WO2004011676A2 - Multi-reporter gene model for toxicological screening - Google Patents
Multi-reporter gene model for toxicological screening Download PDFInfo
- Publication number
- WO2004011676A2 WO2004011676A2 PCT/GB2003/003192 GB0303192W WO2004011676A2 WO 2004011676 A2 WO2004011676 A2 WO 2004011676A2 GB 0303192 W GB0303192 W GB 0303192W WO 2004011676 A2 WO2004011676 A2 WO 2004011676A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- cell
- protein
- acid construct
- lipocalin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4717—Plasma globulins, lactoglobulin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/30—Bird
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0393—Animal model comprising a reporter system for screening tests
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/41—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Definitions
- the present invention relates to a non-invasive reporter gene system for the detection of gene activation events related to altered metabolic status in vivo or in vitro for use in toxicological screening-.
- Genes encode proteins. It is estimated that there at least 3 x 10 4 genes in the vertebrate genome but for a given cell only a subset of the total number of genes is active, with the subset differing between cells of different types and between different stages of development and differentiation (Cho & Campbell Trends Genet. 16 409-415 (2000); Nelculescu et al Trends Genet. 16 423-425 (2000)).
- the D ⁇ A regulatory elements associated with each gene governs the decision as to which genes are active and which are not. Although comprising a number of defined elements these D ⁇ A sequences are collectively termed promoters (Tjian & Maniatis Cell 11 5-8 (1994); Bonifer, Trends Genet. 16 310-315 (2000); Martin, Trends Genet 17444-448 (2001)).
- Transcriptional activity of a gene may be measured by a variety of approaches including R ⁇ A polymerase activity, mR ⁇ A abundance or protein production (Takano et al., 2002). These approaches are limited in that they require development of an assay suitable to each
- reporter genes are often used (Sun et al.
- the product (mR ⁇ A or protein) of a reporter gene allows an assessment of the transcriptional activity of a particular gene and can be used to distinguish cells, tissues or organisms in which the event has occurred from those in which it has not. On the whole reporter genes are foreign to the host cell or organism, allowing their activity to be easily distinguished from the activity of endogenous genes. Alternatively the reporter may be marked or tagged so as to make it distinct from host genes.
- Reporter genes are linked to the test promoter, enabling activity of the promoter gene to be determined by detecting the presence of the reporter gene product. Therefore, the main prerequisite for a reporter gene product is that it is easy to detect and quantify. In some cases, but not all, the reporter gene has enzymatic activity that catalyses the conversion of a substrate into a measurable product.
- a classical example is the bacterial chloramphenicol acetyl transferase (CAT) gene.
- CAT chloramphenicol acetyl transferase
- CAT activity can be measured in cell extracts as conversion of added non-acetylated chloramphenicol to the acetylated form of chloramphenicol by chromatography (Gorman Mol. Cell. Biol. 2 1044-1051 (1982)). Similar strategies enable the use of the firefly luciferase gene as a reporter. In this instance it is the light produced by bioluminescence of the luciferin substrate that is measured.
- Some reporters also benefit from the visual detection assays that allow in situ analysis of reporter activity.
- a frequently used example would be ⁇ -galactosidase (Lac Z), where the addition of an artificial substrate, X-gal, enables reporter activity to be detected by the appearance of blue colouration in the sample.
- Lac Z ⁇ -galactosidase
- X-gal X-gal
- This reporter is particularly useful for measuring transient responses where a promoter is activated for only a short time before being rapidly inactivated.
- This reporter has been successfully used both in cultured cells and in vivo (Campbell et al J. Cell. Biol. 109 2619-2625 (1996)), though its suitability for in vivo use has been questioned in some reports (Sanchez-Ramnos et al Cell Transplant.
- Lac Z in combination with fluorescent substrates can enable the sorting of cells that express the reporter by use of a fluorescence-activated cell sorter (FACS) (Fiering et al Cytometry 12 291-301 (1991)).
- FACS fluorescence-activated cell sorter
- the reporter product itself is directly detected, removing the need for a substrate.
- Green fluorescent protein has become on of the most commonly used examples of this category of reporter (Ikawa et al Curr. Top. Dev. Biol. 44 1-20 (1997)).
- This autofluorescing protein was derived from the bioluminescent jellyfish Aequo ⁇ a victoria. Several colour spectral variants of this reporter have been developed (Hadjantonakis & Nagy, Histochem. Cell. Biol. 115 49-58 (2001)).
- nucleic acid construct comprising (i) a nucleic acid sequence encoding a member of the lipocalin protein family, and (ii) a nucleic acid sequence encoding a peptide sequence of from 5 to 250 amino acid residues
- the lipocalins are a diverse family of small molecule transporter proteins that share a common conserved gene structure (Flower et al Biochim. Biophys Ada 1482 9-24 (2000)). Members of this family are small in size with the majority falling into the 18- 25kD range. Some are naturally secreted, e.g. ovine betalactoglobulin (BLG) (accession No. X12817), or excreted e.g. murine major urinary protein (MUP) (e.g. accession No. NM 031188) and rat ⁇ -2-urinary globulin ( ⁇ -2u) (accession number
- Lipocalin reporters will preferably be either MUP, BLG or ⁇ -2u but could be chosen from the following list of other lipocalin family members shown in Table 1 :
- the nucleic acid sequences of the present invention also include sequences that are homologous or complementary to those referred to above.
- the percent identity of two nucleic acid sequences is determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the sequence) and comparing the amino acid residues or nucleotides at corresponding positions.
- the "best alignment” is an alignment of two sequences which results in the highest percent identity.
- the determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art.
- An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA (1990) 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
- the NBLAST and XBLAST programs of Altschul et al, J. Mol. Biol. (1990) 215:403-410 have incorporated such an algorithm.
- Gapped BLAST can be utilised as described in Altschul et al, Nucleic Acids Res. (1997) 25:3389-3402.
- PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.).
- the default parameters of the respective programs e.g., NBLAST
- NBLAST the default parameters of the respective programs. See www.ncbi.nlm.nih.gov.
- a nucleic acid sequence which is complementary to a nucleic acid sequence of the present invention is a sequence which hybridises to such a sequence under stringent conditions, or a nucleic acid sequence which is homologous to or would hybridise under stringent conditions to such a sequence but for the degeneracy of the genetic code, or an oligonucleotide sequence specific for any such sequence.
- the nucleic acid sequences include oligonucleotides composed of nucleotides and also those composed of peptide nucleic acids.
- the fragment may be at least any ten consecutive nucleotides from the gene, or for example an oligonucleotide composed of from 20, 30, 40, or 50 nucleotides.
- Stringent conditions of hybridisation may be characterised by low salt concentrations or high temperature conditions.
- highly stringent conditions can be defined as being hybridisation to DNA bound to a solid support in 0.5M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), lmM EDTA at 65°C, and washing in O.lxSSC/
- Hybridisation can also be made more stringent by the addition of increasing amounts of formamide to destabilise the hybrid nucleic acid duplex. Thus particular hybridisation conditions can readily be manipulated, and will generally be selected according to the desired results. In general, convenient hybridisation temperatures in the presence of 50% formamide are 42°C for a probe which is 95 to 100% homologous to the target DNA, 37°C for 90 to 95% homology, and 32°C for 70 to 90% homology.
- nucleic acid sequences for use in according to the various aspects of the present invention are the sequences of the invention are disclosed herein.
- Complementary or homologous sequences may be 75%, 80%, 85%, 90%, 95%, 99% similar to such sequences.
- peptide tags to a chosen lipocalin reporter there is provided a useful sub-family of reporter proteins. Essentially it allows generation of a large number of reporters from a single lipocalin where that lipocalin acts as the carrier for a range of peptides that can be clearly differentiated from one another by a range or biological or physical assay techniques.
- a casein kinase recognition sequence engineered in exon 3 of the ovine betalactoglobulin (BLG) gene resulted in expression of a novel form of BLG containing an active kinase substrate in one of the surface loops of the protein in transgenic mice (McClenaghan et al Protein Eng. 12259-264 (1999)).
- the position of the peptide tag may be at the amino terminal or carboxy terminal or inserted internally with respect to the amino acid sequence of the reporter. All three examples are represented in Figure 1.
- the peptide tag can be a sequence consisting of between 5 to 250 amino acids. Suitably, in the ranges of from, 5 to 50, 10 to 60, 20 to 70, 30 to 80, 40 to 90, and so on. In some embodiments of the invention peptides may be required to consist of a greater number of amino acids than 250 residues.
- the peptide tag may be an epitope, that is a defined amino acid sequence from a protein with a fully characterised cognate antibody. The skilled person can select such epitopes based on sequences identified as possessing antigenic properties.
- the epitope tag may be the amino acid sequence below from the c-myc oncogene (Evans et al Mol.
- the epitope may be selected from but not limited to the c-myc and N5 proteins.
- epitopes may include, but are not limited to:
- the epitope tag is recognised by its cognate antibody irrespective of whether it is located at the amino terminal, carboxy terminal or in an internal domain of the reporter protein.
- the peptide tag may possess enzymatic activity that converts a substrate to a form that is readily detectable by an assay.
- a kinase activity specifying phosphorylation of another protein or peptide substrate that could be added to the secreted or excreted analyte along with a phosphate group donor. Detection could be achieved using an immunological assay based on detection by an antibody specifically recognising the phosphorylated version of the tagged reporter protein.
- phosphate radiolabelled with an isotope of phosphorous such as 32 P or 33 P.
- Other enzymic modifications include for example acetylation, sulphation and glycosylation.
- peptide tag that is an enzyme, that is the construct comprises a nucleic acid sequence encoding an enzyme, or a nucleic acid sequence encoding a catalytic sequence thereof, such as Glutathoine-S-transferase (GST) where enzyme activity can be detected by means of an activity assay or by antibody reactivity.
- GST Glutathoine-S-transferase
- the nucleic acid sequence encoding the member of the lipocalin protein family is contiguous with the nucleic acid sequence encoding the peptide sequence.
- a linker nucleic acid sequence may be inserted between these two sequences that encodes a short number of amino acids.
- the nucleic acid construct may additionally comprise a promoter element upstream of the nucleic acid encoding the member of the lipocalin protein family.
- the promoter element may be an inducible promoter, preferably a stress inducible promoter. It is also within the scope of the present invention for the nucleic acid construct to include more than one detectable peptide label. Such as for example, a peptide antigen and an enzyme (or an active catalytic site thereof). One possible combination is the peptide epitope c-myc and the enzyme GST.
- inventions of this aspect could include, for example site of interaction with protein other than antibody e.g. lectin binding site, or modification of tag by e.g. addition of amino acid multimer such as polylysine; or incorporation of a fluorochrome.
- the peptide sequence may be as described above but it also extends to peptides and polypeptides that are substantially homologous thereto.
- polypeptide includes both peptide and protein, unless the context specifies otherwise.
- Such peptides include analogues, homologues, orthologues, isoforms, derivatives, fusion proteins and proteins with a similar structure or are a related polypeptide as herein defined.
- analogue refers to a peptide that possesses a similar or identical function as a peptide coded for by a nucleic acid sequence of the invention but need not necessarily comprise an amino acid sequence that is similar or identical to an amino acid sequence of the invention, or possess a structure that is similar or identical to that of a peptide of the invention.
- an amino acid sequence of a peptide is "similar" to that of a peptide of the invention if it satisfies at least one of the following criteria: (a) the peptide has an amino acid sequence that is at least 30%
- the peptide is encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding at least 5 amino acid residues (more preferably, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues, or at least 150 amino acid residues) of a peptide sequence of the invention; or
- a peptide with "similar structure" to that of a peptide of the invention refers to a peptide that has a similar secondary, tertiary or quaternary structure as that of a peptide of the invention.
- the structure of a peptide can determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy.
- fusion protein refers to a peptide that comprises (i) an amino acid sequence of a peptide of the invention, a fragment thereof, a related peptide or a fragment thereof and (ii) an amino acid sequence of a heterologous peptide ( . e. , not a peptide sequence of the present invention).
- homologue refers to a peptide that comprises an amino acid sequence similar to that of a protein of the invention but does not necessarily possess a similar or identical function.
- orthologue refers to a peptide that (i) comprises an amino acid sequence similar to that of a protein of the invention and (ii) possesses a similar or identical function.
- related peptide refers to a homologue, an analogue, an isoform of , an orthologue, or any combination thereof of a peptide of the invention.
- derivative refers to a peptide that comprises an amino acid sequence of a peptide of the invention which has been altered by the introduction of amino acid residue substitutions, deletions or additions. The derivative peptide possess a similar or identical function as peptides of the invention.
- fragment refers to a peptide comprising an amino acid sequence of at least 5 amino acid residues (preferably, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues) of the amino acid sequence of a peptide of the invention.
- amino acid residues preferably, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues
- isoform refers to variants of a peptide that are encoded by the same gene, but that differ in their isoelectric point (pi) or molecular weight (MW), or both. Such isoforms can differ in their amino acid composition (e.g. as a result of alternative splicing or limited proteolysis) and in addition, or in the alternative, may arise from differential post-translational modification (e.g., glycosylation, acylation, phosphorylation). As used herein, the term “isoform” also refers to a protein that peptide exists in only a single form, i.e., it is not expressed as several variants.
- the percent identity of two amino acid sequences or of two nucleic acid sequences is determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the sequence) and comparing the amino acid residues or nucleotides at corresponding positions.
- the "best alignment" is an alignment of two sequences which results in the highest percent identity.
- the determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art.
- An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA (1990) 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
- Gapped BLAST can be utilised as described in Altschul et al, Nucleic Acids Res. (1997) 25:3389-3402.
- PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.).
- BLAST Altschul et al.
- Gapped BLAST Altschul et al.
- PSI-Blast programs the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.
- amino acids have similar properties.
- One or more such amino acids of a substance can often be substituted by one or more other such amino acids without eliminating a desired activity of that substance.
- the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains).
- amino acids having aliphatic side chains amino acids having aliphatic side chains.
- glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic).
- amino acids which can often be substituted for one another include: phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); lysine, arginine and histidine (amino acids having basic side chains); aspartate and glutamate (amino acids having acidic side chains); asparagine and glutamine (amino acids having amide side chains); and cysteine and methionine (amino acids having sulphur containing side chains). Substitutions of this nature are often referred to as “conservative" or “semi- conservative" amino acid substitutions.
- Amino acid deletions or insertions may also be made relative to the amino acid sequence of a peptide sequence of the invention.
- amino acids which do not have a substantial effect on the biological activity or immunogenicity of such peptides, or at least which do not eliminate such activity may be deleted.
- Amino acid insertions relative to the sequence of peptides of the invention can also be made . This may be done to alter the properties of a peptide of the present invention (e.g. to assist in identification, purification or expression.
- Such amino acid changes relative to the sequence of a polypeptide of the invention from a recombinant source can be made using any suitable technique e.g. by using site-directed mutagenesis.
- the promoter will preferably be of mammalian origin, but also may be from a non-mammalian animal, plant, yeast or bacteria.
- the promoter may be selected from but is not limited to promoter elements of the following inducible genes:
- the sequence can be selected from but not limited to the group consisting of c-myc (Hoffman et al Oncogene 21 3414- 3421), p21/WAF-l (El-Diery Curr. Top. Microbiol. Immunol. 227 121-137 (1998); El-Diery Cell Death Differ. 8 1066-1075 (2001); Dotto Biochim. Biophys. Acta 1471 43-56 (2000)), MDM2 (Alarcon-Nargas & Ronai Carcinogenesis 23 541-547 (2002); Deb & Front Bioscience 7 235-243
- the sequence can be selected from but not limited to the group consisting of MnSOD and/or CuZnSOD (Halliwell Free Radic. Res. 31 261-272 (1999); Gutteridge & Halliwell Ann. NY Acad. Sci. 899 136-147 (2000)), I B (Ghosh & Karin Cell
- the sequence can be selected from but not limited to the group consisting of Lrg-21 (Drysdale et al Mol. Immunol. 33 989-998 (1996)), SOCS-2 and/or SOCS-3 (Tollet-Egnell et al Endocrinol. 140 3693-3704 (1999), PAI-1 (Fink et al Cell. Physiol. Biochem. 11 105-114 (2001)), GBP28/adiponectin (Yoda-Murakami et al Biochem. Biophys. Res. Commun. 285 372-377 (2001)), ⁇ -1 acid glycoprotein (Komori et al Biochem Pharmacol.
- the sequence can be selected from but not limited to the group consisting of Gadd 34 (Hollander et al J. Biol. Chem. 272 13731-13737 (1997)), GAHSP40
- the sequence can be selected from but not limited to the list comprised of xenobiotic metabolising cytochrome p450 enzymes from the 2A, 2B, 2C, 2D, 2E, 2S, 3 A, 4A and 4B gene families (Smith et al Xenobiotica 28 1129-
- the promoter element may also be a synthetic promoter sequence comprised of a minimal eukaryote consensus promoter operatively linked to one or more sequence elements known to confer transcriptional inducibility in response to specific stimulus.
- a minimal eukaryotic consensus promoter is one that will direct transcription by eukaryotic polymerases only if associated with functional promoter elements or transcription factor binding sites. An example of which is the PhCMN*-l (Furth et al Proc. Nat'l Acad. Sci. USA 91 9302-9306 (1994)).
- Sequence elements known to confer transcriptional induction in response to specific stimulus include promoter elements (Montoliu et al Proc. Nat'l Acad. Sci.
- transcription factor binding sites these will be chosen from but are not limited to the list comprising the aryl hydrocarbon (Ah)/Ah nuclear translocator (AR ⁇ T) receptor response element, the antioxidant response element (ARE), the xenobiotic response element (XRE).
- Ah aryl hydrocarbon
- AR ⁇ T nuclear translocator
- ARE antioxidant response element
- XRE xenobiotic response element
- a nucleic acid construct according to the invention may suitably be inserted into a vector which is an expression vector that contains nucleic acid sequences as defined above.
- vector or “expression vector” generally refers to any nucleic acid vector which may be R ⁇ A, D ⁇ A or cD ⁇ A.
- expression vector may include, among others, chromosomal, episomal, and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SN40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
- any vector suitable to maintain, propagate or express nucleic acid to express a polypeptide in a host may be used for expression in this regard.
- Recombinant expression vectors will include, for example, origins of replication, a promoter preferably derived from a highly expressed gene to direct transcription of a structural sequence as defined above, and a selectable marker to permit isolation of vector containing cells after exposure to the vector.
- Expression vectors may comprise an origin of replication, a suitable promoter as defined above and/or enhancer, and also any necessary ribosome binding sites, polyadenylation regions, splice donor and acceptor sites, transcriptional termination sequences, and 5'- flanking non-transcribed sequences that are necessary for expression.
- Preferred expression vectors according to the present invention may be devoid of enhancer elements.
- the expression vectors may also include selectable markers, such as antibiotic resistance, which enable the vectors to be propagated.
- a nucleic acid construct comprising a stress inducible promoter operatively isolated from a nucleic acid sequence encoding a member of the lipocalin protein family by a nucleotide sequence flanked by nucleic acid sequences recognised by a site specific recombinase, or by insertion such that it is inverted with respect to the transcription unit encoding a member of the lipocalin protein family.
- the recombinase recognition sites are arranged in such a way that the isolator sequence is deleted or the inverted promoter's orientation is reversed in the presence of the recombinase.
- the construct also comprises a nucleic acid sequence comprising a tissue specific promoter operatively linked to a gene encoding the coding sequence for the site specific recombinase.
- Stress inducible promoters may be as described in relation to the first aspect of the invention. This aspect allows for detecting reporter transgene induction in specified tissues only. By controlling the appropriate recombinase expression using a tissue specific promoter, the inducible transgene will only be viable in those tissues in which the promoter is active. For example, by driving recombinase activity from a liver specific promoter, only the liver will contain re-arranged reporter construct, and hence will the only tissue in which reporter induction can occur.
- Tissue specific promoters are a class of gene promoters whose function is restricted solely (or more usually, maily) to a particular cell type or tissue.
- tissue specific promoters are as follows (although, the invention is not limited as such):
- the recombination event producing an active reporter transcription unit may therefore only take place in tissues where the recombinase is expressed. In this way the reporter may only be expressed in specified tissue types where expression of the recombinase results in a functional transcription unit comprised of the inducible promoter linked to the promoter.
- Site specific recombinase systems know to perform such a function include the bacteriophage PI cre-lox and the bacterial FLIP systems. The site specific recombinase sequences may therefore be two loxP sites of bacteriophage PI
- Cre lox system is exemplified below, but other site- specific recombinase systems could be used.
- a construct used in the Cre lox system will usually have the following three functional elements:
- a negative selectable marker e.g. Herpes simplex virus thymidine kinase (TK) gene
- TK Herpes simplex virus thymidine kinase
- a host cell transfected with a nucleic acid construct according to any one of the previous aspects of the invention.
- the cell type is preferably of human or non-human mammalian origin but may also be of other animal, plant, yeast or bacterial origin.
- HEPA1-6 mouse hepatoma epithelial cells
- COS-1 African green monkey fibroblasts
- CHO Chinese hamster ovary epithelial cells
- MCF7 human breast adenocarcinoma epithelial-like cells
- HeLa human cervical carcinoma epithelial cells
- HEP G2 human hepatocyte carcinoma epithelial cells; PC3, human prostate adenocarcinoma epithelial cells; A2780, human ovarian carcinoma epithelial cells.
- Introduction of an expression vector into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, infection of other methods.
- Such methods are described in many standard laboratory manuals, such as Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
- the non-human animal is a non-human mammal.
- the transgenic animal is preferably a mouse but may be another mammalian species, for example another rodent, e.g. a rat or a guinea pig, or another species such as rabbit, or a canine or feline, or an ungulate species such as ovine, porcine, equine, caprine, bovine, or a non-mammalian animal species, e.g. an avian (such as poultry, e.g. chicken or turkey).
- the cell or non-human animal may be subjected to further transgenesis, in which the transgenesis is the introduction of an additional gene or genes or protein-encoding nucleic acid sequence or sequences.
- the transgenesis may be transient or stable transfection of a cell or a cell line, an episomal expression system in a cell or a cell line, or preparation of a transgenic non-human animal by pronuclear microinjection, through recombination events in embryonic stem (ES) cells or by transfection of a cell whose nucleus is to be used as a donor nucleus in a nuclear transfer cloning procedure.
- ES embryonic stem
- Methods of preparing a transgenic cell or cell line, or a transgenic non human animal in which the method comprises transient or stable transfection of a cell or a cell line, expression of an episomal expression system in a cell or cell line, or pronuclear microinjection, recombination events in ES cells, or other cell line or by transfection of a cell line which may be differentiated down different developmental pathways and whose nucleus is to be used as the donor for nuclear transfer; wherein expression of an additional nucleic acid sequence or construct is used to screen for transfection or transgenesis in accordance with the first, second, third, or fourth aspects of the invention.
- Examples include use of selectable markers conferring resistance to antibiotics added to the growth medium of cells, e.g.
- neomycin resistance marker conferring resistance to G418 Further examples involve detection using nucleic acid sequences that are of complementary sequence and which will hybridise with, or a component of, the nucleic acid sequence in accordance with the first, second, third, or fourth aspects of the invention. Examples would include Southern blot analysis, northern blot analysis and PCR. According to the fifth aspect of the invention, there is provided the use of a nucleic acid construct in accordance with any one of the first, second, third, or fourth aspects of the invention for the detection of a gene activation event resulting from a change in altered metabolic status in a cell in vitro or in vivo.
- the gene activation event may be the result of induction of toxicological stress, metabolic changes, or disease that may be, but is not limited to, the result of viral, bacterial, fungal or parasitic infection.
- nucleic acid construct comprising a nucleic acid sequence encoding a member of the lipocalin protein family, wherein said lipocalin protein is heterologous to the cell in which it is expressed, for the detection of a gene activation event resulting from a change in altered metabolic status in a cell in vitro or in vivo.
- the gene- activation event may be the result of induction of toxicological stress, metabolic changes, disease that may be, but is not limited to, the result of viral, bacterial, fungal or parasitic infection.
- Uses in accordance with the fifth and sixth aspects of the invention also extend to the detection of disease states or characterisation of disease models in a cell, cell line or non human transgenic animal where a change in the gene expression profile within a target cell or tissue type is altered as a consequence of the disease.
- Diseases in the context of this aspect of the invention which are detectable under the methods disclosed may be defined as infectious disease, cancer, inflammatory disease, cardiovascular disease, metabolic disease, neurological disease and disease with a genetic basis.
- An additional use in accordance with this aspect of the invention involves the growth of a transfected cell line in accordance with the third aspect in a suitable immunocompromised mouse strain (referred to as a xenograft), for example, the nude mouse, wherein an alteration in the expression of the reporter described in the first or second aspects of the invention may be used as a measure of altered metabolic status of the host as a result of toxicological stress, metabolic changes, disease with a genetic basis or disease that may be, but is not limited to, the result of viral, bacterial, fungal or parasitic infection.
- the scope of this use may also be of use in monitoring the effects of exogenous chemicals or drugs on the expression of the reporter construct.
- the fifth and sixth aspects of the invention extend to methods of detecting a gene activation event in vitro or in vivo.
- the method comprises assaying a host cell stably transfected with a nucleic acid construct in accordance with any one of the first or second aspects of the invention, or a transgenic non-human animal according to the fourth aspect of the invention, in which the cell or animal is subjected to a gene activation event that is signalled by expression of a peptide tagged lipocalin reporter gene.
- the method comprises assaying a host cell stably transfected with a nucleic acid construct comprising a nucleic acid sequence encoding a member of the lipocalin protein family, wherein said lipocalin protein is heterologous to the cell in which it is expressed, or a transgenic non-human animal whose cells express such a construct, in which the cell or animal is subjected to a gene activation event that is signalled by expression of a peptide tagged lipocalin reporter gene.
- Toxicological stress may be defined as DNA damage, oxidative stress, post translational chemical modification of cellular proteins, chemical modification of cellular nucleic acids, apoptosis, cell cycle arrest, hyperplasia, immunological changes, effects consequent to changes in hormone levels or chemical modification of hormones, or other factors which could lead to cell damage.
- a method for screening and characterising viral, bacterial, fungal, and parasitic infection comprising the use of a cell, cell line or non human animal which has been transfected with or carries a nucleic acid construct as described above.
- a method for screening for cancer, inflammatory disease, cardiovascular disease, metabolic disease, neurological disease and disease with a genetic basis comprising the use of a cell, cell line or non human animal which has been transfected with or carries a nucleic acid construct as described above.
- the cell may be transiently transfected, maintaining the nucleic acid construct as described above episomally and temporarily.
- cells are stably transfected whereby the nucleic acid construct is permanently and stably integrated into the transfected cells' chromosomal DNA.
- transgenic animal is defined as a non human transgenic animal with the nucleic acid construct as defined above preferably integrated into its genomic DNA in all or some of its cells.
- Expression of the peptide tagged lipocalin protein in respect of the fifth aspect of the invention can be assayed for by measuring levels of the lipocalin protein in cell culture medium or purified or partially purified fractions thereof.
- Lipocalins are known to be secreted into body fluids and some are known to be eliminated in urine.
- Expression of the peptide tagged lipocalin protein in accordance with the fourth aspect of the invention therefore can be assayed for by measuring levels of lipocalin secreted into harvestable body fluids.
- the body fluid will be urine, but may also be selected from the list including milk, saliva, tears, semen, blood and cerebrospinal fluid, or purified or partially purified fractions thereof.
- Detection and quantification of the tagged lipocalins secreted from cultured cells into tissue culture medium or transgenic non-human animal body fluid may be achieved using a number of methods known to those skilled in the art:
- the assay may be an ELISA whereby an antibody or antiserum containing a single or mixture of antibodies recognising either the lipocalin reporter itself or the peptide tag attached to and is used as a capture antibody to coat a microtitre plate or other medium suitable for conducting the assay.
- the culture medium or body fluid containing the reporter gene product (analyte) is added to the microtitre plate to allow binding of the analyte.
- Addition of the same antibody or antiserum that has been conjugated to an enzyme, commonly horseradish peroxidase is used as a second antibody.
- Addition of a suitable substrate, preferably one producing a colour product following conversion by the enzyme is used to quantify the analyte in proportion to how much second antibody conjugate has been bound.
- tissue culture medium or the body fluid (analyte) sample containing the tagged lipocalin is bound to a support suitable for conducting the assay.
- a limited standard amount of antibody specifically recognising the reporter gene product is added to a separate aliquot of the same and allowed to bind. This is added to the analyte bound to the support to allow remaining free antibody to bind.
- a second, enzyme conjugated antibody against for example the Fc region of the first antibody is allowed to bind and the colorimetric readout can be used to quantify the analyte whereby the degree of colour change is inversely proportional to the level of analyte in the sample.
- the membranes were blocked for 1 hour in blocking buffer (5% NFDM w/v in PBS) then incubated with myc mAb (Invitrogen Life Technologies, Carlsbad, CA) diluted in blocking buffer for 2 hours with continuos agitation. After a series of washes in PBST (PBS plus 0.05% Tween-20), the membrane was incubated in an anti-mouse antibody conjugated to
- Detection of conversion of substrate due to enzymatic activity of the lipocalin reporter protein produced The nature of substrate conversion may or may not fall into one or more of the following event categories: Proteolysis, phosphorylation, acetylation, sulphation, methylation 3. Detection of multiple substrates. Where a multiple of lipocalin reporter proteins are used methods suitable for detection of such events could include but not necessarily be limited to:
- a method of detecting a reporter gene activation event comprising the steps of:
- a suitable assay to determine the level expression of the tagged lipocalin reporter for example using detection methods such as ELISA, RIA, Mass spectrometry, NMR, telemetric methods.
- the detectable lipocalin protein may be a heterologous protein to the cell in which the nucleic acid construct is expressed.
- Such an "untagged" lipocalin reporter protein may not therefore need a peptide or protein tag for detection.
- Methods and uses in accordance with the present invention offer significant advances in investigating any area in which modified gene expression plays a significant role.
- Such peptide tagged lipocalin genes will be of use in cells and transgenic animals to detect activity of selected genes. Specific applications include but are not restricted to:
- FIGURE 1 shows the position of the peptide tag at the amino terminal or carboxy terminal or inserted internally with respect to the amino acid sequence of the lipocalin reporter protein
- FIGURE 2 shows the plasmid map for p l ATBLG
- FIGURE 3 shows the plasmid map for pXC3 'MycMUP
- FIGURE 4 shows the plasmid map for pcDNA.3'mycMUP
- FIGURE 5 shows the plasmid map for pX4T.3'MYCMUP
- FIGURE 6 shows the results of expression of Myc tagged MUP
- FIGURE 7 shows the DNA and amino acid sequences of the MUP clone Mmup9a.
- the 18 amino acid secretion signal peptide is shown in bold (amino acid residues 1 to 18).
- FIGURE 8 shows the DNA and amino acid sequence of the recombinant mMUP reporter molecule.
- the protein contains a sixteen amino acid N- terminal addition, comprising of 6 amino acids from the pGEX vector (italics - amino acid residues 1 to 6) and the c-myc epitope (shown in bold - amino acid residues 7 to 16).
- FIGURE 9 shows the DNA and amino acid sequence of the recombinant BLGm reporter molecule.
- the protein contains a six amino acid N-terminal addition from the pGEX vector (italics - amino acid residues 1 to 6) and the C- terminal c-myc epitope (bold - amino acid residues 170 to 179).
- FIGURE 10 shows (a) Western blot of GST-BLGm fusion protem. Lanes 1 to 6 show fractions eluted from a glutathione-agarose column. Lane C, mMUP protein control, (b) Western blot of GST-MUPm fusion protein. Lanes 1 to 7 show fractions eluted from glutathione-agarose column. Blots were probed using 9E10 anti-myc antibody directly conjugated to HRP (Roche).
- FIGURE 11 shows Western blot analysis of urine samples (15 ⁇ l) collected from mice, following injection with either (A) vehicle or recombinant mMUP (2.5mg/kg); or (B) recombinant mMUP (5 and lOmg kg). Blots were probed with anti-myc antibody. Uninjected recombinant GSTmMUP ( ⁇ 45kDa, open arrow) was included as a positive control (right hand lane). The closed arrow indicates the position of the ⁇ 18kDa rnMUP control band.
- FIGURE 12 shows Western blot analysis of urine samples taken at various time points (in hours) and plasma (P) at 24 hours from mice that had been injected with recombinant GST-BLGm and GST-mMUP. Blots were probed with an anti-GST antibody. Arrow indicates the expected size of the band corresponding to GST-mMUP protein.
- FIGURE 13 shows the 3-dimensional solution structure of MUP.
- the antiparallel ⁇ -sheets are shown in brown, and the loop regions in blue.
- the EF loop is marked, as is the FG loop. Red lines indicate amino acid positions where the internal restriction site additions were made.
- FIGURE 14 shows antibody detection of epitope tagged MUP reporter proteins:
- HA Haemaglutinin
- tagged MUP protein was expressed in E. coli, and extracts from induced (Lane 1) and uninduced (Lane 2) cells analysed by western blotting using an anti-HA antibody (3F10, Roche) HRP-conjugated second antibody and ECL detection (Amersham).
- Lane 3 contains molecular size markers. A specific band of the expected size is seen for the HA-tagged GST-MUP fusion protein;
- B ERB tagged MUP protein was expressed in E.
- ERB-tagged GST-MUP fusion protein Extensive photo-bleaching is seen in Lane 1, due to the amount of protein present.
- FIGURE 15 shows modified MUP proteins produced from the pSecTag vector. The various modifications made to the wild-type MUP protein sequence
- FIGURE 16 shows results of pSecTag MUP constructs that were transfected into A2780 cells using Fugene, and the medium (50 ⁇ l) directly examined for secreted protem by Western blotting, using anti-myc antibody 9E10.
- Lane C recombinant mMUP control
- Lane 1, pSML.iclOO Lane 2, pSML; Lane 3, pSM; Lane 4, pSecmMUP.
- Several protein bands are present in the pSecmMUP medium, due to the presence of multiple start sites in the 5'-region of this construct.
- FIGURE 17 shows analysis of mouse urine containing either GST or GST- mMUP, together with GST or GST-mMUP in phosphate buffered saline (PBS) for GST enzymic activity.
- concentration of all proteins was lOO ⁇ g ml.
- the graph shows GST enzymic activity, as absorbance (340nm) versus time, relative to the absorbance at the 30 second timepoint.
- FIGURE 18 shows the nucleotide sequence for ovine betalactoglobulin (BLG)
- FIGURE 19 shows the amino acid sequence for ovine betalactoglobulin (BLG) coded for by the nucleotide sequence of Figure 16.
- FIGURE 20 shows the cDNA encoding the mRNA of murine major urinary protein 1 (Mupl), (Accession no. NM 031188), ), available from www.ncbi.nlm.nih.gov/entrz, published Lucke et al Eur. J. Biochem.266 (3),
- FIGURE 21 shows the amino acid sequence for murine major urinary protein coded for by the nucleotide sequence of Figure 18.
- FIGURE 22 shows the cDNA sequence encoding the mRNA of rat alpha-2-u globulin (accession no. M27434) ), available from www.ncbi.nlm.nih.gov/entrz, published by Roy et al J. Steroid Biochem.21 (4-6), 1129-1134 (1987)
- FIGURE 23 shows the GST coding sequence derived from pGEX6p-l. The GST coding sequence is nucleotide residues 241-917. The residues highlighted in bold
- protease cleavage site allows for the production of cleaved myc- tagged proteins from the GST fusion proteins as described in Example 6.
- the ⁇ lAT promoter (350bp) was excised from alAT/CAT (Yull et al Transgenic Res. 4 70-74 (1995)) as a HindHI Smal fragment and inserted into pBlue ⁇ lAT. Digestion of this with EcoRN and Xhol allowed direct insertion of the ⁇ lAT promoter into pXen ⁇ .S (Simon Temperley, CXR Biosciences) digested with the same enzymes. The microinjection fragment was purified after digestion of the plasmid with p ⁇ lATBLG (shown in Figure 2).
- pXAM4 CXR Biosciences
- pXAM4 was previously constructed by inserting a PCR generated fragment containing the CMN promoter as a BamHl-XhoI fragment into a pSP72 (Promega) multiple cloning site which had been modified by addition of a linker which added restriction sites allowing insertion of additional fragments downstream of the CMN promoter sequence.
- Example 3 Preparation of pXC3'MvcMUP A 2.5kb D ⁇ A fragment encompassing the murine CyplAl promoter and upstream sequences was inserted into SstU/XhoI digested pX4T.3'MycMUP (Thomas McCartney, CXR Biosciences) to engineer a reporter vector capable of expressing COOH terminally c-Myc tagged MUP upon induction of the CYPIAI promoter using a suitable inducing agent, if the construct is used to transfect a suitable cell line or to generate a transgenic animal.
- a DNA fragment encompassing the COOH terminally c-Myc tagged MUP was excised from pX4T.3'Myc (Thomas McCartney, CXR Biosciences) to engineer an expression vector capable of constitutive expression of c-Myc tagged MUP if used to transfect a suitable cell line or to generate a transgenic animal.
- Hepal-6 cells in a T-25 flask using 6ug of DNA in accordance with the protocol supplied with Lipofectamine transfection reagent (Invitrogen).
- Cells and 5ml of medium were harvested 48 hours post-transfection.
- Total protein from the cell pellets was obtained using 1ml TRI reagent (Sigma) per pellet in accordance with directions.
- Cellular protein was further purified using the PlusOne SDS-PAGE Clean-Up Kit (Amersham) in accordance with directions.
- protein was purified from lOO ⁇ l samples of growth medium from each transfected cell batch using the PlusOne SDS-PAGE Clean-Up Kit in accordance with directions.
- Recombinant MUP and BLG were expressed in E.coli using the pGEX vector system (Amersham Bioscience), which expresses all inserted sequences as a C-terminal fusion protein with vector encoded glutathione-S-transferase (GST). GST may be removed from the inserted fusion partner via a specific proteolytic cleavage site located at the C terminal end of GST.
- GST vector encoded glutathione-S-transferase
- GST may be removed from the inserted fusion partner via a specific proteolytic cleavage site located at the C terminal end of GST.
- a MUP clone, Mmup9a was derived from mouse liver RNA by RT-PCR, and the identity confirmed by sequencing ( Figure 7). This clone, Mmup9a, is almost identical (536/537 bases) to the MusMupl type I MUP clone (M16355, Genbank).
- the MUP coding sequence minus the N-terminal 18 amino acid signal peptide, was rederived from clone Mup9a, by PCR as an Ncol-Xhol fragment, and cloned into the E. coli expression vector pGEX-6PB (derived from pGEX-6P-l, Amersham Bioscience) to produce pGEX-MUP.
- pGEX-6PB derived from pGEX-6P-l, Amersham Bioscience
- a synthetic linker oligonucleotide was then used to add the c- myc epitope sequence, as an Ncol-Ncol fragment, to the 5 '-end of the MUP coding sequence to give pGEX-mMUP.
- pCD3'mycBLG containing the BLG precursor protein cDNA fused with a C-terminal myc epitope tag
- BLG cDNA clone pBlacD Roslin Institute
- pGEX-mMUP and pGEX-BLGm were then used to produce recombinant GST fusion proteins in E. coli DH5 ⁇ , and the GST fragments removed by protease treatment (PreScission Protease, Amersham Bioscience) to generate N-terminally myc-tagged MUP (mMUP - Figure 8) and C-terminally myc-tagged BLG (BLGm - Figure 9) lipocalin reporter proteins respectively. Purification of recombmant protein was achieved via affinity chromatography following the manufacturers recommended protocols (Amersham Bioscience).
- recombinant epitope-tagged mMUP lipocalin protein was injected i.v. into male CDI mice (3 doses, 2.5mg/kg, 5mg kg and lOmg kg with 3 mice per group, via the tail vein).
- a control group were also injected with the vehicle solution (isotonic sterile saline).
- urine samples were collected from mice, by scruffing, at approximately 30 minute time intervals over a 6h period. Mice were sacrificed after 24 hours and urine and serum samples taken.
- Urine was analysed by SDS PAGE, followed by western transfer to nitrocellulose membrane (Hybond ECL, Amersham Bioscience) and probed with HRP-conjugated anti-myc antibody (9E10, Roche) and detected with the ECL detection kit (Amersham Bioscience).
- the difference in excretion profiles between GST-mMUP fusion protein (45kDa mol. weight) and mMUP ( ⁇ 18kDa mol. weight) could reflect a difference in the physiological processing of the former (e.g. reabsorption via the kidney into the plasma) or less efficient excretion.
- a choice of non-invasive reporter molecule whose excretion characteristics differ in such a manner could prove useful, depending on whether a persistent readout or a more rapidly decaying, and thus responsive, signal are required.
- Example 8 Epitope tagging of lipocalin reporter protein MUP and BLG lipocalin reporter proteins have been successfully tagged with ⁇ - and
- C-terminal tags (above data for GST and c-myc tags).
- Internal loop positions within the MUP protein have also been used to introduce the peptide epitope sequences.
- Several potential positions for the introduction of epitope tags were chosen, from the MUP protein structure ( Figure 15), as being in external loops. The initial position chosen to introduce a tag corresponded to a site within the EF loop of BLG protein that had previously been used to introduce a kinase recognition site. This had utilised a CM restriction site in the BLG gene, however there is no corresponding restriction site in the MUP gene.
- the Mup cD ⁇ A sequence was modified by the introduction of a) an Avrll-Apal-Sbfl linker fragment into the sequence coding for EF loop region and b) a Spel-EcoRTNsil linker fragment at the 3 'end of the coding sequence.
- the particular restriction site combinations were chosen since they would generate compatible overhanging ends, for the insertion of adapter oligonucleotides containing epitope sequences.
- the MUP 5'-coding region from position 10 to 300, together with an additional GATGCGGTACCACCATGGTGTCTAGACTGCAG 5'- sequence (containing a Kozak signal, start codon and Ncol-Kpnl-Xbal-Pstl linker) and an additional CCTAGGC sequence (containing an Avrll restriction site) was generated by PCR.
- MUP lipocalin reporter proteins have also been produced, in which the epitope has been introduced into the FG loop position. This has been accomplished by the insertion of a Hindlll-BamHI-EcoRI linker fragment into the MUP coding sequence at the FG loop position. This has allowed the insertion of adapter oligonucleotides containing epitope sequences into the Hindlll/EcoRI sites.
- the MUP coding sequence from position 1 to 348, together with an additional GGTACCACC 5'-sequence
- GAGCAGAAACTCATCTCTGAAGAGGATCTGTGAGCTAGC 3'-sequence (containing the c-myc GluGlnLysLeuIleSerGluGluAspLeu epitope tag , stop codon and Nhel restriction site). Ligation of the two fragments, at the BamHI site generated the modified MUP coding sequence, on a Ncol-Nhel fragment.
- a (NNN) X C TTAA where x is a multiple of 3, that contain an epitope tag, can anneal.
- Epitopes that have been inserted into the FG loop, by this method include:
- WLLPEP1 QEQCQEVWRKRVISAFLKSP
- MUP coding sequences containing these epitope tag sequences, were expressed in E. coli as GST fusion precursor proteins, and cleaved tagged MUP proteins, using the pG ⁇ X expression system (Amersham Biosciences).
- FG loop modified MUP coding sequence was cloned into Ncol-Notl cut pG ⁇ X6P vector to generate pGSLM, that contains the MUP coding region downstream of the GST coding sequence and Precissionase cleavage site.
- Individual epitope tags were introduced by HndlJI/EcoRI digestion and annealing of epitope containing oligonucleotide linkers.
- E. coli strain TOP10 (Invitrogen) was transformed with the pGSLM-tag construct, using the manufacturers standard protocols.
- the resultant transformed bacterial strains were grown in shaking flask culture to an OD 600 of 0.5-0.6. Once the optimal turbidity was attained a small sample was removed as a control and IPTG added to the remaining culture to a final concentration of 0.5mM. Both the control sample (uninduced) and the induced cultures were grown for a further 2-3 hours. After the final growth step 0.25ml and 0.5ml of uninduced and induced culture respectively was spun down and resuspended in lOOul 6xGLB and 5- lOul of each run on NuPAGE gels (Invitrogen) to ascertain whether induction had taken place and the fusion product was the correct size.
- the remaining induced culture (3.2L total for large preps) was spun down, lysed and cell debris removed by centrifugation.
- GST fusion proteins from cleared lysate were allowed to bind to Glutathione-Agarose beads (SIGMA) for 0.5-1 hour at +4°C.
- the protein/bead slurry was poured onto a gravity flow column and the resultant gel bed washed thoroughly with lysis buffer to remove bacterial proteins. Fusion proteins were then eluted from the gel bed with excess Glutathione (lOmM in 50mM Tris pH8.0). Samples were checked via SDS-PAGE and Immunodetection before proceeding to cleave and purify the tagged MUP protein from the GST fusion.
- the purified eluate was dialysed in cleavage buffer (4 x 3 hours) and then incubated for 16 hours with at least 60 units of Precissionase at +4°C.
- the digested protein was then added to a gravity flow column containing fresh Glutathione-Agarose beads which bound the GST and Precissionase allowing the elution of the cleaned, digested tagged MUP protein.
- the eluate was re-added twice to ensure complete removal of contaminating proteins and then concentrated using Centricon-P20 columns (Millipore) to give the final protein solution. Extracts from induced and uninduced cells were analysed by western blotting for the presence of the relevant tagged MUP protein, using an epitope-specific monoclonal antibody.
- MUP lipocalin reporter sequences containing internal modifications at protein loop positions, were cloned into the pSecTag2 vector (Invitrogen).
- This vector contains a murine Ig Kappa signal peptide, a 3'-c-myc and His tag, and is designed to express tagged secreted proteins in mammalian cells.
- the DNA constructs were transfected into both murine Hepal-6 hepatoma cells and human A2780 ovarian carcinoma cells, using Fugene transfection reagent (Invitrogen). After 72h, medium was collected and analysed for the presence of secreted protein by western blotting. A typical blot is shown in Figure 16.
- Example 11 Expression of epitope tagged lipocalin reporter proteins in transgenic animals
- Transgenic animals are generated using one of several standard methods including pronuclear injection (Gordon and Ruddle, Science 214, 1244-1246 (1981)), blastocyst injection of transfected cells (Smithies et al, Nature 317, 230-234 (1985)) or using viral vectors (Lois et al. , Science 295, 868-872 (2002); Pfeifer et al, Proc. Natl Acad. Sci. USA 99, 2140-2145 (2002)).
- the transgene comprises D ⁇ A fragments including a promoter sequence driving an open reading frame encoding a tagged-lipocalin.
- transgenes contain the mouse Cyplal promoter sequence driving expression of myc epitope tagged MUP or BLG reporters, as follows:
- pXC3'mycMUP A 2.4Kb fragment encompassing the murine Cyplal promoter was derived by PCR from murine genomic D ⁇ A. This was cloned into the vector pXen5s (CXR Biosciences) as a SpeVXhol fragment to yield the vector pXen5Cyp. The Cypla promoter was subsequently moved from pXen5Cyp into the vector pXen4.3'mycMUP (CXR Biosciences) as an SstTUXhol fragment replacing the CMN promoter contained in this vector. The resultant vector pXC3'mycMUP contains a C-terminally tagged MUP reporter running under the control of the murine Cyplal promoter.
- the BLG reporter was amplified from the vector pBLacD (Roslin Institute) by PCR, adding flanking Xh ⁇ l and Kpn ⁇ sites and inserting a C-terminal Myc epitope tag. This fragment was digested XhoVKpnl and used to replace the MUP reporter in XhoVKpnl digested pXC3'mycMUP vector.
- the resultant vector pXC3'mycBLG contains a C-terminally tagged BLG reporter running under the control of the murine Cyplal promoter.
- Transgenic animals are identified by analysis of DNA (Whitelaw et al, Transgenic Res. 1, 3-13 (1991)) and bred to generate transgenic lines. Transgenic animals are exposed to stress, for example by drug administration, and blood and urine collected over time. Samples collected pre- and post-insult are analysed for the presence of the tagged-lipocalin by standard methods, including Western blot and ELISA. Depending on the specific insult or inducing agent an increase or decrease in reporter activity are detected.
- Transgenes may also be refined to allow expression in specific cells, for example through the DNA recombination based strategies (Fiering et al, Proc. Natl.Acad.Sci.USA 90, 8469-8473 (1993); Gu et al, Cell 73, 1155-1164 (1993)).
- DNA promoter-reporter constructs are introduced into somatic cells of an animal. This could be achieved through the use of adenovirus (Lai et al., DNA Cell Biol. 21, 895-913 (2002), other viral vector methods (Logan et al., Curr. Opin. Bioetcnol. 13, 429-436 (2002)) or by non-viral methods including the direct introduction of naked DNA (Niidome and Huang, Gene Ther. 9, 1647-1652 (2002).
- adenovirus Lai et al., DNA Cell Biol. 21, 895-913 (2002)
- other viral vector methods Logan et al., Curr. Opin. Bioetcnol. 13, 429-436 (2002)
- non-viral methods including the direct introduction of naked DNA (Niidome and Huang, Gene Ther. 9, 1647-1652 (2002).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Environmental Sciences (AREA)
- Hematology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Food Science & Technology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03771161A EP1525314A2 (en) | 2002-07-26 | 2003-07-25 | Multi-reporter gene model for toxicological screening |
| AU2003251343A AU2003251343A1 (en) | 2002-07-26 | 2003-07-25 | Multi-reporter gene model for toxicological screening |
| CA002531779A CA2531779A1 (en) | 2002-07-26 | 2003-07-25 | Multi-reporter gene model for toxicological screening |
| US10/522,356 US20060105323A1 (en) | 2002-07-26 | 2003-07-25 | Multi-reporter gene model for toxicological screening |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0217402.7A GB0217402D0 (en) | 2002-07-26 | 2002-07-26 | Multi-reporter gene model for toxicological screening |
| GB0217402.7 | 2002-07-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004011676A2 true WO2004011676A2 (en) | 2004-02-05 |
| WO2004011676A3 WO2004011676A3 (en) | 2004-05-06 |
Family
ID=9941199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2003/003192 Ceased WO2004011676A2 (en) | 2002-07-26 | 2003-07-25 | Multi-reporter gene model for toxicological screening |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20060105323A1 (en) |
| EP (1) | EP1525314A2 (en) |
| AU (1) | AU2003251343A1 (en) |
| CA (1) | CA2531779A1 (en) |
| GB (1) | GB0217402D0 (en) |
| WO (1) | WO2004011676A2 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005028657A3 (en) * | 2003-09-23 | 2005-07-21 | Cxr Biosciences Ltd | Excretable reporter systems |
| WO2006008484A3 (en) * | 2004-07-16 | 2006-09-14 | Cxr Biosciences Ltd | Detection of cellular stress |
| WO2018078167A1 (en) * | 2016-10-31 | 2018-05-03 | Universität Zürich | Protein screening and detection method |
| WO2018212714A1 (en) * | 2017-05-15 | 2018-11-22 | Agency For Science, Technology And Research | Toxicity testing device and methods for making and using the same |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016123163A2 (en) | 2015-01-27 | 2016-08-04 | Kardiatonos, Inc. | Biomarkers of vascular disease |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPN480095A0 (en) * | 1995-08-15 | 1995-09-07 | Commonwealth Scientific And Industrial Research Organisation | Epitope tagging system |
| US5948677A (en) * | 1996-12-09 | 1999-09-07 | Jarvik; Jonathan W. | Reading frame independent epitope tagging |
| AU5090498A (en) * | 1997-01-07 | 1998-08-03 | California Institute Of Technology | Optical sensors of cell signaling |
| WO1999037142A1 (en) * | 1998-01-27 | 1999-07-29 | Novo Nordisk A/S | Method for producing transgenic animals |
| US7109044B1 (en) * | 1998-09-04 | 2006-09-19 | Maruha Corporation | Method of detection and disease state management for renal diseases |
| DE19926068C1 (en) * | 1999-06-08 | 2001-01-11 | Arne Skerra | Muteins of the bilin binding protein |
| US6114123A (en) * | 1999-06-14 | 2000-09-05 | Incyte Pharmaceuticals, Inc. | Lipocalin family protein |
| EP1130086A1 (en) * | 2000-02-18 | 2001-09-05 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Genetically engineered keratinocytes and toxicity assay using said keratinocytes |
| IT1318608B1 (en) * | 2000-07-04 | 2003-08-27 | Univ Degli Studi Milano | TRANSGENIC MOUSE FOR SCREENING AND PHARMACODYNAMIC STUDIES AND PHARMACOKINETICS OF LIGANDS ACTIVE ON THE EXTROGEN RECEPTOR AND ITS |
| WO2002031151A2 (en) * | 2000-10-13 | 2002-04-18 | Incyte Genomics, Inc. | Lipocalins |
| WO2002053701A2 (en) * | 2000-12-29 | 2002-07-11 | Vanderbilt University | Epididymal lipocalin gene and uses thereof |
-
2002
- 2002-07-26 GB GBGB0217402.7A patent/GB0217402D0/en not_active Ceased
-
2003
- 2003-07-25 US US10/522,356 patent/US20060105323A1/en not_active Abandoned
- 2003-07-25 EP EP03771161A patent/EP1525314A2/en not_active Withdrawn
- 2003-07-25 AU AU2003251343A patent/AU2003251343A1/en not_active Abandoned
- 2003-07-25 WO PCT/GB2003/003192 patent/WO2004011676A2/en not_active Ceased
- 2003-07-25 CA CA002531779A patent/CA2531779A1/en not_active Abandoned
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005028657A3 (en) * | 2003-09-23 | 2005-07-21 | Cxr Biosciences Ltd | Excretable reporter systems |
| WO2006008484A3 (en) * | 2004-07-16 | 2006-09-14 | Cxr Biosciences Ltd | Detection of cellular stress |
| JP2008506380A (en) * | 2004-07-16 | 2008-03-06 | シーエックスアール・バイオサイエンシズ・リミテッド | Cell stress detection |
| AU2005263930B2 (en) * | 2004-07-16 | 2011-04-07 | Cxr Biosciences Limited | Detection of cellular stress |
| WO2018078167A1 (en) * | 2016-10-31 | 2018-05-03 | Universität Zürich | Protein screening and detection method |
| CN110225973A (en) * | 2016-10-31 | 2019-09-10 | 苏黎世大学 | Protein screening and detection method |
| EP4123022A1 (en) | 2016-10-31 | 2023-01-25 | Universität Zürich | Protein screening and detection method |
| CN110225973B (en) * | 2016-10-31 | 2024-02-13 | 苏黎世大学 | Protein Screening and Detection Methods |
| US12054708B2 (en) | 2016-10-31 | 2024-08-06 | Universität Zürich | Protein screening and detection method |
| IL266270B1 (en) * | 2016-10-31 | 2024-09-01 | Univ Zuerich | A method for protein screening and detection |
| IL266270B2 (en) * | 2016-10-31 | 2025-01-01 | Univ Zuerich | Protein screening and detection method |
| WO2018212714A1 (en) * | 2017-05-15 | 2018-11-22 | Agency For Science, Technology And Research | Toxicity testing device and methods for making and using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2003251343A1 (en) | 2004-02-16 |
| WO2004011676A3 (en) | 2004-05-06 |
| CA2531779A1 (en) | 2004-02-05 |
| AU2003251343A8 (en) | 2004-02-16 |
| GB0217402D0 (en) | 2002-09-04 |
| EP1525314A2 (en) | 2005-04-27 |
| US20060105323A1 (en) | 2006-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2461917C (en) | Isolated dna molecules encoding humanized calcitonin gene-related peptide receptor, related non-human transgenic animals and assay methods | |
| JP5988101B2 (en) | Nucleic acid construct for expression of oxidative stress indicator and use thereof | |
| JP2004173696A (en) | Osteoregulin of mammals | |
| US20020082392A1 (en) | Antibodies to cell-cycle regulatory proteins, and uses related thereto | |
| JPH10510143A (en) | ALK-7 (activin-like kinase), serine threonine kinase receptor | |
| US5789651A (en) | Isolation and characterization of Agouti: a diabetes/obesity related gene | |
| Lake et al. | The Drosophila zinc finger protein trade embargo is required for double strand break formation in meiosis | |
| US20060105323A1 (en) | Multi-reporter gene model for toxicological screening | |
| JP4071442B2 (en) | Novel organic anion transport protein | |
| JP2019129772A (en) | Methods for screening compounds that suppress odor of 2-heptanone | |
| EP1516930A1 (en) | Cellular model of tauopathies for lead identification and drug discovery | |
| JPWO2016204296A1 (en) | pH-responsive proteolytic probe | |
| JP2019129773A (en) | Methods for screening compounds that suppress odor of 2-nonanone | |
| Asa | Transgenic and knockout mouse models clarify pituitary development, function and disease | |
| JP2003530066A (en) | Nucleotide sequence encoding human neurogenin 3 | |
| US20070217999A1 (en) | Excretable Reporter Systems | |
| WO2001096371A2 (en) | Adipose-related gene | |
| US20030041341A1 (en) | Non-human transgenic animal whose germ cells and somatic cells contain a knockout mutation in DNA encoding 4E-BP1 | |
| JP2005500038A (en) | Human diagnostic methods for multiple sclerosis | |
| EP1586653B1 (en) | Noc2 knockout mouse | |
| JP4255052B2 (en) | Alstrem syndrome gene | |
| EP1335976B1 (en) | Modifier of organelle metalbolism | |
| US20030100489A1 (en) | Cell-cycle regulatory proteins, and uses related thereto | |
| Wessling | Gene deletion and functional analysis of fetuin-B | |
| De Freitas | The importance of fast skeletal regulatory light chain in muscle contraction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2006105323 Country of ref document: US Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10522356 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003771161 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003771161 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2531779 Country of ref document: CA |
|
| WWP | Wipo information: published in national office |
Ref document number: 10522356 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: JP |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |




