WO2004003018A1 - Recepteur hormonal nucleaire - Google Patents
Recepteur hormonal nucleaire Download PDFInfo
- Publication number
- WO2004003018A1 WO2004003018A1 PCT/GB2003/002814 GB0302814W WO2004003018A1 WO 2004003018 A1 WO2004003018 A1 WO 2004003018A1 GB 0302814 W GB0302814 W GB 0302814W WO 2004003018 A1 WO2004003018 A1 WO 2004003018A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- nucleic acid
- disease
- nuclear hormone
- hormone receptor
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
Definitions
- hCP43593.1 (or 'NHR8', 'NR8' or 'LBDG8') herein identified as a Nuclear Hormone Receptor and to the use of this protein and nucleic acid sequence from the encoding gene in the diagnosis, prevention and treatment of disease.
- hCP43593.1 has been identified as containing both a Nuclear Hormone Receptor Ligand Binding Domain and a Nuclear Hormone Receptor DNA Binding Domain.
- bioinformatics tools increase in potency and in accuracy, these tools are rapidly replacing the conventional techniques of biochemical characterisation. Indeed, the advanced bioinformatics tools used in identifying the present invention are now capable of outputting results in which a high degree of confidence can be placed.
- hCP43593.1 a protein whose sequence is recorded in the Celera predicted human protein dataset as hCP43593.1, and is also present in the public NCBI database as BAA86513.1 (with the corresponding nucleotide accession number AB033025), is implicated as a member of the Nuclear Hormone Receptor family.
- hCP43593.1 has been identified as containing both a Nuclear Hormone Receptor Ligand Binding Domain and a Nuclear Hormone Receptor DNA Binding Domain.
- the Nuclear Hormone Receptor family encodes structurally related proteins that regulate the transcription of target genes. These proteins include receptors for steroid and thyroid hormones, vitamins, and other proteins for which no ligands have been found.
- a protein must possess at least one of two key domains; a C4-type zinc finger DNA-Binding Domain (DBD) or a Ligand Binding Domain (LBD).
- DBD C4-type zinc finger DNA-Binding Domain
- LBD Ligand Binding Domain
- the DBD is required for binding DNA in the vicinity of target genes, and the LBD is required for steroid-like ligand responsiveness. It is the Ligand Binding Domain of Nuclear Hormone Receptors which is the binding site for pharmacological agents such as Tamoxifen.
- Nuclear Hormone Receptors possess both a DBD and an LBD, and a well-known example of this is Estrogen receptor alpha, which possesses both a DBD and an LBD.
- Nuclear Hormone Receptors which possess both a DBD and an LBD can be referred to as "Classical Nuclear Hormone Receptors".
- Nuclear Hormone Receptor family there are also members of the Nuclear Hormone Receptor family that possess an LBD but lack a DBD; for example the protein "Short Heterodimer Partner", SHP (SWISS- PROT code Q15466) possesses an LBD but lacks a DBD.
- SHP SWISS- PROT code Q15466
- a further refinement in the classification of Nuclear Hormone Receptors is to classify on the basis of possession of an LBD.
- Nuclear Hormone Receptors which possess an LBD can be sub-classified as "Nuclear Hormone Receptor Ligand Binding Domain" family members.
- Estrogen receptor alpha and SHP are "Nuclear Hormone Receptor Ligand Binding Domain” family members whereas Knirps and ODR7 are excluded.
- Nuclear Hormone Receptors can also be sub-classified on the basis of possession of a DBD.
- Nuclear Hormone Receptors which possess a C4-type zinc finger DBD can be sub- classified as "Nuclear Hormone Receptor DNA Binding Domain” family members.
- Estrogen Receptor alpha, Knirps and ODR7 are "Nuclear Hormone Receptor DNA Binding Domain” family members whereas SHP is excluded.
- the DBD directs the protein to bind specific DNA sequences in the vicinity of target genes.
- the Ligand Binding Domain binds and responds to the cognate hormone. Ligand binding to the LBD triggers a conformational change which expels a bound "Nuclear Receptor Co-Repressor". The site previously occupied by the Co-Repressor is then free to recruit a "Nuclear Receptor Co- Activator".
- This Ligand-triggered swap of a Co- Repressor for a Co-Activator is the mechanism by which Ligand binding leads to the transcriptional activation of target genes.
- the LBD is the binding site for all Nuclear Hormone Receptor targeted drugs to date and it is thus desirable to identify Ligand Binding Domains since these will be attractive drug targets. The LBD also directs dimerisation with other LBDs.
- the Estrogen receptor alpha ligand binding domain can homodimerise with itself, or heterodimerise with the Estrogen receptor beta ligand binding domain.
- Ligand Binding Domains share low sequence identity ( ⁇ 15%) but have very similar structures and so present ideal targets for a structure-based relationship tool such as Inpharmatica Genome Threader .
- 'Nuclear hormone receptors' are also known in the art as 'nuclear receptors' and thus any reference to 'nuclear receptor(s)' herein also refers to 'nuclear hormone receptor(s)'.
- Class ID refers to a classification code for each member
- accession refers to NCBI GenBank nucleotide accession code.
- Nuclear Hormone Receptor Ligand Binding Domain family members have been shown to play a role in diverse physiological functions, many of which can play a role in disease processes (see Table 2). Table 2. Nuclear Hormone Receptors and disease
- the invention is based on the discovery that the hCP43593.1 protein functions as a Nuclear Hormone Receptor.
- hCP43593.1 has been identified as containing both a Nuclear Hormone Receptor Ligand Binding Domain and a Nuclear Hormone Receptor DNA Binding Domain.
- Human RXRalpha Ligand Binding Domain is known to function as a Nuclear Hormone Receptor Ligand Binding Domain. This relationship is not just to the Human RXRalpha Ligand Binding Domain, but rather to the Nuclear Hormone Receptor Ligand Binding Domain family as a whole.
- results presented herein clearly indicate that the NHR8 transcript is present at detectable levels in a variety of human tissues and cell lines. This confirms the relevance of the NHR8 polypeptides as important targets for further biochemical characterisation.
- the particular tissues and cell lines identified herein as expressing NHR8 represent ideal targets for further studies of NHR8 function in vivo. Such studies may, for example, make use of the ligands identified using the assays and screening methods disclosed herein to investigate the effects of inducing or inhibiting NHR8 function.
- the cloning of the full-length NHR8 polypeptide allows for high-level expression, purification and characterisation of the NHR8 polypeptides of the invention. For example, the cloning, purification and partial characterisation of the LBD or NHR8 is described herein.
- NHR8 is increased in a number of diseased tissues relative to undiseased tissues, particularly in tumour samples such as carcinoma tissue samples.
- NHR8 gene transcript levels were most elevated in both benign and malignant tumours ofthe gastrointestinal tract.
- a ten fold increase in expression was observed in benign adenomas of the duodenum and colon, malignant mucinous adenocarcinoma of the colon and malignant adenocarcinoma of the colon.
- a 5-8 fold increase in expression was observed in adenocarcinoma of the rectum and a 5 fold increase in adenocarcinoma of the pancreas.
- a 2-4 fold increase in expression was observed in adenocarcinoma of the oesophagus and the stomach and signet ring cell carcinoma of the stomach. Outside the gastrointestinal tract, transcript levels were elevated 8 fold in giant cell carcinoma ofthe bone, 2-4 fold in mucinous adenocarcinoma of the breast, squamous carcinoma of the larynx, adenocarcinoma of the lung, adenocarcinoma of the cervix, serous cyst adenocarcinoma of the ovary and adenocarcinoma of the ovary.
- a 6-fold increase in expression was observed in inflammatory bowel disease, a 2-fold increase in expression was observed in chronic obstructive pulmonary disease (COPD) and a 3-fold increase in expression was seen in Conn's tumour ofthe adrenal cortex.
- COPD chronic obstructive pulmonary disease
- agonists and antagonists of NHR8 are likely to be of great value in the treatment of diseases in which Nuclear Hormone Receptors are implicated, especially tumours and carcinomas as disclosed above.
- agonists and antagonists of the NHR8 polypeptides can be readily identified using the assays and screening methods disclosed herein. Once identified, the effect of agonists and antagonists on diseased cell lines and tissue types may then be investigated using the methods disclosed herein or known to those of skill in the art. It is likely that certain agonists or antagonists identified using the assays and methods disclosed herein will be useful in the prophylaxis or treatment of diseases associated with NHR8, especially carcinomas.
- the polypeptides ofthe invention are therefore of value in the development of diagnostic methods for the identification of patients with those particular disease conditions and for the development of suitable prophylactic and therapeutic treatments.
- the present invention allows the development of molecular diagnostic tools, such as monoclonal antibodies, for the detection of NHR8 in vivo, that preferably target the ligand binding domain or DNA binding domain specifically.
- the NHR8 polypeptide is a Nuclear Hormone Receptor, that allows the skilled reader to use this knowledge to generate bespoke compounds that bind to areas of interest and biochemical importance in the polypeptide.
- the identification of patients affected by particular cancer conditions using such diagnostic methods will enable specific therapeutic approaches for individual patients to be selected.
- the present invention allows the design of specific therapies for the treatment of the specific cancer conditions identified herein; such therapies may, for example, target NHR8 expression or function in the relevant tumour cells.
- the invention provides a polypeptide, which polypeptide:
- (ii) is a fragment thereof having activity as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor or having an antigenic determinant in common with the polypeptides of (i); or
- a polypeptide according to the first aspect of the invention consists of the amino acid sequence as recited in SEQ ID NO:2 or is a fragment or functional equivalent thereof.
- polypeptide having the sequence recited in SEQ ID NO:2 is referred to hereafter as "the NHR8 polypeptide”.
- a preferred polypeptide fragment according to part ii) above includes the region of the NHR8 polypeptide that is predicted as that responsible for Nuclear Hormone Receptor Ligand Binding Domain activity (hereafter, the "NHR8LBD region"), or is a variant thereof.
- NHR8LBD region A residue position in NHR8 can be referred to by two different numbering schemes, one which numbers according to the longer raw hCP43593.1 sequence, and another which numbers according to the shorter and refined sequence which appears as SEQ ID NO:2.
- the predicted NHR8LBD is positioned between residues 539-755 according to the hCP43593.1 numbering scheme and residues 496-712 according to the SEQ ID NO:2 numbering scheme.
- a further preferred polypeptide fragment according to part ii) above includes the region of the NHR8 polypeptide that is predicted as that responsible for Nuclear Hormone Receptor DNA Binding Domain activity (hereafter, the "NHR8DBD region"), or is a variant thereof.
- the predicted NHR8DBD is positioned between residues 364-447 in the hCP43593.1 numbering scheme and residues 321-404 according to the SEQ ID NO:2 numbering scheme.
- This aspect of the invention also includes fusion proteins that inco ⁇ orate polypeptide fragments and variants of these polypeptide fragments as defined above, provided that said fusion proteins possess activity as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor.
- polypeptides with 'activity as a Nuclear Hormone Receptor Ligand Binding Domain we refer to polypeptides that comprise amino acid sequence or structural features that can be identified as conserved features present in both NHR8 and other known Nuclear Hormone Receptor Ligand Binding Domains, and that also retain their ligand-binding specificity such that LBD function is not substantially reduced in comparison to the naturally-occurring NHR8 LBD.
- assays to test ligand binding and its effect on NHR8-directed transcription are described in the Examples.
- polypeptides with 'activity as a Nuclear Hormone Receptor DNA Binding Domain we refer to polypeptides that comprise amino acid sequence or structural features that can be identified as conserved features present in both NHR8 and other known Nuclear Hormone Receptor DNA Binding Domains, and that also retain their DNA-binding specificity such that DBD function is not substantially reduced in comparison to the naturally-occurring NHR8DBD.
- the DNA Binding Domains (DBDs) of NHRs make specific base-specific contacts with the nucleotide bases in the DNA and are responsible for the sequence-specificity of DNA recognition.
- the NHR response elements contain similar motifs frequently arranged as direct or inverted repeats with a variable spacer.
- the specificity of NHR DNA recognition motifs is further enhanced by the formation of homodimers or heterodimers with different partners (e.g. retinoic acid receptor, RXR).
- the DNA motif recognized by the DNA binding region of the novel NHR can be identified by assays for the novel NHR as either a homodimer or heterodimer.
- the assay is based on detection ofthe bound NHR or a putative partner to a DNA sequence, which can be either a DNA fragment or a synthetic oligonucleotide.
- the DNA is linked to a solid support (e.g. beads, plates), and the detection of the NHR may use any means of signal read-out (e.g. ELISA, RIA, fluorescence or luminescence), or direct identification by mass-spectrometry.
- polypeptides with 'activity as a Nuclear Hormone Receptor' herein, we refer to polypeptides that comprise amino acid sequence or structural features that can be identified as conserved features present in both NHR8 and other known Nuclear Hormone Receptors, and that also retain their ligand-binding and DNA-binding specificity such that NHR function is not substantially reduced in comparison to naturally-occurring NHR8.
- assays to evaluate the ability of a polypeptide for activity as a Nuclear Hormone Receptor, mediating effects on transcription through ligand binding and subsequent binding of the DNA binding domain to a DNA target are described in the Examples.
- the invention provides a purified nucleic acid molecule that encodes a polypeptide of the first aspect of the invention, or a fragment thereof.
- the purified nucleic acid molecule has the nucleic acid sequence as recited in SEQ ID NO:l (encoding the NHR8 polypeptide), or is a redundant equivalent or fragment of this sequence.
- a further preferred nucleic acid molecule is one that encodes a polypeptide fragment according to part ii) above, preferably a polypeptide fragment that includes the NHR8LBD region, or the NHR8DBD region or that encodes a variant of these fragments as this term is defined above.
- the invention provides a purified nucleic acid molecule which hybridizes under high stringency conditions with a nucleic acid molecule of the second aspect ofthe invention.
- the invention provides a vector, such as an expression vector, that contains a nucleic acid molecule ofthe second or third aspect ofthe invention.
- the invention provides a host cell transformed with a vector ofthe fourth aspect ofthe invention.
- the invention provides a ligand which binds specifically to, and specifically either inhibits or activates the Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor activity of, a polypeptide ofthe first aspect ofthe invention.
- Ligands to a polypeptide according to the invention may come in various forms, including natural or modified substrates, enzymes, receptors, small organic molecules such as small natural or synthetic organic molecules of up to 2000Da, preferably 800Da or less, peptidomimetics, inorganic molecules, peptides, polypeptides, antibodies, structural or functional mimetics ofthe aforementioned.
- such ligands may bind specifically to, and inhibit the activity of a Nuclear Hormone Receptor Ligand Binding Domain ofthe present invention by binding to one or more residues within the LBD, or to one or more residues outside the LBD.
- all known drugs that affect Nuclear Hormone Receptors bind to residues within the LBD. Accordingly, it is preferred that ligands of the invention which inhibit the Nuclear Hormone Receptor Ligand Binding Domain activity of a polypeptide of the invention bind to residues within the LBD.
- such ligands may bind specifically to, and inhibit the activity of a Nuclear Hormone Receptor DNA Binding Domain of the present invention by binding to one or more residues within the LBD, or to one or more residues outside the LBD. It is preferred that ligands ofthe invention which inhibit the Nuclear Hormone Receptor DNA Binding Domain activity of a polypeptide ofthe invention bind to residues within the DBD.
- such ligand may bind specifically to, and inhibit the activity of a Nuclear Hormone Receptor of the present invention by binding to either the LBD or the DBD, such that the NHR is unable to function normally.
- the invention provides a compound that is effective to alter the expression of a natural gene which encodes a polypeptide of the first aspect of the invention or to regulate the activity of a polypeptide ofthe first aspect ofthe invention.
- a compound that is effective to alter the expression of a natural gene which encodes a polypeptide of the first aspect of the invention or to regulate the activity of a polypeptide ofthe first aspect ofthe invention may be identified using the assays and screening methods dislcosed herein.
- a compound of the seventh aspect of the invention may either increase (agonise) or decrease (antagonise) the level of expression of the gene or the activity of the polypeptide.
- the identification ofthe function ofthe region defined herein as the NHR8LBD region of the NHR8 polypeptide, respectively, allows for the design of screening methods capable of identifying compounds that are effective in the treatment and/or diagnosis of diseases in which Nuclear Hormone Receptors are implicated. Examples of suitable assays and screening methods are provided herein.
- the invention provides a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector of the fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, for use in therapy or diagnosis of diseases in which Nuclear Hormone Receptors are implicated.
- Data presented herein shows that the mRNA for NHR8 is normally expressed in brain, testis, ovary and placenta. This is consistent with a role of NHR8 in acting as a receptor for small metabolites such as steroids and mediating their activity in the target tissues.
- Neurosteroids are well-recognised to have effects on cognition and behaviour, in particular addictive behaviours.
- high levels ofthe transcript were identified in A 143 cells, a human cell line derived from a glioblastoma and HCT116 and HT29 cells (two colonic epithelial cell lines).
- the transcript for NHR8 has also been found to be dramtically upregulated in U937 cells by treatment ofthe cells with dibutyryl cAMP. This treatment is known to terminally differentiate these cells and acts as a model system for differentiation to a macrophage phenotype.
- Examples of diseases in which Nuclear Hormone Receptors are implicated include cell proliferative disorders, including neoplasm, melanoma, lung, colorectal, breast, uterus, prostate, pancreas, head and neck and other solid tumours, Conn's tumour ofthe adrenal cortex, glioblastoma, meningioma, giant cell tumour of bone, myeloproliferative disorders, such as leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia, angiogenesis disorder, Kaposis' sarcoma, autoimmune/inflammatory disorders, including allergy, inflammatory bowel disease, arthritis, psoriasis and respiratory tract inflammation, asthma, and organ transplant rejection, cardiovascular disorders, including hypertension, hypotension, oedema, angina, atherosclerosis, thrombosis, sepsis, shock, reperfusion injury, heart arrhythmia, ischemia and chronic obstructive pulmonary disease, neurological disorders including, central
- the disease is proliferative in nature such as inflammation or cancer, particularly carcinomas.
- the disease is a tumour, such as carcinoma; benign and malignant tumours of the gastrointestinal tract, including benign adenomas of the duodenum and colon, malignant mucinous adenocarcinoma of the colon and malignant adenocarcinoma of the colon, adenocarcinoma of the rectum, adenocarcinoma of the pancreas, adenocarcinoma ofthe oesophagus and the stomach and signet ring cell carcinoma ofthe stomach; also giant cell carcinoma of the bone, mucinous adenocarcinoma of the breast, squamous carcinoma of the larynx, adenocarcinoma of the lung, adenocarcinoma of the cervix, serous cyst adenocarcinoma of the ovary, adenocarcinoma of the ovary, inflammatory bowel disease, chronic obstructive pulmonary disease and Conn's tumour ofthe adrenal
- the invention provides a method of diagnosing a disease in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide of the first aspect of the invention or the activity of a polypeptide of the first aspect of the invention in tissue from said patient and comparing said level of expression or activity to a control level, wherein a level that is different to said control level is indicative of disease.
- a method will preferably be carried out in vitro.
- Similar methods may be used for monitoring the therapeutic treatment of disease in a patient, wherein altering the level of expression or activity of a polypeptide or nucleic acid molecule over the period of time towards a control level is indicative of regression of disease.
- a number of different such methods according to the ninth aspect of the invention exist, as the skilled reader will be aware, such as methods of nucleic acid hybridization with short probes, point mutation analysis, polymerase chain reaction (PCR) amplification and methods using antibodies to detect aberrant protein levels. Similar methods may be used on a short or long-term basis to allow therapeutic treatment of a disease to be monitored in a patient.
- the invention also provides kits that are useful in these methods for diagnosing disease.
- a preferred method for detecting polypeptides of the first aspect of the invention comprises the steps of: (a) contacting a ligand ofthe sixth aspect of the invention with a biological sample under conditions suitable for the formation of a ligand-polypeptide complex; and (b) detecting said complex.
- the ligand of the sixth aspect ofthe invention may be any suitable ligand, such as an antibody, hormone or nucleic acid sequence.
- the disease diagnosed by a method of the ninth aspect of the invention is a disease in which Nuclear Hormone Receptors are implicated, as described above.
- the invention provides for the use of a polypeptide ofthe first aspect of the invention, or a fragment thereof, as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor.
- Suitable uses of a polypeptide ofthe invention as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor include use for the hormone-mediated directed regulation of gene transcription.
- polypeptides of the invention include use in methods for the identification of NHR8 LDB and DBD ligands, which ligands will be of use in the modulation of disease processes in which NHR8 is implicated.
- ligands for the NHR8 LBD may be identified using the assays and screening methods disclosed herein. Such ligands may then be used in combination with theNHR8 polypeptides to effect ligand-regulated expression of target genes.
- the invention also provides for the use of a nucleic acid molecule according to the second or third aspects of the invention to express a protein that possesses activity as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor.
- a nucleic acid molecule according to the second or third aspects of the invention to express a protein that possesses activity as a Nuclear Hormone Receptor Ligand Binding Domain and/or a Nuclear Hormone Receptor DNA Binding Domain and/or a Nuclear Hormone Receptor.
- nucleic acid molecules are of utility in the production of the polypeptides of the invention, which polypeptides are useful in a variety of situations, as described above.
- the invention also provides a method for effecting Nuclear Hormone Receptor Ligand Binding Domain and/or Nuclear Hormone Receptor DNA Binding Domain and/or Nuclear Hormone Receptor activity, said method utilising a polypeptide of the first aspect ofthe invention, or a fragment thereof.
- the invention provides a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect ofthe invention, or a vector ofthe fourth aspect ofthe invention, or a host cell according to the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, in conjunction with a pharmaceutically-acceptable carrier.
- the present invention provides a polypeptide ofthe first aspect ofthe invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector ofthe fourth aspect of the invention, or a host cell according to the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, for use in the manufacture of a medicament for the diagnosis or treatment of a disease in which Nuclear Hormone Receptors are implicated, examples of which are given above.
- the invention provides a method of treating a disease in a patient comprising administering to the patient a polypeptide of the first aspect of the invention, or a nucleic acid molecule ofthe second or third aspect ofthe invention, or a vector ofthe fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, or a pharmaceutical composition ofthe eleventh aspect ofthe invention.
- the polypeptide, nucleic acid molecule, vector, host cell, ligand or compound admimstered to the patient should be an agonist.
- the polypeptide, nucleic acid molecule, vector, host cell, ligand or compound administered to the patient should be an antagonist. Examples of such antagonists include antisense nucleic acid molecules, ribozymes and ligands, such as antibodies.
- the disease is a disease in which Nuclear Hormone Receptors are implicated, as described above.
- the invention provides transgenic or knockout non-human animals that have been transformed to express higher, lower or absent levels of a polypeptide of the first aspect of the invention. Such transgenic animals are very useful models for the study of disease and may also be used in screening regimes for the identification of compounds that are effective in the treatment or diagnosis of such a disease.
- the disease is a disease in which Nuclear Hormone Receptors are implicated, as described above.
- polypeptide includes any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e. peptide isosteres. This term refers both to short chains (peptides and oligopeptides) and to longer chains (proteins).
- the polypeptide of the present invention may be in the form of a mature protein or may be a pre-, pro- or prepro- protein that can be activated by cleavage of the pre-, pro- or prepro- portion to produce an active mature polypeptide.
- the pre-, pro- or prepro- sequence may be a leader or secretory sequence or may be a sequence that is employed for purification of the mature polypeptide sequence.
- the polypeptide ofthe first aspect ofthe invention may form part of a fusion protein.
- polypeptide may be fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
- Polypeptides may contain amino acids other than the 20 gene-encoded amino acids, modified either by natural processes, such as by post-translational processing or by chemical modification techniques which are well known in the art.
- modifications which may commonly be present in polypeptides of the present invention are glycosylation, lipid attachment, sulphation, gamma-carboxylation, for instance of glutamic acid residues, hydroxylation and ADP-ribosylation.
- Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
- blockage ofthe amino or carboxyl terminus in a polypeptide, or both, by a covalent modification is common in naturally-occurring and synthetic polypeptides and such modifications may be present in polypeptides ofthe present invention.
- modifications that occur in a polypeptide often will be a function of how the polypeptide is made.
- the nature and extent of the modifications in large part will be determined by the post-translational modification capacity of the particular host cell and the modification signals that are present in the amino acid sequence of the polypeptide in question. For instance, glycosylation patterns vary between different types of host cell.
- polypeptides of the present invention can be prepared in any suitable manner.
- > polypeptides include isolated naturally-occurring polypeptides (for example purified from cell culture), recombinantly-produced polypeptides (including fusion proteins), synthetically-produced polypeptides or polypeptides that are produced by a combination of these methods.
- the functionally-equivalent polypeptides of the first aspect of the invention may be any suitable amino acid sequence.
- polypeptides that are homologous to the NHR8 polypeptide Two polypeptides are said to be "homologous”, as the term is used herein, if the sequence of one of the polypeptides has a high enough degree of identity or similarity to the sequence of the other polypeptide. "Identity” indicates that at any particular position in the aligned sequences, the amino acid residue is identical between the sequences. "Similarity” indicates that, at
- the amino acid residue is of a similar type between the sequences. Degrees of identity and similarity can be readily calculated
- Homologous polypeptides therefore include natural biological variants (for example, allelic variants or geographical variations within the species from which the polypeptides 5 are derived) and mutants (such as mutants containing amino acid substitutions, insertions or deletions) ofthe NHR8 polypeptide.
- Such mutants may include polypeptides in which one or more ofthe amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
- Typical such 0 substitutions are among Ala, Val, Leu and He; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gin; among the basic residues Lys and Arg; or among the aromatic residues Phe and Tyr.
- Particularly preferred are variants in which several, i.e. between 5 and 10, 1 and 5, 1 and 3, 1 and 2 or just 1 amino acids are substituted, deleted or added in any combination.
- silent substitutions, additions and deletions which do not alter the properties and activities of the protein. Also especially preferred in this regard are conservative substitutions.
- Such mutants also include polypeptides in which one or more of the amino acid residues includes a substituent group.
- polypeptides of the first aspect of the invention have a degree of sequence identity with the NHR8 polypeptide, or with active fragments thereof, of greater than 80%. More preferred polypeptides have degrees of identity of greater than 85%, 90%, 95%, 98% or 99%, respectively with the NHR8 polypeptide, or with active fragments thereof.
- the functionally-equivalent polypeptides of the first aspect of the invention may also be polypeptides which have been identified using one or more techniques of structural alignment.
- the Inpharmatica Genome ThreaderTM technology that forms one aspect of the search tools used to generate the Biopendium search database may be used (see PCT application published as WO 01/67507) to identify polypeptides of presently- unknown function which, while having low sequence identity as compared to the NHR8 polypeptide, are predicted to have Nuclear Hormone Receptor activity, by virtue of sharing significant structural homology with the NHR8 polypeptide sequence.
- the Inpharmatica Genome ThreaderTM predicts two proteins, or protein regions, to share structural homology with a certainty of at least 10% more preferably, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and above.
- the certainty value of the Inpharmatica Genome ThreaderTM is calculated as follows. A set of comparisons was initially performed using the Inpharmatica Genome ThreaderTM exclusively using sequences of known structure. Some of the comparisons were between proteins that were known to be related (on the basis of structure). A neural network was then trained on the basis that it needed to best distinguish between the known relationships and known not-relationships taken from the CATH structure classification (www.biochem.ucl.ac.uk/bsm/cath).
- Structural homologues to the Ligand Binding Domain of NHR8 should share structural homology with the NHR8LBD region. Such structural homologues are predicted to have Nuclear Hormone Receptor Ligand Binding Domain activity by virtue of sharing significant structural homology with this polypeptide sequence.
- Structural homologues to the DNA Binding Domain of NHR8 should share structural homology with the NHR8DBD region. Such structural homologues are predicted to have Nuclear Hormone Receptor DNA Binding Domain activity by virtue of sharing significant structural homology with this polypeptide sequence.
- polypeptides ofthe first aspect ofthe invention also include fragments ofthe NHR8 polypeptide, functional equivalents of the fragments of the NHR8 polypeptide, and fragments of the functional equivalents of the NHR8 polypeptides, provided that those functional equivalents and fragments retain Nuclear Hormone Receptor activity or have an antigenic determinant in common with the NHR8 polypeptide.
- fragment refers to a polypeptide having an amino acid sequence that is tiae same as part, but not all, of the amino acid sequence of the NHR8 polypeptides or one of its functional equivalents.
- the fragments should comprise at least n consecutive amino acids from the sequence and, depending on the particular sequence, n preferably is 7 or more (for example, 8, 10, 12, 14, 16, 18, 20 or more). Small fragments may form an antigenic determinant.
- This region is the region that has been annotated as a Nuclear Hormone Receptor DNA Binding Domain.
- this region is considered to extend between residue 321 and residue 404.
- Variants of this fragment are included as embodiments of this aspect ofthe invention, provided that these variants possess activity as a Nuclear Hormone Receptor DNA Binding Domain.
- variable is meant to include extended or truncated versions of this polypeptide fragment.
- NHR8LBD region of the NHR8 polypeptide will fold correctly and show Nuclear Hormone Receptor Ligand
- Binding Domain activity if additional residues C terminal and/or N terminal of these boundaries in the NHR8 polypeptide sequence are included in the polypeptide fragment.
- an additional 5, 10, 20, 30, 40 or even 50 or more amino acid residues from the NHR8 polypeptide sequence, or from a homologous sequence may be included at either or both the C terminal and/or N terminal of the boundaries of the NHR8LBD region of the NHR8 polypeptide, without prejudicing the ability of the polypeptide fragment to fold correctly and exhibit Nuclear Hormone Receptor Ligand Binding
- one or more amino acid residues may be deleted at either or both the C terminus or the N terminus of the NHR8LBD region of the NHR8 polypeptide.
- one preferred fragment is that which was cloned and expressed herein. This encompasses residues 506-756 of NHR8 from human cDNA clone I.M.A.G.E. Consortium ClonelD #215535 (using the hCP43593.1 numbering scheme).
- NHR8DBD region of the NHR8 polypeptide will fold correctly and show Nuclear Hormone Receptor DNA Binding Domain activity if additional residues C terminal and/or N terminal of these boundaries in the NHR8 polypeptide sequence are included in the polypeptide fragment.
- additional residues C terminal and/or N terminal of these boundaries in the NHR8 polypeptide sequence are included in the polypeptide fragment.
- an additional 5, 10, 20, 30, 40 or even 50 or more amino acid residues from the NHR8 polypeptide sequence, or from a homologous sequence may be included at either or both the C terminal and/or N terminal of the boundaries of the NHR8DBD region of the
- NHR8 polypeptide without prejudicing the ability of the polypeptide fragment to fold correctly and exhibit Nuclear Hormone Receptor DNA Binding Domain activity.
- NHR8 polypeptide without prejudicing the ability of the polypeptide fragment to fold correctly and exhibit Nuclear Hormone Receptor DNA Binding Domain activity.
- one or more amino acid residues even 5, 10,
- amino acid residues may be deleted at either or both the C terminus or the N terminus ofthe NHR8DBD region ofthe NHR8 polypeptide.
- the term "variant" includes homologues ofthe polypeptide fragments described above, that possess significant sequence homology with a) the NHR8LBD region ofthe NHR8 polypeptide, provided that said variants retain activity as a Nuclear Hormone Receptor Ligand Binding Domain; or b) the NHR8DBD region of the NHR8 polypeptide, provided that said variants retain activity as a Nuclear Hormone Receptor DNA Binding Domain.
- Homologues include those polypeptide molecules that possess greater than 80% identity with the NHR8LBD regions ofthe NHR8 polypeptide.
- variant homologues of polypeptide fragments of this aspect ofthe invention have a degree of sequence identity with the NHR8LBD region of the NHR8 polypeptide, of greater than 85%. More preferred variant polypeptides have degrees of identity of greater than 90%, 95%, 98% or 99%, respectively with the NHR8LBD regions of the NHR8, polypeptides, provided that said variants retain activity as a Nuclear Hormone Receptor Ligand Binding Domain.
- variant polypeptides also include homologues of the truncated forms of the polypeptide fragments discussed above, provided that said variants retain activity as a Nuclear Hormone Receptor Ligand Binding Domain.
- Homologues also include those polypeptide molecules that possess greater than 80% identity with the NHR8DBD region of the NHR8 polypeptide.
- variant homologues of polypeptide fragments of this aspect of the invention have a degree of sequence identity with the NHR8DBD region of the NHR8 polypeptide, of greater than 85%. More preferred variant polypeptides have degrees of identity of greater than 90%, 95%, 98% or 99%, respectively with the NHR8DBD region of the NHR8 polypeptide, provided that said variants retain activity as a Nuclear Hormone Receptor DNA Binding Domain.
- variant polypeptides also include homologues of the truncated forms of the polypeptide fragments discussed above, provided that said variants retain activity as a Nuclear Hormone Receptor DNA Binding Domain.
- polypeptide fragments of the first aspect of the invention may be polypeptide fragments that exhibit significant structural homology with the structure of the polypeptide fragment defined by the NHR8LBD region of the NHR8 polypeptide sequence, for example, as identified by the Inpharmatica Genome ThreaderTM. Accordingly, polypeptide fragments that are structural homologues of the polypeptide fragments defined by the NHR8LBD region of the NHR8 polypeptide sequence should adopt the same fold as that adopted by this polypeptide fragment, as this fold is defined above.
- polypeptide fragments of the first aspect of the invention may be polypeptide fragments that exhibit significant structural homology with the structure of the polypeptide fragment defined by the NHR8DBD region of the NHR8 polypeptide sequence, for example, as identified by the Inpharmatica Genome ThreaderTM. Accordingly, polypeptide fragments that are structural homologues of the polypeptide fragments defined by the NHR8DBD region of the NHR8 polypeptide sequence should adopt the same fold as that adopted by this polypeptide fragment, as this fold is defined above.
- fragments may be "free-standing", i.e. not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region.
- the fragment ofthe invention When comprised within a larger polypeptide, the fragment ofthe invention most preferably forms a single continuous region.
- certain preferred embodiments relate to a fragment having a pre- and/or pro- polypeptide region fused to the amino terminus of the fragment and/or an additional region fused to the carboxyl terminus of the fragment.
- several fragments may be comprised within a single larger polypeptide.
- polypeptides ofthe present invention or their immunogenic fragments can be used to generate ligands, such as polyclonal or monoclonal antibodies, that are immunospecific for the polypeptides.
- ligands such as polyclonal or monoclonal antibodies
- Such antibodies may be employed to isolate or to identify clones expressing the polypeptides of the invention or to purify the polypeptides by affinity chromatography.
- the antibodies may also be employed as diagnostic or therapeutic aids, amongst other applications, as will be apparent to the; -skilled reader.
- immunospecific means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
- antibody refers to intact molecules as well as to fragments thereof, such as Fab, F(ab')2 and Fv, which are capable of binding to the antigenic determinant in question. Such antibodies thus bind to the polypeptides of the first aspect ofthe invention.
- substantially greater affinity we mean that there is a measurable increase in the affinity for a polypeptide of the invention as compared with the affinity for known Nuclear Hormone Receptors.
- the affinity is at least 1.5-fold, 2-fold, 5-fold 10-fold, 100-fold, 10 3 -fold, 10 4 - fold, 10 5 -fold, 10 6 -fold or greater for a polypeptide of the invention than for known Nuclear Hormone Receptors.
- a selected mammal such as a mouse, rabbit, goat or horse
- a polypeptide of the first aspect of the invention may be immunised with a polypeptide of the first aspect of the invention.
- the polypeptide used to immunise the animal can be derived by recombinant DNA technology or can be synthesized chemically.
- the polypeptide can be conjugated to a carrier protein. Commonly used carriers to which the polypeptides may i . ,,--, discipline
- Monoclonal antibodies to the polypeptides of the first aspect ofthe invention can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies using hybridoma technology is well known (see, for example, Kohler, G.
- Panels of monoclonal antibodies produced against the polypeptides of the first aspect of the invention can be screened for various properties, i.e., for isotype, epitope, affinity, etc. Monoclonal antibodies are particularly useful in purification of the individual polypeptides against which they are directed. Alternatively, genes encoding the monoclonal antibodies of interest may be isolated from hybridomas, for instance by PCR techniques known in the art, and cloned and expressed in appropriate vectors.
- Chimeric antibodies in which non-human variable regions are joined or fused to human constant regions (see, for example, Liu et al., Proc. Natl. Acad. Sci. USA, 84, 3439 (1987)), may also be of use.
- the antibody may be modified to make it less immunogenic in an individual, for example by humanisation (see Jones et al., Nature, 321, 522 (1986); Verhoeyen et al., Science, 239: 1534 (1988); Kabat et al, J. Immunol., 147: 1709 (1991); Queen et al, Proc. Natl Acad. Sci. USA, 86, 10029 (1989); Gorman et al, Proc. Natl Acad. Sci.
- humanised antibody refers to antibody molecules in which the CDR amino acids and selected other amino acids in the variable domains ofthe heavy and/or light chains of a non-human donor antibody have been substituted in place ofthe equivalent amino acids in a human antibody.
- the humanised antibody thus closely resembles a human antibody but has the binding ability ofthe donor antibody.
- the antibody may be a "bispecific" antibody, that is, an antibody having two different antigen-binding domains, each domain being directed against a different epitope.
- Phage display technology may be utilised to select genes which encode antibodies with binding activities towards the polypeptides of the invention either from repertoires of PCR amplified V-genes of lymphocytes from humans screened for possessing the relevant antibodies, or from naive libraries (McCafferty, J. et al, (1990), Nature 348, 552-554; Marks, J. et al, (1992) Biotechnology 10, 779-783).
- the affinity of these antibodies can also be improved by chain shuffling (Clackson, T. et al, (1991) Nature 352, 624-628).
- Antibodies generated by the above techniques have additional utility in that they may be employed as reagents in immunoassays, radioimmunoassays (RIA) or enzyme-linked immunosorbent assays (ELISA).
- the antibodies can be labelled with an analytically-detectable reagent such as a radioisotope, a fluorescent molecule or an enzyme.
- Preferred nucleic acid molecules of the second and third aspects of the invention are those which encode the polypeptide sequence recited in SEQ ID NO:2, and functionally equivalent polypeptides, including active fragments of the NHR8 polypeptide, such as a fragment including the NHR8LBD region of the NHR8 polypeptide sequence, or a homologue thereof, or a fragment including the NHR8DBD region of the NHR8 polypeptide sequence, or a homologue thereof.
- nucleic acid molecules may be used in the methods and applications described herein.
- the nucleic acid molecules of the invention preferably comprise at least n consecutive nucleotides from the sequences disclosed herein where, depending on the particular sequence, n is 10 or more (for example, 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).
- n is 10 or more (for example, 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).
- the nucleic acid molecules of the invention also include sequences that are complementary to nucleic acid molecules described above (for example, for antisense or probing purposes).
- Nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance cDNA, synthetic DNA or genomic DNA. Such nucleic acid molecules may be obtained by cloning, by chemical synthetic techniques or by a combination thereof. The nucleic acid molecules can be prepared, for example, by chemical synthesis using techniques such as solid phase phosphoramidite chemical synthesis, from genomic or cDNA libraries or by separation from an organism. RNA molecules may generally be generated by the in vitro or in vivo transcription of DNA sequences.
- the nucleic acid molecules may be double-stranded or single-stranded.
- Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non- coding strand, also referred to as the anti-sense strand.
- the term "nucleic acid molecule” also includes analogues of DNA and RNA, such as those containing modified backbones, and peptide nucleic acids (PNA).
- PNA peptide nucleic acids
- PNA refers to an antisense molecule or an anti-gene agent which comprises an oligonucleotide of at least five nucleotides in length linked to a peptide backbone of amino acid residues, which preferably ends in lysine.
- PNAs may be pegylated to extend their lifespan in a cell, where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P.E. et al. (1993) Anticancer Drug Des. 8:53-63).
- a nucleic acid molecule which encodes the polypeptide of SEQ ID NO:2, or an active fragment thereof, may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID NO:l . These molecules also may have a different sequence which, as a result ofthe degeneracy ofthe genetic code, encodes the polypeptide SEQ ID NO:2.
- nucleic acid molecules that encode the polypeptide of SEQ ID NO:2 may include, but are not limited to, the coding sequence for the mature polypeptide by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pro-, pre- or prepro- polypeptide sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with further additional, non-coding sequences, including non-coding 5' and 3' sequences, such as the transcribed, non- translated sequences that play a role in transcription (including termination signals), ribosome binding and mRNA stability.
- the nucleic acid molecules may also include additional sequences which encode additional amino acids, such as those which provide additional functionalities.
- nucleic acid molecules are those that encode active fragments of the NHR8 polypeptide, such as a fragment including the NHR8LBD region, or a variant or homologue thereof, as these terms are described above.
- the NHR8LBD region is considered to extend between residue 496 and 712 ofthe NHR8 polypeptide sequence.
- SEQ ID NO:l the NHR8LBD region is thus encoded by a nucleic acid molecule including nucleotide 1486 to nucleotide 2136. Nucleic acid molecules encompassing this stretch of sequence, and variants and homologues of this sequence, form a preferred embodiment of this aspect ofthe invention.
- NHR8DBD region Another active fragment of the NHR8 polypeptide includes the NHR8DBD region, or a variant or homologue thereof, as these terms are described above.
- the NHR8DBD region is considered to extend between residue 321 and 404 ofthe NHR8 polypeptide sequence.
- SEQ ID NO:l the NHR8DBD region is thus encoded by a nucleic acid molecule including nucleotide 961 to nucleotide 1212. Nucleic acid molecules encompassing this stretch of sequence, and variants and homologues of this sequence, form a preferred embodiment of this aspect ofthe invention.
- the term "variant" is meant to include extended or truncated versions of this polynucleotide fragment.
- extended variants it is considered highly likely that the polynucleotide sequences which encode the Nuclear Hormone Receptor Ligand Binding Domain regions of the NHR8 polypeptide will fold correctly and show Nuclear Hormone Receptor Ligand Binding Domain activity if additional residues 5' and/or 3' nucleotides terminal of these boundaries in the polynucleotide sequence are included in the polynucleotide fragment. For example, an additional 5, 15, 60, 90, 120 or even 150 or more nucleotides from the NHR8LBD sequence may be included.
- One embodiment of this aspect of the invention is a polynucleotide sequence that encodes the LBD fragment described in the Examples, namely, that which encompasses residues 506-756 of NHR8 from human cDNA clone I.M.A.G.E. Consortium Clone ⁇ D #215535 (using the hCP43593.1 numbering scheme).
- the nucleic acid molecules of the second and third aspects of the invention may also encode the fragments or the functional equivalents of the polypeptides and fragments of the first aspect ofthe invention.
- nucleic acid molecules according to the invention may be naturally-occurring variants such as a naturally-occurring allelic variant, or the molecules may be a variant that is not known to occur naturally.
- Such non-naturally occurring variants ofthe nucleic acid molecule may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells or organisms.
- variants in this regard are variants that differ from the aforementioned nucleic acid molecules by nucleotide substitutions, deletions or insertions.
- the substitutions, deletions or insertions may involve one or more nucleotides.
- the variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or insertions.
- the nucleic acid molecules of the invention can also be engineered, using methods generally known in the art, for a variety of reasons, including modifying the cloning, processing, and/or expression of the gene product (the polypeptide).
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides are included as techniques which may be used to engineer the nucleotide sequences.
- Site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and so forth.
- Nucleic acid molecules which encode a polypeptide of the first aspect of the invention may be ligated to a heterologous sequence so that the combined nucleic acid molecule encodes a fusion protein.
- Such combined nucleic acid molecules are included within the second or third aspects of the invention.
- a fusion protein that can be recognised by a commercially-available antibody.
- a fusion protein may also be engineered to contain a cleavage site located between the sequence of the polypeptide of the invention and the sequence of a heterologous protein so that the polypeptide may be cleaved and purified away from the heterologous protein.
- the nucleic acid molecules of the invention also include antisense molecules that are partially complementary to nucleic acid molecules encoding polypeptides of the present invention and that therefore hybridize to the encoding nucleic acid molecules (hybridization).
- antisense molecules such as oligonucleotides, can be designed to recognise, specifically bind to and prevent transcription of a target nucleic acid encoding a polypeptide ofthe invention, as will be known by those of ordinary skill in the art (see, for example, Cohen, J.S., Trends in Pharm. Sci., 10, 435 (1989), Okano, J. Neurochem. 56, 560 (1991); O'Connor, J. Neurochem 56, 560 (1991); Lee et al, Nucleic Acids Res 6, 3073 (1979); Cooney et al, Science 241, 456 (1988); Dervan et al, Science 251, 1360 (1991).
- hybridization refers to the association of two nucleic acid molecules with one another by hydrogen bonding. Typically, one molecule will be fixed to a solid support and the other will be free in solution. Then, the two molecules may be placed in contact with one another under conditions that favour hydrogen bonding. Factors that affect this bonding include: the type and volume of solvent; reaction temperature; time of hybridization; agitation; agents to block the non-specific attachment of the liquid phase molecule to the solid support (Denhardt's reagent or BLOTTO); the concentration of the molecules; use of compounds to increase the rate of association of molecules (dextran sulphate or polyethylene glycol); and the stringency of the washing conditions following hybridization (see Sambrook et al. [supra]).
- the inhibition of hybridization of a completely complementary molecule to a target molecule may be examined using a hybridization assay, as known in the art (see, for example, Sambrook et al [supra]).
- a substantially homologous molecule will then compete for and inhibit the binding of a completely homologous molecule to the target molecule under various conditions of stringency, as taught in Wahl, G.M. and S.L. Berger (1987; Methods Enzymol. 152:399-407) and Kimmel, A.R. (1987; Methods Enzymol. 152:507-511).
- Stringency refers to conditions in a hybridization reaction that favour the association of very similar molecules over association of molecules that differ. High stringency
- 5 hybridisation conditions are defined as overnight incubation at 42°C in a solution comprising 50% formamide, 5XSSC (150mM NaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5x Denhardts solution, 10% dextran sulphate, and 20 microgram ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1X SSC at approximately 65°C.
- Low stringency conditions involve the hybridisation
- the conditions used for hybridization are those of high stringency.
- Preferred embodiments of this aspect ofthe invention are nucleic acid molecules that are at least 70% identical over their entire length to a nucleic acid molecule encoding the NHR8 polypeptide (SEQ ID NO:2), and nucleic acid molecules that are substantially
- a preferred active fragment is a fragment that includes the NHR8LBD region of the NHR8 polypeptide sequences, respectively.
- preferred nucleic acid molecules include those that are at least 70% identical over their entire length to a nucleic acid molecule encoding the NHR8LBD region of the NHR8 polypeptide sequence, wherein percentage identity is as determined 0 using BLAST version 2.1.3 using the default parameters specified by the NCBI (the National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/).
- a nucleic acid molecule according to this aspect of the invention comprises a region that is at least 80% identical over its entire length to the nucleic acid molecule having the sequence given in SEQ ID NO:l, to a region including nucleotides 1486-2136 5 of this sequence, or a nucleic acid molecule that is complementary to any one of these regions of nucleic acid.
- nucleic acid molecules at least 90%, preferably at least 95%, more preferably at least 98% or 99% identical over their entire length to the same are particularly preferred.
- Preferred embodiments in this respect are nucleic acid molecules that encode polypeptides which retain Nuclear Hormone Receptor Ligand
- a further preferred active fragment is a fragment that includes the NHR8DBD region of the NHR8 polypeptide sequences, respectively.
- preferred nucleic acid molecules include those that are at least 70% identical over their entire length to a nucleic acid molecule encoding the NHR8DBD region of the NHR8 polypeptide sequence.
- a nucleic acid molecule according to this aspect of the invention comprises a region that is at least 80% identical over its entire length to the nucleic acid molecule having the sequence given in SEQ ID NO:l, to a region including nucleotides 961-1212 of this sequence, or a nucleic acid molecule that is complementary to any one of these regions of nucleic acid.
- nucleic acid molecules at least 90%, preferably at least 95%, more preferably at least 98% or 99% identical over their entire length to the same are particularly preferred.
- Preferred embodiments in this respect are nucleic acid molecules that encode polypeptides which retain Nuclear Hormone Receptor DNA Binding Domain activity.
- the invention also provides a process for detecting a nucleic acid molecule of the invention, comprising the steps of: (a) contacting a nucleic probe according to the invention with a biological sample under hybridizing conditions to form duplexes; and (b) detecting any such duplexes that are formed.
- a nucleic acid molecule as described above may be used as a hybridization probe for RNA, cDNA or genomic DNA, in order to isolate full-length cDNAs and genomic clones encoding the NHR8 polypeptide and to isolate cDNA and genomic clones of homologous or orthologous genes that have a high sequence similarity to the gene encoding this polypeptide.
- the sequencing process may be automated using machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, NV), the Peltier Thermal Cycler (PTC200; MJ Research, Watertown, MA) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).
- machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, NV), the Peltier Thermal Cycler (PTC200; MJ Research, Watertown, MA) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).
- One method for isolating a nucleic acid molecule encoding a polypeptide with an equivalent function to that of the NHR8 polypeptide, particularly with an equivalent function to the NHR8LBD region or the NHR8DBD region of the NHR8 polypeptide is to probe a genomic or cDNA library with a natural or artificially-designed probe using standard procedures that are recognised in the art (see, for example, "Current Protocols in Molecular Biology", Ausubel et al. (eds). Greene Publishing Association and John Wiley Interscience, New York, 1989,1992).
- Probes comprising at least 15, preferably at least 30, and more preferably at least 50, contiguous bases that correspond to, or are complementary to, nucleic acid sequences from the appropriate encoding gene (SEQ ID NO:l), particularly a region from nucleotides 1486-2136 of SEQ ID NO:l according to the SEQ ID NO:l numbering scheme, or a region from nucleotides 961-1212 of SEQ ID NO:l according to the SEQ ID NO:l numbering scheme, are particularly useful probes.
- SEQ ID NO:l nucleic acid sequences from the appropriate encoding gene
- Such probes may be labelled with an analytically-detectable reagent to facilitate their identification.
- Useful reagents include, but are not limited to, radioisotopes, fluorescent dyes and enzymes that are capable of catalysing the formation of a detectable product.
- the ordinarily skilled artisan will be capable of isolating complementary copies of genomic DNA, cDNA or RNA polynucleotides encoding proteins of interest from human, mammalian or other animal sources and screening such sources for related sequences, for example, for additional members of the family, type and/or subtype.
- isolated cDNA sequences will be incomplete, in that the region encoding the polypeptide will be cut short, normally at the 5' end.
- Several methods are available to obtain full length cDNAs, or to extend short cDNAs. Such sequences may be extended utilising a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements. For example, one method which may be employed is based on the method of Rapid Amplification of cDNA Ends (RACE; see, for example, Frohman et al., Proc. Natl. Acad. Sci. USA (1988) 85: 8998-9002).
- RACE Rapid Amplification of cDNA Ends
- Another method which may be used is capture PCR which involves PCR amplification of DNA fragments adjacent a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods Applic. 1: 111-119). Another method which may be used to retrieve unknown sequences is that of Parker, J.D. et al. (1991); Nucleic Acids Res. 19:3055- 3060). Additionally, one may use PCR, nested primers, and PromoterFinderTM libraries to walk genomic DNA (Clontech, Palo Alto, CA). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
- libraries that have been size-selected to include larger cDNAs.
- random-primed libraries are preferable, in that they will contain more sequences that contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA.
- Genomic libraries may be useful for extension of sequence into 5' non-transcribed regulatory regions.
- the nucleic acid molecules of the present invention may be used for chromosome localisation.
- a nucleic acid molecule is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome.
- the mapping of relevant sequences to chromosomes according to the present invention is an important step in the confirmatory correlation of those sequences with the gene-associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins 3o
- the relationships between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localised by genetic linkage to a particular genomic region, any sequences mapping to that area may represent associated or regulatory genes for further investigation.
- the nucleic acid molecule may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier, or affected individuals.
- the nucleic acid molecules of the present invention are also valuable for tissue localisation.
- Such techniques allow the determination of expression patterns of the polypeptide in tissues by detection of the mRNAs that encode them.
- These techniques include in situ hybridization techniques and nucleotide amplification techniques, such as PCR. Results from these studies provide an indication of the normal functions of the polypeptide in the organism.
- comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by a mutant gene provide valuable insights into the role of mutant polypeptides in disease. Such inappropriate expression may be of a temporal, spatial or quantitative nature.
- RNA interference (Elbashir, SM et al. , Nature 2001 , 411, 494-498) is one method of sequence specific post- transcriptional gene silencing that may be employed. Short dsRNA oligonucleotides are synthesised in vitro and introduced into a cell. The sequence specific binding of these dsRNA oligonucleotides triggers the degradation of target mRNA, reducing or ablating target protein expression.
- Efficacy of the gene silencing approaches assessed above may be assessed through the measurement of polypeptide expression (for example, by Western blotting), and at the RNA level using TaqMan-based methodologies.
- the vectors ofthe present invention comprise nucleic acid molecules ofthe invention and may be cloning or expression vectors.
- the host cells of the invention which may be transformed, transfected or transduced with the vectors of the invention may be prokaryotic or eukaryotic.
- polypeptides ofthe invention may be prepared in recombinant form by expression of their encoding nucleic acid molecules in vectors contained within a host cell. Such expression methods are well known to those of skill in the art and many are described in detail by Sambrook et al (supra) and Fernandez & Hoeffler (1998, eds. "Gene expression systems. Using nature for the art of expression”. Academic Press, San Diego, London, Boston, New York, Sydney, Tokyo, Toronto).
- any system or vector that is suitable to maintain, propagate or express nucleic acid molecules to produce a polypeptide in the required host may be used.
- the appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those described in Sambrook et al, (supra).
- the encoding gene can be placed under the control of a control element such as a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the DNA sequence encoding the desired polypeptide is transcribed into RNA in the transformed host cell.
- suitable expression systems include, for example, chromosomal, episomal and virus-derived systems, including, for example, vectors derived from: bacterial plasmids, bacteriophage, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses such as baculoviruses, papova viruses such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, or combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, including cosmids and phagemids.
- Human artificial chromosomes may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid.
- Particularly suitable expression systems include microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (for example, baculovirus); plant cell systems transformed with virus expression vectors (for example, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (for example, Ti or pBR322 plasmids); or animal cell systems.
- Cell-free translation systems can also be employed to produce the polypeptides ofthe invention.
- nucleic acid molecules encoding a polypeptide of the present invention into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., Basic Methods in Molecular Biology (1986) and Sambrook et al, [supra]. Particularly suitable methods include calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid- mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection (see Sambrook et al, 1989 [supra]; Ausubel et al, 1991 [supra]; Spector, Goldman & Leinwald, 1998). In eukaryotic cells, expression systems may either be transient (for example, episomal) or permanent (chromosomal integration) according to the needs ofthe system.
- the encoding nucleic acid molecule may or may not include a sequence encoding a control sequence, such as a signal peptide or leader sequence, as desired, for example, for secretion ofthe translated polypeptide into the lumen ofthe endoplasmic reticulum, into the periplasmic space or into the extracellular environment.
- control sequence such as a signal peptide or leader sequence
- These signals may be endogenous to the polypeptide or they may be heterologous signals.
- Leader sequences can be removed by the bacterial host in post-translational processing.
- regulatory sequences are those which cause the expression of a gene to be increased or decreased in response to a chemical or physical stimulus, including the presence of a regulatory compound or to various temperature or metabolic conditions.
- Regulatory sequences are those non-translated regions of the vector, such as enhancers, promoters and 5* and 3' untranslated regions. These interact with host cellular proteins to carry out transcription and translation.
- Such regulatory sequences may vary in their strength and specificity.
- any number of suitable transcription and translation elements including constitutive and inducible promoters, may be used.
- inducible promoters such as the hybrid lacZ promoter of the Bluescript phagemid (Stratagene, LaJolla, CA) or pSportlTM plasmid (Gibco BRL) and the like may be used.
- the baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (for example, heat shock, RUBISCO and storage protein genes) or from plant viruses (for example, viral promoters or leader sequences) may be cloned into the vector, ⁇ n mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable.
- vectors based on SV40 or EBV may be used with an appropriate selectable marker.
- An expression vector is constructed so that the particular nucleic acid coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the regulatory sequences being such that the coding sequence is transcribed under the "control" of the regulatory sequences, i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence.
- control i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence.
- control sequences and other regulatory sequences may be ligated to the nucleic acid coding sequence prior to insertion into a vector.
- the coding sequence can be cloned directly into an expression vector that already contains the control sequences and an appropriate restriction site.
- cell lines which stably express the polypeptide of interest may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells that successfully express the introduced sequences.
- Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.
- Mammalian cell lines available as hosts for expression are known in the art and include many immortalised cell lines available from the American Type Culture Collection (ATCC) including, but not limited to, Chinese hamster ovary (CHO), HeLa, baby hamster kidney (BHK), monkey kidney (COS), C127, 3T3, BHK, HEK 293, Bowes melanoma and human hepatocellular carcinoma (for example Hep G2) cells and a number of other cell lines.
- ATCC American Type Culture Collection
- the materials for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA (the "MaxBac” kit). These techniques are generally known to those skilled in the art and are described fully in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Particularly suitable host cells for use in this system include insect cells such as Drosophila S2 and Spodoptera Sf9 cells.
- all plants from which protoplasts can be isolated and cultured to give whole regenerated plants can be utilised, so that whole plants are recovered which contain the transferred gene.
- Practically all plants can be regenerated from cultured cells or tissues, including but not limited to all major species of sugar cane, sugar beet, cotton, fruit and other trees, legumes and vegetables.
- Examples of particularly preferred bacterial host cells include streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells.
- yeast cells for example, S. cerevisiae
- Aspergillus cells examples include yeast cells (for example, S. cerevisiae) and Aspergillus cells.
- any number of selection systems are known in the art that may be used to recover transformed cell lines. Examples include the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al (1980) Cell 22:817-23) genes that can be employed in tk- or aprt ⁇ cells, respectively.
- antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dihydrofolate reductase (DHFR) that confers resistance to methofrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14) and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetylfransferase, respectively. Additional selectable genes have been described, examples of which will be clear to those of skill in the art.
- marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed.
- a marker gene can be placed in tandem with a sequence encoding a polypeptide of the invention under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression ofthe tandem gene as well.
- host cells that contain a nucleic acid sequence encoding a polypeptide of the invention and which express said polypeptide may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassays, for example, fluorescence activated cell sorting (FACS) or immunoassay techniques (such as the enzyme-linked immunosorbent assay [ELISA] and radioimmunoassay [RIA]), that include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or protein (see Hampton, R. et al (1990) Serological Methods, a Laboratory Manual, APS Press, St Paul, MN) and Maddox, D.E. et al. (1983) J. Exp. Med, 158, 1211-1216).
- FACS fluorescence activated cell sorting
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- Means for producing labelled hybridization or PCR probes for detecting sequences related to nucleic acid molecules encoding polypeptides of the present invention include oligolabelling, nick translation, end-labelling or PCR amplification using a labelled polynucleotide.
- sequences encoding the polypeptide of the invention may be cloned into a vector for the production of an mRNA probe.
- RNA polymerase such as T7, T3 or SP6 and labelled nucleotides. These procedures may be conducted using a variety of commercially available kits (Pharmacia & Upjohn, (Kalamazoo, MI); Promega (Madison WI); and U.S. Biochemical Corp., Cleveland, OH)).
- Suitable reporter molecules or labels include radionuclides, enzymes and fluorescent, chemiluminescent or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Nucleic acid molecules according to the present invention may also be used to create transgenic animals, particularly rodent ⁇ inimals. Such fransgenic animals form a further aspect of the present invention. This may be done locally by modification of somatic cells, or by germ line therapy to incorporate heritable modifications. Such transgenic animals may be particularly useful in the generation of animal models for drug molecules effective as modulators ofthe polypeptides ofthe present invention.
- the polypeptide can be recovered and purified from recombinant cell cultures by well- known methods including ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. High performance liquid chromatography is particularly useful for purification. Well known techniques for refolding proteins may be employed to regenerate an active conformation when the polypeptide is denatured during isolation and or purification.
- Specialised vector constructions may also be used to facilitate purification of proteins, as desired, by joining sequences encoding the polypeptides of the invention to a nucleotide sequence encoding a polypeptide domain that will facilitate purification of soluble proteins.
- purification-facilitating domains include metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilised metals, protein A domains that allow purification on immobilised immunoglobulin, and the domain utilised in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, WA).
- cleavable linker sequences such as those specific for Factor XA or enterokinase (Invifrogen, San Diego, CA) between the purification domain and the polypeptide of the invention may be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing the polypeptide of the invention fused to several histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilised metal ion affinity chromatography as described in Porath, J. et al. (1992) Prot. Exp. Purif.
- the functional effects for the nuclear hormone receptor gene family are typically modified by ligands, either with transcription being upregulated or downregulated by addition of a ligand.
- ligands may either be therapeutic agents themselves, or form the basis for novel therapeutic agents.
- the set of ligands that known nuclear hormone receptor ligand binding domains interact with include, but are not limited by, steroid, fatty acid, vitamins, and similar molecules. Modulation of the transcriptional activity of nuclear hormone receptors by such ligand is thus indicative of their functional activity.
- the polypeptide ofthe invention can be used to screen libraries of compounds in any of a variety of drug screening techniques. Such compounds may activate (agonise) or inhibit (antagonise) the level of expression of the gene or the activity of the polypeptide of the invention and form a further aspect of the present invention. Preferred compounds are effective to alter the expression of a natural gene which encodes a polypeptide ofthe first aspect ofthe invention or to regulate the activity of a polypeptide ofthe first aspect ofthe invention.
- Agonist or antagonist compounds may be isolated from, for example, cells, cell-free preparations, chemical libraries or natural product mixtures. These agonists or antagonists may be natural or modified substrates, ligands, enzymes, receptors or structural or functional mimetics. For a suitable review of such screening techniques, see Coligan et al., Current Protocols in Immunology l(2):Chapter 5 (1991).
- Compounds that are most likely to be good antagonists are molecules that bind to the polypeptide of the invention without inducing the biological effects of the polypeptide upon binding to it.
- Potential agonists and/or antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to the polypeptide of the invention and thereby activate, inhibit or extinguish its activity, h particular, steroid-based compounds, such as spironolactone, have been demonstrated herein to activate with high affinity the polypeptides of the invention. In this fashion, binding of the polypeptide to normal cellular binding molecules may be modulated, such that the normal biological activity of the polypeptide is enhanced, or decreased for therapeutic utility.
- the polypeptide of the invention that is employed in such a screening technique may be free in solution, affixed to a solid support, borne on a cell surface or located intracellularly.
- screening procedures may involve using appropriate cells or cell membranes that express the polypeptide that are contacted with a test compound to observe binding, or stimulation or inhibition of a functional response.
- the functional response of the cells contacted with the test compound is then compared with control cells that were not contacted with the test compound.
- Such an assay may assess whether the test compound results in a signal generated by activation of the polypeptide, using an appropriate detection system.
- Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist in the presence of the test compound is observed.
- a preferred method for identifying an agonist or antagonist compound of a polypeptide ofthe present invention comprises:
- a particular example is cotransfecting a construct expressing a polypeptide according to the invention, or a fragment such as the LBD, in fusion with the GAL4 DNA binding domain, into a cell together with a reporter plasmid, an example of which is pFR-Luc (Stratagene Europe, Amsterdam, The Netherlands).
- This particular plasmid contains a synthetic promoter with five tandem repeats of GAL4 binding sites that confrol the expression ofthe luciferase gene. When a potential ligand is added to the cells, it will bind the GAL4-polypeptide fusion and induce transcription of the luciferase gene.
- the level ofthe luciferase expression can be monitored by its activity using a luminescence reader (see, for example, Lehman et al JBC 270, 12953, 1995; Pawar et al JBC, 277, 39243, 2002).
- a further preferred method for identifying an agonist or antagonist of a polypeptide ofthe invention comprises:
- a method such as FRET detection of ligand bound to the polypeptide in the presence of peptide co-activators might be used.
- the general methods that are described above may further comprise conducting the identification of agonist or antagonist in the presence of labelled or unlabelled ligand for the polypeptide.
- the method for identifying agonist or antagonist of a polypeptide ofthe present invention comprises: determining the inhibition of binding of a ligand to the polypeptide of the invention on any solid or cellular surface thereof, in the presence of a candidate compound under conditions to permit binding to the polypeptide, and determining the amount of ligand bound to the polypeptide.
- a compound capable of causing reduction of binding of a ligand is considered to be a competitor which may act as an agonist or antagonist.
- the ligand is labelled.
- a method of screening for a polypeptide antagonist or agonist compound comprises the steps of:
- step (b) measuring the amount of labelled ligand bound to the polypeptide on the solid support, whole cell or the cell membrane; (c) adding a candidate compound to a mixture of labelled ligand and immobilized polypeptide on the solid support, the whole cell or the cell membrane of step (a) and allowing the mixture to attain equilibrium;
- step (d) measuring the amount of labelled ligand bound to the immobilized polypeptide or the whole cell or the cell membrane after step (c);
- step (e) comparing the difference in the labelled ligand bound in step (b) and (d), such that the compound which causes a change in binding in step (d) is considered to be an agonist or antagonist, respectively.
- polypeptides may be found to modulate a variety of physiological and pathological processes in a dose-dependent manner in the above-described assays.
- the "functional equivalents" of the polypeptides of the invention include polypeptides that exhibit any of the same modulatory activities in the above-described assays in a dose- dependent manner.
- the degree of dose-dependent activity need not be identical to that of the polypeptides of the invention, preferably the "functional equivalents" will exhibit substantially similar dose-dependence in a given activity assay compared to the polypeptides ofthe invention.
- simple binding assays may be used, in which the adherence of a test compound to a surface bearing the polypeptide is detected by means of a label directly or indirectly associated with the test compound or in an assay involving competition with a labelled competitor, ⁇ n another embodiment, competitive drug screening assays may be used, in which neutralising antibodies that are capable of binding the polypeptide specifically compete with a test compound for binding. In this manner, the antibodies can be used to detect the presence of any test compound that possesses specific binding affinity for the polypeptide. Assays may also be designed to detect the effect of added test compounds on the production of mRNA encoding the polypeptide in cells.
- an ELISA may be constructed that measures secreted or cell-associated levels of polypeptide using monoclonal or polyclonal antibodies by standard methods known in the art, and this can be used to search for compounds that may inhibit or enhance the production of the polypeptide from suitably manipulated cells or tissues. The formation of binding complexes between the polypeptide and the compound being tested may then be measured.
- Assay methods that are also included within the terms of the present invention are those that involve the use of the genes and polypeptides of the invention in overexpression or ablation assays. Such assays involve the manipulation of levels of these genes/polypeptides in cells and assessment of the impact of this manipulation event on the physiology ofthe manipulated cells. For example, such experiments reveal details of signalling and metabolic pathways in which the particular genes/polypeptides are implicated, generate information regarding the identities of polypeptides with which the studied polypeptides interact and provide clues as to methods by which related genes and proteins are regulated.
- Another technique for drug screening provides for high throughput screening of compounds having suitable binding affinity to the polypeptide of interest (see International patent application WO84/03564).
- This method large numbers of different small test compounds are synthesised on a solid substrate, which may then be reacted with the polypeptide of the invention and washed.
- One way of immobilising the polypeptide is to use non-neutralising antibodies.
- Bound polypeptide may then be detected using methods that are well known in the art.
- Purified polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques. Examples of suitable assays for the identification of agonists or antagonists of the polypeptides of the invention are described in Rosen et al, Curr. Opin. Drug Discov. Devel. 2003 6(2):224-30.
- the polypeptide of the invention may be used to identify membrane-bound or soluble receptors, through standard receptor binding techniques that are known in the art, such as ligand binding and crosslinking assays in which the polypeptide is labelled with a radioactive isotope, is chemically modified, or is fused to a peptide sequence that facilitates its detection or purification, and incubated with a source of the putative receptor (for example, a composition of cells, cell membranes, cell supernatants, tissue extracts, or bodily fluids).
- a source of the putative receptor for example, a composition of cells, cell membranes, cell supernatants, tissue extracts, or bodily fluids.
- the efficacy of binding may be measured using biophysical techniques such as surface plasmon resonance (supplied by Biacore AB, Uppsala, Sweden) and spectroscopy. Using such assays, it will be possible to investigate the degree to which polypeptides of the invention dimerise or oligomerise with other poly
- Binding assays may be used for the purification and cloning ofthe receptor, but may also identify agonists and antagonists ofthe polypeptide, that compete with the binding of the polypeptide to its receptor. Standard methods for conducting screening assays are well understood in the art.
- the invention also includes a screening kit useful in the methods for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, that are described above.
- the invention includes the agonists, antagonists, ligands, receptors, substrates and enzymes, and other compounds which modulate the activity or antigenicity of the polypeptide ofthe invention discovered by the methods that are described above.
- compositions comprising a polypeptide, nucleic acid, ligand or compound of the invention in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier may be suitable as therapeutic or diagnostic reagents, as vaccines, or as other immunogenic compositions, as outlined in detail below.
- a composition containing a polypeptide, nucleic acid, ligand or compound [X] is "substantially free of impurities [herein, Y] when at least 85% by weight of the total X+Y in the composition is X.
- X comprises at least about 90% by weight of the total of X+Y in the composition, more preferably at least about 95%, 98% or even 99% by weight.
- compositions should preferably comprise a therapeutically effective amount ofthe polypeptide, nucleic acid molecule, ligand, or compound ofthe invention.
- therapeutically effective amount refers to an amount of a therapeutic agent needed to treat, ameliorate, or prevent a targeted disease or condition, or to exhibit a detectable therapeutic or preventative effect.
- the therapeutically effective dose can be estimated initially either in cell culture assays, for example, of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- an effective amount for a human subject will depend upon the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. This amount can be determined by routine experimentation and is within the judgement of the clinician. Generally, an effective dose will be from 0.01 mg/kg to 50 mg/kg, preferably 0.05 mg/kg to 10 mg/kg. Compositions may be admimstered individually to a patient or may be administered in combination with other agents, drugs or hormones.
- a pharmaceutical composition may also contain a pharmaceutically acceptable carrier, for administration of a therapeutic agent.
- a pharmaceutically acceptable carrier for administration of a therapeutic agent.
- Such carriers include antibodies and other polypeptides, genes and other therapeutic agents such as liposomes, provided that the carrier does not itself induce the production of antibodies harmful to the individual receiving the composition, and which may be administered without undue toxicity.
- Suitable carriers may be large, slowly metabolised macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles.
- Pharmaceutically acceptable salts can be used therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulphates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulphates, and the like
- organic acids such as acetates, propionates, malonates, benzoates, and the like.
- compositions of therapeutic compositions may additionally contain liquids such as water, saline, glycerol and ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such compositions. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient. Once formulated, the compositions of the invention can be administered directly to the subject.
- the subjects to be treated can be animals; in particular, human subjects can be treated.
- compositions utilised in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, infra- arterial, intrameduUary, intrathecal, intraventricular, transdermal or transcutaneous applications (for example, see WO98/20734), subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, intravaginal or rectal means.
- Gene guns or hyposprays may also be used to administer the pharmaceutical compositions of the invention.
- the therapeutic compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
- Direct delivery of the compositions will generally be accomplished by injection, subcutaneously, intraperitoneally, intravenously or intramuscularly, or delivered to the interstitial space of a tissue.
- the compositions can also be administered into a lesion. Dosage treatment may be a single dose schedule or a multiple dose schedule.
- the activity ofthe polypeptide ofthe invention is in excess in a particular disease state
- a pharmaceutically acceptable carrier in an amount effective to inhibit the function of the polypeptide, such as by blocking the binding of ligands, substrates, enzymes, receptors, or by inhibiting a second signal, and thereby alleviating the abnormal condition.
- antagonists are antibodies.
- such antibodies are chimeric and/or humanised to minimise their immunogenicity, as described previously.
- soluble forms of the polypeptide that retain binding affinity for the ligand, substrate, enzyme, receptor, in question may be administered.
- the polypeptide may be administered in the form of fragments that retain the relevant portions.
- expression of the gene encoding the polypeptide can be inhibited using expression blocking techniques, such as the use of antisense nucleic acid molecules (as described above), either internally generated or separately administered.
- Modifications of gene expression can be obtained by designing complementary sequences or antisense molecules (DNA, RNA, or PNA) to the control, 5' or regulatory regions (signal sequence, promoters, enhancers and introns) of the gene encoding the polypeptide.
- inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules.
- the complementary sequence or antisense molecule may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Such oligonucleotides may be administered or may be generated in situ from expression in vivo.
- Ribozymes are catalytically active RNAs that can be natural or synthetic (see for example Usman, N, et al, Curr. Opin. Struct. Biol (1996) 6(4), 527-33). Synthetic ribozymes can be designed to specifically cleave mRNAs at selected positions thereby preventing translation of the mRNAs into functional polypeptide. Ribozymes may be synthesised with a natural ribose phosphate backbone and natural bases, as normally found in RNA molecules. Alternatively the ribozymes may be synthesised with non-natural backbones, for example, 2'-O-methyl RNA, to provide protection from ribonuclease degradation and may contain modified bases.
- RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone ofthe molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of non-traditional bases such as inosine, queosine and butosine, as well as acetyl-, methyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine and uridine which are not as easily recognised by endogenous endonucleases.
- One approach comprises administering to a subject a therapeutically effective amount of a compound that activates the polypeptide, i.e., an agonist as described above, to alleviate the abnormal condition.
- a therapeutic amount of the polypeptide in combination with a suitable pharmaceutical carrier may be administered to restore the relevant physiological balance of polypeptide.
- Gene therapy may be employed to effect the endogenous production of the polypeptide by the relevant cells in the subject. Gene therapy is used to treat permanently the inappropriate production of the polypeptide by replacing a defective gene with a corrected therapeutic gene.
- Gene therapy ofthe present invention can occur in vivo or ex vivo.
- Ex vivo gene therapy requires the isolation and purification of patient cells, the introduction of a therapeutic gene and introduction ofthe genetically altered cells back into the patient.
- in vivo gene therapy does not require isolation and purification of a patient's cells.
- the therapeutic gene is typically "packaged" for administration to a patient.
- Gene delivery vehicles may be non-viral, such as liposomes, or replication-deficient viruses, such as adenovirus as described by Berkner, K.L., in Curr. Top. Microbiol. Immunol., 158, 39-66 (1992) or adeno-associated virus (AAV) vectors as described by Muzyczka, N., in Curr. Top. Microbiol. Immunol., 158, 97-129 (1992) and U.S. Patent No. 5,252,479.
- a nucleic acid molecule encoding a polypeptide ofthe invention may be engineered for expression in a replication-defective retroviral vector.
- This expression construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding the polypeptide, such that the packaging cell now produces infectious viral particles containing the gene of interest.
- These producer cells may be administered to a subject for engineering cells in vivo and expression ofthe polypeptide in vivo (see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics (1996), T Strachan and A P Read, BIOS Scientific Publishers Ltd).
- Another approach is the administration of "naked DNA" in which the therapeutic gene is directly injected into the bloodstream or muscle tissue.
- the invention provides that they can be used in vaccines to raise antibodies against the disease causing agent.
- Vaccines according to the invention may either be prophylactic (ie. to prevent infection) or therapeutic (ie. to treat disease after infection).
- Such vaccines comprise immunising antigen(s), immunogen(s), polypeptide(s), protein(s) or nucleic acid, usually in combination with pharmaceutically-acceptable carriers as described above, which include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Additionally, these carriers may function as immunostimulating agents ("adjuvants").
- the antigen or immunogen may be conjugated to a bacterial toxoid, such as a toxoid from diphtheria, tetanus, cholera, H. pylori, and other pathogens.
- vaccines comprising polypeptides are preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection).
- parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood ofthe recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.
- the vaccine formulations of the invention may be presented in unit-dose or multi-dose containers.
- sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition ofthe sterile liquid carrier immediately prior to use.
- the dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
- nucleic acid molecules according to the present invention as diagnostic reagents. Detection of a mutated form of the gene characterised by the nucleic acid molecules ofthe invention which is associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, which results from under-expression, over-expression or altered spatial or temporal expression of the gene. Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques.
- Nucleic acid molecules for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material.
- the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR, ligase chain reaction (LCR), strand displacement amplification (SDA), or other amplification techniques (see Saiki et al, Nature, 324, 163-166 (1986); Bej, et al, Crit. Rev. Biochem. Molec. Biol., 26, 301-334 (1991); Birkenmeyer et al., J. Virol. Meth., 35, 117-126 (1991); Van Brunt, J., Bio/Technology, 8, 291-294 (1990)) prior to analysis.
- LCR ligase chain reaction
- SDA strand displacement amplification
- this aspect of the invention provides a method of diagnosing a disease in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide according to the invention and comparing said level of expression to a control level, wherein a level that is different to said confrol level is indicative of disease.
- the method may comprise the steps of: a) contacting a sample of tissue from the patient with a nucleic acid probe under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule ofthe invention and the probe; b) contacting a control sample with said probe under the same conditions used in step a); c) and detecting the presence of hybrid complexes in said samples; wherein detection of levels of the hybrid complex in the patient sample that differ from -
- levels ofthe hybrid complex in the control sample is indicative of disease.
- gene transcript levels that encode polypeptides according to the invention are elevated in both benign and malignant tumours of the gastrointestinal tract.
- a ten fold increase in expression was observed in benign adenomas of the duodenum and colon, malignant mucinous adenocarcinoma of the colon and malignant adenocarcinoma of the colon.
- a 5-8 fold increase in expression was observed in adenocarcinoma of the rectum and a 5 fold increase in adenocarcinoma of the pancreas.
- a 2-4 fold increase in expression was observed in adenocarcinoma of the oesophagus and the stomach and signet ring cell carcinoma of the stomach.
- transcript levels were elevated 8 fold in giant cell carcinoma of the bone, 2-4 fold in mucinous adenocarcinoma ofthe breast, squamous carcinoma ofthe larynx, adenocarcinoma of the lung, adenocarcinoma of the cervix, serous cyst adenocarcinoma of the ovary and adenocarcinoma of the ovary.
- a 6-fold increase in expression was observed in inflammatory bowel disease, a 2-fold increase in expression was observed in chronic obstructive pulmonary disease (COPD) and a 3 -fold increase in expression was seen in Conn's tumour ofthe adrenal cortex.
- COPD chronic obstructive pulmonary disease
- a further aspect ofthe invention comprises a diagnostic method comprising the steps of: a) obtaining a tissue sample from a patient being tested for disease; b) isolating a nucleic acid molecule according to the invention from said tissue sample; and c) diagnosing the patient for disease by detecting the presence of a mutation in the nucleic acid molecule which is associated with disease.
- an amplification step for example using PCR, may be included.
- Suitable probes are discussed in some detail above.
- Deletions and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype.
- Point mutations can be identified by hybridizing amplified DNA to labelled RNA ofthe invention or alternatively, labelled antisense DNA sequences of the invention. Perfectly-matched sequences can be distinguished from mismatched duplexes by RNase digestion or by assessing differences in melting temperatures.
- the presence or absence of the mutation in the patient may be detected by contacting DNA with a nucleic acid probe that hybridises to the DNA under stringent conditions to form a hybrid double-stranded molecule, the hybrid double-stranded molecule having an unhybridised portion of the nucleic acid probe strand at any portion corresponding to a mutation associated with disease; and detecting the presence or absence of an unhybridised portion ofthe probe strand as an indication ofthe presence or absence of a disease-associated mutation in the corresponding portion ofthe DNA strand.
- Point mutations and other sequence differences between the reference gene and "mutant" genes can be identified by other well-known techniques, such as direct DNA sequencing or single-strand conformational polymorphism, (see Orita et al, Genomics, 5, 874-879 (1989)).
- a sequencing primer may be used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
- the sequence determination is performed by conventional procedures with radiolabelled nucleotides or by automatic sequencing procedures with fluorescent-tags.
- Cloned DNA segments may also be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR.
- point mutations and other sequence variations, such as polymorphisms can be detected as described above, for example, through the use of allele-specific oligonucleotides for PCR amplification of sequences that differ by single nucleotides.
- DNA sequence differences may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (for example, Myers et al, Science (1985) 230:1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (see Cotton et al., Proc. Natl. Acad. Sci. USA (1985) 85: 4397-4401).
- FISH Fluorescence in situ hybridization
- an array of oligonucleotide probes comprising a nucleic acid molecule according to the invention can be constructed to conduct efficient screening of genetic variants, mutations and polymorphisms.
- Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see for example: M.Chee et al, Science (1996) 274: 610-613).
- the array is prepared and used according to the methods described in PCT application WO95/11995 (Chee et al); Lockhart, D. J. et al. (1996) Nat. Biotech. 14: 1675-1680); and Schena, M. et al. (1996) Proc. Natl. Acad. Sci. 93: 10614-10619).
- Oligonucleotide pairs may range from two to over one million.
- the oligomers are synthesized at designated areas on a substrate using a light-directed chemical process.
- the substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support.
- an oligonucleotide may be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/25116 (Baldeschweiler et al).
- a "gridded" array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures.
- An array such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536 or 6144 oligonucleotides, or any other number between two and over one million which lends itself to the efficient use of commercially-available instrumentation.
- diseases may be diagnosed by methods comprising determimng, from a sample derived from a subject, an abnormally decreased or increased level of polypeptide or mRNA.
- Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
- Assay techniques that can be used to determine levels of a polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and are discussed in some detail above (including radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays).
- This aspect ofthe invention provides a diagnostic method which comprises the steps of: (a) contacting a ligand as described above with a biological sample under conditions suitable for the formation of a ligand- polypeptide complex; and (b) detecting said complex.
- Protocols such as ELISA, RIA, and FACS for measuring polypeptide levels may additionally provide a basis for diagnosing altered or abnormal levels of polypeptide expression.
- Normal or standard values for polypeptide expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably humans, with antibody to the polypeptide under conditions suitable for complex formation The amount of standard complex formation may be quantified by various methods, such as by photometric means.
- Antibodies which specifically bind to a polypeptide ofthe invention may be used for the diagnosis of conditions or diseases characterised by expression of the polypeptide, or in assays to monitor patients being treated with the polypeptides, nucleic acid molecules, ligands and other compounds ofthe invention.
- Antibodies useful for diagnostic purposes may be prepared in the same manner as those described above for therapeutics. Diagnostic assays for the polypeptide include methods that utilise the antibody and a label to detect the polypeptide in human body fluids or extracts of cells or tissues.
- the antibodies may be used with or without modification, and may be labelled by joining them, either covalently or non-covalently, with a reporter molecule.
- reporter molecules A wide variety of reporter molecules known in the art may be used, several of which are described above. Quantities of polypeptide expressed in subject, control and disease samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
- Diagnostic assays may be used to distinguish between absence, presence, and excess expression of polypeptide and to monitor regulation of polypeptide levels during therapeutic intervention. Such assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials or in monitoring the treatment of an individual patient.
- a diagnostic kit ofthe present invention may comprise:
- a diagnostic kit may comprise a first container containing a nucleic acid probe that hybridises under stringent conditions with a nucleic acid molecule according to the invention; a second container containing primers useful for amplifying the nucleic acid molecule; and instructions for using the probe and primers for facilitating the diagnosis of disease.
- the kit may further comprise a third container holding an agent for digesting unhybridised RNA.
- a diagnostic kit may comprise an array of nucleic acid molecules, at least one of which may be a nucleic acid molecule according to the invention.
- a diagnostic kit may comprise one or more antibodies that bind to a polypeptide according to the invention; and a reagent useful for the detection of a binding reaction between the antibody and the polypeptide.
- kits will be of use in diagnosing a disease or susceptibility to diseases in which Nuclear Hormone Receptors are implicated, particularly cell proliferative disorders, including neoplasm, melanoma, lung, colorectal, breast, uterus, prostate, pancreas, head and neck and other solid tumours, Conn's tumour of the adrenal cortex, glioblastoma, meningioma, giant cell tumour of bone, myeloproliferative disorders, such as leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia, angiogenesis disorder, Kaposis' sarcoma, auto mnune/inflammatory disorders, including allergy, inflammatory bowel disease, arthritis, psoriasis and respiratory tract inflammation, asthma, and organ transplant rejection, cardiovascular disorders, including hypertension, hypotension, oedema, angina, atherosclerosis, thrombosis, sepsis, shock, reperfusion injury, heart arrhythmia,
- the disease is proliferative in nature such as inflammation or cancer, particularly carcinomas.
- the disease is a tumour, such as carcinoma; benign and malignant tumours of the gastrointestinal tract, including benign adenomas of the duodenum and colon, malignant mucinous adenocarcinoma of the colon and malignant adenocarcinoma of the colon, adenocarcinoma of the rectum, adenocarcinoma of the pancreas, adenocarcinoma ofthe oesophagus and the stomach and signet ring cell carcinoma ofthe stomach; also giant cell carcinoma of the bone, mucinous adenocarcinoma of the breast, squamous carcinoma of the larynx, adenocarcinoma of the lung, adenocarcinoma of the cervix, serous cyst adenocarcinoma of the ovary, adenocarcinoma of the ovary, inflammatory bowel disease, chronic obstructive pulmonary disease and Conn's tumour ofthe adrenal
- Figure 1 Front page ofthe BiopendiumTM. Search initiated using 1LBD.
- Figure 2 A Inpharmatica Genome ThreaderTM results of search using 1LBD.
- the arrow points to 150514, the Danio rerio (Zebrafish) Retinoid X Receptor, a typical Nuclear Hormone Receptor Ligand Binding Domain family member.
- Figure 2B Inpharmatica Genome ThreaderTM results of search using 1LBD.
- the arrow points to the hCP43593.1 (NHR8) protein.
- Figure 2C Inpharmatica PSI-Blast results from search using 1LBD.
- the arrow points to PI 9793, the Human Retinoid X Receptor alpha, a typical Nuclear Hormone Receptor Ligand Binding Domain family member.
- Figure 2D Inpharmatica PSI-Blast results of search using 1LBD.
- the arrow points to the hCP43593.1 (NHR8) protein.
- Figure 3 InterPro search results for hCP43593.1 (NHR8).
- Figure 4A NCBI Conserved Domain Database search results for hCP43593.1 (NHR8).
- Figure 5A NCBI protein report for BAA86513.1, a public domain sequence which is equivalent to hCP43593.1 (NHR8).
- Figure 5B Graphical view of NCBI PSI-Blast (10 iterations) results for hCP43593.1 (NHR8).
- Figure 5C List of NCBI PSI-Blast (10 iterations) results for hCP43593.1 (NHR8).
- Figure 6A Inpharmatica Genome ThreaderTM results of search using hCP43593.1 (NHR8) as the query sequence. The arrow points to 1LBD, the structure of the Human RXRalpha Ligand Binding Domain.
- Figure 6B Inpharmatica PSI-Blast results from search using hCP43593.1 (NHR8) as the query sequence.
- the arrow points to A56558 The Xenopus Retinoic Acid alpha Receptor, a known member ofthe Nuclear Hormone Receptor Ligand Binding Domain family.
- Figure 6C Inpharmatica PSI-Blast results of search using hCP43593.1 (NHR8) as the query sequence.
- the arrow points to 1LBD, the Human RXRalpha Ligand Binding Domain.
- Figure 6D Genome ThreaderTM alignment of hCP43593.1 (NHR8) and 1LBD.
- Figure 7A Inpharmatica PSI-Blast results of search using hCP43593.1 (NHR8) as the query sequence.
- the arrow points to 1DSZ:A, the Human Retinoic Acid Receptor alpha DNA Binding Domain.
- Figure 7B Inpharmatica PSI-Blast alignment of hCP43593.1 (NHR8) and 1DSZ:A.
- Figure 8A Inpharmatica Genome ThreaderTM results of search using hCP43593.1 (NHR8) as the query sequence.
- the arrow points to 1 G2F:C, the structure ofthe C2H2 Zinc Finger.
- Figure 8B Inpharmatica PSI-Blast results from search using hCP43593.1 (NHR8) as the query sequence.
- the arrow points to 1G2F:C, the structure ofthe C2H2 Zinc Finger.
- Figure 8C Genome ThreaderTM alignment of hCP43593.1 (NHR8) and 1G2F:C, the structure ofthe C2H2 Zinc Finger.
- Figure 9 Dose response curve for one representative NHR8 agonist (spironolactone) identified in the GAL4 cellular assay.
- Figure 10 Normalised expression of NHR8 in 18 normal human tissues.
- Figure 11 Normalised expression of NHR8 in 17 cell line samples.
- Figure 12 Effect of dibutryl cAMP addition upon NHR8 expression in certain cell lines.
- Figure 13 Normalised expression of NHR8 in 10 cell line samples.
- Figure 14 Normalised expression of NHR8 in 20 disease and clinically matched normal samples.
- Figure 15 Expression profiling using Af ymetrix U133 microarrays for NHR8.
- Figure 16 NHR8 Gene Expression in Normal Tissues (Probe set 212942_s_at).
- Example 1 Annotation of hCP43593.1 (NHR8 Nuclear Hormone Receptor Function
- the structure chosen is Human RXRalpha Ligand Binding Domain, PDB code 1LBD ( Figure 1).
- a search ofthe BiopendiumTM for homologues of 1LBD takes place and returns 4146 Inpharmatica Genome ThreaderTM results (selection given in Figure 2 A and 2B) and 1250 Inpharmatica PSI-Blast results (selection in Figure 2C and 2D).
- the 4146 Genome ThreaderTM results include examples of other Nuclear Hormone Receptor Ligand Binding Domain family members, such as 150514, the Danio rerio (Zebrafish) Retinoid X Receptor ( Figure 2A, arrow).
- hCP43593.1 NHR8, Figure 2B, arrow
- the Inpharmatica Genome ThreaderTM has identified residues 496-712 of a sequence, hCP43593.1 (NHR8), as having an equivalent structure to residues 34-237 of Human RXRalpha Ligand Binding Domain (PDB code: 1LBD). Note that due to a different numbering scheme residues 496-712 of hCP43593.1 (NHR8) appear as 539-755 in Figure 2B. Having a structure equivalent to 1LBD suggests that hCP43593.1 (NHR8) is a protein that functions as a Nuclear Hormone Receptor. The Inpharmatica Genome ThreaderTM identifies this with 100% confidence.
- the 1250 Inpharmatica PSI-Blast results include examples of known Nuclear Hormone Receptor Ligand Binding Domains, such as PI 9793, the Human Retinoid X Receptor alpha ( Figure 2C, arrow). Forward iterations of Inpharmatica PSI-Blast are unable to identify the relationship between 1LBD and hCP43593.1 (NHR8). It is only in negative iterations that friphaimatica PSI-Blast can identify Human RXRalpha Ligand Binding Domain (PDB code: 1LBD) as having a sequence relationship to residues 487-713 of hCP43593.1 (NHR8) (appears as residues 530- 756 in Figure 2D).
- PDB code 1LBD
- ⁇ nterPro returns zero hits (no matches) to hCP43593.1 (NHR8). Returning zero hits means that ⁇ nterPro does not identify any region of hCP43593.1 (NHR8) as containing either a Nuclear Hormone Receptor Ligand Binding Domain, or a Nuclear Hormone Receptor DNA Binding Domain. Thus hCP43593.1 (NHR8) is unidentifiable as a Nuclear Hormone Receptor family member using hiterPro.
- CDD NCBI conserveed Domain Database
- NHR8 Figure 4A
- CDD returns zero hits to hCP43593.1 (NHR8).
- Returning zero hits means that CDD does not identify any region of hCP43593.1 (NHR8) as containing either a Nuclear Hormone Receptor Ligand Binding Domain, or a Nuclear Hormone Receptor DNA Binding Domain.
- Returning zero hits from CDD means that hCP43593.1 (NHR8) is unidentifiable as a Nuclear Hormone Receptor member using CDD.
- Celera PANTHER does not provide any annotation for hCP43593.1 (N ⁇ R8).
- Celera PANTHER does not annotate hCP43593.1 (NHR8) as containing a Nuclear Hormone Receptor Ligand Binding Domain, or a Nuclear Hormone Receptor DNA Binding Domain.
- Celera PANTHER does not annotate hCP43593.1 (NHR8) as a Nuclear Hormone Receptor.
- the sequence of hCP43593.1 (NHR8) is not unique to the Celera dataset of human predicted proteins.
- NCBI provides a public domain PSI-Blast server. Querying NCBI PSI-Blast with hCP43593.1 (NHR8) through 10 positive iterations fails to annotate any region of hCP43593.1 (NHR8) as having an obvious relationship to any known Nuclear Hormone Receptor Ligand Binding Domain or Nuclear Hormone Receptor DNA Binding Domain (note that (1) NCBI PSI-Blast has converged by iteration 10, and so further iterations would not return any more sequences and that (2) NCBI PSI-Blast cannot provide data on negative iterations because no all-by-all calculation is performed).
- Figure 5B shows the graphical display of NCBI PSI-Blast results for hCP43593.1 (NHR8).
- NCBI PSI-Blast does not annotate any region of hCP43593.1 (NHR8) as having an obvious relationship to any known Nuclear Hormone Receptor Ligand Binding Domain or to any known Nuclear Hormone Receptor DNA Binding Domain. There is no further annotation for hCP43593.1.
- the public domain information for this protein does not annotate it as containing either a Nuclear Hormone Receptor Ligand Binding Domain or a Nuclear Hormone Receptor DNA Binding Domain.
- the public domain does not annotate hCP43593.1 (NHR8) as a Nuclear Hormone Receptor.
- hCP43593.1 (NHR8) is now used as the query sequence in the BiopendiumTM.
- the Inpharmatica Genome ThreaderTM identifies 161 hits ( Figure 6A) while Inpharmatica PSI-Blast returns 14740 hits ( Figure 6B).
- the Inpharmatica Genome ThreaderTM ( Figure 6A, arrow) identifies residues 496-712 of hCP43593.1 (NHR8) as having a structure the same as Human RXRalpha Ligand Binding Domain (PDB code: ILBD) with 100% confidence. Note that due to a different numbering scheme, residues 496- 712 of hCP43593.1 (NHR8) appear as residues 539-755 in Figure 6A.
- Inpharmatica PSI-Blast also identifies the same region of hCP43593.1 (NHR8) as having a relationship with known Nuclear Hormone Receptor Ligand Binding Domains by the seventh positive iteration.
- Figure 6B shows a selection of Inpharmatica PSI- Blast results and it can be seen that the sequence A56558, The Xenopus Retinoic Acid Receptor alpha has a highly significant relationship to hCP43593.1 (NHR8), being found in the seventh positive iteration with an E- value of 9.0E "47 .
- residues 226-685 of hCP43593.1 are related to residues 6-421 of A56558,
- the Xenopus Retinoic Acid Receptor alpha Residues 226 - 685 includes almost all ofthe hCP43593.1 (NHR8) Nuclear Hormone Receptor Ligand Binding Domain region identified by Genome ThreaderTM (residues 496-712), and matches them to a region of A56558, The Xenopus Retinoic Acid Receptor alpha which contains a known Nuclear Hormone Receptor Ligand Binding Domain (residues 238-419, as determined by PFAM).
- Inpharmatica PSI-Blast is in strong agreement with Inpharmatica Genome ThreaderTM at annotating a region between residues 496 to 712 of hCP43593.1 (NHR8) as containing a Nuclear Hormone Receptor Ligand Binding Domain. This is in contrast to public domain NCBI PSI-Blast which fails to identify any obvious relationship between hCP43593.1 (NHR8) and known Nuclear Hormone Receptor Ligand Binding Domains ( Figures 5B and 5C). Only Inpharmatica Genome ThreaderTM and Inpharmatica PSI-Blast are able to identify hCP43593.1 (NHR8) as containing a Nuclear Hormone Receptor Ligand Binding Domain.
- Inpharmatica PSI-Blast also identifies a relationship between hCP43593.1 (NHR8) and the original query structure ILBD (Human RXRalpha Ligand Binding Domain), Figure 6C arrow.
- the relationship between hCP43593.1 (NHR8) and ILBD is found in the fourteenth positive iteration and has a significant E-value of 4.0E-33.
- This further consolidates the Genome Threader annotation of hCP43593.1 (NHR8) as containing a Nuclear Hormone Receptor Ligand Binding Domain.
- ILBD Human RXRalpha Ligand Binding Domain
- ILBD is chosen (highlighted) against which to view the sequence alignment of hCP43593.1 (theNHR8 polypeptide). Viewing the alignment ( Figure 6D) ofthe query protein against the protein identified as being of a similar structure helps to visualize the areas of homology.
- the reverse search that is querying the BiopendiumTM with hCP43593.1 (NHR8), also identifies (in addition to a Nuclear Hormone Receptor Ligand Binding Domain) a Nuclear Hormone Receptor DNA Binding Domain.
- Inpharmatica PSI-Blast Figure 7A, arrow
- residues 321-404 of hCP43593.1 (NHR8) as having a sequence-sequence relationship to the Human Retinoic Acid Receptor alpha DNA Binding Domain (PDB code: 1DSZ:A). Note that due to a different numbering scheme residues 321-404 of hCP43593.1 (NHR8) appear as residues 364-447 in Figure 7 A.
- the reverse search that is querying the BiopendiumTM with hCP43593.1 (NHR8), also identifies (in addition to a Nuclear Hormone Receptor Ligand Binding Domain and a Nuclear Hormone Receptor DNA Binding Domain) a C2H2 Zinc Finger.
- the Inpharmatica Genome ThreaderTM ( Figure 8 A, arrow) identifies residues 717-786 of hCP43593.1 (NHR8) as having a structure the same as C2H2 Zinc Finger (PDB code: 1G2F:C) with 100% confidence. Note that due to a different numbering scheme residues 717-786 of hCP43593.1 (NHR8) appear as residues 760-829 in Figure 8A.
- residues 717-786 of hCP43593.1 are related to residues 16-85 of C2H2 Zinc Finger (PDB code: 1G2F:C).
- residues 717-786 of hCP43593.1 appear as residues 760-829 in Figure 8B.
- Inpharmatica PSI-Blast is in complete agreement with Inpharmatica Genome ThreaderTM at annotating a region between residues 717 to 786 of hCP43593.1 (NHR8) as containing a C2H2 Zinc Finger.
- the I.M.A.G.E. Consortium ClonelD #215535 (“The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression” Lennon G, Auffray C, Polymeropoulos M, Soares MB. (1996) Genomics. 33(l):151-2) was used as the cDNA source for NHR8.
- NHR8 F and NHR8 R were used to amplify the proposed LBD encompassing amino acids 506-756 of NHR8 from human cDNA clone I.M.A.G.E. Consortium Clone ⁇ D #215535.
- additional flanking sequences are added to either side of the LBD domain as defined by Genome Threader.
- PCR was carried out using the DyNAzyme EXT DNA Polymerase (Finnzymes Oy, Espoo, Finland) in 2 mM MgCl 2 .
- the resulting PCR product was then cloned into the vector pGEMTEasy (Promega UK Ltd, Southampton, UK) and verified by sequence analysis.
- the cotransfection ofthe GAL4 construct and reporter constructs was carried out in the HEK 293 cell line. Subsequently, the assay was repeated in a different cell line in which the NHR8 endogenous expression was highest.
- the GAL4-LBD and the reporter construct were transiently transfected using the Fugene reagent (Roche) and conditions optimised for each cell line.
- Fugene reagent Fugene reagent
- FIG. 9 depicts the dose response curve of one representative NHR8 agonist identified in the GAL4 cellular assay.
- the NHR8 agonist depicted in Figure 9 is the steroid compound spironolactone. This representative compound was tested in duplicate at half —log dilutions and the EC50 was determined using GraphPad Prizm software. The NHR8 activator was identified as spironolactone and the calculated EC50 was 51.1 ⁇ M.
- NHR8 ligands will be of use in the characterisation of NHR8 function in vivo.
- NHR8 ligands will also be of use in the modulation of NHR8 function in vivo, and it is anticipated that they will be of use in the prophylaxis or therapy of diseases in which NHR8 is involved.
- Example 4 Identification of ligand binding domain agonists using an in vitro assay
- a critical step in NHR action is the ligand-dependent recruitment of transcriptional coactivators to target gene promoters. Specifically, it has been shown that agonist binding to the receptor induces a conformational change that permits the formation of a hydrophobic pocket enabling the receptor to interact with the LXXLL motif (where L is leucine and X any amino acid) contained in most coactivators. Building on this observation, an in vitro assay has been designed to screen for putative ligands that will bind the novel NHR in the presence of a peptide containing the LXXLL motif.
- Biotinylated peptides based on known coactivator sequences, and control peptides (for example a peptide which interacts specifically with ER ⁇ ) have been synthesized.
- control peptides for example a peptide which interacts specifically with ER ⁇
- SRC-1 based peptide SRC-1 based peptide
- TRF time resolved fluorescence
- Example 5 Identification of a DNA motif recognised by the DNA binding domain.
- the DNA Binding Domains (DBDs) of NHRs make specific base-specific contacts with the nucleotide bases in the DNA and are responsible for the sequence-specificity of DNA recognition.
- the NHR response elements contain similar motifs frequently arranged as direct or inverted repeats with a variable spacer.
- the specificity of NHRs DNA recognition motifs is further enhanced by the formation of homodimers or heterodimers with different partners (e.g. retinoic acid receptor, RXR).
- RXR retinoic acid receptor
- An in vitro assay was designed to identify rapidly the DNA binding motif recognized by NHR8, both as a homodimer or heterodimer. The assay is based on an ELISA method carried out in 96 well plates. This approach allows the screening of a large number of putative DNA response elements.
- Biotinylated oligonucleotides based on a number of binding elements were generated, annealed to form a double-stranded DNA molecule and bound to the 96-well streptavidin coated plates. Excess unbound DNA was washed twice using washing buffer (PBS, 0.1% Tween 20) and following blocking with 2% BSA in PBS, purified recombinant NHR8 either alone or in the presence of a putative partner protein was added to the plates in binding buffer (PBS, 0.1% Tween 20, 0.1% BSA, 0.1 mg/ml salmon sperm DNA). The bound receptor was detected using general ELISA methodology (Ed Harlow and David Lane, Antibodies - A laboratory manual, Cold Spring Harbor, 1988 ) by a specific antibody, followed by a secondary HRP conjugated antibody.
- Example 6 Quantitative Expression Profiling of NHR8
- TaqMan RT-PCR quantisation was used.
- the TaqMan 3'- 5' exonuclease assay signals the formation of PCR amplicons by a process involving the nucleolytic degradation of a doublelabeled fluorogenic probe that hybridises to the target template at a site between the two primer recognition sequences (cf. U. S. Patent 5,876,930).
- the ABI Prism 7000 and ABI Prism 7700 automates the detection and quantitative measurement of these signals, which are stoichiometrically related to the quantities of amplicons produced, during each cycle of amplification, hi addition to providing substantial reductions in the time and labour requirements for PCR analyses, this technology permits simplified and potentially highly accurate quantification of target sequences in the reactions.
- RNA prepared from diseased or non-diseased organs was purchased from either Ambion Europe (Huntingdon, UK), Clontech (BD, Franklin Lakes, NJ), Biochain (AMS Biotechnology (Europe) Ltd, Abingdon, UK) or Clinomics (Pittsfield, MA).
- Cell lines were passaged using standard tissue culture protocols. Cells were maintained in a humidified atmosphere at 37°C; 5% CO 2 . Culture medium consisted of lx DMEM (Invitrogen, UK) with the addition of 10% foetal bovine serum (Invitrogen, UK); 2mM glutamine (Sigma, Poole, UK); 100 u/ml penicillin G (Invitrogen, UK) and lOOu/ml streptomycin sulfate (Invitrogen, UK). Cell treatments were carried out as follows:
- Oligo Design Oligonucleotide primers and probes were designed using Primer Express software (Applied Biosystems, Foster City CA) with a GC-content of 40-60%, no G-nucleotide at the 5'-end of the probe, and no more than 4 contiguous Gs.
- Primer probe sets were designed within the 3'utr of the proposed NHR8 and also over an exon-exon junction of the proposed NHR8.
- Each primer and probe was analysed using BLAST ® (Basic Local Alignment Search Tool, Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ.: J Mol Biol 1990 Oct 5;215(3):403-10).
- NHR8 exon Rev GAAAGTGCAGTTTTGGATGTTGAT 18s and cyclophilin pre-optimised primers and probes were purchased from Applied Biosystems, Foster City, CA.
- FAM fluorescent reporter dye
- TAMRA 6carboxytetram-ethyl-rhodamine
- Mem 582nm
- TAMRA ⁇ carboxytefram- ethyl-rhodamine
- Mem 582nm
- Primer/probe concentrations were titrated in the range of 50nM to 900nM and optimal concentrations for efficient PCR reactions were determined. Optimal primer and probe concentrations vary in between lOOnM and 900nM depending on the target gene that is amplified.
- cDNA reaction cDNA was prepared using components from Applied Biosystems, Foster City CA. 50 ⁇ l reactions were prepared in 0.5ml RNase free tubes. Reactions contained 500ng total RNA; lx reverse transcriptase buffer; 5.5mM MgC12; lmM dNTPs; 2.5 ⁇ l random hexamers; 20U RNase inhibitor; and 62.5U reverse transcriptase.
- reaction were prepared in 0.5 ml thin-walled, optical grade PCR 96 well plates (Applied Biosystems, Foster City CA). Reactions contained: lx final concentration of TaqMan Universal Master Mix (a proprietary mixture of AmpliTaq Gold DNA polymerase, AmpEraseX UNG, dNTPs with UTP, passive reference dye and optimised buffer components, Applied Biosystems, Foster City CA); lOOnM Taqman probe; 900nM forward primer; 900nM reverse primer and the relevant amount of cDNA template. For the normal and diseased tissue analysis, reactions contained the same amounts of reagents except for the probe, which was used at a final concentration of 200nM. E. Performance of Assay
- Standard procedures for the operation of the ABI Prism 7000 or similar detection system were used. This includes, for example with the ABI Prism 7000, use of all default program settings with the exception of reaction volume which was changed from 50 to 25 ul.
- Thermal cycling conditions consisted of two min at 50 C, 10 min at 95 C, followed by 40 cycles of 15 sec at 95 C and 1 min at 60 C.
- Cycle threshold (Ct) determinations i.e. non-integer calculations of the number of cycles required for reporter dye fluorescence resulting from the synthesis of PCR products to become significantly higher than background fluorescence levels, were automatically performed by the instrument for each reaction using default parameters.
- Assays for target sequences and ribosomal 18s (reference) sequences in the same cDNA samples were performed in separate reaction tubes.
- the levels of target cDNA in each sample were normalised to the level of expression of target in a comparative sample.
- the levels of internal control cDNA in each sample were normalised to the level of expression of internal control in a comparative sample.
- the data was then represented as fold expression of normalised target sequence relative to the level of expression in the comparative sample, which was set arbitrarily to 1.
- Figure 10 shows normalised expression of NHR8 in 18 normal human tissues.
- Taqman RT-PCR was carried out using 15ng of the indicated cDNA using primers/probes specific for NHR8 and 18s rRNA as described above.
- a standard curve for target and internal control was also carried out, using between 25ng to 1.56ng of cDNA template of a typical tissue sample. Using linear regression analysis of the standard curves, the amount of actual starting target or 18s cDNA in each test sample was calculated.
- Figure 10 represents the fold expression of normalised target sequence relative to the level of expression in stomach cDNA, which is set arbitrarily to 1.
- the target expression profile was determined using 2 primer probe sets - one within the 3 'utr of the proposed NHR8 and one over an exon- exon junction within the LBD of NHR8. Each sample was quantitated in 2 or more individual experiments.
- Figure 10 shows the mean + SEM for the multiple experiments.
- NHR8 is expressed at very low levels in most tissues. The highest level of expression was found in the brain relative to the stomach. Ovary and testis expressed significantly higher levels of transcript. Very low levels of expression were observed in liver, skeletal muscle, spleen, stomach and thymus. For NHR8, the relative levels of expression across the different tissues is very similar for both primer/probe sets (3 'utr and exon spanning), indicating the absence of differential splicing of NHR8 in these samples. The PCR reaction was also carried out on cDNA made in the absence of reverse transcriptase enzyme. A signal was not seen in these reactions (data not shown), indicating that the levels of NHR8 detected are present in cDNA. Figure 11 shows normalised expression of NHR8 in 17 cell line samples.
- Taqman RT-PCR was carried out using 15ng of the indicated cDNA using primers/probes specific for NHR8 and 18s rRNA as described above.
- a standard curve for target and internal control was also carried out, using between 25ng to 1.56ng of cDNA template of a typical cell line sample. Using linear regression analysis of the standard curves, the amount of actual starting target or 18s cDNA in each test sample was calculated.
- FIG. 11 represents the fold expression of normalised target sequence relative to the level of expression in HEK293 cells, which is set arbitrarily to 1.
- the target expression profile was determined using 2 primer probe sets - one within the 3 'utr of the proposed NHR8 and one over an exon-exon junction within the LBD of NHR8. Each sample was quantitated in 2 or more individual experiments.
- Figure 11 shows the mean + SEM for the multiple experiments. NHR8 is expressed at very low levels in all cell types, although HT29 appear to have higher relative levels than other cells.
- HT29 cells are derived from human colon epithelial adenocarcinoma and the finding of transcript expressed in the cells is consistent with the observtaion that the gene is upregulated in expression in adenocarcinomas ofthe colon. Additional studies have shown that the gene is significantly expressed in other human colon adenocarcinoma cell lines such as HCT116.
- Figure 13 shows normalised expression of NHR8 in 10 cell line samples.
- Taqman RT-PCR was carried out using 25ng of the indicated cDNA using primers/probes specific for NHR8 and 18S rRNA.
- a standard curve for target and internal confrol was also carried out, using between 50ng to 0.78ng of cDNA template of a typical sample. Using linear regression analysis of the standard curves, the amount of actual starting target or 18S cDNA in each test sample was calculated.
- FIG. 13 represents the fold expression of normalised target sequence relative to the level of expression in HT29 cells, which is set arbitrarily to 1.
- the target expression profile was determined using the primer probe set within the 3 'utr of the proposed NHR8. Each sample was quantitated in 2 individual wells.
- Figure 13 shows the mean and SEM of 2 wells. NHR8 expression is not detected in all cell lines tested here. Expression is notably low in the U937, SK-N-MC and G401 samples. The highest expression is detected in the A 172 cell line.
- NHR8 is up-regulated 24 fold by dbcAMP treatment ofthe U937 cell line, as previously reported. NHR8 expression however, is not up-regulated by dbcAMP treatment in the HCT116 colon carcinoma cell line.
- the finding of the NHR8 transcript is expressed in HT29 and HCT116 cells, two different human colon epithelial cell lines, is consistent with the observation that the gene is upregulated in expression in adenocarcinomas ofthe colon.
- Figure 13 shows high levels of expression of NHR8 in A 172, a human glioblastoma cell line, and in PC-3, a human androgen independent prostate carcinoma cell line. This is of possible significance when compared to the low level of expression of NHR8 in a human androgen responsive prostate cancer sample and also the androgen responsive LNCap prostate carcinoma cell line.
- U937 cells are a human myeloblastic cell line derived from a histiocytic lymphoma. These cells are widely recognised to differentiate into a macrophage phenotype following treatment with dibutyryl cyclic AMP (dbcAMP) (Sheth et al, Immunology, 1989, 63, 483-490).
- dbcAMP dibutyryl cyclic AMP
- NHR8 expression is tightly regulated by dibutyryl cAMP.
- a fifty fold induction in mRNA levels is observed in the cell line after treatment with lmM dbcAMP.
- Cyclic AMP terminally differentiates U937 cells. The upregulation of NHR8 gene expression in these cells following terminal differentiation suggests that the gene may be involved in regulating macrophage activation.
- Antagonists and agonists regulating NR activity may thus be of value in treating inflammatory disorders such as arthritis, inflammatory bowel disease, COPD, multiple sclerosis, atherosclerosis, dementia, and wound healing.
- the PCR reaction was also carried out on cDNA made in the absence of reverse transcriptase enzyme. A signal was not seen in these reactions (data not shown), indicating that the levels of NHR8 detected are present in cDNA.
- NHR8 was increased by dbcAMP in all three cell types ( Figure 12). However, the magnitude of the effect varied between cells. Thus, in U937 cells, dbcAMP increased NHR8 expression about 30 fold, in HT29 cells the increase was about 3-4 fold and in Jurkat cells the increase was about 2 fold.
- cyclic AMP in a number of cell lines is suggestive that this gene is regulated by CREB and possibly links the activity of this gene to cell cycle regulation (as cyclic AMP terminally differentiates the three cell lines described herein).
- Figures 14a and 14b show normalised expression of NHR8 in 20 disease and clinically matched normal samples.
- Taqman RT-PCR was carried out using 25ng of the indicated cDNA using primers/probes specific for NHR8 and cyclophilin mRNA.
- a standard curve for target and internal control was also carried out, using between 50ng to 0.78ng of cDNA template of a typical sample. Using linear regression analysis of the standard curves, the amount of actual starting target or cyclophilin cDNA in each test sample was calculated.
- FIGS 14a abd 14b represent the fold expression of normalised target sequence relative to the level of expression in COPD normal, which is set arbitrarily to 1.
- the target expression profile was determined using the primer probe set within the 3 'utr of the proposed NHR8. Each sample was quantitated in 3 individual experiments.
- Figures 14a and 14b show the mean of 2 wells analysed in a representative experiment. NHR8 expression is not detected in all tissues tested. Expression is notably low in the prostate cancer, Alzheimer's disease, multiple sclerosis, diabetic adipose, adrenal cortical tumour and adenomatous polyposis samples.
- NHR8 is up-regulated 2.4 fold in lung cancer when compared to the normal sample; 6-fold in inflammatory bowel disease compared to normal and 2-fold in COPD compared to normal.
- Example 7 Expression profiling in normal and tumour tissues using Affvmetrix U133 microarravs for NHR8
- Affymetrix microarray analysis of gene expression was carried out in accordance to Affymetrix instructions (Palo Alto, CA www.affymetrix.com). Essentially, cDNA was synthesized using T7-(dT) 24 oligos and Superscript II RT followed by T4 polymerase and was purified using Phase Lock Gel (PLG) and phenol: chloroform extraction.
- PLG Phase Lock Gel
- cRNA was carried out using biotinylated CTP in an in vitro transcription reaction. Labelled product cRNA was then cleaned up using RNeasy columns (Qiagen, UK Ltd.) and was assessed by spectrophotometry. cRNA was then fragmented and analysed using the Agilent LabChip (Agilent, Palo Alto, CA). cRNA was analysed using the latest version of the Affymetrix U-1333 GeneChip. Approximately lO ⁇ g of cRNA was used per GeneChip. Hybridisation and washing protocols were carried out in accordance with Affymetrix protocols.
- the probe set 212942_s_at was used to detect transcript for NHR8. Details of these 10 probes within this set are available at the Affymetrix website (www.Affymetrix.com), NetAf x section. RNA from 2063 normal human tissues were screened for the presence of the transcript of NHR8 using this probe set. Transcript was detected as "present” in 660 of these RNA samples. The distribution is shown in Figure 16. Transcript was detected in all but one of the brain samples (cerebellum, motor cortex, temporal cortex, parietal cortex, frontal cortex, and hippocampus. The majority of lymph node samples (11 of 13) contained detectable levels of expression of NHR8.
- Transcript could be detected in approx 50% of samples from cervix, endometrium, fallopian tubes, ovary, uterus, prostate.
- franscript could be detected in approx 50% of samples from the larynx, lung, omentum, esophagus and skin.
- transcript levels were most elevated in both benign and malignant tumours ofthe gastrointestinal tract.
- a ten fold increase in expression was observed in benign adenomas ofthe duodenum and colon, malignant mucinous adenocarcinoma of the colon and malignant adenocarcinoma ofthe colon.
- a 5-8 fold increase in expression was observed in adenocarcinoma of the rectum and a 5 fold increase in adenocarcinoma of the pancreas.
- a 2-4 fold increase in expression was observed in adenocarcinoma of the esophagus and the stomach and signet ring cell carcinoma of the stomach.
- transcript levels were elevated 8 fold in giant cell carcinoma of the bone, 2-4 fold in mucinous adenocarcinoma ofthe breast, squamous carcinoma ofthe larynx, adenocarcinoma of the lung, adenocarcinoma of the cervix, serous cyst adenocarcinoma ofthe ovary and adenocarcinoma ofthe ovary.
- Example 6 and Example 7 are in accordance with other expression data for NHR8.
- Expression of NHR8 in the brain was described by Su et al. (2002). It is considered that NHR8 may be involved in pain mediation. Accordingly, it is possible that certain agonists or antagonists of NHR8 may be useful in the treatment of pain.
- NHR8 is responsive to p53 (see Isolation and characterization of sixteen novel p53 response genes. Oncogene. 2000 19(35):3978-87). In conjunction with the discovery reported herein that this protein is an NHR, this finding confirms the importance ofthe NHR8 gene in cancer, as indicated by Example 7 above.
- Example 6 and 7 clearly indicate that the NHR8 transcript is present at detectable levels in a variety of normal and diseased human tissues and cell lines. This confirms the relevance of the NHR8 polypeptides as targets for futher biochemical characterisation.
- the tissues and cell lines identified herein represent ideal targets for further studies of NHR8 function in vivo. Such studies may, for example, make use of the ligands identified using the assays and screening methods disclosed herein to investigate the effects of inducing or inhibiting NHR8 function.
- the expression level of NHR8 is increased in a number of diseased tissues relative to undiseased tissues, particularly in carcinoma tissue samples.
- agonists and antagonists to NHR8 are likely to be of value in the treatment of diseases in which Nuclear Hormone Receptors are implicated, especially carcinomas as disclosed herein.
- agonists and antagonists of theNHR8 polypeptides can be readily identified using the assays and screening methods disclosed herein. Once identified, the effect of agonists and antagonists on diseased cell lines and tissue types may then be investigated using the methods disclosed herein or known to those of skill in the art. It is likely that certain agonists or antagonists identified using the assays and methods disclosed herein will be useful in the prophylaxis or treatment of diseases associated with NHR8, especially inflammation and cancer, particularly carcinomas.
- MHR8 polypeptides ofthe present invention are therefore of value in the development of diagnostic methods for the identification of patients with those particular cancer subtypes and for the development of therapies for those particular cancer subtypes.
- the present invention allows the development of molecular diagnostic tools, such as monoclonal antibodies, for the detection of NHR8 in vivo.
- molecular diagnostic tools such as monoclonal antibodies
- the identification of patients affected by particular cancer subtypes using such diagnostic methods will enable specific therapeutic approaches for individual patients to be selected.
- the present invention allows the design of specific therapies for the treatment of the specific cancer subtypes identified herein, such therapies may, for example, target NHR8 expression or function in the relevant tumour cells.
- SEQ ID NO:l (Nucleotide coding sequence for hCP43593.1 (NHR8) protein)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2003242852A AU2003242852A1 (en) | 2002-07-01 | 2003-07-01 | Nuclear hormone receptor |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0215224.7 | 2002-07-01 | ||
GB0215224A GB0215224D0 (en) | 2002-07-01 | 2002-07-01 | Protein |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2004003018A1 true WO2004003018A1 (fr) | 2004-01-08 |
Family
ID=9939654
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB2003/002814 WO2004003018A1 (fr) | 2002-07-01 | 2003-07-01 | Recepteur hormonal nucleaire |
Country Status (3)
Country | Link |
---|---|
AU (1) | AU2003242852A1 (fr) |
GB (1) | GB0215224D0 (fr) |
WO (1) | WO2004003018A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005085285A2 (fr) * | 2004-03-04 | 2005-09-15 | Inpharmatica Limited | Recepteurs hormonaux nucleaires |
US20120052034A1 (en) * | 2010-09-01 | 2012-03-01 | Zotos International, Inc. | Hair treatment composition with naturally - derived peptide identical to human hair |
Citations (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4347245A (en) * | 1981-05-26 | 1982-08-31 | German Shapiro | Spironolactone-containing composition and use thereof |
US4837211A (en) * | 1987-04-06 | 1989-06-06 | Carolina Medical Products, Inc. | Spironolactone composition |
US6391867B2 (en) * | 1995-02-10 | 2002-05-21 | G.D. Searle & Co. | Use of spironolactone for treatment of symptomatic heart failure |
WO2002050301A2 (fr) * | 2000-12-18 | 2002-06-27 | Gene Logic, Inc. | Profils d'expression genique associes a la differenciation osteoblastique |
WO2002068677A2 (fr) * | 2001-02-27 | 2002-09-06 | Eos Biotechnology, Inc. | Nouveaux procedes de diagnostic du cancer colorectal metastatique, compositions et procedes de criblage des modulateurs du cancer colorectal metastatique |
WO2002070539A2 (fr) * | 2001-03-05 | 2002-09-12 | Hyseq, Inc. | Nouveaux acides nucleiques et polypeptides |
WO2002079398A2 (fr) * | 2001-03-08 | 2002-10-10 | Curagen Corporation | Polypeptides therapeutiques, les acides nucleiques les codant et leurs procedes d'utilisation |
WO2002086443A2 (fr) * | 2001-04-18 | 2002-10-31 | Protein Design Labs, Inc | Procedes de diagnostic du cancer du poumon, compositions et procedes de criblage de modulateurs du cancer du poumon |
WO2003012070A2 (fr) * | 2001-08-03 | 2003-02-13 | Gene Logic, Inc. | Gene associe a des troubles osseux |
WO2003025138A2 (fr) * | 2001-09-17 | 2003-03-27 | Protein Design Labs, Inc. | Procedes de diagnostic du cancer, compositions et procedes de criblage de modulateurs du cancer |
-
2002
- 2002-07-01 GB GB0215224A patent/GB0215224D0/en not_active Ceased
-
2003
- 2003-07-01 AU AU2003242852A patent/AU2003242852A1/en not_active Abandoned
- 2003-07-01 WO PCT/GB2003/002814 patent/WO2004003018A1/fr not_active Application Discontinuation
Patent Citations (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4347245A (en) * | 1981-05-26 | 1982-08-31 | German Shapiro | Spironolactone-containing composition and use thereof |
US4837211A (en) * | 1987-04-06 | 1989-06-06 | Carolina Medical Products, Inc. | Spironolactone composition |
US6391867B2 (en) * | 1995-02-10 | 2002-05-21 | G.D. Searle & Co. | Use of spironolactone for treatment of symptomatic heart failure |
WO2002050301A2 (fr) * | 2000-12-18 | 2002-06-27 | Gene Logic, Inc. | Profils d'expression genique associes a la differenciation osteoblastique |
WO2002068677A2 (fr) * | 2001-02-27 | 2002-09-06 | Eos Biotechnology, Inc. | Nouveaux procedes de diagnostic du cancer colorectal metastatique, compositions et procedes de criblage des modulateurs du cancer colorectal metastatique |
WO2002070539A2 (fr) * | 2001-03-05 | 2002-09-12 | Hyseq, Inc. | Nouveaux acides nucleiques et polypeptides |
WO2002079398A2 (fr) * | 2001-03-08 | 2002-10-10 | Curagen Corporation | Polypeptides therapeutiques, les acides nucleiques les codant et leurs procedes d'utilisation |
WO2002086443A2 (fr) * | 2001-04-18 | 2002-10-31 | Protein Design Labs, Inc | Procedes de diagnostic du cancer du poumon, compositions et procedes de criblage de modulateurs du cancer du poumon |
WO2003012070A2 (fr) * | 2001-08-03 | 2003-02-13 | Gene Logic, Inc. | Gene associe a des troubles osseux |
WO2003025138A2 (fr) * | 2001-09-17 | 2003-03-27 | Protein Design Labs, Inc. | Procedes de diagnostic du cancer, compositions et procedes de criblage de modulateurs du cancer |
Non-Patent Citations (1)
Title |
---|
NAGASE T ET AL: "PREDICTION OF THE CODING SEQUENCES OF UNIDENTIFIED HUMAN GENES. XV. THE COMPLETE SEQUENCES OF 100 NEW CDNA CLONES FROM BRAIN WHICH CODE FOR LARGE PROTEINS IN VITRO", DNA RESEARCH, UNIVERSAL ACADEMY PRESS, JP, vol. 6, 1999, pages 337 - 345, XP000865804, ISSN: 1340-2838 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005085285A2 (fr) * | 2004-03-04 | 2005-09-15 | Inpharmatica Limited | Recepteurs hormonaux nucleaires |
WO2005085285A3 (fr) * | 2004-03-04 | 2006-04-27 | Inpharmatica Ltd | Recepteurs hormonaux nucleaires |
US20120052034A1 (en) * | 2010-09-01 | 2012-03-01 | Zotos International, Inc. | Hair treatment composition with naturally - derived peptide identical to human hair |
US9505820B2 (en) * | 2010-09-01 | 2016-11-29 | Zotos International, Inc. | Hair treatment composition with naturally - derived peptide identical to human hair |
Also Published As
Publication number | Publication date |
---|---|
GB0215224D0 (en) | 2002-08-14 |
AU2003242852A1 (en) | 2004-01-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20040249123A1 (en) | Nuclear hormone receptor ligand binding domain | |
WO2004003018A1 (fr) | Recepteur hormonal nucleaire | |
WO2004003010A2 (fr) | Recepteur hormonal nucleaire | |
WO2004005346A2 (fr) | Recepteur de l'hormone nucleaire | |
WO2004005344A1 (fr) | Domaines de liaison aux ligands des recepteurs hormonaux nucleaires | |
US20040147724A1 (en) | Nuclear hormone receptor ligand binding domain | |
WO2004003011A2 (fr) | Recepteur hormonal nucleaire | |
WO2004101618A2 (fr) | Proteines associees au recepteur de progestine yol002c-cgi-45 | |
US20070148655A1 (en) | Leucine rich repeat containing protein | |
WO2003072605A1 (fr) | Proteine comprenant un domaine de liaison aux ligands d'un recepteur d'hormones nucleaire | |
US20060234218A1 (en) | P450 proteins | |
WO2004003190A1 (fr) | Polypeptide identifie comme cytochrome p450 | |
WO2003089469A2 (fr) | Proteines-canaux cationiques | |
WO2002034901A2 (fr) | Proteine kinase | |
WO2004081170A2 (fr) | Proteine de type recepteur de la progestine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |