WO2004011619A2 - Thermostable protease with altered cleavage specificity - Google Patents

Abstract

The present invention is related to thermostable TLP variants with altered substrate specificity. Specifically, the thermostable protease variants are derived from the wild type thermostable protease isolated from Bacillus Caldolyticus so that they efficiently and selectively cleave substrates containing basic or acidic residues. The invention further relates to the nucleic acids encoding these novel polypeptides, as well as the recombinant materials and methods for producing these protease variants. The present invention also provides compositions comprising such a TLP variant for various proteolysis applications.

Description

THERMOSTABLE PROTEASE WITH ALTERED CLEAVAGE SPECIFICITY

FIELD OF THE INVENTION

This invention relates to thermostable protease variants having altered specificity from wild-type protease.

BACKGROUND

Site-specific proteolysis is one of the most common forms of post-translational modifications of proteins (for review see Neurath, H. (1989) Trends Biochem. Sci., 14:268).

Proteases generally have specific substrates. While their specificities are greatly appreciated, the industrial application of natural proteases is also limited by their specificities toward a limited number of substrates. While no one protease will be applicable to every situation given the sequence requirement of the substrate specificity by the protease and the possible existence of incompatible sequences within the desired protein template, an expanded array of proteases with altered substrate specificities, analogous to restriction endonucleases, would make site-specific proteolysis a more widely used method for processing various proteins to generate desired protein/peptide fragments either in vitro or in vivo.

Thermolysin-like proteases (TLPs) are members of the peptidase family M4 of which thermolysin (TLN) is the prototype (Barret et al. (1998) In Handbook of proteolytic enzymes. Academic Press, pp. 350-369). The amino acid sequences of several TLPs have been determined (see Barret, supra), and the three dimentional structure of TLPs isolated from several bacteria have been solved (Weaver et al. (1977) J. Mol. Biol. 114:119-132; Stark et al. (1992) FEBS Eur. J. Biochem. 984:1-11; Thayer et al. (1991) J. Biol. Chem. 266: 2864-2871; and Banbula et al. (1998) Structure 6:1193).

A number of publications describe the thermostability of Bacillus TLPs (see, for example, Veltman et al., (1998) Biochemistry 37(15):5312-9; Burg B et al., (1998) Proc Natl Acad Sci U S A. 95(5):2056-60; Veltman et al. (1997) Eur J Biochem. 248(2):433-40; Mansfeld et al., (1997) J Biol Chem. 272(17):11152-6; Veltman et al (1997) FEBS Lett. 405(2):241-4; Frigerio et al. (1997) Protein Eng. 10(3):223-30; Veltman et al. (1996) Protein Eng. 9(12):1181- 9; Eijsink et al. (1995) Nat Struct Biol. 2(5):374-9; Hardy et al. (1993) FEBS Lett. 317(l-2):89- 92; Eijsink et al. (1992) Protein Eng. 5(5):421-6; Eijsink et al. (1992) Protein Eng. 5(2): 157-63); each of the references is hereby incorporated by reference in its entirety). Saul et al. disclosed the sequence of a highly stable neutral protease from Bacillus sp. strain EA1 (1996, Biochim Biophys Acta. 1338(l):74-80).

Other publications describe the substrate specificity of the TLPs and the effect of amino acid substitutions on the subtrate specificity (see, for example, de Kreij et al. (2002) J Biol Chem. 277(18): 15432-15438; de Kreij et al. (2001) Eur J Biochem. 268(18):4985-91; de Kreij et al. (2000) J Biol Chem. 2000 275(40):31115-20); DeSantis and Jones (1999) Bioorg. Med. Chem. 7:1381-1387). Takahashi et al. (2001, J. Biochem. 133:99-106) reported their modification of Substilisin substrate specificity, a member of the S8A family of serine proteases.

There is a need in the art for more thermostable TLP proteases with various desirable substrate specificities.

SUMMARY OF THE INVENTION

In a first aspect, the present invention provides a thermolysin-like protease comprising an Si' site, where the protease is modified at the Si' site to have a substrate specificity for a basic amino acid.

hi one embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has an Aspartate or a Glutamate at a position corresponding to amino acid Leucine 205 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

In another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has an Aspartate or a Glutamate at a position corresponding to amino acids Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

In another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has an Aspartate at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

In still another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has a Glutamate at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

In yet another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has an Aspartate at one position and has a Glutamate at the other position where the positions correspond to amino acid Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

The present invention also provide a thermolysin-like protease comprising an Si_.' site, where the protease is modified at the S site to have a substrate specificity for an acidic amino acid.

In one embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has a Lysine or an Arginine at a position corresponding to amino acid Leucine 205 in a protease comprising the amino acid sequence of SEQ ID NO. 1

h yet another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has a Lysine or an Arginine at a position corresponding to amino acid Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

In yet another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has a Lysine at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

In still another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has an Arginine at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

In yet another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has a Lysine at one position and has an Arginine at the other position where the positions correspond to amino acid Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

The present invention further provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, where the thermolysin-like protease has an Aspartate or a Glutamate at one or more positions corresponding to amino acids selected from the group consisting of Phenylalanine 133, Valine 143, Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

The present invention still further provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, where the thermolysin-like protease has a Lysine or an Arginine at one or more positions corresponding to amino acids selected from the group consisting of Phenylalanine 133, Valine 143, Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

In one embodiment, the thermolysin-like protease is further modified to have an enhanced thermostability.

In a preferred embodiment, the thermolysin-like protease (e.g., the Phenylalanine 133,

Valine 143, Leucine 205 and or Phenylalanine 136 variant) is further modified to have an enhanced thermostability by having a Valine at a position corresponding to amino acid Glycine 61 in the protease comprising the amino acid sequence of SEQ ID NO. 1.

In one embodiment, the thermolysin-like protease is modified from a protease isolated from Bacillus caldolyticus.

In another embodiment, the thermolysin-like protease is modified from a protease isolated from the bacteria group consisting of Bacillus caldolyticus, Bacillus sp. EA1, Bacillus thermoproteolyticus, Bacillus acidocaldarius, Bacillus sterothermophilus, Lactobacillus spp., Bacillus cereus, Bacillus megaterium, Bacillus brevis, Bacillus polymyxa, and Bacillus subtilis.

In a second aspect, the present invention provides an isolated nucleic acid encoding a thermolysin-like protease modified to have substrate specificity for a basic amino acid.

The present invention also provides an isolated nucleic acid encoding a thermolysin-like protease modified to have substrate specificity for an acidic amino acid. In one embodiment, the isolated nucleic acid encoding a thermolysin-like protease modified to have substrate specificity for a basic or an acidic amino acid further comprises a promoter operably linked to the nucleic acid.

The present invention provides an expression vector comprising an isolated nucleic acid encoding a thermolysin-like protease modified to have substrate specificity for a basic or an acidic amino acid.

The present invention also provides a host cell transformed with such an expression vector.

In a third aspect, the present invention provides a method for producing a thermolysin- like protease having substrate specificity for a basic amino acid comprising site-directed mutagenesis of a nucleic acid encoding a polypeptide with SEQ ID NO. 1, where the site- directed mutagenesis results in an Aspartate or a Glutamate replacement of one or both amino acids at positions Leucine 205 and Phenylalanine 136 within the polypeptide with SEQ ID NO. 1.

The present invention also provides a method for producing a thermolysin-like protease having substrate specificity for an acidic amino acid comprising site-directed mutagenesis of a nucleic acid encoding a polypeptide with SEQ ID NO. 1, where the site-directed mutagenesis results in a lysine or an Arginine replacement of one or both amino acids at positions Leucine 205 and Phenylalanine 136 within the polypeptide with SEQ ID NO. 1.

The present invention further provides a method for proteolysis comprising contacting a polypeptide template with a thermolysin-like protease modified to have substrate specificity for a basic or an acidic amino acid.

The present invention will find use in wide applications such as biological and biomedical research; identification of therapeutic agents and diagnostic markers; characterization of cells and organisms that have undergone genetic modifications; identification of unknown illnesses; characterization of polypeptides and identification of biological samples; and industrial processes. Non-limiting examples of such applications include proteomics applications involving mass spectrometry, peptide mass fingerprinting/protein identification, and protein quantification. Other example applications may relate to the rapid identification of bacteria or other biological species using mass spectroscopy techniques. BRIEF DESCRIPTION OF DRAWINGS

Figure 1 is a graph showing the amino acid sequence of the wild type Bacillus Caldolyticus protease (SEQ ID NOs. 1-3) according to certain embodiments of the invention.

Figure 2 is a table showing the mutation sites for various proteases according to some embodiments of the invention.

Figure 3 is a table showing mutations at positions 136 and/or 205 of SEQ ID NO. 1 according to some embodiments of the invention.

Figure 4 is a figure showing a nucleic acid sequence encoding SEQ LD NO. 1.

Figure 5 is a figure showing alignment of multiple full length protease sequences using Bioedit program with default parameters according to one embodiment of the invention.

Figure 6 is a figure showing alignment of various mature protease against the polypeptide sequence of SEQ ID NO.l using Bioedit program with default parameters according to one embodiment of the invention.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

Terms used in the claims and specification are defined as set forth below unless otherwise specified.

The terms "protease" and "peptidase" are used interchangeably to refer to enzymes which hydrolyze peptide bonds.

The term "thermolysin-like protease (TLP)" as used herein refers to members of the peptidase family M4 with thermolysin as the prototype, for example, as described in Beaumont and Beynon (1998, Thermolysin. In Handbook of Proteolytic Enzymes. Barret, Rawlings and Woessner, eds, Academic Press, London, UK), and as described by the International Union of Pure and Applied Chemistry (IUPAC) enzyme classification guidelines (Webb, E.G. 1992, Enzvme nomenclature 1^st, page 1-862). A TLP includes an α helix which is located at the bottom of the active site cleft and contains several of the catalytically important residues. Four substrate binding pockets (S2, SI, Si ' and S ') have been identified in TLPs (see, for example, as described in Hangauer et al., 1984, Biochemistry 23: 5730-5741). TLPs according to the present invention include, but are not limited to, thermolysin-like protease for which the gene sequence is known, for example, from Bacillus amyloliquefaciens, Bacillus caldolyticus (e.g., Accession U25629, M63575, P23384, S72176, P23384), Bacillus sp. (e.g., Accession U25630, JC4113, S72175), Bacillus thermoproteolyticus (e.g., Accession HYBST, P06784, P43133), Bacillus acidocaldarius (Accession JC4113), Bacillus sterothermophilus (e.g., Accession Ml 1446, CAA54291, A46564), Lactobacillus spp. (Accession D29673), Bacillus cereus (Accession A24306), Bacillus megaterium (Accession Q00891), Bacillus brevis (Accession P43263), Bacillus olymyxa (Accession P29148), Bacillus subtilis (Accession P39899, P06142, JQ2129, P06832), and Alicyclobacillus acidocaldarius (e.g., Accession U07824).

The terms "Si ' site" and "Si_.' subsite" are used interchangeably to refer to a hydrophobic pocket that is located within the active site cleft of a TLP and is considered to be a major determinant of substrate specificity (Feder and Schuck, 1970, Biochemistry 14:2784-2791; Feder, 1968, Biochemistry, 6:2088-2093). SI' sites are less conserved in TLPs, for example, the S_t' site is formed by Phel33, Vall43, Leu205 and Phel36 (or Leul36) in B. Caldolyticus. The structural diversity of the SI' site, therefore, is involved in determining the substrate specificity for each specific enzyme. The SI' site in a given polypeptide, according to the present invention, can be identified by aligning the given polypeptide or a portion of the given polypeptide against SEQ ID NO. 1 or 3 of the present invention. Any amino acid within the given polypeptide is identified as a SI' site amino acid which can be mutagenized to generate the modified protease with altered substrate specificity if it aligns with an amino acid located within the region of 128-148 or the amino acid 200-210 of SEQ ID NO. 1 (or their corresponding region of SEQ ID NO. 3, i.e., amino acids 354-374 and 426-436 respectively). Alignment is made using the Bioedit Sequence Alignment Editor (Hall, 1999, Nucl, Acids, Symp. Ser. 41: 95-98) which uses the clustalw algorithm (Thompson et al., 1994, Nucleic Acids Res. 22:4673-80). In addition, the SI' site in a given polypeptide, according to the present invention, can also be identified by aligning the given polypeptide or a portion of the given polypeptide against the mature polypeptide of the thermolysin sequence (Genbank accession No. S41312). Any amino acid within the given polypeptide is identified as a SI' site amino acid if it aligns with an amino acid within the region of 125-141 or the amino acid 197-207 of the thermolysin sequence. Alignment is made using the Bioedit Sequence Alignment Editor (Hall, 1999, Nucl, Acids, Symp. Ser. 41: 95-98) which uses the clustalw algorithm (Thompson et al., 1994, Nucleic Acids Res. 22:4673-80). The sequence of Si', as a non-limiting example, may comprise the amino acid motif corresponding to "XFXXXSGXXDXXXHEX" at amino acid position 132-147 of B. Caldolyticus TLP as indicated in FIG. 2.

The term "amino acid" or amino acid residue", as used herein, refers to naturally occurring L amino acids or residues, unless otherwise specifically indicated. The commonly used one- and three-letter abbreviations for amino acids are used herein (Lehninger, A. L., Biochemistry, 2d ed., pp. 71-92, Worth Publishers, N. Y. (1975)). Basic amino acids include Arginine (Arg or R) and Lycine (Lys or K). Acidic amino acids include Aspartate (Asp or D) and Glutamate (Glu or D).

The term "modified protease", "protease modified", "mutant protease" or "protease variant" refers to a thermolysin-like protease haying a sequence which is not found in nature that is derived from a wild type thermolysin-like protease according to the present invention. The modified protease has a substrate specificity different from the wild type thermolysin-like protease by virtue of at least one amino acid substitution within at least one of the active sites of the wild type thermolysin-like protease amino acid sequence. The term is meant to include modified proteases in which the DNA sequence encoding a wild type thermolysin-like protease is modified to produce a mutant DNA sequence which encodes the substitution of one or more amino acids in the naturally occurring wild type thermolysin-like protease amino acid sequence. A "modified protease" is designated by using the single letter amino acid code for the wild-type residue followed by its position and the single letter amino acid code of the replacement residue. Multiple mutants (i.e., having two or more amino acids substitutions) are indicated by component single mutants separated by slashes. Thus the modified TLP protease L205K/F136K is a di-substituted variant in which Lys replaces Leu and Phe at residue positions 205 and 136, respectively, in a wild-type TLP protease. When referring to mutants or variants, the wild type amino acid residue is followed by the residue number and the new or substituted amino acid residue. For example, substitution of V for wild type G in residue position 61 is denominated G61V.

The term "substrate specificity", as used herein, refers to the ability of a thermolysin-like protease to cleave the peptide substrate at a specific amino acid side chain of a peptide. Wild type thermolysin-like protease exhibits a preference for large hydrophobic Pi' residues, i.e., Leu or Phe. A TLP modified to have a substrate specificity for a basic amino acid is a modified TLP having a preference for a basic amino acid side chain (e.g., in Arg or Lys); while a TLP modified to have a substrate specificity for an acidic amino acid is a modified TLP having a preference for an acidic amino acid side chain (e.g., in Asp or Glu). A "protease having a preference for a basic or an acidic amino acid" refers to a protease having an increased catalytic efficiency toward a peptide substrate comprising the basic or the acidic amino acid (e.g., cleaving at the basic or acidic amino acid within the peptide substrate) when compared to that of a wild type protease. The protease activity may be determined by Kcat /Km ratio as measured by a substrate activity assay, for example, as described in Fujii et al. (1983, J. Bacteriology, 154: 831-837). Generally, the objective is to secure a modified protease having a greater, i.e. numerically larger (for example, at least 10% higher or more, e.g., 20%, 50%, 100%), or 2 fold, 4 fold, 8 fold or higher) Kcat/Km ratio for a given substrate when compared with a wide type protease. A greater Kcat/Km ratio for a particular substrate indicates that the modified protease may be used to more efficiently cleave the substrate. The specificity or discrimination between two or more competing substrates may be determined by the ratios of kcat/Km (Fersht, A. R., (1985) in Enzyme Structure and Mechanism, W. F. Freeman and Co., N.Y. p. 112). An increase in Kcat/Km ratio for one substrate (e.g., a basic or an acidic amino acid) may be accompanied by a reduction in Kcat/Km ratio for another substrate (e.g., a large hydrophobic amino acid).

As used herein, the term "enhanced thermostability" refers to an increased resistance to thermal inactivation; that is, the ability of a protease variant to retain a specific hydrolytic activity at a given temperature longer than the wild type protease from which the variant is derived. Thermal stability is quantified by T₅₀, i.e., the temperature which results in 50% residual activity after a 30-minute period of incubation (Vriend and Eijsink, (1993) J. Comput. Aided. Mol. Des. 7:367-396; Vriend et al., (1998) J. Biol. Chem. 273:35074-35077). A TLP variant with an "enhanced thermostability", according to the invention, has a T₅₀ that is at least 20% or higher, for example, 40%, 60%, 80%, 2-fold, 4-fold, 6-fold or 8-fold or higher, than T₅₀ of the wild type TLP from which it is derived.

An amino acid residue in a first protease is said to be "at a position corresponding to" an amino acid in a second protease (e.g., a wild type protease) if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in the second protease (i.e., having the same or similar functional capacity to combine, react, or interact chemically).

The term "expression vector" refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of the DNA in a suitable host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, "plasmid" and "vector" are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.

The term "host cell", as used herein, refers to a prokaryotic or eukaryotic cell, strain, species or genera, suitable for introduction and for expression of heterologous DNA sequences. Such DNA sequences may be modified for expression in a particular host as a DNA sequence containing (1) codons preferably used by the host, or (2) promoters, operators, ribosome binding sites and terminator sequences used by the host. Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the protease or expressing the desired protease protein.

The term "operably linked', as used herein, when describing the relationship between two DNA regions, simply means that the two DNA regions are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.

As used herein, the term "polypeptide(s)" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds. "Polypeptide(s)" refers to both short chains, commonly referred to as peptides, oligopeptides and oligomers and to longer chains generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptide(s)" include those modified either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art. It will be appreciated that the same type of modification may be present in the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side- chains, and the amino or carboxyl termini. Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or micleotide derivative, covalent attachment

5 of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, glycosylation, lipid attachment, sulfation, gamma-carboxylation of

0 glutamic acid residues, hydroxylation, selenoylation, sulfation and transfer-RNA mediated addition of amino acids to proteins, such as arginylation, and ubiquitination. See, for instance: Proteins - Structure And Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Posttranslational Covalent Modification Of Proteins, B. C. Johnson, Ed.,

5 Academic Press, New York (1983); Seifter et al., Mefh. Enzymol. 182:626-646 (1990); and

Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62(1992). Polypeptides may be branched or cyclic, with or without branching. Cyclic, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well.

0 As used herein, the term "polypeptide template" refers to any polypeptide (i.e., as defined above) of interest which is subject to proteolysis of a TLP mutant of the present invention.

As used herein, the term "nucleic acid(s)" generally refers to any polyribonucleotide or poly-deoxyribonucleotide, which may be unmodified RJSfA or DNA or modified RNA or DNA. "Nucleic acid(s)" include, without limitation, single- and double-stranded DNA, DNA that is a

,5 mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded, or triple-stranded regions, or a mixture of single- and double-stranded regions. As used herein, the term "nucleic acid(s)"also includes DNAs or RNAs as described

>0 above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "nucleic acid(s)" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are nucleic acids as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term "nucleic acid(s)" as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including, for example, simple and complex cells." Nucleic acid(s)" also embraces short polynucleotides often referred to as oligonucleotide(s).

As used herein, the term "nucleic acid encoding a polypeptide" or equivalent language encompasses nucleic acids that include a sequence encoding a polypeptide of the invention, particularly a TLP polypeptide and more particularly a TLP with altered substrate specificity, even more particularly a TLP polypeptide and more particularly a TLP with altered substrate specificity derived from SEQ ID NO: 1. The tenn also encompasses nucleic acids that include a single continuous region or discontinuous regions encoding the polypeptide (for example, nucleic acids interrupted by integrated phage, an integrated insertion sequence, an integrated vector sequence, an integrated transposon sequence, or due to RNA editing or genomic DNA reorganization) together with additional regions that also may contain coding and/or non-coding sequences.

A "nucleic acid encoding a TLP" refers to a nucleic acid encoding a polypeptide which is a member of the peptidase family M4 with thermolysin as the prototype according to the well known IUPAC enzyme classification.

The term "isolated", when used in reference to a nucleic acid means that a naturally occurring sequence has been removed from its normal cellular (e.g., chromosomal) environment or is synthesized in a non-natural environment (e.g., artificially synthesized). Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only nucleotide chain present, but that it is essentially free (about 90-95%) pure at least) of non-nucleotide material naturally associated with it, and thus is distinguished from isolated chromosomes.

As used herein, the term "variant(s)" refers to a nucleic acid or polypeptide that differs from a reference polynucleotide or polypeptide, respectively, but retains one or more of the biological activities of TLP as described herein. A typical variant of a nucleic acid differs in nucleotide sequence from another, reference nucleic acid. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, and truncations in the polypeptide encoded by the reference sequence, or in the formation of fusion proteins, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. The present invention also includes variants of each of the polypeptides of the invention, that is polypeptides that vary from the referents by conservative amino acid substitutions whereby a residue is substituted by another with like characteristics. Typically, such substitutions are among Val, Leu and lie; among Ser and Thr; among the acidic residues Asp and Glu; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. A variant of a nucleic acid or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and polypeptides may be made by mutagenesis techniques, by direct synthesis, and by other recombinant methods known to skilled artisans.

"Identity" and "similarity," as used herein and as known in the art, are relationships between two or more polypeptide sequences or two or more nucleic acid sequences, as the case may be, as determined by comparing the sequences. Amino acid or nucleic acid sequence "identity" and "similarity" are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman - Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453). "Identity" means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide. In contrast to identity, "similarity" encompasses amino acids that are conservative substitutions. A "conservative" substitution is any substitution that has a positive score in the blosum62 substitution matrix (Hentikoff and Hentikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919). By the statement "sequence A is n%> similar to sequence B" is meant that n%> of the positions of an optimal global alignment between sequences A and B consists of conservative substitutions. By the statement "sequence A is n%> identical to sequence B" is meant that n%> of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides.

As used herein, the term "bacteria identification" refers to the identification of genus and/or species of a bacterium of interest by analyzing its proteolysis pattern using a TLP variant of the present invention. One or more standard or reference proteolysis patterns from bacteria whose genus and/or species are known may be generated by subjecting the known bacteria to a TLP variant. The proteolysis pattern of the bacterium of interest whose genus and/or species is unknown (i.e., to be identified) is then generated by the same TLP variant and compared with the standard or reference patterns so that the genus and/or species of the bacterium of interest can be determined.

As used herein, the term "expression vector" or "vector" refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome-binding site, often along with other sequences. Useful expression vectors include, but are not limited to, P_L expression system, His Fusion system, pBAD vectors from Invitrogen (Carlsbad , CA); pTrc vectors from Amersham Biosciences (Piscataway , NJ); pALTER vectors from Promega (Madison , WI); pBH, pBV, pBX vectors from Roche Molecular Biochemicals (Summerville , NJ); pCAL vectors and pET vectors from Stratagene (La Jolla , CA); and pET vectors from Novagen (Madison , WI).

As used herein, the term "host cell" refers to a cell which has been transformed or transfected, or is capable of transfonnation or transfection by an exogenous polynucleotide sequence. Host cell, as used herein, is intended to include not only the original cell which was transformed with a nucleic acid, but also descendants of such a cell, which still contain the nucleic acid. The preferred host cells for the present invention include, but are not limited to E. coli and bacillus host cells.

As used herein, the terms "transform" and "transfect" as used herein refer to the introduction of foreign DNA into prokaryotic or eukaryotic cells. Transformation of prokaryotic cells may be accomplished by a variety of means known to the art including the treatment of host cells with various salt solutions or nonionic compounds (e.g., CaCl ) to render the cells competent, electroporation treatment, etc. Wild Type Thermostable TLP Proteases

Enzymes are classified according to the type of reaction they catalyze, e.g., oxidoreductases, transferases, hydrolyses, lysases, isomerases and ligases. The M4 family (Rawlings and Barret (1995) Methods Enzymol. 248:183-228) is represented by thermolysin as its prototype and the family consists of secreted eubacterial endopeptidases from both Gram- positive and Gram-negative sources. Thermolysin has a three amino acid deletion relative to SEQ ID NO. 1 so the numbering of the corresponding amino acids within the Si' site maybe different in other M4 family enzymes. For example, G 58 in therniolysin corresponds to G61 of SEQ ID NO. 1; F133 in thermolysin corresponds to F136 of SEQ ID NO. 1; L202 in thermolysin corresponds to L205 of SEQ ED NO. 1; F130 in thermolysin correspond to F133 of SEQ ID NO. 1; and V139 in thermolysin corresponds to V143 of SEQ ID NO. 1. The numbers used in the present specification correspond to the numbers as in thermolysin, unless it is specifically referred to as SEQ ID NO. 1.

The M4 family currently consists of approximately 38 members. The neutral proteases within the M4 family (i.e., the TLPs) are inhibited by specific zinc chelators and have their pH optimum mainly at neutral pH (Matsubara and Feder (1971) Other Bacterial, Mold, and Yeast Protease. In: The Enzymes, Academic Press New York, pp. 721-792). All TLPs bind two calcium ions in a double calcium binding site, whereas the more stable TLPs bind two additional calcium ions in two separate single calcium binding sites (Veltman et al. 1998 supra). Two Ph.D. dissertations by Dr. de Kreij (2001) and Dr. Veltman (1997), both from University of Groningen (Kerklaan, Netherlands) examined the amino acids that are important for maintaining the stability and substrate specificity of TLPs respectively, each of which is incorporated by reference in its entirety.

TLPs are enzymes of industrial importance. They are used in diverse applications such as the preparation of protein hydrolysates; the degradation of gluten from wheat (baking industry); the clarification of beer (brewing industry) and in dehairing or dewooling of skins (leather industry) (Gerhartz, (1990) Enzymes In Industry, VCH Verlaggesellschaft, NVeinheim, Germany). Thermolysin is also used in peptide synthesis, particularly in the production of artificial sweeteners like aspartame (Isowa et al., (1979) Tetrahedron Lett. 28:2611-2612; Nakanishi et al., (1990) Appl. Micobiol. Biotechnol. 32:633-636). The amino acid sequences of several TLPs have been determined (see, for example, Table 1). The three dimensional structure of TLPs isolated from several bacteria have been solved, for example, Bacillus thermoproteolyticus, Bacillus cereus, Pseudomonas aeruginosa, and Staphylococcus aureus. In a significant number of published structures in which TLP was co-crystallised with inhibitors (Weaver et al. (1977) J.Mol.Biol. 114, 119-132; Gaucher et al., (1999) Biochemistry 38:12569-12576; Hausrath et al., (1994) J.Biol.Chem. 269:18839-18842; Holmes et al, (1983) Biochemistry 22, 236-240; Jin et al., (1998) Bioorg.Med.Chem.Lett 8:3518; Kester et al., (1977) Biochemistry 16:2506-2516), the residues involved in catalysis could be identified.

TLPs consist of an α-helical C- terminal domain and an N-terminal domain mainly consisting of β-strands. The domains are connected by a central α-helix. This helix is located at the bottom of the active site cleft and contains several of the catalytically important residues (Fig. 4.1 of de Kerij et al (2001), supra). Four substrate binding pockets [S₂, Si, Si' and S₂'; nomenclature according to Schechter and Berger (1967 Biochem. Biophys. Res. Commun. 27:157-162)] have been identified (Hangauer et al. (1984) Biochemistry 23:5730-5741).

The Si' subsite is a hydrophobic pocket which is considered a major determinant of substrate specificity (Feder, J. (1968) Biochemistry 6:2088-2093, 133). The Si' site is formed by Phel33, Vall43, Leu205 and Phel36 in TLP of 5. Caldolyticus. However, due to the three amino acid deletion of thermolysin and some other TLPs, the Si' subsite is mainly formed by Phe 130, Val 139, Leu202 and either of Phe 133 or Leu 133 in thermolysin and some TLPs produced by some other bacteria.

Crystallographic (Weaver et al. (1977), supra; Kester et al. (1977), supra; Hangauer et al. (1984), supra; Matthews, B.W. (1988) Ace. Chem. Res. 21:333-340) and modelling studies (Hangauer et al. (1984), supra) of thermolysin have indicated that the Si' subsite allows efficient binding of a leucine side chain.

Table 1: Examples of Thermolysin-like proteases for which the gene is known.

Species strains gene references

Bacillus amyloliquefaciens ATCC 23844 npr Vasantha. et al., 1984. J. Bacteriol.

159:811-819

Bacillus brevis 7882 npr Avakov et al., 1991. Dokl.Biochem.24: 1363- 1377

Bacillus caldolyticus YP-T nprC Van den Burg et al., 1991 J. Bacteriol. 173:4107-4115

Bacillus cereus DSM 3101 nprC Wetmore et al, 1992 Mol. Microbiol. 6:1593-1604

Bacillus megaterium ATCC 14581 nprM Ktihn & Fortnagel, 1993 J. Gen. Microbiol. 139:39-47

Bacillus polymyxa 72 npr Takekawa et al., 1991 J. Bacteriol. 173:6820-6825

Bacillus CU21 nprT Fujii et al., 1983 J. Bacteriol. 154:831- stearothermophilus 837

MK232 nprM Kubo & Imanaka, 1988 J. Gen. Microbiol. 134:1883-1892

TELNE nprS Nishiya & Imanaka, 1990 J. Bacteriol. 172:4861-4869

Bacillus subtilis GSY264 prE Yang et al, 1984 J. Bacteriol. 160:15-21 DBIO4 nprB Tran et al, 1991 J. Bacteriol. 173:6364- 6372

Bacillus rokko npr O'Donohue et al., 1994 Biochem. J. thermoproteolyticus 300:599-603

Bacillus sp. EA1 npr Saul et al., 1996 Biochim. Biophys. Acta 1308:75-80

Bacillus sp. BT1 npr Vecerek & Kysllk, 1995 Gene 158:147- 148

Enterococcusfaecalis OGl-10 gelE Su et al, 1991 Infect. Immun. 59:415- subsp. liquefaciens 420

Erwinia carotovora EC14 prtl Kyostio et al., 1991 J. Bacteriol. 173:6537-6546

Lactobacillus sp. no.l mrpL Maeda et al., 1994 J. Ferment. Bioeng. 77:339-346

Legionella pneumophila Black et al, 1990 J. Bacteriol. 172:2608-2613

Listeria monocytogenes LO28 prtA Mengaud et al., 1991 Infect. Immun. 59:1043-1049 l/2a mpl Domann et al, 1991 Infect. Immun. 59:65-72

Pseudomonas aeruginosa PAO1 lasB Bever & Iglewski, 1988 J. Bacteriol. 170:4309-4314

Serratia marcescens ATCC 21074 snip Kwon et al., 1993 Gene 125:75-80

Staphylococcus TU3298-P sepA Teufel & Gotz. 1993 J. Bacteriol. epidermidis 175:4218-4224

Vibrio anguillarum. nblO empA Milton et al, 1992 J. Bacteriol. 174:7235-7244

Vibrio cholerae 3083 hap Haese & Finkelstein, 1991 J. Bacteriol. 173:3311-3317

Vibrio proteolyticus. nrpV David et al., 1992 J. Bacteriol. 112: 107- 112

Variant Design

A. Thermostable TLP Variant With Substrate Specificity To Basic Residue(s) Or Acidic Residue(s)

Rational design of substrate specificity is one of the main goals of protein engineering. Exploitation of enzymes in industry would be facilitated by the ability to rationally modify the substrate specificity of an enzyme. Consequently, an extensive body of literature exists on engineering the substrate specificity of proteases. Three examples of specificity determinants are discussed below.

The first and most common example is the engineering of the substrate binding pockets to change the substrate specificity. Mei et al. (Mei et al., (1998) Protein Eng. 11:109-117) replaced glycines in the Si subsite of subtilisin YaB by larger residues such as alanine and valine. This resulted in an increase in activity towards substrates with a Pi Ala and a sharp decrease in activity towards substrates with a Pi Phe or Leu. Many other examples exist in which the preference for large hydrophobic substrates was diminished by reducing the substrate binding pocket size through the replacement of small binding pocket residues by larger residues (Mei et al. (1998) supra; Bech and Breddam, (1993) Biochemistry 32:2845-2852; Rheinnecker et al, (1993) Biochemistry 32:1199-1203).

The second example concerns the conversion of trypsin to chymotrypsin. The existence of secondary specificity determinants imply that substrate specificity is not necessarily determined by a limited set of amino acids in the substrate binding pockets. Instead, substrate specificity can be a globally distributed property determined by a large part of the protein fold. One of the most thoroughly studied and now best understood systems is the conversion of trypsin to chymotrypsin and the structural basis of substrate specificity in the serine proteases (Perona et al., (1995) Biochemistry 34:1489-1499; Perona and Craik, (1995) Protein Sci. 4:337-360; Perona and Craik, (1997) J.Biol.Chem. 272:29987-29990). Trypsin and chymotrypsin both belong to the SI peptidase family and catalyze peptide bond cleavage by identical mechanisms. A serine residue acts as a nucleophile and the catalytic residues are in the order His, Asp, Ser in the primary sequence. Both enzymes are endopeptidases and possess very similar tertiary structures consisting of two juxtaposed six stranded β-barrel domains (Matthews et al. (1967) Nature 214:652-656; Ruhlmann et al., (1973) J.Mol.Biol. 77:417-437). The substrate specificity of trypsin, expressed in relative k_cat/K_m values, is nearly 10⁶ -fold higher for Pi Arg or Lys containing substrates compared to the activity towards analogous Pi Phe containing substrates. Conversely, chymotrypsin favors peptide substrates possessing Tip, Tyr and Phe at the Pi position, with an overall specificity relative to Pi Lys substrates of up to 10 -fold.

Since the structures of the Si subsites of the two enzymes are very similar, the difference in substrate specificity was thought to be a simple property of the local electrostatic environment. However, replacement of the primary binding determinant Aspl 89 of trypsin with the analogous Ser 189 of chymotrypsin failed to convert the specificity but, instead, resulted in a poorly performing nonspecific protease (Graf et al., (1988) Proc. Natl. Acad. Sci. USA 85:4961-4965). Conversion of trypsin to a chymotrypsin-like protease required the substitution of four residues in the Si subsite together with the exchange of two adjacent surface loops, which do not directly contact the substrate (Hedstrom et al., (1992) Science 255:1249-1253). Inspection of the crystal structures of the wild-type trypsin and chymotrypsin and those of several mutants, revealed the specificity determinants involved (Perona et al., (1995) Biochemistry 34: 1489-1499). The conserved Gly216, which contacts the P₃ residue in both trypsin and chymotrypsin, turned out to be crucial for correct positioning of the substrate in the active site. The different structures of the surface loops in trypsin and chymotrypsin maintain Gly216 in distinct conformations, enabling this residue to function as a specificity determinant despite being conserved in both proteases.

The study of the trypsin-chymotrypsin system has led to a definition of two types of specificity determinants (Perona (1995), supra); primary specificity determinants encompassing amino acids that directly contact the substrate, and secondary specificity determinants which are more distantly located elements in the protein. The secondary determinants can act through various mechanisms such as influencing the conformation of primary determinants, as in the case of Gly216 in trypsin and chymotrypsin, or by modulating the degree of flexibility in the substrate binding site. Examples of the latter can be found in elastase (Bone et al., (1989) Nature 339:191- 195; Bone et al, (1991) Biochemistry 30:10388-10398) and coenzyme A fransferase (Fierke et al, (1986) J. Biol. Chem. 261:7603-7606).

The third example is another example of a specificity determinant which is not located in a subsite. This example relates to the S 10 family of serine carboxypeptidases. Carboxypeptidases (CPDs) catalyze the removal of amino acids from the C-terminus of peptide substrates. The S10 family of serine carboxypeptidases is a group of eukaryotic proteases that, based on their primary structures, can be divided into three groups (Olesen et al., (1995) Biochemistry 34:15689-15699), namely those that have a similar Si pocket environment as CPD- C, those that have a similar SI pocket as CPD-D and a small group of unassignable proteases. All CPD-D like proteases preferentially hydrolyze substrates with a Pi Lys as compared to analogous Leu containing substrates. Among the CDP-C carboxypeptidases some are selective for V_\ Leu, others for P₁ Lys.

Unexpectedly, the comparison of primary structures showed that the substrate binding pocket itself is fully conserved in all S 10 family members, offering no explanation for the differences in substrate specificity. However three residues around the S_t pocket were not conserved. Mutation of these residues and analysis of their effects showed that the preference for a Pi Lys originated from the accessibility of the Pi side chain in the pocket to water, not from a direct interaction between the protein and the Pi side chain of the substrate (Olesen et al., (1994) Biochemistry 33:11121-11126; Sørensen and Breddam, (1997) Protein Sci 6:2227-2232; Olesen and Breddam, (1997) Biochemistry 36:12235-12241). The examples referred to above illustrate that the substrate binding pockets play an important role in determining the substrate specificity. However, other residues outside the binding pockets can influence the substrate specificity as well.

In general, for a modified TLP variant to have a useful catalytic efficiency for cleavage of a particular substrate (i.e., basic or acidic amino acid) the K_cat/K_m ratio is preferably between lxlO³ M^'V¹ to about lxlO⁷ M^'V¹, more preferably, the K_catK_m ratio is between about lxlO⁴ M^"1

It is intended for the present invention to encompass modified TLP variants with altered substrate specificity towards a basic or an acidic amino aid by mutating any amino acids present in the native TLP sequence as demonstrated by the above three examples. In one embodiment, the modified TLP variants are generated by mutating one or more amino acids residing within the substrate binding pockets of the wild type TLP. In another embodiment, the modified TLP variants are generated by mutating one or more amino acids residing within the secondary specificity determinant structure formed by protein folding. In another embodiment, the modified TLP variants are generated by mutating one or more amino acid residues within other specificity determinants.

A number of studies have shown that hydrophobic binding pockets can display complex substrate binding behaviour (Sørensen et al., (1993) Biochemistry 32:8994-8999). Different amino acids can show different binding modes in which substrates interact with different residues in a hydrophobic binding pocket. Furthermore, examples exist in which neighboring amino acids in the substrate influence the exact conformation of a substrate amino acid in a binding pocket.

Although the natural Si' subsite allows efficient binding of a leucine side chain. The present invention provides TLP variants with substrate specificity for a basic or an acidic amino acid. As mentioned above, the Si' site is mainly formed by Phel33, Vall43, Leu205 and Phel36 in TLP of B. Caldolyticus. The corresponding Si' site amino acids in thermolysin and some other TLPs are Phel30, Vail 39, Leu202 and Phel33 or Leul33.

In one embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for a basic amino acid, wherein the thermolysin-like protease has an Aspartate or a Glutamate at one or more amino acids selected from the group consisting of Phel33, Vall43, Leu205 and Phel36 in TLP of 5. caldolyticus. In another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein the thermolysin-like protease has an Aspartate or a Glutamate at one or more positions corresponding to amino acids selected from the group consisting of Phel33, Vall43, Leu205 and Phel36 in TLP of B. caldolyticus. The corresponding positions, for example, could be Phel30, Vall39, Leu202 and Phel33 or Leul33, respectively, in thermolysin and some TLPs produced by some other bacteria.

In one embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein the thermolysin-like protease has a Lysine or an Arginine at one or more amino acids selected from the group consisting of Phel33, Vall43, Leu205 and Phel36 in TLP of B. caldolyticus.

In another embodiment, the invention provides a thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein the thermolysin-like protease has a Lysine or an Arginine at one or more positions corresponding to amino acids selected from the group consisting of Phel33, Vall43, Leu205 and Phel36 in TLP of B. caldolyticus. The corresponding positions, for example, could be Phel30, Vall39, Leu202 and Phel33 or Leul33, respectively, in thermolysin and some TLPs produced by some other bacteria.

It is important to note that, however, the present invention is not limited to providing TLP variants with know SI' site amino acid composition. Rather, the present invention can be used to make corresponding TLP variants in any TLPs with an unknown Si' composition. To prepare TLP variants capable of cleaving a peptide substrate comprising a basic residue or an acidic residue, one need to identify one or more amino acid residues corresponding to the Si' site amino acids of thermolysin, a TLP fromR. caldolyticus or any other bacteria with known SI' site amino acid composition. An amino acid residue in a first protease is said to be "at a position corresponding to" an amino acid in a second protease (e.g., a TLP from B. caldolyticus, SEQ ID NO. 1) if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in the second protease (i.e., having the same or similar functional capacity to combine, react, or interact chemically).

In order to establish homology to primary structure, the amino acid sequence of the first protease is directly compared to the wild type protease primary sequence and particularly to a set of residues known to be invariant in all TLPs for which the sequences are known. After aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletion and insertion), the amino acid in the first protease at a position corresponding to particular amino acids in the primary sequence of the second protease are defined. Alignment of conserved residues may conserve 100%> of such residues. However, alignment of greater than 75% or as little as 50% of conserved residues is also adequate to define equivalent residues.

In one embodiment, the sequences of two or more TLPs sequences are aligned using the following parameters in the Needleman- Wunsch alignment algorithm:

For polypeptides:

Substitution matrix: blosum62. Gap, scoring function: -A -B*LG, where A=l 1 (the gap penalty), B=l (the gap length penalty) and LG is the length of the gap. For nucleotide sequences:

Substitution matrix: 10 for matches, 0 for mismatches.

Gap scoring function: -A -B*LG where A=50 (the gap penalty), B=3 (the gap length penalty) and LG is the length of the gap.

Typical conservative substitutions are among Met, Val, Leu and He; among Ser and Thr; among the residues Asp, Glu and Asn; among the residues Gin, Lys and Arg; or aromatic residues Phe and Tyr. In calculating the degree (most often as a percentage) of similarity between two polypeptide sequences, one considers the number of positions at which identity or similarity is observed between corresponding amino acid residues in the two polypeptide sequences in relation to the entire lengths of the two molecules being compared.

In another embodiment, corresponding amino acids homologous at the level of tertiary structure for a second protease whose tertiary structure has been determined by x-ray crystallography, are defined as those for which the atomic coordinates of 2 or more of the main chain atoms of a particular amino acid residue of the first protease and the second protease (i.e., N on N, CA on CA, C on C, and O on O) are within 0.13 nm and preferably 0.1 nm after alignment. Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the first protease with the second protease. A corresponding amino acid in a first protease which is functionally analogous to a specific amino acid of a second is defined as an amino acid of the first protease which may adopt a conformation such that it either alters, modifies, or contributes to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the second protease as described herein. Further, it may be an amino acid of the first protease (for which a tertiary structure has been obtained by x-ray crystallography), which occupies an analogous position to the extent that although the main chain atoms of the given residue may not satisfy the criteria of equivalence on the basis of occupying a homologous position, the atomic coordinates of at least two of the side chain atoms of the residue lie within 0.13 nm of the corresponding side chain atoms of the second protease. The three dimensional structures would be aligned as outlined herein above.

A three-dimensional model of TLP was built on the basis of the crystal structure of thermolysin, using the molecular modelling program WHAT-IF (Vriend, G. (1990) J. Mol.

Graph. 8:52-56, hereby incorporated by reference in its entirety), as has been described elsewhere (Vriend and Eijsink (1993) J. Comput. Aided. Mol. Des. 7:367-396). The high sequence identity between thermolysin and other TLPs indicates that the TLP model should be sufficiently reliable for prediction and analysis of the effects of most amino acid substitutions (Vriend and Eijsink (1993), supra; Mosimann et al. (1995) Proteins 23, 301-317). The TLP model has been used successfully for the design of various stabilizing mutations (Veltman et al.

(1997) FEBS Lett. 405:241-244; Mansfeld et al. (1997) J. Biol. Chem. 272:11152-11156;

Veltman et al. (1997) supra; Hardy et al. (1993) FEBS Lett. 317: 89-92). An non-limiting example of an amino acid residue "at a position corresponding to" amino acid G61, F136, V143, and/or L205 of SEQ ID NO. 1 is provided in Figure 1 and Figure 5.

B. TLP Variants With Increased Thermostability

Protein-stability can be defined as the resistance of a protein against global unfolding. The thermal stability of broad-specificity proteases such as TLPs are, in contrast to most proteins, dependent on local unfolding processes which lead to autolytically susceptible states and subsequent cleavage, rather then global unfolding (Fontana, 1(988) Biophys. Chem. 29:181- 193; Vriend & Eijsink, (1993) J. Comput.-Aided Mol. Des. 7:367-196; Braxton & Wells, (1992) Biochemistry 31:7796-7801; Kidokoro et al., (1995) FEBS Lett. 367:73-76). The molecular mechanism of thermolysin-like protease inactivation was described by Eijsink et al. (1991, Biochem. Internat. 24:517-525).

Stability can be assessed in various ways, for example by determining the thermodynamic parameter T_m (melting temperature). T_m is determined under conditions at which folded and unfolded protein are at equilibrium, hi addition to temperature, other factors can induce protein unfolding, for example chaotropic reagents (like urea and guanidinium-HCl (GdmCl)), extremes of pH, certain salts (e.g., LiCl, KSCN and CaCl₂) and high hydrostatic pressure (Jaenicke & Rudolph, 1990). For a reliable determination of T_m (and thus stability) unfolding and refolding curves have to be measured.

Based on a large number of site-directed mutagenesis experiments on various TLP proteins, there are several different domains (or cores) within the TLPs that are important for the thermostability of TLPs.

1. Manipulation of the hydrophobic core

The hydrophobic core of TLPs tolerates some genetic manipulation. Protein functionality is usually not lost as long as hydrophobicity is preserved. Mutations in the hydrophobic cores of most proteins are almost always destabilizing, and the destabilizing effects of deleting methyl groups from hydrophobic cores have been investigated in great detail. It has been concluded that the hydrophobic core of a protein usually reflects a compromise between the hydrophobic effects, which tend to maximise the core packing density, and the strain energy that would be incurred in eliminating all packing defects. In contrast with the general conclusions described above, TLP-ste (a member of the M3 family) turned out to be insensitive towards mutations in its hydrophobic core. Drastic mutations either filling (e.g. Leu-» Trp, Ala— 4 Val) or creating (e.g. Leu-» Ala) a cavity had marginal effects on stability. This remarkably small effect is most likely due to the fact that the C-terminal domain of TLP-ste in which the mutations were introduced does not play a role in stability-determining unfolding processes, as discussed in section 1.4.2 and in chapters 2 and 4 of Dr. de Kerij's thesis (2001, supra).

2. Mutations which have the primary effect of reducing the entropy of the unfolded state.

In 1987, Matthews et al. (Proc. Natl. Acad. Sci. USA 84:6663-6667) drew attention to the fact that the stability of a protein can be increased by mutations that reduce the entropy of the unfolded state. Such mutations include the replacement of Glycine residues by residues with a side chain (usually Alanine is used), and the introduction of Proline residues. Obviously, such mutations can only be introduced at positions where the main chain dihedral angles are compatible with the residue to be introduced (e.g. Hardy et al., (1993), FEBS letters 317:89-92). Several examples of stabilizing Glycine - Alanine mutations have been described (e.g. Imanaka et al, (1986) Nature 324:695-697; Matthews et al, (1987) supra; Zhang et al. (1991), Biochemistry 30: 2012-2017; Blaber et al., (1993) Science 260:1637-1640; Blaber et al., (1994), J. Mol. Biol. 246:600-624; Margarit et al. (1992) Protein Engng. 5:543-550), but it is far from certain whether entropic effects are in all cases the main cause for the stabilization observed. Part of the observed stabilizing effects probably have to be attributed to improvement of the stability of α-helices (Zhang et al., 1991, supra; Blaber et al., 1993, supra). As for any mutation, the effect of Gly- Ala mutations is highly context-dependent.

For TLPs some stabilizing Gly-» Xxx mutations have been described (Margarit et al., 1992, supra; Imanaka et al., 1986, supra), but a considerable number of Gly-» Xxx mutations in these enzymes turned out to be destabilising or to leave stability unchanged (Vriend & Eijsink, (1993), J. Comput. Aided Nol. Des. 7:367-396). However, Saul et al. (1996, supra) disclosed the sequence of a highly stable neutral protease from Bacillus sp. strain EA1 which contains a Valine amino acid substitution at G61.

The introduction of Proline residues at positions where the main chain dihedral angles are compatible with a Proline residue seems to be one of the more 'certain' ways to stabilize a protein (e.g. Watanabe et al., (1994), Eur. J. Biochem. 226:277-283). This stabilization strategy has yielded considerable success for various proteins, such as T4 lysozyme, human lysozyme, oligo-l,6-glucosidase, subtilisin AprM, human triosephosphate isomerase, and TLP-ste. An increase in Proline content has been observed when going from more labile to more stable variants in families of homologous proteins. The importance of these extra Prolines for stability has been confirmed by experiments in some cases (Watanabe et al., 1994, supra).

Disulfide bonds can make considerable contributions to the stability of proteins, primarily, but not exclusively, because they decrease the conformational entropy of the unfolded state. A few highly stabilizing engineered disulfide bridges have been reported (Matsumura et al., (1989) Nature 342:291-293; Takagi et al., (1990), J. Biol. Chem. 265:6874-6878; Kanaya et al., (1991) J. Biol. Chem. 266:6038-6044; Wakarchuk et al., (1994) Protein Engng 7:1379-1386; Clarke et al, (1995), J. Mol. Biol. 253:493-504; Yamaguchi et al., (1996) Protein Engng. 9:789- 795). Lack of success of engineering disulfide bonds is usually attributed to the effects of the individual Xxx-» Cys mutations and/or to the introduction of strain resulting from suboptimal geometry of the disulfide bridge. Attempts to increase the stability of a specific proteases such as subtilisin and TLPs have been particularly unsuccessful. Mansfeld et al. (1997, J. Biol. Chem. 272:11152-11156) speculated that the main cause for this was the fact that disulfide bridges had been introduced in parts of the proteases that do not play a major role in the rate-limiting unfolding processes that determine stability. Indeed, and in contrast with all previous studies, a dramatic stabilization of TLP-ste (a TLP from Bacillus stearothermophilus) was obtained upon introducing a disulfide bridge in the stability-determining region of this enzyme. Recently, Van den Burg et al. (1998, Proc Natl Acad Sci USA 95:2035-6) have shown that introduction of a disulphide bond yielded a TLP-ste variant with a T₅₀ of more than 100 °C and a half-life at 100 °C of about three hours.

3. Improving the stability of α-helices

Without doubt the α-helix is the most studied secondary structure element in proteins. Many studies aimed at determining helical propensities for the twenty naturally occurring amino acids have been performed, using both statistics and synthetic helical model peptides. These studies have substantially deepened our insight in the factors determining α-helix stability and have provided a rationale for many of the observations made with model systems. It is clear that one of the safest strategies to stabilize proteins is a strategy aimed at stabilizing α-helices in these proteins.

Detailed studies of T4 lysozyme and barnase have shown that proteins can effectively be stabilized by optimizing their helices. One type of stabilizing mutation aims at improving hydrogen bonding at the N-terminal and C-terminal caps of the helices (which may contain unsatisfied hydrogen bond donors and acceptors in their main chain). This optimization can be achieved either by introducing Glycines, thus improving solubility, or by the introduction of residues with appropriate hydrogen bonding potential.

Another method to stabilize proteins by stabilizing their helices is the introduction of residues that neutralize the macroscopic dipole that gives the N-terminal end of an a-helix some positive charge and the C-terminal end some negative charge. This method has proven to be relatively straightforward and it is one of the most consistently effective ways to stabilize a protein. The mutation most often used is the introduction of negatively charged Asp (not Glu, because of the greater entropy loss) residues in the N-terminal turns of α-helices. This is a very effective stabilization method that was also successfully applied to TLP-sub, a thermolysin-like protease from Bacillus subtilis (Eijsink et al, (1992), Protein Engng. 5:165-170). Helix stabilization can also be obtained by the introduction of "optimal" residues in the middle part of helices. At solvent-exposed positions several mutations are normally possible, and it has been convincingly shown that it is most useful to introduce Ala at such positions. At internal positions, mutational possibilities are highly restricted by the (protein) environment of the residue to be mutated. Helix optimization by this method has been reviewed in detail by Fersht & Serrano (1993, Curr. Opinion Struct. Biol. 3:75-83).

It should be noted that the studies of Blaber et al. (1993, supra) and Fersht & Serrano (1993, supra) yielded the rather remarkable conclusion that hydrophobic residues such as Met, Leu and He can be quite favorable for stability at solvent-exposed positions in α-helices. This effect was attributed to the favorable hydrophobic packing between the 'helix-side' of these residues and the helix itself. Interestingly, Van den Burg et al. (1994, Eur. J. Biochem. 220:981- 985) showed that this beneficial effect of "sub-surface hydrophobicity" may be a more general phenomenon, applying to all but hyper-exposed surface-located residues.

4. Salt bridges Studies on the effects of engineered salt bridges have shown that salt bridges on the surfaces of proteins (e.g., subtilisin BPN', T4 lysozyme) often only contribute little to protein stability (e.g., Erwin et al. (1990) Protein Engng. 4:87-97; Yang & Honig, (1992) Curr. Opinion Struct. Biol. 2:40-45). This is most likely due to the fact that the beneficial effect of the electrostatic interaction is offset by the entropy loss of holding the interacting residues close together. Internal salt bridges, however, can be important for stability (Anderson et al., (1990) Biochemistry 29: 2403-2408). Surface-located salt bridges can lead to stabilization if neither of the partners involved are fully solvent-exposed.

5. Hydrogen bonding

In principle, proteins could be stabilized by mutations aimed at improving hydrogen bonding networks in the protein interior. This is an approach of rather unpredictable outcome, for example, because of complications arising from the fact that polar groups can have their hydrogen bonding potential satisfied in both the folded and the unfolded state of a protein. Also, it will in most cases be difficult to design mutations that fully satisfy the hydrogen bond potential of, for example, a buried hydroxyl group. This stabilization strategy is therefore not commonly used and examples of successful stabilization experiments are rare. Accidentally, these experiments almost all include proteases such as subtilisins. In the study by Vriend et al. (1991, Protein Engng. 4: 941-945) stabilization is obtained by replacing a buried water molecule by the hydroxyl group of a Ser residue (Alal63- Ser). The stabilization obtained was ascribed primarily to the entropy gain of 'releasing' the buried water molecule.

6. Metal-binding site

All TLPs bind two calcium ions in a double calcium-binding site, whereas the more stable TLPs bind two additional calcium ions in two separate single calcium binding sites. Calcium-binding by extracellular proteins is usually important for stability (Strynadka et al., (1991) Curr. opinion. Structural Biol. 1:905-914). Besides TLPs, several enzymes (e.g., DNAsel, α-amylase, dihydrofolate reductase and several proteolytic enzyme members of the trypsin and subtilisin families of Serine proteases) have been shown to require relatively high concentrations of Ca²⁺ ions in the media for maintaining structural integrity and/or protection against (auto-) proteolytic attack. Structural analyses showed that in the majority of the cases the Ca²⁺ ions were not located in the active site and did not participate in catalysis. These Ca²⁺ binding sites were found to be at least 10 A away from the active site residues (McPhalen et al. (1991) Adv. Protein Chem. 42:77-144). The bound Ca²⁺ ions are often located at or near the surface of the protein within potentially flexible loops. This suggests that the Ca²⁺ ion might properly arrange the residues in these flexible loops, thereby assisting the maintenance of structural integrity and in reduction of proteolytic susceptibility.

TLPs contain a zinc ion bound in the active site and a varying number of calcium ions that are important for stability (Matthews et al. (1972) supra). The comparison of the thermostability of closely related TLPs, showed that a correlation exists between the sequence identity and the difference in thermal stability. At elevated temperatures TLPs are irreversibly inactivated as a results of autolysis. The fact that the stability-determining unfolding processes have a local character means that the effect of a site-directed mutation on stability is to a certain extent determined by the location of the mutation: mutations in regions that partially unfold to the most easily autolytically susceptible conformations will have relatively large affects on stability. Such regions are likely to be located at the surface of the protein, since the early steps of unfolding of a protein are thought to involve mainly surface-located structure elements (Veltman et al. (1996) Supra, and Veltman et al. (1997) supra, each reference hereby incorporated by reference in its entirety). Veltman et al. (1997, supra) used site-directed mutagenesis to assess the contribution of individual residues and a bound calcium in the 55-69 region of the thermolysin-like protease of Bacillus stearothermophilus (TLP-ste) to thermal stability. The importance of the 55-69 region was reflected by the finding that almost all mutations had drastic effects on stability. These effects (both stabilizing and destabilizing) were obtained by mutations affecting main chain flexibility, as well as by mutations affecting the interaction between the 55-69 region and the rest of the protease molecule. The calcium-dependency of stability could be largely abolished by mutating one of its ligands (Asp57 or Asp59). In the case of the Asp57~>Ser mutation, the accompanying loss in stability was modest compared with the effects of other destabilizing mutations or the effects of (combinations of) stabilizing mutations. The detailed knowledge of the stability-determining region of TLP-ste pennits effective rational design of stabilizing mutations, which, are also useful for related TLPs such as thermolysin. This is demonstrated by the successful design of a stabilizing salt bridge involving residues 65 and 11. As mentioned above, due to the three amino acid deletion present in thermolysin and other TLPs including TLP-ste used for this study, the 55-69 region corresponds to the 58-72 region of SEQ ID NO. 1 which is derived from Bacillus caldolyticus. Accordingly, a stabilizing salt bridge involving residues 65 and 11 of TLP-ste involves residues 68 and 11. Figure 5 represents a non-limiting example of amino acid in other TLPs corresponding to the 55-69 region of TLP-ste.

It is intended in the present application to apply the knowledge described above to increase thermostability for TLPs. Corresponding amino acids which reside in a hydrophobic core, an α-helix, a salt bridge, or a hydrogen bond can be readily identified according to the available structure of TLPs known in the art, for example, as described in Dr. Veltman' s dissertation (2001, supra).

Saul et al. 1996. Biochemica et Biophysica Acta 1308:74-80 (hereby incorporated by reference in its entirety) reported the identification of a gene for a highly thermostable neutral proteinase (Npr). The gene was sequenced and shown to be closely related to a neutral proteinase gene from Bacillus caldolyticus strain YP-T; the mature form of the enzyme differing by only a single amino acid. Enzyme samples were prepared from both the native organisms and also from recombinant Escherichia coli expressing the two npr genes. The proteinase from strain EA1 was shown to be significantly more thermostable than that from B. caldolyticus (SEQ ID NO. 1). This difference is the result of a single amino acid substitution G61V which is situated proximal to a region of the enzyme known to be crucial to conferring thermal stability. Figure 2 represents a non-limiting example of amino acid in other TLPs corresponding to G61 of TLP from Bacillus caldolyticus (SEQ ID NO. 1).

In one embodiment of the invention, a TLP is modified to have an increased thermostability by having a Valine at an amino acid corresponding to G61 of SEQ ID NO. 1.

In another embodiment of the invention, the TLP modified to have substrate specificity for a basic or an acidic amino acid is further modified to have a Valine at an amino acid position corresponding to G61 of SEQ ID NO. 1.

The corresponding amino acid in a TLP template can be determined in a similar way as described for determining corresponding amino acids for the modification of substrate specificity.

C. The Prosequence Of TLPs

TLPs are secreted as prepro-enzymes. The roles of the pro-sequence have been studied for several of these proteases (Toma et al., (1991) Biochemistry 30:97-106; Wetmore et al., (1994) Mol. Microbiol. 12:747-759; O'Donohue & Beaumont, (1996) J. Biol. Chem. 271:26477- 26481; and Sfrausberg et al., (1993) Biochemistry 32:8112-8119). The presence of the prosequence of different proteases may inhibit the activity of their mature enzymes at different levels, for example, the prosequence of thermolysin inhibits the activity of mature thermolysin enzyme about ten times better than the prosequence of the highly homologous TLP-ste for the mature TLP-ste. The prosequence has also been shown to aid in refolding of denatured mature enzyme. In the absence of the pro-sequence, O'Donohue & Beaumont (1996, supra) succeeded in refolding 2%> of the initial amount of unfolded thermolysin, whereas addition of pro-sequence increased refolding to 20%.

Takahashi et al. (2001, J. Biochem. 130:99-106) reported that enhanced processing was achieved by engineering the pro-region of mutant subtilisin E of Bacillus subtilis. A marked increase in active enzyme production occurred when Tyr(-l) in the pro-region of these mutants was replaced by Asp or Glu. The prosequence of Bacillus caldolyticus TLP is shown as SEQ ID NO. 2 in Figure 1.

In one embodiment of the invention, where an nucleic acid encoding SEQ ID NO. 3 is used to generate a TLP variant, the Tyr(-l), i.e., the last amino acid of the prosequence is mutated into Asp or Glu to increase the processing of TLP. In another embodiment of the invention, where an nucleic acid encoding SEQ ED NO. 3 is used to generate a TLP variant modified to have substrate specificity for a basic or an acidic amino acid is further modified to have a Asp or Glu at an amino acid position corresponding to Tyr(-l), i.e., the last amino acid of the prosequence.

It has been shown that the rate of thermal inactivation in thermolysin-like proteinases is determined by partial denaturation which renders the protein susceptible to autolysis. There is evidence that a region proximal to G61 is the first to become susceptible to autolysis and so is one of the most crucial regions for concerning thermal stability (Eijsink et al. (1995) Nature Struct. Biol. 2:374-379). Eijsink and co-workers studied the effect on thermal stability of amino acid substitutions in this region. Included amongst the mutations tested was G61 to A61 (using thermolysin numbering this would be residue 58). Saul et al. (1996, supra) reported a highly thermostable neutral protease from Bacillus sp. strain EA1 which contains a G61 V substitution. G61 is proximal to a surface loop containing three tyrosines in thermolysin and five in some other TLPs including TLP isolated from Bacillus caldolyticus (i.e., SEQ ID NO. 1). It is proposed that the stabilization of V61 over G61 is due to a hydrophobic interaction. Homology models based on the structure of thermolysin suggest that the isopropl group of EA1-V61 maybe interacting with the aromatic side group of Y27 and providing a stronger interaction than the single methyl group of the thermolysin A58 or G61 of SEQ ID NO.l.

In one embodiment of the invention, the TLP variant with increased thermostability of the present invention contains an amino acid substitution at a position corresponding to G61 of SEQ ED NO.1. En a preferred embodiment, the TLP variant with increased thermostability of the present invention contains a Valine at a position corresponding to G61 of SEQ ED NO. 1. In another preferred embodiment, the TLP variant with increased thermostability of the present invention contains an Alanine at a position corresponding to G61 of SEQ ID NO. 1.

In one embodiment, the TLP variant contains an Alanine or Valine substitution at a position corresponding to G61 of SEQ ID NO. 1, as well as another amino acid substitution at one or more of the positions corresponding to Leucine 205 and Phenylalanine 136 of SEQ ED NO. 1.

Takahashi et al. (2001, J. Biochem. 130:99-106) demonstrated that the pro-region of mutant subtilisins E of Bacillus subtilis can be engineered to enhance pro-protein processing into mature protein, therefore further increasing the efficiency of proteolysis by TLPs. It is also the intention of the present invention to increase the pro-protein processing of a TLP variant by further mutating an amino acid of the pro-region of a TLP corresponding to SEQ ED NO. 1. In one embodiment, an amino acid corresponding to Tyr(-l), i.e., the last amino acid of SEQ ID NO. 2 is substituted by another amino acid. In a preferred embodiment, Tyr(-l) is substituted by an Aspartate or a Glutamate. In another embodiment, the Tyr(-l)Asp or Tyr(-l) Glu is incorporated into a TLP variant with increased thermostability and/or with altered subsfrate specificity when a polynucleotide encoding the preproprotein of a TLP (e.g., SEQ ID NO. 3) is used as a template for constructing the desired variants of the present invention.

Preparation Of TLP Variants

The desired TLP variants of the present invention are preferably prepared using recombinant DNA technology, e.g., by site-directed mutagenesis or random mutagenesis.

A. Nucleic Acid Template

In general, two types of nucleic acid templates may be used to provide the desired TLP variants. One template is a nucleic acid encoding the mature protease polypeptide, for example, a nucleic acid encoding SEQ ID NO. 1 of the present invention. The other type of nucleic acid template is a nucleic acid encoding the entire protease polypeptide (i.e., including the prosequence), for example, a nucleic acid encoding SEQ ID NO. 3 of the present invention. To generate a desired TLP variant of the present invention, either a nucleic acid sequence encoding the entire protease sequence or a nucleic acid encoding the mature protease sequence may cloned into a vector. Vectors comprising a template TLP polynucleotide may be constructed before being subject to mutagenesis. Methods for DNA cloning are well known in the art and can be found in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, 1987; Davis et al., 1986, Basic Methods in Molecular Biology, Elsevier, NY, Chapter 11. Preferably, the nucleic acid template is amplified by PCR as is well known in the art, for example, as described in Kawasaki and Wang, 1989, PCR Technology, ed. Erlich, Stockton Press NY; Kawasaki, 1990, PCR Protocols: A Guide to Methods and Applications, frmis et al. eds. Academic Press, San Diego.The mutated nucleic acid may than be transformed into a Bacillus or E. coli strain to allow the expression and processing of the TLP polypeptides, from which a desired TLP variant may be isolated.

The most common method for cloning PCR products involves incorporation of flanking restriction sites onto the ends of primer molecules. PCR cycling is carried out and the amplified DNA is then purified, restricted with an appropriate endonuclease(s) and ligated to a compatible vector preparation.

A method for directly cloning PCR products eliminates the need for preparing primers having restriction recognition sequences and eliminates the need for a restriction step to prepare the PCR product for cloning. Additionally, such a method would preferably allow cloning PCR products directly without an intervening purification step.

U.S. Patent Nos. 5,827,657 and 5,487,993 (hereby incorporated by reference in their entirety) discloses method for direct cloning of PCR products using a DNA polymerase which takes advantage of the single 3'-deoxy-adenosine monophosphate (dAMP) residues attached to the 3' termini of PCR generated nucleic acids. Vectors are prepared with recognition sequences that afford single 3'-terminal deoxy-thymidine monophosphate (dTMP) residues upon reaction with a suitable restriction enzyme. Thus, PCR generated copies of genes can be directly cloned into the vectors without need for preparing primers having suitable restriction sites therein.

Taq DNA polymerase exhibits terminal fransferase activity where a single dATP is added to the 3' ends of PCR products in the absence of template. This activity is the basis for the TA cloning method in which PCR products amplified with Taq are directly ligated into vectors containing single 3'dT overhangs.

The cloned nucleic acid encoding the entire protease polypeptide (e.g., SEQ ED NO. 3 of Figure 1) or the mature protease polypeptide (e.g., SEQ ID NO. 1 of Figure 1) maybe modified to generate the desired variants by mutagenesis.

Alternatively, the amplified PCR product may be directly used as templates for mutagenesis.

B. Genetic Modifications - Mutagenesis

The preferred method of preparing a desired TLP variant of the present invention is by DNA mutagenesis (e.g., by modifying the DNA sequence of a nucleic acid template). This can be carried out by either site-directed mutagenesis or random mutagenesis.

Preferably, site-directed mutagenesis may be used to mutate the codons for amino acids described above, e.g., those amino acids which affect the thermostability of TLP (e.g., corresponding to G61 of SEQ ID NO. 1) or amino acids which reside within the Sj' site (e.g., corresponding to Phenylalanine 133, Valine 143, Leucine 205 and Phenylalanine 136 of SEQ ED NO. 1).

There are a number of site-directed mutagenesis methods known in the art which allow one to mutate a particular site or region in a straightforward manner, based on the sequences of the polymerization domain of a DNA polymerase. There are also a number of kits available commercially for the performance of site-directed mutagenesis, including both conventional and PCR-based methods. Examples include the EXSITE™ PCR-Based Site-directed Mutagenesis Kit available from Stratagene (Catalog No. 200502) and the QUIKCHANGE™ Site-directed mutagenesis Kit from Stratagene (Catalog No. 200518), and the CHAMELEON^® double- stranded Site-directed mutagenesis kit, also from Stratagene (Catalog No. 200509).

Older methods of site-directed mutagenesis known in the art rely upon sub-cloning of the sequence to be mutated into a vector, such as an M13 bacteriophage vector, that allows the isolation of single-sfranded DNA template. In these methods one anneals a mutagenic primer (i.e., a primer capable of annealing to the site to be mutated but bearing one or more mismatched nucleotides at the site to be mutated) to the single-stranded template and then polymerizes the complement of the template starting from the 3' end of the mutagenic primer. The resulting duplexes are then transformed into host bacteria and plaques are screened for the desired mutation.

More recently, site-directed mutagenesis has employed PCR methodologies, which have the advantage of not requiring a single-stranded template. In addition, methods have been developed that do not require sub-cloning. Several issues must be considered when PCR-based site-directed mutagenesis is performed. First, in these methods it is desirable to reduce the number of PCR cycles to prevent expansion of undesired mutations introduced by the polymerase. Second, a selection must be employed in order to reduce the number of non- mutated parental molecules persisting in the reaction. Third, an extended-length PCR method is preferred in order to allow the use of a single PCR primer set. And fourth, because of the non- template-dependent terminal extension activity of some thermostable polymerases it is often necessary to incorporate an end-polishing step into the procedure prior to blunt-end ligation of the PCR-generated mutant product. Mutagenic primers may be designed such that mutant clones can be recognized by the appearance or disappearance of an endonuclease restriction site. The protocol described below accommodates these considerations through the following steps (e.g., as provided by the QuikChange mutagenesis kit of Stratagene, Cat # 200516). First, PfuTurbo^® DNA polymerase is used to extend the mutagenic oligonucleotide (i.e., annealed to a desired template polynucleotide) with the highest possible fidelity by PCR. The PCR reaction products are then treated with the restriction endonuclease Dpnl (recognition target sequence: 5- Gm6ATC-3, where the A residue is methylated). Dpnl is used to select against parental DNA since most common strains of E. coli Dam methylate their DNA at the sequence 5-GATC-3. The daughter molecules containing the desired mutation are transformed into appropriate host cells (e.g., E coli).

A non-limiting example for the method is described in detail as follows:

Plasmid template DNA (approximately 0.5 pmole) is added to a PCR cocktail containing: lx mutagenesis buffer (20 mM Tris HC1, pH 7.5; 8 mM MgCl₂; 40 μg/ml BSA); 12-20 pmole of each primer (one of skill in the art may design a mutagenic primer as necessary, giving consideration to those factors such as base composition, primer length and intended buffer salt concentrations that affect the annealing characteristics of oligonucleotide primers; one primer must contain the desired mutation, and one (the same or the other) must contain a 5' phosphate to facilitate later ligation), 250 μM each dNTP, 2.5 U Taq DNA polymerase, and 2.5 U of Taq Extender (Available from Stratagene; See Nielson et al. (1994) Strategies 7: 27, and U.S. Patent No. 5,556,772). Primers can be prepared using the triester method of Matteucci et al., 1981, J. Am. Chem. Soc. 103:3185-3191, incorporated herein by reference. Alternatively automated synthesis may be preferred, for example, on a Biosearch 8700 DNA Synthesizer using cyanoethyl phosphoramidite chemistry.

The PCR cycling is performed as follows: 1 cycle of 4 min at 94°C, 2 min at 50°C and 2 min at 72°C; followed by 5-10 cycles of 1 min at 94°C, 2 min at 54°C and 1 min at 72°C. The parental template DNA and the linear, PCR-generated DNA incorporating the mutagenic primer are treated with Dpnl (10 U) and Pfu DNA polymerase (2.5U). This results in the Dpnl digestion of the in vivo methylated parental template and hybrid DNA and the removal, by Pfu DNA polymerase, of the non-template-directed Taq DNA polymerase-extended base(s) on the linear PCR product. The reaction is incubated at 37°C for 30 min and then transferred to 72°C for an additional 30 min. Mutagenesis buffer (115 ul of lx) containing 0.5 mM ATP is added to the Dpnl-digested, Pfu DNA polymerase-polished PCR products. The solution is mixed and 10 ul are removed to a new microfuge tube and T4 DNA ligase (2-4 U) is added. The ligation is incubated for greater than 60 min at 37°C. Finally, the treated solution is transformed into competent E. coli according to standard methods.

When site-directed mutagenesis is used, at least one PCR primer is a mutagenic primer comprising the codon for the amino acid designed to replace an original amino acid. In one embodiment, a mutagenic primer is designed to comprise a codon for Valine at a position corresponding to G61 of SEQ ID NO. 1 to generate a TLP variant with increased thermostability. In another embodiment, a mutagenic primer is designed to comprise a codon for a Lysine or an Arginine at a position corresponding to amino acids Leucine 205 of SEQ ID NO. 1 to generate a LTP variant with substrate specificity to an acidic amino acid. In another embodiment, a mutagenic primer is designed to comprise a codon for a Lysine or an Arginine at a position corresponding to amino acids Phenylalanine 136 of SEQ ID NO. 1 to generate a TLP variant with substrate specificity to an acidic amino acid. In a different embodiment, a mutagenic primer is designed to comprise a codon for an Aspartate or a Glutamate at a position corresponding to amino acid Leucine 205 of SEQ ID NO. 1 to generate a TLP variant with substrate specificity for a basic amino acid. In yet another embodiment, a mutagenic primer is designed to comprise a codon for an Aspartate or a Glutamate at a position corresponding to amino acid Phenylalanine 136 of SEQ ID NO. 1 to generate a TLP variant with substrate specificity for a basic amino acid.

In one embodiment, two or more mutagenic primers may be used simultaneously to create desired mutations at two or more sites (e.g., use QuikChange kit from Stratagene, Cat # 200514). In one embodiment, two mutagenic primers, one designed to comprise a codon for Valine at a position corresponding to G61 of SEQ ID NO. 1, the other designed to introduce one of the mutations at amino acid Leucine 205 or Phenylalanine 136 of SEQ ID NO. 1 are used in the same mutagenesis reaction. In another embodiment, three mutagenic primers, one designed to comprise a codon for Valine at a position corresponding to G61 of SEQ ID NO. 1, another designed to introduce one of the mutations at amino acid Leucine 205 and the third primer designed to introduce one of the mutations at amino acid Phenylalanine 136 of SEQ ED NO. 1 are used in the same mutagenesis reaction to create the desired TLP variants.

In addition to site-directed mutagenesis, methods of random mutagenesis which will result in a panel of mutants bearing one or more randomly-situated mutations may also be used as well described in the art. In this case, such a panel of mutants may then be screened for those exhibiting altered substrate specificity or enhanced thermostability as described in the art and in the present specification. An example of a method for random mutagenesis is the so-called "error-prone PCR method". As the name implies, the method amplifies a given sequence under conditions in which the DNA polymerase does not support high fidelity incorporation. Although the conditions encouraging error-prone incorporation for different DNA polymerases vary, one skilled in the art may determine such conditions for a given enzyme. A key variable for many DNA polymerases in the fidelity of amplification is, for example, the type and concentration of divalent metal ion in the buffer. The use of manganese ion and/or variations of the magnesium or manganese ion concentration may therefore be applied to influence the error rate of the polymerase.

After conducting mutagenesis, the mutated nucleic acids may be transformed into host cells, (e.g., E. coli) for the preparation of mutated DNAs. The isolated DNAs from the host cells can than be directly sequenced to confirm the mutation if site-directed mutagenesis was used.

The mutated nucleic acid may be transformed into a protease deficient strain of B. subtilis (e.g., BG2036 or DB403) or an E. coli strain and than be tested for protease activity according to methods known in the art or as described below.

C. Chemical Modifications

Prior to the development of site-directed mutagenesis techniques only chemical methods were available to protein chemists to alter enzyme properties (DeSantis and Jones (1999) Curr.Opin.Biotechnol. 10:324-330). One of the main problems of chemical modification of enzymes is that the extent and precise location of the modifications often remain uncertain because most reagents are unspecific. Furthermore, heterogeneous mixtures are often produced. Despite such disadvantages, the combination of chemical modification and site directed mutagenesis provides a unique handle for protein modification, because chemical modification of the substituted amino acid offers the possibility for introducing virtually any desired molecule at a specific site in the protein. This approach allows one to introduce unnatural amino acid side chains and to circumvent the limitations in structural variations imposed by the occurrence of only 20 natural amino acids.

An example of the combined mutagenesis and chemical modification approach to modify the substrate specificity of subtilisin concerns the introduction of a unique cysteine in the SI binding pocket, followed by its chemical modification with methanethiosulfonate reagents to generate chemically modified mutant enzymes (DeSantis and Jones, (1999) Curr. Opin. Biotechnol. 10:324-330; DeSantis et al, (1998) Biochemistry 37:5968-5973; DeSantis et al., (1999) Biochemistry 38: 13391-13397). A potential problem with this approach is the size reduction of the binding pocket due to the introduced chemical modification. Studies with subtilisin indeed showed some size exclusion effects (DeSantis et al., (1999) supra) although a proper choice of the modification site could avoid some of these problems. The various available reagents offer the possibility to introduce novel functionality in a binding pocket, such as multiple negative charges. Using this method, encouraging results concerning the alteration of substrate specificity have already been obtained (Davis et al., (1999) Bioorg. Med. Chem. Lett. 7:2293-2301).

Another possible application of chemical modification of proteins is the production of glycosylated heterologous proteins by prokaryotes. A persistent problem of eukaryotic gene expression in prokaryotes is the lack of glycosylation of the expressed proteins. Regio-selective glycosylation of subtilisin was obtained through site directed mutagenesis and subsequent chemical modification after purification of the protein (Davis et al., (2000) Bioorg. Med. Chem. 8:1527-1535; Davis et al., (1998) J. Org. Chem. 63:9614-9615). This is an important advance for the production of properly glycosylated eukaryotic proteins in prokaryotes.

It is intended for the present invention to generate TLP variants using genetic and/or chemical mutagenesis methods.

Protease Specificity Assays

To identify easily an transformant expressing a functional TLP, E. coli transformed with a vector expressing a TLP variant is cultured on a skim milk-containing plate in a halo-forming assay as described in the art (Takagi et al. (1996) FEBS Lett. 395:127-132; Takahashi et al. (2001) J. Biochem. 130: 99-106). Because lower temperature was suitable for prepro-TLP synthesized in E. coli cells to be efficiently secreted, folded and auto-processed, cells expressing TLP would not made halo at 37°C (Shinde and Inouye, (1994) J. Biochem. 115:629-636). Therefore, after a colony of E. coli is developed by incubation at 37°C, the plate is transferred to 23 °C and further incubate for about 20 hours unless otherwise indicated. Halo-forming activity is estimated by the diameter ratio of halo to colony.

Alternatively, specific activities of the TLP variants towards casein can be determined according to a method adapted from Fujii et al. ((1983) Journal of Bacteriology 154, 831-837) using purified TLP. TLPs may be produced and purified as described in the art, for example, as in (Eijsink et al, (1992) Proteins 14:224-236; van den Burg et al. (1989) J. Biochem. Biophys. Meth. 18:209-220). Casein is selected as a standard substrate for activity measurements because it behaves as a noncompact and largely flexible structure (Holt and Sawyer, (1988) Protein Eng. 2:251-259.), thus rendering all scissionable motifs accessible to the same extent for the various proteases at all temperatures employed. Before determining the kinetic parameters, protease preparations are desalted to 20 mM NaAc pH 5.3, 5 mM CaC12 and 20% isopropanol using prepacked PD-10 gel filtration columns supplied by Amersham Pharmacia. Briefly, approximately 0.5 μg of protease is incubated in 1 ml of 50 mM 2-amino-2-(hydroxymethyl)-l,3-propane-diol (Tris.HCl) (pH 7.5) containing 0.8% (wt/vol) casein and 5 mM CaCl₂ at 37 °C for 1 h. The reaction is quenched by the addition of 1 ml of a solution containing 100 mM tri-chloro- acetic acid (TCA), pH 3.5. One unit of protease activity is defined as the amount of enzyme activity needed to liberate a quantity of acid-soluble peptide corresponding to an increase in A _75nm of 0.001 per min. Analysis of the digestion patterns of casein may indicate the substrate specificity of a TLP variant on protein substrates.

Hydrolytic activity for specific synthetic peptide substrates comprising either acidic or basic amino acids can be investigated according to methods known in the art, e.g., as described in Takagi et al. ((1988) J. Biol. Chem. 263:19592-19596). For example, the enzyme reaction is performed in 50 mM Tris-HCl (pH 8.5) and 1 mM CaCl₂ at 37°C. The amount of released p- nitroaniline is determined by measuring the absorbance at 410 nm with a Beckman Specfrophotometer DU640 (Beckman Instruments, Fullerton, CA). The specific activities of purified TLP variants are calculated as units/mg-total protein. One unit is defined as the activity releasing 1 nmol ofp-nitroaniline per min. The kinetic values of the hydrolysis with a purified TLP variant are determined from the initial rates of the reaction.

In addition, the k_ca K_m and K_m values for synthetic peptide substrates (e.g., di-peptides or fri-peptides, for examples see Table 2) of the TLP variants can be determined using method known in the art, for example, at 37 °C in a thermostated Perkin-Elmer Lambda 11 specfrophotometer. The reaction mixture (e.g., 1 ml) contains 50 mM Tris, 50 mM 4- morpholineethanesulfonic acid (MES) (pH 7.0), 5 mM CaCl₂, 5% DMSO, 0.5% 2-proρanol, 0.01%) Triton X-100 and 100 μM to 2.5 mM of substrate, and the reaction is followed by measuring the decrease in absorption at 345 nm (Δε₃₄₅ = -317 M^"1 .cm^"1 ) (Feder, (1968) Biochemistry 6:2088-2093). The apparent second order rate constant k_cαt/K_m can be determined by varying the enzyme concentrations (over a 50-fold range) under pseudo-first-order conditions and measuring the initial activity, essentially according to the method described by Feder (1968, supra).

Table 2: Examples of commercially available synthetic pep tides that may be used to measure the cleavage specificity of a modified TLP according to some embodiments of the invention.

Catalog # Rationale Peptide Sequence

L-1775 Pj 'Hydrophobic Suc-Ala-Ala-Pro-Ala-pNA (SEQ ID NO.4)

L-1390 Pi 'Hydrophobic Suc-Ala-Ala-Pro-Leu-pNA (SEQ ID NO.5)

L-1790 Pi 'Hydrophobic Suc-Ala-Ala-Pro-Ile-pNA (SEQ ID NO.6) L-1770 Pi 'Hydrophobic Suc-Ala-Ala-Pro-Val-pNA (SEQ ID NO.7)

L-1400 Pi 'Hydrophobic Suc-Ala-Ala-Pro-Phe-pNA (SEQ ID NO.8)

L-1395 Pi 'Hydrophobic Suc-Ala-Ala-Pro-Met-pNA (SEQ ID NO.9)

L-1710 Pi' Acidic Suc-Ala-Ala-Pro-Glu-pNA (SEQ ID NO.10)

L-1835 Pi' Acidic Suc-Ala-Ala-Pro-Asp-pNA (SEQ ID NO.11) L-1725 Pi' Basic Suc-Ala-Ala-Pro-Lys-pNA (SEQ ID NO.12)

L-1720 Pi' Basic Suc-Ala-Ala-Pro-Arg-pNA (SEQ ED NO.13) ** Synthetic peptides are available from: Bachem California Inc. 3132 Kashiwa Street Torrance, CA 90505; www.bachem.com

Table 3: Examples of assays** that may facilitate specificity determination of a modified TLP According to some embodiments of the present invention.

1. Aminopeptidase Coupled assay: (spectrophotometric detection of p-nitroaniline at 405 nm) TLP Aminopeptidase

Suc-Ala-Ala-Pro-Ala-pNA- — > Suc-Ala-Ala-Pro + Ala-pNA >Ala + pNA (405 nm)

(SEQ ID NO. 4)

2. HPLC assay (monitor product accumulation at 210 nm)

Sue-Ala- Ala-Pro-Ala-pNA > Sue- Ala- Ala-Pro + Ala-pNA (SEQ ID NO. 4)

3. Mass Spectrometric Assay

Digestion carried on selected synthetic peptides and/or protein standards; cleavage specificity determined by analysis of the peptide fragments

4. Autocatalytic Cleavage Assay (example: assay for lysine-specific cleavage) a. Construction of mutation at the ?ι ' autocatalytic site of cleavage (V1K; numbering based on mature polypeptide) b. Perform a second round of mutagenesis to generate the desired Si' site variants (example F136D) c. Express protein in E. coli, lyse cells, heat treat at 70 C for 30 minutes, centrifuge to obtain clarified lysate d. Perform zymogram gel analysis of the clarified lysate

A zone of clearing in the zymogram analysis at the expected molecular mass in the Si' site variant, but not the control (no Si ' site variation), indicates a TLP with the ability to autocatalytically cleave itself at lysine. This result can be used to infer to that the TLP has acquired the ability to use substrates with K as the Pi' residue.

*In some embodiments, more that one of these assays may be required to fully characterize/validate subsfrate specificity. Thermostability Assays

Thermostability of a wild-type or a TLP variant may be determined by methods known in the art. For example, for the determination of thermal stability 0.1 μM purified protease solutions (in 20 mM sodium acetate, pH 5.3, 5 mM CaCl₂, 0.01% Triton X-100, 0.5% 2- propanol, and 62.5 mM NaCl) are incubated at various temperatures for 30 min, after which the residual proteolytic activity is determined with casein as a substrate (Fujii et al., (1983) Journal of Bacteriology 154:831-837). Thermal stability can be quantified by T₅₀, i.e., the temperature which results in 50%) residual activity after a 30 min period of incubation (Vriend and Eijsink, (1993) J. Comput. Aided. Mol. Des. 7:367-396; Vriend et al., (1998) J. Biol. Chem. 273:35074- 35077). To facilitate comparison, the maximum activity of the different TLPs may be normalized to 100%).

Expression Of Wild-type or TLP Variants Generated By Mutagenesis

Methods known in the art may be applied to express and isolate the mutated forms of TLP proteases according to the invention. The methods described here can be also applied for the expression of wild-type protease. Many bacterial expression vectors contain sequence elements or combinations of sequence elements allowing high level inducible expression of the protein encoded by a foreign sequence. For example, as mentioned above, bacteria expressing an integrated inducible form of the T7 RNA polymerase gene may be transformed with an expression vector bearing a mutated DNA polymerase gene linked to the T7 promoter. Induction of the T7 RNA polymerase by addition of an appropriate inducer, for example, isopropyl-β-D- thiogalactopyranoside (IPTG) for a lac-inducible promoter, induces the high level expression of the mutated gene from the T7 promoter.

Any appropriate host strains of bacteria may be selected from those available in the art by one of skill in the art. As a non-limiting example, E. coli strain BL-21 and JM109 are commonly used for expression of exogenous proteins since it is protease deficient relative to other sfrains of E. coli. BL-21 strains bearing an inducible T7 RNA polymerase gene include WJ56 and ER2566 (Gardner & Jack, 1999, supra). For situations in which codon usage for the particular polymerase gene differs from that normally seen in E. coli genes, there are strains of BL-21 that are modified to carry tRNA genes encoding tRNAs with rarer anticodons (for example, argU, ileY, leuW, and proL tRNA genes), allowing high efficiency expression of cloned protein genes, for example, cloned archaeal enzyme genes (several BL21 -CODON PLUSTM cell sfrains carrying rare-codon tRNAs are available from Stratagene, for example).

For example, TLP variants can be expressed and purified from E. coli strain JM109 induced by 1 mM EPTG as described in the art, for example, in Spizizen ((1958) Proc.Natl.Acad.Sci.USA 44: 1072-1078). Protein concentration can be measured by a protein assay kit (e.g., by Bio-Rad Laboratories). Recombinant B. subtilis cells can be grown at 37°C for 24 h in LB medium containing 20 μg/ml tetracycline. An ammonium sulfate precipitate (70%) saturation) of the culture supernatant can be applied onto a CM-Sepharose^® Fast Flow column (Pharmacia Biotech, Uppsala, Sweden) equilibrated with 10 mM sodium phosphate buffer (pH 6.2). The mutant TLP is then eluted with 10 mM phosphate buffer (pH 6.2) containing 80-140 mM NaCl in a stepwise gradient, and the enzymatic activity of individual fractions was monitored by hydrolysis of a specific synthetic peptide (i.e., acidic or basic). The active fractions containing a single protein band, and which exhibites the same mobility as standard wild-type TLP in SDS-PAGE, are collected as purified fractions.

The purified TLP variants can be further confirmed by immunoblotting. For example, polyclonal antibodies raised against thermolysin may be used.

There are many other methods known to those of skill in the art that are also suitable for the purification of a modified DNA polymerase of the invention. For example, the method of Lawyer et al. (1993, PCR Meth. & App. 2: 275) is well suited for the isolation of DNA polymerases expressed in E. coli, as it was designed originally for the isolation of Taq polymerase. Alternatively, the method of Kong et al. (1993, J. Biol. Chem. 268: 1965, incorporated herein by reference) may be used, which employs a heat denaturation step to destroy host proteins, and two column purification steps (over DEAE-Sepharose and heparin- Sepharose columns) to isolate highly active and approximately 80%> pure DNA polymerase. Further, DNA polymerase mutants may be isolated by an ammonium sulfate fractionation, followed by Q Sepharose and DNA cellulose columns, or by adsorption of contaminants on a HiTrap Q column, followed by gradient elution from a HiTrap heparin column. U.S. Patent No. 5,489,523 (thereby incorporated by reference in its entirety) describes an alternative method which may be used for the expression and purification of the TLP mutants of the present invention. The present invention may be used in wide applications such as biological and biomedical research; identification of therapeutic agents and diagnostic markers; characterization of cells and organisms that have undergone genetic modifications; identification of unknown illnesses; characterization of polypeptides and identification of biological samples; and industrial processes. Non-limiting examples of such applications include proteomics applications involving mass spectromefry, peptide mass fingerprinting/protein identification, and protein quantification. Other example applications may relate to the rapid identification of bacteria or other biological species using mass spectroscopy techniques.

For example, the characterization of genomic proteins for proteomics has become one of the most important applications of modem mass spectromefry where the primary tools are proteases and computer-facilitated data analysis. As a result of generating intact ions, the molecular weight information on the peptides/proteins is quite unambiguous. Sequence specific enzymes such as TLP variants of the present invention can then provide protein fragments that can be associated with proteins within a database by correlating observed and predicted fragment masses. With the availability of the human genome sequence (which indirectly contains the sequence information of all the proteins in the human body), identification of the proteins can be quickly determined simply by measuring the mass of proteolytic fragments.

Protein mass mapping has also been used for studying higher order protein structure by combining limited proteolytic digestion, mass analysis, and computer-facilitated data analysis. In the analysis of protein structure, proteases such as the TLP variants of the present invention may be used to initially cleave surface accessible regions of the protein or protein complex. These initial cleavage sites are then identified using accurate mass measurements combined with the protein's known structure and the known specificity of the enzyme. Computer-based sequence searching programs allow for the identification of each proteolytic fragment, which in turn can be used to map the protein's structure.

EXAMPLES Example 1. Production Of A TLP Variant With Substrate Activity For A Basic Amino Acid Enzymes and reagents

The materials used in the following examples are obtained from Stratagene and other bioreagent providers as listed below. PfuTurbo DNA polymerase (Stratagene, Cat. #600252)

Taq DNA ligase (New England BioLabs #M0208S)

dNTPs (Stratagene, Cat. #200415)

Dpn I (Stratagene, Cat. #500402)

QuikSolution (Stratagene, Cat. 200516)

control plasmid DNA (pWS72I)

control primer mix (QC1, K2, H2)

βME

XL 10-Gold^® ultracompetent cells (Stratagene, Cat. 200314),

Pfu DNA ligase (Stratagene, Cat. #600191). General Procedure

Mutagenesis was carried out as described in the product manual of the QuikChange mutagenesis kit of Stratagene (Cat # 200516) or the QuikChange Multi-site mutagenesis kit (Stratagene, Cat # 200513. Mutagenic primers were synthesized with a 5' phosphate moiety (Genset or Oligos Etc.). Primers were designed to introduce one or more nucleotide changes into a polynucleotide encoding a polypeptide of SEQ ID NO: 1 (i.e., a polynucleotide of SEQ ED NO: 2) cloned into the pETIEa vector. The nucleotide changes are designed to substitute Leucine 205 and/or Phenylalanine 136 of SEQ ID NO: 1 with an Aspartate or a Glutamate. This procedure may be readily adapted for the site-directed mutagenesis of other molecules using different primers. The mutagenesis reactions employed temperature cycling parameters of 1 cycle at 95°C for 1 minute followed by 18 cycles at 95°C for 50 seconds, 60°C for 50 seconds, and 68°C for 9 minutes. The reaction products were digested with Dpn I and electrophoresed on a 1-% agarose gel. M, Kb DNA Ladder.

The mutagenesis reaction was set up as follows:

5 μl of lOx reaction buffer 3 μl pETIIa vector template (1 ng/μl)

1.25 μl (125 ng, 22 nM) of each oligonucleotide primer from primer set of Table 1.

1 μl of 10 mM dNTP mix (2.5 mM each NTP)

' Double-distilled water (ddH₂O) to a final volume of 50 μl

1 μl of native Pfu DNA polymerase (2.5 U/μl) was added before PCR started.

The addition of DMSO (5-7%) may increase product yield and increase the amplification efficiency for long templates.

Bacterial Transformation

XLIO-Gold ultracompetent cells (lOOμl) were transformed with 1.5μl of each .Dp/? I- digested sample. Plasmid DNAs were isolated from a number of fransformants and were subject to DNA sequencing for the identification of the nucleotide changes.

Protein Expression And Purification

The pETIIa lasmids with identified nucleotide changes are transformed into BL21 (DE3) strain. BL21 (DE3) transformed with the pETIIa construct were grew at 37oC to O.D. 0.6, the temperature was then decreased to 25oC, and the expression of TLP was induced with 0.5 mM IPTG. The culture was grown for another 12 hours after EPTG induction. The cells were harvest and lysed for protein purification. The cells were first heat-treated at 70oC for 30 munites and then were centrifuged. The TLP protein was purified from the cells using standard chromatographic procedures. The enzymatic activity of individual chromatographic fractions was monitored by hydrolysis of a specific basic peptide. After purification the enzymes were stored at -20°C in the elution buffer used in the affinity separation procedure. Purified enzyme was analyzed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Example 2. Production Of A TLP Variant With Substrate Activity For An Acidic Amino Acid

The production of a TLP variant with subsfrate activity for an acidic amino acid was performed following essentially the same procedure as described in Example 1 except that the mutagenic primers were designed to introduce a Lysine or an Arginine at amino acid positions which correspond to Leucine 205 and/or Phenylalanine 136 of SEQ ID NO: 2. Table 4: Sequences of example primers used to mutate the B. Caldolyticus TLP gene.

Primer Rationale DNA Sequence*

G61V enhanced thermostability AGCTTGTGGGCCGATGTGGACAACCAATTTTTC

(SEQ ID NO. 14)

F136D altered Si' site CAGACGTTTTTGCCGGATTCCGGCGGCATTGAC (SEQ ID NO.15)

F136E altered Si' site CAGACGTTTTTGCCGGAATCCGGCGGCATTGAC (SEQ ED NO.16)

F136K altered Si' site CAGACGTTTTTGCCGAAATCCGGCGGCATTGAC (SEQ ID NO.17)

F136R altered Si' site CAGACGTTTTTGCCGCGCTCCGGCGGCATTGAC

(SEQ ID NO.18)

L205D altered Si ' site ATCGCCGGCGATGCGGATCGCTCGATGTCCGAC (SEQ ED NO.19)

L205E altered Si' site ATCGCCGGCGATGCGGAACGCTCGATGTCCGAC (SEQ ID NO.20) L205K altered Si' site ATCGCCGGCGATGCGAAACGCTCGATGTCCGAC (SEQ ID NO.21)

L205R altered Si' site ATCGCCGGCGATGCGCGCCGCTCGATGTCCGAC (SEQ ED NO.22)

**A11 primers contained a 5 prime phosphate. The codon for the substituted amino acid of interest is indicated in bold. Example 3. Protease Specificity Assays

To identify easily an transformant expressing a functional TLP, E. coli transformed with a vector expressing a TLP variant was cultured on a skim milk-containing plate in a halo- forming assay as described in the art (Takagi et al. (1996) FEBS Lett. 395:127-132; Takahashi et al. (2001) J. Biochem. 130: 99-106).

Subsequently, specific activity of a TLP variant towards casein was determined according to a method adapted from Fujii et al. ((1983) Journal of Bacteriology 154, 831-837) using purified TLP. Approximately 0.5 μg of purified TLP variant was incubated in 1 ml of 50 mM Tris-HCL (pH 7.5) containing 0.8% (wt/vol) casein and 5mM CaCl₂ at 37°C for 1 hour. The reaction was quenched by the addition of 1 ml solution containing 100 mM TCA, pH 3.5. One unit of activity was defined as the amount of enzyme activity needed to liberate a quantity of acid soluble peptide corresponding to an increase in A_275nm of 0.001 per minute.

Hydrolytic activity for specific synthetic peptide substrates comprising either acidic or basic amino acids was investigated according to methods known in the art, e.g., as described in Takagi et al. ((1988) J. Biol. Chem. 263:19592-19596). The enzyme reaction was performed in 50 mM Tris-HCl (pH 8.5) and 1 mM CaCl₂ at 37°C. The amount of released -nitroaniline was determined by measuring the absorbance at 410 nm with a Beckman Specfrophotometer DU640 (Beckman Instruments, Fullerton, CA). The specific activities of purified TLP variants were calculated as units/mg-total protein. One unit was defined as the activity releasing 1 nmol of p- nifroaniline per min. The kinetic values of the hydrolysis with a purified TLP variant were determined from the initial rates of the reaction.

Example 4. Thermostability Assay

To determine T₅₀, aliquots of diluted pure enzyme were incubated at appropriate temperatures. Subsequently, the residual protease activity was determined using a casein assay (Fujii et al., 1983, as described in Example 3). a Reference thermolysin sample was purchased from Boehringer Mannheim and was used as a control T₅₀ for wild type enzyme. However, T₅₀ of a TLP variant was also directly compared to the T₅₀ of the wild type TLP from which the variant was derived.

The foregoing embodiments demonstrate experiments performed and techniques contemplated by the present inventors in making and carrying out the invention. It is believed that these embodiments include a disclosure of techniques which serve to both apprise the art of the practice of the invention and to demonsfrate its usefulness. It will be appreciated by those of skill in the art that the techniques and embodiments disclosed herein are preferred embodiments only that in general numerous equivalent methods and techniques may be employed to achieve the same result.

All of the references identified hereinabove, are hereby expressly incorporated by reference in their entirety.

Claims

Claims

1. A thermolysin-like protease comprising an Si ' site, wherein said protease is modified at said Si' site to have a subsfrate specificity for a basic amino acid.

2. A thermolysin-like protease comprising an Si' site, wherein said protease is modified at amino acid motif XFXXXSGXXDXXXHEX (SEQ ED No. 23) to have a substrate specificity for a basic amino acid.

3. A thermolysin-like protease modified to have a subsfrate specificity for a basic amino acid, wherein said thermolysin-like protease has an Aspartate or a Glutamate at a position , corresponding to amino acid Leucine 205 in a protease comprising the amino acid sequence of SEQ ED NO. 1.

4. A themiolysin-like protease modified to have a substrate specificity for a basic amino acid, wherein said thermolysin-like protease has an Aspartate or a Glutamate at a position corresponding to amino acid Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1.

5. A thermolysin-like protease modified to have a subsfrate specificity for a basic amino acid, wherein said thermolysin-like protease has an Aspartate at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

6. A thermolysin-like protease modified to have a substrate specificity for a basic amino acid, wherein said thermolysin-like protease has a Glutamate at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ED NO. 1.

7. A thermolysin-like protease modified to have a substrate specificity for a basic amino acid, wherein said thermolysin-like protease has an Aspartate at one position and has a Glutamate at the other position wherein said positions correspond to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ED NO. 1.

8. A thermolysin-like protease comprising an Si' site, wherein said protease is modified at said Si' site to have a substrate specificity for an acidic amino acid.

9. A thermolysin-like protease comprising an Si' site, wherein said protease is modified at amino acid motif XFXXXSGXXDXXXHEX (SEQ ID No. 23) to have a substrate specificity for a basic amino acid.

10. A thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein said thermolysin-like protease has a Lysine or an Arginine at a position corresponding to amino acid Leucine 205 in a protease comprising the amino acid sequence of SEQ ID NO. 1

11. A thermolysin-like protease modified to have a subsfrate specificity for an acidic amino acid, wherein said thermolysin-like protease has a Lysine or an Arginine at a position corresponding to amino acid Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

12. A thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein said thermolysin-like protease has a Lysine at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

13. A thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein said thermolysin-like protease has an Arginine at each position corresponding to amino acids Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

14. A thermolysin-like protease modified to have a subsfrate specificity for an acidic amino acid, wherein said thermolysin-like protease has a Lysine at one position and has an Arginine at the other position wherein said one and the other positions correspond to amino acid Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ED NO. 1.

15. A thermolysin-like protease modified to have a substrate specificity for a basic amino acid, wherein said thermolysin-like protease has an Aspartate or a Glutamate at one or more positions corresponding to amino acids selected from the group consisting of Phenylalanine 133, Valine 143, Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

16. A thermolysin-like protease modified to have a substrate specificity for an acidic amino acid, wherein said thermolysin-like protease has a Lysine or an Arginine at one or more positions corresponding to amino acids selected from the group consisting of Phenylalanine 133, Valine 143, Leucine 205 and Phenylalanine 136 in a protease comprising the amino acid sequence of SEQ ID NO. 1

17. The thermolysin-like protease of claim 1 , wherein said thermolysin-like protease is further modified to have an enhanced thermostability.

18. The thermolysin-like protease of claim 1, wherein said thermolysin-like protease is further modified to have a Valine at a position corresponding to amino acid Glycine 61 in said protease comprising the amino acid sequence of SEQ ED NO. 1.

19. The thermolysin-like protease of claim 1 , wherein said thermolysin-like protease is modified from a protease isolated from Bacillus caldolyticus.

20. The thermolysin-like protease of claim 1 , wherein said thermolysin-like protease is modified from a protease isolated from the group of bacteria consisting of Bacillus caldolyticus, Bacillus sp. EA1, Bacillus thermoproteolyticus, Bacillus acidocaldarius, Bacillus sterothermophilus, Lactobacillus spp., Bacillus cereus, Bacillus megaterium, Bacillus brevis, Bacillus polymyxa, and Bacillus subtilis.

21. An isolated nucleic acid encoding the thermolysin-like protease of claims 1 ,2, 3 or 4.

22. An expression vector comprising the isolated nucleic acid of claim 21.

23. A host cell transformed with the vector of claim 22.

24. A method for producing a thermolysin-like protease having a substrate specificity for a basic amino acid comprising site-directed mutagenesis of a nucleic acid encoding a polypeptide with SEQ ED NO. 1, wherein said site-directed mutagenesis results in an Aspartate or a Glutamate replacement of one or both amino acids at positions Leucine 205 and Phenylalanine 136 within said polypeptide with SEQ ID NO. 1.

25. A method for producing a thermolysin-like protease having a subsfrate specificity for an acidic amino acid comprising site-directed mutagenesis of a nucleic acid encoding a polypeptide with SEQ ED NO. 1, wherein said site-directed mutagenesis results in a lycine or an Arginine replacement of one or both amino acids at positions Leucine 205 and Phenylalanine 136 within said polypeptide with SEQ ID NO. 1.

26. A method for proteolysis comprising contacting a polypeptide template with the thermolysin-like protease of any one of claims 1-16.