention, the anti-codons following the cleavage of the linker attached thereto, remain hybridised to the unique codons because the anti-codons attached to the templates can be ligated together to create a complementary template. The ligation of the anti- codons may be performed after all or the majority of building blocks have been incorporated or, in the alternative, the ligation can be performed after the incorporation of each new building block. Furthermore, in some occasions, it may be of advantage to ligate the anti-codons together prior to the cleavage of the linkers. The ligation of the all the anti-codons provide a direct covalent link between the complementing template and the templated mole- cule. The covalent link is preferably designed to allow the separation of the templated molecule from the complementing template. The separation of the templated molecule will in general during an enrichment process appear as one of the later steps. Therefore, it is of importance in most applications that the covalent link is selectively cleavable, i.e. cleavable under certain chemi- cal conditions not used in the prior steps of enrichment. In one aspect of the invention the templated molecule is released by the use of enzymes. As an example, restriction nucleases may be used by the incorporation of a restriction site close to the templated molecule. Another example is to use a phos- phodiesterase to perform a total or partly digest of the template or comple- menting template. The use of ligation also have another advantage, because it is possible to use anti-codons having a shorter sequence of nucleotides. An example of a typically anti-codon will have 15 to 25 nucleotides in sequence to obtain an appropriate annealing temperature of around 40 to 70°C. By ligating building blocks in the vicinity of each other using a ligase or a chemical crosslink, it becomes possible to incorporate very small anti-codons (e.g. 4-10 nucleotides) with high specificity and efficiency. The ligation of a small anti-codon to another anti-codon or a complementing template increases the total annealing temperature. A result of using smaller anti-codons is that, the local con- centration of functional entities is increased, and therefore, the efficiency of the reaction between the reactive groups becomes more efficient.
Another way to increase the proximity further is to provide building blocks intended to interact with each other, with a reversible interacting molecule pair. The molecule pair allows a building block to form a reversible coupling to another building block in the vicinity thereof through the interaction of the two parts of the pair situated on each building block. Preferably, the molecule pair is also termed a dimerisation domain and is located in the functional entity or is a portion of the linker that is close to the functional entity. The dimer- isation domains of two building blocks intended to react with each other are designed to have an affinity to each other. Examples of dimerisation domains include leucine-rich areas, coiled-coil structures, antibody-antigen pairs, complementing sequences of nucleotides, ect. The affinity of the dimerisation of two building blocks are preferably lower than the affinity between the codon and the anti-codon to allow for shifting dimerisation partners though performing temperature cycles. When the dimerisation domains of two building blocks intended to interact are sequences of nucleotides, the length of the sequences may be chosen to obtain an annealing temperature below room temperature but preferably above 5°C, e.g. between 10°C and 20°C. When the dimerisation domain includes two complementing oligonucleotides, the domain is also referred to as a "zipper box". A suitable temperature scheme for the propagation step of the present invention is to add a building block to the template at a temperature above the annealing temperature for said building block. Then the temperature is lowered below the annealing temperature to allow the new building block as well as the building block harbouring the nascent templated molecule to find and bind to their respective parts of the template. Excess building blocks and debris are then preferably washed away. Then the temperature is decreased below the annealing temperature of the dimerisation domain and consequently the probability that the functional entities are connected is increased. Potentially, the conditions in the reaction vessel, other than the temperature, may be changed to provide for the connection. Following the connection between the functional entities/templated molecules, the temperature is raised and the temperature scheme is repeated.
Another method of increasing the proximity further is to apply a "rigid" linker attached to the anti-codon with molecular hinges. A result of using a rigid linker is that a smaller three dimensional space is sampled by the functional entity. Thereby the probability is increased that two functional entities in the vicinity of each other and attached to a rigid linker will be close enough to each other for a reaction to proceed. A rigid linker may be prepared by various methods available to the skilled person in the art. An example is to use a double stranded oligonucleotide. In a preferred embodiment, the anti-codon and the linker is performed of a contiguous oligonucleotide, wherein the anti- codon domain of the oligonucleotide is able to hybridise to a unique codon of a template and a suffer domain is able to hybridise to a further oligonucleotide complementary thereto. The hinges may be provided by any group allowing essentially unhindered rotation about at least one bonding. A hinge may be provided in the above preferred embodiment by separation of the anti- codon domain and the stiffer domain with at least one nucleotide. In other words, a hinge may be provided by a single stranded region positioned between the double stranded unique codon:anti-codon hybrid and the double stranded rigid linker. In one aspect of the invention, the template is covalently connected to the complementing template. The connection may be performed by covalently bonding the two hybridised strings to each other. In the alternatively, the template may at one end be designed with a hair pin loop to enable the ligation of the template end to an anti-codon. According to this aspect, the templated molecule will be linked to a double stranded template. The double stranded template may be an advantage because it is more stable allowing more versatile chemical reactions.
In one aspect of the invention a library of complexes is obtainable from the above methods.
The library may be used for a variety of applications, including the search for compounds for use in therapeutic or diagnostic methods and plant protection compounds, like pesticides, fungicides ect. The library may comprise any number of complexes according to the invention. At one extreme, the library consists of only two complexes. At the other extreme, the library can consist of up to 1018 complexes. Usually, the number of complexes is to be selected between these to extremes.
One method to identify the most active compounds which can be used in e.g. therapeutic applications is to subject the library to an enrichment treatment. According to one aspect of the invention an enrichment of a library of complexes comprising templated molecules with respect to a predetermined activity, comprises the steps of: i) establishing a first library of complexes comprising templated molecules, said library being obtainable according to any of the methods of the invention, ii) exposing the library to conditions enriching the library with complexes having the predetermined activity, iii) amplifying the complexes of the enriched library, iv) optionally, repeating step ii) to iii), and v) obtaining an enriched library having a higher ratio of complexes comprising templated molecules with the predetermined activity.
The amplification is normally preferred, though not always necessary. Especially, when several cycles of enrichments are conducted it is of advantage to make an amplification to obtain sufficient complexes. In a preferred aspect of the invention, the amplification of the complexes of the enriched library comprises the steps of contacting the library of complexes with amplification means, amplifying the templates or the complementing templates, and conducting the method according to the invention using the amplification product as templates. The amplification means can be any of the nucleic acid amplification means suitable for the amplification of the template, such as PCR. Preferably, the amplification of the complex comprises a 101 to 1015-fold amplification.
To allow for multiple enrichment cycles the steps ii) and iii) are repeated at least 2, 3, 5 times, such as at least 10 times, such as at least 15 times. The complexes may be identified after the completion of each cycle or may be only be identified after the last cycle. There is no explicit need for intermediate identifications as the amplification can be performed without knowing the sequence of the template or a sequence complementing the template, if the template or the complement thereof is provided with suitable primer regions. The identification after the enrichment process involves the determination of the sequence of the template and/or the structural determination of the templated molecule and/or the entire complex having the predetermined activity.
Preferably, the conditions enriching the library comprise contacting a binding partner to the templated molecules of interest. The binding partner may be in solution or may be directly or indirectly immobilised on a support. The enrichment is in general performed using an affinity or activity assay. In one aspect of the invention, the enrichment is conducted by screening for complexes having an affinity for - or an effect on - a target molecule or a target entity. In another aspect the enrichment is conducted by selection for catalytic activity. Alternatively, the conditions enriching the library involves any one or more of electrophoretic separation, gelfiltration, immunoprecipitation, isoelectric focusing, centrifugation, and immobilization.
The enrichment process can involve cells. Thus, in one embodiment, the conditions enriching the library comprises providing cells capable of internalising the templated molecule, or performing an interaction with the templated molecule having the desired predetermined activity.
When the library of complexes have been enriched to a small pool comprising complexes displaying a predetermined activity, it is desirable to obtain each of the complexes separately. Thus, the invention also entails to a method for the manufacture of a complex of a templated molecule attached to the template which directed the synthesis thereof, said method comprises the steps of a) providing a template comprising a number of coding regions and a re- active group, wherein each coding region specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of the template, and the functional entity comprises at least one reactive group, c) contacting the template with a building block having an anti-codon which complements the unique codon of a specific coding region, said contacting being per ormed under conditions which allow specific hybridisation of the anti-codon to the unique codon of the templates, d) reacting the reactive group of the template and the reactive group of the building block to obtaining a chemical connection, e) contacting under conditions allowing specific hybridisation, the template harbouring the nascent templated molecule with a further building block having an anti-codon complementary to the unique codon of a coding region in the vicinity of the coding region harbouring the nas- cent templated molecule, f) allowing the functional entity of the further building block to form a chemical connection to the nascent templated molecule, g) optionally, cleaving one or more of the linkers, provided that at least one linker remains to connect the nascent templated molecule with the template which directed the synthesis thereof, h) optionally repeating steps e) through g), i) obtaining a templated molecule attached via the linker of one or more building blocks to the template which directed the synthesis thereof.
The templated molecule can be obtained from the complex by cleaving the linker(s) of the one or more building blocks to release the templated molecule from the template.
Detailed disclosure of the invention
Codon The codons occurring in nature consist of a sequence of three nucleic acid monomers. The length of the codon sequence may be of the same order in accordance with the present invention but is preferably longer to obtain a suitable annealing temperature. Preferably the sequence is selected to produce an annealing temperature above normal room temperature. Herein the terms annealing temperature and melting temperature may be used interchangeably said temperature being defined as the maximum of the first derivative of the absorbance vs. temperature curve. The different codons need no to be of the same lengths, that is to comprise the same number of nucleic acid monomers. However, a typically number of nucleic acid monomers in the codon sequence is normally above 6 but below 25. Each nucleic acid monomer is normally composed of three parts, namely a nucleobase moiety, a sugar moiety and a intemucleoside linker.
The nucleobase moiety may be selected among naturally occurring nucleo- bases as well as non-naturally occurring nucleobases. It should be clear to the person skilled in the art that various nucleobases which previously have been considered "nonnaturally occurring" have subsequently been found in nature. Thus, "nucleobase" includes not only the known purine and pyrimi- dine hetero-cycles, but also heterocyclic analogues and tautomers thereof. Illustrative examples of nucleobases are adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7- deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosin, N6,N6-ethano-2,6- diamino-purine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocy- tosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Pat No. 5,432,272. The term "nucleobase" is intended to cover every and all of these examples as well as analogues and tautomers thereof. Especially interesting nucleobases are adenine, guanine, thymine, cytosine, 5-methylcytosine, and uracil, which are considered as the naturally occurring nucleobases in relation to therapeutic and diagnostic application in humans.
The sugar moiety is suitably a pentose but may be the appropriate part of an PNA. Suitable examples of possible pentoses include ribose, 2'-deoxyribose,
2'-O-methyl-ribose, 2'-flour-ribose, and 2'-4'-O-methylene-ribose (LNA).
Suitably the nucleobase is attached to the 1' position of the pentose entity.
An intemucleoside linker connects the 3' end of preceding monomer to a 5' end of a succeeding monomer. The intemucleoside linkage may be the natu- ral occurring phospodiester linkage or a derivative thereof. Examples of such derivatives include phosphorothioate, methylphosphonate, phosphoramidate, phosphotriester, and phosphodithioate. Furthermore, the intemucleoside linker can be any of a number of non-phosphorous-containing linkers known in the art.
Preferred nucleic acid monomers include naturally occurring nucleosides forming part of the DNA as well as the RNA family connected through phos- phodiester linkages. The members of the DNA family include de- oxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine. The members of the RNA family include adenosine, guanosine, uridine, cytidine, and inosine.
Each codon is complemented by an anti-codon. The anticodon has the ability specifically to engage with the codon which it complements. The affinity between the codon and the complementing anti-codon is affected through hydrogen bondings following the well-known Watson-Crick base pairing system. Thus, the anti-codon may be composed of the same kind of nucleic acid monomers as the codon itself.
Linkers Linkers connecting the anti-codon and functional entity of building blocks may be selected from a variety of possibilities. Linkers may include one or more reactive groups in order to obtain a selectively cleavable linker, a cleavable linker, and a translocating linkers. Suitable linkers may be selected from but are not limited to, the group comprising: carbohydrides and substituted car- bohydrides; vinyl, polyvinyl and substituted polyvinyl; acetylene, polyacety- lene; aryl/hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl; ethers, polyethers such as e.g. polyethylenglycol and substituted polyethers; amines, polyamines and substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides and substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides; and polyamides and natural and un- natural polypeptides and substituted polyamides and natural and unnatural polypeptides.
Functional groups The functional entity may comprise one or more functional groups, i.e. groups which eventually form part of the templated molecule. The templated molecule may comprise one or more of the following functional groups either alone or in combination:
1. Hydroxyls
2. Primary, secondary, tertiary amines
3. Carboxylic acids
4. Phosphates, phosphonates 5. Sulfonates, sulfonamides
6. Amides
7. Carbamates
8. Carbonates
9. Ureas 10.Alkanes, Alkenes, Alkynes
11. Anhydrides
12. Ketones
13. Aldehydes 14. Nitatrat.es, nitrites 15. lmines
16. Phenyl and other aromatic groups
17. Pyridines, pyrimidines, purines, indole, imidazole, and heterocyclic bases
Iδ. Heterocycles 19. polycycles
20. Flavins
21. Halides 22. Metals
23. Chelates
24. Mechanism based inhibitors
25. Small molecule catalysts 26. Dextrins, saccharides
27. Fluorescein, Rhodamine and other fluorophores
28. Polyketides, peptides, various polymers
29. Enzymes and ribozymes and other biological catalysts
30. Functional groups for post-polymerization/post activation coupling of functional groups
31. Drugs, e.g., taxol moiety, acyclovir moiety, "natural products"
32. Supramolecular structures, e.g. nanoclusters
33. Lipids
34. Oligonucleotides, oligonucleotide analogs (e.g., PNA, LNA, mor- pholinos)
35. Hydrogen
Reactive groups Reactive groups relates among other things to groups which form part of the functional entity and are capable of participating in a reaction that form a connection between two functional entities, either directly or via a suitable bridging molecular entity. Examples of reactive groups are listed below:
1. N-carboxyanhydrides (NCA)
2. N-thiocarboxyanhydrides (NTA) 3. Amines
4. Carboxylic acids
5. Ketones
6. Aldehydes
7. Hydroxyls 8. Thiols
9. Esters 10.Thioesters 11. conjugated system of double bonds
12. Alkyl halides 13. Hydrazines
14. N-hydroxysuccinimide esters 15. Epoxides
16. Haloacetyls
17. UDP-activated saccharides 18.Sulfides 19.Cyanates 20.CarbonylimidazoIe
21.Thiazinanones
22. Phosphines
23. Hydroxylamines 24.Sulfonat.es 25. Activated nucleotides
26.Vinylchloride 27.Alkenes, quinones
Templated molecules
According to the present invention, virtually any molecule may be templated using the general method disclosed herein. Examples of compounds which it is anticipated can be synthesised includes, but are not limited to, the compounds listed below:
alpha-, beta-, gamma-, and omega-peptides Mono-, di- and tri-substituted peptides; L- and D-form peptides; Cyclohexane- and cyclopentane-backbone modified beta-peptides; Vinylogous polypeptides; glycopolypeptides; polyamides; vinylogous sulfonamide peptide; polysulfonamide; conjugated peptide (i.e., having prosthetic groups); polyesters; polysaccharides; polycarbamates; polycarbonates; polyureas; poly-peptidylphosphonates; azatides; peptoids (oligo N-substituted glycines); polyethers; ethoxyformacetal oligomers; poly- thioethers; polyethylene glycols (PEG); polyethylenes; polydisulfides; pol- yarylene sulfides; polynucleotides; PNAs; LNAs; morpholinos; oligo pyrroli- none; polyoximes; polyimines; polyethyleneimine; polyacetates; polystyrenes; polyacetylene; polyvinyl; lipids; phospholipids; glycolipids; polycycles (ali- phatic); polycycles (aromatic); polyheterocycles; proteoglycan; polysiloxanes; polyisocyanides; polyisocyanates; polymethacrylates; monofunctional, Di- functional, Trifunctional and Oligofunctional open-chain hydrocarbons; mono- functional, difunctional, trifunctional and oligofunctional nonaromatic carbocy- cles; monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons; bridged poly- cyclic hydrocarbons; monofunctional, difunctional, trifunctional, and oligofunctional nonaromatic heterocycles; monocyclic, bicyclic, tricyclic, and polycyclic heterocycles, bridged polycyclic heterocycles; monofunctional, difunctional, trifunctional and oligofunctional aromatic carbocycles; monocyclic, bicyclic, tricyclic, and polycyclic aromatic carbocycles; monofunctional, difunctional, trifunctional and oligofunctional aromatic heterocycles; monocyclic, bicyclic, tricyclic and polycyclic heterocycles; chelates; fullerenes; steroids; cyc- losporin analogs; as well as any combination of the above molecular moieties.
Use of Library
Selection or screening, commonly referred to as enrichment, of the library of complexes comprising templated molecules with respect to desired activities (for example binding to particular target, catalytic activity, or a particular effect in an activity assay) may be performed according to any standard proto- col. For example, affinity selections may be performed according to the principles used for phage displayed, polysome-displayed or mRNA-protein fusion displayed peptides. Selection for catalytic activity may be performed by affinity selections on transition-state analogue affinity columns (Baca et al. , Proc. Natl. Acad. Sci USA. 1997; 94(19):10063-8), or by function-based selection schemes (Pedersen et al., Proc. Natl. Acad. Sci. USA. 1998, 95(18):10523-8).
Screening for a desired characteristic may be performed according to standard microtiter plate-based assays, or by FACS-sorting assays. Generally, affinity selections involve the immobilisation of a target or a binding partner on a solid support, such as a column. Subsequently, the complex manufactured according to the invention is added to the column under condi- tions allowing a part of the complexes to bind to the target. The complexes not bound to the target is eluted out of the column and discharged. The part of the complexes attached to the target may be amplified using the template or complementing template associated with the templated molecule.
The choice of amplification method depends on the choice of codons and anti-codons. Natural oligonucleotides can be amplified by any state of the art method. These methods include, but is not limited to the polymerase chain reaction (PCR); as wells as e.g. nucleic acid sequence-based amplification (e.g. Compton, Nature 350, 91-92 (1991)), amplified anti-sense RNA (e.g. van Gelder et al., PNAS 85: 77652-77656 (1988)); self-sustained sequence replication system (e.g. Gnatelli et al., PNAS 87: 1874-1878 (1990)); polymerase independent amplification as described in e.g. Schmidt et al., NAR 25: 4797-4802 (1997), as well as in vivo amplification of plasmids carrying cloned DNA fragments. Ligase-mediated amplification methods may also be used, e.g., LCR (Ligase Chain Reaction).
For non-natural nucleotides the choices of efficient amplification procedures are fewer. As non-natural nucleotides per definition can be incorporated by certain enzymes including polymerases, it will be possible to perform manual polymerase chain reaction by adding the polymerase during each extension cycle.
For oligonucleotides containing nucleotide analogs, fewer methods for amplification exist. One may use non-enzyme mediated amplification schemes (Schmidt et al., NAR 25: 4797-4802 (1997)). For backbone- modified oligonucleotide analogs such as PNA and LNA, this amplification method may be used. Before or during amplification the templates or complementing templates may be mutagenized or recombined in order to create a larger diversity for the next round of selection or screening.
Following the amplification of the template part or complementing template part of the complex, the method according to the invention is conducted using the amplification product as the templates. The result is a reduced or enriched library of complexes of a template attached to a template molecule.
The selection and amplification steps may be repeated if considered neces- sary to further enrich the library. When the selection and amplification steps are repeated, the binding step involving the target and the complexes, is preferably performed under more strict conditions ensuring that only a part of the complexes adhere to the target.
The enrichment cycles may be performed 2 to 15 times or even more with enrichment in each cycle of 10 to 1000 times. In one approach, the starting library amounts to 1014 complexes. After seven cycles of enrichments with a 100 fold concentration in each cycle, the complex with the highest affinity to the target should, theoretically, be obtained. However, it is more likely that the final cycles deliver a small pool of interesting complexes, which have to be examined by other means.
After the final round of selection, it is often desirable to sequence individual templates, in order to determine the composition of individual templated molecules. If the template contains natural nucleotides, it is a standard routine to optionally PCR amplify the isolated templates (if the template is an RNA molecule, it is necessary to use reverse transcriptase to produce cDNA prior to the PCR-amplification), and then clone the DNA fragments into for example plasmids, transform these and then sequence individual plasmid- clones containing one or multiple tandem DNA sequences. In this case, it is practical to design a restriction site in both of the flanking sequences to the central random or partly random sequence of the template (i.e., in the primer binding sites). This will allow easy cloning of the isolated nucleotides. Sequencing can be done by the standard dideoxy chain termination method, or by more classical means such as Maxam-Gilbert sequencing.
If the template contains non-natural nucleotides, it may not be feasible to clone individual sequences by transfer through a microbial host. However, using bead populations where each bead carries one oligonucleotide sequence, it is possible to clone in vitro, where after all the nucleotides attached to a specific bead may be optionally amplified and then sequenced (Brenner et al., 2000, Proc. Natl. Acad. Sci. USA 97, 1665-1670). Alternatively, one may dilute the population of isolates adequately, and then aliquot into microtiter plates so that the wells on average contain for example 0.1 templates. By amplifying the single templates by for example PCR, it will now be possible to sequence using standard methods. Of course, this requires that the non-natural nucleotides are substrates for the thermostable polymerase used in the PCR.
If alternative methods are used that require shorter oligonucleotides it may be desirable to design the starting template so as to contain restriction sites on either side of the encoding/templating region of the template. Thereby, after the final selection round, the templates can be restricted, to obtain a short oligonucleotide encoding the templated polymer, and then these short oligonucleotides can be applied to various analytical procedures.
It is also possible to sequence the isolates by the use of a DNA array of oligonucleotides with random but predetermined sequences.
It may also be desirable to sequence the population of isolates as a pool, for example if the sequences are expected to be in register, for example be- cause the initial library consisted of a degenerate sequence based on a polymer sequence with a known (relatively high) desired activity. Therefore, it is then expected that all the isolates have sequences similar to the initial sequence of the templates before selection. Thus, the population of isolates can be sequenced as a whole, to obtain a consensus sequence for the population as a whole.
Selection of template-displaying molecules that will bind to known targets The present invention is also directed to approaches that allow selection of small molecules capable of binding to different targets. The template- displaying molecule technology contains a built-in function for direct selection and amplification. The binding of the selected molecule should be selective in that they only coordinate to a specific target and thereby prevent or induce a specific biological effect. Ultimately, these binding molecules should be possible to use e.g. as therapeutic agents, or as diagnostic agents.
Template-displaying molecule libraries can easily be combined with screen- ings, selections, or assays to assess the effect of binding of a molecule ligand on the function of the target. In a more specific embodiment, the template-displaying method provides a rapid means for isolating and identifying molecule ligands which bind to supra-molecular, macro-supra-molecular, macro-molecular and low-molecular structures (e.g. nucleic acids and pro- teins, including enzymes, receptors, antibodies, and glycoproteins); signal molecules (e.g. cAMP, inositol triphosphate, peptides, prostaglandins); and surfaces (e.g. metal, plastic, composite, glass, ceramics, rubber, skin, tissue).
Specifically, selection or partitioning in this context means any process whereby the template-displaying molecule complex bound to a target molecule, the complex-target pair, can be separated from template-displaying molecules not bound to the target molecule. Selection can be accomplished by various methods known in the art.
The selection strategy can be carried out so it allows selection against almost any target. Importantly, no steps in this selection strategy need any detailed structural information of the target or the molecules in the libraries. The entire process is driven by the binding affinity involved in the specific recognition/coordination of the molecules in the library to a given target. However, in some applications, if needed, functionality can also be included analogous to selection for catalytic activity using phage display (Soumillion et al. (1994) J. Mol. Biol. 237: 415-22; Pedersen et al. (1998) PNAS. 18: 10523-10528). Example of various selection procedures are described below.
This built-in template-displaying molecule selection process is well suited for optimizations, where the selection steps are made in series starting with the selection of binding molecules and ends with the optimized binding molecule. The single procedures in each step are possible to automate using various robotic systems. This is because there is a sequential flow of events and where each event can be performed separately. In a most preferable setting, a suitable template-displaying molecule library and the target molecule are supplied to a fully automatic system which finally generates the optimized binding molecule. Even more preferably, this process should run without any need of external work outside the robotic system during the entire procedure.
The libraries of template-displayed molecules will contain molecules that could potentially coordinate to any known or unknown target. The region of binding on a target could be into a catalytic site of an enzyme, a binding pocket on a receptor (e.g. GPCR), a protein surface area involved in protein- protein interaction (especially a hot-spot region), and a specific site on DNA (e.g. the major groove). The template-displaying molecule technology will primarily identify molecules that coordinate to the target molecule. The natural function of the target could either be stimulated (agonized) or reduced (antagonized) or be unaffected by the binding of the template-displaying molecules. This will be dependent on the precise binding mode and the par- ticular binding-site the template-displaying molecules occupy on the target. However, it is known that functional sites (e.g. protein-protein interaction or catalytic sites) on different proteins are more prone to bind molecules that other more neutral surface areas on a protein. In addition, these functional sites normally contain a smaller region that seems to be primarily responsible for the binding energy, the so called hot-spot regions (Wells, et al. (1993) Recent Prog. Hormone Res. 48; 253-262). This phenomenon will increase the possibility to directly select for small molecules that will affect the biological function of a certain target.
The template-displaying molecule technology of the invention will permit selection procedures analogous to other display methods such as phage dis- play (Smith (1985) Science 228: 1315-1317). Phage display selection has been used successfully on peptides (Wells & Lowman. (1992) Curr. Op. Struct. Biol. 2, 597-604) proteins (Marks et al. (1992) J. Biol. Chem. 267: 16007-16010) and antibodies (Winter et al. (1994) Annu. Rev. Immunol. 12: 433-455). Similar selection procedures are also exploited for other types of display systems such as ribosome display (Mattheakis et al. (1994) Proc. Natl. Acad. Sci. 91: 9022-9026) and mRNA display (Roberts, et al. (1997) Proc. Natl. Acad. Sci. 94: 12297-302). However, the template-displaying molecule technology of the invention, will for the first time allow direct selection of target-specific small non-peptide molecules independently of the translation process on the ribosome complex. The necessary steps included in this invention are the amplification of the templates and incorporation and reaction of the monomer building blocks. The amplification and incorporation and the incorporation and reaction are either done in the same step or in a sequential process.
The linkage between the templated molecule (displayed molecule) and DNA replication unit (coding template) allows a rapid identification of binding molecules using various selection strategies. This invention allows a broad strategy in identifying binding molecules against any known target. In addition, this technology will also allow discovery of novel unknown targets by isolating binding molecules against unknown antigens (epitopes) and use these bind- ing molecules for identification and validation (see section "Target identification and validation").
As will be understood, selection of binding molecules from the template- displaying molecule libraries can be performed in any format to identify optimal binding molecules. A typical selection procedure against a purified target will include the following major steps: Generation of a template-displaying molecule library: Immobilization of the target molecule using a suitable immobilization approach; Adding the library to allow binding of the template- displayed molecules; Removing of the non-binding template-displayed molecules; Elution of the template-displayed molecules bound to the immobilized target; Amplification of enriched template-displaying molecules for identification by sequencing or to input for the next round of selection. The general steps are schematically shown in Figure 27.
In a preferred embodiment, a standard selection protocol using a template- displaying molecule library is to use the bio-panning method. In this technique, the target (e.g. protein or peptide conjugate) is immobilized onto a solid support and the template-displayed molecules that potentially coordi- nate to the target are the ones that are selected and enriched. However, the selection procedure requires that the bound template-displayed molecules can be separated from the unbound ones, i.e. those in solution. There are many ways in which this might be accomplished as known to ordinary skilled in the art.
The first step in the affinity enrichment cycle (one round as described in Figure 27) is when the template-displayed molecules showing low affinity for an immobilized target are washed away, leaving the strongly binding template- displayed molecules attached to the target. The enriched population, remain- ing bound to the target after the stringent washing, is then eluted with, e.g. acid, chaotropic salts, heat, competitive elution with the known ligand or proteolytic release of the target/template molecules. The eluted template- displayed molecules are suitable for PCR, leading to many orders of amplification, i.e. every single template-displayed molecule enriched in the first selection round participates in the further rounds of selection at a greatly increased copy number. After typically three to ten rounds of enrichment a population of molecules is obtained which is greatly enriched for the template-displayed molecules which bind most strongly to the target. This is followed quantitatively by assaying the proportion of template-displaying molecules which remain bound to the immobilized target. The variant template sequences are then individually sequenced.
Immobilisation of the target (peptide, protein, DNA or other antigen) on beads might be useful where there is doubt that the target will adsorb to the tube (e.g. unfolded targets eluted from SDS-PAGE gels). The derivatised beads can then be used to select from the template-displaying molecules, simply by sedimenting the beads in a bench centrifuge. Alternatively, the beads can be used to make an affinity column and the template-displaying libraries suspension recirculated through the column. There are many reactive matrices available for immobilizing the target molecule, including for instance attachment to -NH2 groups and -SH groups. Magnetic beads are essentially a vari- ant on the above; the target is attached to magnetic beads which are then used in the selection. Activated beads are available with attachment sites for -NH2 or -COOH groups (which can be used for coupling). The target can be also be blotted onto nitrocellulose or PVDF. When using a blotting strategy, it is important to make sure the strip of blot used is blocked after immobilization of the target (e.g. with BSA or similar protein).
In another preferred embodiment, the selection or partitioning can also be performed using for example: Immunoprecipitation or indirect immunoprecipitation were the target molecule is captured together with template-displaying binding molecules; affinity column chromatography were the target is immobilized on a column and the template-displaying libraries are flowed through to capture target-binding molecules; gel-shift (agarose or polyacrylamide) were the selected template-displaying molecules migrate together with the target in the gel; FACS sorting to localize cells that coordinates template-displaying molecules; CsCI gradient centrifugation to isolate the target molecule together template-displaying binding molecules; Mass spectroscopy to identify target molecules which are labelled with template-displaying molecules; etc., without limitation. In general, any method where the template-displaying molecule/target complex can be separated from template-displaying molecules not bound to the target is useful.
Table 1 : Examples of selection method possible to use to identify binding molecules using the template-displaying technology.
Type of Target Method of choice
Soluble receptors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
Cell Surface receptor Cell-surface subtraction selection, FACS sorting, Affinity column.
Enzyme inhibitors Direct immobilization, Immunoprecipitation, affinity column, FACS sorting, MS.
Surface epitopes Cell-surface subtraction selection, in-vivo selection, FACS sorting, Affinity column.
Elution of template-displayed molecules can be performed in different ways. The binding molecules can be released from the target molecule by denatu- ration, acid, or chaotropic salts and then transferred to another vial for amplification. Alternatively, the elution can be more specific to reduce the background. Elution can be accomplished using proteolysis to cleave a linker between the target and the immobilizing surface or between the displaying molecule and the template. Also, elution can be accomplished by competition with a known ligand. Alternatively, the PCR reaction can be performed directly in the washed wells at the end of the selection reaction. A possible feature of the invention is the fact that the binding molecules need not be elutable from the target to be selectable since only the encoding template DNA is needed for further amplification or cloning, not the binding molecule itself. It is known that some selection procedure can bind the most avid ligands so tightly as to be very difficult to elute. However the method of the invention can successfully be practiced to yield avid ligands, even covalent binding ligands.
Alternative selection protocol includes a known ligand as fragment of each displayed molecule in the library. That known ligand will guide the selection by coordinate to a defined part on the target molecule and focus the selection to molecules that binds to the same region. This could be especially useful for increasing the affinity for a ligand with a desired biological function but with a too low potency.
A further aspect of the present invention relates to methods of increasing the diversity or complexity of a single or a mixture of selected binding molecules. After the initial selection, the enriched molecules can be altered to further increase the chemical diversity or complexity of the displayed molecules. This can be performed using various methods known to the art. For example, using synthesized randomized oligonucleotides, spiked oligonucleotides or random mutagenesis. The randomization can be focused to allow preferable codons or localized to a predetermined portion or sub-sequence of the template nucleotide sequence. Other preferable method is to recombine tem- plates coding for the binding molecules in a similar manner as DNA shuffling is used on homologous genes for proteins (Stemmer (1994) Nature 370:389- 91). This approach can be used to recombine initial libraries or more preferably to recombine enriched encoding templates.
In another embodiment of the invention when binding molecules against spe- cific antigens that is only possible to express on a cell surface, e.g. ion channels or transmembrane receptors, is required, the cells particle themselves can be used as the selection agent. In this sort of approach, cells lacking the specific target should be used to do one or more rounds of negative selection or be present in large excess in the selection process. Here, irrelevant template-displayed molecules are removed. For example, for a positive selection against a receptor expressed on whole cells, the negative selection would be against the untransformed cells. This approach is also called subtraction selection and has successfully been used for phage display on antibody libraries (Hoogenboom et al. (1998) Immunotech. 4: 1-20).
A specific example of a selection procedure can involve selection against cell surface receptors that become internalized from the membrane so that the receptor together with the selected binding molecule can make its way into the cell cytoplasm or cell nucleus. Depending on the dissociation rate constant for specific selected binding molecules, these molecules largely reside after uptake in either the cytoplasm or the nucleus.
The skilled person in the art will acknowledge that the selection process can be performed in any setup where the target is used as the bait onto which the template-displaying molecules can coordinate.
The selection methods of the present invention can be combined with secondary selection or screening to identify molecule ligands capable of modifying target molecule function upon binding. Thus, the methods described herein can be employed to isolate or produce binding molecules which bind to and modify the function of any protein or nucleic acid. It is contemplated that the method of the present invention can be employed to identify, isolate or produce binding molecules which will affect catalytic activity of target enzymes, i.e., inhibit catalysis or modifying substrate binding, affect the functionality of protein receptors, i.e., inhibit binding to receptors or modify the specificity of binding to receptors; affect the formation of protein multimers, i.e., disrupt quaternary structure of protein subunits; and modify transport properties of protein, i.e., disrupt transport of small molecules or ions by proteins. A still further aspect of the present invention relates to methods allowing functionality in the selection process can also be included. For example, when enrichment against a certain target have been performed generation a number of different hits, these hits can then directly be tested for functionality (e.g. cell signalling). This can for example be performed using fluorescence- activated cell sorting (FACS).
The altered phenotype may be detected in a wide variety of ways. Generally, the changed phenotype is detected using, for example: microscopic analysis of cell morphology; standard cell viability assays, including both increased cell death and increased cell viability; standard labelling assays such as fluorometric indicator assays for the presence of level of particular cell or molecule, including FACS or other dye staining techniques; biochemical de- tection of the expression of target compounds after killing the cells; etc. In some cases, specific signalling pathways can be probed using various reporter gene constructs.
Secondary selection methods that can be combined with template-displaying molecule technology include among others selections or screens for enzyme inhibition, alteration or substrate binding, loss of functionality, disruption of structure, etc. Those of ordinary skill in the art are able to select among various alternatives of selection or screening methods that are compatible with the methods described herein.
The binding molecules of the invention can be selected for other properties in addition to binding, For example, during selection; stability to certain conditions of the desired working environment of the end product can be included as a selection criterion. If binding molecules which are stable in the presence of a certain protease is desired, that protease can be part of the buffer medium used during selection. Similarly, the selection can also be performed in serum or cell extracts or any type of media. As will be understood, when util- izing this template-displaying approach, conditions which disrupt or degrade the template should be avoided to allow amplification. Other desired properties can be incorporated, directly into the displaying molecules as will be understood by those skilled in the art. For example, membrane affinity can be included as a property by employing building blocks with high hydrophobicity.
Molecules selected by the template-displaying molecule technology can be produced by various synthetic methods. Chemical synthesis can be accomplished since the structure of selected binding molecules is readily obtained form the nucleic acid sequence of the coding template. Chemical synthesis of the selected molecules is also possible because the building blocks that compose the binding molecules are also known in addition to the chemical reactions that assemble them together.
In a preferred embodiment, the selected binding molecules is synthesized and tested in various appropriate in vitro and in vivo testing to verify the selected candidates for biological effects and potency. This may be done in a variety of ways, as will be appreciated by those in the art, and may depend on the composition of the bioactive molecule.
Target identification and validation
In another aspect, the present invention provides methods to identify or isolate targets that are involved in pathological processes or other biological events. In this aspect, the target molecules are again preferably proteins or nucleic acids, but can also include, among others, carbohydrates and various molecules to which specific molecule ligand binding can be achieved. In principal, the template-displaying molecule technology could be used to select for specific epitopes on antigens found on cells, tissues or in vivo. These epitopes might belong to a target that is involved in important biological events. In addition, these epitopes might also be involved in the biological function of the target. Phage display with antibodies and peptide libraries has been used numerous times successfully in identifying new cellular antigens, (e.g. Pasqualini et al. (1996) Nature 380: 364-366; Pasqualini et al. (2000) Cancer Res. 60: 722- 727; Scheffer et al. (2002) Br J Cancer 86: 954-962; Kupsch et al. (1999) Clin Cancer Res. 5: 925-931 ; Tseng-Law et al. (1999) Exp. Hematol. 27: 936-945; Gevorkian et al. (1998) Clin. Immunol. Immunopathol. 86: 305-309). Especially effective have been selection directly on cells suspected to express cell-specific antigens. Importantly, when selecting for cell-surface antigen, the template molecule can be maintained outside the cell. This will increase the probability that the template molecule will be intact after release for the cell surface.
In vivo selection of template-displayed molecules has tremendous potential. By selecting from libraries of template-displayed molecules in vivo it is possi- ble to isolate molecules capable of homing specifically to normal tissues and other pathological tissues (e.g. tumours). This principle has been illustrated using phage display of peptide libraries (Pasqualini & Ruoslathi (1996) Nature 280: 364-366). This system has also been used in humans to identify peptide motifs that localized to different organs (Arap et al. (2002) Nat. Med. 2:121-127). A similar selection procedure could be used for the template- displaying libraries. The coding DNA in phage display is protected effectively by the phage particle allows selection in vivo. Accordingly, the stability of the template in vivo will be important for amplification and identification. The template can be stabilised using various nucleotide derivatives in a similar way as have been used to stabilise aptamers for in vivo applications (Nolte (1996) Nature Biotechnol. 14: 1116-1121; Pagratis et al. (1997) Nature Biotechnol. 15: 68-72). However, it is reasonable to believe that the template structure will be stabilized against degradation due to the modified bases used for encoding the displayed molecule. Other types of protection are also possible where the template molecule is shielded for the solution using various methods. This could include for example liposomes, pegylation, binding proteins or other sorts of protection. The template molecule could also be integrated into another designed structure that protects the template form external manipulation. Fort example, the linker can be design to be incorporated in vesicles to position the templates inside the vesicle and the displaying molecules on the outside. The arrangement will protect the template molecules from external manipulate and at the same time allow exposure of the displaying molecules to permit selection.
Most antibodies have a large concave binding area which requires to some degree protruding epitopes on the antigens. Also, the antibody molecule is a large macromolecule (150 KDa) which will sterically reduce the access for a number of different antigens (e.g. on a cell surface). The template-displaying technology should be able to access and recognize epitopes inaccessible to antibodies. The small binding molecules will be able to bind into active sites, grooves and other areas on an antigen. The coding template element is also smaller that an antibody which will increase the physical access of the template-binding molecule par. In addition, the diversity and complexity of the template-displaying molecule libraries will be much greater compare to peptide libraries. This will increase the possibility to find molecules that can coordinate to epitopes inaccessible to peptides due to inadequate chemistry. All together, the template-displaying molecule technology has the potential to identify novel antigens which is not possible to identify with antibodies or peptides. One of ordinary skill in the art will acknowledge that various types of cells can be used in the selection procedure. It will also be understood that the selection for new antigens can be performed using subtraction methods as described previously.
Another aspect of the present invention relates to methods to validate the identified target. The identified binding molecules can directly be used if they change the biological response of the target. This can be done either in vitro using any direct or cell-based assay or directly in vivo studying any phenotypic response. The strength of this approach is that the same molecules are used both for identification and validation of various targets. Most favourable, the binding molecules could also directly be used as therapeutic agents.
In another preferred embodiment, the template-displaying molecules are used to pull out the target molecules. This can for instance be achieved by selection against a cDNA library expressed on bacteriophage (libraries vs. libraries). By mixing a template-displaying molecule library with a cDNA library it will be possible to find binding pairs between the small molecules in the template-displaying molecule library and proteins from the cDNA library. One possibility is to mix a phage display library with a template display library and do a selection for either the phage or template library. The selected library is then plated to localized phage clones and the DNA coding for the phage and template displayed molecules can then be identified using PCR. Other types of libraries than cDNA could also be used such as nucleic acids, carbohydrates, synthetic polymer.
In another embodiment of the invention the template-displaying molecule technology can be used to account for in vivo and in vitro drug metabolism. That could include both phase I (activation) and phase II (detoxification) reac- tions. The major classes of reactions are oxidation, reduction, and hydrolysis. Other enzymes catalyze conjugations. These enzymes could be used as targets in a selection process to eliminate displayed molecule that are prone to coordinate to these enzymes. The templates corresponding to these displayed molecules could subsequently be used to compete or eliminate these molecules when making template-displaying molecule libraries. These obtained libraries will then be free of molecules that will have a tendency of binding to enzymes involved in phase l-ll and possible be faster eliminated. For instance, a selection on each separate enzyme or any combination of cytochrome P450 enzymes, flavin monooxygenase, monoamine oxidase, esterases, amidases, hydrolases, reductases, dehydrogenases, oxidases UDP-glucuronosyltransferases, glutathione S-transferases as well as other relevant enzymes could be performed to identify these binding molecules that are prone to coordinate to these metabolic enzymes. Inhibitors are easily selected for due to their binding affinity but substrates need at least micro molar affinity to be identified.
Another interesting embodiment of this invention is the possibility to directly select for molecules that passively or actively becomes transported across epithelial plasma membrane, or other membranes. One possible selection assay is to use CaCO-2 cells, a human colon epithelial cell line, which is general, accepted as a good model for the epithelial barrier in the gastroin- testinal guts. The CaCO-2 assay involves growing a human colon epithelial cell line on tissue culture well inserts, such that the resultant monolayer forms a biological barrier between apical and basolateral compartments. The template-displaying molecule libraries are placed either side of the cell monolayer and the molecules that can permeate the cell monolayer is col- lected and amplified. This process can be repeated until active molecules have been identified. Other cell line or setup of this assay is possible and is obvious for skill in the art.
A still further aspect of the present invention relates methods of selecting for stability of the selected molecules. This could be performed by subjecting an enriched pool of binding molecules to an environment that will possibly degrade or change the structure of the binding molecules. Various conditions could be certain proteases or a mixture of protease, cell extract, and various fluids from for example the gastrointestinal gut. Other conditions could be various salts or acid milieu or elevated temperature. Another possibility is to generate a library of known ligands and subject that library to stability tests and selection to identify stable molecules under certain conditions as describe above.
Therapeutic applications
The potential therapeutic applications of the invention are great. For example, the template-displaying molecule technology of the invention may be used for blocking or stimulating various targets. A therapeutically relevant target is a substance that is known or suspected to be involved in a regulating process that is malfunctioning and thus leads to a disease state. Examples of such processes are receptor-ligand interaction, transcription-DNA in- teraction, and cell-cell interaction involving adhesion molecules, cofactor- enzyme interaction, and protein-protein interaction in intracellular signalling. Target molecule means any compound of interest for which a molecule ligand is desired. Thus, target can, for example, include a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds, a biological macromolecule, such as DNA or mRNA, a bacteriophage peptide display library, a ribosome peptide display library, an extract made from biological materials such as bacteria, plants, fungi, or animal (e.g. mammalian) cells or tissue, protein, fusion protein, peptide, enzyme, receptor, receptor ligand, hormone, antigen, antibody, drug, dye, growth factor, lipid, substrate, toxin, virus, or the like etc., without limitation. Other examples of targets include, e.g. a whole cell, a whole tissue, a mixture of related or unrelated proteins, a mixture of viruses or bacterial strains or the like, etc., without limitation.
Therapeutic drug targets can be divided into different classes according to function; receptors, enzymes, hormones, transcription factors, ion channels, nuclear receptors, DNA, (Drews, J. (2000) Science 287:1960-1964). Among those, receptors, nuclear receptors, and metabolic enzymes constitute overwhelmingly the majority of known targets for existing drugs. Especially, G Protein-Coupled Receptors (GPCR) constitutes one of the most important classes of drug targets together with proteases for pharmacological intervention. Although the above examples are focused on the most relevant targets, it will be self-evident for a person skilled in the art that any other therapeutic target may be of interest.
The present invention employing the template-displaying molecule technology can be utilized to identify agonists or antagonists for all these classes of drug targets, dependent on the specific properties each target holds. Most of the targets are possible to obtain in a purified form for direct selection procedures. Other targets have to be used when they are in their native environments such as imbedded cell surface receptors. In those situations the selec- tion using the template-displaying molecule libraries can be performed using subtraction-selection described previously.
One specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as antagonists, where the molecules block the interaction between a receptor and one or more ligands. Another application includes cell targeting. For example, the generated molecules recognizing specific surface proteins or receptors will be able to bind to certain cell types. Such molecules may in addition carry another therapeutic agent to increase the potency and reduce the side- effects (for example cancer treatment). Applications involving antiviral agents are also included. For example, a generated molecule, which binds strongly to epitopes on the virus particle, may be useful as an antiviral agent. Another specific application of the template-displaying molecule technology of the invention is to generate molecules that can function as agonists, where the molecules stimulate or activate a receptor to initiate a cellular signalling pathway.
Brief description of the figures
Fig. 1 shows the general principle for one embodiment of the present inven- tion for the multi-step synthesis of templated molecules.
Fig. 2 shows the general structure of templates useful in the generation of a library.
Fig. 3 shows an example of design of templates fro the generation of a library. Fig. 4 shows examples of building blocks for use in the preparation of a library of templated molecules. Fig. 5 shows further examples of building blocks. Fig. 6 shows examples of the preparation of building blocks. Fig. 7 shows examples of the preparation of building blocks starting from a 5'-NH2 derivatized oligonucleotide.
Fig. 8 shows a general procedure of performing one embodiment for the for- mation of the templated molecule.
Fig. 8, example 1, shows an example of the embodiment shown in Fig. 8 involving light induced reaction between symmetrical building blocks. Fig. 9 shows a general procedure of performing one embodiment for the formation of the templated molecule. Fig. 10 shows a general procedure of performing one embodiment of the invention for the formation of a mixed polymer templated molecule. Fig. 10, example 1, shows examples of simultaneous reaction and cleavage of neighbouring of functional entities for the formation of (A) and alpha- peptide and (C) a polyamine.. Fig. 10, example 2, shows examples of simultaneous reaction and cleavage of neighbouring functional entities for the formation of (A) a peptoid, or an α- or β-peptide, and (B) a hydrazino peptide.
Fig. 11 depicts a templated synthesis of a polymer, using non-simultaneous reaction and cleavage. Fig. 12 depicts formation of a templated molecule due to activation of reactive groups and partly release of the templated molecule for the template by ring-opening.
Fig. 13 shows the connection of two functional entities by the fill-in of connecting moiety. Fig. 13, example 1 , discloses an exemplification of Fig. 13, in which an imine is formed by a fill-in reaction.
Fig. 13, example 2, shows an exemplification of Fig. 13, in which an amide is formed. Fig. 13, example 3, shows an exemplification of Fig. 13, in which an urea bonding is formed.
Fig. 13, example 3.1, shows an exemplification of Fig. 13 in which functional entities 13.3.1.A and 13.3.1. B are synthesised. Fig. 13, example 4, shows the formation of chiral and achiral templated molecules.
Fig. 13, example 5, shows the formation of a phosphodiester bond by symmetric fill-in. Fig. 13, example 6, shows the formation of a phosphodiester bond by a fill-in reaction, wherein the building block comprises a single reactive group. Fig. 13, example 7, shows a pericyclic fill-in reaction. Fig. 13, example 7.1 , shows an exemplification of Fig. 13 in which functional entities 13.7.1. A and 13.7.1.B are synthesised. Fig 14 shows a schematic representation of a fill-in reaction using asymmetric monomers.
Fig. 14, example 1, shows an asymmetric fill-in reaction using modified Staudinger ligation and ketone-hydrazide reaction.
Fig. 15 shows a schematic representation of a templated synthesis of a non- linear molecule.
Fig. 16 shows a representation of the templated synthesis of a non-linear molecule employing reactive groups of different classes and non- simultaneous reaction and cleavage.
Fig. 17 depicts a templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold. Fig. 18 shows examples of the templated synthesis of non-linear molecules. Fig. 19 shows a schematic representation of a templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient. Fig. 20 shows examples of various reactions types allowing simultaneous reaction and cleavage.
Fig. 21 shows examples of pairs of reactive groups (X) and (Y), and the resulting bond (XY).
Fig. 22 shows a schematic representation (panel A) of the zipper box principle and an example (panel B) of two building block. Fig. 23 shows a schematic representation of various methods for increasing the proximity of functional entities of different building blocks. Fig. 24 shows examples of the chemical constitution of a linker to be able to be cleaved.
Fig. 25 schematically shows the templated synthesis by generating a new reactive group.
Fig. 25, example 1 , shows a method in which reactive groups generated in a first round subsequently are reacted with introduced reactive groups. Fig. 26 shows examples of post-templating modifications of the templated molecule.
Detailed description of the invention
The following symbols are used in the figures to indicate general characteristics of the system: In figures 8; 10; 10, examples 1 and 2; 12; 12, examples 1; 13; 13, examples 1-7; 14; 14, example 1; 18; 20; 22; 23; 25; 25, example 1 , a long horizontal line symbolizes a template. Coding region 1 symbolizes sequences that anneal to type 1 building blocks. Building blocks are symbolized as shown in figures 4-7. X/Y, S/T and P/Q represent pairs of reactive groups (where the reactive groups of one pair (e.g. X and Y) are partly or fully orthogonal to the reactive groups of other pairs (e.g. S/T, P/Q)). R-i, R2, .., Rx symbolize functional groups. L and Li, L2, L3l... represent cleavable linkers, where linkers of one group (e.g., Li-linkers) are cleavable under conditions where linkers of other groups (L2, L3, ....) are not cleaved, or are cleaved less efficiently. The proximity effect that results from incorporating two building blocks on the same template, or alternatively, as a result of incorporating a building block on a template to which is attached a reactive group, may be enhanced by any of the methods described above or below that increases this effect. For example, in order to increase the efficiency and specificity of templated synthesis, the proximity effect may be increased by the introduction of zipper boxes in most of the general concepts described here.
In all the examples, the templated molecule may be coupled to the template through the non-covalent interaction of a monomer building block with the template, or alternatively, through covalent or non-covalent coupling to the template, and may be located at either of the ends of the template, or anywhere on the template. The coupling reaction to the template may be performed before, during or after the synthesis of the templated molecule. For clarity, in some of the figures only the reaction step, not the cleavage step, has been included.
The figures included have been drawn so as to highlight specific set-ups. Obviously, any combination of the methods may be employed, in order to make linear, as well as non-linear molecules, to use reactive groups that lead to simultaneous cleavage, as well as reactive groups that do not lead to simultaneous cleavage, to use cleavable and non-cleavable linkers etc.
The protocol for an embodiment of a multi-step templated synthesis is shown in Fig. 1 and involves a number of steps that each result in the addition of one or more molecular moieties to a growing molecule that eventually be- comes the templated molecule. Each of these steps can be divided into sub- steps. Initially, a number of templates (also called a library of templates) are provided. Each of the templates comprises a plurality of unique codons and a reactive group. Also, a plurality of different building blocks are provided, each of the building blocks comprises a functional entity separated from an anti- codon with a suitable linker. The anti-codon of a specific building block complements a unique codon of a template and is, therefore, capable under proper hybridisation conditions to anneal to the unique codon. The incorporation of building blocks is initiated by contacting the plurality of different templates with a subset of the entire amount of building blocks. The subset car- ries anti-codons which hybridise to unique codons of a distinct coding region. A connection between the reactive group of the template and the functional entity of the building blocks is obtained. In Fig. 1 the reactive group of the template is part of a building block (building block 1) and the said building block is hybridised to the template. In a preferred embodiment the building block 1 comprising the reactive group of the template and the second build- ing block are contacted with the template simultaneously to allow for an efficient connection between the functional entities. The line between FEi and FE2 symbolise a direct connection between the functional entities or an indirect connection via a bridging molecule entity. The molecule part formed by a connection of FEi to FE2 is a nascent templated molecule, which may be added further functional entities resulting in a growing nascent templated molecule.
The propagation part of the method starts with the incorporation of a further building block (building block 3). The incorporation involves the hybridisation of a subset of the building blocks to the plurality of templates bearing the nascent templated molecule. The subset of building blocks is selected to have anti-codons which complement unique codons of the templates, said unique codons being in the vicinity of, preferably neighbouring to, unique codons hybridised to the building block(s) bearing the templated molecule. The functional entity of the further building block is able to form a chemical connection to the nascent templated molecule through the reaction of a reactive group attached to the functional entity. The linkage between one or more of the functional entities and the corresponding anti-codons may be cleaved if desired and the incorporation of a new building block may be performed. In the example illustrated in Fig. 1 only three functional entities are connected in the templated molecule. However the propagation step may be conducted as many times as appropriate to obtain the desired templated compound.
As a terminal phase the linkers connecting functional entities/templated molecule and anti-codons may be cleaved. The complex comprising the templated molecules (specific compositions or sequences of molecular moieties, the identity of which is determined by the template) attached to the templates that templated their synthesis, can now be taken through a screening process. This process leads to an enrichment of templated molecules complexes with appropriate characteristics. The isolated complexes may now be enriched by amplification of the templates, and a new round of templated synthesis and screening can be performed. Eventually, the templated molecules may be identified by characterization of the corresponding templates.
The stages of the process involving incorporation of building blocks may be mediated by chemicals, or enzymes such as polymerase or ligase. For example, the anti-codon part of the building blocks may be nucleotide- derivatives that are incorporated by a polymerase. Incorporation may also be solely by hybridization of building blocks to the template. If the template is a DNA molecule, the template may comprise primer binding sites at one or both ends (allowing the amplification of the template by e.g. PCR). The remaining portion of the templates may be of random or partly random sequence.
The reaction stage of the method involves reactions between the incorporated building blocks, thereby forming chemical connections between the functional entities. The chemical connection can be a direct chemical bond or the connection can be established through a suitable bridging molecule.
The optional cleavage step involves cleaving some, all but one, or all of the linkers that connect the functional entities and anti-codons. In Fig. 1 the templated molecule is displayed by cleaving the linkers of the second and third functional entities, while maintaining the linker from the first building block.
Subsequent to the production of library according to the invention a selection is performed. The selection or screening involves enriching the population of template-templated molecule pairs for a desired property. For example, passing a library of templated molecule-template complexes over a solid phase to which a protein target has been immobilized, and washing unbound complexes off, will enrich for complexes that are able to bind to the protein. The selection may be performed more than once, for example with increasing stringency. Between each selection it is in general preferable to perform an amplification. The amplification involves producing more of the template- templated molecule complexes, by amplification of the template or complementing template, and producing more of the template-templated molecule pairs, for further rounds of selection/screening, or for sequencing or other characterization. For example, if the template is a DNA strand, the template may be amplified by PCR, where after the templated synthesis can be performed using the amplified DNA, as described above.
Cloning and sequencing may also be useful techniques and involve the cloning of the isolated templates or complementing templates, followed by characterization. In some cases, it may be desirable to sequence the population of isolated templates or complementing templates, wherefore cloning of individual sequences is not required.
In Fig. 2, in the upper part of the figure, the general structure of a template is shown. The templates comprise x coding regions. Each coding region has a unique sub-structure which differentiates it from some or all of the other coding regions. Shown below the general structure of a template are specific templates. A given specific template carries a specific set of x unique codons. A unique codon specifies (by way of interaction with a specific anticodon of a building block) a specific functional entity. The unique codons 1.1,
1.2, 1.3, , 1.m are all examples of coding region 1 sequences. The general design of the templates therefore enables the templated incorporation of building blocks, in the sense that a sub-set of building blocks can be added that will only be incorporated at the same position on the template (i.e., coding region 1 if the building blocks have anti-codons that are complementary to the unique codons of codon region 1).
Fig. 3 Shows an example of a design of templates and anti-codons for oligonucleotide-based building blocks. Section A discloses the general structure of a set of templates carrying 6 coding regions, each containing a partly random sequence (X specifies either C or G), and a constant sequence that is identical for all sequences in the group (e.g., all coding region 1 sequences carries a central ATATTT sequence). By using C and G only (or, alternatively, A and T only), the building blocks that are complementary to coding regions 1 have very similar annealing temperatures wherefore mis- annealing is insignificant. The attachment point of the linker that connects the anti-codon and the functional entity is not specified in the figure. Ideally, the linker is attached to the constant region of the anti-codon, in order to avoid bias in the annealing process.
Section B of Fig. 3 shows examples of codon and anti-codon sequences. Example codon 1 and codon 6 sequences are shown. The example codon 1 sequence represents one specific sequence out of 1024 different sequences that anneal specifically to the complementary anti-codon 1 sequences; the example codon 6 sequence represents one specific sequence out of 128 different sequences that anneal to the complementary anti-codon 6 sequences.
Fig. 4 illustrates different general designs of building blocks. A building block comprises or essentially consists of a functional entity, connected through a (cleavable) linker to an anti-codon. Panel A shows a building block with one reactive group (X), connecting the functional group (Rx) with the anti-codon. This type of building block may be used for the simultaneous reaction and cleavage protocol (e.g. figures 9 and 15). The functional entity in this example comprises one reactive group, and a functional group Rx, also called a functionality. The reactive groups typically become part of the templated molecule. Panel B shows a building block with two reactive groups (X and Y), connecting the anti-codon and the functional group (Rx). The functional entity in this example comprises two reactive groups that are both part of the moiety that links the anti-codon and functional group, Rx. Panel C shows a building block with a reactive group (X) connecting Rx and the anti-codon, and a reactive group (Y) attached to the Rx group. This type of building block may be used in the simultaneous reaction and cleavage protocol (e.g., Fig. 9 and 10). The functional entity comprises two reactive groups X and Y, where X is part of the linker, and Y is attached to the functional group Rx. Panel D shows a building block with one reactive group (X). The reactive group (X) does not link the functional group (Rx) and the complementing element. A cleavable linker (L) is provided in order to release the functional entity from the anti-codon. This type of building block may be used in protocols that require cleavage of the linker after the reactive groups of the functional entities have reacted (e.g., Fig. 12). Panel E disclose a building block with four reactive groups and a functional group Rx. The four reactive groups and the functional group Rx may serve as a scaffold, onto which substituents (encoded by building blocks bound to codons on the same template) are coupled through reaction of reactive groups (X) of other building blocks with the reactive groups (Y) (e.g., figure 15). In this example, no cleavable linker is indicated. Therefore, after the templating reactions the templated molecule is attached to the template through the linker of this building block.
In Fig. 5 three different building blocks are depicted. Building block A comprises an anti-codon (horizontal line), which may be an oligonucleotide, to which a linker carrying the functional entity is attached to the central part. The portion of the linker marked "a" may represent a oligonucleotide sequence to which a single stranded nucleotide may be annealed in order to make the linker more rigid, or alternatively, "a" may represent a zipper box sequence of nucleotides or other type of zipper box moiety. The vertical line may represent a PEG (polyethylene glycol) linker, oligonucleotide linker, or any other linker that provides the functional entity with the appropriate freedom interact productively with a functional entity of a building block annealed to the same template during the templating process. In building block, the linker is attached to the terminus of the anti-codon. The anti-codon and the linker may be one continuous strand of an oligonucleotide. The horizontal part here represents the anti-codon, and the vertical part represents the linker. The linker may contain a moiety "a" that functions as a zipper box (see Fig. 22), a rigid linker, or an annealing site for another entity that rigidities the linker upon annealing. In building block C of Fig . 5 the linker and anti-codon may be a continuous strand of an oligonucleotide. Attached to the linker is a nucleophile "Nu" which may react with a functional entity. This may be used as an anchorage point for the templated molecule. Building block C may preferably be used as the starting or the terminal building block. When used in the initial stage of the production of the complex comprising the templated molecule, building block C may provide the template with a reactive group to which the functional entities may be attached in the growing templated molecule. In a further embodiment of the invention "Nu" of building block C represents any reactive group able to participate in a reaction resulting in the formation of a connection to a functional entity of a building block.
Fig. 6 shows five different general methods for the preparation of building blocks. The general methods involves the coupling of the functional entities to oligonucleotide-based building blocks. Reactions and reagents are shown that may be used for the coupling of functional entities to modified oligonucleotides (modified with thiol, carboxylic acid, halide, or amine), without significant reaction with the unmodified part of the oligonucleotide. As an alternative approach, the functional entity may be synthesized as phosphoramidite precursor, which can then be used for oligonucleotide synthesis by standard methods, resulting in an oligonucleotide-derivative carrying a functional entity.
Fig. 7 shows the design and synthesis of exemplary building blocks. Panel A shows a general synthesis scheme for building blocks using DNA oligonucleotide as codon, and coupling amines and carboxylic esters. The oligonucleotide is purchased with an amine coupled to e.g. the base at a terminal position of the oligo. By addition of EDC (1-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and NHS (N- hydroxysuccinimide), the oligonucleotide is coupled to the building block through an amide bond. Panel B shows specific synthesis schemes for the generation of specific classes of building blocks.
Fig. 8 illustrates an embodiment for the templated synthesis of a polymer. X and Y are reactive groups of the functional entity. X and Y may be different kinds of reactive groups (e.g., amine and carboxylic acid), of the same kind but different (e.g., different primary amines or a primary amine and a secondary amine), or identical. Reaction of X with Y to form XY either happens spontaneously when the building block has been incorporated, or is induced by a change of conditions (e.g. pH), or by the addition of an inducing factor (chemical or UV exposure, for example)
Fig. 8, ex.1. shows light-induced reaction between symmetric coumarin- derivatives. Light-induced reaction of the coumarin units, followed by cleavage of the linker, result in a ring structure. Examples of functional groups (phosphate and carboxylic acid) are shown. The building blocks are said to be symmetric because the two reactive groups, two coumarin units, are of the same reactivity (in fact, in this example are identical).
Fig. 9 shows an embodiment for templated synthesis of a polymer. A population of templates, each carrying four codons are incubated with two sets of building blocks (carrying anti-codons 1 and 2, respectively), at a temperature that ensures efficient and specific annealing of anti-codons type
1 to coding regions 1 , and efficient and specific annealing of anti-codons type
2 to coding regions 2. After annealing, the excess building blocks may optionally be removed. If desired, reactive groups may be deprotected (and thus activated for reaction) at this step. Then building block-template complexes are incubated under conditions that allow the reactive groups of the building blocks (i.e., reactive groups X and Y) to react. This leads to a transfer of the functional group R1 from building block 1 to building block 2, and thus results in the formation of a dimeric polymer carrying two functional groups, R1 and R2. The process is then repeated, i.e. a third monomer (with anti-codon type 3) is added, and after annealing to coding region 3, excess building block is removed, and the reaction between X and Y now leads to the formation of a trimeric polymer, coupled to the building block annealed to coding region 3. Once more, the process is repeated with building blocks of type 4, resulting in the formation of a tetrameric polymer.
The reactive groups X and Y used in this scheme thus have two functions: i) reaction between X and Y leads to coupling of the corresponding functionalities (e.g., R1 and R2), and simultaneously, ii) the linker between R1 and the anti-codon is cleaved. Examples of reactive groups X and Y with such characteristics (i.e., the ability to simultaneously react and cleave) are shown in Fig. 20. By appropriate choice of X and Y, the nascent polymer is migrated down the template, from building block to building block, as it is being synthesized. For example, by choosing X = ester (COOR), and Y = amine (NH2), the nucleophilic attack of the amine on the ester leads to transfer of the upstream functionality (e.g., R to the downstream building block (e.g., carrying anti-codon type 2). This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).
If desired, the templated polymer may be coupled to the template through the non-covalent interaction of a building block with the template (in the example given, through the interaction of building block 4 with the template), or alternatively, through covalent coupling to a reactive group on the template, located at either of the ends of the template, or anywhere on the template sequence. In the latter case, the coupling reaction to the template may be performed before, during or after the synthesis of the polymer.
Fig. 10 shows the templated synthesis of a mixed polymer. The most noticeable difference, when compared to the embodiment shown in Fig. 9 is that the reactive groups on the individual building blocks are different. The pairs of reactive groups (X/Y, S/T, and P/Q) are chosen so that the reaction of X and Y, S and T, P and Q, respectively, results in transfer of a functional group from one building block to another (i.e., the reaction both mediates the coupling of the two functional groups and the cleavage of the linker that initially connects one of the functional groups to the anti-codon). Example pairs of reactive groups that mediate this simultaneous reaction and cleavage are shown in Fig. 20.
Fig. 10, example 1 shows two methods of obtaining different classes of compounds using simultaneous reaction and cleavage. In panel A, the formation of an alpha-peptide is disclosed and in panel C the synthesis of a polyamine is shown.
In panel A, two building blocks are incorporated by hybridization to the template. One of the building blocks is an oligonucleotide to which has been appended a thioester. The other building block is an oligonucleotide to which has been appended an amino acid thioester. The amine of the latter building block attacks the carbonyl of the other building block. This results in formation of an amide bond, which extends the peptide one unit. When the next amino acid thioester building block is incorporated, this may attack the thioester carbonyl, resulting in cleavage of the dipeptide from the anti-codon, to form a tripeptide. This process is repeated until the desired peptide has been generated. Importantly, as the reaction in each step is between the incoming subunit-precursor and the subunit of the nascent polymer that is closest to the linker that connects it to the anti-codon, the geometry of the nucleophilic attack remains unchanged. The reactivity of the amine with the ester may be tuned in several ways. Parameters that will affect the reactivity include: (i) pH and temperature, (ii) nature of ester (thio-, phospho-, or hydroxy-ester); (iii) the nature of the substituent on the sulfur (see panel B below). The general scheme presented here can be applied to most nucleophilic reactions, including formation of various types of peptides, amides, and amide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted α-, β-, γ-, and Ω-peptides, polyesters, polycarbonate, polycarbarmate, polyurea), using similar functional entities.
Panel B shows four different thioesters with different substituents on the sulphur and therefore different reactivity towards nucleophiles.
Panel C relates to the formation of a polyamine. Using the same principle as in (A), a polyamine is formed.
Fig. 10, example 2 shows simultaneous reaction and cleavage for two reactions. In reaction A a peptoid or an α- or β-peptide is formed, and in reaction B a hydrazino peptide is formed.
In reaction A, two building blocks are initially incorporated, one of which carries both a nucleophile (an amino group) and an electrophile (e.g. an ester); the other building block only carries an electrophile (e.g. a thioester). As a result, the nucleophilic amine will attack the electrophile of the building block attached to the same template. As a result, a dimeric structure is formed, linked to building block that initially carried the amine. Upon sequential addition of building blocks, the linear structure grows, and eventually the desired templated molecule (a peptoid or an α- or β-peptide) has been formed.
The reaction B follows the same line as in A, except that hydrazine-peptide precursor building blocks are used, leading to the formation of hydrazino peptides.
Fig. 11 shows a general reaction scheme for templated synthesis of a polymer, using non-simultaneous reaction and cleavage. In this scheme, the reaction of the reactive groups (e.g., X and Y) does not in itself lead to cleavage, wherefore the functional entity is coupled to the anti-codon via a cleavable linker. Therefore, each addition of a subunit to the growing polymer involves two steps. First, the reactive groups X and Y react to form a bond XY. Then, in a separate step, a cleavable linker L is cleaved, which releases one of the functional entities from the anti-codon. By alternating between two types of cleavable linkers (cleavable under different conditions) one may achieve migration of the nascent polymer down the template, like described in fig. 9 and 10. This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers). In the example, some or all of the reactive pairs may be of the same kind (e.g., X/Y = S/T = P/Q).
Example reactions that do not mediate simultaneous reaction and cleavage are shown in fig. 21. Any combination of cleavable and non-cleavable linkers may be used, dependent on the nature of the reactive groups in the functional entities (e.g., dependent on whether the reaction involves a release from the anti-codon).
Fig. 12 relates to activation of reactive groups and release from anti-codon by ring-opening.
Reaction of the initiator with X in the ring structure opens the ring, resulting in activation of Y. Y can now react with X in a neighboring functional entity. As a result of ring-opening, the functional entities are released from the anti- codons.lf the zipper-box principle is applied to this set-up (where each additional building block added reacts with the nascent templated molecule attached to the initiator), the initiator linker must carry half of the zipper (e.g., the "sense strand"), and all the building blocks must carry the other half of the zipper-box (the "anti-sense strand").
Fig. 12, example 1. Ring-opening of N-thiocarboxyanhydrides, to form β- peptides. After incorporation of two building blocks, where one of the building blocks carry an initiator reactive group (or incorporation of one building block next to a covalently attached initiator molecule), the initiator is activated, for example by deprotection or by an increase in pH. The primary amine then attacks the carbonyl of the N-thiocarboxyanhydride (NTA) unit. As a result, CSO is released, and a primary amine is generated. When the next building block is incorporated, this amine will react with the NTA, and eventually when all the building blocks have been incorporated and the NTA units have reacted, a β- peptide will have formed. Finally, the linkers that connect the β-peptide to the anti-codons are cleaved, resulting in a β-peptide attached to its template through one linker.
A number of changes to this set-up can be envisaged. For example, instead of thiocarboxyanhydrides, one might use carboboxyanhydrides. The initiator might be protected with a base- or photolabile group. If a base-labile protection group is chosen, the stability of the carboxyanhydride must be considered. At higher pH it may be advantageous to use carboxyanhydrides rather than thiocarboxyanhydrides. Other types of peptides and peptide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted α-, β-, γ-, and Ω-peptides, polyesters, polycarbonate, polycarbarmate, polyurea) can be made, using a similar scheme. For example, α-peptides can be made by polymerization of 5-membered carboxyanhydride rings.
Fig. 13 shows the principle of symmetric fill-in (symmetric XX building blocks). The fill-in reaction occurs between the reactive groups ("X" in the figure) and bridging molecules "Y-Y" in figure).
For clarity, only the reaction (not the cleavage) is shown in the figure. X represents the reactive groups of the functional entity. In this case the two reactive groups are of the same kind. (Y-Y) is added to the mixture before, during or after incorporation of the building blocks.
Fig. 13, ex.1 shows imine formation by fill-in reaction. Dialdehyde is added in excess to incorporated diamines. As a result, an imine is formed. In the example, the templated molecule carries the following functional groups: cyclopentadienyl and hydroxyl.
Fig. 13, example 2 shows an example of amide formation using symmetric fill-in. After incorporation of two building blocks each carrying a di-amine, non-incorporated building blocks may be removed. Then EDC (1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide), and dicarboxylic acid is added in excess to the primary amines of the building blocks. Alternatively, a di-(N-hydroxy- succinimide ester) may be added in excess. At a pH of 7-10, this will lead to the formation of two amide bonds linking the functional entities. After reaction, excess reagents may be removed by dialysis, precipitation of the building blocks and template, gel filtration or by other means that separate the reagents from the building blocks. When the process of incorporation- and-reaction has been repeated a number of times, and the desired molecule lias been templated, the linkers (L) may be cleaved, and, if functional groups have been masked by protection groups (PG), these functional groups can be deprotected to expose the functional groups. Appropriate protecting groups would be for example Boc-, Fmoc, benzyloxycarbonyl (Z, cbz), trifluoracetyl, phthaloyl, or other amino protecting groups described e.g. in (T. W. Green and Peter G. M. Wuts (1991), Protective Groups in Organic Synthesis).
An alternative route to amide-bonded functional entities would be to incorporate building blocks carrying di-carboxylic acids, and then add diamines, NHS and EDC. Alternatively, the building blocks could carry N- hydroxy-succinimidyl (NHS) esters, which would react with the added amines without the need to add EDC and NHS.
Fig. 13, example 3 shows an example of urea-bond formation.
The functional entities of the incorporated building blocks react with phosgen or a phosgen-equivalent such as CDI to form a polyurea. Formaldehyde may also be used. The linkers are cleaved and the protected hydroxyl is deprotected. Appropriate leaving groups (Lv) are chloride, imidazole, nitrotriazole, or other good leaving groups.
Fig.13, example 4 shows the formation of chiral and achiral templated molecules. In this example, the functional group Rx is used as a cleavable linker, that generates the desired functional group upon activation. In both reaction A and reaction B, a urea-bond is formed.
In reaction A, the functional group is attached to the backbone via a chiral carbon. The hydrogen on this carbon is drawn to emphasize this. Before bond formation, there is free rotation about the bond connecting the chiral carbon and the functional group. When the reactive groups (the amines) react with the phosgen equivalent (e.g., a carbonyldiimidazole) to form the templated molecule, the building blocks may be inserted in either of two orientations (as indicated by the position of the hydrogen, left or right). As a result, each encoded residue of the templated molecule will have two possible chiral forms. If the templated molecule was e.g. a pentameric polyurea (formed from five functional entities), this molecule would have 25 = 32 stereoisomers. In certain cases it may be advantageous to incorporate such additional structural diversity in the library (for example when a low building block diversity is employed). In other cases such additional diversity is not desirable, as the screening efficiency may become compromised, or it may become too difficult to determine the identity of a templated molecule that has been isolated in a screening process.
In reaction B, the chiral carbon of reaction A has been replaced by a nitrogen. As a result, the resulting templated molecule is achiral, i.e. the template encodes one specific structure.
Fig.13, example 5 shows the formation of a phosphodiester bond by the principle of symmetric fill-in. The incorporated building blocks react with the activated fill-in molecule to form a phosphodiester bond. Then the linkers are cleaved, releasing the templated molecule from its template. An example of an appropriate leaving group (Lv) is imidazole.
Fig. 13, example 6 shows phosphodiester formation with one reactive group in each building block.
Upon addition of a dihydroxylated compound such as 1 ,3-dihydroxypyridine, a phosphodiester bond is formed. Finally, the functional group Rx is liberated from the anti-codon by cleavage of the protection groups/cleavable linker that connected it to the anti-codon.
Fig.13, example 7 shows the an example of a pericyclic fill-in reaction. First, two building blocks are incorporated. Then 1 ,4-benzoquinone is added in excess, resulting in the formation of a polycyclic compound. A third building block is added, reacted with the 1 ,4-benzoquinone, and this process is repeated a number of times until the desired templated molecule has been generated. Finally, all but one of the linkers that connect the templated molecule to the anti-codon, are cleaved.
Fig. 14 relates to asymmetric fill-in using XS building blocks. A fill-in reaction between reactive groups (X and S) and bridging molecules (T-Y) is shown. For clarity, only the reaction (not linker cleavage) is shown. X and S represent the reactive groups of the functional entity. In this case the two reactive groups are not of the same kind. (T-Y) is added to the mixture before, during or after incorporation of the building blocks. Likewise, significant reaction between X and Y, and between S and T may take place during or after incorporation of the building blocks.
Fig. 14, example 1 shows an example of asymmetric fill-in by modified Staudinger ligation and ketone-hydrazide reaction. The reactive groups X and S of the building blocks are azide and hydrazide. The added molecule that fills the gaps between the building blocks carry a ketone and a phosphine moiety. The reactions between a ketone and a hydrazide, and between an azide and a phosphine, are very chemoselective. Therefore, most functional groups Rx can be employed without the need for protection during the reactions. Examples for the molecular moieties R, R1 , X and Y may be found in (Mahal et al. (1997), Science 276, pp. 1125-1128; Saxon et al. (2000), Organic Letters 2, pp. 2141-2143).
Fig. 15 shows a general reaction scheme for templated synthesis of a nonlinear molecule. A template carrying four codons is mixed with two building blocks. The functional entity of one building block comprises a reactive group X and a functional group R-i. The other building block comprises three reactive groups Y and a functional group R2. The building block bound to codon 2 is here called the scaffold, as the functional groups are transferred to this building block during the templating process.
After incubation at a temperature that ensures efficient and specific annealing of the two building blocks to their respective codon, and optionally, excess building block has been removed, X is brought to react with one of the reactive groups Y, for example by changing the conditions, by deprotecting X or Y, or by simply exploiting the pronounced proximity of X and Y groups when the building blocks are bound to the template.
In this scheme, X and Y have been chosen so as to allow simultaneous reaction and cleavage. Thus, as a result of the reaction between X and Y, the substituent group (functional group) Ri is transferred to the scaffold. Example reactive groups X and Y that mediate simultaneous reaction and cleavage are given in figure 20. Any pair of reactive groups X and Y that mediates simultaneous reaction and cleavage can be used in this scheme, i.e., different X/Y pairs may be used at each substituent position.
Annealing and reacting of two more building blocks lead to the formation of a scaffolded molecule carrying three substituents (R-i, R3 and R ). The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached.
Figure 16 shows templated synthesis of a non-linear molecule, employing reactive groups of different kinds, and non-simultaneous reaction and cleavage. The reactive groups X, S, P and Y, T, Q may be of different kinds, and the bonds formed (XY, ST, and PQ) therefore may be of different kinds.
After reaction and then cleavage of the linker L (that attaches the functional entity of the first building block to the anti-codon), the substituent (functional group) R1 is transferred to the second building block (the scaffold). Thus, relative to the synthesis scheme of figure 15, here an additional step of linker cleavage is required. After repeating the processes of annealing, reacting and cleavage a number of times, a scaffolded molecule has been formed carrying encoded substituents. The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached. The position of the substituents are determined by the identity of the reactive groups Y, T and Q of the scaffold, and therefore indirectly determined by the identity of the codon to which the scaffold building block anneals. Therefore, in this set-up, the identity and position of the substituents, as well as the identity of the scaffold, is determined by the sequence of the template. The reactive pairs may also be of the same kind (e.g., X Y = S/T = P/Q).
Fig. 17 discloses the principle of templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a "migrating" scaffold. In this set-up, the templated molecule migrates down the template as it is being synthesized. This is made possible by the use two different linkers Lx and Ly, cleavable under different conditions. As a result, a high proximity is maintained throughout the templating process, as the building blocks that react in each reaction step are bound to adjacent coding regions on the template. Fig. 18 shows the templated synthesis of various non-linear molecules.
(A) Three building blocks are added and reacted one at a time. Each building block comprises an activated ester (reactive group, (X)) where the ester moiety carries a functional group Rx. Upon reaction between the esters and the amines on the scaffold (scaffold is covalently attached to the template), amide bonds are formed, and the Rx groups are now coupled to the scaffold via amide bonds. This is thus an example of simultaneous reaction (amide formation) and cleavage (release of the Rx moiety from the anti-codon), see e.g. fϊg.15.
(B) Analogously to (A), three amines react with three esters to form three amide bonds, thereby coupling the functional groups Rx to the scaffold moiety. However, as opposed to (A), the scaffold is here encoded by the template, and therefore the scaffold is here part of the functional entity of a building block.
(C) Three building blocks are used. The nucleophilic amine (covalently attached to the template) attacks the ester carbonyl of the building block bound to coding region 3; the amine of the third monomer attacks the thioester of the next incorporated building block, and after incorporation of the third building block, the Homer-Wittig Emmans reagent of the building block reacts with the aldehyde of the third monomer under alkaline conditions. This forms the templated molecule. The double bond may be post-templating modified by hydrogenation to form a saturated bond, or alternatively, submitted to a Michael addition.
(D) The thiol of the scaffold reacts with the pyridine-disulfide of the incorporated building block. The amine of the scaffold reacts with the ester of the second incorporated building block. The double nitrile- activated alpha-position is acylated by the thioester of the next building block in the presence of base. Finally, the aryliodide undergoes Suzuki coupling with the arylboronate of monomer 4 to yield the biaryl moiety.
(E) The incorporated building block acylates one of the primary amines. The aryliodide undergoes a Suzuki coupling by reaction with the next building block, and the benzylic amine is acylated by last incorporated building block.
(F) Acylation of the hydrazine followed by cyclization leads to formation of a hydroxypyrazole. After incorporation of the second building block, the arylbromide undergoes Suzuki coupling with the aryl boronate. Finally, the aldehyde reacts with the Homer-Wittig- Emmons reagent of the building block that is next incorporated, to yield an alpha, beta-unsatu rated amide, which may be further modified or functionalized by either reduction with H2/Pd-C or Michael addition with nucleophiles. Alternatively, a fourth building block might be used to template the coupling of a nucleophilic substituent at the double bond position.
Fig. 19 shows a general procedure of templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.
It may be desirable to perform the reaction step (or one of the other steps) under conditions where annealing of building blocks is in-efficient. To solve this potential problem, one may covalently link the incorporated building blocks, either chemically or by using a ligase (when the anti-codon comprises an oligonucleotide) or a polymerase (when the anti-codon is e.g. a nucleotide). In this set-up, the template is designed to fold back on itself. In step 1, the two incorporated building blocks are incorporated and may be ligated together, and be linked to the template, during or after their incorporation. If desired, the conditions may now be changed to increase the efficiency of the reaction step that follows. Then, in step 2, the reactive groups X and Y are brought to react. Because the building blocks are covalently attached to each other (and to the template), the reaction can be performed under conditions where annealing of the building blocks to the template is inefficient. Reaction conditions that may not be compatible with efficient annealing and double helix structure include organic solvents, low salt and high temperature, all of which may be used with the set-up described in this figure.
After step 2 (reaction), the conditions are changed again, in order to allow efficient incorporation and covalent linkage of the next building block (step 3). This cycling between conditions that allow incorporation and ligation, and that allow reaction, is continued until the desired number of building blocks have been incorporated and reacted. Finally, some of the linkers are cleaved to give the templated molecule. As described above, the covalent coupling of the building blocks to each other allows the reaction between their reactive groups to be performed under more diverse conditions than would otherwise be possible. In addition, covalent coupling between building blocks makes it possible to use anti-codons comprising shorter recognition sequences. When the anti-codon comprises an oligonucleotide, it is generally preffered to use an oligonucleotide of at least fifteen nucleotides during incorporation, in order to obtain high efficiency of incorporation. However, if a ligase or chemical is used to covalently couple the building blocks, a shorter oligonucleotide (4-8 nucleotides) may be used. This will bring the reactive groups X and Y into closer proximity, and increase the local concentration of rective groups dramatically: If the distance between the reactive groups is decreased from 16 nucleotides to 4 nucleotides, this will increase the local concentration 43 = 64. Everything else being equal, this will increase the rate of the reaction by 64-fold. In order to change between conditions that allow incorporation and covalent coupling between building blocks, and conditions that allow the reaction to occur efficiently, the templates may be attached to a solid phase material (e.g., streptavidin beads if the templates are biotinylated), or the templates (with the building blocks associated to them) may be precipitated and resuspended in appropriate buffer during the steps of incorporation and reaction.
Fig. 20 shows various reaction types allowing simultaneous reaction and activation. Different classes of reactions are shown which mediate translocation of a functional group from one monomer building block to another, or to an anchorage point. The reactions have been grouped into three different classes: Nucleophilic substitutions, addition-elimination reactions, and transition metal catalyzed reactions These reactions are compatible with simultaneous reaction and activation.
(A) Reaction of nucleophiles with carbonyls. As a result of the nucleophilic substitution, the functional group R is translocated to the monomer building block initially carrying the nucleophile.
(B) Nucleophilic attack by the amine on the thioester leads to formation of an amide bond, in effect translocating the functional group R of the thioester to the other monomer building block.
(C) Reaction between hydrazine and β-ketoester leads to formation of pyrazolone, in effect translocating the R and R' functional groups to the other monomer building block.
(D) Reaction of hydroxylamine with β-ketoester leads to formation of the isoxazolone, thereby translocating the R and R' groups to the other monomer building block.
(E) Reaction of thiourea with β-ketoester leads to formation of the pyrimidine, thereby translocating the R and R' groups to the other monomer building block. (F) Reaction of urea with malonate leads to formation of pyrimidine, thereby translocating the R group to the other monomer building block.
(G) Depending on whether Z = O or Z = NH, a Heck reaction followed by a nucleophilic substitution leads to formation of coumarin or quinolinon, thereby translocating the R and R' groups to the other monomer building block.
(H) Reaction of hydrazine and phthalimides leads to formation of phthalhydrazide, thereby translocating the R and R' groups to the other monomer building block. (I) Reaction of amino acid esters leads to formation of diketopiperazine, thereby translocating the R group to the other monomer building block. (J) Reaction of urea with α-substituted esters leads to formation of hydantoin, and translocation of the R and R' groups to the other monomer building block. (K) Alkylation may be achieved by reaction of various nucleophiles with sulfonates. This translocates the functional groups R and R' to the other monomer building block. (L) Reaction of a di-activated alkene containing an electron withdrawing and a leaving group, whereby the alkene is translocated to the nucleophile. (M) Reaction of disulfide with mercaptane leads to formation of a disulfide, thereby translocating the R' group to the other monomer building block. (N) Reaction of amino acid esters and amino ketones leads to formation of benzodiazepinone, thereby translocating the R group to the other monomer building block. (O) Reaction of phosphonates with aldehydes or ketones leads to formation of substituted alkenes, thereby translocating the R" group to the other monomer building block. (P) Reaction of boronates with aryls or heteroaryls results in transfer of an aryl group to the other monomer building block (to form a biaryl). (Q) Reaction of arylsulfonates with boronates leads to transfer of the aryl group. (R) Reaction of boronates with vinyls (br alkynes) results in transfer of an aryl group to the other monomer building block to form a vinylarene
(or alkynylarene). (S) Reaction between aliphatic boronates and arylhalides, whereby the alkyl group is translocated to yield an alkylarene. (T) Transition metal catalysed alpha-alkylation through reaction between an enolether and an aryihallide, thereby translocating the aliphatic part. (U) Condensations between e.g. enamines or enolethers with aldehydes leading to formation of alpha-hydroxy carbonyls or alpha, beta- unsaturated carbonyls. The reaction translocates the nucleophilic part. (V) Alkylation of alkylhalides by e.g. enamines or enolethers. The reaction translocates the nucleophilic part. (W) [2+4] cycloadditions, translocating the diene-part. (X) [2+4] cycloadditions, translocating the ene-part. (Y) [3+2] cycloadditions between azides and alkenes, leading to triazoles by translocation of the ene-part. (Z) [3+2] cycloadditions between nitriloxides and alkenes, leading to isoxazoles by translocation of the ene-part.
Fig. 21 shows pairs of reactive groups (X) and (Y), and the resulting bond
(XY).
A collection of reactive groups that may be used for templated synthesis as described herein are shown, along with the bonds formed upon their reaction.
After reaction, cleavage may be required (e.g., see fig. 8).
Fig. 22 shows a method of increasing the proximity effect of the template: The Zipper-box. Panel A discloses linkers carrying oligonucleotide zipper boxes (a) and (b) that are complementary. By operating at a temperature that allows transient interaction of (a) and (b), the reactive groups X and Y are brought into close proximity during multiple annealing and strand-melting events, which has the effect of keeping X and Y in close proximity in a larger fraction of the time than otherwise achievable. Alternatively, one may cycle the temperature between a low temperature (where the zipper boxes pairwise interact stably), and a higher temperature (where the zipper boxes are apart, but where the anti-codon remains stably attached to the codon of the template). By cycling between the high and low temperature several times, a given reactive group X is exposed to several reactive groups Y, and eventually will react to form an XY bond. As a final alternative, the temperature may be kept appropriately low that the two strands of the zipper-box (a and b) are stably associated. Independent on which of these protocols is followed, the building blocks must be added to the reaction mix at an appropriately high temperature where the interaction between the codon and anti-codon is specific. Once the building blocks have been specifically associated with the template, the temperature can be lowered, and the alternative protocols described above followed, in order to achieve a high reaction efficiency.
When the anti-codon is an oligonucleotide (e.g., DNA, RNA) or oligonucleotide analog (e.g., PNA, LNA), it may be practical to use a continuous nucleotide strand, comprising both the anti-codon, linker and zipper-box (see (B) below).
Panel B shows sequences of two DNA oligo-based building blocks. The anticodon ("annealing region"), linker and zipper-box are indicated. Thus, in this example, one linear DNA molecule constitutes the anti-codon, the linker that connects the functional entity and the anti-codon, and the zipper-box. The reactive groups X (a carboxylic acid) and Z (an amine) are coupled to the 3'- end of DNA oligo 1 and the 5'-end of DNA oligo 2, respectively. A template sequence to which oligo 1 and oligo 2 would anneal might contain the follow- ing sequence: 5'-CCGATGCAATCCAGAGGTCG- GCTGGATGCTCGACAGGTC.
Fig. 23 shows three methods of how the proximity effect can be increased: (A) Helix stacking, (B) Ligation and (C) Rigid linkers.
(A) Helix stacking. Two building blocks with oligonucleotide-based anti- codons anneal to their respective codons (in the figure, the left building block is a "scaffold" that carries four reactive groups, and the right building block carries a functional entity with e.g. one reactive group, i.e., the latter building block may carry the substituent that will become attached to the scaffold. Double helices tend to stack, especially if the sequence of the opposing ends of the helices has been designed so as to optimize this interaction (for example by the presence of the sequence GGG at the ends of the duplex structures). This stacking tendency will bring the two building blocks into closer proximity, in turn increasing reaction efficiency between the functional entities. If the "substituent-building blocks" have anti-codons with lower melting temperatures than that of the "scaffold-building block", the substituent building block may be removed after its reaction with the scaffold building block, before the next building block is incorporated. In this way, the template region between two reacting building blocks may be kept single stranded, allowing this region to loop out and let the two duplex structures stack during the reaction between the two building blocks.
(B) Ligation of building blocks. The anti-codons of two building blocks may be chemically or enzymatically ligated together. Coupling of two anti-codons will increase the annealing efficiency. Therefore, smaller anti-codons can be used if ligated together with the previously incorporated building block. As an example, first add a building block (or just an 20-nucleotide DNA oligo) with a melting temperature of e.g. 60 °C. Then add another building block (e.g., with a 8-nucleotide DNA anti-codon) with a low melting temperature and therefore only capable of transiently interacting with the template at the ambient temperature. If a DNA ligase is employed, or if the anti-codon can be ligated to the anti-codon of the first building block chemically, then the second building block will become firmly attached to the template, despite its short length of just 8 nucleotides. Thus, ligation allows the use of shorter anti- codons, which in turn brings the reactive groups into closer proximity.
(C) Rigid linkers. By using linkers comprising one or more flexible regions ("hinges") and one or more rigid regions, the probability of two functional entities getting into reactive contact may be increased, a. Symbol used for building block with a rigid part and two flexible hinges. b. A building block with the characteristics described in (a). The building block contains a continuous oligonucleotide -strand, constituting both the anti-codon (horizontal line), and linker (vertical line) connecting the functional entity (FE) with the anti-codon. Annealing of a complementary sequence to the central part of the linker leads to formation of a rigid double helix; at either end of the linker a single-stranded region remains, which constitutes the two flexible hinges.
Fig. 24 discloses various cleavable linkers. A number of cleavable linkers are shown, as well as the agents that cleave them and the products of the cleavage-reaction. In addition, catalysts including enzymes and ribozymes, may also be used to cleave the linker. Exemplary enzymes are proteases (e.g. chymotrypsin), nucleases, esterases and other hydrolases.
Fig. 25 shows two different ways of templated synthesis by generating a new reactive group. In cases where the reaction of X and Y leads to formation of a new reactive group Z, this may be exploited to increase the diversity of the templated molecule, by incorporating building blocks carrying reactive groups Q that react with Z. Using this approach, the templated molecules may be very compact structures, and thus, this approach describes a method to make highly substituted (functionalized and diverse) libraries of molecules of relatively low molecular weight. (A) First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond. In this example, both the reaction of X with Y, and of Z with Q, are reactions that involve simultaneous reaction and cleavage.
(B) First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond. In this example, the reaction of Z with Q does not involve simultaneous cleavage, wherefore an additional step of linker cleavage is introduced.
Fig. 25, example 1, shows a templated synthesis by generating a new reactive group. The reaction of the functional entities of the first three building blocks leads to formation of two double bonds, which may react with two hydroxylamines carried in by the building blocks added in the latter steps, and leads to formation of an ester, which may react with the hydroxylamine, encoded by a building block. Finally, the linkers are cleaved, generating the templated molecule.
Fig. 26 shows different methods of performing post-templating modifications on templated molecule. After the templating process has been performed, the templated molecules may be modified to introduce new characteristics. This list describes some of these post-templating modificiations.
Fig. 27 illustrates one preferred method for selection of template-displaying molecules.
Figure 28 shows the proposed complexes that may form when a reaction step is performed using set-ups that allow for stacking of DNA duplexes. Figure 29 shows a autoradiography of a polyacrylamide gel analysis of the reaction between building blocks.
Figure 30 shows the Feuston 3 functional entity as well as the Feuston 5 ligand.
Figure 31 shows the structure of the pentenoyl protected aspartate.
Figure 32 shows the use of allylglycine building blocks.
Figure 33 shows the autoradiography of a polyacrylamide gel.
Figure 34 shows an Elisa analysis of the product of the two-step encoding process.
Examples
In the following examples, building blocks are used which contain a zipper box adjacent to the functional entity. The zipper box sequences are underlined below. The following buffers and protocols are used in the same three examples.
Buffers.
Buffer A (100 mM Hepes pH= 7,5; 1 M NaCl)
Buffer B (20 mM Hepes pH= 7,5; 200 mM NaCl)
5'-Labeling with 32P.
Mix 5 pmol oligonucleotide, 2 μl 10 x phosphorylation buffer (Promega cat#4103), 1 μl T4 Polynucleotide Kinase (Promega cat#4103), 1 μl γ-32P ATP, add H2O to 20 μl. Incubate at 37°C 10-30 minutes. PAGE (polyacrylamide gel electrophoresis).
The samples are mixed with formamide dye 1:1 (98% formamide, 10 mM EDTA, pH 8, 0,025 % Xylene Cyanol, 0,025% Bromphenol Blue), incubated at 80°C for 2 minutes, and run on a denaturing 10% polyacrylamide gel. Develop gel using autoradiography (Kodak, BioMax film).
Example 1
The effect of alternating temperature on reaction efficiency in the zipper box system.
DNA-oligos:
X= Carboxy-dT (Glen Research, cat.no. 10-1035) 6= Amino-Modifier 5 (cat. Nr. 10-1905)
AH 316: 5'- 6GTAACAGACCTGTCGAGCATCCAGCT AH 331: 5'-
CGACCTCTGGATTGCATCGGTGTTACX AH140: 5'-
AGCTGGATGCTCGACAGGTCAGGTCGATCCGCGTTACCAGTCTTGCC- TGAACGTAGTCGTCCGATGCAATCCAGAGGTCG
Experimental. Mix 10 μl Buffer A, 1 pmol AH 331 (32P-labelled), 10 pmol AH 316, 5 pmol AH 140, and add H2O to 50 μl.
Anneal from 80° C to 30° C (-1° C / 30 sek). Then dilute 100 times in buffer B + 50 mM DMT-MM. (Prepared according to Kunishima et al. Tetrahedron (2001), 57, 1551) dissolved in ddH2O. Incubate at one of 8 different temperature profiles o/n (6 different constant temperatures ( 15°C; 17,8°C; 22,7°C; 28,3°C; 31,0°C; or 35,0°C; or alternating between 10°C for 5 sec. and 35°C for 1 sec); or alternating between 20°C for 5 sec. and 45°C for 1 sec). Analyze by 10% urea polyacrylamide gel electrophoresis.
Results. The polyacrylamide gel analysis showed that a more efficient reaction results from alternating the temperature between 10 °C and 35 °C, rather than performing the reaction at a constant temperature of 15°C, 17,8°C, 22,7°C, 28,3°C, 31,0°C, or 35,0°C.
Example 2
The effect of stacking on reaction efficiency.
DNA-oligos:
X= Carboxy-dT (cat.no. 10-1035)
Z= Amino-Modifier C6 dT (cat.no. 10-1039)
6= Amino-Modifier 5 (cat.no. 10-1905)
AH36: 5'-
CGACCTCTGGATTGCATCGGTCATGGCTGACTGTCCGTCGAATGTGTC-
CAGTTACX
AH38: 5'- AGCTGGATGCTCGACAGGTCCCGATGCAATCCAGAGGTCG AH51 : 5'-
ZGTAACACCTGTGTAAGCTGCCTGTCAGTCGGTACTGACCTGTCGAG-
CATCCAGCT
AH 137: 5'-ACGACTACGTTCAGGCAAGA
AH138: 5'- TCTTGCCTGAACGTAGTCGTAGGTCGATCCGCGTTACCAGAGCTG-
GATGCTCGACAGGTCCCGATGCAATCCAGAGGTCG
AH 139: 5'-CGACCTCTGGATTGCATCGG AH 143: 5'-
CTGGTAACGCGGATCGACCTTCATTTTTTTTTTTTTTTTTTTTTGGCT-
GACTGTCCGTCGAATGTGTCCAGTTACX
AH 202: δ'-TCTGGATTGCATCGGGTJACX
AH 270: 5'- 6GTAACGACCTGTCGAGCATCCAGCT
AH 286: 5'-
AGCTGGATGCTCGACAGGTCAAGTAACAGGTCGATCCGCGTTA-
TATCGTTTACGGCATTACCCGTATAGCCGCTAGATGCCCAACCATGACG
GCCCATAGCTTGCGGCTTGC
AH 320: 5'~
AGCTGGATGCTCGACAGGTCAGGTCGATCCGCGTTACCAGGCC-
CATAGCTTGCGGCTTGCTGCAGTCGATGGACCATGCCTCTTGCCT-
GAACGTAGTCGTCCGATGCAATCCAGAGGTCG
AH 321: 5'-CAAGAGGCAT
AH 322: δ'-TCAGGCAAGAGGCATGGTCC
AH 342: δ'-TACTTGACCTGTCGAGCATCGTJACX
AH 343: 5'- 6GTAACCAGCTGCAAGCCGCAAGCTATGGGC
Experimental.
Mix buffer A and relevant oligos (see table below).
Figure imgf000082_0001
Figure imgf000083_0001
Anneal from 80°C to 30°C (-1°C/min). Add 0,5 M DMT-MM. (Prepared according to Kunishima et al. Tetrahedron (2001), 57, 1551 ) dissolved in H2O. to a final concentration of 50 mM. Incubate at 10°C for 5 sec. and then 25°C for 1 sec. Repeat o/n. Analyze by 10% urea polyacrylamide gel electrophoresis.
Results.
In order to test the effect of stacking of DNA duplexes on reaction efficiency, we designed a number of different set-ups of templates and building blocks (see Figure 28). The following conclusions were reached:
Figure 28,1 and Figure 29, lane 1: Reference reaction between two building blocks annealed to adjacent sites on the template. As expected an efficient reaction is observed. In this set-up, the two building blocks anneal to the template and thereby form DNA duplexes that can stack onto each other. Figure 28,2 and Figure 29, lane 2: In this set-up, the two building blocks anneal to adjacent sites on the template. However, the two DNA-duplexes stack onto each other, basically forming one long DNA duplex. This rigid duplex does not allow the two building blocks to bend around the flexible hinge that might otherwise be present at the connection point between the two duplexes (i.e. the position of the nick in the DNA). Consequently, no significant reaction between the two building blocks is observed.
Figure 28,3 and Figure 29, lane 3; and Figure 28,4 and Figure 29, lane 4: Despite the fact that the two building blocks anneal to sites separated by 80 nucleotides, the reaction is still very efficient. We speculate that this is because of stacking, i.e. the intervening 80 nucleotides are looped out as a consequence of this, and therefore, the two functional entities are brought into close proximity.
In the experiment of Figure 29, lane 3 the linker that connects the functional entity to the complementing element is short (5 nucleotides); in Figure 29, lane 4 it is long (35 nucleotides). However, both linker lengths result in an efficient reaction.
Figure 28, 5 and Figure 29, lane 5; and Figure 28, 6 and Figure 29, lane 6: The annealing sites and separation between them are identical to those of the experiment described above (Figure 28, 3 and 4; Figure 29, lanes 3 and 4). In addition, a short oligo (10 nucleotides) has been annealed to the cen- tral region of the template. This result in a drastic decrease in reaction efficiency for the building blocks with the short linkers (lane 5); the reaction efficiency of the building blocks with the long linkers is only slightly affected if at all by the annealing of the short oligo. As indicated by the suggested structure of the complexes (Figure 28, 5 and 6), we believe this is because of stacking of the 3 DNA duplexes to generate an "extended" duplex: The short linkers cannot reach across the extended duplex; the long linkers can reach across the extended duplex structure and the reaction efficiency is not significantly affected.
Figure 28, 7 and Figure 29, lane 7; and Figure 28, 8 and Figure 29, lane 8: As immediately above, except that a 20 nucleotide long oligo is annealed to the central region of the template. In this case none of the linkers (short or long) can reach across the extended duplexes, and as a result no or little reaction is observed.
Figure 28,9 and Figure 29, lane 9; Figure 28,10 and Figure 29, lane 10; and Figure 28,11 and Figure 29, lane 11: In these experiments the building blocks are oriented the "other way", i.e. the linker connecting the complementing element and the functional entity is near the ends of the template. Additionally, the complementing element of the left building block contains a 5-nucleotide sequence that is complementary to other right end of the template. As a result, the building block should be capable of circularizing the template, as depicted in Figures 27, 9-11. These circular structures should also be stabilized by an extended duplex structure across the ends of the template. In the experiments of lanes 10 and 11 , a short oligo (10 nucleo- tides) or two longer oligos (each 20 nucleotides) are annealed to the central region. This has no effect on the reaction efficiency, in correlation with the proposal that the building blocks stack onto each other through a circulariza- tion of the template, thereby bringing the functional entities into close proximity.
Example 3
Single step transfers of functional entities.
DNA-Oliqos:
7=Thioi-Modifier C6 S-S (Glen Research, cat.no.10-1936) Z=Amino-Modifier C6 dT (10-1039) P= PC Spacer (10-4913)
AH136: 5'- AGCTGGATGCTCGACAGGTCTCTTGCCTGAACGTAGTCG- TCCGATGCAATCCAGAGGTCG AH 174: 5'-TACGTTCAGGCAAGAGT6CCAGTTAC7
AH 190: 5'- ZGTAACACCTGPTGACCTGTCGAGCATC
Experimental: Loading of NHM on the DNA-oligo:
Dry 10 nmol DNA oligo (AH 174) and then resuspended in 50 μl 100 mM DTT (1 ,4-Dithio-L-Threitol D-9760 Sigma) in 50 mM Phosphate buffer pH=8. Incubate at 37°C for 1 hour. Purification on Microspin G-25 (Amersham Biosciences, 27-5325-01). Add 50 μl 200 mM NHM ( N-Hydroxymaleimide Fluka 55510) and incubate at 25°C for 2 hours. Purification on Microspin G-25 equilibrated in H2O.
Loading of building blocks (4-pentenoic-acid, β-ala-Boc or CH3COOH) on the NHM-DNA-oligo:
Mix 50 μl 100 mM EDC and 50 μl 100 mM building block. Incubate at 25°C for 30 minutes.
Then mix 500 pmol NHM-DNA-oligo (AH174-NHM) and 10 μl of the EDC/ building block mix from above. Add 100 mM MES pH=6 to 20 μl. Incubate at 25°C for 5 minutes.
Purification on Micro Bio-Spin Chromatography Columns P6 (Bio-Rad 732-
6221) equilibrated in 100 mM MES pH=6.
Transfers: Mix 350 pmol AH136, 300 pmol AH190 and 500 pmol building block loaded AH 174. Add Buffer A to 50 μl. Anneal from 60°C to 25°C (-1°C/ 30 sec.) Incubate at 10°C for 5 sec. and then 25°C for 1 sec. Repeat o/n. Purification on Micro Bio-Spin Chromatography Columns P6 equilibrated in H2O.
Results:
The transfers were analyzed by MS, see table below. Transfer efficiencies of 20-34% were observed.
Figure imgf000087_0001
Example 4
Multistep transfer of functional entities to a scaffold oligonucleotide
In this example three functional entities are transferred to an amino modified scaffold oligo by a three step reaction, and analyzed by a denaturing acryla- mide gel using radio labelling.
Loading of functional entities on modified oligonucleotides to create building blocks.
5 nmoles of three carboxylic acid modified building block oligos [AH 155; 5'CTG GTA ACG CGG ATC GAC CTG TTA CT-COOH 3'; AH 272 5'ACG ACT ACG TTC AGG CAA GAG TTA CT-COOH 3' and AH 202 5'-TCT GGA TTG CAT CGG CTG TTA CT-COOH 3'] (all oligonucleotides described ordered from DNA technology, Aarhus, Denmark) one from each of the three positions corresponding to the template were loaded with β-Alanine methyl ester coupled to allylglycine n-Boc followed by Boc deprotection (β-AlaOMe AG). The loading was done by incubating each of the oligos with 10 mM β- AlaOMe AG, 75 mM DMT-MM in 150 mM Hepes-OH buffer, pH 7,5 to a final volume of 50 μl at 25°C shaking overnight. Then adding 5 μl 1 M NH4- acetate, incubated at 25°C for 10 min, then spin column purified with ddH2O equilibrated columns (Micro Bio-Spin chromatography columns P-6, Bio- Rad). The deprotection of the methyl group protected acid was done by adding 0,5 μl 2M NaOH to the oligos and incubating for 10 min at 80°C. Lastly the oligos were spin column purified and loadings confirmed by mass spec- trophotometry.
Transfers of functional entities to scaffold oligo.
In order to be able to analyze the functional entity transfers using acrylamide gel analysis, the scaffold oligo [MDL251 5'amino-C6 dT-ACC TGT CGA GCA TCC AGC T 3'] was radioactively labelled in the 3' end. 50 pmol of the oligo was labelled with 10 μl ddATP αP32 (Amersham Biosciences) by adding 4 μl 10X NEbuffer 4, 4μl 10X CoCI2 and 35 units of terminal deoxynucleotide transferase (New England Biolabs) and water to a final volume of 40 μl. Mixture incubated at 37°C for 1 hour. Labeled oligo purified using ddH2O equilibrated spin column.
12,5 pmol of the labeled scaffold oligo, 125 pmol loaded building block oligo AH 202, corresponding to position three on the template and 62,5 pmol template [AH 154 5' AGC TGG ATG CTC GAC AGG TCA AGT AAC AGG TCG ATC CGC GTT ACC AGT CTT GCC TGA ACG TAG TCG TCC GAT GCA ATC CAG AGG TCG 3'] was incubated in a final volume of 45 μl containing 20 mM Hepes-OH pH 7,5, 200 mM NaCl buffer. The oligos were annealed by heating to 80°C and slowely going down to 20°C (1 min) using a thermocy- cler (Eppendorf, Mastergradient) Following the annealing 5 μl 0,5M DMT- MM was added. Sample crosslinked, see figure 32 overnight cycling at 10°C 10 sec/35°C 1 sec. The sample was spin column purified and the crosslinked product cleaved to give first transfer of β-Ala to scaffold oligo amine by adding 10 μl 25 mM 12 dissolved in 1:1 tetrahydrofuran:H2O and incubated at 37°C for 1,5 hours. Followed by addition of 1 ,5 μl 1 M β-mercapotethanol and then purified with two equilibrated spin columns. The sample was completely dried down and oligos redissolved in 30 μl ddH2O. Transfer 2, oligo AH 272 and transfer 3, AH 202 were done in the exact same way as just described including the annealing, crosslinking and cleavage. For each remaining round adding same amount of building block oligo, 125 pmol.
Samples for analysis were taking out along the way, before and after crosslinking for the three transfers, which were analyzed on a 10% acryla- mide denaturing gel, see fig 33. As can be seen, crosslinking efficiency (step 1) was approximately 50% (Figure 33, lane 1). This was followed by an al- most 100%) efficient cleavage (lane 2), which results in the transfer of the β - Ala moiety onto the scaffold. This is followed by the crosslinking/cleavage of step 2 and 3 (lanes 3+4, 5+6) to generate the final product on the scaffold oligo. The product thus contains the three transferred β-Ala moieties.
Example 5
Two-step transfer and functional analysis by ELISA.
In this example two entities are transferred to a scaffold oligo by a two-step reaction to produce a ligand, Feuston 5 (see Figure 30) that binds to the αVβ3 integrin receptor. The product of the two-step process was analyzed by Elisa.
Loading of functional entities on modified oligonucleotides to create building blocks.
Two building block oligos were used, AH 155 (see above) loaded with Feuston 3 allylglycine. Feuston 3 is a derivative of the Feuston 5 ligand see fig 30 (F3OMeAG) and AH 272 (see above) loaded with glycine allylglycine (GlyO- MeAG) according to the above protocol (example Xa) for loadings of allylglycine functional entities to carboxylic acid modified oligos. 10 nmoles of each was loaded in two reactions each.
To create the Feuston 5 ligand aspartate is also needed. Therefore aspartate which was loaded as a pentenoyl (amine) and methyl (carboxylic acid) protected functional entity see Figure 31 , to an amino modified scaffold oligo [AH 270 ;5' amino-GTA ACG ACC TGT CGA GCA TCC AGC T 3']. The loading was done by mixing 25 μl 150 mM EDC (N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide hydrochloride, Fluka), 25 μl NHS (N- hydroxysuccinimide, Sigma) and 5 μl 100 mM of the pentenoyl protected aspartate functional entity, all reagents were dissolved in N,N- dimethylformamide, DMF. Incubated at 25°C for 40 min. To this mixture 5 nmol of the scaffold oligo, AH 270 resuspended in 30 μl 150 mM Hepes-OH pH 7,5 was added and this incubated shaking over night at 25°C. The amine pentenoyl protection group was deprotected by adding 20 μl 25 mM 12 dissolved in 1 :1 tetrahydrofuran: water and incubated at 37°C for 2 hours. Followed by spin column purification, and loading confirmed by mass spectrum analysis.
Transfers of functional entities to scaffold oligo.
The transfers were done in the same manner as described above, but using larger amounts of oligo to ensure there being enough ligand created to give a sufficient signal in the ELISA. For the first round the following amounts were used: 850 pmol loaded scaffold oligo; AH 270, 7500 pmol loaded building block oligo; AH 272 and 3250 pmol template oligo AH 140 [ 5' AGC TGG ATG CTC GAC AGG TCA GGT CGA TCC GCG TTA CCA GTC TTG CCT GAA CGT AGT CGT CCG ATG CAA TCC AGA GGT CG 3']. The second round, adding 7500 pmol loaded building block oligo AH 155 for a transfer. The created Feuston 5 ligand on the scaffold oligo still had a methyl group protected acid on the aspartate, which was deprotected just as described before. By adding 0,5 μl 2 M NaOH to the oligos and incubating at 80°C for 10 min. The sample this time though was pH calibrated with 0,5 μl 2 M HCl and was now ready for the ELISA analysis.
ELISA assay
Maxisorb plates (Nunc Immunomodule U8 Maxisorp. Biotecline) were coated with αVβ3 integrin receptor 0,1 μg/well in PBS over night at 4°C. The wells were blocked with 300 μl blocking buffer containing PBS, 0.05% Tween 20 (Sigma), 1% BSA (Sigma), 0.1 mg/mL herring sperm DNA (Sigma), for 3 hours at room temperature. Wells were washed 5 * 300 μl using wash buffer containing PBS, 0.05%o Tween 20, 1% BSA. The sample prepared above containing the displayed Feuston 5 ligand on a scaffold oligo was added to a well, control for the experiment being a 20 mer oligo loaded with the RGD peptide, a well known and well described ligand for this integrin receptor (loaded according to above described method for the pentenoyl and methyl protected aspartate functional entity). The incubation with these ligands was done in ligand binding buffer containing PBS, 1 mM MnCI2, 1 mg/mL BSA at room temperature for one hour. Washed in washing buffer 5 * 300 μl. Incubated with 100 μl horseradish peroxidase-streptavidine (Endogen) diluted 1 :10000 times in wash buffer, incubated for one hour at room temperature.
Washed again in 5 * 300 μl wash buffer. 100 μl 3, 3', 5,5'-tetrametylbenzidine hydrogenperoxidase (TMB substrate, Kem-en-tec) added and incubated at room temperature until color development. 100 μl 0,2 M sulphuric acid added, color measured at 450 nm, see figure 34. As can be seen the Feus- ton 5 ligand generated by the two-step encoding procedure is active and binds the integrin receptor with relatively high efficiency.

Claims

Claims
1. A method for the manufacture of a library of complexes comprising templated molecules, said method comprises the steps of a) providing a plurality of different templates comprising a number of cod- ing regions and a reactive group, wherein each coding region of a specific template specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of a template, and the functional entity comprises at least one reactive group, c) contacting the plurality of different templates with a subset of the plurality of different building blocks, said subset having anti-codons which complement the unique codons of a specific coding region, said con- tacting being performed under conditions which allow specific hybridisation of the anti-codons to the unique codons of the templates, d) reacting the reactive group of the template and the reactive group of the building block to obtaining a chemical connection, e) contacting under conditions allowing specific hybridisation, the plurality of different templates harbouring the nascent templated molecules with a further subset of the plurality of building blocks, said subset having anti-codons complementary to the unique codons of a coding region in the vicinity of the coding region harbouring the nascent templated molecules, f) allowing the functional entities of the subset of further building blocks to form a chemical connection to the nascent templated molecules, g) optionally, cleaving one or more of the linkers, provided that at least one linker remains to connect the nascent templated molecule with the template which directed the synthesis thereof, h) optionally repeating steps e) through g), i) obtaining a templated molecule attached via the linker one or more building blocks to the template which directed the synthesis thereof.
2. The method according to claim 1 , wherein the reactive group of step a) comprised by the template is covalently attached to the template.
3. The method according to claim 1 , wherein the reactive group of the template is non-covalently attached to the template.
4. The method according to claim 3, wherein the reactive group of the template is covalently attached to a complementing element hybridised to the template.
5. The method according to claim 3 or 4, wherein the reactive group of the template is part of a building block.
6. The method according to any of the claims 3 to 5, wherein the building blocks harbouring the reactive group of step a) and the subset of building blocks contacted with the templates in step c) are positioned next to each other.
7. The method according to any of the preceding claims, wherein the individual coding regions of the plurality of templates are positioned next to each other in a linear sequence.
8. The method according to claims 1 to 6, wherein the template is branched.
9. The method according to any of the claims 1 to 8, wherein coding regions are separated by a spacer group.
10. The method according to claim 9, wherein the spacer group identifies the neighbouring coding region or unique codon.
11. The method according to any of the preceding claims, wherein the number of coding regions is 3 to 100.
12. The method according to any of the preceding claims, wherein the number of unique codons within a coding region is between 1 and 10,000.
13. The method according to any of the preceding claims, wherein each unique codon is a sequence of 3 to 100 nucleic acid monomers.
14. The method according to claim 13, wherein each unique codon comprises a sequence of 8 to 30 nucleic acid monomers.
15. The method according to any of the preceding claims, wherein the individual unique codon:anti-codon hybrids within a specific coding region have a similar annealing temperature.
16. The method according to any of the claims 1 to 14, wherein the individual unique codon:anti-codon hybrids within a specific coding region have a different annealing temperature.
17. The method according to any of the preceding claims, wherein the functional entity of a building block comprises a reactive group capable of forming a connection to a reaction partner of another functional entity or nascent templated molecule.
18. The method according to any of the preceding claims, wherein the functional entity of a building block comprises a reactive group capable of forming a connection to a reactive group of another functional entity or nascent templated molecule through a bridging fill-in group.
19. The method according to any of the preceding claims, wherein the linker is attached to the anti-codon oligonucleotide at a central area thereof.
20. The method according to any of the preceding claims, wherein the anti-codon and the linker is a contiguous linear oligonucleotide.
21. The method according to any of the preceding claims, wherein the linker is attached to the functional entity through a reactive group capable of forming a connection to another functional entity or a nascent templated molecule.
22. The method according to claim 21 , wherein the linker is capable of being cleaved simultaneously with the formation of the connection.
23. The method according to any of the preceding claims, wherein the reactive groups involved in the formation of the connection between functional entities or a functional entity and a nascent templated molecule are reactions partners.
24. The method according to any of the preceding claims, wherein the subset in steps c) comprises building blocks having anti-codons which form hybrids with unique codons in a coding region neighbouring the reactive group of the template.
25. The method according to any of the preceding claims, wherein the subset in step e) comprises building blocks having anti-codons which form hybrids with unique codons in a coding region neighbouring the building block harbouring the nascent templated compound.
26. The method according to claims 24 or 25, wherein the subset is formed by adding the building blocks separately.
27. The method according to any of the claims 24 or 25, wherein the subsets in steps c) or e) are formed by directing the annealing temperature of the individual building blocks.
28. The method according to any of the preceding claims, wherein the anticodon of a building block with a functional entity is ligated to the anti-codon of a building block harbouring a nascent molecule prior to establishing the connection between the functional entity and the nascent molecule being prepared.
29. The method according to any of the preceding claims, wherein building blocks intended to interact with each other each are provided with a part of a molecule pair being capable of reversible interaction.
30. The method according to claim 29, wherein the one part of the molecule pair is present on the linker, close to the functional entity or nascent templated molecule.
31. The method according to claims 29 or 30, wherein the one part of the reversible interacting molecule pair of a first building block is an oligonucleotide and the other part of the reversible interacting molecule pair of a second building block intended to interact with the first building block is a complementing oligonucleotide.
32. The method according to the preceding claims 29 to 31 , wherein the annealing temperature of an interacting molecule pair is lower than the annealing temperatures for the unique codon:anti-codon hybrids of the involved building blocks.
33. The method of claim 32, wherein the annealing temperature of the reversible interacting molecule pair is below room temperature but above 5°C.
34. The method according to claim 33, wherein the annealing temperature is between 10°C and 20°C.
35. The method according to any of the preceding claims, wherein the linker is rigid and attached the anti-codon through a molecular hinge.
36. The method according to claim 35, wherein the rigid linker is a double stranded oligonucleotide.
37. The method according to claim 35 or 36, wherein the molecular hinge is a single stranded region of the building block.
38. The method for the manufacture of a library according to claim 1 , wherein the complexes obtained comprise templated molecules attached to the template which templated the syntheses thereof via a single building block.
39. The method according to claim 1 , comprising the further step of connecting the templated molecule with the template which directed the synthe- ses thereof, or a complementing template, via a covalent link.
40. The method according to claim 39, wherein the covalent link is selectively cleavable to provide for a release of the templated molecule.
41. The method according to claim 1 , wherein the templated molecules of the library complex are polymers.
42. The method according to any of the claims 1 to 41 , wherein the optional cleavage of some or all of the linkers of step g) are not performed.
43. The method according to claim 42, comprising the further step of cleaving all but one linker after the formation of the templated molecule.
44. The method according to any of the preceding claims, wherein the anti-codons following the cleavage of the linker attached thereto, remain hybridised to the unique codons.
45. The method according to claim 44, wherein the anti-codons attached to the templates are ligated together to create a complementary template.
46. The method according to claim 1 , comprising the further step of trans- ferring the templated molecule to an anchorage point on the template, or a sequence complementing the template, to establish an effective chemical connection.
47. The method according to claim 46, wherein the complementing se- quence has a higher annealing temperature than one or more of the building blocks.
48. The method according to claim 1 , comprising the further step of connecting the templated molecule with a complementary template via a cova- lent link.
49. The method according to claim 48, wherein the template is covalently connected to the complementing template.
50. The method according to claim 48, wherein the covalent link is selectively cleavable to provide for a separation of the templated molecule from the complementary template.
51. A library of complexes obtainable according to any of the claims 1 to 45.
52. A method of enriching a library of complexes comprising templated molecules with respect to a predetermined activity, said enrichment method comprising the steps of: i) establishing a first library of complexes comprising templated molecules, said library being obtainable according to any of the claims 1 to 50, ii) exposing the library to conditions enriching the library with complexes having the predetermined activity, iii) amplifying the complexes of the enriched library, iv) optionally, repeating step ii) to iii), and v) obtaining an enriched library having a higher ratio of complexes comprising templated molecules with the predetermined activity.
53. The method of claim 52, wherein step iii) comprises a 101 to 1015-fold amplification.
54. The method of claim 52, wherein the steps ii) and iii) are repeated at least 2, 3, 5 times, such as at least 10 times, such as at least 15 times.
55. The method of claim 52, further comprising a step of identification of the complexes having the predetermined activity.
56. The method of claim 52, wherein the identification is conducted by analysing the template and/or complementary template associated with the molecule.
57. The method of claim 52, wherein the conditions enriching the library comprises contacting a binding partner to the templated molecules of interest.
58. The method according to claim 57, wherein the binding partner being directly or indirectly immobilised on a support.
59. The method according to claim 52, wherein the enrichment is conducted by screening for complexes having an affinity for - or an effect on - a target molecule or a target entity.
60. The method according to claim 52, wherein the enrichment is conducted by selection for catalytic activity.
61. The method of claim 52, wherein the conditions enriching the library involves any one or more of electrophoretic separation, gelfiltration, immunoprecipitation, isoelectric focusing, centrifugation, and immobilization.
62. The method of claim 52, wherein the conditions enriching the library comprises providing cells capable of internalising the templated molecule, or performing an interaction with the templated molecule having the desired predetermined activity.
63. The method according to claim 52, wherein the amplification of the complexes of the enriched library comprises the steps of A. contacting the library of complexes with amplification means,
B. amplifying the templates or the complementing templates, and
C. conducting the method according to any of the claims 1 to 50 using the amplification product of step B as templates.
64. A method for the manufacture of a complex of a templated molecule attached to the template which directed the synthesis thereof, said method comprises the steps of a) providing a template comprising a number of coding regions and a reactive group, wherein each coding region specifies a unique codon, b) providing a plurality of different building blocks, each building block comprising an anti-codon, a functional entity and a linker connecting the anti-codon and the functional entity, wherein the anti-codon of each building block complements a unique codon of the template, and the functional entity comprises at least one reactive group, c) contacting the template with a building block having an anti-codon which complements the unique codon of a specific coding region, said contacting being performed under conditions which allow specific hybridisation of the anti-codon to the unique codon of the templates, d) reacting the reactive group of the template and the reactive group of the building block to obtaining a chemical connection, e) contacting under conditions allowing specific hybridisation, the tem- plate harbouring the nascent templated molecule with a further building block having an anti-codon complementary to the unique codon of a coding region in the vicinity of the coding region harbouring the nascent templated molecule, f) allowing the functional entity of the further building block to form a chemical connection to the nascent templated molecule, g) optionally, cleaving one or more of the linkers, provided that at least one linker remains to connect the nascent templated molecule with the template which directed the synthesis thereof, h) optionally repeating steps e) through g), i) obtaining a templated molecule attached via the linker of one or more building blocks to the template which directed the synthesis thereof.
60. A method for preparing a templated molecule, comprising the further step of claim 59 of cleaving the linker(s) of the one or more building blocks to release the templated molecule.
PCT/DK2003/000516 2002-08-01 2003-07-30 Multi-step synthesis of templated molecules WO2004013070A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
ES03766117T ES2572203T3 (en) 2002-08-01 2003-07-30 Complex library comprising small non-peptide molecules and double stranded oligonucleotides for molecule identification
AU2003247266A AU2003247266A1 (en) 2002-08-01 2003-07-30 Multi-step synthesis of templated molecules
SI200332480A SI1539980T1 (en) 2002-08-01 2003-07-30 Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules
EP03766117.0A EP1539980B1 (en) 2002-08-01 2003-07-30 Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules
US10/523,006 US10730906B2 (en) 2002-08-01 2003-07-30 Multi-step synthesis of templated molecules
DK03766117.0T DK1539980T3 (en) 2002-08-01 2003-07-30 Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides that identify the molecules

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US39969202P 2002-08-01 2002-08-01
US60/399,692 2002-08-01
DKPA200201171 2002-08-01
DKPA200201171 2002-08-01

Publications (2)

Publication Number Publication Date
WO2004013070A2 true WO2004013070A2 (en) 2004-02-12
WO2004013070A3 WO2004013070A3 (en) 2004-03-25

Family

ID=31496949

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2003/000516 WO2004013070A2 (en) 2002-08-01 2003-07-30 Multi-step synthesis of templated molecules

Country Status (4)

Country Link
US (1) US10730906B2 (en)
EP (1) EP1539980B1 (en)
AU (1) AU2003247266A1 (en)
WO (1) WO2004013070A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004074501A2 (en) * 2003-02-21 2004-09-02 Nuevolution A/S A method for obtaining structural information about an encoded molecule
WO2004074429A2 (en) * 2003-02-21 2004-09-02 Nuevolution A/S Method for producing second-generation library
WO2004083427A2 (en) * 2003-03-20 2004-09-30 Nuevolution A/S Ligational encoding of small molecules
WO2004039825A3 (en) * 2002-10-30 2004-10-28 Nuevolution As Method for the synthesis of a bifunctional complex
WO2005090566A2 (en) * 2004-03-22 2005-09-29 Nuevolution A/S Ligational encoding using building block oligonucleotides
WO2006079061A2 (en) * 2005-01-21 2006-07-27 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
US7413854B2 (en) 2002-03-15 2008-08-19 Nuevolution A/S Method for synthesising templated molecules
US7727713B2 (en) 2001-06-20 2010-06-01 Nuevolution A/S Templated molecules and methods for using such molecules
US7935658B2 (en) 2003-12-17 2011-05-03 Praecis Pharmaceuticals, Inc. Methods for synthesis of encoded libraries
US7972994B2 (en) 2003-12-17 2011-07-05 Glaxosmithkline Llc Methods for synthesis of encoded libraries
US7989395B2 (en) 2005-10-28 2011-08-02 Glaxosmithkline Llc Methods for identifying compounds of interest using encoded libraries
EP2396459A1 (en) 2009-02-13 2011-12-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
AU2011226815B2 (en) * 2002-10-30 2014-09-25 Nuevolution A/S Enzymatic encoding
EP2748357B1 (en) 2011-09-07 2018-04-04 X-Chem, Inc. Methods for tagging dna-encoded libraries
EP2872680B1 (en) 2012-07-13 2018-04-04 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP3083957B1 (en) 2013-12-20 2018-05-23 Philochem AG Production of encoded chemical libraries
US10730906B2 (en) 2002-08-01 2020-08-04 Nuevolutions A/S Multi-step synthesis of templated molecules
US11118215B2 (en) 2003-09-18 2021-09-14 Nuevolution A/S Method for obtaining structural information concerning an encoded molecule and method for selecting compounds
US11225655B2 (en) 2010-04-16 2022-01-18 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
US11702652B2 (en) 2005-12-01 2023-07-18 Nuevolution A/S Enzymatic encoding methods for efficient synthesis of large libraries

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004028682A2 (en) * 2002-09-27 2004-04-08 Carlsberg A/S Spatially encoded polymer matrix
EP2175019A3 (en) 2002-12-19 2011-04-06 Nuevolution A/S Quasirandom structure and function guided synthesis methods
US8017323B2 (en) * 2003-03-26 2011-09-13 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
WO2005078122A2 (en) * 2004-02-17 2005-08-25 Nuevolution A/S Method for enrichment involving elimination by mismatch hybridisation
PT3050878T (en) 2013-09-24 2021-12-02 Fujifilm Corp Novel nitrogen-containing compound or salt thereof, or metal complex thereof
EP3218479A1 (en) 2014-11-11 2017-09-20 Nanocore ApS Method for identification of molecules with desired characteristics
EP3472376A4 (en) 2016-06-16 2019-12-18 Richard Edward Watts Oligonucleotide directed and recorded combinatorial synthesis of encoded probe molecules
US11795580B2 (en) 2017-05-02 2023-10-24 Haystack Sciences Corporation Molecules for verifying oligonucleotide directed combinatorial synthesis and methods of making and using the same
US11214795B2 (en) * 2017-09-25 2022-01-04 California Institute Of Technology Bistable polynucleotide devices for the sensing and quantification of molecular events
US11391734B2 (en) * 2017-09-25 2022-07-19 California Institute Of Technology Surface-immobilized bistable polynucleotide devices for the sensing and quantification of molecular events

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005785A1 (en) 1988-11-18 1990-05-31 The Regents Of The University Of California Method for site-specifically incorporating unnatural amino acids into proteins
DE19646372C1 (en) 1995-11-11 1997-06-19 Evotec Biosystems Gmbh Conjugates of polypeptide and encoding nucleic acid
WO1998031700A1 (en) 1997-01-21 1998-07-23 The General Hospital Corporation Selection of proteins using rna-protein fusions
WO2000032823A1 (en) 1998-12-02 2000-06-08 Phylos, Inc. Dna-protein fusions and uses thereof
WO2000061775A1 (en) 1999-04-08 2000-10-19 Pavel Sergeev Synthesis of biologically active compounds in cells

Family Cites Families (215)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS53104797A (en) * 1977-02-22 1978-09-12 Japan Tobacco Inc Preparation of expanded veins and stalks of tobacco leaves
US6040166A (en) 1985-03-28 2000-03-21 Roche Molecular Systems, Inc. Kits for amplifying and detecting nucleic acid sequences, including a probe
US4822731A (en) 1986-01-09 1989-04-18 Cetus Corporation Process for labeling single-stranded nucleic acids and hybridizaiton probes
US5047519A (en) 1986-07-02 1991-09-10 E. I. Du Pont De Nemours And Company Alkynylamino-nucleotides
DE3788914T2 (en) 1986-09-08 1994-08-25 Ajinomoto Kk Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers.
US5449602A (en) 1988-01-13 1995-09-12 Amoco Corporation Template-directed photoligation
US5025388A (en) 1988-08-26 1991-06-18 Cramer Richard D Iii Comparative molecular field analysis (CoMFA)
US5324829A (en) 1988-12-16 1994-06-28 Ortho Diagnostic Systems, Inc. High specific activity nucleic acid probes having target recognition and signal generating moieties
KR0185192B1 (en) 1989-10-05 1999-04-01 제임스 더블유. 데이비 Cell-free synthesis and isolation of novel genes and polypeptides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
CA2039517C (en) 1990-04-03 2006-11-07 David Segev Dna probe signal amplification
US5723289A (en) 1990-06-11 1998-03-03 Nexstar Pharmaceuticals, Inc. Parallel selex
US5723286A (en) 1990-06-20 1998-03-03 Affymax Technologies N.V. Peptide library and screening systems
US5650489A (en) 1990-07-02 1997-07-22 The Arizona Board Of Regents Random bio-oligomer library, a method of synthesis thereof, and a method of use thereof
US5843701A (en) 1990-08-02 1998-12-01 Nexstar Pharmaceticals, Inc. Systematic polypeptide evolution by reverse translation
WO1992002536A1 (en) 1990-08-02 1992-02-20 The Regents Of The University Of Colorado Systematic polypeptide evolution by reverse translation
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
AU2313392A (en) 1991-08-01 1993-03-02 University Research Corporation Systematic polypeptide evolution by reverse translation
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
JP2780572B2 (en) 1991-09-13 1998-07-30 株式会社島津製作所 Enzymatic synthesis of oligonucleotides and use of oligonucleotides as primers
US5639603A (en) 1991-09-18 1997-06-17 Affymax Technologies N.V. Synthesizing and screening molecular diversity
CA2118806A1 (en) 1991-09-18 1993-04-01 William J. Dower Method of synthesizing diverse collections of oligomers
US6197556B1 (en) 1991-12-20 2001-03-06 The University Of Chicago Nucleic acid amplification using modular branched primers
US5424413A (en) 1992-01-22 1995-06-13 Gen-Probe Incorporated Branched nucleic acid probes
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5541061A (en) 1992-04-29 1996-07-30 Affymax Technologies N.V. Methods for screening factorial chemical libraries
US6503759B1 (en) 1992-10-01 2003-01-07 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5565324A (en) 1992-10-01 1996-10-15 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
WO1994008051A1 (en) 1992-10-01 1994-04-14 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5684169A (en) 1992-11-27 1997-11-04 Ensuiko Sugar Refining Co., Ltd. Cyclodextrin inclusion complex of taxol, and method for its production and its use
AU5827294A (en) 1992-12-11 1994-07-04 Chiron Corporation Synthesis of encoded polymers
US5681943A (en) 1993-04-12 1997-10-28 Northwestern University Method for covalently linking adjacent oligonucleotides
DE69433010T2 (en) 1993-04-12 2004-06-09 Northwestern University, Evanston METHOD FOR PRESENTING OLIGONUCLEOTIDES
US5840485A (en) 1993-05-27 1998-11-24 Selectide Corporation Topologically segregated, encoded solid phase libraries
NZ267843A (en) 1993-05-27 1997-10-24 Selectide Corp Libraries of synthetic test compound attached to separate phase synthesis supports
EP0706531A4 (en) 1993-07-02 1998-11-25 Lynx Therapeutics Inc Synthesis of branched nucleic acids
US5473060A (en) 1993-07-02 1995-12-05 Lynx Therapeutics, Inc. Oligonucleotide clamps having diagnostic applications
US5571903A (en) 1993-07-09 1996-11-05 Lynx Therapeutics, Inc. Auto-ligating oligonucleotide compounds
US6087186A (en) 1993-07-16 2000-07-11 Irori Methods and apparatus for synthesizing labeled combinatorial chemistry libraries
GB9315847D0 (en) 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
AU7390994A (en) 1993-08-25 1995-03-21 Symbicom Aktiebolag Molecular modelling and drug design
CN1154640C (en) 1993-10-01 2004-06-23 纽约市哥伦比亚大学理事 Complex combinatorial chemical libraries encoded with tags
US5503805A (en) 1993-11-02 1996-04-02 Affymax Technologies N.V. Apparatus and method for parallel coupling reactions
CN1134156A (en) 1993-11-02 1996-10-23 阿菲马克斯技术公司 Synthesizing and screening molecular diversity
US6165778A (en) 1993-11-02 2000-12-26 Affymax Technologies N.V. Reaction vessel agitation apparatus
JPH09506629A (en) 1993-12-17 1997-06-30 キュビッチョッティ,ロジャー・エス Nucleotide-controlled biomolecular and multimolecular drug assembly and devices
ZA95260B (en) * 1994-01-13 1995-09-28 Univ Columbia Synthetic receptors libraries and uses thereof
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US5449613A (en) 1994-03-01 1995-09-12 The University Of Iowa Research Foundation Reacting an enzyme in a non-aqueous solvent by adding a lyophilizate of enzyme and salt to the solvent
US6936477B2 (en) 1994-04-13 2005-08-30 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5643722A (en) 1994-05-11 1997-07-01 Trustees Of Boston University Methods for the detection and isolation of proteins
JPH08268A (en) 1994-06-16 1996-01-09 Koichi Nishigaki Method of producing ligated double-stranded dna
US5663046A (en) 1994-06-22 1997-09-02 Pharmacopeia, Inc. Synthesis of combinatorial libraries
JPH10507160A (en) 1994-06-23 1998-07-14 アフィマックス テクノロジーズ エヌ.ブイ. Photoactive compounds and methods of using the same
WO1996003418A1 (en) 1994-07-26 1996-02-08 The Scripps Research Institute Soluble combinatorial libraries
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5695934A (en) 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US5846719A (en) 1994-10-13 1998-12-08 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US6045671A (en) 1994-10-18 2000-04-04 Symyx Technologies, Inc. Systems and methods for the combinatorial synthesis of novel materials
US5985356A (en) 1994-10-18 1999-11-16 The Regents Of The University Of California Combinatorial synthesis of novel materials
WO1996024847A1 (en) 1995-02-10 1996-08-15 Smithkline Beecham Corporation A process for identifiying pharmaceutically active agents using an epitope-tagged library
US5843650A (en) 1995-05-01 1998-12-01 Segev; David Nucleic acid detection and amplification by chemical linkage of oligonucleotides
US5679519A (en) 1995-05-09 1997-10-21 Oprandy; John J. Multi-label complex for enhanced sensitivity in electrochemiluminescence assay
US6210900B1 (en) 1995-05-23 2001-04-03 Smithkline Beecham Corporation Method of encoding a series of combinatorial libraries and developing structure activity relationships
US5830658A (en) 1995-05-31 1998-11-03 Lynx Therapeutics, Inc. Convergent synthesis of branched and multiply connected macromolecular structures
US5824471A (en) 1995-06-05 1998-10-20 Brigham And Women's Hospital Detection of mismatches by cleavage of nucleic acid heteroduplexes
US5958792A (en) 1995-06-07 1999-09-28 Chiron Corporation Combinatorial libraries of substrate-bound cyclic organic compounds
HUP9900910A2 (en) 1995-06-07 1999-07-28 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
WO1997004131A1 (en) 1995-07-21 1997-02-06 Forsyth Dental Infirmary For Children Single primer amplification of polynucleotide hairpins
US5780613A (en) 1995-08-01 1998-07-14 Northwestern University Covalent lock for self-assembled oligonucleotide constructs
US5795976A (en) 1995-08-08 1998-08-18 The Board Of Trustees Of The Leland Stanford Junior University Detection of nucleic acid heteroduplex molecules by denaturing high-performance liquid chromatography and methods for comparative sequencing
US5723320A (en) 1995-08-29 1998-03-03 Dehlinger; Peter J. Position-addressable polynucleotide arrays
US6495314B1 (en) 1995-09-29 2002-12-17 The Scripps Research Institute Process for characterizing proteins
WO1997019039A1 (en) 1995-11-17 1997-05-29 Novartis Ag Solid phase synthesis of heterocyclic compounds and combinatorial compound library
US5763175A (en) 1995-11-17 1998-06-09 Lynx Therapeutics, Inc. Simultaneous sequencing of tagged polynucleotides
US5763263A (en) 1995-11-27 1998-06-09 Dehlinger; Peter J. Method and apparatus for producing position addressable combinatorial libraries
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
JP2002515738A (en) 1996-01-23 2002-05-28 アフィメトリックス,インコーポレイティド Nucleic acid analysis
US6613508B1 (en) 1996-01-23 2003-09-02 Qiagen Genomics, Inc. Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques
US5880972A (en) 1996-02-26 1999-03-09 Pharmacopeia, Inc. Method and apparatus for generating and representing combinatorial chemistry libraries
EP0904540A1 (en) 1996-03-22 1999-03-31 Ontogen Corporation Methods for spatially-dispersed positionally-encoded combinatorial library synthesis
US6294325B1 (en) 1996-07-05 2001-09-25 The Mount Sinai School Of Medicine Of The City University Of New York Cloning and expression of thermostable multi genes and proteins and uses thereof
US5821356A (en) 1996-08-12 1998-10-13 The Perkin Elmer Corporation Propargylethoxyamino nucleotides
US6355490B1 (en) 1996-09-13 2002-03-12 Jill Edie Hochlowski Attached tags for use in combinatorial chemistry synthesis
DE19642751A1 (en) 1996-10-16 1998-04-23 Deutsches Krebsforsch Saccharide library
US5954874A (en) 1996-10-17 1999-09-21 Hunter; Charles Eric Growth of bulk single crystals of aluminum nitride from a melt
DE69739163D1 (en) 1996-10-17 2009-01-22 Mitsubishi Chem Corp Molecule that combines genotype and phenotype and its applications
US6261804B1 (en) 1997-01-21 2001-07-17 The General Hospital Corporation Selection of proteins using RNA-protein fusions
US6127533A (en) 1997-02-14 2000-10-03 Isis Pharmaceuticals, Inc. 2'-O-aminooxy-modified oligonucleotides
US5739314A (en) 1997-04-25 1998-04-14 Hybridon, Inc. Method for synthesizing 2'-O-substituted pyrimidine nucleosides
ATE250668T1 (en) 1997-05-28 2003-10-15 Discerna Ltd RIBOSOME COMPLEXES AS SELECTION PARTICLES FOR IN VITRO DISPLAY AND EVOLUTION OF PROTEINS
US6969584B2 (en) * 1997-06-12 2005-11-29 Rigel Pharmaceuticals, Inc. Combinatorial enzymatic complexes
AU8147798A (en) 1997-06-16 1999-01-04 University Of North Carolina At Chapel Hill, The Peptido oligonucleotides (pons) and their combinatorial libraries
US6607878B2 (en) 1997-10-06 2003-08-19 Stratagene Collections of uniquely tagged molecules
US6348322B1 (en) 1997-10-17 2002-02-19 Duke University Method of screening for specific binding interactions
US20030004122A1 (en) 1997-11-05 2003-01-02 Leonid Beigelman Nucleotide triphosphates and their incorporation into oligonucleotides
US6232066B1 (en) 1997-12-19 2001-05-15 Neogen, Inc. High throughput assay system
JP2002540380A (en) 1998-02-21 2002-11-26 ウィッシス・テクノロジー・ファウンデーション・インコーポレイテッド One-dimensional chemical compound arrays and their assay methods
US6316616B1 (en) 1998-04-02 2001-11-13 President And Fellows Of Harvard College Parallel combinatorial approach to the discovery and optimization of catalysts and uses thereof
JP2002510505A (en) 1998-04-03 2002-04-09 フィロス インク. Localizable protein arrays
EP1073730A1 (en) 1998-04-17 2001-02-07 Whitehead For Biomedical Research Use of a ribozyme to join nucleic acids and peptides
CA2332862A1 (en) 1998-05-15 1999-11-25 Isis Innovation Ltd. Libraries of oligomers labelled with different tags
US6287765B1 (en) 1998-05-20 2001-09-11 Molecular Machines, Inc. Methods for detecting and identifying single molecules
US6096875A (en) 1998-05-29 2000-08-01 The Perlein-Elmer Corporation Nucleotide compounds including a rigid linker
US5948648A (en) 1998-05-29 1999-09-07 Khan; Shaheer H. Nucleotide compounds including a rigid linker
EP1086064A2 (en) 1998-06-10 2001-03-28 Glycodesign Inc. Directed combinatorial compound library and high throughput assays for screening same
WO2000020639A1 (en) 1998-10-05 2000-04-13 Lynx Therapeutics, Inc. Enzymatic synthesis of oligonucleotide tags
AU6295999A (en) 1998-10-09 2000-05-01 Pharmacopeia, Inc. Selecting codes to be used for encoding combinatorial libraries
US6175001B1 (en) 1998-10-16 2001-01-16 The Scripps Research Institute Functionalized pyrimidine nucleosides and nucleotides and DNA's incorporating same
CA2346989A1 (en) 1998-10-19 2000-04-27 The Board Of Trustees Of The Leland Stanford Junior University Dna-templated combinatorial library chemistry
CA2343878A1 (en) 1998-10-28 2000-05-04 Novozymes A/S Method for generating a gene library
US5942609A (en) 1998-11-12 1999-08-24 The Porkin-Elmer Corporation Ligation assembly and detection of polynucleotides on solid-support
US6209546B1 (en) * 1998-11-30 2001-04-03 Truman W. Ellison Apparatus and method for improved hydrate formation and improved efficiency of recovery of expansion agent in processes for expanding tobacco and other agricultural products
US6087112A (en) 1998-12-30 2000-07-11 Oligos Etc. Inc. Arrays with modified oligonucleotide and polynucleotide compositions
CA2360407A1 (en) 1999-01-08 2000-07-13 Nickolai Alexandrov Sequence-determined dna fragments and corresponding polypeptides encoded thereby
WO2000075373A2 (en) 1999-05-20 2000-12-14 Illumina, Inc. Combinatorial decoding of random nucleic acid arrays
CA2376623C (en) 1999-06-25 2011-04-19 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
CA2377468C (en) 1999-07-27 2010-04-20 Phylos, Inc. Peptide acceptor ligation methods
GB9920194D0 (en) 1999-08-27 1999-10-27 Advanced Biotech Ltd A heat-stable thermostable DNA polymerase for use in nucleic acid amplification
WO2001016151A1 (en) 1999-08-27 2001-03-08 Japan Science And Technology Corporation Reversible photocoupling nucleic acid and phosphoroamidite
US20020048760A1 (en) 1999-12-10 2002-04-25 Hyseq, Inc. Use of mismatch cleavage to detect complementary probes
CA2396810A1 (en) 2000-01-24 2001-07-26 Phylos, Inc. Sensitive, multiplexed diagnostic assays for protein analysis
WO2001056955A1 (en) 2000-02-03 2001-08-09 Nanoscale Combinatorial Synthesis, Inc. Nonredundant split/pool synthesis of combinatorial libraries
US20020127598A1 (en) 2000-03-27 2002-09-12 Wenqiang Zhou Solution-phase combinatorial library synthesis and pharmaceutically active compounds produced thereby
US7682837B2 (en) 2000-05-05 2010-03-23 Board Of Trustees Of Leland Stanford Junior University Devices and methods to form a randomly ordered array of magnetic beads and uses thereof
EP1290222B1 (en) 2000-05-19 2007-08-08 Richard B. Williams In vitro evolution of nucleic acids and encoded polypeptide
US7244560B2 (en) 2000-05-21 2007-07-17 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
EP1297338B1 (en) 2000-06-05 2007-04-18 Novartis Vaccines and Diagnostics, Inc. Microarrays for performing proteomic analyses
US20020115068A1 (en) 2000-06-23 2002-08-22 Ian Tomlinson Matrix screening method
CA2415098A1 (en) 2000-07-03 2002-01-10 Merck & Co., Inc. Methods for encoding combinatorial libraries
JP2002024382A (en) 2000-07-05 2002-01-25 Nec Corp System and method for medical treatment in home care
WO2002010186A1 (en) 2000-07-27 2002-02-07 California Institute Of Technology A rapid, quantitative method for the mass spectrometric analysis of nucleic acids for gene expression and genotyping
US20020072887A1 (en) 2000-08-18 2002-06-13 Sandor Szalma Interaction fingerprint annotations from protein structure models
US7718600B2 (en) 2000-09-29 2010-05-18 The Trustees Of Princeton University IAP binding compounds
DE10051427C1 (en) * 2000-10-17 2002-06-13 Adam Mueller Process for the production of an extract containing tetrahydrocannabinol and cannabidiol from cannabis plant material and cannabis extracts
WO2002034948A2 (en) 2000-10-25 2002-05-02 City Of Hope Candidate region mismatch scanning for genotyping and mutation detection
JP2002315577A (en) 2000-11-14 2002-10-29 Gencom Co Method for constructing nucleic acid library
US7678554B2 (en) 2001-03-19 2010-03-16 President And Fellows Of Harvard College Nucleic acid shuffling
ATE335754T1 (en) 2001-03-19 2006-09-15 Harvard College DEVELOPMENT OF NEW MOLECULAR FUNCTIONS
WO2002083951A1 (en) 2001-04-10 2002-10-24 Northeastern University Multiplexed ligand/protein binding assays with pna labels
US20040137458A1 (en) * 2001-05-03 2004-07-15 Christian Archambault Molecular tag code for monitoring a product and process using same
AU2003303395A1 (en) 2001-05-22 2004-07-22 Dahl, Gary, A. Target-dependent transcription using deletion mutants of n4 rna polymerase
AU2002312389A1 (en) 2001-06-05 2002-12-16 Irm Llc Functional proteomic profiling
ATE371026T1 (en) 2001-06-20 2007-09-15 Nuevolution As A METHOD FOR SYNTHESIS OF MATTRICE-DEPENDENT MOLECULES
US20060234231A1 (en) 2001-06-20 2006-10-19 Nuevolution A/S Microarrays displaying encoded molecules
WO2004001042A2 (en) 2002-06-20 2003-12-31 Nuevolution A/S Microarrays displaying encoded molecules
WO2002102820A1 (en) 2001-06-20 2002-12-27 Nuevolution A/S Nucleoside derivatives for library preparation
US20040161741A1 (en) 2001-06-30 2004-08-19 Elazar Rabani Novel compositions and processes for analyte detection, quantification and amplification
DE10145226A1 (en) 2001-09-13 2003-04-10 Lifebits Ag Manufacture of carrier-bound molecules
GB0122284D0 (en) 2001-09-14 2001-11-07 Ici Plc Method for roller coating rough surfaces
CA2466164A1 (en) 2001-10-30 2003-05-08 Nanomics Biosystems Pty, Ltd. Device and methods for directed synthesis of chemical libraries
WO2003062417A1 (en) 2002-01-22 2003-07-31 Mitsubishi Chemical Corporation Rna-dna ligation product and utilization thereof
US20070213519A1 (en) 2002-03-01 2007-09-13 Nuevolution A/S Building Block Forming A C=C Double Bond Upon Reaction
AU2002310846B2 (en) 2002-03-08 2008-03-20 Eidgenossische Technische Hochschule Zurich Encoded self-assembling chemical libraries (ESACHEL)
EP2186897B1 (en) 2002-03-15 2016-02-17 Nuevolution A/S An improved method for synthesising templated molecules
WO2003078446A2 (en) 2002-03-15 2003-09-25 Nuevolution A/S A building block forming a c-c or a c-hetero atom bond upon reaction
EP1490384A2 (en) 2002-03-15 2004-12-29 Nuevolution A/S A building block forming a c-c bond upon reaction
EP1487851A2 (en) 2002-03-15 2004-12-22 Nuevolution A/S A building block capable of functional entity transfer to nucleophil
AU2003226008A1 (en) 2002-03-22 2003-10-13 Emory University Template-driven processes for synthesizing polymers and components related to such processes
GB0213816D0 (en) 2002-06-14 2002-07-24 Univ Aston Method of producing DNA and protein libraries
AU2003242516A1 (en) 2002-07-23 2004-02-09 Nuevolution A/S Gene shuffling by template switching
EP1539980B1 (en) 2002-08-01 2016-02-17 Nuevolution A/S Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules
EP1540013B1 (en) 2002-08-19 2015-07-08 The President and Fellows of Harvard College Evolving new molecular function
US20040197845A1 (en) 2002-08-30 2004-10-07 Arjang Hassibi Methods and apparatus for pathogen detection, identification and/or quantification
WO2004024929A2 (en) 2002-09-12 2004-03-25 Nuevolution A/S Proximity-aided synthesis of templated molecules
EP1551986B1 (en) 2002-09-30 2014-08-27 Affymetrix, Inc. Polynucleotide synthesis and labeling by kinetic sampling ligation
ES2368215T3 (en) 2002-10-30 2011-11-15 Nuevolution A/S ENZYMATIC CODING.
EP1576126A3 (en) 2002-10-30 2005-10-26 Pointilliste, Inc. Systems for capture and analysis of biological particles and methods using the systems
AU2003297682A1 (en) 2002-12-03 2004-06-23 Archemix Corporation Method for in vitro selection of 2'-substituted nucleic acids
EP2175019A3 (en) 2002-12-19 2011-04-06 Nuevolution A/S Quasirandom structure and function guided synthesis methods
WO2005003375A2 (en) 2003-01-29 2005-01-13 454 Corporation Methods of amplifying and sequencing nucleic acids
US20070026397A1 (en) 2003-02-21 2007-02-01 Nuevolution A/S Method for producing second-generation library
WO2004074501A2 (en) 2003-02-21 2004-09-02 Nuevolution A/S A method for obtaining structural information about an encoded molecule
JP4054871B2 (en) 2003-02-24 2008-03-05 独立行政法人産業技術総合研究所 Thermostable DNA ligase
US7915201B2 (en) 2003-03-20 2011-03-29 Nuevolution A/S Ligational encoding of small molecules
EP1625230A2 (en) 2003-05-09 2006-02-15 Thorleif Möller Selection and evolution of chemical libraries
WO2004110964A2 (en) 2003-06-16 2004-12-23 Nuevolution A/S Encoded molecules by translation (emt)
WO2005003778A2 (en) 2003-07-02 2005-01-13 Nuevolution A/S A method for identifying a synthetic molecule having affinity towards a target
US20070134662A1 (en) 2003-07-03 2007-06-14 Juswinder Singh Structural interaction fingerprint
EP1533385A1 (en) 2003-09-05 2005-05-25 Nuevolution A/S Templated compounds for generation of encoded molecules and directional methods using such compounds
DE602004023960D1 (en) 2003-09-18 2009-12-17 Nuevolution As Method for obtaining structural information of encoded molecules and for selection of compounds
US7972994B2 (en) 2003-12-17 2011-07-05 Glaxosmithkline Llc Methods for synthesis of encoded libraries
BRPI0417830B1 (en) 2003-12-17 2021-02-17 Praecis Pharmaceuticals Inc methods for synthesizing a molecule comprising a functional portion operably linked to a coding oligonucleotide
WO2005078122A2 (en) 2004-02-17 2005-08-25 Nuevolution A/S Method for enrichment involving elimination by mismatch hybridisation
DK1730277T3 (en) 2004-03-22 2010-03-01 Nuevolution As Coding by ligation using building block oligonucleotides
WO2005116213A2 (en) 2004-04-15 2005-12-08 President And Fellows Of Harvard College Directed evolution of proteins
ZA200704520B (en) 2004-11-08 2008-09-25 Vipergen Aps Structural nucleic acid guided chemical synthesis
EP1828381B1 (en) 2004-11-22 2009-01-07 Peter Birk Rasmussen Template directed split and mix systhesis of small molecule libraries
DE602005022936D1 (en) 2004-12-20 2010-09-23 Genentech Inc PYRROLIDINES AS INHIBITORS OF IAP
WO2006079061A2 (en) 2005-01-21 2006-07-27 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
WO2007008276A2 (en) 2005-05-03 2007-01-18 Ensemble Discovery Corporation Turnover probes and use thereof for nucleic acid detection
WO2006128138A2 (en) 2005-05-26 2006-11-30 Ensemble Discovery Corportion Biodetection by nucleic acid-templated chemistry
US20090163371A1 (en) 2005-05-31 2009-06-25 Stern Andrew M Anchor-Assisted Fragment Selection and Directed Assembly
WO2006135654A2 (en) 2005-06-07 2006-12-21 President And Fellows Of Harvard College Polymer evolution via templated synthesis related applications
DE602006012971D1 (en) 2005-06-07 2010-04-29 Harvard College MEDIATED CHEMISTRY
RU2459869C2 (en) 2005-06-09 2012-08-27 ГЛЭКСОСМИТКЛАЙН ЭлЭлСи Compound containing coding oligonucleotide, production method thereof, library of compounds, production method thereof, method of identifying compound bound with biological target (versions)
WO2006138666A2 (en) 2005-06-17 2006-12-28 President And Fellows Of Harvard College Iterated branching reaction pathways via nucleic acid-mediated chemistry
US20090035824A1 (en) 2005-06-17 2009-02-05 Liu David R Nucleic acid-templated chemistry in organic solvents
WO2007011722A2 (en) 2005-07-15 2007-01-25 President And Fellows Of Harvard College Reaction discovery system
US20090005256A1 (en) 2005-07-29 2009-01-01 Bittker Joshua A Analysis of Encoded Chemical Libraries
CA2626325A1 (en) 2005-10-28 2007-05-10 Praecis Pharmaceuticals Incorporated Methods for identifying compounds of interest using encoded libraries
DE602006018648D1 (en) 2005-12-01 2011-01-13 Nuevolution As ENZYMMETRING CODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES
WO2007124758A1 (en) 2006-05-03 2007-11-08 Vipergen Aps A method for preparing compounds by nucleic acid directed synthesis
WO2008014238A2 (en) 2006-07-24 2008-01-31 Tetralogic Pharmaceuticals Corporation Dimeric iap inhibitors
JP2010503860A (en) 2006-09-18 2010-02-04 アンサンブル ディスカバリー コーポレイション Receptor family profiling
JP2010504983A (en) 2006-09-28 2010-02-18 アンサンブル ディスカバリー コーポレイション Compositions and methods for biological detection by chemistry using nucleic acid templates
US8383370B2 (en) 2007-01-30 2013-02-26 The Rockefeller University Modified RNA ligase for efficient 3′ modification of RNA
US20100159446A1 (en) 2007-07-27 2010-06-24 Haff Lawrence A Detection Assays and Use Thereof
WO2009077173A2 (en) 2007-12-19 2009-06-25 Philochem Ag Dna-encoded chemical libraries
TW201011006A (en) 2008-06-16 2010-03-16 Nuevolution As IAP binding compounds
CN101963939A (en) 2009-07-23 2011-02-02 鸿富锦精密工业(深圳)有限公司 Embedded electronic device and calibration method of program execution in embedded electronic device
JP5330530B2 (en) 2010-01-22 2013-10-30 パナソニック株式会社 Image management apparatus, image management method, program, recording medium, and integrated circuit
DK2558577T3 (en) 2010-04-16 2019-04-01 Nuevolution As Bi-functional complexes and methods for the preparation and use of such complexes

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005785A1 (en) 1988-11-18 1990-05-31 The Regents Of The University Of California Method for site-specifically incorporating unnatural amino acids into proteins
DE19646372C1 (en) 1995-11-11 1997-06-19 Evotec Biosystems Gmbh Conjugates of polypeptide and encoding nucleic acid
WO1998031700A1 (en) 1997-01-21 1998-07-23 The General Hospital Corporation Selection of proteins using rna-protein fusions
WO2000032823A1 (en) 1998-12-02 2000-06-08 Phylos, Inc. Dna-protein fusions and uses thereof
WO2000061775A1 (en) 1999-04-08 2000-10-19 Pavel Sergeev Synthesis of biologically active compounds in cells

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BAIN ET AL.: "Biosynthetic site-specific incorporation of a non-natural amino acid into a polypeptide", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 111, no. 20, 1989, pages 8013 - 8014
GARTNER ET AL.: "The generality of DNA-templated synthesis as a basis for evolving non-natural small molecules", JOURNAL OF AMERICAN CHEMICAL SOCIETY, UNITED STATES, vol. 123, no. 28, 18 July 2001 (2001-07-18), pages 6961 - 6963, XP002265222, DOI: doi:10.1021/ja015873n
KEILER ET AL.: "Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA", SCIENCE; UNITED STATES, vol. 271, no. 5251, 16 February 1996 (1996-02-16), pages 990 - 993, XP002265223, DOI: doi:10.1126/science.271.5251.990
KURZ ET AL.: "cDNA - protein fusions: covalent protein - gene conjugates for the in vitro selection of peptides and proteins", CHEMBIOCHEM - EUROPEAN JOURNAL OF CHEMICAL BIOLOGY, vol. 2, no. 9, 3 September 2001 (2001-09-03), pages 666 - 672, XP002415941, DOI: doi:10.1002/1439-7633(20010903)2:9<666::AID-CBIC666>3.0.CO;2-#
NAZARENKO ET AL.: "Nucleic Acids Research", vol. 25, 1 January 1997, OXFORD UNIVERSITY PRESS, article "A closed tube format for amplification and detection of DNA based energy transfer", pages: 2516 - 2521
NOREN ET AL.: "A general method for site-specific incorporation of unnatural amino acids into protein", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, vol. 244, 14 April 1989 (1989-04-14), pages 182 - 188
YAMANE ET AL.: "Discrimination between D- and L-tyrosyl transfer ribonucleic acids in peptide chain elongation", BIOCHEMISTRY, vol. 20, no. 25, 8 December 1981 (1981-12-08), pages 7059 - 7064

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7727713B2 (en) 2001-06-20 2010-06-01 Nuevolution A/S Templated molecules and methods for using such molecules
US10669538B2 (en) 2001-06-20 2020-06-02 Nuevolution A/S Templated molecules and methods for using such molecules
US10731151B2 (en) 2002-03-15 2020-08-04 Nuevolution A/S Method for synthesising templated molecules
US7413854B2 (en) 2002-03-15 2008-08-19 Nuevolution A/S Method for synthesising templated molecules
US10730906B2 (en) 2002-08-01 2020-08-04 Nuevolutions A/S Multi-step synthesis of templated molecules
WO2004039825A3 (en) * 2002-10-30 2004-10-28 Nuevolution As Method for the synthesis of a bifunctional complex
AU2003273792B2 (en) * 2002-10-30 2011-07-07 Nuevolution A/S Method for the synthesis of a bifunctional complex
US10077440B2 (en) 2002-10-30 2018-09-18 Nuevolution A/S Method for the synthesis of a bifunctional complex
AU2011226815B2 (en) * 2002-10-30 2014-09-25 Nuevolution A/S Enzymatic encoding
US11001835B2 (en) 2002-10-30 2021-05-11 Nuevolution A/S Method for the synthesis of a bifunctional complex
EP2348125A3 (en) * 2002-10-30 2012-07-04 Nuevolution A/S Method for the synthesis of a bifunctional complex
EP2348124A3 (en) * 2002-10-30 2012-03-21 Nuevolution A/S Synthesis of a bifunctional complex
WO2004074501A2 (en) * 2003-02-21 2004-09-02 Nuevolution A/S A method for obtaining structural information about an encoded molecule
WO2004074429A2 (en) * 2003-02-21 2004-09-02 Nuevolution A/S Method for producing second-generation library
WO2004074429A3 (en) * 2003-02-21 2004-09-30 Nuevolution As Method for producing second-generation library
WO2004074501A3 (en) * 2003-02-21 2004-09-30 Nuevolution As A method for obtaining structural information about an encoded molecule
EP2236606A3 (en) * 2003-03-20 2010-10-20 Nuevolution A/S Ligational encoding of small molecules
US7915201B2 (en) 2003-03-20 2011-03-29 Nuevolution A/S Ligational encoding of small molecules
WO2004083427A2 (en) * 2003-03-20 2004-09-30 Nuevolution A/S Ligational encoding of small molecules
WO2004083427A3 (en) * 2003-03-20 2005-02-17 Nuevolution As Ligational encoding of small molecules
US11118215B2 (en) 2003-09-18 2021-09-14 Nuevolution A/S Method for obtaining structural information concerning an encoded molecule and method for selecting compounds
US11965209B2 (en) 2003-09-18 2024-04-23 Nuevolution A/S Method for obtaining structural information concerning an encoded molecule and method for selecting compounds
US7972992B2 (en) 2003-12-17 2011-07-05 Praecis Pharmaceuticals, Inc. Methods for synthesis of encoded libraries
US7972994B2 (en) 2003-12-17 2011-07-05 Glaxosmithkline Llc Methods for synthesis of encoded libraries
US8410028B2 (en) 2003-12-17 2013-04-02 Glaxosmithkline Llc Methods for synthesis of encoded libraries
US7935658B2 (en) 2003-12-17 2011-05-03 Praecis Pharmaceuticals, Inc. Methods for synthesis of encoded libraries
WO2005090566A3 (en) * 2004-03-22 2006-03-09 Nuevolution As Ligational encoding using building block oligonucleotides
WO2005090566A2 (en) * 2004-03-22 2005-09-29 Nuevolution A/S Ligational encoding using building block oligonucleotides
US7704925B2 (en) 2004-03-22 2010-04-27 Nuevolution A/S Ligational encoding using building block oligonucleotides
WO2006079061A3 (en) * 2005-01-21 2006-09-28 Harvard College Free reactant use in nucleic acid-templated synthesis
WO2006079061A2 (en) * 2005-01-21 2006-07-27 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
AU2006206219B2 (en) * 2005-01-21 2012-07-26 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
JP2008528000A (en) * 2005-01-21 2008-07-31 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Free reactants used in nucleic acid template synthesis
CN101107357B (en) * 2005-01-21 2013-01-02 哈佛大学校长及研究员协会 Free reactant use in nucleic acid-templated synthesis
US7989395B2 (en) 2005-10-28 2011-08-02 Glaxosmithkline Llc Methods for identifying compounds of interest using encoded libraries
US11702652B2 (en) 2005-12-01 2023-07-18 Nuevolution A/S Enzymatic encoding methods for efficient synthesis of large libraries
EP3211126B1 (en) 2009-02-13 2020-10-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
EP2396459B1 (en) 2009-02-13 2017-05-03 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
EP2396459A1 (en) 2009-02-13 2011-12-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
CN102317513A (en) * 2009-02-13 2012-01-11 X-化学有限公司 The method in the storehouse of generation and screening DNA coding
EP3653763A1 (en) * 2009-02-13 2020-05-20 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
JP2017201991A (en) * 2009-02-13 2017-11-16 エックス−ケム インコーポレイテッド Method for fabricating and screening dna-coded library
US11168321B2 (en) 2009-02-13 2021-11-09 X-Chem, Inc. Methods of creating and screening DNA-encoded libraries
US9359601B2 (en) 2009-02-13 2016-06-07 X-Chem, Inc. Methods of creating and screening DNA-encoded libraries
US11225655B2 (en) 2010-04-16 2022-01-18 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
EP2748357B1 (en) 2011-09-07 2018-04-04 X-Chem, Inc. Methods for tagging dna-encoded libraries
US10865409B2 (en) 2011-09-07 2020-12-15 X-Chem, Inc. Methods for tagging DNA-encoded libraries
EP3351631B1 (en) 2011-09-07 2020-11-04 X-Chem, Inc. Methods for tagging dna-encoded libraries
EP3392338B1 (en) 2012-07-13 2020-12-09 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
US11674135B2 (en) 2012-07-13 2023-06-13 X-Chem, Inc. DNA-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP2872680B1 (en) 2012-07-13 2018-04-04 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP3083957B1 (en) 2013-12-20 2018-05-23 Philochem AG Production of encoded chemical libraries

Also Published As

Publication number Publication date
AU2003247266A1 (en) 2004-02-23
US20060121470A1 (en) 2006-06-08
WO2004013070A3 (en) 2004-03-25
AU2003247266A8 (en) 2004-02-23
EP1539980A2 (en) 2005-06-15
EP1539980B1 (en) 2016-02-17
US10730906B2 (en) 2020-08-04

Similar Documents

Publication Publication Date Title
US10730906B2 (en) Multi-step synthesis of templated molecules
US7413854B2 (en) Method for synthesising templated molecules
US10669538B2 (en) Templated molecules and methods for using such molecules
EP2305808B1 (en) Templated molecules and methods for using such molecules
KR102242879B1 (en) Methods for tagging dna-encoded libraries
WO2004024929A2 (en) Proximity-aided synthesis of templated molecules
DK1539980T3 (en) Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides that identify the molecules
DK2186897T3 (en) An improved method for the synthesis of templated molecules
ZA200406941B (en) An improved method for synthesising templated molecules.
Class et al. Patent application title: TEMPLATED MOLECULES AND METHODS FOR USING SUCH MOLECULES
JP2005521365A6 (en) An improved method for synthesizing templated molecules.
AU2002315243A1 (en) Templated molecules and methods for using such molecules

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003766117

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003766117

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006121470

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10523006

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10523006

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP