WO2004006939A1 - Blocking inflammation by inhibiting st3-gal-vi activity - Google Patents

Abstract

This invention provides methods and compositions for treating and preventing inflammation. The methods for treating and preventing inflammation and related conditions involve administering to a mammal an agent that reduces activity of a sialyltransferase, such as an ST3Gal-VI.

Description

BLOCKING INFLAMMATION BY INHIBITING ST3Gal-VI ACTIVITY

STATEMENT REGARDING FEDERALLY SPONSORED- RESEARCH

This invention was made with government support under GranfNo. PO1- HL57345 awarded by the National Institutes of Health. The United States Government may have certain rights in the invention.

BACKGROUND OF THE INVENTION

This invention pertains to the field of treating and preventing inflammation. Compounds and methods for modulating an inflammatory response are provided.

A mammal often responds to cell injury, infection, or an abrupt change in a tissue by inducing an inflammatory response. Typically, an inflammatory response is initiated by endothelial cells producing molecules that attract and detain inflammatory cells (e.g., myeloid cells such as neutrophils, eosinophils, and basophils) at the site of injury. The inflammatory cells then are transported through the endothelial barrier into the surrounding tissue. The resulting accumulation of inflammatory cells, in particular neutrophils, is followed by generation of toxic oxygen particles and, release of neutrophil granules which contain acid hydrolases and degradative enzymes such as proteases, elastase, and coUagenase, which contribute to local tissue breakdown and inflammation. Neutrophils can also release chemoattractants and complement activators that amplify the inflammation.

Although the inflammatory response can play a role in the healing process by destroying, diluting, and isolating injurious agents and stimulating repair of the affected tissue, inflammatory responses can also be harmful, and indeed life-threatening. Five symptoms often characterize the inflammatory response: pain, redness, heat, swelling, and loss of function. For example, inflammation results in leakage of plasma from the blood vessels. Although this leakage can have beneficial effects, it causes pain and when uncontrolled can lead to loss of function and death (such as adult respiratory distress syndrome). Anaphylactic shock, arthritis, and gout are among the conditions that are characterized by uncontrolled or inappropriate inflammation.

Inflammatory responses differ from immune responses mediated by T- and B- lymphocytes in that an inflammatory response is non-specific. While antibodies and MHC- mediated immune responses are specific to a particular pathogen or other agent, the inflammatory response does not involve identification of a specific agent. Both inflammatory responses and specific immune responses, however, involve extravasation of the respective cell types from the blood vessels to the site of tissue injury or infection. Moreover, several of the receptors that mediate extravasation of lymphocytes are also involved in extravasation of inflammatory cells. In particular, lymphocyte trafficking to lymph nodes under normal circumstances is mediated by selectins that are expressed by cells of the vascular endothelium in response to cytokine induction. Selectins are also involved in the recruitment of neutrophils to the vascular endothelium during inflammation (reviewed in Kansas (1996) Blood 88: 3259-87; McEver and Cummings (1997) J Clin. Invest. 100: 485-91). Three types of selectins are involved in the interaction between leukocytes and the vascular endothelium. The expression pattern of the three selectin molecules E, L, and P, reflects the physiologic role that each plays in vivo. E- and P-selectin are induced on the vascular endothelium during inflammation; while P-selectin is also found on platelets, and L- selectin is expressed on the surface of leukocytes. Absence of these molecules, singly or in combination, yields defects to varying degrees in leukocyte homeostasis, trafficking, and innate immune responses during inflammation. (Arbones et al. (1994) Immunity 1: 247-260; Johnson et al. (1995) Blood 86: 1106-14; Labow et al. (1995) Immunity 1 : 709-720; Mayadas et al. (1993) Cell 74: 541-554); Bullard et al (1996) JExp Med. 183:2329-2336; and Collins et al (2001) Blood 98:727-735). The carbohydrate (glycan) ligands of the selectins are less well defined. The prototypical selectin ligand structure is a terminal tetrasaccharide (Siaα2-3GalBl-4[Fucαl- 3]GlcNAc-) termed Sialyl Lewis X (sLe^x) (reviewed in Varki (1997) J. Clin. Invest. 99: 158-162). Evidence from gene ablation studies indicates that multiple glycosyltransferases control selectin ligand biosynthesis. For example, fucosyltransferase-NII (FucT-VII) is required for functional E-, P- and L-selectin ligand formation, and its absence in mice provokes deficits involving both neutrophil trafficking in inflammation and lymphocyte homing and colonization of the lymph nodes Maly et al (1996) Cell 86:643-653). hi contrast, FucT-LV contributes to E-selectin ligand function, mostly in concert with FucT-NII as evident in the FucT-NII deficient background Homeister et al (2001) Blood 15:115-126). In contrast, the core 2 Ν-acetylglucosaminyltransferase-I (C2GlcΝAcT-I) is required for the formation of a subset of selectin ligands involved in neutrophil recruitment during inflammation but not in lymphocyte trafficking to peripheral lymph nodes (Ellies et al (1998) Immunity 881-890).

Six genes have been identified in the mammalian genome that encode Golgi- resident sialyltransferases that form α2-3 sialic acid linkages (ST3Gal-I-VI) potentially involved in selectin ligand formation (Kono et al, (1997) Glycobiology.; 7:469 479; Kono et al, (1998) Biochem Biophys Res Commun.; 253:170-175; Okajima, et α/. (1999) J. Biol. Chem. 274: 11479). Three of those (ST3Gal-III, ST3Gal-IN and ST3Gal-NI) are known to sialylate type II (Galβl-4GlcΝAc) oligosaccharides in vitro, consistent with involvement in the formation of sLe^x (Okajima, et al. (1999) and Sasaki et al (1993) JBiol Chem 268:22782-22787. In fact, ST3Gal-III expression has been correlated with the formation of sLe^x in some cancer tissues (Ogawa et al (1997) 79: 1678-1685. However, ST3Gal-III exhibits strongest substrate preference for type I (GalBl-3GlcNAc) oligosaccharides, which could result in the formation of sLe^a on leukocytes Wen et al (1992) JBiol Chem 267:21011- 21019. ST3Gal-I and ST3Gal-II activity in vitro is predominantly towards type III oligosaccharides, while ST3Gal-II prefers glycolipid substrates, and neither has detectable in vitro activity towards type II chains that form the foundation for sLe^x structures on leukocytes (Kono et al (1997) and Fukuda et al (1985) JBiol Chem 260:12957-12967). ST3Gal-V is also known as GM₃ synthase and has a substrate preference for glycolipids (Kono et al (1998)). Any of these ST3Gal sialyltransferases may be involved to some degree in selectin ligand formation among various cell types in vivo.

Sialyltransferase function may also be influenced by competition in the Golgi with other glycosyltransferases that operate in concurrent biosynthetic and branching steps, potentially impacting on the formation of downstream terminal branch structures. For example, it is known that ST3Gal-I effectively competes with C2GlcNAcT-I for the same substrate, and thereby reduces core 2 O-glycan branch formation in vivo Priatel et al, (2000) Immunity; 12:273-283). Such characterization of genetically altered mice has revealed the essential and modulatory role of specific glycosyltransferases and their glycan products in leukocyte-endothelial recognition by the selectins Marth, (1999) In: Narki et al, eds.

Essentials of Glycobiology. Cold Spring Harbor, ΝY: Cold Spring Harbor Laboratory Press

1999:499-514.. Despite progress in this field, further characterization of the enzymes involved in selectin ligand formation is needed in the art. The present invention addresses these and other needs.

SUMMARY OF THE INVENTION

The invention is based, at least in part, on the identification of ST3Gal-VI sialyltransferase as an enzyme involved in the synthesis of the sLe^x structure. The present invention thus provides novel prophylactic, treatment and diagnostic methods for inflammation and related conditions.

The invention provides methods for modulating the amount of selectin ligands (sLe^x) that are attached to inflammatory cells in an animal. The methods can involve administering to the animal an agent that causes a decrease in ST3Gal-NI sialyltransferase activity in the animal. The decrease in sialyltransferase activity can be achieved by administering an agent that decreases expression of a gene that encodes an ST3Gal-NI sialyltransferase, and/or by administering an agent that inhibits enzymatic activity of an ST3Gal-NI sialyltransferase. Also provided by the invention are methods for monitoring the efficacy of a method for inhibiting ST3Gal-NI sialyltransferase in a mammal. These methods involve testing cells obtained from the mammal for the presence or absence of a cell-surface oligosaccharide having a sLe^x structure wherein the absence of the terminal cc2,3-linked sialic acid is indicative of inhibition of sialyltransferase activity. In another embodiment, the invention provides eukaryotic cells in which a non-naturally occurring mutation is present in an ST3Gal-NI sialyltransferase. At least one, and sometimes two or more alleles have a mutation. In presently preferred embodiments, the mutation either disrupts the expression of ST3Gal-NI or results in expression of an ST3Gal- VI polypeptide that has reduced activity compared to an ST3Gal-VI polypeptide encoded by a gene that lacks the mutation. The invention also provides methods of screening for agents that can be used to reduce or inhibit inflammation in a mammal. The methods involve screening for agents that inhibit ST3Gal-VI activity. The agents can inhibit the activity of the enzyme or nucleic acids encoding the enzyme.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig 1. Sialylated glycan chain termini and expression of ST3Gal-I, -II, -III and -IV sialyltransferase RNA.

A. ST3Gal-sialyltransferases add sialic acid to the terminus of type I, II or III glycan chains, as occurs in formation of selectin ligands such as sialyl Lewis X.

B. Total RNA from various mouse tissues was hybridized with cDNA probes specific for each of the sialyltransferases. The sybergreen stained gel (bottom) indicates equal loading of the RNA.

Fig 2. ST3Gal-II and ST3Gal-III mutagenesis. A and E. Genomic clones bearing wild-type ST3Gal-II and -III allelic structure, respectively, were used to construct targeting constructs using t spflox vector. In the ST3Gal-II, exons containing the large sialylmotif were flanked by loxP sites (ST3Gal-II^F[tkneco]), while loxP sites flanked the transmembrane domain in the ST3Gal-III gene (ST3Gal-III^F[tkneo]). Restriction enzyme sites indicated are Bam HI (B,) Avr II (A), Cla I (C), Eco RI (E), Hind III (H), Kpn I (K), Nhe I (N), Sal I (Sa), Stu I (St) and Xba I (X). B and F. Transient Cre expression in ES cells that have undergone homologous recombination with ST3Gal-II or -III targeting vector yielded subclones with a ST3Gal-II or -III^ (systemic null) or ST3Gal-II or -I^F (conditional-null) mutation.

C and G. Southern blot analysis of ES cell DNA probed with a loxP probe confirmed the expected recombined genomic structures. Wild type RI ES cell DNA did not hybridize with the loxP probe. Three loxP sites were present parental clones of ST3Gal-II and -III (2-3 and 2-6, respectively). One loxP site is present in each of two ST3Gal-II ^Λ subclones (2-3B4 and 2-3B5) and STSGal-III^ subclones (26A5 and 2-6D5). Two loxP sites are present in the ST3Gal-II^F subclones (2-3B3 and 23B6) and ST3Gal-III^F subclones (2-6A1 and 2-6A3). D and H. PCR analyses of tail DNA from offspring of parental mice heterozygous for the ST3Gal-IIΔ allele reveals the 230 by wild type (wt) fragment and the 190 by deleted (Δ) fragment. PCR analyses of tail DNA from offspring of parental mice heterozygous for the ST3Gal-III Δ allele indicates the 370 bp wt allele and the 260 by Δ allele.

Fig 3. ST3GaI-I-IV sialyltransferase deficiencies result in differential degrees of exposed galactose and selectin-Ig chimera binding to blood neutrophils.

A. RCA-I, ECA, and PNA lectin binding to circulating Grl⁺ cells (mostly neutrophils) or CD8⁺ T cells was assessed by flow cytometry. Reduced sialylation resulting in exposed beta-linked galactose was observed differentially among leukocytes and specific sialyltransferase mutations.

B. P- and E- selectin Ig chimera binding to circulating Grl⁺ leukocytes of ST3Gal-I, -II, -III and -IV deficient mice was analyzed by flow cytometry and compared with C2GlcNAcT-I deficiency. Panels A and B are representative of 3 separate experiments. Filled histograms represent selectin binding to neutrophils of mutant mice, and are compared with wild type littermates in the same panel.

Fig 4. Sialidase treatment and compound ST3Gal deficiencies implicate multiple sialyltransferases in the formation of selectin ligands in vivo.

E- and P-selectin Ig chimera binding was assessed following treatment of peripheral blood Grl⁺ cells from ST3Gal-LV deficient mice with Arthrobacter ureafaciens neuraminidase.

Fig 5. Leukocyte rolling in vitro.

A,B. Rolling of purified bone marrow neutrophils on CHO cells expressing either P-selectin or E-selectin at 1.5 dynes/cm . Data are presented as the mean ± SEM of total rolling events and are derived from 8 independent experiments.

Fig 6. Altered in vivo leukocyte rolling in ST3Gal-IV^Δ/Δ mice during TNFα-induced vascular inflammation. A. Leukocyte rolling per 100μ.tm vessel segment length was assessed in ST3Gal-LV^{A Λ} mice (black bars) and control mice (gray bars) treated with either P-selectin blocking mAb RB40.34 or E-selectin blocking mAb 9A9.

B-D . Cumulative velocity distribution for ST3 Gal-IN^{Δ Δ} mice (solid line) and wild-type littermates (dotted line) with (B) no treatment, (C) P-selectin blocking mAb

RB40.34, and (D) E-selectin blocking mAb 9A9. Significant differences in leukocyte velocity (*p<0.05) between ST3Gal-IN^Δ/Λ mice and wild-type mice were observed for anti

P-selectin treated mice and mice without antibody treatment, indicating an E-selectin ligand defect. DETAILED DESCRIPTION

DEFINITIONS

The following abbreviations are used herein: Ara = arabinosyl;

Fru = fructosyl; Fuc = fucosyl;

Gal = galactosyl;

GalNAc = N-acetylgalactosaminyl;

Glc = glucosyl;

GlcNAc = N-acetylglucosaminyl; Man = mannosyl; and

NeuAc = sialyl (N-acetylneuraminyl). Oligosaccharides are considered to have a reducing end and a non-reducing end, whether or not the saccharide at the reducing end is in fact a reducing sugar. -In accordance with accepted nomenclature, oligosaccharides are depicted herein with the non- reducing end on the left and the reducing end on the right.

All oligosaccharides described herein are described with the name or abbreviation for the non-reducing saccharide (e.g., Gal), followed by the configuration of the glycosidic bond (α or β), the ring bond, the ring position of the reducing saccharide involved in the bond, and then the name or abbreviation of the reducing saccharide (e.g., GlcNAc). The linkage between two sugars may be expressed, for example, as 2,3, 2- 3, or (2,3). Each saccharide is a pyranose. The term "sialic acid" refers to any member of a family of nine-carbon carboxylated sugars. The most common member of the sialic acid family is N-acetyl- neuraminic acid (2-keto-5-acetamindo-3,5-dideoxy-D-glycero-D-galactononulopyranos-l- onic acid (often abbreviated as Neu5Ac, NeuAc, or NANA). A second member of the family is N-glycolyl-neuraminic acid (Neu5Gc or NeuGc), in which the N-acetyl group of NeuAc is hydroxylated. A third sialic acid family member is 2-keto-3-deoxy-nonulosonic acid (KDN) (Nadano et α/. (1986) J. Biol Chem. 261: 11550-11557; Kanamori et /. (1990) J. Biol. Chem. 265: 21811-21819. Also included are 9-substituted sialic acids such as a 9-O-C1-C6 acyl-Neu5Ac like 9-O-lactyl-Neu5Ac or 9-O-acetyl-Neu5Ac, 9-deoxy-9-fluoro-Neu5Ac and 9-azido-9-deoxy-Neu5Ac. For review of the sialic acid family, see, e.g., Narki (1992)

Glycobiology 2: 25-40; Sialic Acids: Chemistry, Metabolism and Function, R. Schauer, Ed. (Springer-Nerlag, New York (1992). The synthesis and use of sialic acid compounds in a sialylation procedure is disclosed in international application WO 92/16640.

Much of the nomenclature and general laboratory procedures required in this application can be found in Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. The manual is hereinafter referred to as "Sambrook et al"

The term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence includes the complementary sequence thereof.

An "inhibitory nucleic acid" is any nucleic acid or modified nucleic acid used or designed for use in inhibitory nucleic acid therapy. "Inhibitory nucleic acid therapy" refers to the use of inhibitory nucleic acids to inhibit gene expression, for example, inhibition of DNA transcription, inhibition of RNA processing, transport or translation, or inhibition of protein synthesis. -Inhibitory nucleic acid therapy includes the variety of approaches for treatment of disease using nucleic acids or modified nucleic acids as described herein. Various inhibitory nucleic acid therapies are discussed in detail below. The term "recombinant" when used with reference to a cell indicates that the cell replicates a heterologous nucleic acid, or expresses a peptide or protein encoded by a heterologous nucleic acid. Recombinant cells can contain genes that are not found within the native (non-recombinant) form of the cell. Recombinant cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain a nucleic acid endogenous to the cell that has been modified without removing the nucleic acid from the cell; such modifications include those obtained by gene replacement, site-specific mutation, and related techniques.

A "heterologous sequence" or a "heterologous nucleic acid", as used herein, is one that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form.

A "subsequence" refers to a sequence of nucleic acids or amino acids that comprise a part of a longer sequence of nucleic acids or amino acids (e.g., polypeptide) respectively.

A "recombinant expression cassette" or simply an "expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with nucleic acid elements that are capable of affecting expression of a structural gene in hosts compatible with such sequences. Expression cassettes include at least promoters and optionally, transcription termination signals. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed (e.g., a nucleic acid encoding a desired polypeptide), and a promoter. Additional factors necessary or helpful in effecting expression may also be used as described herein. For example, an expression cassette can also include nucleotide sequences that encode a signal sequence that directs secretion of an expressed protein from the host cell. Transcription termination signals, enhancers, and other nucleic acid sequences that influence gene expression, can also be included in an expression cassette. The term "isolated" is meant to refer to material which is substantially or essentially free from components which normally accompany the enzyme as found in its native state. Thus, the enzymes of the invention do not include materials normally associated with their in situ environment. Typically, isolated proteins of the invention are at least about 80% pure, usually at least about 90%, and preferably at least about 95% pure as measured by band intensity on a silver stained gel or other method for determining purity. Protein purity or homogeneity can be indicated by a number of means well known in the art, such as polyacrylamide gel electrophoresis of a protein sample, followed by visualization upon staining. For certain purposes high resolution will be needed and HPLC or a similar means for purification utilized.

The phrase "substantially identical," in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 70%, preferably 80%, most preferably 90-95% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman (1981) Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman & Wunsch (1970) J. Mol. Biol. 48: 443, by the search for similarity method of Pearson & Lipman (1988) Proc. Nat 'I. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al, supra). Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff& Henikoff (1989) Proc. Natl Acad. Sci. USA 89: 10915).

"Conservatively modified variations" of a particular polynucleotide sequence refers to those polynucleotides that encode identical or essentially identical amino acid sequences, or where the polynucleotide does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance, the codons CGU, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of "conservatively modified variations." Every polynucleotide sequence described herein which encodes a polypeptide also describes every possible silent variation, except where otherwise noted. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent variation" of a nucleic acid which encodes a polypeptide is implicit in each described sequence.

Furthermore, one of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are "conservatively modified variations" where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. See, e.g., Creighton (1984) Proteins, W.H. Freeman and Company. In addition, individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also "conservatively modified variations".

The term "transgenic" refers to a cell that includes a specific genetic modification that was introduced into the cell, or an ancestor of the cell. Such modifications can include one or more point mutations, deletions, insertions, or combinations thereof. When referring to an animal, the term "transgenic" means that the animal includes cells that are transgenic, and descendants of such animals. An animal that is composed of both transgenic and non-transgenic cells is referred to herein as a "chimeric" animal.

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention provides compositions and methods for reducing and/or preventing inflammation in a mammal. The invention is based on the discovery that inhibition of ST3Gal-VI sialyltransferase activity results in a decrease in neutrophil recruitment and extravasation in response to an inflammatory stimulus. Accordingly, the compositions and methods of the invention are useful for treating and/or preventing inflammation by causing a decrease in the amount of cell-surface oligosaccharides terminating in the Sialyl Lewis X (sLe^x) structure.

Prophylactic and Therapeutic Methods for Inflammation

In some embodiments, the invention provides methods for reducing inflammation by decreasing the amount of cell surface N-linked and/or O-linked oligosaccharides that terminate in the sLe^x structure. The invention provides several methods by which reductions in biosynthesis of oligosaccharides that terminate in the sLe^x structure can be accomplished. The expression of an ST3Gal-VI sialyltransferase gene can be inhibited, for example, or the enzymatic activity of the protein can be inhibited. Alternatively, the oligosaccharide that serves as an acceptor for the sialyltransferase-catalyzed reaction can be modified, e.g., by addition or removal of a saccharide residue from the acceptor to render the oligosaccharide no longer an acceptable acceptor for the sialyltransferase.

Sialyltransferase Inhibitors In some embodiments, reductions in inflammation are obtained by inhibiting the enzymatic activity of ST3Gal-VI. Enzyme inhibition generally involves the interaction of a substance with an enzyme so as to decrease the rate of the reaction catalyzed by that enzyme.

Several inhibitors of sialyltransferases are known in the art. For example, analogs of sialyltransferase substrates are suitable for use as inhibitors. Analogs of both the donor (e.g., analogs of CMP-sialic acid) and the acceptor have been reported which serve as sialyltransferase inhibitors (Schaub et al. (1998) Glycoconjugate J. 15: 345-354; Schaub and Schmidt (1996) Abstract C 10, Second European Conference on Carbohydrate Mimics, La Garda (Italy); Amann et al. (1998) Chem. Eur. J. 4: 1106-1115; Mύller et al. (1998) Tetrahedron Lett. 39: 509-512; Korytnyk et /. (1980) Eur. J. Med. Chem. 15: 77-84;

Kijima-Suda et al. (1986) Cancer Res. 46: 858-862; Khan et al. (1992) In Glycoconjugates, Composition, Structure, Function (Eds.: H. J. Allen, E. C. Kisailus). M. Dekker, New York, pp. 361-378 and references therein; Hashimoto et al. (1993) Carbohydr. Res. 247: 179-193; Imamoto and Hashimoto (1996) Tetrahedron Lett. 37: 1451-1454; Kleineidam et al. (1997) Glycoconjugate J. 14: 57-66). Transition state analogs are also useful as sialyltransferase inhibitors (Schaub et al, supra., Schaub and Schmidt, supra.; Amann et al, supra., and WO 008040). Other sialyltransferase inhibitors are described in Cambron and Leskawa (1993) Biochem. Biophys. Res. Commun. 193:585-90. α2,3 -sialyltransferase activity can also be regulated by modulation of the phosphorylation state of the enzyme. Phosphorylation of a serine residue in ST3Gal-IN by, for example, protein kinase A or C results in a decrease in sialyltransferase activity (Gu et al. (1995) J. Neurochem. 64:2295-302). Activity can be restored by treatment with a phosphatase. Protein kinase activators and phosphatase inhibitors can therefore be administered to reduce sialyltransferase activity, including ST3Gal-NI activity. One example of a suitable protein kinase inhibitor is a subtype of the 14-3-3 protein family that has been shown to be associated with ST3Gal-IN (Gao et al. (1996) Biochem. Biophys. Res.

Commun. 224: 103-7). Other examples of suitable protein kinase activators and phosphatase inhibitors are described in Bieberich et al (1998) J. Neurochem. 71 :972-9.

Additional inhibitors of the α2,3 -sialyltransferase can be readily identified by screening methods known to those of skill in the art. Sialyltransferase activity and its inhibition is typically assayed according to standard methods for determining enzyme activity. For a general discussion of enzyme assays, see, Rossomando, "Measurement of Enzyme Activity" in Guide to Protein Purification, Vol. 182, Methods in Enzymology (Deutscher ed., 1990), and Fersht, Enzyme Structure and Mechanism (2d ed. 1985). Enzyme inhibition of kinetically complex systems involving more than one substrate, as is the case for glycosyltransferases, are described in Segel, Enzyme Kinetics, (Wiley, Ν.Y. 1975), which is incorporated herein by reference.

An assay for α2,3-sialyltransferase activity typically contains a buffered solution adjusted to physiological pH, a source of divalent cations, a donor substrate (usually labeled CMP-sialic acid), an acceptor substrate (e.g., Galβl,4GlcΝAc or Galβl,3GalNAc), the sialyltransferase, and the compound whose inhibitory activity is to be tested. After a predetermined time, typically at 23°C or 37°C, the reaction is stopped and the sialylated product is isolated and measured according to standard methods (e.g., in a scintillation counter). Sialyltransferase assays which use a UN-labeled acceptor and lead to a UN-labeled product that can be readily separated by reverse phase HPLC and quantitated by UN spectroscopy are described in Schaub et al. (1998) Glycoconjugate J. 15: 345-354. See also, Kajihara et al. (1994) Carbohydr. Res. 264, C1-C5; (1995) J. Org. Chem. 60: 5732-5735. Inhibition of sialyltransferase activity in an assay as defined herein refers to a decrease in enzyme specific activity in the presence of an inhibitory agent of at least about 50%, more preferably at least about 70%, and still more preferably at least about 90%, compared to the activity in the absence of the agent. Screening can be employed to identify α2,3 -sialyltransferase inhibitors that are present in a mixture of synthetically produced compounds or alternatively in a naturally occurring mixture, such as a cell culture broth. Suitable cells include any cultured cells such as mammalian, insect, microbial or plant cells. Microbial cell cultures are composed of any microscopic organism such as bacteria, protozoa, yeast, fungi and the like. In the typical screening assay, a sample, such as a funGal-broth, is added to a standard sialyltransferase assay. If inhibition of activity as compared to control assays is found, the mixture is usually fractionated to identify components of the sample that provide the inhibiting activity. The sample is fractionated using standard methods such as ion exchange chromatography, affinity chromatography, electrophoresis, ultrafiltration, HPLC and the like. See, e.g., Protein

Purification, Principles and Practice, (Springer-Nerlag, 1982). Each isolated fraction is then tested for inhibitory activity. If desired, the fractions are then further subfractionated and tested. This subfractionation and testing procedure can be repeated as many times as desired. By combining various standard purification methods, a substantially pure compound suitable for in vivo therapeutic testing can be obtained. A substantially pure blocking agent as defined herein is an inhibitory compound which migrates largely as a single band under standard electrophoretic conditions or largely as a single peak when monitored on a chromatographic column. More specifically, compositions of substantially pure blocking agents will comprise less than ten percent miscellaneous compounds. Inhibitors can be classified according a number of criteria. For example, they may be reversible or irreversible. An irreversible inhibitor dissociates very slowly, if at all, from its target enzyme because it becomes very tightly bound to the enzyme, either covalently or noncovalently. Reversible inhibition, in contrast, involves an enzyme-inhibitor complex which may dissociate. Inhibitors can also be classified according to whether they are competitive, noncompetitive or uncompetitive inhibitors. In competitive inhibition for kinetically simple systems involving a single substrate, the enzyme can bind either the substrate or the" inhibitor, but not both. Typically, competitive inhibitors resemble the substrate or the product(s) and bind the active site of the enzyme, thus blocking the substrate from binding the active site. A competitive inhibitor diminishes the rate of catalysis by effectively reducing the affinity of the substrate for the enzyme. Typically, an enzyme may be competitively inhibited by its own product because of equilibrium considerations. Since the enzyme is a catalyst, it is in principle capable of accelerating a reaction in the forward or reverse direction. Noncompetitive inhibitors allow the enzyme to bind the substrate at the same time it binds the inhibitor. A noncompetitive inhibitor acts by decreasing the turnover number of an enzyme rather than diminishing the proportion of free enzyme. Another possible category of inhibition is mixed or uncompetitive inhibition, in which the inhibitor affects the binding site and also alters the turnover number of the enzyme.

Inhibition of ST3Gal-NI gene expression

Inhibition of ST3Gal-NI gene expression can also be achieved through the use of inhibitory nucleic acids. Inhibitory nucleic acids can be single-stranded nucleic acids that are complementary to a target sequence such as a nucleic acid that encodes ST3Gal-NI. The term "inhibitory nucleic acids" as used herein, refers to "sense" and "antisense" nucleic acids, as well as interference RΝA (RΝAi).

In one embodiment, the inhibitory nucleic acid can be based on a nucleic acid that encodes an ST3Gal-NI sialyltransferase. The nucleotide sequence of a human ST3Gal- VI DΝA is reported in Okajima, et al (1999) J. Biol. Chem. 274(17): 11479 (GeneBank accession No. NM-006100). This nucleotide can be used as a probe for the identification of α2,3-sialyltransferase-encoding nucleic acids from other species. From the human or other α2,3-sialyltransferase-encoding nucleotide sequences, one can derive suitable inhibitory nucleic acids. Administration of such inhibitory nucleic acids to a mammal can reduce inflammation by reducing or eliminating the biosynthesis of Sia 2,3 Gal-containing oligosaccharides.

The inhibitory nucleic acid can inhibit the function of the target nucleic acid. The particular mechanism by which the inhibitory nucleic acid inhibits the function of the target nucleic acid is not critical to the invention. This could, for example, be a result of blocking DNA transcription, processing or poly(A) addition to mRNA, DNA replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradation, -hihibitory nucleic acid methods therefore encompass a number of different approaches to altering expression of specific genes that operate by different mechanisms. Different types of inhibitory nucleic acid technology are described in Helene and Toulme (1990) Biochim. Biophys. Ada. 1049: 99-125. Nucleic acids can be designed to bind to the major groove of the duplex DNA to form a triple helical or "triplex" structure. Alternatively, inhibitory nucleic acids are designed to bind to regions of single stranded DNA resulting from the opening of the duplex DNA during replication or transcription. More commonly, inhibitory nucleic acids are designed to bind to mRNA or mRNA precursors. Inhibitory nucleic acids are used to prevent maturation of pre-mRNA. -Inhibitory nucleic acids may be designed to interfere with RNA processing, splicing or translation. The inhibitory nucleic acids are often targeted to mRNA. In this approach, the inhibitory nucleic acids are designed to specifically block translation of the encoded protein. Using this approach, the inhibitory nucleic acid can be used to selectively suppress certain cellular functions by inhibition of translation of mRNA encoding critical proteins. For example, an inhibitory antisense nucleic acid complementary to regions of a target mRNA inhibits protein expression. See, e.g., Wickstrom E.L. et al. (1988) Proc. Nat 7. Acad. Sci. USA 85:1028-1032 and Harel-Bellan et al. (1988) Exp. Med, 168:2309-2318. As described in Helene and Toulme, inhibitory nucleic acids targeting mRΝA have been shown to work by several different mechanisms in order to inhibit translation of the encoded protein(s). Posttranscriptional gene silencing or RΝA interference (RΝAi) has been reported to be accompanied by the accumulation of small (20-25, e.g., 20, 21, 22 nucleotide) fragments of double stranded RΝA, which are reported to be synthesized from an RΝA template (Hamilton & Baulcombe, Science 286:950-952 (1999)). These fragments are called small interfering RΝAs (siRΝAs). It has become clear that in a range of organisms, including mammals, siRΝA is an important component leading to gene silencing (Fire et al, Nature 391:806-811 (1998); Timmons & Fire, Nature 395:854 (1998); WO99/32619; Kennerdell & Carthew, Cell 95:1017-1026 (1998); Νgo et al, Proc. Nat'lAcad. Sci. USA 95:14687-14692 (1998); Waterhouse et al, Proc. Nat'lAcad. Sci. USA 95:13959-13964 (1998); WO99/53050; Cogoni & Macino, Nature 399:166-169 (1999); Lohmann et al, Dev. Biol. 214:211-214 (1999); Sanchez- Alvarado & Νewmark, Proc. Nat'lAcad. Sci. USA 96:5049-5054 (1999); Elbashir et al, Nature 411:494-297 (2001)). Thus, RΝAi is useful in inhibiting the expression of target genes in vivo.

The inhibitory nucleic acids introduced into the cell can also encompass the "sense" strand of the gene or mRΝA to trap or compete for the enzymes or binding proteins involved in mRΝA translation. Lastly, the inhibitory nucleic acids can be used to induce chemical inactivation or cleavage of the target genes or mRNA. Chemical inactivation can occur by the induction of crosslinks between the inhibitory nucleic acid and the target nucleic acid within the cell. Alternatively, irreversible photochemical reactions can be induced in the target nucleic acid by means of a photoactive group attached to the inhibitory nucleic acid. Other chemical modifications of the target nucleic acids induced by appropriately derivatized inhibitory nucleic acids may also be used.

Cleavage, and therefore inactivation, of the target nucleic acids may be effected by attaching a substituent to the inhibitory nucleic acid which can be activated to induce cleavage reactions. The substituent can be one that effects either chemical, photochemical or enzymatic cleavage. Alternatively cleavage can be induced by the use of ribozymes or catalytic RNA. -In this approach, the inhibitory nucleic acids would comprise either naturally occurring RNA (ribozymes) or synthetic nucleic acids with catalytic activity. Once inhibitors are identified, they can be tested for ability to reduce inflammation upon administration to laboratory animals. Animals can be treated with pharmacological doses of the inhibitor to block formation of the sLe^x structure. The effect of the inhibitor on inflammation is then determined.

Reduction in suitable acceptors for sialyltransferase Another approach to reducing the sLe^x structure displayed on inflammatory cells is to reduce the amount of acceptor that is available for sialylation by an α2,3- sialyltransferase. Methods for reducing the amount of acceptor are described in, for example,

WO98/54365. Screening Methods Standard assay can be performed to identify agents that modify the activity of

ST3Gal-VI sialyltransferases. Generally, in a preferred embodiment, a test agent is contacted with the enzyme and the activity of the enzyme is detected using known assay methods such as those described above.

The term "test agent " or grammatical equivalents as used herein describes any molecule, e.g., protein, oligopeptide, small organic molecule, polynucleotide, and the like, to be tested for the capacity to directly or indirectly inhibit the activity of a ST3Gal-VI sialyltransferase or the expression of a nucleic acid encoding it.

Test agents can encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Candidate agents comprise functional groups necessary for structural interaction with the sialyltransferase, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. Known inhibitors discussed above are logical starting points for candidate agents. In certain embodiments, combinatorial libraries of test agents will be screened for an ability to bind to a ST3Gal-VI sialtransferase or to modulate its activity. Conventionally, new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis.

In one preferred embodiment, high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such "combinatorial chemical libraries" are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics. Combinatorial chemical libraries are commonly used to prepare a collection of diverse chemical compounds (see, Gallop et al, J. Med. Chem. 37(9):1233-1251 (1994)). Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433 A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA).

A number of well known robotic systems have also been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zy ate II, Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett-Packard, Palo Alto, Calif.), which mimic the manual synthetic operations performed by a chemist. Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art. In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, MO, ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.).

High throughput assays for the presence, absence, quantification, or other properties of particular nucleic acids or protein products are well known to those of skill in the art. Similarly, binding assays and reporter gene assays are similarly well known. Thus, e.g., U.S. Patent No. 5,559,410 discloses high throughput screening methods for proteins, U.S. Patent No. 5,585,639 discloses high throughput screening methods for nucleic acid binding (i.e., in arrays), while U.S. Patent Nos. 5,576,220 and 5,541,061 disclose high throughput methods of screening for ligand/antibody binding.

In addition, high throughput screening systems are commercially available (see, e.g., Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman instruments, Inc. Fullerton, CA; Precision Systems, Lnc, Natick, MA, etc.). These systems typically automate entire procedures, including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, e.g., Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.

Administration Of Anti-Inflammatory Agents

The invention provides methods and compositions for treating and preventing inflammation. In therapeutic applications, the ST3Gal-VI sialyltransferase inhibitors of the invention are administered to an individual already suffering from inflammation.

Compositions that contain the inhibitors are administered to a patient in an amount sufficient to decrease the amount of ST3Gal-NI sialyltransferase activity, and to cure or at least partially arrest the symptoms and/or complications of the inflammation. For example, the ST3Gal-NI sialyltransferase inhibitors can arrest the further development of the inflammation. An amount adequate to accomplish this is defined as "therapeutically effective dose." Amounts effective for this use will depend on, e.g., the inhibitor composition, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician. Therapeutic administration can begin at the first sign of disease or the detection or shortly after diagnosis in the case of inflammation. This is often followed by repeated administration until at least symptoms are substantially abated and for a period thereafter.

Therapeutically effective amounts of the ST3Gal-NI sialyltransferase inhibitor compositions of the present invention generally range, for the initial administration (that is for therapeutic or prophylactic administration), from about 1.0 mg to about 10 g of ST3Gal- VI inhibitor for a 70 kg patient, usually from about 10 mg to about 5 g, and preferably between about 2 mg and about 1 g. These doses can be followed by repeated administrations over weeks to months depending upon the patient's response and condition by measuring immune system activity.

For prophylactic use, administration should be given to individuals that fall into groups that are at risk for developing inflammation. A "prophylactic dose" is that which is effective to maintain the concentration of sLe^xat a desired level that is associated with reduced risk of inflammation.

The pharmaceutical compositions for therapeutic or prophylactic treatment are intended for parenteral, topical, oral or local administration. Typically, the pharmaceutical compositions are administered parenterally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly. Compositions of the invention are also suitable for oral administration. Thus, the invention provides compositions for parenteral administration which comprise a solution of the glycosyltransferase inhibiting agent dissolved or suspended in an acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be used, e.g., water, buffered water, 0.9% saline, 0.3% glycine, hyaluronic acid and the like. These compositions may be sterilized by conventional, well known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.

The concentration of ST3Gal-NI sialyltransferase inhibiting agents of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.

The ST3Gal-NI sialyltransferase inhibitors of the invention can also be administered via liposomes, which serve to target the conjugates to a particular tissue, such as myeloid tissue, as well as increase the half-life of the peptide composition. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. In these preparations the inhibitor to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to, e.g., a receptor prevalent among myeloid cells, or with other therapeutic or immunogenic compositions. Thus, liposomes filled with a desired inhibitor of the invention can be directed to the site of myeloid cells, where the liposomes then deliver the selected inhibitor compositions. Liposomes for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream. A variety of methods are available for preparing liposomes, as described in, e.g., Szoka et al (1980) Ann. Rev. Biophys. Bioeng. 9: 467, U.S. Pat. Νos. 4,235,871, 4,501,728 and 4,837,028.

The targeting of liposomes using a variety of targeting agents is well known in the art (see, e.g-., U.S. Patent Νos. 4,957,773 and 4,603,044). For targeting to the immune cells, a ligand to be incorporated into the liposome can include, e.g., antibodies or fragments thereof specific for cell surface determinants of the desired target cells. A liposome suspension containing a peptide or conjugate can be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the conjugate being delivered, and the stage of the disease being treated.

For solid compositions, conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For oral administration, a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient, that is, one or more conjugates of the invention, and more preferably at a concentration of 25%-75%. For aerosol administration, the inhibitors are preferably supplied in a suitable form along with a surfactant and propellant. Typical percentages of α2,3-sialyltransferase inhibitors are 0.01%-20% by weight, preferably 1%-10%. The surfactant must, of course, be nontoxic, and preferably soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides can be employed. The surfactant can constitute 0.1%-20% by weight of the composition, preferably 0.25-5%. The balance of the composition is ordinarily propellant. A carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery. Alternatively, DNA or RNA that inhibits expression of one or more glycosyltransferase, such as an RNAi, antisense nucleic acid or a nucleic acid that encodes a peptide that blocks expression or activity of ST3Gal-VI sialyltransferase can be introduced into patients to achieve inhibition. USPN 5,580,859 describes the use of injection of naked nucleic acids into cells to obtain expression of the genes which the nucleic acids encode. During the course of treatment, inflammation is preferably monitored and the frequency and amounts of inhibitor administration are adjusted as required.

Diagnostic Methods

The present invention also provides methods of determining the levels of ST3Gal-NI activity in a sample from a patient. The diagnostic methods are also useful for monitoring the effectiveness of a prophylactic or treatment regime for atherosclerosis-related conditions, for example. Samples that are suitable for use in the diagnostic methods of the invention include, for example, myeloid cells and other blood cells.

The methods involve contacting a sample from a patient or other animal with a detection moiety that binds to a particular oligosaccharide structure, e.g., an sLe^x structure. Standard methods for detection of desired carbohydrate structures are known. For instance, specific lectins or antibodies raised against oligosaccharide can be used. For example, members of the siglec family of lectins that bind to oligosaccharides that are terminated with α2,3-linked sialic acid are suitable. For example, the MAL II lectin, which can be isolated from Maackia amurensis seeds, is suitable. Alternatively, rather than using a binding moiety that binds to the sialic acid- terminated oligosaccharides, one can employ a binding moiety that binds to the acceptor for the ST3Gal-NI. In the absence of a particular sialyltransferase, the concentration of acceptor moieties tends to increase. Thus, decreased levels of ST3Gal-NI activity will result in an increase in the concentration of such unsialylated acceptor moieties. For example, one can employ a lectin, antibody, or other moiety that binds to unsialylated Galβ 1 ,4GlcΝAc or Galβl,3GalNAc. Lectins that are suitable for this purpose include, for example, peanut agglutinin (PNA) or Erythrina cristagalli (ECA) lectin.

Glycosyltransferases themselves, in particular the acceptor binding domain of a glycosyltransferase, are also useful as binding moieties in the diagnostic assays of the invention. A deficiency of ST3Gal-VI sialyltransferase causes a dramatic increase in terminal galactose residues (i.e., Galβl,4GlcNAc-) on myeloid cells. Thus, one can use the ST3Gal-VI sialyltransferase as a detection moiety to determine whether ST3Gal-NI is deficient in the cells.

In typical embodiments, the detection moieties are labeled with a detectable label. The detectable labels can be primary labels (where the label comprises an element that is detected directly or that produces a directly detectable element) or secondary labels (where the detected label binds to a primary label, as is common in immunological labeling). An introduction to labels, labeling procedures and detection of labels is found in Polak and Nan Νoorden (1997) Introduction to Immunocytochemistry, 2nd ed., Springer Nerlag, ΝY and in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals, a combined handbook and catalogue published by Molecular Probes, Inc., Eugene, OR. Primary and secondary labels can include undetected elements as well as detected elements. Useful primary and secondary labels in the present invention can include spectral labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetrarhodimine isothiocynate (TRITC), etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDyes™, and the like), radiolabels (e.g., ³H, ¹²⁵1, ³⁵S, ¹⁴C, ³²P, ³³P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectral colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads. The label can be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well lαiown in the art. As indicated above, a wide variety of labels can be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.

Preferred labels include those that use: 1) chemiluminescence (using horseradish peroxidase or luciferase) with substrates that produce photons as breakdown products as described above) with kits being available, e.g., from Molecular Probes,

Amersham, Boehringer-Mannheim, and Life Technologies/ Gibco BRL; 2) color production (using both horseradish peroxidase and/or alkaline phosphatase with substrates that produce a colored precipitate (kits available from Life Technologies/Gibco BRL, and Boehringer-Mannheim)); 3) hemifluorescence using, e.g., alkaline phosphatase and the substrate AttoPhos (Amersham) or other substrates that produce fluorescent products, 4) fluorescence (e.g., using Cy-5 (Amersham)), fluorescein, and other fluorescent tags); 5) radioactivity. Other methods for labeling and detection will be readily apparent to one skilled in the art.

Preferred enzymes that can be conjugated to detection reagents of the invention include, e.g., luciferase, and horse radish peroxidase. The chemiluminescent substrate for luciferase is luciferin. Embodiments of alkaline phosphatase substrates include p-nitrophenyl phosphate (pNPP), which is detected with a spectrophotometer; 5-bromo-4- chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) and fast red/napthol AS-TR phosphate, which are detected visually; and 4-methoxy-4-(3-phosphonophenyl) spiro(l,2- dioxetane-3,2'-adamantane), which is detected with a luminometer. Embodiments of horse radish peroxidase substrates include 2,2'azino-bis(3-ethylbenzthiazoline-6 sulfonic acid) (ABTS), 5-aminosalicylic acid (5AS), o-dianisidine, and o-phenylenediamine (OPD), which are detected with a spectrophotometer; and 3,3,5,5'-tetramethylbenzidine (TMB), 3,3'diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), and 4-chloro-l-naphthol (4C1N), which are detected visually. Other suitable substrates are lαiown to those skilled in the art.

In general, a detector which monitors a particular label is used to detect the label. Typical detectors include spectrophotometers, phototubes and photodiodes, microscopes, scintillation counters, cameras, film and the like, as well as combinations thereof. Examples of suitable detectors are widely available from a variety of commercial sources lαiown to persons of skill. Commonly, an optical image of a substrate comprising bound labeling moieties is digitized for subsequent computer analysis.

Commercially available detection moieties that are suitable for use in the methods of the invention include SNA-fluorescein isothiocyanate (FITC) lectin (FL-1301, Vector Laboratories, Burlingame CA) and biotinylated SNA lectin (B-1305, Vector Laboratories) for 2,3 sialyl galactosides.

A reduction in ST3Gal-VI activity is evidenced by a substantial reduction in the sLe^x structure in a sample obtained from the patient. Alternatively, methods for detecting levels of ST3Gal-VI enzymatic activities can be used. As used herein, a "substantial reduction" in the appropriate sialylgalactoside levels or ST3Gal-VI activity refers to a reduction of at least about 30% in the test sample compared to a non-immunodeficient control. Depending on the degree of reduction in inflammation desired, the reduction in ST3Gal-VI activity or sLe^x will be at least about 50%, more preferably at least about 75%, and most preferably sLe^x or ST3Gal-VI levels will be reduced by at least about 90% in a sample from an animal that has a clotting disorder compared to a control. Again, however, monitoring of the extent of inflammation is the preferred method of monitoring the effectiveness of a treatment or prophylactic administration.

Transgenic Animals That Lack ST3Gal-VI Sialyltransferase

The invention also provides eukaryotic cells, as well as chimeric and transgenic nonhuman animals which contain cells, that lack at least one ST3Gal-VI gene that is typically found in wild-type cells of the animal. Methods for producing such cells and animals are also provided. These cells and animals are useful for several purposes, including the study of the mechanisms by which leukocyte extravasation and resulting inflammation occur. The "knockout" cells and animals can also be used for producing glycoproteins and glycolipids that, when produced in a wild-type cell or animal, would carry an sLe^x structure that is not desirable for a particular application.

A "chimeric animal" includes some cells that lack the functional sialyltransferase gene of interest and other cells that do not have the inactivated gene. A "transgenic animal," in contrast, is made up of cells that have all incorporated the specific modification which renders the sialyltransferase gene inactive. While a transgenic animal is capable of transmitting the inactivated sialyltransferase gene to its progeny, the ability of a chimeric animal to transmit the mutation depends upon whether the inactivated gene is present in the animal's germ cells.

The modifications that inactivate the sialyltransferase gene can include, for example, insertions, deletions, or substitutions of one or more nucleotides. The modifications can interfere with transcription of the gene itself, with translation and/or stability of the resulting mRNA, or can cause the gene to encode an inactive sialyltransferase polypeptide. For example, a mutation can be introduced into the promoter region of one or more ST3Gal- VI genes, in which case the gene is expressed at a reduced level, if at all. Alternatively, the coding region of the gene can be mutated. The methods of the invention are useful for producing transgenic and chimeric animals of most vertebrate species. Such species include, but are not limited to, nonhuman mammals, including rodents such as mice and rats, rabbits, ovines such as sheep and goats, porcines such as pigs, and bovines such as cattle and buffalo. Methods of obtaining transgenic animals are described in, for example, Puhler, A., Ed., Genetic Engineering of Animals, VCH Publ., 1993; Murphy and Carter, Eds., Transgenesis Techniques : Principles and Protocols (Methods in Molecular Biology, Vol. 18), 1993; and Pinkert, CA, Ed., Transgenic Animal Technology : A Laboratory Handbook, Academic Press, 1994. One method of obtaining a transgenic or chimeric animal having an inactivated ST3Gal-VI gene in its genome is to contact fertilized oocytes with a vector that includes an ST3Gal-VI - encoding polynucleotide that is modified to contain an inactivating modification. For some animals, such as mice, fertilization is performed in vivo and fertilized ova are surgically removed. In other animals, particularly bovines, it is preferably to remove ova from live or slaughterhouse animals and fertilize the ova in vitro. See DeBoer et al, WO 91/08216. In vitro fertilization permits the modifications to be introduced into substantially synchronous cells. Fertilized oocytes are then cultured in vitro until a pre-implantation embryo is obtained containing about 16-150 cells. The 16-32 cell stage of an embryo is described as a morula. Pre-implantation embryos containing more than 32 cells are termed blastocysts. These embryos show the development of a blastocoel cavity, typically at the 64 cell stage. If desired, the presence of a desired inactivated ST3Gal-VI gene in the embryo cells can be detected by methods known to those of skill in the art. Methods for culturing fertilized oocytes to the pre-implantation stage are described by Gordon et al. (1984)

Methods Enzymol 101 : 414; Hogan et al. (1986) Manipulation of the Mouse Embryo: A Laboratory Manual, C.S.H.L. N.Y. (mouse embryo); Hammer et al. (1985) Nature 315: 680 (rabbit and porcine embryos); Gandolfi et al. (1987) J. Reprod. Fert. 81: 23-28; Rexroad et α/. (1988) J. Anim. Sci. 66: 947-953 (ovine embryos) and Eyestone et al (1989) J. Reprod. Fert. 85:715-720; Camous et al (1984) J. Reprod. Fert. 72: 779-785; and Heyman et al. (1987) Theriogenology 27: 5968 (bovine embryos). Sometimes pre- implantation embryos are stored frozen for a period pending implantation. Pre-implantation embryos are transferred to an appropriate female resulting in the birth of a transgenic or chimeric animal depending upon the stage of development when the transgene is integrated. Chimeric mammals can be bred to form true germline transgenic animals.

Alternatively, the disrupted ST3Gal-VI gene can be introduced into embryonic stem cells (ES). These cells are obtained from preimplantation embryos cultured in vitro. See, e.g., Hooper, ML, Embryonal Stem Cells : Introducing Planned Changes into the Animal Germline (Modern Genetics, v. 1), IntT. Pub. Distrib., Inc., 1993; Bradley et al. (1984) Nature 309, 255-258. Transformed ES cells are combined with blastocysts from a nonhuman animal. The ES cells colonize the embryo and in some embryos form the germ line of the resulting chimeric animal. See, aenisch (1988) Science 240: 1468-1474. Alternatively, ES cells or somatic cells that can reconstitute an organism ("somatic repopulating cells") can be used as a source of nuclei for transplantation into an enucleated fertilized oocyte giving rise to a transgenic mammal. See, e.g., Wilmut et al. (1997) Nature 385: 810-813. The introduction of the modified ST3Gal-VI gene into recipient cells can be accomplished by methods lαiown to those of skill in the art. For example, the modified gene can be targeted to the wild type ST3Gal-VI locus by homologous recombination. Alternatively, a recombinase system can be employed to delete all or a portion of a locus of interest. Examples of recombinase systems include, the cre/lox system of bacteriophage Pl (see, e.g., Gu et al. (1994) Science 265: 103-106; Terry et al. (1997) Transgenic Res. 6: 349-356) and the FLP/FRT site specific integration system (see, e.g., Dymecki (1996) Proc. Nat'l. Acad. Sci. USA 93: 6191-6196). In these systems, sites recognized by the particular recombinase are typically introduced into the genome at a position flanking the portion of the gene that is to be deleted. Introduction of the recombinase into the cells then catalyzes recombination which deletes from the genome the polynucleotide sequence that is flanked by the recombination sites. If desired, one can obtain animals in which only certain cell types lack the sialyltransferase gene of interest. See, e.g., Tsien et al. (1996) Cell 87: 1317-26; Brocard et α/. (1996) Proc. Nat 7. Acad. Sci. USA 93: 10887-10890; Wang et al (1996) Proc. Nat'l Acad. Sci. USA 93: 3932-6; Meyers et al. (1998) Nat. Genet. 18: 136-41).

EXAMPLES

Materials and Methods

Tissue Northern RΝA expression levels in various tissues of normal mice were analyzed as previously described (Shafi et al., Proc Natl Acad Sci USA., 97:5735-5739 (2000)), using ST3Gal-cDΝAs I-LV, each containing the entire protein coding sequence.

Gene Targeting and Mutant Mouse Production

Genomic clones of the ST3Gal-II and ST3Gal-III were isolated from a 129/SvJ phage library (Stratagene) and Cre-loxP gene targeting constructs prepared by described approaches and procedures (Fig. 113 ; (Priatel et al., Glycobiology;! :45-56 (1997))). Mice bearing mutant genotypes were produced and bred by previously described procedures (Shafi et al., Proc Natl Acad Sci USA., 97:5735-5739 (2000)). Genotyping was performed by PCR using oligonucleotide primers: LE-120 (5'- CCCTGTCTGACCTGGAACACAC) and LE-121 (5'- CACTGAGAGCTCTCAGGAGGCTGAG) to detect the 220 by ST3Gal-II wild-type allele; LE-120 and rlox (5*-CTCGAATTGATCCCCGGGTAC) to detect the 170 by ST3Gal-II Δ allele; LE-110 (5'-CCAGCCAGCAGAGGATCTGATAC) and LE-115 (5'- CGCAGGGGGCGTTTCTAGAC) to detect the 450 by ST3Gal-III wild type allele; and LE- 110 and rlox to detect the 300 by ST3Gal-III Δ allele.

Hematology

Blood was collected from the tail vein of anesthetized mice into EDTA microtubes (Becton Dickinson, Mountain View, CA) and analyzed with a CELL-DYN 3500 calibrated with normal mouse blood. Differential blood counts were also performed on Wright-Giemsa stained blood smears.

Isolation of Peripheral Blood Leukocytes and Flow Cytometry

Blood from wild type or mutant mice was collected as above into lithium heparin microtubes (Becton Dickinson) and diluted 1:1 in PBS. An equal volume of 2% dextran T500 (Pharmacia, Uppsala, Sweden) in PBS was added and the cells incubated at 37°C for 10 min. The upper layer containing peripheral blood leukocytes (PBLs) was removed and washed in PBS. Red blood cells were lysed with PharM lyse (Pharmingen, San Diego, CA) and PBLs resuspended in PBS containing 0.1 % BSA (PBS/BSA). Cells were incubated with 0.5 μg/ml Fc block (Pharmingen) prior to antibody, IgM-chimera, and lectin staining. Ricinus communis agglutinin-1 (RCA-I), Erythrina crystagalli lectin (ECA) or Peanut agglutinin (PNA) (all from Vector Laboratories, Burlingame, CA) were incubated with PBLs in combination with antibody Grl (Pharmingen) for 10 min prior to analysis by flow cytometry on a FACScalibur (Becton Dickinson). Mouse P- and E-selectin eDNAs were linked to the CH2, CH3 and CH4 domains of human IgM to construct P- and E-selectin IgM chimeras (Maly et al., Cell; 86:643-653 (1996)). Supernatants from transfected COS cells were diluted 1 :20 for P-selectin IgM or 1 :30 for E-selectin IgM chimeras in PBS/BSA. An anti-human IgM FITC antibody (Sigma Chemical, St. Louis, MO) was added at 1:1000 for 15 min and labeled selectin chimeras were added to PBLs in the presence of Grl for 10 min prior to flow cytometry. -In other experiments, PBLs from wild type littermates were treated with Arthrobacter ureafaciens neuraminidase (Sigma) in 10 mM HEPES, 140 mM NaCl pH 7.0 for 1 h at 37°C prior to incubation with selectin chimeras. In Vitro Rolling Assay

Monolayers of Chinese hamster ovary (CHO) cells stably transfected with either human P- or E-selectin (Snapp et al., Blood; 97:3806-3811 (2001)) served as the rolling substrate in a parallel plate flow chamber (Glycotech, Rockville, MD). Bone marrow neutrophils, prepared as previously described (Snapp et al., Blood; 97:3806-3811 (2001)), were introduced into the flow chamber at a concentration of 1 x 10⁶ cells/ml. Wall shear stress was maintained at 1.5 dynes/cm² and images obtained with a Nikon Eclipse TE300 inverted microscope. Rolling events, defined as a rolling cell that can be tracked between sequential images separated by a time delay of 2 seconds, were measured and analyzed as described (Knibbs et al, J Cell Biol; 133:911-920 (1996)).

Antibodies and Cytokines

The P-selectin mAb RB40.34 (rat IgGl, 30 μg/mouse) (Bosse et al., Eur J Immunol; 24:3019-3024 (1994)) was used to block P-selectin-dependent leukocyte adhesion and rolling in vivo. The rat anti mouse E-selectin mAb 9A9 (rat IgGI, 30 μg/mouse) (Norton et al, Biochem Biophys Res Commun.; 195:250-258 (1993)) was used to block E-selectin function in vitro and E-selectin dependent rolling in vivo. For the in vivo model, recombinant murine TNFα (500 ng per mouse; R&D, Minneapolis, MN 55413) was diluted in 0.3 ml normal saline and injected intrascrotally 2 h prior to the experiment.

Intravital Microscopy and Cremaster Muscle Preparation Mice were anesthetized with an intraperitoneal (i.p.) injection of ketamine

(125 mg/g body weight, Ketalar; Parke-Davis, Morris Plains, NJ), xylazine (12.5 mg/g body weight; Phoenix Scientific, Inc., St. Joseph, MO), and atropine sulfate (0.025 mg/g body weight; Elkins-Sinn, Inc., Cherry Hill, NJ). Mice were then placed on a heating pad to maintain body temperature. -Intravital microscopy experiments were conducted with a microscope (Axioskop; Zeiss, Thornwood, NY) equipped with a saline immersion objective (SW 40/0.75 numerical aperture) and connected to a charged coupled device (CCD) camera (model VE-1000CD, Dage-MTI, Michigan-City, IN) and a video recorder (Panasonic, Secausus, NJ). After tracheal intubation, the left carotid artery was cannulated for systemic administration of anesthetics and mAbs and for taking blood samples during the experiment. The cremaster muscle was prepared as described earlier (Kunkel et al., Circ

Res.;79:l 196-1204 (1996)) and superfused with thermocontrolled (35°C) bicarbonate buffered saline. Systemic blood samples (10 μl) were taken after each mAb injection and stained with Kimura to assess systemic white blood cell counts. Leukocyte rolling was observed in venules with diameters ranging from 20 μm to 45 μm. Microvessel diameters, lengths and rolling leukocyte velocities were measured using a digital image processing system (Pries, A.R., Microcirculation; 8:243-249 (2001); Norman et al, Microcirculation, 8:243-249 (2001)). The number of rolling cells was counted in each 100 μm segment of postcapillary venules. Centerline blood flow velocity was measured using a dual photodiode and a digital on line cross-correlation program (Circusoft instrumentation, Hockessin, DE) and converted to mean blood flow velocity by multiplying with an empirical factor of 0.625 (Lipowsky et al., Microvasc Res.; 15:93-101 (1978)). Wall shear rates (γ_w) were estimated as 2.12 (8v_b/d), where V_b is the mean blood flow velocity, d is the diameter of the vessel, and 2.12 is a median empirical correction factor obtained from velocity profiles measured in microvessels in vivo (Lipowsky et al, Microvasc Res.; 15:93-101 (1978)). Leukocyte rolling velocities (>5 leukocytes per venule) were measured as averages over a 2 sec time window.

Statistics

Statistics Statistical analysis was performed using Sigma-Stat 2.0 software package (SPSS Science, Chicago, IL). Average vessel diameter, leukocyte rolling, leukocyte rolling velocities, and wall shear rates between groups and treatments were compared with the one way ANOVA on ranks (Kruskal-Wallis) with a multiple pairwise comparison test (Dunn's test). Leukocyte rolling between untreated and antibody-treated groups was compared with Student's t test or by the Wilcoxon rank sum-test as appropriate. Statistical significance was set atp< 0.05, indicated by asterisk (*).

Results Sialyltransferase Tissue Distribution and Targeted Gene Disruption The ST3 Gal-family of sialyltransferases appears to consist of a total of six genes in mammals. All encode type II transmembrane proteins residing in the Golgi apparatus and bearing a common sialylmotif that is essential for donor substrate binding and catalytic activity (Datta et al, JBiol Chem.; 270:1497-1500 (1995)). ST3Gal-I-IV RNA expression is broadly distributed with variations in levels observed among distinct tissues (Fig. IB). Multiple RNA transcripts are noted in some cases, as has been described (Kono et al., Glycobiology.; 7:469 479 (1997)). While the patterns of RNA expression were different for each ST3Gal-gene studied, all tissues surveyed expressed multiple ST3Gal- sialyltransferases.

The production and initial characterization of ST3Gal-I and ST3Gal-IN mutant mice has been described (Priatel et al., Immunity; 12:273 283, 21 (2000)). Both are fertile and without overt developmental and morphologic abnormalities. Herein we have similarly generated mice lacking functional ST3Gal-II and -III sialyltransferases by CreloxP gene targeting to produce deletions of either the large sialylmotif or transmembrane domain, respectively (Fig. 2A, B, E-and F). The loxP flanked and deleted alleles of each gene were confirmed by Southern blot analysis of embryonic stem cell DΝA (Fig. 2C and G). Correctly targeted ES cells were used to generate mutant mice bearing the deleted allelic structures (Fig. 2D and H), as previously described (Shafi et al., Proc Natl Acad Sci USA., 97:5735-5739 (2000)). Heterozygous ST3Gal-II^{wt Δ} and III^{wt Δ} mice were bred to the C57BL/6 strain for more than 5 generations prior to crossing to produce homozygotes and littermate controls for studies.

Sialyltransferase Mutations Result in Increased Beta-Linked Galactose

Exposure on Peripheral Blood Leukocytes

Sialic acid and fucose are terminal modifications to beta-linked galactose residues present among various glycan classes. Lectins that bind beta-linked galactose were used to assess the loss of ST3 Gal-function among myeloid and lymphoid cell types. These studies revealed differential increases in the exposure of beta linked galactose on specific peripheral blood leukocytes among all four homozygous mutant genotypes (Fig. 3A). Binding of the RCA-I lectin which has a preference for unsialylated terminal galactose on type II and type III glycans (Baenziger et al., JBiol Chem.; 254:9795-9799 (1979)) was increased on the surface of neutrophils among mice homozygous for deletions in the genes encoding ST3Gal-I, -II and -IN. -Increased binding to ECA lectin, which is specific for unsialylated type II chains (Debray et al., Carbohydr Res.; 151:359-370 (1986)), occurred to a significant extent only among cells homozygous for the ST3Gal-IN deletion. PΝA lectin binding, which primarily discriminates between sialylated and unsialylated type III glycans (Lotan et al, JBiol Chem.; 250:8518-8523 (1975)), revealed an increase in unsialylated Gal(81-3GalΝAc- among neutrophils from mice homozygous for deletions in ST3Gal-I,

ST3Gal-II and MGal-IV and CD8⁺ T cells from mice homozygous for deletions in ST3Gal-I and ST3Gal-IN. PΝA can also recognize unsialylated type I chains to some extent (Pereira et al., Carbohydr Res.; 51:107-118 (1976)), and the increase in binding to CD8⁺ T cells from mice homozygous for the ST3Gal-III deletion may reflect this additional binding specificity. Neutrophils from ST3Gal-III mutant mice did not shown any binding changes using RCA L, ECA or PNA lectins, suggesting the possibility that ST3Gal-III is not expressed in Grl⁺ cells, or perhaps that other sialyltransferases may fully compensate for ST3Gal-III deficiency. -In addition to providing data on the cell types in which these ST3Gal-sialyltransferases operate in vivo, the results obtained reflect closely the described substrate specificity and preferences from in vitro enzymatic studies that have been described (Kono et al., Glycobiology.; 7:469 479 (1997)).

Hematologic Findings in ST3 Gal-Deficiencies

Hematologic analyses of all four mutations bred to homozygosity revealed erythroid profiles within normal limits, as compared to wild-type littermates (Table 1). While the numbers of lymphocytes in circulation were also normal, we noted a consistent increase in circulating monocytes and a likely decrease in eosinophils in ST3Gal-I deficient mice. However none of the ST3 Gal-deficiencies resulted in leukocytosis. -Interestingly, both ST3Gal-I and ST3Gal-IN deficiencies resulted in thrombocytopenia. -In the absence of ST3Gal-IN, exposure of galactose occurs in a manner among some plasma constituents that triggers asialoglycoprotein receptor (ASGPR) clearance mechanisms and thereby reduces levels of von WiUebrand factor and platelets in circulation (Ellies et al., Proc Natl Acad Sci U SA. (2002); in press). Table 1. Peripheral Blood Hematology

Hematology Values are presented as means ± SD. WBC, white blood cells, RBC, red blood cells, PLT, platelet, MPV, mean platelet volume. Significant differences between appropriate wild- type or heterozygous controls and Δ/Δ genotypes are indicated (*), p < 0.01. Wild-type values are pooled as littermates of all mutant genotypes.

P- and E-selectin Ligand Deficiency on Grl Leukocytes from ST3Gal-

IV Mutant Mice

The binding of selectin chimera immunoglobulin (IgM) Fc fusion proteins was used in flow cytometric analyses as a measure of selectin ligand levels on the cell surface (Maly et al, Cell; 86:643-653 (1996)). When compared with Grl⁺ cells, which are primarily mature neutrophils, from wild-type littermates, P-selectin Ig chimera binding was reduced by approximately 50% among ST3Gal-IN deficient samples with mean peak fluorescence intensity measurements (MFIs) or 207 and 97, respectively) (Fig. 3B). A slightly greater reduction in E-selectin binding to approximately 40% of control levels was found (MFIs: 96 and 37, respectively). However, neither of these reductions in E- and P-selectin ligand levels were as great as those observed in the absence of the glycosyltransferase C2GlcΝAcT-I^π; Fig. 3B). -Interestingly, a slight but reproducible increase of approximately 20% in P- selectin chimera binding was observed in ST3Gal-I deficient mice, -h contrast to the these changes, no alterations in selectin ligand levels were observed among Grl cells from ST3Gal-II and ST3Gal-III deficient mice.

Multiple Sialyltransferases in E- and P-Selectin Ligand Formation

The possibility that only ST3Gal-IV contributes to E- and P-selectin ligand formation was investigated in vitro using neuraminidase (sialidase) treatment of intact cells, followed by flow cytometry as described above. Sialidase treatment of ST3Gal-LV deficient Grl cells further reduced P- and E-selectin-Ig chimera binding suggesting that other sialyltransferases, in addition to ST3Gal-IN, are also involved in E- and P-selectin ligand formation (Fig 4).

Reduced Rolling of ST3Gal-IV^Δ/Δ Neutrophils on P- and E-selectin To examine the biologic effect of reduced selectin ligands on STSGal-IN^ neutrophils, we used a parallel plate attachment and rolling assay, as previously described in studies of mice with C2GlcΝAcT-I deficiency (Snapp et al., Blood; 97:3806-3811 (2001)). Transfected CHO cells used as a monolayer in this assay express E-selectin at levels approximating those found on human umbilical vein endothelial cells activated by TNF, while P-selectin expressing CHO cells express levels 2-3 times above that (Snapp et al.,

Blood; 97:3806-3811 (2001)). The assay was carried out in a flow chamber with a wall shear stress maintained at 1.5 dynes/cm2 as previously described (Knibbs et al, J Cell Biol; 133:911-920 (1996)). Consistent with a partial effect on P-selectin ligands measured by flow cytometry, bone marrow derived ST3Gal-LV deficient neutrophils showed a 50 ± 16% reduction in rolling on P-selectin expressed by CHO cells (Fig. 5 A). ST3Gal-LV^Δ/Δ neutrophils showed a 22 ± 9 % reduction in rolling on E-selectin in this assay (Fig. 5B), also consistent with the flow cytometry assay.

Leukocyte Rolling In Vivo is Impaired in ST3 Gal-TV Deficient Mice fritrascrotal injection of TNFof>2h prior to the experiment leads to the expression of E-selectin and enhances the expression of P-selectin on venular endothelial cells of the cremaster muscle (Jung et al., Microcirculation.; 4:311-319 (1997)). We studied leukocyte rolling in 23 venules of eight TNFc-treated mice deficient in ST3Gal-IV and compared the results to rolling in 19 venules of five littermate control mice. Hemodynamic and microvascular parameters for both groups indicate similar vessel diameters, centerline velocities, and wall shear rates (Table 2).

Table 2. Hemodynamic and Microvascular Parameters in TNFα-Induced Inflammation

Mouse Mice Venules Diameter Centerline Velocity Wall Shear Rate

Genotype

ST3Gal-IV^Δ'^Δ 8 23 33 ± 1 2,800 ± 300 880 ± 80

Control 5 19 37 ± 2 2,900 ± 300 840 ± 100

Venule diameters, centerline velocity, and wall shear rate presented as mean ± SEM.

To compare in vivo rolling to the above results from the flow chamber experiments, we analyzed leukocyte rolling in the TNF-αpretreated cremaster muscle. The results indicated a reduction in the number of rolling cells per 100 μm vessel length in ST3Gal-LV deficient mice compared to wild type littermates when treated with the blocking P-selectin mAb RB40.34 (Fig. 6A). The reduction involving E-selectin mediated rolling in ST3Gal-LV^{Δ Δ} mice was consistent with the reduction in E-selectin mediated rolling of ST3Gal- IN^Δ/Δ leukocytes in the flow chamber (Fig. 5). -In contrast, blocking E-selectin with mAb 9A9 in vivo, which leads to P-selectin mediated rolling, revealed a similar number of rolling cells per vessel length in both groups (Fig. 6A).

Leukocyte rolling velocities in TΝFc-treated cremaster muscle venules were next investigated. TΝFα -reated ST3Gal- IN^Δ/Δ mice showed significant higher rolling velocities (V_av 13 ± 1 μm/s) than control mice (V_avg 10 ± 1 μ/s) (Fig. 6B). E-selectin mediated rolling was measured after treatment with the P-selectin blocking mAb RB40.34 and found to be faster in ST3Gal-IN deficient mice (V_avg 9 + 1 μm/s) than in control mice (V_aVg 6 ± 1 μm/s; Fig. 6C). -In contrast, there was no difference in rolling velocity in P- selectin dependent rolling after injection of the E-selectin blocking antibody 9A9 (Fig. 6D), suggesting that sialylation by ST3Gal-IN contributes to characteristic slow rolling mediated by Eselectin.

Discussion

Recognition of selectin ligands by leukocytes and endothelial cells of the vasculature forms the basis for a significant component of the inflammatory response and contributes to leukocyte homeostasis. While single genes exist to produce each of the selectins, the formation of selectin ligands requires the orchestrated action of many distinct glycosyltransferase genes that encode enzymes operating in the secretory pathway, primarily within the Golgi apparatus. Changes in the normal expression profile of glycosyltransferases in various cell types can alter glycan branching and influence terminal modifications in the Golgi, thereby providing multiple regulatory points in selectin ligand formation that can act to partition the physiologic activities of selectins (Ellies et al., Immunity.; 9:881 890 (1998); Yeh et al., Cell; 105:957-969 (2001)). Among the 19 sialyltransferase genes found in the mammalian genome to date, 6 are ST3Gal-sialyltransferases that may operate either singly or in combination in producing selectin ligands (Kono et al., Glycobiology.; 7:469479 (1997 Moore et al., J Cell Biol; 118:445-456 (1992); Sako et al., Cell; 75:1179-1186 (1993); Lenter et al., J Cell Biol, 125:471-481 (1994)). Mice deficient in four of these six candidates: ST3Gal-I, ST3Gal-II, ST3Gal-III, and ST3Gal-LV, have been produced. The relative contribution of each to selectin ligand formation among neutrophils has been analyzed. All ST3 Gal-deficiencies studied result in exposure of galactose termini; however each ST3 Gal-operated to a different degree among leukocyte cell types studied. None of the ST3 Gal-deficiencies caused leukocytosis, which is a phenotype found in glycosyltransferase mutant mice with severe deficiencies of selectin ligands (Maly et al, Cell; 86:643-653 (1996); Ellies et al., Immunity.; 9:881 890, 42 (1998)).

The in vivo findings reported here conform with data acquired from in vitro enzymatic analyses that proposes ST3Gal-I predominantly sialylates type III glycan chain termini (Gal 31-3GalNAc-), leading to a dramatic increase in PNA binding to ST3Gal-I deficient leukocytes (Kono et al., Glycobiology.; 7:469 479 (1997); Priatel et al., Immunity; 12:273 283, 21 (2000)). Since sLe^x is constructed with type II glycan chains (Gal/31- 4GlcNAc-), it was considered unlikely that ST3Gal-I would be directly involved in selectin ligand formation. Nevertheless, ST3Gal-I expression has been found to effectively compete with the action of C2GlcNAcT-I for the same substrate in vivo. Thus ST3Gal-I deficiency might lead to increased selectin ligand formation by increasing the availability of core 2 O- glycans that bear type II glycan termini (Priatel et al., Immunity; 12:273 283, 21 (2000); Dalziel et al., JBiol Chem.; 276:11007 11015 (2001)). The results reported here indeed indicate that ST3Gal-I deficiency results an increase in P-selectin ligand formation by approximately 20%> on neutrophils. Moreover, levels of core 2 O-glycans recognized by antibody IB 11 are also increased (data not shown).

ST3Gal-II deficiency results in increased PNA binding to peripheral blood neutrophils, as well as increased binding of RCA and to a lessor extent ECA. Unlike ST3Gal-I, no change in PNA binding to CD8⁺ T cells was observed. ST3Gal-II prefers glycolipid substrates and although studies have indicated that selectins can recognize glycolipids (Alon et al., J.Immunol; 154:5356 5366 (1995)), no evidence of a deficiency in selectin ligands on neutrophils was found in the absence of ST3Gal-II. These findings do not preclude the possibility that glycolipids bear selectin ligands due to ST3Gal-II sialylation among other cell types, and perhaps in some cases among tumor cells (Hakomori et al., Cancer Res.; 56:5309 5318 (1996)) ST3Gal-III levels have been associated with the formation of sLe^x in lung carcinoma (Ogawa et al., Cancer.; 79:1678 1685 (1997)). However, ST3Gal-III prefers to sialylate type I (Gal/31-3 GlcNAc) glycan chains. Moreover, no decrease in selectin ligands among ST3Gal-III deficient neutrophils was observed. Increased binding of PNA on ST3Gal-III deficient CD8⁺ T cells, consistent with a defect in sialylation due to ST3Gal-III mutagenesis was observed. The unsialylated type 1 chain can be recognized to some extent byPNA (Pereira et al., Carbohydr Res.; 51:107-118 (1976)). Therefore the increase in PNA reactivity observed among ST3Gal-III deficient CD8⁺ T cells is distinct from the undersialylation that occurs with ST3Gal-I deficiency which involves type III glycan chains, and which leads to a defect in CD8⁺ T cell homeostasis (Priatel et al., Immunity; 12:273 283, 21 (2000)). No defect in CD8⁺ T cell homeostasis was observed in ST3Gal-III deficient mice. While ST3Gal-III is also not essential for synthesis of P- and E-selectin ligands on peripheral blood neutrophils in normal circumstances, this sialyltransferase may nevertheless participate in selectin ligand formation in other cell types and in tumorigenic contexts.

ST3Gal-IV deficiency was unique among the four ST3Gal-sialyltransferase mutations studied by significantly reducing the formation of selectin ligands on circulating neutrophils. However, this reduction was only partial when compared to C2GlcNAcT-I deficient neutrophils. -In addition, a further reduction in selectin binding to ST3Gal-IV deficient neutrophils was noted following neuraminidase treatment in vitro. This indicates the likelihood that other sialyltransferases are involved in selectin ligand formation in vivo. It is also possible, though perhaps unlikely, that this finding reflects conformational alterations in glycoproteins occurring upon de-sialylation that alter E- and P-selectinlgM chimera binding independent of the role of o2-3 sialic acid in selectin ligand formation. The role of ST3Gal-sialyltransferases in selectin ligand formation by first applying flow cytometry as a screen to detect changes in selectin ligand expression levels was investigated. This has been found to be a valuable initial approach as flow cytometric findings of decreased selectin ligands are found associated with defects in neutrophil rolling in vitro on synthetic and cell based selectin substrates (Maly et al, Cell; 86:643-653 (1996); Ellies et al., Immunity.; 9:881 890, 42 (1998)). However, neutrophil rolling and recruitment in vitro and in vivo can provide functional data regarding alterations observed in selectin ligand expression. A significant decrement in rolling on cell monolayers bearing P-selectin, as well as E-selectin, using bone marrow derived neutrophils was observed. These findings are similar in scope to the flow cytometric results and indicate a functional role for ST3Gal- IV in selectin ligand formation.

The number of neutrophils rolling per length of inflamed vascular endothelium following TNFo; treatment in vivo revealed data that corroborated the in vitro evidence for an effect on E-selectin ligands, but contradicted findings suggesting P-selectin ligand deficiencies. The effect of ST3Gal-IV on E-selectin mediated leukocyte interactions was also remarkably similar to that reported for FucT-LV deficiency (Weninger et al., Immunity.; 12:665 676 (2000)). The leukocyte rolling flux fraction, a measure of the net balance between leukocyte attachment to the endothelium (increasing leukocyte rolling flux fraction) and firm leukocyte adhesion resulting in transmigration (removing leukocytes from the rolling pool), was normal in both FucT-IV (Weninger et al., Immunity.; 12:665-676 (2000)) and ST3Gal-LV deficient mice (data not shown). However, an increase in E-selectin dependent rolling velocity is observed in both strains, suggesting that these two glycosyltransferases may collaborate to form E-selectin ligands important in slow rolling of leukocytes. A role for ST3Gal-IN in P-selectin ligand function in vivo was not evident. The different findings regarding P-selectin interactions between the in vitro and in vivo rolling assays are not fully resolved at this time; however, several possible explanations exist. Since subtle differences exist in PSGL-1 glycosylation between mouse and man, the human P- selectin used in the in vitro rolling assay may recognize slightly different glycosylation patterns on mouse PSGL-1, resulting in reduced binding efficiency in the absence of ST3Gal- IV. Nevertheless, the selectin-Ig chimeras used in cytometric analysis were of mouse origin and these reagents also revealed a decrement in P-selectin ligand formation. Another possible explanation involves the fact that leukocytes in the in vitro flow chamber are subjected to lower shear stresses than leukocytes in vivo, which may be important in altering the availability and conformation of molecules at the cell surface. In addition, the differences observed may be due to the more complex and dynamic molecular interactions in vivo which include contributions to neutrophil rolling by LFA-1 and Mac 1 (Dunne et al., Blood.; 99:336 341 (2002)). The initial step of leukocyte tethering to the endothelium during inflammation is largely dependent on P-selectin interactions. No effect of ST3Gal-LV deficiency was found on E- or P-selectin ligands in this process. Since PSGL-lis the major ligand for P-selectin and in vivo rolling is markedly reduced in PSGL-1 deficient mice (Yang et al., JExp Med.; 181 :669 675 (1995)), these data suggest that ST3Gal-LV does not contribute to functional selectin ligands on PSGL-1 in vivo. -In contrast, E-selectin dependent leukocyte rolling velocity was increased in ST3Gal- F7^{Δ Δ} mice. Previous studies have reported a requirement for E-selectin in slow leukocyte rolling on the vessel wall in the TNF-α treated cremaster model of inflammation (Kunkel et al., Circ Res.;79:l 196 1204 (1996)). These findings reveal an important role for ST3Gal-IV in forming E-selectin ligands necessary for reducing the rolling velocity of circulating leukocytes as they enter sites of inflammation. Such ligands have not been found on PSGL-1 (Yang et al, JExp Med.; 181:669 675 (1995)).

Other sialyltransferase mutations not yet produced or examined may also be informative in resolving the degree of contribution to selectin function by sialic acid linkages. Of the six ST3Gal-sialyltransferases identified thus far, and the two remaining to be analyzed in this manner for selectin ligand formation, ST3Gal-V bears a strong glycolipid substrate preference, like ST3Gal-II, but specifically generates the ganglioside GM₃ (Kono et al., Biochem Biophys Res Commun.; 253:170-175 (1998)). -In contrast, ST3Gal-VI is similar to ST3Gal-IV with specificity for type II glycan chains (Okajima et al., JBiol Chem.; 274:11479-11486 (1999)). ST3Gal-VI therefore also plays a significant role in selectin ligand formation in vivo, alone or in combination with ST3Gal-IN.

Selectin expression and selectin ligand formation provide multiple points of regulation pertaining to cell type communication during leukocyte homeostasis and innate immune responses. Distinct physiologic outcomes emerge from the characterization of mice inheriting genetic deficiencies of various selectins and glycosyltransferases operating in selectin ligand formation, including FucT-NII, C2GlcΝAcT-I, and FucT-IV (Labow et al., Immunity.; 1:709 720 (1995); Maly et al, Cell.; 86:643-653 (1996); Homeister et al., Immunity.; 15 :115-126 (2001); Ellies et al., Immunity.; 9:881 890, 42 (1998); Knibbs et al., J Cell Biol; 133:911 920 (1996); Yang et al., JExp Med.; 181:669 675 (1995); Ley et al., J. Exp Med., 181:669-675 (1995); Kunkel et al, J Exp Med.; 183:57 65 (1996)). The present invention provides evidence of a functional segregation involving ST3Gal-sialyltransferase activity in the formation of selectin ligands in vivo. Among ST3Gal-I, II, III and LV sialyltransferases, only ST3Gal-FV provides a significant degree of selectin ligand formation in vivo. Our data suggest that ST3Gal-LN contributes to the characteristic slow rolling velocity observed for E-selectin mediated rolling during inflammation without significantly affecting E-selectin mediated capturing of leukocytes. These findings reveal a significant degree of specificity among ST3Gal-sialyltransferases in vivo in the formation of selectin ligands on neutrophils. In particular, ST3Gal-NI and ST3Gal-IN play a significant role in selectin ligand formation in vivo, alone or in combination.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference for all purposes.

Claims

WHAT IS CLAIMED IS:

1. A method for reducing or preventing inflammation in a mammal, the method comprising administering to the mammal an agent that inhibits the activity of an ST3Gal-NI sialyltransferase.

2. The method of claim 1 , wherein the agent inhibits expression of a gene encoding the ST3 Gal-NI sialyltransferase.

3. The method of claim 1, wherein the agent is an inhibitory nucleic acid molecule that specifically inhibits an ST3GalNI-encoding nucleic acid.

4. The method of claim 3, wherein the inhibitory nucleic acid is an RΝAi molecule.

5. The method of claim 1, wherein the agent inhibits enzymatic activity of the ST3Gal-VI sialyltransferase

6. The method according to claim 5, wherein the agent comprises an analog of a sialic acid precursor.

7. The method according to claim 5, wherein the agent comprises an analog of a donor substrate, or an analog of an acceptor substrate, for the glycosyltransferase.

8. The method according to claim 7, wherein the agent comprises an analog of a sugar nucleotide.

9. The method of claim 1, wherein the agent is administered in conjunction with administration of a drug for which inflammation is a potential side effect.

10. The method of claim 9, wherein the agent is administered before or simultaneously with the drug for which inflammation is a potential side effect.

11. The method of claim 1 , wherein the method is performed as a prophylactic measure against inflammation.

12. The method of claim 1, wherein the method is performed as a therapeutic measure against inflammation.

13. The method of claim 1, wherein the inflammation is mediated by neutrophils.

14. A method of screening for an agent that reduces or prevents inflammation in a mammal, the method comprising the steps of: (i) contacting the agent with a ST3Gal-VI sialyltransferase, and (ii) determining the functional effect of the compound upon the ST3Gal-VI sialyltransferase.

15. The method of 14, wherein the agent is a small molecule.

16. The method according to claim 14, wherein the agent comprises an analog of a sialic acid precursor.

17. The method according to claim 14, wherein the agent comprises an analog of a donor substrate, or an analog of an acceptor substrate, for the glycosyltransferase.

18. The method according to claim 17, wherein the agent comprises an analog of a sugar nucleotide.

19. A method of screening for an agent that reduces or prevents inflammation in a mammal, the method comprising the steps of: (i) contacting the agent with a cell expressing a ST3Gal-VI sialyltransferase, and (ii) determining the functional effect of the compound upon expression of the ST3Gal-VI sialyltransferase.

0. The method of claim 19, wherein the agent is an RNAi molecule.