WO2004008141A1

WO2004008141A1 - Novel screening method

Info

Publication number: WO2004008141A1
Application number: PCT/JP2003/007501
Authority: WO
Inventors: Shuji Hinuma; Ryo Fujii; Masataka Harada; Masaki Hosoya; Masaaki Mori
Original assignee: Takeda Chemical Industries, Ltd.
Priority date: 2002-07-15
Filing date: 2003-06-12
Publication date: 2004-01-22
Also published as: AU2003242342A1

Abstract

Using a G protein-coupled receptor protein having an amino acid sequence which is the same or substantially the same as an amino acid sequence represented by SEQ ID NO:1, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21 or its salt and a humanin-like peptide, a compound or a salt thereof capable of changing the binding properties of the above receptor protein or its salt to the humanin-like peptide can be efficiently screened.

Description

Description New Screening Method Technical Field

The present invention relates to a screening method for agonist and antagonist using a hummanin-like peptide and a G protein-coupled receptor protein (FPRL1 or FPRL2). Background art

Many physiologically active substances such as hormones and transtransmitters regulate the functions of living organisms through specific receptor proteins present on cell membranes. Many of these receptor proteins transmit intracellular signals through the activity of conjugated guanine nucleotide-binding protein (hereinafter sometimes abbreviated as G protein). Because they have a common structure with a transmembrane region, they are collectively called G protein-coupled receptor one protein or seven transmembrane receptor proteins (7 TMR).

G protein-coupled receptor proteins are present on the surface of various functional cells in living cells and organs, and are used as physiological targets as molecules that regulate the functions of those cells and organs, such as hormones, neurotransmitters and bioactive substances. Plays an important role. The receptor transmits a signal into the cell through binding to a physiologically active substance, and this signal causes various reactions such as suppression of activation and activation of the cell.

To clarify the relationship between substances that regulate complex functions in cells and organs of various organisms and their specific receptor proteins, particularly G protein-coupled receptor proteins, it is necessary to clarify the relationship between cells and organs of various organisms. It will provide a very important tool for drug development that elucidates the functions of these drugs and is closely related to those functions.

For example, in various organs of the living body, physiological functions are regulated under the control of many hormones, hormone-like substances, neurotransmitters or bioactive substances. In particular, bioactive substances exist in various parts of the body, It regulates its physiological functions through corresponding receptor proteins. There are many unknown hormones, neurotransmitters, and other physiologically active substances in living organisms, and the structures of their receptor proteins have not been reported so far. Furthermore, it is often unknown whether subtypes exist in known receptor proteins.

Clarifying the relationship between substances that regulate complex functions in living organisms and their specific receptor proteins is a very important tool for drug development. In addition, in order to efficiently screen agonists and antagonists for receptor proteins and to develop pharmaceuticals, it is necessary to elucidate the functions of receptor protein genes expressed in vivo and express them in an appropriate expression system. Was necessary.

In recent years, as a means of analyzing genes expressed in vivo, studies on the random analysis of cDNA sequences have been actively conducted, and the thus obtained cDNA fragment sequence is expressed in an Expressed Sequence. Registered as a Tag (EST) in the database and published. However, most ESTs have sequence information only, and it is difficult to estimate their functions.

Human F PRL1 is known as one of the orphan G protein-coupled receptor proteins (J. Biol. Chem. 267 (11), 7637-7643 (1992)). The Agonisuto of F PRL 1, which f ML F from bacteria to, ^ 11 ₈ p 4 1 or gp 1 20 partial peptide derived from prion partial peptide, 4 2, An Nexin as endogenous substances Partial peptides such as I partial peptide, Acutephaseprotein, hCAP18, and NADH dehydrogenase, and lipid lipoxin A4 have been reported (Immunopharmacol. Vol. 2, pp. 1-13, 2002).

Alzheimer's disease is a typical neurodegenerative disease with advanced dementia and cognitive dysfunction, but no effective treatment has been found so far. Needless to say, Alzheimer's disease is one of the most important diseases in the aging society, and the development of its therapeutic agent has extremely significant medical economics. Recently, Hashimoto et al. Focused on the fact that there is little lesion in the occipital lobe of patients with Alzheimer's disease, and the “Death trap” method (D, Adamio et al., Semin. Immunol., Vol. 9, pp. 17-23, 1997) A gene that suppresses cell death of nerve cells into which a gene responsible for familial Alzheimer's disease was introduced was cloned from the occipital lobe (Proc. Natl. Acad. Sci. USA, 98, 6 336—634, 2001). Year) . This gene encodes a 24-residue peptide named humanin (WO 0 1/2 1 7 8 7), and the synthetic human anin peptide is used for neuronal cell death in which a familial Alzheimer's disease gene has been introduced. In addition to suppressing neuronal cell death, which is thought to be a possible cause of Alzheimer's disease. It is thought that humanin is secreted extracellularly and acts on nerve cells to suppress cell death, but its receptor has not been revealed.

Α42 is an FPRL 1 agonist, showing chemotaxis via FPRL 1 and the accumulation of FPRL 1 in senile plaques, a characteristic lesion of Alzheimer's disease. I have. These findings suggest a link between FPRL1 and the inflammatory response seen in Alhaima disease (The Journal of Neuroscience, 2001, Vol. 21 RC123).

A] 342 has also been reported to form fibrin aggregates (amyloid-like deposits) by being taken up into macrophage cells via FPRL1 (The FASEB Journal, Vol.15 November 2001, 2454). -2462).

Furthermore, human FPR L2 is known as one of the orphan G protein-coupled receptor proteins (Genomics 13 (2), 437-440 (1992)).

Human FPRL2 has high homology with FPR1, the receptor for fMLF (formy l—Met—Leu_Phe), but human FPRL2 may not react with fMLF. It has been reported. It was also reported that FPR L2 was expressed in monocytes, but not in neutrophils in which FPR 1 and FPRL 1 were expressed (Biochem. Biophys. Res. Commun., 1994 May 30; 201 (1): 174-9).

WP eptide (Trp-Lys-Tyr-Met-Va Met-NH ₂ ) It is an agonist of PRL2, and it has been reported that FPRL2 is highly expressed in monocytes (J. Biol. Chem. 276 (24), 21585-21593 (2001)).

It has been reported that Helicobacter pylori-derived peptide Hp (2-20) is an agonist of FPRL2 and activates monocytes via FPRL1 / FPRL2 (J. Clin. Invest., 2001 Oct; 108 (8): 1221-8).

Dendritic cells (mature and immature), which are a type of antigen-presenting cells, express FPRL2, which retains its function, and may control trafficking of 榭 cells. It has been reported. (J. Leukoc. Biol., 2002 Sep; 72 (3): 598-607).

It has been described that rat type hum a n in has neuroprotective activity (The FASEB Journal, Vol. 16, August 2002, 1331-1333).

Conventionally, substances that inhibit the binding between a G protein-coupled receptor and a physiologically active substance (ie, a ligand), or substances that bind to cause the same signal transduction as a physiologically active substance (ie, a ligand), It has been used as a specific antagonist or agonist as a drug that regulates biological functions. Therefore, determining a specific ligand for a G protein-coupled receptor protein is a very important means for finding agonists and antagonists that can also be targets for drug development.

However, even at present, there are a number of so-called orphan receptors for which G protein-coupled receptors with unknown functions and corresponding ligands have not been identified. The elucidation of functions is eagerly desired.

The G protein-coupled receptor is useful for searching for a new physiologically active substance (that is, a ligand) and for searching for an agonist or antagonist for the receptor using the signal transduction action as an index. Such ligands, agonists or antagonists to these receptors can be expected to be used as preventive / therapeutic agents and diagnostic agents for diseases associated with dysfunction or hyperfunction of G protein-coupled receptors.

Furthermore, based on a gene mutation of a G protein-coupled receptor, Reduced or enhanced receptor function often causes some disease. In this case, the present invention is applied not only to administration of an antagonist or agonist to the receptor, but also to gene therapy by introducing the receptor gene into a living body (or a specific organ) or introducing an antisense nucleic acid against the receptor gene. You can also. In this case, the nucleotide sequence of the receptor is indispensable information for examining the presence or absence of a deletion or mutation in the gene, and the gene of the receptor is used to prevent or treat a disease associated with dysfunction of the receptor. And diagnostics.

The present invention relates to a method for screening a compound (antagonist, agonist) or a salt thereof, which changes the binding property between a humanin-like peptide and FPRL1 or FPRL2, a screening kit thereof, and a screening method thereof. Alternatively, a compound (antagonist, agonist) or a salt thereof that alters the binding of humanin-like peptide to FPRL1 or FPRL2, which can be obtained by using a screening kit, and humanin An object of the present invention is to provide a drug or the like containing a compound (antagonist, agonist) that changes the binding property between a similar peptide and FPRL1 or FPRL2. Disclosure of the invention

The present inventors have conducted intensive studies in order to solve the above-mentioned problems, and as a result, have found that a novel human-like peptide or a salt thereof is a ligand of FPRL1. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention

[1] (1) SEQ ID NO: 1 (human FPRL1), SEQ ID NO: 17 (rat FPRL1), SEQ ID NO: 19 (mouse FPRL2) or SEQ ID NO: 21 (human F PRL 2) G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 2), its partial peptide or its salt (2) humanin analogous peptide or its A salt comprising a receptor protein or a salt thereof and a humanin-like peptide; Or a method of screening for a compound or a salt thereof that alters the binding to a salt or signal transduction thereof,

[2] h uma n i n similar

(1) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 6, or a salt thereof, or

(2) The peptide according to the above (1), which is a peptide consisting of 6 to 20 consecutive amino acids in the amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 6, or a salt thereof. Screening method,

(3) huma nini analogous peptide,

(1) a) an amino acid sequence represented by SEQ ID NO: 6; b) an amino acid sequence in which 1 to 10 amino acids in the amino acid sequence represented by SEQ ID NO: 6 have been deleted; c) SEQ ID NO: 6 An amino acid sequence in which 1 to 10 amino acids have been added to the amino acid sequence represented by: d) an amino acid sequence in which 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 6 have been substituted with other amino acids Or e) a polypeptide comprising an amino acid sequence obtained by combining these deletions, cohesion and substitution, or a salt thereof, or

(2) a) 19th to 24th, 5th to 24th, 1st to 20th, 5th to 20th, 1st to 2nd of amino acid sequence represented by SEQ ID NO: 6 1st or 5th to 21st amino acid sequence, b) amino acid sequence having 1 to 6 amino acids deleted in the amino acid sequence, c) 1 to 6 amino acids added to the amino acid sequence An amino acid sequence, d) an amino acid sequence in which 1 to 6 amino acids in the amino acid sequence have been substituted with another amino acid, e) or an amino acid sequence obtained by combining these deletions and additions. Peptides having an acid number of 6 to 20 (provided that the amino acids represented by SEQ ID NO: 11 or SEQ ID NO: 12 are ninth to twenty-fourth and fifth to twenty-fourths of the amino acid sequence IJ) 1st, 20th, 5th to 20th, 1st to 21st or 5th to 21st Excluding a peptide consisting acid sequence) or a salt thereof screening method described in [1],

(4) huma ni n analog peptide,

(1) a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, or a polypeptide thereof Salt, or

(2) 19th to 24th, 5th to 24th, 1st to 20th, 5th to 20th, 1st to 21st of the amino acid sequence represented by SEQ ID NO: 6 The screening method according to the above (1), which is a peptide comprising the amino acid sequence of the 5th to 21st positions or a salt thereof.

[5] (1) G protein-coupled receptor containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 A protein, a partial peptide or a salt thereof, and (2) a binding or signal transduction between a huinin receptor protein or a salt thereof and a humanin-like peptide or a salt thereof, characterized by containing a humanin-like peptide. A kit for screening a compound or a salt thereof that changes

[6] The same or substantially the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1 and a humanin-like peptide or a salt thereof, which can be obtained by using the screening method described in [1] or the screening kit described in [5]. A compound or a salt thereof that alters the binding property or signal transduction with a G protein-coupled receptor protein or a salt thereof containing the same amino acid sequence,

(7) the compound of the above (6), which is an agonist,

(8) the compound of the above (6), which is an antagonist,

[9] An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 with a human nin analog or a salt thereof A pharmaceutical comprising a compound or a salt thereof that alters the binding or signal transduction with a G protein-coupled receptor protein or a salt thereof,

(10) A preventive / therapeutic agent for a neurodegenerative disease or cerebral dysfunction comprising the agonist according to (7) above,

[11] Alzheimer's disease, Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion disease, Creutzfeldt-Jakob disease, Huntington's chorea, diabetic two euro one, multiple sclerosis, cerebral infarction, cerebral hemorrhage, spider Submembrane hemorrhage, ischemic brain disease, The prophylactic-therapeutic agent according to the above (10), which is an agent for preventing or treating epidural or subdural hematoma.

(12) a cell death inhibitor comprising the agonist according to (7),

[13] (1) G protein conjugate containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 Type receptor protein, its partial peptide or its salt, and (2) a compound or its salt that changes binding or signal transduction between humanin analogous peptide or its salt and the receptor protein or its salt. Screening method for agonists or antagonists against the receptor protein or its salt,

[14] administering an effective amount of the agonist according to [7] to a mammal, (i) a method for preventing or treating a neurodegenerative disease or cerebral dysfunction,

(ii) Alzheimer's disease, Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion disease, Creutzfeldt-Jakob disease, Huntington's chorea, diabetic two eurobachi one, multiple sclerosis, cerebral infarction, cerebral hemorrhage, arachnoid Prevention and treatment of subhemorrhagic bleeding, ischemic brain disease, epidural or subdural hematoma, or (iii) a method of suppressing cell death, and

[15] (i) Prevention and treatment of neurodegenerative diseases or cerebral dysfunction (ii) Alheimer's disease, Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion disease, Kuitsitzfeld-Jakob disease, Huntington's disease Disease, diabetic neuropathy, multiple sclerosis, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, ischemic brain disease, epidural hematoma or subdural hematoma There is provided use of the agonist according to the above [7] for producing an agent.

Further, the present invention provides

[16] (i) having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 G protein-coupled receptor protein (hereinafter abbreviated as FPR LlZF PRL 2), a partial peptide or a salt thereof, and a humanin-like peptide or a salt thereof, and (ii) FPRL 1 FPRL2, its partial peptide or a salt thereof, and a comparison with the case of contacting a humanin analogous peptide or a salt thereof and a test compound, wherein the screening method according to the above (1),

[17] (i) contacting a labeled humanin-like peptide or a salt thereof with FPRL 1 / FPRL2, a partial peptide or a salt thereof, and (ii) a labeled humanin-like peptide or a salt thereof. F PRL 1 / F PRL of labeled humanin analogous peptide or salt thereof when the salt and test compound are contacted with FPRL 1 / F PRL 2, its partial peptide or its salt. Measuring the amount of binding to the peptide or a salt thereof and comparing the amounts, and the screening method according to the above (1),

[18] (i) when a labeled humanin analog peptide or a salt thereof is brought into contact with cells containing FPRL1-FPRL2; and (ii) a labeled humanin analogous peptide or a salt thereof and a test compound. Wherein the amount of the labeled humanin-like peptide or its salt bound to the cells is measured when the cells are brought into contact with cells containing FPRL1 / FPRL2, and the results are compared. (1) the screening method described,

[19] (i) contacting a labeled humanin-like peptide or a salt thereof with a membrane fraction of cells containing FPRLl / F PRL2; and (ii) a labeled humanin-like peptide or a salt thereof. When a salt and a test compound were brought into contact with the membrane fraction of cells containing FPRL1 / FPRL2, the amount of the bound hum anin-like peptide or its salt bound to the membrane fraction of the cells was measured. The screening method according to the above (1), wherein

[20] (i) A transformant obtained by transforming a labeled humanin analogous peptide or a salt thereof with a recombinant vector containing a DNA containing FPRL1 / FPRL2 and a DNA is used. When the cells were brought into contact with FPRL1ZFPRL2 expressed on the cell membrane of the transformant by culturing, and (ii) the labeled humanin-like peptide or its salt and the test compound were expressed on the cell membrane of the transformant. In the case of contact with FPR L 1ZF PRL 2, the labeled human or similar salt of Fuma The screening method according to the above (1), wherein the amount of binding is measured and compared.

[21] (i) contacting a compound or a salt thereof which activates FPR L1 / FPRL 2 with a cell containing FPR L1 / FPR L2; and (ii) FPRL 1 PR To measure and compare FPRL 1 ZFPR L2-mediated cell stimulating activity when a compound that activates L2 or a salt thereof and a test compound are brought into contact with cells containing FPRL1 / FPRL2. The screening method according to the above (1), wherein

[22] culturing a transformant obtained by transforming a compound that activates FPRL1ZFPRL2 or a salt thereof with a recombinant vector containing a DNA containing a DNA encoding FPRL1 / FPRL2. FPRL expressed in the cell membrane of the transformant, and FPRL expressed in the cell membrane of the transformant, a compound that activates FPRLlZFPRL2 or a salt thereof and a test compound. 1 / FPRL 2, when contacted with FPRL 1 / FPRL 2 cell stimulating activity is measured and compared, the screening method according to the above (1),

(23) the screening method according to the above (21) or (22), wherein the compound that activates F PRL lZF PRL 2 is a humanin-like peptide;

(24) the screening kit according to (5) above, which comprises a cell containing FPRL1 FPRL2 or a membrane fraction thereof, and

(25) Contains FPRL1 / FPRL2 expressed on the cell membrane of the transformant by culturing the transformant transformed with the recombinant vector containing DNA encoding FPRL1ZFPRL2 And a screening kit and the like according to the above [5]. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the activity of various concentrations of humanin-like peptide HN 3 (SEQ ID NO: 6) to suppress glutamate-induced cell death on rat adrenal medulla-derived pheochromocytoma cells PC12h. The cell survival rate was 100% in the group without glutamate. Expressed by the ratio at the time. * Indicates that the difference is significant (p <0.05) with respect to the humanin-like peptide HN3 non-added caro group.

FIG. 2 shows the results of examining the dose-dependence of the ligand activity of humanin-like peptide (HN 3) specific to CHO cells expressing FPRL1-GFP receptor by the amount of intracellular cAMP. In contrast to the condition not stimulated by forskolin (B asal), forskolin was added in ΙμΜ (FSK), and HN3 at the concentration shown in the figure (μΜ) was incubated in the presence of forskolin, and intracellular c This is the result of comparing the amount of AMP. Basa1 indicates the case where forskolin (FSK) and ligand were not added. FSK shows the case where forskolin was added. Ligand (M) + FSK shows the case where HN3 and forskolin were added. The numbers on the horizontal axis indicate the concentration (μΜ) of the added HN 3. C AMP (p mo 1 / we 11) on the vertical axis indicates the amount of intracellular c AMP (pmo 1 / we 11).

Figure 3 shows the dose dependence of the ligand activity of the human-like peptide (HN3) specific to CHO cells (mo ck) that do not express FPRL1-GFP receptor by the amount of intracellular cAMP. The results are shown. In contrast to the condition not stimulated by forskolin (Basa 1), forskolin was supplemented with 1 M-added kasum (FSK) and a huma ni η-like peptide (ΗΝ3) at the concentration (μΜ) indicated in the figure. FIG. 4 shows the results of comparing the amount of intracellular cAMP after incubation in the presence of AMP. Basal indicates the case where forskolin (FSK) and ligand were not added. FSK shows the case where forskolin was added. L i g an d (μ +) + F SK indicates the case where HN 3 and forskolin were added. The numbers on the horizontal axis indicate the concentration (μΜ) of the added HN 3. C AMP (pmo 1 / we 11) on the vertical axis indicates the amount of intracellular c AMP (pmo 1 / we 11).

4 measures the intracellular c AMP amount when reacted various ligands into CHO cells expressing the respective receptor protein, EC _5. The value (nM) is shown. EC ₅ . V a 1 ues the EC _5. Indicates a value. Samp 1 e indicates the ligand sample used. HN3 represents humanin-like peptide (HN3) consisting of the amino acid sequence represented by SEQ ID NO: 6. W—Peptide indicates T rp—Lys-Tyr-Me t-V a1 dMe t—NH ₂ (SEQ ID NO: 31) You. dMe t indicates the D field Me t. ] 3 _Amy loid (1-4-2) indicates] 3 mono-amyloid (1-4-2). h FPR 1 indicates human-derived FPRL. hFPRL1 indicates human-derived FPRL1. hFPRL2 indicates human-derived FPRL2. mFPRL2 indicates mouse-derived FPRL2 (FPRL1). rFPRL1 indicates rat-derived FPRL1. > 100 000 indicates a value of 1 000 M or more. BEST MODE FOR CARRYING OUT THE INVENTION

FPRL1 used in the present invention is a receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 .

FPRL2 used in the present invention is a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 21.

FPRL1 or FPRL2 can be, for example, a human mammal (eg, guinea pig, rat, mouse, egret, pig, sheep, pigeon, monkey, etc.), or any cell (eg, spleen cell, nerve cell, Glial cells, knee cells] 3 cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T cells , B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, bone cells, osteoblasts, osteoclasts, breast cells , Hepatocytes or stromal cells, or their precursors, stem cells or cancer cells), blood cells, or any tissue in which these cells are present, such as the brain, Each part of the brain (e.g., olfactory bulb, squamous nucleus, basal sphere, hippocampus, thalamus, hypothalamus, hypothalamus, cerebral cortex, medulla oblongata, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate Nucleus, brain stain, substantia nigra), spinal cord, pituitary, stomach, knee, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), intestinal tract , Blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testicle, testis, ovary, placenta, uterus, bone, joints, skeletal muscle, etc., especially spleen, bone marrow, intestine, single Sphere, ma It may be a protein derived from an immunocompetent organ such as clophage and an immunocompetent cell, or may be a synthetic protein.

Examples of the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 include, for example, SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 And an amino acid sequence having about 85% or more, preferably 90% or more, more preferably about 95% or more homology with the amino acid sequence represented by

The protein of the present invention containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 is, for example, represented by SEQ ID NO: 1. Having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19, and having substantially the same activity as FPRL1 comprising the amino acid sequence represented by SEQ ID NO: 19. Proteins having the same are preferred.

The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 17 is, for example, about 85% or more, preferably 90% or more, more preferably the amino acid sequence represented by SEQ ID NO: 17 An amino acid sequence having about 95% or more homology is exemplified.

Examples of the protein of the present invention having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 17 include, for example, an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 17 And a protein having substantially the same activity as FPRL2 consisting of the amino acid sequence represented by SEQ ID NO: 17 is preferred.

The homology of the amino acid sequences was determined using the homology calculation algorithm NCB I BLAST (National Center for Biotechnol- ogy Function Basement Affinity L e n c i n nt S nt nt Tol) and the following conditions (expected value = 10; Allow gap; Matritas = BLOSUM62; Filtering = OFF).

Substantially equivalent activities include, for example, ligand binding activity, signal information transmission Effect. Substantially the same means that their activities are the same in nature. Therefore, activities such as ligand binding activity and signal transduction activity are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 2 times). However, the quantitative factors such as the degree of these activities and the molecular weight of the protein may be different.

The activities such as the ligand binding activity and the signal transduction activity can be measured according to a method known per se, for example, according to the screening method described later.

Examples of FPRL1 include: a) one or more (preferably about 1 to 30 and more preferably 1 to 30 amino acids in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19; Is about 1 to 10 amino acids, and more preferably several (1 to 5) amino acids are deleted. B) SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 An amino acid having one or more (preferably about 1 to 30, more preferably about 1 to 10, and more preferably several (1 to 5)) amino acids added to the amino acid sequence Sequence, c) 1 or 2 or more (preferably about 1 to 30, more preferably 1 to 10) in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19; About, more preferably several (1-5) amino acids are replaced by other amino acids Been § amino acid sequence, or d), such as protein containing the amino acid sequence comprising a combination thereof may be used.

Examples of FPRL2 include: a) 1 or 2 or more (preferably about 1 to 30, more preferably about 1 to 10, more preferably about 1 to 10) in the amino acid sequence represented by SEQ ID NO: 21; (1-5) amino acids deleted; b) 1 or 2 or more (preferably about 1-30, more preferably 1) in the amino acid sequence represented by SEQ ID NO: 21; An amino acid sequence to which about 10 or more, more preferably several (1 to 5)) amino acids are added; c) one or more (preferably, one or more) in the amino acid sequence represented by SEQ ID NO: 21 About 1 to 30 amino acids, more preferably about 1 to 10 amino acids, and still more preferably several (1 to 5) amino acids in which amino acids are substituted with other amino acids; or d) Combination A protein containing the amino acid sequence of the present invention may also be used.

In the present specification, FPRL1 or FPRL2 has an N-terminus (amino terminus) at the left end and a C-terminus (carboxyl terminus) at the right end according to the convention of peptide notation. SEQ ID NO: FPRL 1 including the FPRL 1 containing the amino acid sequence represented by 1, C-terminal, a carboxyl group (one COOH), Karubokishire bets (one COO-), ami de (- CONH ₂₎ or ester (-COOR).

Here, as R in the ester, e.g., methyl, Echiru, n- propyl Honoré, C -6 alkyl group such as isopropyl or n- butyl, cyclo pentyl, c ₃ _ ₈ cycloalkyl group such as cyclohexyl, for example, Hue - Le, α- C ₆ _ ₁₂ 7 aryl group such as naphthyl, for example, benzyl, phenylene Lou CI- 2 alkyl or alpha-naphthylmethyl etc. alpha-naphthyl, such Fuwenechiru - Ci-2 alkyl group In addition to C ₇ _ ₁₄ aralkyl groups, a bivaloyloxymethyl group commonly used as an oral ester is used.

When FPRL1 or FPRL2 has a carboxyl group (or carboxylate) at a position other than the C-terminus, FPRL1 or FPRL1 of the present invention may have a carboxyl group that is amidated or esterified. Included in PRL 2. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

Furthermore, the FPRL 1 or FPRL 2, in proteins mentioned above, Amino group protecting groups Mechionin residues of N-terminal (e.g., formyl group, C -6 Ashiru group such as C ₂ _ ₆ Arukanoiru group such Asechiru ), The N-terminal is cleaved in vivo, and the daltamyl group formed is pyroglutamine-oxidized, the substituent on the side chain of the amino acid in the molecule (eg, 1 OH, 1 SH, amino group) , imidazole group, indole group, etc. Guanijino group) appropriate protecting groups (e.g., formyl group, C ₂ such Asechiru - those are protected by like C ^ e Ashiru groups such as ₆ Arukanoiru group), or a sugar It also includes complex proteins such as so-called glycoproteins with linked chains.

Specific examples of the FPRL1 of the present invention include, for example, human-derived FPRL1 consisting of the amino acid sequence represented by SEQ ID NO: 1, and amino acid represented by SEQ ID NO: 17. Rat-derived F PRL 1 comprising the amino acid sequence, mouse-derived F PRL 2 comprising the amino acid sequence represented by SEQ ID NO: 19, and the like are used. This human-derived FPR L1 is a known protein described in J. Biol. Chem. 267 (11), 7637-7643 (1992). Mouse-derived FPRL2 is a known protein described in J. Immunol. 169, 3363-3369 (2002).

As a specific example of FPRL2 of the present invention, for example, human-derived FPRL2 consisting of the amino acid sequence represented by SEQ ID NO: 21 is used. This human-derived FPRL2 is a known protein described in Genomics 13 (2), 437-440 (1992).

The partial peptide of FPRL1 or FPRL2 (hereinafter sometimes abbreviated as the partial peptide of the present invention) may be any partial peptide of FPRL1 or FPRL2 described above. For example, a protein molecule of FPRL1 or FPRL2 which is exposed outside the cell membrane and has substantially the same receptor binding activity may be used.

Specifically, a partial peptide of FPRL 1 having the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 or FPRL having the amino acid sequence represented by SEQ ID NO: 21 The partial peptide of 2 is a peptide containing a portion analyzed as an extracellular region (hydrophilic site) in a hydrophobicity plot analysis. Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. The number of amino acids of the partial peptide of the present invention is at least 20 or more, preferably 50 or more, more preferably 100 or more amino acids in the amino acid sequence constituting the receptor protein of the present invention. Peptides are preferred. A substantially identical amino acid sequence refers to an amino acid sequence having about 85% or more, preferably about 90% or more, more preferably about 95% or more homology with these amino acid sequences.

The homology of the amino acid sequence is calculated by the homology calculation algorithm NCB I BLAST (National C enterfor Biotechnology I). It can be calculated using the following conditions (expected value = 10; gap allowed; matrix = B LOSUM62; filtering = OFF) using the nfo raction Basic Alignment Sensor Tool.

Here, “substantially the same receptor activity” has the same meaning as described above. The “substantially the same receptor activity” can be measured in the same manner as described above. Further, the partial peptide of the present invention is characterized in that one or more (preferably about 1 to 10, more preferably several (1 to 5)) amino acids in the above amino acid sequence are deleted, or One or more (preferably about 1 to 20, more preferably about 1 to 10, and more preferably several (1 to 5)) amino acids are added to the amino acid sequence; One or more (preferably about 1 to 10, more preferably several, and still more preferably about 1 to 5) amino acids in the amino acid sequence may be substituted with another amino acid.

In the partial peptide, the C-terminus carboxyl group of the present invention (_COOH), the force Rupokishireto (one COO-), may be any amino-de (_CONH ₂₎ or ester (one C OOR). When the partial peptide of the present invention has a carboxyl group (or carboxylate) at a position other than the C-terminal, the partial peptide of the present invention includes those in which the carboxyl group is amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

Further, the partial peptide of the present invention includes, as in the case of FPRL1 or FPRL2 described above, those in which the amino group of the N-terminal methionine residue is protected with a protecting group, and the N-terminal side is cleaved in vivo. The resulting daltamyl group is pyroglutamic acid, the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or a complex peptide such as a so-called glycopeptide to which a sugar chain is bound Is also included.

Examples of the salt of FPRL1, FPRL2 or a partial peptide thereof of the present invention include a physiologically acceptable salt with an acid or a base, and a physiologically acceptable acid addition salt is particularly preferable. Such salts include, for example, inorganic acids (eg, Salts with hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, conodic acid, tartaric acid, citric acid, malic acid, oxalic acid, Salts with benzoic acid, methanesulfonic acid, and benzenesulfonic acid are used.

The FPRL 1 of the present invention or a salt thereof can be produced from the above-mentioned human mammal cells or tissues by a method for purifying a receptor protein known per se, or the FPRL 1 of the present invention described later. Can also be produced by culturing a transformant containing DNA encoding In addition, the protein can also be produced according to the protein synthesis method described later or according thereto.

When producing from human mammalian tissues or cells, the human mammalian tissues or cells are homogenized, extracted with an acid or the like, and the extract is subjected to reverse-phase mouth chromatography, ion-exchange chromatography. Purification and isolation can be achieved by combining chromatography such as the above.

For the synthesis of the FPRL1 of the present invention or its partial peptide, its salt or its amide, a commercially available resin for protein synthesis can be usually used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, and 4-hydroxy resin. Doxymethylmethylphenylacetamide methyl resin, polyacrylamide resin, 4- (2,, 4'dimethoxyphenyl-1-hydroxymethyl) phenoxy resin, 4- (2,, 4,1-dimethoxyphenyl) (Fmoc aminoethyl) phenoxy resin. Using such a resin, an amino acid having an appropriately protected amino group and side chain functional group is condensed on the resin in accordance with the sequence of the target protein according to various known condensation methods. At the end of the reaction, the protein is cleaved from the resin, and at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the target protein or its amide. Regarding the condensation of the protected amino acids described above, various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Carbodimids include DCC, N, N'-diisopropyl carbodiimide, N- Til—N ′ — (3-dimethylaminoprolyl) carbodiimide is used. For these activations, the ability to add protected amino acids directly to the resin along with racemization inhibitors (eg, HOBt, HOOBt) or pre-protected as symmetrical anhydrides or HOBt esters or HOOBt esters It can be added to the resin after activation of the amino acid.

The solvent used for activation of the protected amino acid or condensation with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methinolepyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, trifluoromethane Alcohols such as ethanol, sulfoxides such as dimethyl sulfoxide, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; An appropriate mixture or the like is used. The reaction temperature is appropriately selected from a range known to be usable for a protein bond formation reaction, and is usually appropriately selected from a range of about 120 to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, if the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained even by repeating the reaction, an unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole.

Examples of the protecting group for the starting amino group include Z, Boc, tertiarynyloxycanolebonyl, isobonolenyloxycarbonyl, 4-methoxybenzyloxycarbol, CI—Z, Br_Z , Adamantyloxycarbonyl, trifinoleoloacetyl, phthaloyl, honoleminole, 2-nitrophenylsnolephenyl, diphenylphosphinochioil, Fmoc and the like.

The carboxyl group may be, for example, alkyl esterified (for example, methyl, ethyl, propynole, butynole, tertiary butynole, cyclopentynole, cyclohexynole, linear, branched such as cycloheptyl, cyclooctyl, 2-adamantyl, etc.). Or cyclic alkyl esterification), aralkyl esterification (eg, benzyl Estenolle, 4-Nitrobenzinoleste / re, 4-Methoxybenzinolestenole, 4—Cross-opening benzenolestenole, Benzhi Dorinolestenoraye), fenacinolestesterylation, benzyloxycarbonyle It can be protected by drazidation, tert-butoxycarbonyl hydrazide, tritinolehydrazide, etc. The hydroxyl group of serine can be protected, for example, by esterification or etherification. As a group suitable for this esterification, for example, a lower alkanol group such as an acetyl group, an arylo group such as a benzoyl group, a group derived from carbonic acid such as a benzyloxycarbonyl group, an ethoxycarbonyl group, and the like are used. Examples of a group suitable for etherification include a benzyl group, a tetrahydrobiranyl group, and a t-butyl group.

The protecting group of the phenolic hydroxyl group of tyrosine, for _{example, B z 1, C 1 2} - B zl, 2- nitrobenzyl, B r-Z, such as tertiary butyl Ru is used.

As a protecting group for imidazole of histidine, for example, Tos, 4-methoxy2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethinole, Bum, Boc, Trt, Fmoc and the like are used.

Examples of activated carboxyl groups in the raw materials include, for example, corresponding acid anhydrides, azides, and active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichloromouth phenol, 2,4-dinitrophenol) Esters with phenol, cyanome tyranolecol, noranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalide / imido, and HOBt). For example, the corresponding phosphoramide is used as the raw material of the active amino group.

Methods for removing (eliminating) protecting groups include, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, or hydrogen fluoride anhydride or methanesulfonic acid. Acid treatment with trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and sodium in liquid ammonia Reduction is also used. The elimination reaction by the acid treatment is as follows: In general, the reaction is carried out at a temperature of about −20 to 40 ° C. In the acid treatment, for example, anisol, phenanol, thioanisole, meth-cresol, noracresol, dimethylsulfone, 1,4-butanedithio-one It is effective to add a cation scavenger such as 1,2-ethanedithionole and the like. In addition, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is replaced with the above 1,2-ethanedithiol, In addition to deprotection by acid treatment in the presence of 4-butanedithiol, etc., it is also removed by alkali treatment with dilute sodium hydroxide solution or dilute ammonia.

The protection of the functional group which should not be involved in the reaction of the raw material, the protection group, the elimination of the protective group, and the activation of the functional group involved in the reaction can be appropriately selected from known groups or known means.

As another method for obtaining an amide form of a protein, for example, after protecting the α-carboxyl group of the carboxy terminal amino acid by amidation, a peptide (protein) chain is added to the amino group side to a desired length. After the elongation, a protein in which only the protecting group of the amino terminus at the Ν-terminal of the peptide chain was removed and a protein in which only the protecting group of the carboxyl group at the C-terminus was removed were produced. Condensate in a mixed solvent. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude protein. This crude protein is purified by making use of various known purification means, and the main fraction is freeze-dried to obtain an amide of the desired protein.

To obtain an ester of a protein, for example, after condensing the _α -force carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, the ester of the desired protein can be obtained in the same manner as the amide of the protein. You can get the body. The partial peptide of FPRL1 of the present invention or a salt thereof can be produced according to a known peptide synthesis method, or by cleaving FPRL1 of the present invention with an appropriate peptide. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the FPR of the present invention The desired peptide can be produced by condensing a partial peptide or amino acid capable of constituting L1 with the remaining portion, and if the product has a protecting group, removing the protecting group. Examples of known condensation methods and elimination of protecting groups include the methods described in the following a) to e).

a) M. Bodanszky and M. A. 0ndetti, Peptide Synthesis

Synthesis), Interscience Publishers, New York (1966)

b) Schroeder and Luebke, The Peptide, Academic Press, New York (1965)

c) Nobuo Izumiya et al., Fundamentals and Experiments of Peptide Synthesis, Maruzen Co., Ltd. (1975) d) Haruaki Yajima and Shunpei Sakakibara, Biochemistry Laboratory Course 1, Protein Chemistry IV, 205,

(1977)

e) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten After the reaction, this method combines ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. The partial peptides of the invention can be purified and isolated. When the partial peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method. Conversely, when the partial peptide obtained by a salt is a free form, it can be converted to a free form by a known method. Can be converted. FPR L2, its partial peptide or its salt of the present invention can also be produced by the same method as described above.

The polynucleotide encoding FPRL1 or FPRL2 of the present invention includes a polynucleotide containing the above-described nucleotide sequence (DNA or RNA, preferably DNA) encoding FPRL1 or FPRL2 of the present invention. Anything can be used. The polynucleotide is a DNA encoding FPRL1 or FPRL2 of the present invention, RNA such as mRNA, and may be double-stranded or single-stranded. In the case of double-stranded, double-stranded DNA, double-stranded RNA or DNA: RNA hybrid may be used. In the case of a single strand, it may be a sense strand (ie, a coding strand) or an antisense strand (ie, a non-coding strand).

Using the polynucleotide encoding FPR L1 or F PRL 2 of the present invention For example, by quantifying the mRNA of FPRL1 or FPRL2 of the present invention by the method described in the known experimental medicine special edition "New PCR and its application" 15 (7), 1997 or a method analogous thereto. be able to.

Examples of the DNA encoding FPRL1 or FPRL2 of the present invention include genomic DNA, genomic DNA library, cDNA from cells and tissues described above, cDNA library from cells and tissues described above, and synthetic DN. Any of A may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using a total RNA or mRNA fraction prepared from the above-mentioned cells and tissues.

Specifically, as the DNA encoding the FPR L1 of the present invention, for example, a DNA or a sequence comprising the base sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 It has a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 2 under high stringent conditions, and comprises an amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 Any DNA may be used as long as it encodes a receptor protein having substantially the same activity as PRL1 (eg, ligand binding activity, signal transduction activity, etc.). Examples of the DNA capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 include, for example, the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 And DNA containing a nucleotide sequence having a homology of about 85% or more, preferably about 90% or more, more preferably about 95% or more.

Examples of the DNA encoding the FPR L2 of the present invention include, for example, a DNA containing the nucleotide sequence represented by SEQ ID NO: 22 or a DNA sequence hybridizing with the nucleotide sequence represented by SEQ ID NO: 22 under high stringent conditions. Which encodes a receptor protein having an activity similar to that of FP L2 consisting of the amino acid sequence represented by SEQ ID NO: 21 (eg, ligand binding activity, signal transduction action, etc.) Any DNA may be used as long as it is DNA. Examples of the DNA capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 22 include, for example, about 85% or more, preferably about 90% or more, more preferably about 95% or more with the nucleotide sequence represented by SEQ ID NO: 22 For example, DNA having a nucleotide sequence having homology to the DNA is used.

The homology of the nucleotide sequences was determined using the homology calculation algorithm NCB IB LAST (Natlona 1 C enterior Biotechnology Information Base Acid Alignment Search Tool) under the following conditions (expected value = 10; Gap is allowed; filtering = ON; match score = 1; mismatch score = -3).

Hybridization is carried out according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). You can do it. When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, the reaction can be performed under high stringency conditions.

The high stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM, and a temperature of about 50 to 70 ° C, preferably about 60 to 65 ° C. Indicates conditions. In particular, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C. is most preferable.

More specifically, as the DNA encoding human FPRL1 consisting of the amino acid sequence represented by SEQ ID NO: 1, a DNA consisting of the base sequence represented by SEQ ID NO: 2 or the like is used. As the DNA encoding rat FPRL1 consisting of the amino acid sequence represented by SEQ ID NO: 17, a DNA consisting of the base sequence represented by SEQ ID NO: 18 or the like is used. As the DNA encoding mouse FPRL2 comprising the amino acid sequence represented by SEQ ID NO: 19, a DNA comprising the base sequence represented by SEQ ID NO: 20 and the like are used. As the DNA encoding human FPRL2 comprising the amino acid sequence represented by SEQ ID NO: 21, a DNA comprising the base sequence represented by SEQ ID NO: 22 or the like is used. You.

A polynucleotide comprising a part of the base sequence of DNA encoding FPR L1 or FPR L2 of the present invention or a part of a base sequence complementary to the DNA is defined as the following of the present invention. It is used to include not only DNA encoding a partial peptide but also RNA.

According to the present invention, an FPRL in which an antisense polynucleotide (nucleic acid) capable of inhibiting replication or expression of the FPRL1 gene or the FPRL2 gene has been cloned or determined. It can be designed and synthesized based on the nucleotide sequence information of DNA encoding 1 or FPRL2. Such a polynucleotide (nucleic acid) can hybridize with RNA of the FPRL1 gene or FPRL2 gene, and can inhibit the synthesis or function of the RNA, or FPRL1-related RNA or The expression of the FPRL1 gene or the FPRL2 gene can be regulated and controlled through the interaction with the FPRL2-related RNA. Polynucleotides that are complementary to a selected sequence of FPRL1-related RNA or FPRL2-related RNA, and that can specifically hybridize with FPRL1-related RNA or FPRL2-related RNA, are in vivo and in vivo. It is useful for regulating and controlling the expression of FPRL1 gene or FPRL2 gene outside, and is also useful for treating or diagnosing diseases. The term "corresponding" means having homology or being complementary to a specific sequence of nucleotides, base sequences or nucleic acids including genes. The “correspondence” between a nucleotide, nucleotide sequence or nucleic acid and a peptide (protein) is defined as the amino acid of the peptide (protein) in the directive derived from the nucleotide (nucleic acid) sequence or its complement. Usually pointing. FPRL 1 gene or FPRL 2 gene 5, terminal hairpin loop, 5, terminal 6— ^ ^ —spare 'repeat, 5, terminal untranslated region, polypeptide translation start codon, protein coding region, ORF translation start codon, 3 The 'end untranslated region, the 3' end palindrome region, and the 3 'end hairpin loop may be selected as preferred regions of interest, but any region within the FPRL1 gene or FPRL2 gene may be selected.

To hybridize with the target nucleic acid in a complementary manner to at least a part of the target region The relationship between the target polynucleotide and the target can be said to be "antisense" with the subject. Antisense 'polynucleotides are polydeoxyribonucleotides containing 2-dexoxy-D-ribose, polyribonucleotides containing D-ribose, N-daricosides of purine or pyrimidine bases. Or other polymers having a non-nucleotide backbone (eg, commercially available protein nucleic acids and synthetic sequence-specific nucleic acid polymers) or other polymers containing special bonds (provided that the polymer is Pairing of bases as found in DNA and RNA (contains nucleotides having a configuration that allows base attachment)). They can be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, and even DNA: RNA hybrids, and can be unmodified polynucleotides (or unmodified oligonucleotides), or even known. With modifications of, for example, those labeled in the art, capped, methylated, one or more natural nucleotides replaced by analogs, intramolecular nucleic acids Modified, such as those with uncharged bonds (eg, methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged or sulfur-containing bonds (eg, phosphorothioate, Those having a phospholipid dithioate), such as proteins (nucleases, nucleases, inhibitors, toxins, Antibodies, signal peptides, poly (L-lysine, etc.) or sugars (for example, monosaccharides), etc., which have side chain groups, or those with an interactive compound (for example, acridine, psoralen, etc.), chelates Those containing compounds (eg, metals, radioactive metals, boron, oxidizing metals, etc.), those containing alkylating agents, those with modified bonds (eg, α-anomeric nucleic acids, etc.) It may be. Here, “nucleoside”, “nucleotide” and “nucleic acid” may include not only those containing purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleotides and modified nucleotides also The sugar moiety may be modified, for example, one or more hydroxyl groups may be substituted with a halogen and a force or an aliphatic group, or may be converted to a functional group such as ether or amine.

The antisense 'polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA). Specific examples of modified nucleic acids include sulfur derivatives of nucleic acids, thiophosphate derivatives, and polynucleoside amides, which are resistant to degradation of oligonucleoside amides, but are not limited thereto. Absent. The antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, to make the antisense nucleic acid more stable in the cell, to make the antisense nucleic acid more cell permeable, to have a greater affinity for the target sense strand, and to be more toxic if it is toxic. Minimize the toxicity of sense nucleic acids.

Thus, many modifications are known in the art, for example, J. Kawakarai et al., Pharm Tech Japan, Vol. 8, pp. 247, 1992; Vol. 8, pp. 395, 1992; ST Crooke et al. Ed. , Antisense Research and Applications, CRC Press, 1993.

The antisense nucleic acids of the present invention may contain altered or modified sugars, bases, or bonds, and may be provided in special forms such as ribosomes or microspheres, applied by gene therapy, or added. Can be given in a written form. Thus, in the form of addition, polycations such as polylysine, which acts to neutralize the charge of the phosphate skeleton, and lipids, which increase the interaction with the cell membrane or increase the uptake of nucleic acids ( For example, phospholipids, cholesterol, etc.). Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chromate formate, cholic acid, etc.). Such a substance can be attached to the 3 'end or 5' end of a nucleic acid, and can be attached via a base, sugar, or intramolecular nucleoside bond. Other groups include cap groups specifically located at the 3 'or 5' end of nucleic acids that prevent degradation by nucleases such as exonuclease and RNase. Can be Such capping groups include, but are not limited to, hydroxyl-protecting groups known in the art, including dalicol such as polyethylene glycol and tetraethylene glycol.

The antisense nucleic acid inhibitory activity can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of a G protein-coupled receptor protein. it can. The nucleic acid can be applied to cells by various methods known per se.

The DNA encoding the partial peptide of FPRL1 of the present invention may be any DNA as long as it contains the base sequence encoding the partial peptide of FPRL1 of the present invention described above. There may be. Further, it may be any of genomic DNA, genomic DNA library, cDNA derived from the above-mentioned cells and tissues, cDNA library derived from the above-described cells and tissues, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid, and the like. Alternatively, the mRNA fraction can be amplified by reverse transcriptase polymerase chain reaction (hereinafter abbreviated as RT-PCR method) using the prepared mRNA fraction from the cells and tissues described above.

Specifically, the DNA encoding the partial peptide of FPRL1 of the present invention includes, for example, (1) a base represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 A DNA having a partial base sequence of DNA having a sequence, or (2) a base sequence which hybridizes with a base sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 under high stringent conditions. And has substantially the same activity as FPRL 1 consisting of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17 or SEQ ID NO: 19 (eg, ligand binding activity, signal information transmitting action, etc.) A DNA having a partial base sequence of DNA encoding a receptor protein or the like is used.

Nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 Examples of the hybridizable DNA include, for example, the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 18 or SEQ ID NO: 20 It contains a nucleotide sequence having a homology of 85% or more, preferably about 90% or more, more preferably about 95% or more. DNA is used.

Examples of the DNA encoding the partial peptide of FPRL2 of the present invention include: (1) DNA having a partial nucleotide sequence of DNA having the nucleotide sequence represented by SEQ ID NO: 22, or (2) SEQ ID NO: 22 Has a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 21, and has substantially the same activity as FPRL2 consisting of the amino acid sequence represented by SEQ ID NO: 21 (eg, ligand binding) For example, a DNA having a partial nucleotide sequence of a DNA encoding a receptor protein having activity, signal transduction, etc.) may be used.

Examples of the DNA capable of hybridizing the base sequence represented by SEQ ID NO: 22 include, for example, about 85% or more, preferably about 90% or more, and more preferably about 95% or more homology with the base sequence represented by SEQ ID NO: 22 DNA containing a nucleotide sequence having the following sequence is used.

The homology of the nucleotide sequences was determined using the homology calculation algorithm NCB I BLAST (National C enterfor Biotechnology Inf olution Basin L ic lic n nt nt S nt nt To ol) using the following conditions (expected value = 10; The gap can be calculated; filtering = ON; match score = 1; mismatch score = -3).

Hybridization is carried out according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). You can do it. When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be carried out under high stringent conditions.

The high stringent conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM, and a temperature of about 50 to 70 ° C, preferably about 60 to 65 ° C. Are shown. In particular, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C. is most preferable.

FPR L1 of the present invention or a partial peptide thereof (hereinafter abbreviated as FPRL1) FPRL2 of the present invention or FPRL2 or a partial peptide thereof (hereinafter sometimes abbreviated as FPRL2) may be cloned by FPRL1 or FPRL2 of the present invention. The ability to amplify by the PCR method using a synthetic DNA primer having a partial nucleotide sequence of PRL2, or a part of FPRL1 or FPRL2 of the present invention is obtained by incorporating DNA incorporated in an appropriate vector. Can be selected by hybridization with a DNA fragment encoding the entire region or labeled with a synthetic DNA. Hybridization can be performed according to, for example, the method described in Molecular 'Cloning (Molecular Cloning) 2nd (J. Sarabrook et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.

DNA base sequence conversion can be performed using PCR or a known kit such as Mutan ™ -super Express Km (Takara Shuzo Co., Ltd.) or Mutan ™ -K (Takara Shuzo Co., Ltd.). The method can be performed according to a method known per se, such as the LA PCR method, the Gappedduplex method, the Knuckle 1 method, or a method analogous thereto.

The cloned DNA encoding FPRL1 or FPRL2 can be used as it is or, if desired, digested with a restriction enzyme or added with a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 ′ end, and TAA, TGA or TAG as a translation stop codon at the 3 ′ end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter.

The expression vector of FPRL1 or FPRL2 of the present invention may be prepared by, for example, (a) cutting out a DNA fragment of interest from DNA encoding FPRL1 or FPRL2 of the present invention; Is ligated downstream of the promoter in an appropriate expression vector.

Examples of the vector include plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), and plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC1). 94), yeast-derived plasmid (eg, pSH19, pSH 15) Batteriophages such as phage, animal viruses such as retrovirus, vaccinia virus and baculovirus, pAl-11, pXT1, pRc / CMV, pRc / RSV, pc DNAI ZN eo is used.

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, SRa promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter and the like can be mentioned.

Among them, it is preferable to use the CMV promoter, the SRa promoter and the like. If the host is a bacterium belonging to the genus Escherichia, the trp promoter, lac promoter, recA promoter, P _L promoter, lpp promoter, etc. are used.If the host is a bacterium belonging to the genus Bacillus, the SPO1, SPO2, and pen P promoters are used. For example, when the host is yeast, a PH05 promoter, a PGK promoter, a GAP promoter, an ADH promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferred.

The expression vector may contain, in addition to the above, an enhancer, a splicing signal, a polyA addition signal, a selection marker, and an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), if desired. Can be used. As the selection marker, for example, dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [Mesotorekise Ichito (MTX) resistance], ampicillin resistant gene (hereinafter sometimes abbreviated as Amp ^r), neomycin resistant gene (hereinafter sometimes abbreviated as Ne o ^r, G418 resistance). In particular, when the dhfr gene is used as a selection marker using CHO (dhfr-) cells, the target gene can be selected even on a thymidine-free medium.

If necessary, a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. If the host is Escherichia, Pho A • signal sequence, Omp A signal sequence, etc., if the host is Bacillus, α-amylase signal sequence, subtilisin signal sequence, etc., if the host is yeast, MFa signal sequence, When the host is an animal cell, such as the SUC2 signal sequence, an insulin signal sequence, an α_interferon signal sequence, an antibody molecule and a signal sequence can be used.

A transformant can be produced using the vector containing the DNA encoding FPRL1 or FPRL2 of the present invention thus constructed. As the host, for example, Escherichia bacteria, Bacillus bacteria, yeast, insect cells, insects, animal cells, and the like are used.

Specific examples of the genus Escherichia include Escherichia coli K12. DH1 [Processing's of the National 'Academy' of 'Sciences of the' SA ' (Proc. Natl. Acad. Sci. USA), 60 vol., 160 (1968)], JM103 [Nucleic Acids Research, 9 vol., 309 (1981)], JA 2 2 1 [Journal of Molecular Biology, 120, 5 17 (1 978)], Ι Ι ジャーナルジャーナル [Journal of Molecular Biology. , 41, 459 (1969)], C600 [Genetics, 39, 440 (1954)], and the like. Examples of Bacillus bacteria include, for example, Bacillus subtilis MI 114 (Gene, 24 vol., 255 (1983)), 20 7-21 (Journal of Biochemistry). Biochemistry), 95 vol., 87 (1 984)].

Examples of yeast include Saccharomyces cerevisiae AH22, AH22R—, NA87—11A, DKD—5D, 20B—12, and Schizosaccharomyces pombe NC YC1. 9 13 3, NCYC 2036, Pichia pastoris, etc. are used.

As insect cells, for example, when the virus is Ac NPV, Derived cell lines (Spodoptera frugiperda cells; Sf cells), MG1 cells derived from Trichoplusia midgut, High Five ^TM cells derived from Trichoplusia ni eggs, cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used. . When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) or the like is used. Examples of the Sf cell include Sf9 cell (ATCC CRL1711), Sf21 cell (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like. Used.

As insects, for example, silkworm larvae are used [Maeda et al., Nature, Vol. 315, 592 (1985)].

Examples of animal cells include monkey cell COS-7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), dhfr gene-deficient Chinese hamster cell CHO (hereinafter abbreviated as CHO (dhfr-) cell). Mouse L cells, mouse At T_20, mouse myeloma cells, rat GH3, human FL cells, and the like.

For transformation of Escherichia, for example, Proc. Natl. Acad. Sci. USA (Proc. Natl. Acad. Sci. USA) , 69, 2110 (1972) and Gene (17), 107 (1982).

Transformation of Bacillus sp. Can be performed, for example, according to the method described in Molecular & General Genetics; 168%, 11 (1979). .

To transform yeast, see, for example, Methods in Enzymology, Vol. 194, 182—187 (1991), Processings of the National Academy of Sciences. · Sciences · Ob 'The'S.A. (Proc. Natl. Acad. Sci. USA), Vol. 75, 1929 (1978).

Insect cells or insects can be transformed by, for example, the method described in Bio / Technology, 6, 47-55 (1988). Can be.

In order to transform animal cells, for example, Cell Engineering Separate Volume 8 New Cell Engineering Experiment Protocol. 263-26 7 (19995) (published by Shujunsha), Virology, 5 It can be carried out according to the method described in Vol. 2, 456 (1973). Thus, a transformant transformed with the expression vector containing DNA encoding FPRL1 or FPRL2 is obtained.

When culturing a transformant whose host is a bacterium belonging to the genus Escherichia or Bacillus, a liquid medium is suitable as a medium for cultivation, and a carbon source necessary for the growth of the transformant is contained therein. , Nitrogen sources, inorganic substances and others. Examples of the carbon source include glucose, dextrin, soluble starch, and sucrose.Examples of the nitrogen source include ammonium salts, nitrates, cornchea liqueur, peptone, casein, meat extract, soybean meal, Inorganic or organic substances such as potato extract and inorganic substances include, for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

Examples of a medium for culturing Escherichia bacteria include, for example, an M9 medium containing glucose and casamino acids (Miller, Journal of Ob's Journal of Molecular Genetics). in Molecular Genetics), 431-143, Cold Spring Harbor Laboratory, New York 197 2]. If necessary, an agent such as, for example, 3] 3-r-ndolylacrylic acid can be added to make the promoter work efficiently.

When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.

When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours, and if necessary, aeration and stirring can be applied.

When culturing a transformant in which the host is yeast, for example, Burkholder's minimal medium [Bostian, K. Shira, Prosessing's, The National 'Academy', Sciences Of The You Natl. Acad. Sci. USA), ₇₇ , 4505 ( ₁₉₈₀ )] or an SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings. · The National 'Academy' of 'Sciences' · Prof. Natl. Acad. Sci. USA, 81, 5330 (1 984)]. The pH of the medium is preferably adjusted to about 5-8. Culture is usually performed at about 20 to 35 ° C for about 24 to 72 hours, and aeration and agitation are added as necessary. When culturing an insect cell or a transformant whose host is an insect, the medium used was 10% immobilized in Grace's Insect Medium (Grace, TCC, Nature, 195, 788 (1962)). A mixture to which additives such as sera are appropriately added is used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and agitation are added as necessary.

When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122, 501, (1952). )], DMEM medium [Virology, 8, 396 (1959)], RPM I 1640 medium [Journal of the American Medical Association (The Journal of the American Medical Association)] Proceding of the Society for the Biological Medicine, Volume 99, 5 19 (1967)], 199 Medium [Proceding of the Society for the Biological Medicine], Volume 73, 1 (1 950)] is used. Preferably, the pH is about 6-8. The cultivation is usually performed at about 30 to 40 ° C for about 15 to 60 hours, and aeration and stirring are added as necessary.

As described above, the FPRL1 or FPRL2 of the present invention can be produced in the transformant, inside the cell membrane, or outside the cell.

The FPRL1 or FPRL2 of the present invention can be separated and purified from the culture by, for example, the following method.

When FPRL1 or FPRL2 of the present invention is extracted from cultured cells or cells, after culturing, the cells or cells are collected by a known method, and the cells are suspended in an appropriate buffer solution. Disrupt cells or cells by sonication, lysozyme and Z or freeze-thaw, and then centrifuge or filter for FPRL1 or FPR A method of obtaining a crude extract of L2 or the like is appropriately used. A protein modifier such as urea or hydrochloric grayed Anijin The buffer, a surfactant such as Triton X- 1 00 ^TM may be included. When FPRL1 or FPRL2 is secreted into the culture solution, after the culture is completed, bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected.

Purification of FPRL1 or FPRL2 contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SD s-polyacrylamide gel electrophoresis. Mainly using difference in molecular weight, Method using charge difference such as ion exchange chromatography, Method using specific novelty such as affinity chromatography, Hydrophobic such as reverse phase high performance liquid chromatography A method utilizing the difference in gender, a method utilizing the difference in isoelectric points such as isoelectric focusing, etc. are used.

When FPR L1 or FPR L2 thus obtained is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when it is obtained in a salt form. Can be converted into a free form or another salt by a method known per se or a method analogous thereto.

Prior to or after purification, FPRL1 or FPRL2 produced by the recombinants may be arbitrarily modified or partially removed by the action of an appropriate protein-modifying enzyme. You can also. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used.

The activity of the thus produced FPRL 1 or FPRL 2 of the present invention can be measured by a binding experiment with a labeled ligand (a humanin-like peptide) and an enzymimnoassay using a specific antibody. .

The ligand of FPRL1 or FPRL2 of the present invention is a human-like peptide or a salt thereof.

The amino acid sequence represented by SEQ ID NO: 6 Polypeptides containing the same or substantially the same amino acid sequence as the sequence (hereinafter abbreviated as humanin-like peptides) and the like are used.

Humanin-like peptides can be found in cells of human non-human warm-blooded animals (eg, guinea pigs, rats, mice, chicks, egrets, pigs, hidges, dogs, monkeys, etc.) (eg, hepatocytes, spleen cells, Nerve cells, glial cells, knee / 3 cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages , T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, bone cells, osteoblasts, osteoclasts , Mammary cells, or stromal cells, or their precursors, stem cells or cancer cells, etc.) or any tissue in which those cells are present, for example, the brain, parts of the brain (Eg, olfactory bulb, nucleus pronucleus, basal ganglia, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum), spinal cord, pituitary, stomach, knee, kidney, liver, gonad, thyroid, gall bladder, bone marrow , Adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, salivary gland, peripheral blood, prostate, testicle, ovary, placenta, uterus, bone, cartilage, joint, skeletal muscle Or the like, may be a recombinant polypeptide, or may be a synthetic polypeptide.

"Substantially identical" refers to the activity of a peptide similar to humanin, for example, cell death inhibitory action (eg, inhibitory action on cell death associated with various diseases), cell survival maintaining action, or neurodegenerative disease, cancer, immune disease, infection It means that the physiological characteristics such as the preventive / therapeutic activity (effect) of diseases, gastrointestinal diseases, cardiovascular diseases, endocrine diseases, etc. are substantially the same. Unless amino acid substitutions, deletions, additions or insertions cause a significant change in the physiological or chemical properties of the polypeptide, the substituted, deleted, added or inserted polypeptide is Substantially identical to those without substitutions, deletions, additions or insertions. Substantially the same amino acid substitution in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs.

Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, norkuline, proline, phenylalanine, tryptophan and methionine. I can do it. Polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Examples of positively charged (basic) amino acids include arginine, lysine, and histidine. Examples of negatively charged (acidic) amino acids include aspartic acid and dartamic acid.

As an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 6, a polypeptide comprising the amino acid sequence is a human amino acid sequence comprising the amino acid sequence represented by SEQ ID NO: 6. It is not particularly limited as long as it has substantially the same activity (property) as the similar peptide. For example, about 80% or more, preferably about 85% or more of the amino acid sequence represented by SEQ ID NO: 6; More preferred are amino acid sequences having about 90% or more, most preferably about 95% or more homology.

The amino acid sequence homology was determined using the homology calculation algorithm NCB IB LAST (National C enterfor Biotechnology Informa tion Basement L ic lic n nt S e n t ic T ool) under the following conditions (expected value = 10 ; Allow gaps; matrix = B LOSUM62; filtering = OFF).

Examples of the above-mentioned substantially equivalent activities (properties) include, for example, a cell death inhibitory effect of a human-like peptide containing the amino acid sequence represented by SEQ ID NO: 6 (eg, against cell death associated with various diseases). Suppressive action), cell survival maintaining action, or qualitatively qualitatively the preventive and therapeutic activity (action) of neurodegenerative disease, cancer, immune disease, infectious disease, gastrointestinal disease, cardiovascular disease, endocrine disease, etc Indicates that there is.

Further, more specifically, as a huma ni η-like peptide containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 6, for example, a) the amino acid sequence represented by SEQ ID NO: 6 An amino acid sequence in which one or two or more amino acids (for example, about 1 to 10, preferably about 1 to 6, more preferably about 1 to 3, and more preferably 1 or 2) have been deleted B) one or more amino acid sequences represented by SEQ ID NO: 6 (for example, about 1 to 10 Or about 1 to 6, more preferably about 1 to 3, and still more preferably 1 or 2) amino acids, c) 1 of the amino acid sequence represented by SEQ ID NO: 6 Or an amino acid sequence in which two or more (for example, about 1 to 5, more preferably about 1 to 3, and more preferably 1 or 2) amino acids are substituted with another amino acid, or d) their deletion · Includes polypeptides consisting of amino acid sequences combining addition and substitution, etc., but also SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 Alternatively, it does not include the polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 16.

When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.

Specifically, as the human analog-like peptide, a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 6 and the like are used.

The human-like analogous peptide may be a partial peptide of the above-mentioned polypeptide. As the partial peptide of the humanin-like peptide, any partial peptide of the above-mentioned humanin-like peptide may be used.For example, the partial peptide may be substantially the same as the humanin-like peptide. Activity ("substantially the same activity" has the same meaning as described above) is preferably used.

More specifically, the partial peptide of the human-like peptide is, for example, a partial peptide of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 6 described above. And preferably about 6 to 20 consecutive amino acids in the amino acid sequence represented by SEQ ID NO: 6 or more preferably about 6 to 15 consecutive amino acids, more preferably For example, a partial peptide consisting of about 6 to 10 amino acid sequences is used.

“Substantially the same” means “substantially the same j” in the description of the above-mentioned humanin-like peptide.

More specifically, as a partial peptide of the humanin analogous peptide, for example, a) about 6 to 20, preferably about 6 to 15 in the amino acid sequence represented by SEQ ID NO: 6, More preferably, a peptide consisting of about 6 to 10 amino acid sequences, or b) one or more amino acids in the amino acid sequence (eg, 1 to 6 Degree, preferably about 1 to 3, more preferably 1 or 2) amino acid sequence, c) 1 or 2 or more amino acids in the amino acid sequence (eg, about 1 to 6, preferably 1) An amino acid sequence to which about 3 or more, more preferably 1 or 2) amino acids are added; d) 1 or 2 or more amino acids in the amino acid sequence (e.g., about 1 to 6, preferably about 1 to 3; More preferably, it includes an amino acid sequence in which one or two amino acids have been substituted with another amino acid, or e) a partial peptide comprising an amino acid sequence obtained by combining deletion, addition and substitution thereof. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited. However, the above substitution does not include the substitution of the amino acid at position 3, 12, 14, 15, 16 or 24 in the amino acid sequence represented by SEQ ID NO: 6.

Specific examples of partial peptides of humanin-like peptides include, for example, a) ninth to twenty-fourth, fifth to twenty-fourth, and first to amino acid sequences represented by SEQ ID NO: 6. 20th, 5th to 20th, 1st to 21st, or 5th to 21st amino acid sequences, or b) One or more than one amino acid sequence in the amino acid sequence ( For example, about 1 to 6, preferably about 1 to 3, more preferably 1 or 2) amino acid sequence deleted c) 1 or 2 or more amino acids in the amino acid sequence (eg, 1 to 6 About, preferably about 1 to 3, more preferably 1 or 2) amino acid sequence; d) 1 or 2 or more amino acids in the amino acid sequence (eg, about 1 to 6, preferably about 1 to 2) Amino acid sequence in which 1 to 3 amino acids have been substituted with another amino acid, more preferably 1 or 2 amino acids Or e) consisting of an amino acid sequence obtained by combining deletion, addition and substitution thereof, wherein the number of amino acids is about 6 to 20, preferably about 6 to 15, and more preferably 6 to 10 And partial peptides having a certain degree. However, the above substitution does not include the substitution of the amino acid at position 3, 12, 14, 15, 15, 16 or 24 in the amino acid sequence represented by SEQ ID NO: 6.

As more preferred specific examples of the partial peptide of the human-like peptide, for example, ninth to twenty-fourth (SEQ ID NO: 9), fifth to twenty-fourth of the amino acid sequence represented by SEQ ID NO: 6, 1st to 20th, 5th to 20th, Peptides consisting of the 1st to 21st or 5th to 21st amino acid sequences, and the like.

In addition, human analog-like peptides or partial peptides thereof are those in which the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or the so-called sugar peptides to which a sugar chain is bonded. Etc. are also included.

Furthermore, the humanin-like peptide may exist as a dimer, trimer, tetramer, etc., in addition to the monomer, and specifically, the humanin-like peptide Examples include the case of forming a dimer, the case of forming a dimer between the partial peptides of the present invention, and the case of forming a dimer of a humanin-like peptide and the partial peptide of the present invention.

Furthermore, the human-like peptide or its partial peptide (hereinafter abbreviated as human-like peptide) has any foreign peptide sequence (antibody recognition site) that can be an epitope (antibody recognition site) at each N-terminus or C-terminus. For example, a tag having a FLAG, His tag, HA tag, HSV tag, etc. is also included.

According to the convention of peptide labeling, the human-like peptide has an N-terminal (amino terminal) at the left end and a C-terminal (carboxyl terminal) at the right end. Humanin-like peptides, including polypeptides containing the amino acid sequence represented by SEQ ID NO: 8, have carboxyl groups (—COOH), carboxylate (—COO—), and amides (_CONH ₂ ) Or an ester (one COOR).

Here, as R in the ester, e.g., methyl, Echiru, n- propyl Honoré, CI_ ₆ alkyl group such as isopropyl or n- butyl, Shikurobe pentyl, C ₃ of cyclohexyl etc. cyclohexane - ₈ cycloalkyl group, for example, phenyl, alpha-naphthyl C _{6 12} Ariru groups such, for example, phenyl and benzyl, Fuwenechiru - C ₇ _ ₁₄ such CI_ ₂ alkyl or alpha-alpha-naphthyl one C ₂ § Norekiru group naphthylmethyl The power of an aralkyl group, a pivaloyloxymethyl group commonly used as an oral ester, and the like are used.

humanin-like peptide has a carboxyl group (or When it has Kishireto), a carboxyl group as the ester when this _c included in humanin similar peptides in the present specification which are amino-de reduction or Esutenorei spoon, for example, esters of C-terminal described above is Used.

Furthermore, in humanin-like peptides, amino-terminal amino acid residues (eg, methionine residues) at the N-terminus are protected with a protecting group (eg, C i -formyl group, acetyl group, etc .; C ^ e-acyl group, such as ₆ alkanoyl group). Etc.), N-terminal glutamyl group generated by cleavage in vivo, pyroglutamine oxidation, Substituent on the side chain of amino acid in the molecule (eg, 1 OH, 1 SH, amino acid) group, one imidazole group, indole group, Guanijino group) is protected with a suitable protecting group (e.g., such as C i ₆ Ashiru groups such as C i _ ₆ Arukanoiru group such formyl group, Asechiru group), or Complex polypeptides such as so-called sugar polypeptides to which sugar chains are bonded are also included.

As salts of humanin-like peptides or partial peptides thereof, salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts) are used, and particularly physiologically acceptable salts are used. Preferred acid addition salts are: Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, Salts with succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) are used.

Hereinafter, in the specification, a humanin-like peptide, a partial peptide thereof, or a salt thereof is abbreviated as a humanin-like peptide.

The humanin-like peptide can be produced from the cells or tissues of the above-mentioned human or non-human warm-blooded animal by a known polypeptide purification method, or a polypeptide (DNA) encoding the humanin-like peptide described later. ) Can also be produced by culturing a transformant containing It can also be produced according to the peptide synthesis method described below.

In the case of production from tissues or cells of a non-human mammal, the resulting tissue or cells of the non-human mammal are homogenized and then extracted with an acid or the like. The resulting extract can be purified and isolated by combining chromatography such as reverse phase chromatography and ion exchange chromatography.

For the synthesis of the human-like peptide or its amide, a commercially available resin for polypeptide synthesis can be usually used. Examples of such resins include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzoxybenzyl alcohol resin, 4-methylinobenzhydrylamine resin, PAM resin, and 4-hydrogen resin. Roxymethylmethylphenacetamide methyl resin, polyacrylamide resin, 4- (2,, 4'-dimethoxyphenyl) hydroxymethyl) phenoxy resin, 4- (2 ', 4'-Dimethoxyphenyl) Fmoc aminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide in accordance with various known condensation methods. At the end of the reaction, the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed.In addition, an intramolecular disulphide bond formation reaction is carried out in a highly diluted solution to obtain the desired huma ni η-like peptide or a peptide thereof. Obtain the amide body.

For the condensation of the protected amino acids described above, various activating reagents that can be used for the synthesis of polypeptides can be used, and carbodiimides are particularly preferable. As carbodiimides, DCC, N, N'-diisopropylcarbodiimid, N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimid and the like are used. For these activations, the protected amino acid may be added directly to the resin along with the racemization inhibitor (eg, HOBt, HOOBt) or may be pre-protected as the corresponding acid anhydride or HOBt ester or HOOBt ester. It can be added to the resin after activation of the acid.

The solvent used for activating the protected amino acid or for condensing with the resin can be appropriately selected from solvents known to be usable for the polypeptide condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, and N-methylpyrrolidone; halogenated hydrocarbons such as methylene chloride and chloroform; Alcohols such as ethanol, dimethyl sulfoxide Sulfoxides such as sides, ethers such as pyridine, dioxane, tetrahydrofuran, etc., -tolyls such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof are used. The reaction temperature is appropriately selected from the range known to be usable for the polypeptide bond formation reaction, and is usually selected from the range of about 120 to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. If sufficient condensation is not obtained even after repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole so that subsequent reactions are not affected. .

Examples of the protecting group for the starting amino group include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, C 1 _Z, Br—Z, Damantyloxycarbonyl, trifluoroacetinole, phthaloynole, honoleminole, 2-nitrophenylenolesnolefenole, diphenylenolephosphinochioil, Fmoc and the like are used.

The carboxyl group may be, for example, alkyl esterified (eg, methyl, ethyl, propynole, butyl, t-butynole, cyclopentyl, cyclohexyl, cycloheptyl, cyclootatyl, 2-adamantyl, etc. Alkynole esterification), aralkyl esterification (for example, benzyl ester, 4-ethoxybenzinoleestenole, 4-methoxybenzinooleestenole, 4-chlorobenzyl ester, benzhydryl esterification), fenasi The compound can be protected by esterification, benzyloxycarbonyl hydrazide, t-butoxycarbol hydrazide, tritinolehydrazide, or the like.

The hydroxyl group of serine can be protected, for example, by esterification or etherification. Examples of groups appropriately used for the esterification include a lower such Asechiru group (C -! ₆₎ Arukanoiru group, Aroiru groups such Benzoiru group, Benjiruokishi carbonyl group, and a group derived from carbonic acid such as ethoxycarbonyl group using It is possible. Also, groups suitable for ethenoleich include, for example, benzyl group, A robiranyl group, a t_butyl group and the like.

The protecting group of the phenolic hydroxyl group of tyrosine, for _{example, B z 1, C 1 2} - B zl, 2- two Torobenjiru, B r- Z, t-butyl and the like are used.

As the protecting group for imidazole of histidine, for example, Tos, 4-methoxy-1,2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used. .

Examples of activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, pentachlorophenol, 2,4,5-trichloromouth phenol, 2,4- Esters with dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimid, HOB t). As the activated amino group of the raw material, for example, a corresponding phosphoric acid amide is used.

Methods for removing (eliminating) protecting groups include, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, or anhydrous hydrogen fluoride, methanesulfone, or the like. Acid treatment with acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and reduction with sodium in liquid ammonia Are also used. The elimination reaction by the above-mentioned acid treatment is generally carried out at a temperature of about −20 to 40 ° C. In the acid treatment, for example, anisolone, phenolic, thioanisoneol, methacrylic acid, laccrezomonolic acid, dimethyl sulfide, It is effective to add a cation scavenger such as 1,4-butanedithiol or 1,2-ethanedithiol. In addition, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4- In addition to deprotection by acid treatment in the presence of butanediol, etc., it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia and the like.

Protection of functional groups that should not participate in the reaction of Elimination of the protecting group, activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.

As another method for obtaining an amide form of a humanin-like peptide, for example, first, after amidating and protecting the α-carboxyl group of the carboxy terminal amino acid, a peptide (polypeptide) chain is added to the amino group side of the desired amino acid. After extending the chain length, a polypeptide was obtained by removing only the protecting group of the amino group at the Ν end of the peptide chain, and a polypeptide was obtained by removing only the protecting group of the carboxyl group at the C terminal. Both polypeptides are condensed in a mixed solvent as described above. The details of the condensation reaction are the same as described above. After purifying the protected polypeptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude polypeptide. The crude polypeptide is purified by various known purification means, and the main fraction is freeze-dried to obtain a desired amide of a similar peptide.

To obtain an ester form of a humanin-like peptide, for example, after condensing the ct-carboxyl group of the carboxy-terminal amino acid with a desired alcohol to form an amino acid ester, the same as the humanin amide form, An ester of the peptide can be obtained.

Humanin analogous peptides can also be produced according to known peptide synthesis methods. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting humanin with the remaining portion, and if the product has a protective group, removing the protective group to produce the desired peptide. Examples of the known condensation method and elimination of the protecting group include the methods described in the following ① to ⑤.

(DM. Bodanszky and M.A. Ondetti, Peptide 'Peptide Synthesis, Interscience Publishers, New York (1966),

② Schroeder and Luebke, The Peptide, Academic Press, New York (1965),

(3) Nobuo Izumiya et al. Basics and experiments of peptide synthesis, Maruzen Co., Ltd. (1975), 治 Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemical Experiment 1, Protein Chemistry IV, 205, (1977), and

治 Supervised by Haruaki Yajima, Development of Continuing Drugs, Volume 14, Peptide Synthesis, Hirokawa Shoten.

After the reaction, the polypeptide of the present invention and the partial peptide of the present invention are purified and isolated by a combination of conventional purification methods, for example, solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. be able to. When the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto. It can be converted to a free form or another salt by a method or a method analogous thereto.

As the polynucleotide encoding the huma nin-like peptide (hereinafter, these may be collectively referred to as the polynucleotide of the present invention), any polynucleotide containing the aforementioned nucleotide sequence encoding huma nin can be used. (DNA or RNA, preferably DNA). The polynucleotide is RNA such as DNA or mRNA encoding a human-like peptide, and may be double-stranded or single-stranded. In the case of double-stranded DNA, double-stranded DNA, double-stranded RNA or DNA: RNA hybrid may be used. In the case of a single strand, it may be a sense strand (ie, a coding strand) or an antisense strand (ie, a non-coding strand).

The DNA encoding the humanin analog peptide may be any of genomic DNA, cDNA derived from the above-described cells or tissues, and synthetic DNA. The vector used for the library may be any of batteriophage, plasmid, cosmid, phagemid and the like. In addition, a reverse RNA is directly prepared using a total RNA or mRNA fraction prepared from the cells or tissues described above.

It can also be amplified by Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method).

Specific examples of the DNA encoding the humanin-like peptide include a DNA containing a DNA having a base sequence represented by SEQ ID NO: 5. DNA that can hybridize with the base sequence represented by SEQ ID NO: 5 under high stringency conditions can also be mentioned as DNA encoding a humanin-like peptide. A DNA or the like containing a nucleotide sequence having a homology of about 80% or more, preferably about 85% or more, more preferably about 90% or more with the base sequence to be used is used.

The homology of the nucleotide sequences was determined using the homology calculation algorithm NCB I BLAST (Nationa 1 to enter Biotechnology Information Base Asynchronous Alignment Search Tool) under the following conditions (expected value = 10; gap: Filtering = ON; Match score = 1; Mismatch score =-3).

Hybridization is performed according to a known method or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). Can be. When a commercially available library is used, the procedure can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions.

High stringency conditions refer to, for example, sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM, and a temperature of about 50 to 70 ° C, preferably about 60 to 65 ° C. .

Examples of the DNA encoding a human similar peptide consisting of the amino acid sequence represented by SEQ ID NO: 6 include DNA consisting of the base sequence represented by SEQ ID NO: 5, and the like.

The DNA encoding the partial peptide of the human analog-like peptide may be any DNA as long as it encodes the partial peptide of the human analog-like peptide. As a specific example, the DNA encoding the partial peptide consisting of the amino acid sequence represented by SEQ ID NO: 9 includes DNA consisting of the base sequence represented by SEQ ID NO: 10, and the like.

Cloning procedure for DNA encoding the complete huma nin-like peptide The columns include the ability to expand genomic DNA and cDNA by PCR using synthetic DNA primers having a partial nucleotide sequence of DNA encoding a humanin-like peptide, or DNA integrated into an appropriate vector. (Library) can be selected by hybridization with a DNA isotope or enzyme-labeled (DNA probe) using a DNA fragment or synthetic DNA encoding a part or all of humanin. . Hybridization can be performed according to the method described in lci in Molecular Cloning 2nd (Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989)), and commercially available libraries. When used, it can be performed according to the method described in the attached instruction manual.

The DNA base sequence can be replaced using the ODA-LA PCR method using PCR or a known kit, such as Mutan ™ -super Express Km (Takara Shuzo) or Mutan ™ -K (Takara Shuzo). It can be carried out according to a known method such as the Gupped duplex method or the Kunkel method, or a method analogous thereto.

The DNA encoding the cloned human-like peptide can be used as it is depending on the purpose, or digested with a restriction enzyme or added with a linker if desired. The DNA may have ATG as a translation initiation codon at the 5 ′ end, and TAA, TGA or TAG as a translation stop codon at the 3 ′ end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter.

An expression vector for a humanin-like peptide can be obtained, for example, by (i) cutting out a DNA fragment of interest from DNA encoding a humanin-like peptide, and (mouth) converting the DNA fragment into a promoter of an appropriate expression vector. It can be manufactured by connecting downstream.

Examples of the vector include plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC13), and plasmid derived from Bacillus subtilis (eg, pUB110, pTP5, pC194). Yeast-derived plasmids (eg, pSH19, pSH15); bacteriophages such as phage; animal viruses such as retroviruses, vaccinia viruses and baculovirus; pAl-l1, ρΧΤ. 1, pRc / CMV, pRc / RSV, pcDNAI / Neo and the like are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when an animal cell is used as a host, SRa promoter, SV40 promoter, LTR promoter, CMV promoter, HS V-TK promoter, β-actin and the like can be mentioned.

Of these, it is preferable to use the CMV (cytomegalovirus) promoter, SRct promoter and the like. When the host is Eshierihia genus bacterium, trp promoter, lac promoter, re cA promoter,; LP _L promoter one coater, 1 pp promoter, T 7 promoter etc. When the host is Bacillus, spol promoter, When the host is yeast, such as SP02 promoter and penP promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferred.

In addition to the above, an expression vector containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), etc., if desired, may be used. be able to. As the selection marker, for example, dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], § ampicillin resistant gene (hereinafter sometimes abbreviated as Amp ^r), neomycin resistant gene (hereinafter sometimes abbreviated as Ne o ^r, Geneticin resistance). In particular, when the dhfr gene is used as a selection marker using dhfr gene-deficient Chinese hamster cells, recombinant cells can be selected using a thymidine-free medium.

If necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide of the present invention. When the host is a genus Escherichia, the P h0A signal sequence, Omp A, signal sequence, etc., and when the host is a Bacillus genus, α-amylase, signal sequence, subtilisin, signal sequence, etc. The host is yeast If the host is an animal cell, MFa signal sequence, SUC2 signal sequence, etc. If the host is an animal cell, insulin signal sequence, signal sequence, antibody molecule, signal sequence Etc. can be used respectively.

A transformant can be produced using a vector containing a DNA encoding a similar peptide or a partial peptide thereof thus constructed. As the host, for example, bacteria of the genus Escherichia, bacteria of the genus Bacillus, yeast, insect cells, insects, animal cells, and the like are used.

Specific examples of the genus Escherichia include, for example, Escherichia coli K12, DH1 Natl. Acad. Sci. USA, 60 vol., 160 (1968)], JM103 [Nucleic Acids Research, 9 vol., 309 (1 981)] , JA 2 21 [Journal of Molecular Biology (Journal of Molecular)

Biology), 120 volumes, 5 17 (1 978)], HB 101 (Journal 'Ob • Molecular' Biology, 41 volumes, 459 (1 969)), C 600 [The Enetics (Genetics), Vol. 39, 440 (1954)]. Examples of Bacillus bacteria include, for example, Bacillus subtilis (Bacillus subtilis) MI 114 (Gene, 24 vol., 255 (1983)), 207—21 [Jar Nanoleop Biochemistry (Journal) of Biochemistry), 95 vol., 87 (1 984)].

Examples of yeast include Saccharomyces cerevisiae (Saccharomyces cerevisiae) AH 2 2, AH22R _, NA8 7 - 1 1 A, DKD- 5D, 20 B- 1 2, Schizosaccharomyces Cylinders (Schizosaccharomyces pombe) NC YC 1 9 13, NCYC 2036, Pichia pastoris KΜ71 and the like are used.

Insect cells include, for example, when the virus is Ac NPV, Spodoptera frugiperda cell (S f Itoda _), Trichoplusia ni MG1 cell derived from the midgut, Trichoplusiani Egg-derived High Five ™ cells, Mamestra A cell derived from brassicae or a cell derived from Estigmena acrea is used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N cell; Bm N cell) or the like is used. As the S f cells, for example, S f 9 cells (ATCCCRL1711), S f 21 cells (above, Vaughn, JL, et al., In Vivo, 13, 213-217, (1977)) and the like are used. Can be

Examples of animal cells include monkey cell COS-7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), dhfr gene-deficient Chinese hamster cell CHO (hereinafter abbreviated as CHO (dhfr-1) cell). , Mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3 cells, and human FL cells.

In order to transform Escherichia sp., For example, Proc. Natl. Acad. Sci. USA, 69 Vol. 21 10 (1972) and Gene (

Gene, Vol. 17, Vol. 107, (1982).

Transformation of Bacillus spp. Can be performed, for example, according to the method described in Molecular & General Genetics, 168, 11 (179).

To transform yeast, see, for example, Methods in Enzymology, Vol. 194, 182—187 (1991), Processings of the National Academy of Sciences. · Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 75, 1929 (1978).

Transformation of insect cells or insects can be performed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988).

To transform animal cells, for example, see Cell Engineering Separate Volume 8 Kokutokoru. 263-267 (1995) (published by Shujunsha), Virology, Vol. 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide can be obtained.

When culturing a transformant whose host is a bacterium belonging to the genus Escherichia or Bacillus, a liquid medium is suitable as a medium for cultivation, and a carbon source necessary for the growth of the transformant is contained therein. , Nitrogen sources, inorganic substances and others. Examples of carbon sources include glucose, dextrin, soluble starch, and sucrose. Examples of nitrogen sources include ammonium salts, nitrates, corn chips, liquor, peptone, casein, yeast extract, and meat extract. And inorganic or organic substances such as soybean meal and potato extract, and inorganic substances include, for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8. Examples of a medium for culturing Escherichia bacteria include, for example, an M9 medium containing glucose and casamino acids (Miller, Journal of Ob 'et al. In-Molecular Synthetics). Experiments in Molecular Uenetics), 431-43, old Spring Harbor Laboratory, New York 1972]. Here, if necessary, a promoter such as 30-indolylacrylic acid can be added to make the promoter work efficiently.

When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring can be applied.

When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C for about 6 to 24 hours, and if necessary, aeration and stirring can be applied.

When culturing a transformant in which the host is yeast, as a medium, for example, Burkholder's minimal medium [Bostian, KL et al., Processing's The National Academy of Sciences. Natl. Acad. Sci. USA, 77 vol., 4505 (1980)] and an SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings. • The National Academy of Sciences, _Ob . _{Sciences, Ob} . The _Science, Proc. Natl. Acad. Sci. USA, 81, 5330 (1 984)]. The pH of the medium is preferably adjusted to about 5-8. Culture is usually performed at about 20 to 35 ° C for about 24 to 72 hours, and if necessary, aeration and stirring are added. When culturing an insect cell or a transformant in which the host is an insect, the medium used is 10% serum serum immobilized in Grace's Insect Medium (Grace, TCC, Nature, 195, 788 (1962)). And the like to which additives such as the above are appropriately added are used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and agitation are added as necessary.

When culturing a transformant in which the host is an animal cell, examples of the medium include a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122 vol., 501 (1952)], a DMEM medium [Virology, 8 volumes, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association] 199, 519 (1 967)], 199 medium [Proceeding of the Society for the Biological Medicine], 73, 1 (1950)], etc. Used. Preferably, the pH is about 6-8. Cultivation is usually carried out at about 30 to 40 ° C for about 15 to 60 hours, and aeration and stirring are added as necessary.

As described above, a hum anin-like peptide can be produced in the transformant, inside the cell membrane, or outside the cell (preferably outside the cell).

The separation and purification of the human analog peptides from the above culture can be performed, for example, by the following method.

When extracting the human-like peptide from cultured cells or cells, collect the cells or cells by a known method after culture, suspend the cells in an appropriate buffer, and sonicate, lysozyme and Z or freeze-thaw, etc. After destruction of the cells or cells by centrifugation, a method of obtaining a crude extract of humanin-like peptide by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ™. In the case where a human-like peptide is secreted into the culture solution, after the culture is completed, the bacterial cells or cells are separated from the supernatant by a known method, and the supernatant is collected.

Purification of the human analog-like peptide contained in the thus obtained culture supernatant or extract can be carried out by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis. A method using a difference in molecular weight, a method using a difference in charge such as ion exchange chromatography, a method using a specific affinity such as ab initious mouth chromatography, a hydrophobic method such as a reversed-phase high-performance liquid chromatography, etc. A method using the difference in gender, a method using the difference in isoelectric point such as isoelectric focusing, etc. are used.

When the humanin analogous peptide obtained by force is obtained in a free form, it can be converted into a salt by a known method or a method analogous thereto, and conversely, when it is obtained in a salt, It can be converted to a free form or another salt by a known method or a method analogous thereto.

The human-like peptide produced by the recombinant can be arbitrarily modified or treated with a human-like peptide before or after purification by the action of an appropriate protein-modifying enzyme or protease. It can also be partially removed. As these enzymes, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used.

The presence of the thus formed hum analog-like peptide can be measured by an enzyme immunoassay western blot analysis or the like using a specific antibody.

In addition, as described above, any exogenous peptide sequence (eg, FLAG, HIS tag, my c tag, HA tag, etc.) that can serve as an epitope (antibody recognition site) at the N-terminus or C-terminus of humanin-like peptide, etc. HSV tag, etc.) and detecting chemiluminescence or the like using an antibody that recognizes the peptide sequence, whereby the presence of a huanin-like peptide can be measured. Since the humanin-like peptide has a cell death inhibitory action, a cell survival maintaining action, and the like, the humanin-like peptide and the FPRL1 or FPRL2 of the present invention, which is a receptor, have the following uses. I have.

That is, the present invention provides a method for screening a compound or a salt thereof (eg, agonist, antagonist, etc.) that alters the binding or signal transduction between FPRL1 or FPRL2 of the present invention and a humanin-like peptide. And a medicament comprising a compound or a salt thereof that alters the binding or signal transduction between FPRL1 or FPRL2 of the present invention and a humanin-like peptide. By using the force of using the FPRL 1 or FP L2 of the present invention, or by constructing an expression system for the recombinant FPRL 1 or FP L2 and using a receptor-binding assay system using the expression system, the ligand can be used. Compounds that alter the binding or signal transduction between a certain humanin analogous peptide and FPRL1 or FPRL2 of the present invention (eg, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc.) or The salt can be efficiently screened. Such compounds include (a) compounds having a cell stimulating activity via FPRL1 or FPRL2 (so-called agonists against FPRL1 or FPRL2 of the present invention), and (mouth) FPRL1 or FPRL2. (A so-called antagonist against FPRL1 or FPRL2 of the present invention) which inhibits cell-stimulating activity mediated by FPRL1 or FPRL2 of the present invention. And (2) a compound that decreases the binding force between the human nin-like peptide and FPRL1 or FPRL2 of the present invention.

Specifically, the present invention relates to (i) the case where the FPRLl or FPRL2 of the present invention is brought into contact with a humanin-like peptide; A compound or a salt thereof that alters the binding or signal transduction between humanin-like peptide and FPRL1 or FPRL2 of the present invention, which is compared with the case where the peptide and a test compound are brought into contact with each other. Is provided.

In the screening method of the present invention, in the cases (i) and (ii), For example, it is characterized by measuring the amount of binding of a humanin-like peptide to FPRL1 or FPRL2, cell stimulating activity, and the like, and comparing them.

Cell stimulating activity includes, for example, arachidonic acid release, acetylcholine release, cell 內 C a2 ⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, Examples include an activity of promoting or suppressing c-fos activation, a decrease in pH, and the like, and among them, an activity of inhibiting intracellular cAMP production is preferable.

More specifically, the present invention provides

a) When a labeled humanin-like peptide is brought into contact with the FPRL1 or FPRL2 of the present invention, and when a labeled humanin-like peptide and a test compound are tested with the FPRL1 or FPRL of the present invention. 2, the amount of the labeled humanin-like peptide bound to the FPRL 1 or FPRL 2 is measured and compared, and the human-like peptide is compared with the FPRL 1 or FPRL of the present invention. A method of screening for a compound or a salt thereof that changes the binding to 2 or the signal transduction,

b) When the labeled humani analog is contacted with cells containing the FPRL1 or FPRL2 of the present invention or the membrane fraction of the cells, the labeled humani analog and the test compound are compared with each other. When a cell containing the FPRL1 or FPRL2 of the present invention or a membrane fraction of the cell was brought into contact with the cell, the amount of the labeled humanin analogous peptide bound to the cell or the membrane fraction was measured. A method for screening a compound or a salt thereof that alters the binding or signal transduction between the humanin analog peptide and the FPRL1 or FPRL2 of the present invention, wherein

c) FPR L1 or FPR expressed on the cell membrane by culturing the transformed transformant containing DNA of the present invention with the labeled hum anin-like peptide

FPRL1 or FPRL1 of the present invention expressed on the cell membrane by culturing a transformant containing the DNA of the present invention with a labeled humanin-like peptide and a test compound when the cells are brought into contact with L2. When contacted with FPRL2, the labeled humanin-like peptide reacts with FPRL1 or FPRL2. A method of screening for a compound or a salt thereof that alters the binding or signal transduction between human nin analog-like peptide and FPRL 1 or FPRL 2 of the present invention, which comprises measuring and comparing the amount of binding.

d) A compound that activates FPRL1 or FPRL2 of the present invention or a salt thereof (for example, a human-like peptide) is converted to FPRL1 or FPRL1 of the present invention.

When the cells were brought into contact with the cells containing PRL2, the compound or the salt thereof, which activates FPRL1 or FPRL2 of the present invention, and the test compound were brought into contact with the cells containing FPRL1 or FPRL2 of the present invention. In this case, the binding or signal between human nin-like peptide and FPRL1 or FPRL2 of the present invention is characterized by measuring and comparing FPRL1 or FPRL2 mediated cell stimulating activity. A method of screening a compound that alters transmission or a salt thereof, and

e) A compound or a salt thereof that activates FPRL 1 or FPRL 2 of the present invention (eg, a humanin-like peptide) is cultured on a cell membrane by culturing a transformant containing the DNA of the present invention. When the expressed FPRL1 or FPRL2 of the present invention is brought into contact with the FPRL1 or FPRL2 of the present invention, the compound that activates FPRL1 or FPRL2 of the present invention, or a salt thereof, and a test compound contain the DNA of the present invention. Measurement of cell stimulating activity through FPRL1 or FPRL2 of the present invention when the FPRL1 or FPRL2 of the present invention is brought into contact with the FPRL1 or FPRL2 of the present invention expressed on the cell membrane by culturing the transformant. And a method for screening a compound or a salt thereof that alters the binding or signal transduction between humanin and FPRL1 or FPRL2 of the present invention, which is characterized by comparing.

Furthermore, as the ligand, a compound or a salt thereof that changes the binding property between humanin-like peptide and FPRL1 or FPRL2 can be used instead of the humanin-like peptide. A compound or a salt thereof that alters the binding property between the humanin analogous peptide and FPRL1 or FPRL2 is, for example, subjected to the screening method of the present invention described below using a humanin analogous peptide as a ligand. Can be obtained by: In the following screening method, humanin-like peptide and FPRL 1 or A compound or a salt thereof that changes the binding property to FPRL2 is simply referred to as a human analog-like peptide.

The specific description of the screening method of the present invention is as follows.

First, the FPRL 1 or FPRL 2 of the present invention used in the screening method of the present invention may be any one containing the above-described FPRL 1 or FPRL 2 of the present invention. However, a cell membrane fraction of a mammalian organ containing FPRL1 or FPRL2 of the present invention is preferred. However, since organs derived from humans are extremely difficult to obtain, FPRL1 derived from human or expressed in large amounts using recombinants should be used for screening. FPR L 2 is suitable.

The above-mentioned method is used for producing the FPRL1 or FPRL2 of the present invention, but is preferably performed by expressing the DNA of the present invention in mammalian cells or insect cells. Complementary DNA is used for the DNA fragment encoding the target protein portion, but is not necessarily limited thereto. For example, a gene fragment / synthetic DNA may be used. In order to introduce a DNA fragment encoding the FPRL1 or FPRL2 of the present invention into host animal cells and express them efficiently, a nuclear polyhedron belonging to a baculovirus using an insect as a host must be used. Diseases Polynodrin promoter of nuclear polyhedrosis virus (NPV), SV40-derived promoter, retrovirus promoter, metallotionin promoter, human heat shock promoter, cytomegalovirus promoter, downstream of SRα promoter, etc. Re, preferably incorporated into. Examination of the quantity and quality of the expressed receptor can be carried out by a method known per se (for example, see [Nambi, P. et al., The Journal of Biological Chemistry (J. Biol. Chem.)). ), Vol. 267, pp. 19555-19559, 1992].

Therefore, in the screening method of the present invention, the FPRL 1 or FPRL 2 containing the FPRL 1 or FPRL 2 of the present invention may be FPRL 1 or FPRL 2 purified according to a method known per se, Cells containing the FPRL1 or FPRL2 may be used, and cells containing the FPRL1 or FPRL2 may be used. The membrane fraction of the cells may be used.

In the screening method of the present invention, when a cell containing the FPRL1 or FPRL2 of the present invention is used, the cell may be immobilized with dartal aldehyde, formalin, or the like. The immobilization method can be performed according to a method known per se.

The cell containing the FPRL1 or FPRL2 of the present invention refers to a host cell expressing the FPRL1 or FPRL2. Examples of the host cell include E. coli, Bacillus subtilis, yeast, and insect. Cells and animal cells are preferred.

The cell membrane fraction refers to a cell membrane-rich fraction obtained by disrupting cells and then obtained by a method known per se. Potter—

A method of crushing cells with an Elvehjem homogenizer, crushing with a Perling Blender-Polytron (manufactured by Kinematica), crushing with ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure with a French press, etc. And so on. For cell membrane fractionation, centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used. For example, the cell lysate is centrifuged at a low speed (500-3000 rpm) for a short time (typically about 1-10 minutes), and the supernatant is further centrifuged at a higher speed (15000-30000 rpm) for 30 minutes to 2 hours. The resulting precipitate is used as the membrane fraction. The membrane fraction is rich in expressed FPRL1 or FPRL2 and membrane components such as cell-derived phospholipid membrane protein.

The amount of FPRL1 or FPRL2 in the cells or membrane fraction containing FPRL1 or FPRL2 is preferably 10 ³ to 10 ⁸ molecules per cell, and 10 ⁵ to 10 ^7. Preferably it is a molecule. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which not only makes it possible to construct a highly sensitive screening system, but also makes it possible to measure a large number of samples in the same lot. Become. In order to carry out the above a) to c) for screening a compound or a salt thereof that changes the binding or signal transduction between the humanin-like peptide and FPRL1 or FPRL2 of the present invention, for example, Requires FPRL 1 or FPL L 2 fractions and labeled humanin analogous peptides.

The FPRL 1 fraction or FPRL 2 fraction includes the natural FPRL 1 fraction. Alternatively, a FPRL 2 fraction or a recombinant FPRL 1 fraction or an FPRL 2 fraction having an activity equivalent thereto is desirable. Here, “equivalent activity” means equivalent ligand binding activity, signal transduction action, and the like.

As a labeled humanin-like peptide, for example, a humanin-like peptide labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], or the like is used.

Specifically, to screen a compound or a salt thereof that alters the binding or signal transduction between a humanin analogous peptide and FPRL1 or FPRL2 of the present invention, first, the FPR of the present invention must be screened. Prepare an FPRL1 preparation or FPRL2 preparation by suspending cells containing L1 or FPRL2 or a membrane fraction of the cells in a buffer suitable for screening. The buffer may be any phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or any buffer such as a buffer of tris-monohydrochloride that does not inhibit the binding of human to FPRL1 or FPRL2. . In order to reduce non-specific binding, a surfactant such as CHAPS, Tween-80 ™ (Kao Ichi Atlas), digitonin, and dexcholate can be added to the buffer. Furthermore, a protease inhibitor such as PMS F, leptin, E-64 (manufactured by Peptide Research Institute), or papstatin should be added to suppress the degradation of the receptor and human-like peptide by the protease. You can also. A fixed amount (5000 to 500,000 cpm) of labeled humanin is added to the receptor solution of 0.1 to 1 Om 1, and a test compound of 10 to ⁴ M to ^{10 to 1} ° M is co-existent at the same time. Let me do it. Prepare a reaction tube containing a large excess of unlabeled humanin-like peptide to determine the amount of non-specific binding (NSB). The reaction is carried out at about 0-50 ° C, preferably about 4-37, for about 20 minutes to 24 hours, preferably for about 30 minutes to 3 hours. After the reaction, the mixture is filtered through a glass fiber filter paper or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter paper is measured with a liquid scintillation counter or a Y-counter. Nonspecific binding amount from the count (beta ₀₎ where any antagonizing substance is absent (NS B) a count obtained by subtracting (beta. One NSB) When was the 1 100%, especially specific binding amount (Beta NSB) 1S For example, antagonize test compounds that are 50% or less. Can be selected as a harmful candidate substance.

In order to carry out the above-mentioned methods d) to e) for screening a compound or a salt thereof that alters the binding or signal transduction between humanin-like peptide and FPRL1 or FPRL2 of the present invention. For example, the cell stimulating activity via FPRL1 or FPRL2 can be measured using a known method or a commercially available measurement kit.

Specifically, first, cells containing the FPR L1 or FPR L2 of the present invention are cultured in a multiwell plate or the like. Before performing screening, replace the cells with fresh medium or an appropriate buffer that is not toxic to cells, add test compounds, etc., incubate for a certain period of time, and then extract cells or collect supernatant. The product produced is quantified according to the respective method. If the production of a substance (for example, cAMP, arachidonic acid, etc.) as an indicator of cell stimulating activity is difficult due to the presence of a degrading enzyme contained in the cells, the assay may be performed by adding an inhibitor against the degrading enzyme. . In addition, activities such as cAMP production suppression can be detected as a production suppression effect on cells whose basal production has been increased by forskolin or the like.

In order to perform screening by measuring cell stimulating activity, cells expressing appropriate FPRL1 or FPRL2 are required. Examples of the cells expressing the FPRL1 or FPRL2 of the present invention include a cell line having the natural FPRL1 or FPRL2 of the present invention, and the above-mentioned recombinant FPRL1 or FPRL2. A cell strain in which expression has occurred is desirable.

As test compounds, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. are used, and these compounds are novel compounds. Or a known compound.

The test compound may form a salt, and a salt with a physiologically acceptable acid (eg, an inorganic acid) or a base (eg, an organic acid) is used as the salt of the test compound. Particularly preferred are physiologically acceptable acid addition salts. Such salts include, for example, inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) Salts or salts with organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, cunic acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.) Are used.

As the test compound, a compound designed to bind to the ligand binding pocket based on the atomic coordinates of the active site of FPRL1 or FPRL2 and the position of the ligand binding pocket is preferably used. The measurement of the atomic coordinates of the active site of FPRL1 or FPRL2 and the position of the ligand-binding boxet can be performed by a known method or a method analogous thereto.

Whether a compound or its salt that alters the binding between humanin-like peptide and FPRL1 or FPRL2 is an agonist or antagonist is determined by `` humanin-like peptide and FPRL1 or FPRL2. Of FPRL1- or FPRL2-mediated intracellular cAMP production inhibitory activity when a compound or a salt thereof that changes its binding to FPRL1 or FPRL2 is contacted FPRL1 or FPRL2, which is characterized in that the

Specifically, an agonist determination method for FPRL1 or FPRL2 is performed by constructing an expression system of the recombinant FPRL1 or FPRL2 of the present invention and using a receptor-binding assay system using the expression system. This is a method for determining a compound having an activity of inhibiting intracellular cAMP production via FPRL1 or FPRL1 or a salt thereof.

More specifically,

(1) Inhibition of intracellular cAMP production when a compound or its salt that alters the binding between humanin-like peptide and FPRL1 or FPRL2 is brought into contact with cells containing FPRL1 or FPRL2 A method for determining an agonist for FPRL 1 or FPRL 2 characterized by measuring the activity; and

(2) A compound or a salt thereof that alters the binding between human nin-like peptide and FPRL1 or FPRL2 is cultured on a cell membrane by culturing a transformant containing FPRL1 DNA or FPRL2 DNA. Via FPRL 1 or FPRL 2 when exposed to FPRL 1 or FPRL 2 A method for determining an agonist for FPRL1 or FPRL2, which comprises measuring the intracellular cAMP production inhibition activity.

When cells containing FPRL1 or FPRL2 are used in this agonist determination method, the cells may be immobilized with daltaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method.

The membrane fraction of cells containing FPRL1 or FPRL2 refers to a fraction containing a large amount of cell membrane obtained by crushing the cells and then using a known method. The cells can be crushed by crushing the cells with a Potter-Elvehjem homogenizer, crushing with a Warlinda blender-Polytron (manufactured by Kinematica), crushing with ultrasonic waves, or thinning the cells while applying pressure with a French press. Crushing by jetting from a nozzle can be mentioned. For cell membrane fractionation, centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used. For example, the cell lysate is centrifuged at a low speed (500-3000 rpm) for a short time (usually: approx. ~ 10 min), and the supernatant is further centrifuged at a higher speed (15000-30000 rpm), usually 30 min. Centrifuge for ~ 2 hours, and use the resulting precipitate as the membrane fraction. The membrane fraction is rich in the expressed FPRL1 or FPRL2 and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of FPRL1 or FPRL2 in the cells containing FPRL1 or FPRL2 or the cell membrane fraction thereof is preferably 10 ³ to 10 ⁸ molecules per cell, and 10 ⁵ to 10 ⁷ molecules per cell. It is preferred that The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which not only enables the construction of a highly sensitive screening system, but also enables the measurement of a large number of samples in the same port. become.

In order to carry out the agonist determination method of the present invention, the activity of suppressing intracellular cAMP production via FPRL1 or FPRL2 can be measured using a known method or a commercially available measurement kit. . Specifically, first,? Shaku! Culture cells containing ^ 丄 or PRL2 in a multiwell plate or the like. Before making an agonist decision, make sure that fresh media or cells are not toxic. Replace with the appropriate buffer, add the test compound, etc., incubate for a certain period of time, then extract the cells or collect the supernatant, and quantitate the resulting product according to each method. When the production of a substance (for example, cAMP or the like) as an indicator of the cell stimulating activity is difficult to be assayed by a degrading enzyme contained in a cell, an inhibitor for the degrading enzyme may be added to perform the assay.

By using this agonist determination method, a compound exhibiting an inhibitory activity on intracellular cAMP production can be used as an agonist against FPRL1 or FPRL2, and a compound exhibiting no inhibitory activity on intracellular cAMP production can be identified as FPRL1 or FPRL1. Alternatively, it can be selected as an antagonist to FPRL2.

A kit for screening a compound or a salt thereof that alters the binding or signal transduction between a human nin analog and a FPRL1 or FPRL2 of the present invention is a FPRL1 or FPRL of the present invention. 2. Cells containing the FPRL1 or FPRL2 of the present invention, or those containing the membrane fraction of cells containing the FPRL1 or FPRL2 of the present invention.

Examples of the screening kit of the present invention include the following. 1. Screening reagent

a) Measurement buffer and washing buffer

Hanks' Balanced Salt Solution (manufactured by Gibconed Earth) plus 0.05% of serum albumin (manufactured by Sigma).

Sterilize by filtration through a 0.45 m filter, and store at 4 ° C. Alternatively, prepare at use.

b) F PRL 1 standard or F PRL 2 standard

CHO cells expressing the FPRL 1 or F PRL 2 of the present invention, 1 2 Anapu rate passaged 5 X 1 0 ⁵ cells _/ / well, 3 7 ° C, 5% C0 2, 9 5% Cultured in air for 2 days.

c) Labeled huma n i n-like peptide

Commercially available ^[3 H], ^[125 I], ^[14 C], ^[35 S] labeled h uma nin similar base peptide, etc.

Store the solution in an aqueous solution at 4 ° C or 120 ° C. Dilute to 1 uM with liquid.

d) huma n i n analogous standard peptide solution

Dissolve the human analog peptide in PBS containing 0.1% serum albumin (manufactured by Sigma) to a concentration of 1 mM, and store at 120 ° C.

2. Measurement method

a) 1 2 a F PRL 1 or FP RL 2 expression CHO cell of the invention cultured in well tissue culture plate and washed twice with assay buffer ₁ m 1, 490 μ 1 of assay buffer Is added to each hole.

b) After 1 0 ³ to 1 0 ^{1 Q} M test compound solution was added 5 mu 1, labeled h um anin 5 ju 1 was added and reacted at room temperature for 1 hour. A supplementary 5 mu 1 to h uma nin similar base peptide of 1 0- ³ M in place of the test compound to determine the amount of non-specific binding.

c) Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled human-like peptide bound to the cells is dissolved in 0.2 N NaOH—1% SDS, and mixed with 4 ml of liquid scintillator A (manufactured by Wako Pure Chemical).

d) Measure the radioactivity using a liquid scintillation counter (manufactured by Beckman), and determine the Percent Maximum Binding (PMB) by the following formula.

PMB = [(B-NS B) Z (B. One NSB)] X 100

PMB: Percent Maximum Binding

B: Value when the sample is added

NSB: Non-specific Binding

B 0: maximum binding amount

The compound obtained by using the screening method or the screening kit of the present invention or a salt thereof has an effect of changing the binding or signal transduction between humanin analogous peptide and FPRL1 or FPRL2 of the present invention. A compound having a cell stimulating activity through FPRL1 or FPRL2 of the present invention or a salt thereof (so-called FPRL1 or FPRL1 of the present invention). (Agonist against FPRL2), (mouth) Compound having no cell stimulating activity or salt thereof (so-called FPRL1 or FPR of the present invention) An antagonist to L2), (c) a compound or a salt thereof that enhances the binding force between the humanin analog peptide and the FPRL1 or FPRL2 of the present invention, or (2) a humanin analog peptide and the present invention. FPRL 1 or a compound or a salt thereof that reduces the binding strength to FPRL2.

Compounds obtained using the screening method or the screening kit of the present invention include peptides, proteins, non-peptidic compounds, synthetic compounds, enzymatic products, and the like. Or a known compound.

As the salt of the compound, a salt with a physiologically acceptable acid (eg, an inorganic acid, etc.) or a base (eg, an organic acid, etc.) is used, and a physiologically acceptable acid addition salt is particularly preferable. . Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).

Since the agonist against FPR L1 or F PRL2 of the present invention has the same action as the biological activity of the humanin analog peptide, it is safe and low in accordance with the biological activity of the humanin analogous peptide. Useful as a toxic drug.

The antagonist against FPR L1 or FPR L2 of the present invention can suppress the biological activity of the humanin-like peptide, and therefore has a safe and low toxicity for suppressing the biological activity of the humanin-like peptide. It is useful as a medicine.

A compound or a salt thereof that enhances the binding force between humanin-like peptide and FPRL1 or FPRL2 of the present invention is a safe and low-toxic drug for enhancing the physiological activity of a humanin-like peptide. Useful.

A compound or a salt thereof that reduces the binding force between the humanin-like peptide and the FPRL1 or FPRL2 of the present invention is a humanin-like peptide for reducing the biological activity of the humanin-like peptide. Suppresses physiological activity of peptides It is useful as a safe and low-toxicity drug.

Specifically, a compound or a salt thereof that enhances the binding force between an agonist or a humanin-like peptide obtained using the screening method or the screening kit of the present invention and FPRL 1 or FPRL 2 of the present invention includes, for example, Cell death inhibitors further include, for example, diseases associated with neurodegeneration, such as neurodegenerative diseases [eg, Alzheimer's disease (familial Alzheimer's disease, juvenile Alzheimer's disease, sporadic Alzheimer's disease, etc.), Parkinson's disease , Down syndrome, amyotrophic lateral sclerosis, prion disease, Creutzfeldt-Jakob disease, Huntington's chorea, diabetic neuropathy, multiple sclerosis, etc.), cerebral dysfunction (eg, cerebral infarction, cerebral hemorrhage, subarachnoid) Bleeding, ischemic brain disease, epidural hematoma, subdural hematoma, etc.), cancer (eg, astrocytoma) Bacterial or viral meningitis such as oligodendroglioma, immune disease, infectious disease (eg, meningitis, protozoal infection, rickettsial infection, metazoan infection, Borna disease, etc., after vaccination Encephalitis, AIDS encephalopathy, etc.), prophylactic / therapeutic agents for various diseases such as gastrointestinal diseases, cardiovascular diseases, endocrine diseases, etc., preferably as preventive / therapeutic agents for neurodegenerative diseases and cerebral dysfunction, and more preferably as Alzheimer's disease. It can be used as a low toxic and safe medicine as a preventive and therapeutic agent for diseases.

On the other hand, a compound or a salt thereof that reduces the binding force between the antagonist or the humanin-like peptide obtained by the above-described screening method and FPRL1 or FPRL2 of the present invention is overexpressed by FPRL1 or FPRL2 of the present invention. It can be used as a medicine such as an agent for preventing and treating diseases caused by.

Furthermore, among the antagonists obtained by the above screening method, those that inhibit the binding of β-amyloid (1-42) to FPRL1 are used, for example, as cell death inhibitors, and further, for example, to inhibit neurodegeneration. Associated diseases such as neurodegenerative diseases [eg, Alzheimer's disease (familial Alzheimer's disease, juvenile Alzheimer's disease, sporadic Alzheimer's disease, etc.), Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion's disease , Creutzfeldt-Jakob disease, Huntington's disease, diabetic neuropathy, multiple sclerosis, etc.), cerebral dysfunction (eg, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, ischemic brain disease, epidural hematoma, dural Submural hematoma, etc.), cancer ( Eg, astrocytoma, oligodendroglioma, etc., bacterial or viral, such as immune disease, infectious disease (eg, meningitis, protozoal infection, rickettsial infection, metazoan infection, Borna disease, etc.) Prophylactic / therapeutic agents for various diseases such as meningitis, post-vaccination encephalitis, AIDS encephalopathy), gastrointestinal diseases, cardiovascular diseases, endocrine diseases, etc., preferably for the prevention of neurodegenerative diseases and brain dysfunction. More preferably, it can be used as an agent for preventing and treating Alzheimer's disease as a low-toxicity and safe drug. When the compound obtained by using the screening method or the screening kit of the present invention or a salt thereof is used as the above-mentioned pharmaceutical composition, it can be formulated according to a conventional method.

For example, the compound or a salt thereof is orally administered as a tablet, capsule, elixir, microcapsule or the like, which is sugar-coated as necessary, or water or other pharmaceutically acceptable liquid. It can be used parenterally in the form of an injection such as a sterile solution or suspension. For example, the compound or a salt thereof may be combined with a known physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc., in a unit dose required for generally accepted formulation practice. It can be manufactured by mixing in the form. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.

Examples of additives that can be mixed with tablets and capsules include binders such as gelatin, corn starch, tragacanth, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Such leavening agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cellulose are used. When the unit dosage form is a capsule, the above type of material can further contain a liquid carrier such as an oil or fat. Sterile compositions for injection can be formulated according to standard pharmaceutical practice, such as dissolving or suspending the active substance in a vehicle such as water for injection, or naturally occurring vegetable oils such as sesame oil or coconut oil. . Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium salt, etc.). Solubilizer, For example, alcohol (eg, ethanol), polyalcohol (eg, propylene glycol, polyethylene glycol), non-ionic surfactant (eg, Polysorbate 80 ^™ , HCO-50) may be used in combination. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and may be used in combination with a solubilizing agent such as benzyl benzoate or benzyl alcohol.

Examples of the prophylactic / therapeutic agent include a buffer (for example, a phosphate buffer and a sodium acetate buffer), a soothing agent (for example, chlorbenzizarconidum, prochlorin hydrochloride, etc.), It may be combined with a stabilizer (eg, human serum albumin, polyethylene glycol, etc.), a preservative (eg, benzyl alcohol, phenol, etc.), an antioxidant, and the like. The prepared injection solution is usually filled into a suitable ampoule.

The preparations obtained in this way are safe and low toxic, for example, against human mammals (eg, rats, mice, rabbits, sheep, pigs, pigs, cats, dogs, monkeys, etc.). Can be administered.

The dose of the compound or a salt thereof varies depending on the administration subject, target organ, symptoms, administration method, and the like. In the case of oral administration, for example, in an Alzheimer's disease patient (with a body weight of 60 kg), The agoquest for FPR L1 or FPR L2 per day is about 0.:!-100 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose varies depending on the subject of administration, target organ, symptoms, administration method, etc. For example, usually in the form of injections, for example, Alzheimer's disease patients (with a body weight of 6 O kg) In one embodiment, the daily dose for FPRL1 or FPRL2 is about 0.01 to 3 Omg, preferably about 0.1 to 20 mg, and more preferably about 0.1 to: It is convenient to administer about 0 mg of L by intravenous injection. In the case of other animals, the dose can be administered in terms of the body weight per 60 kg.

In the present specification and drawings, bases, amino acids, and the like are indicated by abbreviations based on the abbreviations of IUPAC—IUB Commission on Biochemical Nomenclature or commonly used abbreviations in the art, and examples thereof are described below. Ma When there is a possibility that the amino acid has an optical isomer, the L-form is indicated unless otherwise specified.

DNA Deoxyribonucleic acid

c DNA complementary deoxyribonucleic acid

A adenine

T thymine

G Guanin

C cytosine

RNA ribonucleic acid

mRNA messenger ribonucleic acid

d ATP Deoxyadenosine triphosphate

d TTP Deoxythymidine triphosphate

dGTP Deoxyguanosine triphosphate

dCTP Deoxycytidine triphosphate

AT P Adenosine triphosphate

EDTA ethylenediaminetetraacetic acid

SD S Sodium dodecyl sulfate

G 1 y Glycine

A 1 a Alanin

Va 1 Valine

Le u leucine

I 1 e isoloisin

S e r serine

Th r

Cy s Sistine

Me t Methionin

G 1 u Gunoletamic acid

As p

Lys lysine A rg: Arginine

H i s: Histidine

P he: Huenialanin

T y r: Tyrosine

T r p: Tribute fan

Pro: Proline

A s n: Asparagine

G in: Glutamine

pG1u: pyroglutamic acid

*: Corresponding to the stop codon

Me: methyl group

E t: ethyl group

B u: butyl group

P h: phenyl group

TC: thiazolidine-1 (R) —carboxamide group

Further, substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols.

To s: p—to

CHO: Honoreminore

B z 1: benzyl

C1 ₂ Bz 1: 2, 6-dichlorobenzyl

B om: Penzinoleoxymethinole

Z: Benzoxycarbinole

C 1—Z ： 2-cyclohexylbenzyloxycarbonyl

B r— Z: 2-bromobenzyloxycarbonyl

B o c: t-butoxycarbonyl

DNP: dinitrophenol

Trt: Trityl

Bum: t-bu F moc N— 9—Funore Reninoreme Toxicanore Boninole

HOB t 1 -Droxybenztriazole

HOOB t 3, 4—Hydroxy 1—Hydroxy 1 4-Oxo 1

1, 2, 3-benzotriazine

HONB 1 -Hydroxy-5-nonolevonorenene-2,3-dicarboximide DCC N, N 'Dicyclohexylcarbodiimide

P b f 2,2,4,6,7-pentamethyldihydrobenzene

5 Snollehoninore

t B u Tertiary butyl

TTFF AA: trifluoroacetic acid

HOA t 1—hydroxy-7—azabenzotriazole

P y A op 7-azabenzotriazole 1-yloxytris pyrrolidinophosphonium hexafenoleophosphate

D I PCD I 1,3—Diisopropyl force

Fmoc-Leu- Ser (Psi (Me, Me) pro) -OH: (4S) -3- (Fmoc-Leu) -2,2, -Dimethyloxazolidine-4- 4-Rubonic acid [(4S) -3- ( Fmoc-Leu) -2, 2- dimethy loxazol i dine_4-carboxylic acid]]

The sequence numbers in the sequence listing in the present specification indicate the following sequences.

[SEQ ID NO: 1]

2 shows the amino acid sequence of human-derived FPR L1.

[SEQ ID NO: 2]

1 shows the nucleotide sequence of cDNA encoding human-derived FPRL1.

[SEQ ID NO: 3]

2 shows the nucleotide sequence of a primer used in Reference Example 1.

[SEQ ID NO: 4]

2 shows the nucleotide sequence of a primer used in Reference Example 1.

[SEQ ID NO: 5]

2 shows the nucleotide sequence of a DNA encoding the humanin analogous peptide obtained in Reference Example 1. [SEQ ID NO: 6]

2 shows the amino acid sequence of humanin-like peptide (HN 3) obtained in Reference Example 1.

[SEQ ID NO: 7]

The base sequence of the query used in Reference Example 1 is shown.

Column number: 8]

1 shows the nucleotide sequence of DNA containing SEQ ID NO: 7 obtained in Reference Example 1.

[SEQ ID NO: 9]

3 shows the amino acid sequence of the partial peptide of the humanin analogous peptide NH 3 (SEQ ID NO: 6) obtained in Reference Example 1.

[SEQ ID NO: 10]

Shows the nucleotide sequence of DNA encoding SEQ ID NO: 9.

[SEQ ID NO: 11]

1 shows the amino acid sequence of human hum a n in (1-24).

[SEQ ID NO: 1 2]

[G 1 y ¹⁴ ] — Shows the amino acid sequence of human humanin (1-24). [SEQ ID NO: 13]

1 shows the amino acid sequence of human type humanin (1-21).

[SEQ ID NO: 14]

2 shows the amino acid sequence of rat type humanin (1—38).

[SEQ ID NO: 15]

2 shows the amino acid sequence of rat type humanin (1-24).

[SEQ ID NO: 16]

2 shows the amino acid sequence of rat type hum a n i n (1-21).

[SEQ ID NO: 17]

2 shows the amino acid sequence of rat-derived FPR L1.

[SEQ ID NO: 18]

1 shows the nucleotide sequence of cDNA encoding rat-derived FPR L1.

[SEQ ID NO: 19] 1 shows the amino acid sequence of mouse-derived F PRL 2 (F PRL 1).

[SEQ ID NO: 20]

Shows the nucleotide sequence of cDNA encoding mouse-derived FPRL2 (FPRL1).

[SEQ ID NO: 21]

2 shows the amino acid sequence of human-derived FPRL2.

[SEQ ID NO: 22]

1 shows the nucleotide sequence of cDNA encoding human-derived FPRL2.

[SEQ ID NO: 23]

7 shows the base sequence of primer 1 used in Reference Example 5.

[SEQ ID NO: 24]

7 shows the nucleotide sequence of primer 2 used in Reference Example 5.

[SEQ ID NO: 25]

7 shows the base sequence of primer 3 used in Reference Example 6.

[SEQ ID NO: 26]

7 shows the base sequence of primer 4 used in Reference Example 6.

[SEQ ID NO: 27]

7 shows the base sequence of primer 5 used in Reference Example 6.

[SEQ ID NO: 28]

7 shows the nucleotide sequence of primer 16 used in Reference Example 6.

[SEQ ID NO: 29]

7 shows the base sequence of primer 7 used in Reference Example 6.

[SEQ ID NO: 30]

7 shows the base sequence of primer 8 used in Reference Example 6.

[SEQ ID NO: 31]

2 shows the amino acid sequence of W-Peptide.

The transformant Escherichia coli T0P10 / pcDNA-hn3 obtained in Reference Example 1 described below has been used since July 19, 2001, 1-1 1-1 Higashi, Tsukuba-shi, Ibaraki, Japan 1 Chuo No. 6 (Zip code 305-8 56 6) Patent student, National Institute of Advanced Industrial Science and Technology Received the order number FERM BP-76 74 from the Deposit Center, from July 3, 2001, 2-chome 7-85, Jusanhoncho 2-chome, Yodogawa-ku, Osaka, Japan (postal code)

532-8686) with the Fermentation Research Institute (IFO).

Deposited as 73.

Transformants obtained in Reference Example 6 described later Escherircichaco1i

JM1 09ZPUC 1 8— r F PRL l Since January 10, 2003 1-1 1-1 Higashi, Tsukuba City, Ibaraki Prefecture 1 Independent Administrative Law of Chuo No. 6 (Zip code: 30 5—8 56 6) Research Institute Depositary No. F ERM BP-8

Deposited as 274.

Example

Hereinafter, the present invention will be described in more detail with reference to Reference Examples and Examples, but these examples do not limit the scope of the present invention. The gene using Escherichia coli was in accordance with the method described in Molecular cloning.

Reference example 1

A GEMBLE database search was performed using the human humanin gene coding region represented by SEQ ID NO: 7 as a query, and the start and corresponding positions of the humanin gene coding region in the accession number AL356135 sequence were determined. It was found that a gene region similar to the humanin gene including a stop codon was present. To confirm that this gene actually exists and is transcribed and functioning, human whole brain polyA + RNA (Clontech) 1.0 / g was used and Superscript reversetranscriptase (Gibco BRL) was used. In accordance with the manual, reverse transcription was performed using oligo (dT) primers to produce cDNA, and the coding region of the humanin-like sequence in the sequence of accession number AL356135, 5, TACCCTAACCGTGCAAAGGTAGCATG (SEQ ID NO: 3), in the order corresponding to upstream and 3 ′ downstream,

A PCR reaction was performed using a primer of GTGGGCTTATTGGGTGTTGTTTGCATTGG (SEQ ID NO: 4) in a liquid volume of 20 μl. The composition is as follows: 10 ng mRNA equivalent from the cDNA preparation solution is 铸 -type, both primers 0.5 ^ M, 2.5mM MgCl ₂ , dNTP 0.2mM, AmpliTaq Gold (PerkinElmer) 1/100 volume, 10x concentrated AmpliTaq Gold Buffer 1/10 volume I went in. The reaction was kept at 95 ° C for 10 minutes, then repeated at 95 ° C for 15 seconds, 67 ° C for 15 seconds, and 72 ° C for 15 seconds 40 times, and then kept at 72 ° C for 5 minutes. The resulting reaction solution was subcloned into plasmid vector pcDNA3.1 / V5 / His-T0P0 using an Eukaryotic T0P0 TA cloning kit (Invitrogen) and introduced into Escherichia coli TOP10. Plasmid DNA was purified from the resulting transformant using QIA prep8 mini prep (Qiagen). The reaction for base sequence determination was performed using the BigDye Terminator Cycle Sequence Ready Reaction Kit (PerkinElmer) and read using a fluorescent automatic sequencer. As a result, the nucleotide sequence represented by SEQ ID NO: 8 containing the coding region (SEQ ID NO: 5) of the humanin-like sequence found in the search was obtained, and this gene was expressed in the whole human brain. Was confirmed.

Since this sequence contained the entire coding region of the humanin-like sequence, Escherichia coli T0P10 / pcDNA-hn3 was obtained by transforming Escherichia coli T0P10 with the above plasmid.

Reference example 2

A Humanin-like peptide (HN 3) containing the amino acid sequence represented by SEQ ID NO: 6 was produced by the following method.

Fmoc-Thr (tBu)-0- Clt resin (0.527 ramol / g) 0.25 mmol obtained by introducing Fmoc-Thr (tBu)-OH into commercially available 2_chlorotrityl resin (Clt resin, 1.33 nunol / g) The sample was placed in a reaction vessel of a peptide synthesizer ABI 433A, and solid-phase synthesis was performed using the Fmoc / DCC / HOBt method. As the side chain protecting group of Fmoc amino acid, Pbf group was used for Arg, Boc group for Lys, tBu group for Asp, Thr, Ser, and Trt group for Cys. Other amino acids were used without side chain protection, and the peptide chain was extended to Thr at position 13 in the above sequence. Fmoc- Leu- Ser (Psi (Me, Me) pro) -OH (NOVA, product number 05-20-1004) was added to the obtained Fmoc-humanin similar peptide (13-24) -0-Clt resin. After the introduction with DIPCDI / HOAt, the sequence was introduced from Leu at position 10 to the N-terminal side with DCC / HOBt in sequence order to obtain the desired protected peptide resin.

100 mg¾rTFA, thioanisole ^ m—cresol, water, triisopropy 丄 si lane, ethandithiol (80: 5: 5: 5: 2.5: 2.5) in a mixture (total 1.5 ml) After stirring at room temperature for 1.5 hours, ether was added to the reaction solution to precipitate a white powder. The operation except for was repeated three times. The residue was extracted with water and freeze-dried to obtain a white powder. The obtained crude peptide was subjected to preparative HPLC using a YMC Pack R & D-0DS-5-BS-5, 120A column (30 x 250 py), solution A: 0.1% TFA_water, solution B: 0 A / B: Acetonitrile containing 1% TFA was used to perform a linear gradient elution from 78/22 to 68/32 (60 min). The fraction containing the target compound was collected and lyophilized to give 21.8 mg of a white powder. Obtained.

ESI-MS: M + 2692.8 (theoretical 2692.5)

HPLC elution time 10.5 minutes

Elution conditions

Column YMC AM 301 (4.6 x 100mm)

Eluent A: 0.1% TFA_water, B: 0.1% TFA-containing acetonitrile, A / B: 80/20 to 30/70 Linear concentration gradient elution (25 minutes)

Flow rate 1.0ml / min

Reference example 3

Humanin-like peptide inhibits glutamate-induced cell death in rat adrenal medulla-derived pheochromocytoma cells PC12h

Collagen-coated 96 大阪 L plate (IWAKI) is a medium containing Dulbecco modified Eagle's medium (DMEM) containing 10% fetal serum and 5% horse serum as medium. Provided by Prof. Hatanaka, H., Brain Research, Vol. 222, pp. 225-233, 1981) at a cell density of 2 × 10 ⁴ cels / cm ² . After 24 hours, the medium was replaced with DMEM containing 100 μl of 20 mM HEPES (pH 7.5), and at the same time, various concentrations of the humanin-like peptide (SEQ ID NO: 4) produced in Example 2 and after addition Glutamic acid was added to give a concentration of 1 raM. After 72 hours, cells were lysed using 100/1 phosphate buffered saline containing 0.2% Tween20, and the lactate dehydratase (LDH) activity of the extract was measured using LDH Cytotoxic Test WAK0 (Wako Pure Chemical Industries) . The results are shown in Figure 1.

After 72 hours of glutamate treatment, the cell viability in the non-humanin-like peptide-added group was 34.0%, whereas the humanin-like peptide was added at 1 / zM or 10 μM. Cell viability increased to 59.3% or 74.6%, respectively. The cell viability is represented by the ratio when the glutamic acid-free group was defined as 100%. From this, it is clear that the humanin-like peptide suppresses glutamate-induced cell death of rat adrenal medulla-derived pheochromocytoma cells PC12h.

Reference example 4

Humanin-like peptide (19-24) (SEQ ID NO: 9):

Production of Pro- Val- Lys- Arg- Arg- Thr

Using Fmoc-Thr (tBu) -0-Clt resin, prepare a protected peptide resin of the target sequence, and purify by the same method as the method for purifying humanin-like peptides described in Example 2 to obtain 29 mg of white powder. Obtained.

ESI-MS: M + 756.5 (theoretical 756.5)

HPLC elution time 10.2 minutes

Elution conditions

Column YMC AM 301 (4.6 x 100mm)

Eluent A: 0.1% TFA-water, B: 0.1% TFA in acetonitrile, A / B: 80/20 to 30/70 Linear concentration gradient elution (25 minutes)

Flow rate 1.0ml / min

Reference Example 5 Cloning of cDNA encoding FPRL2 from mouse spleen and construction of expression vector

Using mouse spleen cDNA (Ma ratho n-Ready ™ cDNA; C 1 ontech) as type II, two pieces designed based on the sequence information of mouse FPRL2 (Acession # 071 180; NCB I) PCR was performed using the primer No. 1, primer 1 (SEQ ID NO: 23) and primer 2 (SEQ ID NO: 24). Pyrobest DNA pol ymerase (Takara Shuzo) is used for PCR, ① After 98 ° C · 1 minute, ② 98 ° C · 10 seconds, 55 ° C · 30 seconds, 72 ° C · 60 seconds 35 times After that, ③ extension reaction was performed at 72 ° C for 2 minutes. After the reaction, the amplified product was digested with restriction enzymes Sa1I and XbaI, and then inserted into plasmid vector pAKKO-111H to construct an expression vector. As a result of analyzing the base sequence, a cDNA sequence (SEQ ID NO: 20) encoding mouse FPRL2 consisting of the amino acid sequence represented by SEQ ID NO: 19 was obtained.

Reference Example 6 Cloning of cDNA encoding FPR L1 from rat spleen Determination of its nucleotide sequence and construction of an expression vector

CDNA was synthesized from rat spleen mRNA using Marathon ™ cDNA Amp1ification Kit (C1ontech), and an adapter was added to the end. Using this as a 铸 type, PCR was performed using two primers, primer 3 (SEQ ID NO: 25) and primer 4 (SEQ ID NO: 26). For the PCR, AdV antage 2 Polymerasemix (C 1 ontech) was used. ① 96 ° C for 1 minute, ② 96 ° C for 10 seconds, 72 ° C for 2 minutes 5 times, ③ 96 ° C. 10 seconds, 70 ° C '2 minutes 5 times, ④ 96 ° C' 10 seconds, 68 ° C. '2 minutes 25 times, ⑤ 72 ° C 5 minutes An extension reaction was performed. After the reaction, the amplified product was inserted into plasmid vector pCR2.1 TOPO (Invitrogen) according to the prescription of TOPO TA Cloning Kit (Invitrogen), and this was inserted into E. coli JM109 (Takara Shuzo). Crawling was introduced. As a result of analyzing the nucleotide sequence of each clone, a cDNA sequence encoding a part of the novel G protein-coupled receptor 1 protein was obtained. Based on this sequence information, two primers, primer 5 (SEQ ID NO: 27) and primer 16 (SEQ ID NO: 28) were designed, and cDNA synthesized from rat spleen mRNA described above was synthesized. 5′-RACE and 3′-RACE were performed according to the prescription of Marathon ™ cDNA Amp1ification Kit (C 1 ontech) as molds, respectively. PCR is performed in the same manner as described above. After the reaction, the amplification product is inserted into the plasmid vector pCR2.1 TOPO (Invitrogen) according to the prescription of TOPO TA Cloning Kit (Invitrogen). This was introduced into E. coli JM109 (Takara Shuzo) and clawed. As a result of analyzing the nucleotide sequence of each clone, a cDNA sequence encoding a part of the novel G protein-coupled receptor protein was obtained. Based on these sequence information, two more primers, primer 7 (SEQ ID NO: 29) and primer 8 (SEQ ID NO: 30) were designed, and the cDNA synthesized from the above-mentioned rat B base mRNA was converted to type III. A PCR was performed. Using PCI ^ i ^ iP yrobest DNA pol ymerase (Takara Shuzo), ① After 98 ° C · 1 minute, ② 98 ° C · 10 seconds, 55 ° C · 30 seconds, 72 ° C · 60 seconds 3 After 5 times, ③ 7 2 ° C · 2 An extension reaction was performed for 1 minute. After the reaction, the amplified product was digested with restriction enzymes Sa1I and XbaI, and inserted into a plasmid vector pAKKO-11H to construct an expression vector. This was cleaved with restriction enzymes Sa1I and NheI to excise the inserted fragment, inserted into a plasmid vector pUC119, and analyzed for its nucleotide sequence. As a result, the amino acid represented by SEQ ID NO: 17 was obtained. A cDNA sequence (SEQ ID NO: 18) encoding a novel rat G protein-coupled receptor protein comprising the sequence was obtained. A novel protein having the amino acid sequence (SEQ ID NO: 17) derived from this cDNA was named rat FPRL1. A transformant carrying this plasmid was designated as Escherichiaco 1i JM109 / pUC119-rFPRL1.

Reference Example 7 Preparation of plasmid containing cDNA encoding FPRL1 derived from rat spleen

The expression vector obtained in Reference Example 6 was digested with the restriction enzymes Sal I and Nhe I to excise the inserted fragment, inserted into the plasmid vector pUC18, and analyzed for their base sequences. As in Example 5, it was confirmed to be a cDNA sequence (SEQ ID NO: 18) encoding a novel rat G protein-coupled receptor protein consisting of the amino acid sequence represented by SEQ ID NO: 17. In addition, a transformant carrying this plasmid was named Escherichia coli (Escherichchiacco1i) JM109 / pUC18-rFPRLl.

Example 1 In CHO cells expressing FPRL1-GFP, suppression of the amount of cAMP increased by the addition of forskolin by the human analog-like peptide (HN3) (SEQ ID NO: 6)

After washing the CHO cells expressing FPRL-1 GFP in Atsushi medium (HBSS supplemented with 0.1% serum albumin and 0.2 mM I BMX), 37 ° C, was incubated for 30 minutes at 5% C0 ₂ conditions. Each concentration of HN 3 and forskolin diluted in Atsushi's medium was added to make a concentration of 1. 37 ° C, 5% C0 were incubated for 30 minutes at ₂ conditions. Discard the culture supernatant and measure the amount of cAMP in the cells using a plate reader (ARVO sx multilabel) according to the protocol of cAMP screenkit (Applied Biosystems). (Wall counter, Wallac).

As a result, compared to the CHO cells transfected with the vector alone (mock) (Fig. 3), the amount of intracellular cAMP increased by the addition of forskolin was increased in the CHO cells transfected with the FPRL1-GFP gene. A dose-dependent and specific decrease by 3 was detected (Figure 2).

Example 2 Human FPR1-expressing CHO cells (No. 14), human FPRL1-expressing CHO cells (No. 8), human FPRL2-expressing CHO cells (No. 17), mouse FPRL2 (No. 14) 15) and rat FPRL1-expressing CHO cells (No. 15) suppress the intracellular cAMP level increased by forskolin by each agonist.

After washing the CHO cells expressing the above-mentioned receptor in a medium for Atsushi (HBS S (GibcoBRL) supplemented with 0.1% serum albumin and 0.2 mM I BMX), 37 ° C, 5% C0 were incubated for 30 minutes at ₂ conditions. Humanin-like peptide (HN3) at each concentration diluted in Atsey's medium was added, followed by 1 μΜ of forskolin. The cells were cultured at 37 ° C under 5% CO ₂ for 30 minutes. The culture supernatant was discarded, and the amount of cAMP in the cells was measured using a plate reader (ARVOs X multilabel counter, Wallac) according to the protocol of cAMP screenkit (Applied Biosystems). Assuming that cAMP production in cells supplemented with 1 M of forskolin is 100% and cAMP production in cells not supplemented with forskolin is 0%, the amount of cA ^ when each agonist is added is indicated in%. did. c The concentration that inhibits the amount of AMP production by 50% (EC ₅₀ ) was calculated from a logit-log plot. As a result, HN3 was found to react not only with hFPRL1 but also with hFPRL2, and also with mFPRL2 and rFPRL1. (Figure 4). Industrial applicability

By using the FPRL1, FPRL2, its partial peptide or a salt thereof and the humanin-like peptide of the present invention, the humanin-like peptide and the FPRL1, FPRL2, its partial peptide or its partial peptide of the present invention are used. With salt Can efficiently screen compounds that change the binding property of _c

Claims

The scope of the claims

1. (1) G protein-coupled receptor containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 A protein, a partial peptide thereof or a salt thereof (2) a binding property between the receptor protein or a salt thereof and a humanin similar peptide or a salt thereof characterized by using a humanin similar peptide or a salt thereof; A method for screening a compound or a salt thereof that alters signal transduction.

2.Huma ni n similar peptide,

(2) The screening according to claim 1, which is a peptide comprising 6 to 20 consecutive amino acids in the amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 6, or a salt thereof. Method.

3.Hum a n i n Similar peptide power

(1) a) the amino acid sequence represented by SEQ ID NO: 6; b) the amino acid sequence in which 1 to 10 amino acids in the amino acid sequence represented by SEQ ID NO: 6 have been deleted; c) the sequence number : Amino acid sequence obtained by adding 1 to 10 amino acids to the amino acid sequence represented by 6; d) 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 6 are substituted with other amino acids Or e) a polypeptide comprising an amino acid sequence obtained by combining these deletions, additions and substitutions, or a salt thereof, or

(2) a) 19th to 24th, 5th to 24th, 1st to 20th, 5th to 20th, 1st to 2nd of amino acid sequence represented by SEQ ID NO: 6 1st or 5th to 21st amino acid sequence, b) amino acid sequence in which 1 to 6 amino acids are deleted in the amino acid sequence, c) 1 to 6 amino acids in the amino acid sequence An added amino acid sequence, d) an amino acid sequence in which 1 to 6 amino acids in the amino acid sequence have been substituted with another amino acid, e) or an amino acid sequence obtained by combining deletion, addition, and substitution thereof. The number of amino acids is 6-20 (Provided that the amino acid sequence represented by SEQ ID NO: 11 or SEQ ID NO: 12 is 19th to 24th, 5th to 24th, 1st to 20th, or 5. The method according to claim 1, wherein the amino acid sequence is amino acid sequence of 5th to 20th, 1st to 21st or 5th to 21st (excluding peptides) or a salt thereof.

4. The huma ni n analog peptide is

(1) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 6, or a salt thereof, or

(2) 19th to 24th, 5th to 24th, 1st to 20th, 5th to 20th, 1st to 21st of the amino acid sequence represented by SEQ ID NO: 6 The screening method according to claim 1, wherein the screening method is a peptide consisting of the amino acid sequence of the 5th to 21st positions or a salt thereof.

5. (1) a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21, (2) Altering the binding property or signal transduction between the receptor protein or a salt thereof and the humanin similar peptide or a salt thereof, which contains the partial peptide or a salt thereof and (2) the humanin similar peptide Kit for screening compounds or salts thereof.

6. The same or substantially the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, which can be obtained by using the screening method according to claim 1 or the screening kit according to claim 5, and a peptide similar to humanin or a salt thereof. Or a salt thereof, which alters the binding or signal transduction with a G protein-coupled receptor protein or a salt thereof, which contains the same amino acid sequence as the above.

7. The compound according to claim 6, which is an agonist.

8. The compound according to claim 6, which is an antagonist.

9. An amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 with a humanin analogous peptide or a salt thereof. Contains G protein-coupled receptor protein A pharmaceutical comprising a compound or a salt thereof that alters the binding to a protein or a salt thereof or signal transduction.

10. A preventive / therapeutic agent for a neurodegenerative disease or cerebral dysfunction, comprising the agonist according to claim 7.

1 1. Alzheimer's disease, Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion disease, Creutzfeldt-Jakob disease, Huntington's disease, diabetic dieuropathy, multiple sclerosis, cerebral infarction, cerebral hemorrhage, arachnoid membrane 11. The preventive / therapeutic agent according to claim 10, which is a preventive / therapeutic agent for subhemorrhagia, ischemic brain disease, epidural hematoma or subdural hematoma.

1 2. A cell death inhibitor comprising the agonist according to claim 7.

1 3. (1) G protein-coupled receptor having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21 A protein, a partial peptide or a salt thereof, and (2) a compound or a salt thereof that alters the binding or signal transduction between a humanin-like peptide or a salt thereof and the receptor protein or a salt thereof. A method of screening an agonist or an antagonist for a receptor protein or a salt thereof.

14. An effective amount of the agonist according to claim 7 is administered to a mammal, (i) a method for preventing or treating a neurodegenerative disease or cerebral dysfunction, (ii) Alzheimer's disease, Parkinson's disease , Down's syndrome, amyotrophic lateral sclerosis, prion disease, Kreutzfenoreth-Jakob disease, Huntington's chorea, diabetic neuropathy, multiple sclerosis, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, ischemic brain A method for preventing or treating a disease, epidural or subdural hematoma, or (iii) a method for suppressing cell death.

1 5. (i) Prevention and treatment of neurodegenerative disease or cerebral dysfunction, (ii) Alzheimer's disease, Parkinson's disease, Down's syndrome, amyotrophic lateral sclerosis, prion disease, Kuitsitzfeld-Jakob disease, Huntington's disease Prevention and treatment of chorea, diabetic neuropathy, multiple sclerosis, cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, ischemic brain disease, epidural or subdural hematoma or (iii) cell death Use of an agonist according to claim 7 for producing an inhibitor.