WO2003104437A2 - Anti-addl antibodies and uses thereof - Google Patents
Anti-addl antibodies and uses thereof Download PDFInfo
- Publication number
- WO2003104437A2 WO2003104437A2 PCT/US2003/019640 US0319640W WO03104437A2 WO 2003104437 A2 WO2003104437 A2 WO 2003104437A2 US 0319640 W US0319640 W US 0319640W WO 03104437 A2 WO03104437 A2 WO 03104437A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- addls
- amyloid
- addl
- antibodies
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4711—Alzheimer's disease; Amyloid plaque core protein
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4709—Amyloid plaque core protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
Definitions
- U.S. Patent App. No. 09/369,236 is a continuation-in-part of U.S. Patent App. Serial No. 08/796,089, filed February 5, 1997, now U.S. Patent No. 6,218,506.
- U.S. Patent App. No. 09/369,236 claims priority from U.S. Patent App. No. 60/095,264, filed August 4, 1998. All patents, patent applications as well as all other scientific or technical writings referred to anywhere herein are incorporated by reference to the extent that they are not contradictory.
- the invention was made with support from the U.S. Department of Health and Human Services, National Institutes of Health (NIH). Accordingly, the U.S. government may have certain rights in the invention.
- This invention pertains to the fields of medicine, molecular biology, cellular biology and biochemistry. Specifically, this invention pertains to the diagnosis, prevention and treatment of degenerative diseases, especially neurodegenerative diseases such as Alzheimer's disease and the like. More specifically, this invention pertains to antibodies that bind to amyloid beta ( ⁇ ) derived diffusible ligands (ADDLs), namely anti-ADDL antibodies.
- ⁇ amyloid beta
- ADDLs amyloid beta derived diffusible ligands
- AD Alzheimer's disease
- a ⁇ 1-42 the longer form of the amyloid beta peptide
- Exactly how such elevated levels of A ⁇ - ⁇ 2 lead to the disease has not been precisely elucidated, but the most frequently invoked and longstanding explanation is the amyloid cascade hypothesis involving deposition of amyloid fibrils and the purported toxic activity thereof (Hardy, J.A. & Higgins, G.A. (1992) Science, vol. 256, pp. 184- 185; Small, D.H. (1998) Amyloid, vol. 5, pp. 301-304; Golde, T.E.
- a ⁇ - 2 is a 42-amino acid amphipathic peptide derived proteolytically from a widely expressed membrane precursor protein (Selkoe, D.J. (1994) Annu. Rev. Neurosci., vol. 17, pp. 489-517).
- the amyloid peptide has never been demonstrated to have toxic effects, and in some studies it has been purported to have neurotrophic effects.
- Monomers of A ⁇ - 2 assemble into at least three neurotoxic species: fibrillar amyloid (Pike, C.J. et al. (1993) J. Neurosci., vol. 13, pp. 1676-1687; Lorenzo, A. & Yanker, B.A. (1994) Proc. Natl. Acad. Sci. USA, vol. 91 , pp. 12243- 12247), protofibrils (Hartley, D.M. et al. (1999) J. Neurosci., vol. 19, pp. 8876- 8884; Walsh, D.M. et al. (1999) J. Biol. Chem., vol. 274, pp.
- Fibrillar amyloid is insoluble, and deposits of fibrillar amyloid are easily detected in AD and transgenic mice because of their birefringence with dyes such as thioflavin S. Fibrillar amyloid is a major protein component of senile plaques in Alzheimer's disease brain. A ⁇ peptides of various lengths, including A ⁇ 1-40, 1-42, 1-43, 25-35, and 1-28 assemble into fibrils in vitro.
- ADDLs comprise small soluble A ⁇ - 2 oligomers, predominantly trimers and tetramers but also higher-order species (Lambert, M.P. et al. (1998) Proc. Natl. Acad. Sci. USA, vol. 95, pp. 6448-6453; Chromy, B.A. et al. (2000) Soc. Neurosci. Abstr., vol. 26, p. 1284). All three forms of assembled A ⁇ - 2 rapidly impair reduction of the dye MTT (Shearman, M.S. et al. (1994) Proc. Natl. Acad. Sci. USA, vol. 91 , pp. 1470-1474; Walsh, D.M. et al. (1999) J.
- ADDLs also show selectivity in neurotoxicity, killing hippocampal but not cerebellar neurons in brain slice cultures (Kim, H.-J. (2000) Doctoral Thesis, Northwestern University, pp. 1-169).
- fibrillar amyloid deposits are not the toxic form of A ⁇ -42 most relevant to AD.
- Non-fibrillar assemblies of A ⁇ occur in AD brains (Kuo, Y.M. et al. (1996) J. Biol. Chem., vol. 271 , pp. 4077-4081 ; Roher, A.E. et al. (1996) J. Biol. Chem., vol. 271 , pp. 20631-20635; Enya, M. et al. (1999) Am. J. Pathol., vol. 154, pp. 271-279; Funato, H. et al. (1999) Am. J. Pathol., vol. 155, pp. 23-28; Pitschke, M. et al. (1998) Nature Med., vol. 4, pp.
- Soluble A ⁇ oligomers are likely to be responsible for neurological deficits seen in multiple strains of transgenic mice that do not produce amyloid plaques (Mucke, L. ef al. (2000) J. Neurosci., vol. 20, pp. 4050- 4058; Hsia, A.Y. et al. (1999) Proc. Natl. Acad. Sci.
- the present invention provides just such an approach that is independent of amyloid clearance, whether fibrillar or monomeric.
- the present invention provides an immune strategy that directly targets and neutralizes ADDLs.
- antibodies that have been generated and selected for the ability to bind ADDLs specifically, without binding to A ⁇ monomer or amyloid fibrils will be employed to treat and prevent disease that results from the action of ADDLs in the brain.
- the present invention further uses such antibodies for specific diagnosis of individuals who have measurable levels of ADDLs present in the brain or CSF.
- the present invention uses anti-ADDL antibodies in assays that allow for the detection of molecules that block the formation or activity of ADDLs.
- the present invention seeks to overcome the substantial problems with the prior art that are based largely on the flawed theory that amyloid fibrils and plaques cause AD. Accordingly, one object of the present invention is the production, characterization and use of new compositions comprising specific ADDL-binding molecules such as anti-ADDL antibodies, which are capable of direct or indirect interference with the activity and/or formation of ADDLs (soluble, globular, non-fibrillar oligomeric A ⁇ - ⁇ -42 assemblies).
- ADDLs soluble, globular, non-fibrillar oligomeric A ⁇ - ⁇ -42 assemblies
- the present invention pertains to amyloid beta-derived diffusible ligands (ADDLs), antibodies that bind to ADDLs (anti-ADDL antibodies), uses of anti- ADDL antibodies to discover anti-ADDL therapeutics, and uses of anti-ADDL antibodies in the diagnosis, treatment and prevention of diseases associated with ADDLs, including Alzheimer's disease, learning and memory disorders, and neurodegenerative disorders.
- ADDLs amyloid beta-derived diffusible ligands
- anti-ADDL antibodies antibodies that bind to ADDLs
- uses of anti- ADDL antibodies to discover anti-ADDL therapeutics uses of anti-ADDL antibodies in the diagnosis, treatment and prevention of diseases associated with ADDLs, including Alzheimer's disease, learning and memory disorders, and neurodegenerative disorders.
- the invention specifically pertains to antibodies that recognize and bind ADDLs preferentially, with much lower binding capability for monomer forms of the amyloid peptide. Antibodies with these characteristics are useful for blocking the neurotoxic activity of ADDLs, and they are useful for eliminating ADDLs from the brain
- Antibodies with these characteristics also are useful for detection of ADDLs in biological samples, including human plasma, cerebrospinal fluid, and brain tissue.
- Anti-ADDL antibodies are useful for quantitative measurement of ADDLs in cerebrospinal fluid, enabling the diagnosis of individuals adversely affected by ADDLs. Such adverse effects may manifest as deficits in learning and memory, alterations in personality, and decline in other cognitive functions such as those functions known to be compromised in Alzheimer's disease and related disorders.
- Anti-ADDL antibodies are also useful for quantitative detection of ADDLs in brain tissue obtained at autopsy, to confirm pre-mortem diagnosis of Alzheimer's disease.
- the invention further pertains to antibodies that recognize and bind ADDLs preferentially, with much lower binding capability for fibrillar and monomer forms of the amyloid peptide. Such antibodies are particularly useful for treatment and prevention of Alzheimer's disease and other ADDL-related diseases in patients where prevalent fibrillar amyloid deposits exist in the brain, and for whom treatment with antibodies that preferentially bind to fibrillar forms of amyloid will result in serious brain inflammation and encephalitis.
- the invention further pertains to the use of ADDLs to select or identify antibodies or any other ADDL binding molecule or macromolecule capable of binding to ADDLs, clearing ADDLs from the brain, blocking ADDL activities, or preventing the formation of ADDLs.
- Additional inventions include new composition of matter, such molecule being capable of selecting antibodies or anti-ADDL binding molecules, or inducing an ADDL blocking immune response when administered to an animal or human.
- the invention extends further to include such uses when applied to methods for creating synthetic antibodies and binding molecules and other specific binding molecules through selection or recombinant engineering methods as are known in the art.
- the invention pertains to the preparation, characterization and methods of using such anti-ADDL antibodies.
- the invention also pertains to the use of anti-ADDL antibodies for the detection of ADDL formation and for the detection of molecules that prevent ADDL formation.
- the invention further pertains to the use of such antibodies to detect molecules that block ADDL binding to specific ADDL receptors present on the surface of nerve cells that are compromised in Alzheimer's disease and related disorders.
- ADDLs comprise amyloid ⁇ (A ⁇ ) peptide assembled into soluble, globular, non-fibrillar, oligomeric structures that are capable of activating specific cellular processes.
- a ⁇ amyloid ⁇
- Disclosed herein are methods for preparing and characterizing antibodies specific for ADDLs as well as methods for assaying the formation, presence, receptor protein binding and cellular activities of ADDLs. Also described are compounds that block the formation or activity of ADDLs, and methods of identifying such compounds. ADDL formation and activity are relevant inter alia to compromised learning and memory, nerve cell degeneration, and the initiation and progression of Alzheimer's disease.
- ADDLs amyloid beta-derived diffusible ligands or amyloid beta-derived dementing ligands
- ADDLs consist of amyloid ⁇ peptide assembled into soluble non-fibrillar oligomeric structures that are capable of activating specific cellular processes.
- a preferred aspect of the present invention comprises antibodies and binding molecules that are specific for ADDLs, and methods for preparation, characterization and use of antibodies or binding molecules that are specific for ADDLs.
- Another preferred embodiment comprises antibodies or binding molecules that bind to ADDLs but do not bind to A ⁇ monomers or fibrillar aggregates.
- Another aspect of the invention consists of methods for assaying the formation, presence, receptor protein binding and cellular activities of ADDLs, and methods for diagnosing diseases or potential diseases resulting from the presence of ADDLs.
- a further aspect of the invention is the use of anti-ADDL antibody or anti-ADDL binding molecules for the therapy and/or prevention of Alzheimer's disease and other diseases associated with the presence of ADDLs.
- the invention further encompasses assay methods and methods of identifying compounds that modulate (e.g., increase or decrease) the formation and/or activity of ADDLs. Such compounds can be employed in the treatment of diseases, disorders, or conditions due to the effects of the ADDLs.
- Figure 1 is a computer-generated image of a densitometer-scanned silver- stained polyacrylamide gel which shows the ADDLs electrophoresing with a primary band corresponding to about 30 kD, a less abundant band corresponding to about 17 kD, and no evidence of fibrils or aggregates.
- Figure 2 is a computer-generated image of a densitometer-scanned
- Coomassie-stained SDS-polyacrylamide gel which shows ADDLs electrophoresing with a primary band (upper doublet) corresponding to a size of about 17 to about 22 kD, and with another band (lower dark band) indicating abundant 4 kD monomer present, presumably a breakdown product.
- Figure 3 is a representative computer-generated image of AFM analysis of
- Figure 4 is a computer-generated image of a densitometer-scanned
- FIG. 5 is a graph of ADDL concentration measured as amyloid ⁇ 1-42 concentration (nM) vs. % dead cells for brain slices from mice treated with the ADDL preparations.
- Figure 6 is a bar chart showing % MTT reduction for control PC 12 cells not exposed to ADDLs ("Cont.”), PC 12 cells exposed to clusterin alone (“Apo J”), PC 12 cells exposed to monomeric A ⁇ (“A ⁇ ”), PC12 cells exposed to amyloid ⁇ coaggregated with clusterin and aged one day (“A ⁇ :Apo J”).
- Figure 7 is a FACScan showing fluorescence intensity (0-170) versus events (0-300) for B103 cells not exposed to ADDLs (unshaded peak) and B103 cells bound to fluorescent labeled ADDLs (shaded peak).
- Figure 8 is a FACScan showing fluorescence intensity (0-200) versus events (0-300) for hippocampal cells not exposed to ADDLs (unshaded peak, "- ADDLs”) and hippocampal cells bound to fluorescent labeled ADDLs (shaded peak, "+ADDLs”).
- Figure 9 is a bar chart of percent maximum ADDL binding or ADDL- evoked death for B103 cells that either have been not exposed ("-”) or coexposed (“+”) to the peptides released by trypsinization of B103 cells.
- Figure 10 is a graph of relative ADDL concentration vs. % dead cells for brain slices from mice treated with the ADDL preparations. To determine relative concentration, an initial concentration of 10 ⁇ M A ⁇ protein was employed to form
- Figure 11 is a bar chart showing optical density obtained in the ADDL binding ELISA assay wherein B103 cells were coincubated with ADDLs and 6E10 antibody ("cells, ADDL, 6E10" bar), B103 cells were coincubated with ADDLs ("cells, ADDL” bar), B103 cells were coincubated with 6E10 antibody ("cells, 6E10” bar), B103 cells were incubated alone (“cells” bar), 6E10 antibody was incubated alone (“6E10” bar), or the optical density of diluent was read (“blank” bar).
- Figure 12 is a bar chart of % dead cells in either fyn +/+ (wild type, "Fyn +”; crosshatched bars) or fyn -I- (knockout, "Fyn -”; solid bars) mice either not treated ("Medium”) or contacted with ADDLs ("ADDLs").
- Figure 13 is a graph of A ⁇ concentration ( ⁇ M) versus activated glia (number) obtained upon incubation of astrocytes with ADDLs (filled triangles) or A ⁇ 17-42 (filled squares).
- Figure 14 is a graph of time (minutes) versus % baseline cell body spike amplitude for control mice not treated with ADDLs (filled triangles) or mice treated with ADDLs (filled squares).
- Figure 15 is a graph of time (minutes) versus mean spike amplitude for control rat hippocampal slices not exposed to ADDLs (filled triangles) versus rat hippocampal slices exposed to ADDLs (filled squares).
- Figure 16 is a computer-generated image of a densitometer-scanned
- Figure 17 is a computer-generated image of an AFM analysis of ADDLs.
- the top view subtracted image shows a high magnification view (2.0 ⁇ m x 2.0 ⁇ m) of aggregated amyloid ⁇ molecules that have been spotted on freshly cleaved mica.
- Figure 18 displays data showing that ADDLs maintain their oligomeric profile and cytotoxic activity after storage at 4°C.
- A Silver stain of initial ADDL preparation and the same preparation one day later. A ⁇ 1-42 was dissolved in DMSO, then in F12 (see Example 22, Materials and Methods), and incubated at 4°C for 24 hours. After centrifugation, the supernatant, which represents the initial ADDL preparation, was removed to a new tube. Supernatant proteins were separated on a Tris tricine gel using SDS-PAGE and visualized with a silver stain. Lane 1 : Colored molecular weight markers (not silver stained). Lane 2: Initial ADDL preparation showing abundant monomer, slight dimer, and substantial trimer and tetramer oligomers.
- Lane 3 ADDL preparation one day later at 4°C showing essentially the same profile. In this image, the uniform gray background of these two lanes is from the colored background of the silver stain, ⁇ . MTT Assay of initial ADDL preparation and the same preparation one day later. The MTT assay was used to compare the effect of a 4-hour ADDL incubation on PC12 cells (Example 22, Materials and Methods). Whether fresh or stored, ADDL preparations caused at least 50% inhibition. Data from A and B indicate that the 48-hour sample, which was used for injection, is similar in structure and toxicity to the initial preparation.
- Figure 19 presents data showing that antibody M94 displays a strong preference for oligomers in immunoblots.
- ADDLs were separated using SDS- PAGE, transferred to nitrocellulose, and probed with the indicated antibodies. Binding was identified with a secondary conjugated to horseradish peroxidase and visualized using chemiluminescence.
- the monoclonal antibody 4G8 (right lane) recognizes four A ⁇ species, from monomer to tetramer.
- the monoclonals 26D6 (middle lane) and 6E10 (Fig. 3) recognize monomer, trimer, and tetramer, but not dimer.
- the new polyclonal antisera M94 left lane
- M93 Fig. 3 preferentially recognize oligomers.
- Figure 20 presents data showing that the oligomer-selective M93 antibody detects amyloid ⁇ monomer only at high antibody concentrations.
- A. Immunoblot An ADDL immunoblot was probed with decreasing concentrations of antibody. Visualization of ADDLs was by chemiluminescence. M93 potency is at least that of 6E10, a commercial monoclonal antibody unselective for oligomers that is shown for reference (at a dilution of 1 :2000).
- B. Quantification of chemiluminescent bands The intensity of each band was determined by image analysis (Methods) and normalized to the 6E10 monomer band (100%). M93 antibody bound monomer only at higher antibody concentrations ( ⁇ 1 :500 dilution). These data indicate that oligomers are preferentially recognized by M93 antibody.
- FIG 21 presents data showing that pre-absorption of oligomer-selective antibodies with ADDLs eliminates binding in immunoblots. Each antibody (as indicated) was incubated with ADDLs for 2 hours at 0, 1 , 5, or 10 times the protein concentration. Then the solutions were used on an ADDL immunoblot that was developed in the standard manner. Prior absorption by ADDLs eliminates all binding. This result indicates that binding of the antibodies to ADDLs requires specific recognition.
- Figure 22 presents data showing that oligomer-selective antibodies exhibit no binding to normal brain proteins. In order to determine if the antibodies bind to brain proteins other than ADDLs, rat brain homogenate was prepared and separated alone or in the presence of ADDLs using SDS-PAGE.
- ADDLs were added to protein (60 ⁇ g) immediately before electrophoresis. The resulting immunoblot was probed with M94 and binding visualized with chemiluminescence. No binding occurred to brain proteins alone (middle lane). Samples that had ADDLs and homogenate (right lane) showed tetramer and trimer (closed arrow) as well as higher molecular weight species. The most prominent of these bands are indicated by the open arrow, with trace amounts showing up at higher molecular weights. ADDLs alone are shown in the left lane. These results indicate that the antibodies recognize only A ⁇ oligomers and not brain proteins.
- Figure 23 presents data showing the localization of ADDL binding in cultured rat hippocampal cells.
- Rat hippocampal cultures were prepared, exposed to ADDLs for 90 min., and then fixed. Bound ADDLs were identified using M94 antibody and visualized with secondary IgG conjugated to Oregon green-514. The top panels are immunofluorescence images; the bottom panels are inverted fluorescent images. Left: cultures were treated with ADDLs but no primary antibody. Middle: cultures were treated with ADDLs and M94 antibody. Right: cultures were treated with vehicle control and M94 antibody. There is no binding to primary- or ADDL-free cultures. Label seen in cultures treated with both ADDLs and M94 is located almost exclusively on neurites. The bar in the lower left corner represents 25 microns.
- Figure 24 presents data showing that toxicity to PC12 cells (as measured by an MTT assay) is blocked by ADDL-selective antibodies.
- Pre-immune serum was added to ADDLs for 2 hours before the MTT reaction was performed in PC12 cells. This addition does not prevent the reduction of MTT in a dose- dependent manner (open squares, bottom line). However, if antibodies are pre- incubated with ADDLs for 2 hours, no change in MTT reduction is seen (filled squares, top line).
- ADDLs A ⁇ -derived oligomers
- the antibodies discriminate oligomers from monomers, and they exhibit efficacy and specificity in immunoblots and immunofluorescence microscopy.
- the antibodies moreover, neutralize the biological activity of ADDLs. This is significant because emerging evidence suggests that ADDLs are the relevant pathogenic molecules that form when levels of A ⁇ -42 become elevated.
- ADDLs are small neurotoxins that are soluble and diffusible. They have been demonstrated to interfere directly with the key electrophysiology and biochemistry required for information storage, namely LTP.
- ADDL preparations show specificity for oligomers. In some instances, monomers can be detected at very high doses of antibodies, but serial dilutions establish that antibodies from several animals (designated 90, 93 or 94) preferentially recognize and bind to oligomers (Fig. 19 and Fig. 20). It should be noted these ADDL preparations do not convert to protofibrils or fibrils, eliminating the possibility that these larger assemblies could be responsible for generating the observed immune response.
- oligomers may be more antigenic than monomer.
- the oligomers may be inherently more immunogenic due to presentation of novel, conformationally dependent epitopes, absent from monomer.
- Monomers also are likely to be intrinsically less immunogenic because of their physiological role consequent to normal metabolism of APP molecules (Selkoe, D.J. ⁇ 1994) Annu. Rev. of Neurosci., vol. 17, pp. 489-517), which are transiently abundant during development (Enam, S.A. (1991 ) Ph.D. Thesis, Northwestern University).
- Another possibility might be that monomers may be cleared more efficiently than oligomers.
- ADDL-antibodies The binding affinities and detection efficacies of ADDL-antibodies are comparable to commercial A ⁇ monoclonal antibodies (Fig. 19). For example, at higher ADDL concentrations (100 pmol), ADDL-antibodies at 0.3 ⁇ g/ml show a binding intensity comparable to that of commercial monoclonal antibodies used at 0.4 to 0.5 ⁇ g/ml (Fig. 19). These commercial monoclonals also recognized epitopes common to several states of A ⁇ assembly, including monomers and dimers, which were not detected by anti-ADDL antibodies. That alternative assembly-states of A ⁇ manifest different epitopes is in harmony with their differing toxic activities, a property that may be exploited for future drug development.
- ADDL-antibodies also show efficacies that are as least as good as monoclonal antibodies when used at very low A ⁇ concentrations (Ida, N. ef al. (1996) J. Biol. Chem., vol. 271 , pp. 22908-22914; Potempska, A. ef al. (1999) Amyloid, vol. 6, pp. 14-21). Immunoblots with ADDL-antibodies at a final IgG protein concentration of 0.6 ⁇ g/ml can recognize less than 1 fmol of ADDLs.
- the antibodies show significant specificity, making them useful for analytical experiments. This is not always the case for other antibodies produced against A ⁇ peptides.
- some monoclonal antibodies against A ⁇ 3 5-42 and A ⁇ 3 3-4o bind non-specifically to components in CSF and blood plasma on immunoblots, even though they are selective for A ⁇ in an ELISA (Ida, N. ef al. (1996) J. Biol. Chem., vol. 271 , pp. 22908-22914).
- the M93 and M94 antibodies showed no binding to proteins in total rat homogenate, in harmony with their selectivity for oligomer over monomer.
- the antibodies showed little binding to cell surfaces in the absence of exogenous ADDLs.
- ADDLs were mixed with brain homogenates
- immunoblots showed ADDLs at their normal molecular weight range, but, in addition, species at a higher molecular weight were also observed.
- the basis for this addition is not known, but it previously has been established that several different proteins can influence the aggregation properties of A ⁇ (Klein, W.L. (2000) in Molecular Mechanisms of Neurodegenerative Diseases (Chesselet, M.-F., Ed.), Humana Press; Klein, W.L. et al. (2001) Trends Neurosci., vol. 24, pp. 219-224).
- the size of the species seen here is the same as the size suggested to be a predominant form in AD-afflicted brain (Guerette, P.A. ef al. (2000) Soc. Neurosci. Abstr., vol. 25, p. 2129).
- the additional species may also be tightly-adherent ADDLs bound to a small brain protein, e.g., ApoE.
- ApoE a small brain protein
- a stable complex between A ⁇ and ApoE has been seen previously (LaDu, M.J. ef al. (1997) J. Neurosci. Res., vol. 49, pp. 9-18; LaDu, M.J. ef al. (1995) J. Biol. Chem., vol. 270, pp.
- ADDLs became associated with neurons in a highly patterned manner.
- the nature of these "hot spots” suggests possible receptor involvement in ADDL toxicity (Viola, Gong, Lambert, Lin, and Klein, in preparation).
- amyloid-free APP-transgenic mice were found to exhibit loss of synaptophysin-immunoreactive terminals, a good measure of cognitive decline in AD (Terry, R.D. (1999) in Alzheimer's Disease (Terry, R.D. et al., Eds.), pp. 187-206, Lippincott Williams & Wilkins), in a manner that correlates nonetheless with levels of soluble A ⁇ 1-42 species (Mucke, L. et al. (2000) J. Neurosci., vol. 20, pp. 4050-4058). The authors suggest their results support an emerging view that plaque-independent A ⁇ toxicity is important in the development of synaptic deficits in AD.
- ADDLs ADDLs
- the current neutralizing antibodies which target novel domains dependent on peptide assembly, are proposed as prototypes for therapeutic vaccination. It is predicted that use of homologous antibodies would combat memory deficits in early stages of AD. By binding to ADDLs, antibodies would protect neural plasticity, which is inhibited experimentally at low ADDL doses (Lambert, M.P. ef al. (1998) Proc. Natl. Acad. Sci. USA, vol. 95, pp. 6448-6453; Wang, H. et al. (2000) Soc. Neurosci. Abstr., vol.
- ADDL-selective antibodies provide a basis for simple high throughput assays to screen libraries for compounds that block toxic oligomerization. It has been discovered that in neurotoxic samples of amyloid ⁇ not only do fibrillar structures exist, but also, unexpectedly, some globular protein structures exist that appear to be responsible for the neurotoxicity. Using novel methods, samples that contain predominantly these soluble globular protein assemblies and no fibrillar structures have been generated as described herein.
- amyloid ⁇ -derived dementing ligands amyloid ⁇ -derived diffusible ligands
- ADDLs amyloid ⁇ soluble non-fibrillar structures
- amyloid ⁇ oligomeric structures amyloid ⁇ oligomeric structures
- ADDLs can be formed in vitro.
- a solution e.g., a DMSO solution
- monomeric amyloid ⁇ 1-42 or other appropriate amyloid ⁇ , as further described herein
- cold tissue culture media e.g., F12 cell culture media
- the supernatant fraction contains small, soluble oligomeric globules that are highly neurotoxic, e.g., in neuronal cell and brain slice cultures.
- the ADDLs also can be formed by co-incubation of amyloid ⁇ with certain appropriate agents, e.g., clusterin (a senile plaque protein that also is known as ApoJ), as well as by other methods, as described herein.
- clusterin a senile plaque protein that also is known as ApoJ
- the present invention pertains to an isolated, soluble, non-fibrillar amyloid ⁇ oligomeric structure.
- the oligomeric structure so isolated does not contain an exogenously added crosslinking agent.
- the oligomeric structure desirably is stable in the absence of any crosslinker.
- Atomic force microscope analysis can be carried out as is known in the art and described herein, for instance, using a Digital Instruments Atomic force microscope as described in Example 3.
- AFM of such a supernatant fraction ⁇ i.e., a supernatant fraction in which fibrillar structures have been removed
- AFM of such a supernatant fraction reveals a number of different size globules ⁇ i.e., or different size oligomeric structures) present in the fraction.
- These globules fall within the range of from about 4.7 to about 11.0 nm, with the major fraction falling within a size range of from about 4.7 nm to about 6.2 nm.
- globules having dimensions of from about 5.3 nm to about 5.7 nm. Larger globules from about 6.5 nm to about 11.0 nm appear less frequently, but may possess neurotoxic properties similar to the more prevalent, smaller species. It appears that the globules of dimensions of from about 4.7 nm to about 6.2 nm on AFM comprise the pentamer and hexamer form of oligomeric amyloid ⁇ (A ⁇ ) protein. The AFM size globules of from about 4.2 nm to about 4.7 nm appear to correspond to the A ⁇ tetramer.
- the large globules appear to correspond to oligomeric species ranging in size from about 13 amyloid monomers to about 24 amyloid monomers.
- the size globules of from about 2.8 nm to about 3.4 nm correspond to dimer (Roher ef al. (1996) J.
- the A ⁇ monomer AFM size ranges from about 0.8 nm to about 1.8 - 2.0 nm.
- Monomeric and dimeric amyloid ⁇ are not neurotoxic in neuronal cell cultures or in the organotypic brain slice cultures.
- the present invention provides an isolated soluble non-fibrillar amyloid ⁇ oligomeric structure ⁇ i.e., an ADDL) that preferably comprises at from about 3 to about 24 amyloid ⁇ protein monomers, especially from about 3 to about 20 amyloid ⁇ protein monomers, particularly from about 3 to about 16 amyloid ⁇ protein monomers, most preferably from about 3 to about 12 amyloid ⁇ protein monomers, and which desirably comprises at from about 3 to about 6 amyloid ⁇ protein monomers.
- large globules (less predominant species) appear to correspond to oligomeric species ranging in size from about 13 amyloid ⁇ monomers to about 24 amyloid ⁇ monomers.
- the invention provides an isolated soluble non-fibrillar amyloid ⁇ oligomeric structure wherein the oligomeric structure preferably comprises trimer, tetramer, pentamer, hexamer, heptamer, octamer, 12-mer, 16-mer, 20-mer or 24- mer aggregates of amyloid ⁇ proteins.
- the invention provides an isolated soluble non-fibrillar amyloid ⁇ protein oligomeric structure wherein the oligomeric structure preferably comprises trimer, tetramer, pentamer, or hexamer aggregates of amyloid ⁇ protein.
- the oligomeric structure of the invention optimally exhibits neurotoxic activity.
- the higher order structure of the soluble, non-fibrillar amyloid ⁇ protein oligomer structure ⁇ i.e., the aggregation of monomers to form the oligomeric structure) desirably can be obtained not only from amyloid ⁇ 1-42, but also from any amyloid ⁇ protein capable of stably forming the soluble non-fibrillar amyloid ⁇ oligomeric structure.
- amyloid ⁇ 1-43 also can be employed.
- Amyloid ⁇ 1-42 with biocytin at position 1 also can be employed.
- Amyloid ⁇ (e.g., ⁇ 1-42 or ⁇ 1-43) with a cysteine at the N-terminus also can be employed.
- a ⁇ truncated at the amino terminus e.g., particularly missing one or more up to the entirety of the sequence of amino acid residues 1 through 8 of A ⁇ 1-42 or A ⁇ 1-43), or A ⁇ (e.g., A ⁇ 1-42 or 1-43) having one or two extra amino acid residues at the carboxyl terminus
- amyloid ⁇ 1-40 can transiently form ADDL-like structures which can be toxic, but these structures are not stable and cannot be isolated as aqueous solutions, likely due to the shortened nature of the protein, which limits its ability to form such higher order assemblies in a stable fashion.
- the isolated soluble non-fibrillar amyloid ⁇ oligomeric structure according to the invention comprises globules of dimensions of from about 4.7 nm to about 11.0 nm, particularly from about 4.7 nm to about 6.2 nm as measured by atomic force microscopy.
- the isolated soluble non- fibrillar amyloid ⁇ oligomeric structure comprises globules of dimensions of from about 4.9 nm to about 5.4 nm, or from about 5.7 nm to about 6.2 nm, or from about 6.5 nm to about 11.0 nm, as measured by atomic force microscopy.
- the isolated soluble non-fibrillar amyloid ⁇ oligomeric structure according to the invention is such that wherein from about 30% to about 85%, even more preferably from about 40% to about 75% of the assembly comprises two predominant sizes of globules, namely, of dimensions of from about 4.9 nm to about 5.4 nm, and from about 5.7 nm to about 6.2 nm, as measured by atomic force microscopy.
- the oligomeric structure comprises AFM size globules of about 5.3 to about 5.7 nm. It is also desirable that the oligomeric structure may comprise AFM size globules of about 6.5 nm to about 11.0 nm.
- the bands corresponding to ADDLs run at about from 26 kD to about 28 kD, and with a separate broad band representing sizes of from about 36 kD to about 108 kD.
- the ADDLs comprise a band that runs at from about 22 kD to about 24 kD, and may further comprise a band that runs at about 18 to about 19 kD.
- the invention preferably provides an isolated soluble non-fibrillar amyloid ⁇ oligomeric structure ⁇ i.e., ADDL) that has a molecular weight of from about 26 kD to about 28 kD as determined by non-denaturing gel electrophoresis.
- the invention also preferably provides an isolated soluble non-fibrillar amyloid ⁇ oligomeric structure ⁇ i.e., ADDL) that runs as a band corresponding to a molecular weight of from about 22 kD to about 24 kD as determined by electrophoresis on a 15% SDS- polyacrylamide gel.
- the invention further preferably provides an isolated soluble non-fibrillar amyloid ⁇ oligomeric structure ⁇ i.e., ADDL) that runs as a band corresponding to a molecular weight of from about 18 kD to about 19 kD as determined by electrophoresis on a 15% SDS-polyacrylamide gel.
- ADDL isolated soluble non-fibrillar amyloid ⁇ oligomeric structure
- ADDL bands can be visualized.
- the increased resolution obtained with this gel system confirms the ability to obtain according to the invention an isolated oligomeric structure having a molecular weight ranging from about 13 kD to about 116 kD, as determined by electrophoresis on a 16.5% tris-tricine SDS- polyacrylamide gel.
- the ADDL bands appear to correspond to distinct size species.
- this gel system allows visualization of bands corresponding to trimer with a size of about 13 to about 14 kD, tetramer with a size of about 17 to about 19 kD, pentamer with a size of about 22 kD to about 23 kD, hexamer with a size of about 26 to about 28 kD, heptamer with a size from about 32 kD to 33 kD, and octamer with a size from about 36 kD to about 38 kD, as well as larger soluble oligomers ranging in size from about 12 monomers to about 24 monomers.
- the invention desirably provides an isolated oligomeric structure, wherein the oligomeric structure has, as determined by electrophoresis on a 16.5% tris-tricine SDS-polyacrylamide gel, a molecular weight selected from the group consisting of from about 13 kD to about 14 kD, from about 17 kD to about 19 kD, from about 22 kD to about 23 kD, from about 26 kD to about 28 kD, from about 32 kD to about 33 kD, and from about 36 kD to about 38 kD.
- the invention further provides a method for preparing the isolated, soluble, non-fibrillar amyloid ⁇ oligomeric structure.
- This method optionally comprises the steps of: (a) obtaining a solution of monomeric amyloid ⁇ protein;
- step (c) incubating the media resulting from step (b) at about 4°C; (d) centrifuging the media at about 14,000 g at about 4°C; and
- step (c) of this method the solution desirably is incubated for about 2 hours to about 48 hours, especially for about 12 hours to about 48 hours, and most preferably for about 24 hours to about 48 hours.
- step (d) of this method the centrifugation preferably is carried out for about 5 minutes to about 1 hour, especially for about 5 minutes to about 30 minutes, and optimally for about 10 minutes. Generally, however, this is just a precautionary measure to remove any nascent fibrillar or protofibrillar structures and may not be necessary, particularly where long-term stability of the ADDL preparation is not an issue.
- the A ⁇ protein is diluted in step (b) desirably to a final concentration ranging from about 5 nM to about 500 ⁇ M, particularly from about 5 ⁇ M to about 300 ⁇ M, especially at about 100 ⁇ M.
- the "appropriate media" into which the A ⁇ protein solution is diluted in step (b) preferably is any media that will support, if not facilitate, ADDL formation.
- F12 media (which is commercially available as well as easily formulated in the laboratory) is preferred for use in this method of the invention.
- substitute F12 media also desirably can be employed. Substitute F12 media differs from F12 media that is commercially available or which is formulated in the laboratory.
- substitute F12 media preferably comprises the following components: N, N- dimethylglycine, D-glucose, calcium chloride, copper sulfate pentahydrate, iron(ll) sulfate heptahydrate, potassium chloride, magnesium chloride, sodium chloride, sodium bicarbonate, disodium hydrogen phosphate, and zinc sulfate heptahydrate.
- synthetic F12 media optionally comprises: N, N-dimethylglycine (from about 600 to about 850 mg/L), D-glucose (from about 1.0 to about 3.0 g/L), calcium chloride (from about 20 to about 40 mg/L), copper sulfate pentahydrate (from about 15 to about 40 mg/L), iron(ll) sulfate heptahydrate (from about 0.4 to about 1.2 mg/L), potassium chloride (from about 160 to about 280 mg/L), magnesium chloride (from about 40 to about 75 mg/L), sodium chloride (from about 6.0 to about 9.0 g/L), sodium bicarbonate (from about 0.75 to about 1.4 g/L), disodium hydrogen phosphate (from about 120 to about 160 mg/L), and zinc sulfate heptahydrate (from about 0.7 to about 1.1 mg/L).
- synthetic F12 media comprises: N, N-dimethylglycine (about 766 mg/L), D-glucose (about 1.802 g/L), calcium chloride (about 33 mg/L), copper sulfate pentahydrate (about 25 mg/L), iron(ll) sulfate heptahydrate (about 0.8 mg/L), potassium chloride (about 223 mg/L), magnesium chloride (about 57 mg/L), sodium chloride (about 7.6 g/L), sodium bicarbonate (about 1.18 g/L), disodium hydrogen phosphate (about 142 mg/L), and zinc sulfate heptahydrate (about 0.9 mg/L).
- the pH of the substitute F12 media preferably is adjusted, for instance, using 0.1 M sodium hydroxide, desirably to a pH of about 7.0 to about 8.5, and preferably a pH of about 8.0.
- the foregoing method further desirably can be carried out by forming the slowly-sedimenting oligomeric structure in the presence of an appropriate agent, such as clusterin. This is done, for instance, by adding clusterin in step (c), and, as set out in the Examples which follow.
- an appropriate agent such as clusterin.
- the invention also provides as described in the Examples, a method for preparing a soluble non-fibrillar amyloid ⁇ oligomeric structure according to the invention, wherein the method comprises:
- ADDLs incubating at about 4°C for about 24 hours.
- the ADDLs are prepared by the incorporation of 10% biotinylated amyloid ⁇ 1-42 (or other appropriate biotinylated amyloid ⁇ protein), they can be utilized in a receptor binding assay using neural cells and carried out, for instance, on a fluorescence activated cell sorting (FACS) instrument, with labeling by a fluorescent avidin conjugate.
- FACS fluorescence activated cell sorting
- another reagent capable of binding the ADDL to form a fluorescently labeled molecule, and which may already be part of a fluorescent-labeled conjugate can be employed.
- the soluble non- fibrillar amyloid ⁇ oligomeric structure can be formed such that the amyloid protein includes another binding moiety, with "binding moiety” as used herein encompassing a molecule (such as avidin, streptavidin, polylysine, and the like) that can be employed for binding to a reagent to form a fluorescently-labeled compound or conjugate.
- binding moiety as used herein encompassing a molecule (such as avidin, streptavidin, polylysine, and the like) that can be employed for binding to a reagent to form a fluorescently-labeled compound or conjugate.
- the "fluorescent reagent" to which the oligomeric structure binds need not itself fluoresce directly, but instead may merely be capable of fluorescence through binding to another agent.
- the fluorescent reagent which binds the oligomeric structure can comprise a ⁇ amyloid specific antibody (e.g., 6E10), with fluorescence generated by use of a fluorescent secondary antibody.
- a ⁇ amyloid specific antibody e.g. 6E10
- FACSscan analysis of the rat CNS B103 cells was done without and with ADDL incubation. Results of these and further studies confirm that binding to the cell surface is saturable, and brief treatment with trypsin selectively removes a subset of cell surface proteins and eliminates binding of ADDLs. Proteins that are cleavable by brief treatment with trypsin from the surface of B103 cells also prevent ADDL binding to B103 cells or cultured primary rat hippocampal neurons.
- ADDLs act through a particular cell surface receptor, and that early events mediated by the ADDLs ⁇ i.e., events prior to cell killing) can be advantageously controlled (e.g., for treatment or research) by compounds that block formation and activity (e.g., including receptor binding) of the ADDLs.
- the invention provides a method for identifying compounds that modulate ⁇ i.e., either facilitate or block) activity ⁇ e.g., activity such as receptor binding) of the ADDL.
- This method preferably comprises: (a) contacting separate cultures of neuronal cells with the oligomeric structure of the invention either in the presence or absence of contacting with the test compound; (b) adding a reagent that binds to the oligomeric structure, the reagent being fluorescent;
- the method desirably is carried out wherein the oligomeric structure is formed from amyloid ⁇ 1-42 protein (or another amyloid ⁇ ) prepared such that it comprises a binding moiety capable of binding the fluorescent reagent.
- the method can be employed for identifying compounds that modulate ⁇ i.e., either facilitate or block) formation or activity (e.g., binding to a cell surface protein, such as a receptor) of the oligomeric structure comprising:
- the method can be carried out wherein the oligomeric structure is formed from amyloid ⁇ protein prepared such that it comprises a binding moiety capable of binding the fluorescent reagent.
- the fluorescence of the cultures further optionally is compared with the fluorescence of cultures that have been treated in the same fashion except that instead of adding or not adding test compound prior to formation of the oligomeric structure, the test compound either is or is not added after formation of the oligomeric structure.
- compounds that block formation of the oligomeric structure are identified as resulting in a reduced fluorescence of the culture, and compounds that facilitate formation of the oligomeric structure are identified as resulting in an increased fluorescence of the culture, as compared to the corresponding culture contacted with the oligomeric structure in the absence of the test compound, only when the compound is added prior to oligomeric structure.
- a cell surface protein e.g., a receptor
- compounds that facilitate binding to a cell surface protein of the oligomeric structure are identified as resulting in an increased fluorescence of the culture, as compared to the corresponding culture contacted with the oligomeric structure in the absence of the test compound, when the compound is added either prior to or after oligomeric structure.
- a cell-based assay particularly a cell-based enzyme- linked immunosorbent assay (ELISA) can be employed in accordance with the invention to assess ADDL binding activity.
- the method can be employed to detect binding of the oligomeric structure to a cell surface protein. This method preferably comprises:
- an antibody e.g., 6E10
- said antibody including a conjugating moiety (e.g., biotin, or other appropriate agent);
- the antibody can be any antibody capable of detecting ADDLs (e.g., an antibody specific for ADDLs or an antibody directed to an exposed site on amyloid ⁇ ), and the antibody conjugating moiety can be any agent capable of linking a means of detection (e.g., an enzyme).
- the enzyme can be any moiety (e.g., perhaps even other than a protein) that provides a means of detecting (e.g., color change due to cleavage of a substrate), and further, can be bound (e.g., covalent or noncovalent) to the antibody bound to the oligomeric structure by means of another moeity (e.g., a secondary antibody).
- step (b) should be carried out as described herein such that ADDLs are able to bind to cells.
- step (c) should be carried out for a sufficient length of time (e.g., from about 10 minutes to about 2 hours, desirably for about 30 minutes) and under appropriate conditions (e.g., at about room temperature, preferably with gentle agitation) to allow antibody to bind to ADDLs.
- appropriate blocking steps can be carried out such as are known to those skilled in the art using appropriate blocking reagents to reduce any nonspecific binding of the antibody. The artisan is familiar with ELISAs and can employ modifications to the assay such as are known in the art.
- the assay desirably also can be carried out so as to identify compounds that modulate ⁇ i.e., either facilitate or block) formation or binding to a cell surface protein of the oligomeric structure.
- the test compound is either added to the ADDL preparation, prior to the contacting of the cells with the ADDLs.
- This assay thus can be employed to detect compounds that modulate formation of the oligomeric structure (e.g., as previously described).
- the test compound can be added to the ADDL preparation prior to contacting the cells (but after ADDL formation), or to the cells prior to contact with ADDLs. This method (e.g., as previously described) can be employed to detect compounds that modulate ADDL binding to the cell surface.
- a test compound can be added to the mixture of cells plus ADDLs.
- This method e.g., as previously described
- a cell surface protein e.g., to an ADDL receptor
- the specificity of the compounds for acting on an ADDL-mediated downstream effect can be confirmed, for instance, by simply adding the test compound in the absence of any coincubation with ADDLs.
- further appropriate controls e.g., as set forth in the following Examples and as known to those skilled in the art should be included with all assays.
- the present invention provides a method for identifying compounds that block formation of the oligomeric structure of the invention, wherein the method desirably comprises:
- This information on compounds that modulate ⁇ i.e., facilitate or block) formation, activity, or formation and activity, including, but not limited to, binding to a cell surface protein, of the oligomeric structure can be employed in the research and treatment of ADDL-mediated diseases, conditions, or disorders.
- the methods of the invention can be employed to investigate the activity and neurotoxicity of the ADDLs themselves. For instance, when 20 nL of the ADDL preparation was injected into the hippocampal region of an adult mouse 60-70 minutes prior to the conduct of a long-term potentiation (LTP) experiment ⁇ see e.g., Namgung et al. (1995) Brain Research, vol. 689, pp.
- LTP long-term potentiation
- the stimulation phase of the experiment occurred in a manner identical with saline control injections, but the consolidation phase showed a significant, continuing decline in synaptic activity as measured by cell body spike amplitude, over the subsequent 2 hours, compared with control animals, in which synaptic activity remained at a level comparable to that exhibited during the stimulation phase.
- Analysis of brain slices after the experiment indicated that no cell death had occurred.
- the invention provides a method for assaying the effects of ADDLs that preferably comprises:
- the method optionally is carried out wherein the long-term potentiation response of the animal is compared to the long-term potentiation response of another animal treated in the same fashion except having saline administered instead of oligomeric structure prior to application of the electrical stimulus.
- This method further can be employed to identify compounds that modulate ⁇ i.e., increase or decrease) the effects of the ADDLs, for instance, by comparing the LTP response in animals administered ADDLs either alone, or, in conjunction with test compounds.
- the invention provides a method for identifying compounds that modulate the effects of the ADDL oligomeric structure.
- the method preferably comprises:
- the method further optionally comprises administering oligomeric structure to the hippocampus either before, along with, or after administering the saline or test compound.
- the present invention provides a method for identifying compounds that modulate ⁇ i.e., either increase or decrease) the neurotoxicity of the ADDL protein assembly, which method comprises:
- Compounds that block the neurotoxicity of the oligomeric structure are identified, for example, as resulting in an increased proportion of viable cells in the culture as compared to the corresponding culture contacted with the oligomeric structure in the absence of the test compound.
- Compounds that increase the neurotoxicity of the oligomeric structure are identified, for example, as resulting in a reduced portion of viable cells in the culture as compared to the corresponding culture contacted with the oligomeric structure in the presence of the test compound.
- ADDLs bring about a rapid morphological change in serum-starved B103 cells, and they also activate Fyn kinase activity in these cells within 30 minutes of ADDL treatment (data not shown).
- ADDLs also induce rapid complex formation between Fyn and focal adhesion kinase (FAK) (Zhang ef al. (1996) Neurosci. Lett., vol. 211 , pp. 1-4), and translocating of several phosphorylated proteins and Fyn-Fak complex to a Triton-insoluble fraction (Berg ef al. (1997) J.
- FAM focal adhesion kinase
- ADDLs may be important neuroprotective drugs for Alzheimer's disease.
- ADDLs when ADDLs are added to cultures of primary astrocytes, the astrocytes become activated and the mRNA for several proteins, including IL-1 , inducible nitric oxide synthase, Apo E, Apo J and ⁇ 1- antichymotrypsin become elevated.
- IL-1 inducible nitric oxide synthase
- Apo E Apo J
- ⁇ 1- antichymotrypsin become elevated.
- test material is contacted with serum-starved neuroblastoma cells (e.g., B103 neuroblastoma cells); and
- morphological changes in the cells are measured by comparing the morphology of the cells against neuroblastoma cells that have not been contacted with the test material.
- test material is contacted with brain slice cultures
- brain cell death is measured as compared against brain slice cultures that have not been contacted with the test material.
- the method further desirably can be conducted wherein:
- test material is contacted with neuroblastoma cells (e.g., B103 neuroblastoma cells); and
- Fyn kinase activity can be compared making use of a commercially available kit (e.g., Kit #QIA-28 from Oncogene Research Products, Cambridge, MA) or using an assay analogous to that described in Borowski ef al. (1994) J. Biochem. (Tokyo), vol. 115, pp. 825-829.
- Kit #QIA-28 from Oncogene Research Products, Cambridge, MA
- the method desirably comprises:
- the method optionally comprises:
- proteins selected from the group consisting of interleukin-1 , inducible nitric oxide synthase, Apo E, Apo J, and ⁇ 1-antichymotrypsin
- ADDLs according to the present invention have utility in vitro.
- Such ADDLs can be used inter alia as a research tool in the study of ADDL binding and interaction within cells and in a method of assaying ADDL activity.
- ADDLs and studies of ADDL formation, activity and modulation can be employed in vivo.
- the compounds identified using the methods of the present invention can be used to treat any one of a number of diseases, disorders, or conditions that result in deficits in cognition or learning ⁇ i.e., due to a failure of memory), and/or deficits in memory itself.
- Such treatment or prevention can be effected by administering compounds that prevent formation and/or activity of the ADDLs, or that modulate (i.e., increase or decrease the activity of, desirably as a consequence of impacting ADDLs) the cell agents with which the ADDLs interact (e.g., so-called "downstream" events).
- Such compounds having ability to impact ADDLs are referred to herein as "ADDL-modulating compounds”.
- ADDL- modulating compounds not only can act in a negative fashion, but also, in some cases preferably are employed to increase the formation and/or activity of the ADDLs.
- the method when employed in vivo, can be employed for protecting an animal against decreases in cognition, learning or memory due to the effects of the ADDL protein assembly.
- This method comprises administering a compound that blocks the formation or activity of the ADDLs.
- deficits in cognition, learning and/or memory accrue due to ADDL formation and/or activity such deficits can be reversed or restored once the activity (and/or formation) of ADDLs is blocked.
- the invention thus preferably provides a method for reversing (or restoring) in an animal decreases in cognition, learning or memory due to the effects of an oligomeric structure according to the invention.
- This method preferably comprises blocking the formation or activity of the ADDLs.
- the invention thus also desirably provides a method for reversing in a nerve cell decreases in long-term potentiation due to the effects of a soluble non-fibrillar amyloid ⁇ oligomeric structure according to the invention (as well as protecting a nerve cell against decrease in long-term potentiation due to the effects of a soluble non-fibrillar amyloid ⁇ oligomeric structure), the method comprising contacting the cell with a compound that blocks the formation or activity of the oligomeric structure.
- this method desirably can be applied in the treatment or prevention of a disease, disorder, or condition that manifests as a deficit in cognition, learning and/or memory and which is due to ADDL formation or activity, especially a disease, disorder, or condition selected from the group consisting of Alzheimer's disease, adult Down's syndrome ⁇ i.e., over the age of 40 years), and senile dementia.
- this method desirably can be applied in the treatment or prevention of early deleterious effects on cellular activity, cognition, learning, and memory that may be apparent prior to the development of the disease, disorder, or condition itself, and which deleterious effects may contribute to the development of, or ultimately constitute the disease, disorder, or condition itself.
- the method preferably can be applied in the treatment or prevention of the early malfunction of nerve cells or other brain cells that can result as a consequence of ADDL formation or activity.
- the method preferably can be applied in the treatment or prevention of focal memory deficits (FMD) such as have been described in the literature (see e.g., Linn ef al. (1995) Arch. Neurol., vol. 52, pp.
- FMD focal memory deficits
- the method further desirably can be employed in the treatment or prevention of ADDL-induced aberrant neuronal signaling, impairment of higher order writing skills (see e.g., Snowdon ef al. (1996) JAMA, vol. 275, pp. 528-532) or other higher order cognitive function, decreases in (or absence of) long-term potentiation, that follows as a consequence of ADDL formation or activity.
- ADSL-induced aberrant neuronal signaling can be measured by a variety of means. For instance, for normal neuronal signaling (as well as observation of a long-term potentiation response), it appears that among other things, Fyn kinase must be activated, Fyn kinase must phosphorylate the NMDA channel (Miyakawa et al. (1997) Science, vol. 278, pp. 698-701 ; Grant (1996) J. Physiol. Paris, vol. 90, pp.
- ADDL-induced aberrant neuronal signaling which is a signaling malfunction that is induced by aberrant activation of cellular pathways by ADDLs
- knowledge thereof can be employed in the methods of the invention, such as would be obvious to one skilled in the art.
- ADDL-induced aberrant cell signaling can be assessed (e.g., as a consequence of contacting nerve cells with ADDLs, which may further be conducted in the presence or absence of compounds being tested for ADDL-modulating activity) using any of these measures, or such as would be apparent to one skilled in the art, e.g., Fyn kinase activation (or alteration thereof), Fyn-FAK complex formation (or alteration thereof), cytoskeletal reorganization (or alteration thereof), Fyn kinase subcellular localization (or alteration thereof), Fyn kinase phosphorylation of the NMDA channel (or alteration thereof).
- Fyn kinase activation or alteration thereof
- Fyn-FAK complex formation or alteration thereof
- cytoskeletal reorganization or alteration thereof
- Fyn kinase subcellular localization or alteration thereof
- Fyn kinase phosphorylation of the NMDA channel or alteration thereof.
- amyloid formation can be (but need not necessarily be) modeled as a two-phase process.
- amyloid precursor protein e.g., the amyloid precursor protein of 695 amino acids (Kang ef al. (1987) Nature, vol. 325, pp. 733-736) or the 751 amino acid protein (Ponte ef al. (1988) Nature, vol. 331 , pp.
- amyloid processing and/or deposition into higher molecular weight structures e.g., fibrils, or any other structure of ⁇ amyloid having a molecular weight greater than ⁇ amyloid monomer, and including structures that are considerably smaller than plaques and pre-plaques. It is conceivable that some compounds may impact one or both of these phases. For some compounds, a deleterious effect is obtained, but it is not clear whether the locus of inhibition is on protein production, or on amyloid processing and/or deposition.
- compounds that act at either the first or second phase, or both phases are compounds that act at either the first or second phase, or both phases.
- compounds that modulate the second phase have special utility to impact ADDLs and find use in methods of treatment that rely on ADDL modulation.
- Such compounds that modulate (e.g., block) the deposition of amyloid into higher molecular weight structures include, but are not limited to, compounds that modulate (particularly compounds that impede) the incorporation of ⁇ amyloid monomers into higher molecular weight structures, especially fibrils.
- such compounds that impair incorporation of ⁇ amyloid monomers into higher molecular weight structures can be employed to exert an inhibitory effect on ADDL formation and/or activity ⁇ i.e., by reducing formation of ADDLs), in accordance with the methods of the invention.
- ADDLs ⁇ amyloid monomers
- Such known modulators that desirably can be employed in the present invention are described as follows, however, other similar modulators also can be employed.
- PCT International Application WO 96/39834 and Canadian Application 2222690 pertain to novel peptides capable of interacting with a hydrophobic structural determinant on a protein or peptide for amyloid or amyloid-like deposit formation, thereby inhibiting and structurally blocking the abnormal folding of proteins and peptides into amyloid and amyloid-like deposits.
- the '834 application pertains to inhibitory peptides comprising a sequence of from about 3 to about 15 amino acid residues and having a hydrophobic cluster of at least three amino acids, wherein at least one of the residues is a ⁇ -sheet blocking amino acid residue selected from Pro, Gly, Asn, and His, and the inhibitory peptide is capable of associating with a structural determinant on the protein or peptide to structurally block and inhibit the abnormal filing into amyloid or amyloid-like deposits.
- PCT International Application WO 95/09838 pertains to a series of peptidergic compounds and their administration to patients to prevent abnormal deposition of ⁇ amyloid peptide.
- PCT International Application WO 98/08868 pertains to peptides that modulate natural ⁇ amyloid peptide aggregation.
- These peptide modulators comprise three to five D-amino acid residues and include at least two D-amino acid residues selected from the group consisting of D-leucine, D-phenylalanine, and D-valine.
- an amyloid modulator compound that comprises an amyloidogenic protein or peptide fragment thereof (e.g., transthyretin, prion protein, islet amyloid polypeptide, atrial natriuretic factor, kappa light chain, lambda light chain, amyloid A, procalcitonin, cystatin C, ⁇ 2-microglobulin, ApoA-1 , gelsolin, procalcitonin, calcitonin, fibrinogen, and lysozyme) coupled directly or indirectly to at least one modifying group (e.g., comprises a cyclic, heterocyclic, or polycyclic group, contains a cis- decalin group, contains a cholanyl structure, is a cholyl group, comprises a biotin- containing group, a fluorescein-containing group, etc.) such that the compound modulates the aggregation of natural amyloid proteins or peptides
- an amyloidogenic protein or peptide fragment thereof e
- PCT International Application WO 97/21728 pertains to peptides that incorporate the Lys-Leu-Val-Phe-Phe (KVLFF) sequence of amyloid ⁇ that is necessary for polymerization to occur. Peptides that incorporate this sequence bind to amyloid ⁇ and are capable of blocking fibril formation.
- KVLFF Lys-Leu-Val-Phe-Phe
- PCT International Application WO 97/16191 pertains to an agent for inhibiting the aggregation of amyloid protein in animals by administering a 9-acridinone compound having the formula:
- R 1 and R 2 are hydrogen, halo, nitro, amino, hydroxy, trifluoromethyl, alkyl, alkoxy, and alkythio;
- R 3 is hydrogen or alkyl;
- R 4 is alkylene-N R 5 R 6 , wherein R 5 and R 6 are independently hydrogen, C C 4 alkyl, or taken together with the nitrogen to which they are attached are piperidyl or pyrrolidinyl, and the pharmaceutically acceptable salts thereof.
- the disclosed compounds previously were identified as antibacterial and antitumor agents (U.S. Patent 4,626,540) and as antitumor agents (Cholody ef al. (1990) J. Med. Chem., vol. 33, pp. 49-52; Cholody ef al.
- PCT International Application WO 97/16194 pertains to an agent for inhibiting the aggregation of amyloid protein in animals by administering a naphthylazo compound having the formula:
- R 1 and R 2 independently are hydrogen, alkyl, substituted alkyl, or a complete heterocyclic ring
- R 3 is hydrogen or alkyl
- R 4 ,R 5 , R 6 , and R 7 are substituent groups including, but not limited to hydrogen, halo, alkyl, and alkoxy.
- Japanese Patent 9095444 pertains to an agent for inhibiting the agglomeration and/or deposition of amyloid protein wherein this agent contains a thionaphthalene derivative of the formula:
- R is a 1-5 carbon alkyl substituted with OH or COOR 4 (optionally substituted by aryl, heterocyclyl, COR 5 , CONHR 6 , or cyano;
- R 4 is H or 1-10 carbon alkyl, 3-10 carbon alkenyl, 3-10 carbon cyclic alkyl (all optionally substituted);
- R 5 and R 6 are optionally substituted aryl or heterocyclyl;
- R 1 and R 2 are H, 1-5 carbon alkyl or phenyl;
- R 3 is hydrogen, 1-5 carbon alkyl or COR 7 ;
- R 7 is OR', -R" or-N(R'") 2 ;
- R ⁇ R", R'" is 1-4 carbon alkyl.
- Japanese Patent 7309760 and PCT International Application WO 95/11248 pertain to inhibitors of coagulation and/or deposition of amyloid ⁇ protein which are particular rifamycin derivatives.
- Japanese Patent 7309759 pertains to inhibitors of coagulation and/or deposition of amyloid ⁇ protein which are particular rifamycin SV derivatives.
- Japanese Patent 7304675 pertains to inhibitors of agglutination and/or precipitation of amyloid ⁇ protein which are particular 3-homopiperazinyI-rifamycin derivatives.
- Japanese Patent 7247214 pertains to pyridine derivatives and that salts or prodrugs that can be employed as inhibitors of ⁇ -amyloid formation or deposition.
- U.S. Patent 5,427,931 pertains to a method for inhibiting deposition of amyloid plaques in a mammal that comprises the administration to the mammal of an effective plaque-deposition inhibiting amount of protease nexin-2, or a fragment or analog thereof.
- PCT International Application WO 96/25161 pertains to a pharmaceutical composition for inhibiting production or secretion of amyloid ⁇ protein, which comprises a compound having the formula:
- R represents OR 1 ,
- R 1 , R 2 and R 3 are the same or different and each is selected from a hydrogen atom, an optionally substituted hydrocarbon group or R 2 and R 3 , taken together with the adjacent nitrogen atom, form an optionally substituted nitrogen-containing heterocyclic group, and Y is an optionally substituted alkyl group, or a pharmaceutically acceptable salt thereof, if necessary, with a pharmaceutically acceptable excipient, carrier or diluent.
- modulators e.g., of the first phase or the second phase
- gossypol and gossypol derivatives be employed.
- modulators are employed that have ability to impact ADDL activity (e.g., PCT International Applications WO 93/15112 and 97/26913).
- ADDLs themselves may be applied in treatment. It has been discovered that these novel assemblies described herein have numerous unexpected effects on cells that conceivably can be applied for therapy. For instance, ADDLs activate endothelial cells, which endothelial cells are known, among other things to interact with vascular cells. Along these lines, ADDLs could be employed, for instance, in wound healing. Also, by way of example, Botulinum Toxin Type A (BoTox) is a neuromuscular junction blocking agent produced by the bacterium Clostridium botulinum that acts by blocking the release of the neurotransmitter acetylcholine. Botox has proven beneficial in the treatment of disabling muscle spasms, including dystonia.
- BoTox Botulinum Toxin Type A
- ADDLs themselves theoretically could be applied to either command neural cell function or, to selectively destroy targeted neural cells (e.g., in cases of cancer, for instance of the central nervous system, particularly brain). ADDLs appear further advantageous in this regard given that they have very early effects on cells, and given that their effect on cells (apart from their cell killing effect) appears to be reversible.
- a cell can be any cell, and, preferably, is a eukaryotic cell.
- a eukaryotic cell is a cell typically that possesses at some stage of its life a nucleus surrounded by a nuclear membrane.
- the eukaryotic cell is of a multicellular species (e.g., as opposed to a unicellular yeast cell), and, even more preferably, is a mammalian (optionally human) cell.
- the method also can be effectively carried out using a wide variety of different cell types such as avian cells, and mammalian cells including but not limited to rodent, primate (such as chimpanzee, monkey, ape, gorilla, orangutan, or gibbon), feline, canine, ungulate (such as ruminant or swine), as well as, in particular, human cells.
- Preferred cell types are cells formed in the brain, including neural cells and glial cells.
- An especially preferred cell type according to the invention is a neural cell (either normal or aberrant, e.g., transformed or cancerous).
- the neural cell is a neuroblastoma cell.
- a cell can be present as a single entity, or can be part of a larger collection of cells.
- a "larger collection of cells” can comprise, for instance, a cell culture (either mixed or pure), a tissue (e.g., neural or other tissue), an organ (e.g., brain or other organs), an organ system (e.g., nervous system or other organ system), or an organism (e.g., mammal, or the like).
- the organs/tissues/cells of interest in the context of the invention are of the central nervous system (e.g., are neural cells).
- contacting comprises any means by which these agents physically touch a cell.
- the method is not dependent on any particular means of introduction and is not to be so construed.
- Means of introduction are well known to those skilled in the art, and also are exemplified herein. Accordingly, introduction can be effected, for instance, either in vitro ⁇ e.g., in an ex vivo type method of therapy or in tissue culture studies) or in vivo. Other methods also are available and are known to those skilled in the art.
- Such "contacting” can be done by any means known to those skilled in the art, and described herein, by which the apparent touching or mutual tangency of the ADDLs and ADDL-modulating compounds and the cell can be effected.
- contacting can be done by mixing these elements in a small volume of the same solution.
- the elements further can be covalently joined, e.g., by chemical means known to those skilled in the art, or other means, or preferably can be linked by means of noncovalent interactions (e.g., ionic bonds, hydrogen bonds, Van der Waals forces, and/or nonpolar interactions).
- the cell to be affected and the ADDL or ADDL-modulating compound need not necessarily be brought into contact in a small volume, as, for instance, in cases where the ADDL or ADDL-modulating compound is administered to a host, and the complex travels by the bloodstream or other body fluid such as cerebrospinal fluid to the cell with which it binds.
- the contacting of the cell with a ADDL or ADDL-modulating compound sometimes is done either before, along with, or after another compound of interest is administered. Desirably this contacting is done such that there is at least some amount of time wherein the coadministered agents concurrently exert their effects on a cell or on the ADDL.
- an agent e.g., an ADDL or ADDL-modulating compound
- suitable methods of administering an agent e.g., an ADDL or ADDL-modulating compound
- an agent e.g., an ADDL or ADDL-modulating compound
- suitable methods of administering an agent (e.g., an ADDL or ADDL-modulating compound) of the present invention to an animal for purposes of therapy and/or diagnosis, research or study are available, and, although more than one route can be used for administration, a particular route can provide a more immediate and more effective reaction than another route.
- Pharmaceutically acceptable excipients also are well-known to those who are skilled in the art, and are readily available. The choice of excipient will be determined in part by the particular method used to administer the agent. Accordingly, there is a wide variety of suitable formulations for use in the context of the present invention. The following methods and excipients are merely exemplary and are in no way limiting.
- Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the compound dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as solids or granules; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
- Tablet forms can include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible excipients.
- Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients as are known in the art.
- An agent of the present invention alone or in combination with other suitable ingredients, can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also can be formulated as pharmaceuticals for non-pressured preparations such as in a nebulizer or an atomizer.
- Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- the formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
- Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
- the dose administered to an animal, particularly a human, in the context of the present invention will vary with the agent of interest, the composition employed, the method of administration, and the particular site and organism being treated. However, preferably a dose corresponding to an effective amount of an agent (e.g., an ADDL or ADDL-modulating compound according to the invention) is employed.
- an agent e.g., an ADDL or ADDL-modulating compound according to the invention.
- An "effective amount” is one that is sufficient to produce the desired effect in a host, which can be monitored using several end-points known to those skilled in the art.
- desired effects include, but are not limited to, an effect on learning, memory, LTP response, neurotoxicity, ADDL formation, ADDL cell surface protein (e.g., receptor) binding, antibody binding, cell morphological changes, Fyn kinase activity, astrocyte activation, and changes in mRNA levels for proteins such as interleukin-1 , inducible nitric oxide synthase, ApoE, ApoJ, and ⁇ 1-antichymotrypsin.
- ADDL cell surface protein e.g., receptor
- antibody binding e.g., antibody binding
- cell morphological changes Fyn kinase activity
- astrocyte activation e.g., astrocyte activation
- changes in mRNA levels for proteins such as interleukin-1 , inducible nitric oxide synthase, ApoE, ApoJ, and ⁇ 1-antichymotrypsin.
- ADDLs or ADDL-modulating compounds can vary depending on whether the composition is administered in combination with other pharmaceutical compositions, or depending on interindividual differences in pharmacokinetics, drug disposition, and metabolism.
- amounts can vary in in vitro applications depending on the particular cell type utilized or the means or solution by which the ADDL or ADDL- modulating compound is transferred to culture.
- One skilled in the art easily can make any necessary adjustments in accordance with the requirements of the particular situation.
- Direct techniques include, but are not limited to, the placement of a drug delivery catheter into the ventricular system of the host, thereby bypassing the blood-brain barrier.
- Indirect techniques include, but are not limited to, the formulation of the compositions to convert hydrophilic drugs into lipid-soluble drugs using techniques known in the art (e.g., by blocking the hydroxyl, carboxyl, and primary amine groups present on the drug) which render the drug able to cross the blood-brain barrier.
- the delivery of hydrophilic drugs can be improved, for instance, by intra-arterial infusion of hypertonic solutions (or other solutions) which transiently open the blood brain barrier.
- ADDLs were prepared by dissolving 1 mg of solid amyloid ⁇ 1-42 (e.g., synthesized as described in Lambert ef al. (1994) J. Neurosci. Res., vol. 39, pp. 377-395) in 44 ⁇ L of anhydrous DMSO. This 5 mM solution then was diluted into cold (4°C) F12 media (Gibco BRL, Life Technologies, Gaithersburg, Md)) to a total volume of 2.20 mL (50-fold dilution), and vortexed for about 30 seconds.
- solid amyloid ⁇ 1-42 e.g., synthesized as described in Lambert ef al. (1994) J. Neurosci. Res., vol. 39, pp. 377-395
- This 5 mM solution then was diluted into cold (4°C) F12 media (Gibco BRL, Life Technologies, Gaithersburg, Md)) to a total volume of 2.20 mL (50-fold d
- ADDLs were formed at a concentration of A ⁇ protein of 100 ⁇ M. Typically, the highest concentration used for experiments is 10 ⁇ M and, in some cases, ADDLs (measured as initial A ⁇ concentration) were diluted (e.g., in cell culture media) to 1 nM.
- atomic force microscopy For analysis by atomic force microscopy (AFM), a 20 ⁇ L aliquot of the 1 :100 dilution was applied to the surface of a freshly cleaved mica disk and analyzed. Other manipulations were as described as follows, or as is apparent.
- ADDL formation was carried out as described above, with the exception that the F12 media was replaced by a buffer ⁇ i.e., "substitute F12 media" containing the following components: N, N-dimethylglycine (766 mg/L), D-glucose (1.802 g/L), calcium chloride (33 mg/L), copper sulfate pentahydrate (25 mg/L), iron(ll) sulfate heptahydrate (0.8 mg/L), potassium chloride (223 mg/L), magnesium chloride (57 mg/L), sodium chloride (7.6 g/L), sodium bicarbonate (1.18 g/L),disodium hydrogen phosphate (142 mg/L), and zinc sulfate heptahydrate (0.9 mg/L).
- the pH of the buffer was adjusted to 8.0 using 0.1 M sodium hydroxide.
- Glutaraldehyde has been successfully used in a variety of biochemical systems. Glutaraldehyde tends to crosslink proteins that are directly in contact, as opposed to nonspecific reaction with high concentrations of monomeric protein.
- glutaraldehyde-commanded crosslinking of amyloid ⁇ was investigated. Oligomer preparation was carried out as described in Example 1 , with use of substitute F12 media. The supernatant that was obtained following centrifugation (and in some cases, fractionation) was treated with 0.22 mL of a 25% aqueous solution of glutaraldehyde (Aldrich, St.
- This example sets forth the size characterization of ADDLs formed as in Example 1 using a variety of methods (e.g., native gel electophoresis, SDS- polyacrylamide gel electrophoresis, AFM, field flow fractionation, immunorecognition, and the like).
- AFM was carried out essentially as described previously (e.g., Stine ef al.
- Section and width analysis are in separate analysis modules in the Nanoscope Ilia software.
- ADDL analysis there is a systematic deviation between the sizes obtained by section analysis and those obtained by width analysis. Namely, for a 4 ⁇ scan, section analysis yields heights that are usually about 0.5 nm taller, thus resulting in a deviation of about 0.5 nm in the values obtained for the sizes of the globules.
- ADDLs were resolved on 4-20% tris-glycine gels under non-denaturing conditions (Novex). Electrophoresis was performed at 20 mA for approximately 1.5 hours. Proteins were resolved with SDS-PAGE as described in Zhang ef al. (1994) J. Biol. Chem., vol. 269, pp. 25247-25250. Protein was then visualized using silver stain (e.g., as described in Sherchenko ef al. (1996) Anal. Chem., vol. 68, pp. 850-858).
- ADDLs Size characterization of ADDLs by AFM section analysis (e.g., as described in Stine ef al. (1996) J. Protein Chem., vol. 15, pp. 193-203) or width analysis (Nanoscope III software) indicated that the predominant species were globules of about 4.7 nm to about 6.2 nm along the z-axis. Comparison with small globular proteins ⁇ A ⁇ 1-40 monomer, aprotinin, bFGF, carbonic anhydrase) suggested that ADDLs had mass between 17-42 kD. What appear to be distinct species can be recognized.
- globules of dimensions of from about 4.9 nm to about 5.4 nm, from about 5.4 nm to about 5.7 nm, and from about 5.7 nm to about 6.2 nm.
- the globules of dimensions of about 4.9-5.4 nm and 5.7-6.2 nm appear to comprise about 50% of globules.
- An ADDL preparation according to the invention was fractionated on a Superdex 75 column (Pharmacia, Superose 75PC 3.2/3.0 column).
- the fraction comprising the ADDLs was the third fraction of UV absorbance eluting from the column and was analyzed by AFM and SDS-polyacryalamide gel electrophoresis.
- a representative AFM analysis of fraction 3 is depicted in Fig. 3. Fractionation resulted in greater homogeneity for the ADDLs, with the majority of the globules having dimensions of from about 4.9 nm to about 5.4 nm.
- SDS-polyacrylamide gel electrophoresis of the fraction demonstrated a heavy lower band corresponding to the monomer/dimer form of A ⁇ .
- Clusterin treatment was carried out as described in Oda et al. ⁇ Exper. Neurol., vol. 136, pp. 22-31 (1995)) basically by adding clusterin in the incubation described in Example 1.
- the starting A ⁇ 1-42 could be dissolved in 0.1 N HCl, rather than DMSO, and this starting A ⁇ 1-42 could even have fibrillar structures at the outset.
- incubation with clusterin for 24 hours at room temperature of 37°C resulted in preparations that were predominantly free of fibrils, consistent with their slow sedimentation. This was confirmed by experiments showing that fibril formation decreases as the amount of clusterin added increases.
- the preparations resulting from clusterin treatment exclusively comprised small globular structures approximately 5-6 nm in size as determined by AFM analysis of ADDLs fractionated on a Superdex 75 gel column. Equivalent results were obtained by conventional electron microscopy. In contrast, A ⁇ 1-42 that had self-associated under standard conditions (Snyder ef al. (1994) Biophys. J., vol. 67, pp. 1216-1228) in the absence of clusterin showed primarily large, non- diffusible fibrillar species. Moreover, the resultant ADDL preparations were passed through a Centricon 10 kD cut-off membrane and analyzed on as SDS- polyacrylamide gradient gel. As can be seen in Fig.
- ADDLs are retained by the filter. Monomer found after the separation could only be formed from the larger molecular weight species retained by the filter.
- the toxic moieties in Example 4 could comprise rare structures that contain oligomeric A ⁇ and clusterin.
- Oda ef al. ⁇ Exper. Neurol., vol. 136, pp. 22-31 (1995) reported that clusterin was found to increase the toxicity of A ⁇ 1-42 solutions, others have found that clusterin at stoichiometric levels protects against A ? 1-40 toxicity (Boggs ef al. (1997) J. Neurochem., vol. 67, pp. 1324-1327). Accordingly, ADDL formation in the absence of clusterin further was characterized in this Example.
- ADDLs essentially indistinguishable from those chaperoned by clusterin.
- ADDLs also formed when monomeric A ⁇ solutions were incubated at 37 degrees in brain slice culture medium but at very low concentration (50 nM), indicating a potential to form physiologically. All ADDL preparations were relatively stable and showed no conversion to fibrils during the 24 hour tissue culture experiments.
- Example 6 are Diffusible, Extremely Potent CNS Neurotoxins
- ADDLs were induced by clusterin, low temperature, or low A ⁇ concentration
- the stable oligomers that formed were potent neurotoxins. Toxicity was examined in organotypic mouse brain slice cultures, which provided a physiologically relevant model for mature CNS. Brain tissue was supported at the atmosphere-medium interface by a filter in order to maintain high viability in controls.
- brain slices were obtained from mouse strains B6 129 F2 and JR 2385 (Jackson Laboratories, Bar Harbor, ME) and cultured as previously described (Stoppini ef al. (1991) J. Neurosci. Meth., vol. 37, pp. 173- 182), with modifications. Namely, an adult mouse was sacrificed by carbon dioxide inhalation, followed by rapid decapitation.
- the head was immersed in cold, sterile dissection buffer (94 mL Gey's balanced salt solution, pH 7.2, supplemented with 2 mL 0.5M MgCI 2 , 2 ml 25% glucose, and 2 mL 1.0 M Hepes), after which the brain was removed and placed on a sterile Sylgard-coated plate.
- the cerebellum was removed and a mid-line cut was made to separate the cerebral hemispheres. Each hemisphere was sliced separately. The hemisphere was placed with the mid-line cut down and a 30 degree slice from the dorsal side was made to orient the hemisphere.
- the hemisphere was glued cut side down on the plastic stage of a Campden tissue chopper (previously wiped with ethanol) and immersed in ice cold sterile buffer. Slices of 200 ⁇ m thickness were made from a lateral to medial direction, collecting those in which the hippocampus was visible.
- Each slice was transferred with the top end of a sterile pipette to a small petri dish containing Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal calf serum, 2% S/P/F (streptomycin, penicillin, and fungizone; Life Technologies (Gibco, BRL), Gaithersburg, MD), observed with a microscope to verify the presence of the hippocampus, and placed on a Millicell-CM insert (Millipore) in a deep well tissue culture dish (Falcon, 6-well dish). Each well contained 1.0 mL of growth medium, and usually two slices were on each insert. Slices were placed in a incubator (6% CO 2 , 100% humidity) overnight.
- DMEM Dulbecco's Modified Eagle Medium
- S/P/F streptomycin, penicillin, and fungizone
- Life Technologies Gaithersburg, MD
- Millicell-CM insert Millipore
- the MetaMorph image analysis system (Universal Imaging Corporation, Philadelphia, PA) was used to quantify the number and/or area of cells showing green or red fluorescence.
- ADDLs were present for 24 hours at a maximal 5 ⁇ M dose of total A ⁇ ⁇ i.e., total A ⁇ was never more than 5 ⁇ M in any ADDL experiment).
- Cell death as shown by "false yellow staining", was almost completely confined to the stratum pyramidale (CA 3-4) and dentate gy s (DG) suggesting strongly that principal neurons of the hippocampus (pyramidal and granule cells, respectively) are the targets of ADDL-induced toxicity.
- CA 3-4 stratum pyramidale
- DG dentate gy s
- glia viability is unaffected by a 24 hour ADDL treatment of primary rat brain glia, as determined by trypan blue exclusion and MTT assay (Finch ef a/., unpublished).
- Dentate gyms (DG) and CA3 regions were particularly sensitive and showed ADDL-evoked cell death in every culture obtained from animals aged P20 (weanlings) to P84 (young adult). Up to 40% of the cells in this region die following chronic exposure to ADDLs. The pattern of neuronal death was not identical to that observed for NMDA, which killed neurons in DG and CA1 but spared CA3.
- FIG. 5 illustrates the % dead cells verses ADDL concentration measured as initial amyloid ⁇ 1-42 concentration (nM). Because of the difficulties of quantifying brain slices, the results are not detailed enough to determine the EC50 with precision. However, as can be seen in Fig. 5, even after 1000-fold dilution (-5 nM A ⁇ ), ADDL-evoked cell death was more than 20%. Toxicity was observed even with 0.3 nM ADDLs. This contrasts with results obtained with conventionally aged A ⁇ , which is toxic to neurons in culture at about 20 to about 50 ⁇ M. These data show that ADDLs are effective at doses approximately 1, 000-10,000-fold smaller than those used in fibrillar A ⁇ experiments.
- ADDLs were to pass through the culture-support filter to cause cell death, the results validate that ADDLs are diffusible, consistent with their small oligomeric size.
- the methods set forth herein can be employed as an assay for ADDL-mediated changes in cell viability.
- the assay can be carried out by co-incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such co-incubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- This example sets forth an assay that can be employed to detect an early toxicity change in response to amyloid ⁇ oligomers.
- PC12 cells were passaged at 4 x 10 4 cells/well on a 96-well culture plate and grown for 24 hours in DMEM + 10% fetal calf serum + 1% S/P/F (streptomycin, penicillin, and fungizone). Plates were treated with 200 ⁇ g/mL poly-l-lysine for 2 hours prior to cell plating to enhance cell adhesion.
- One set of six wells was left untreated and fed with fresh media, while another set of wells was treated with the vehicle control (PBS containing 10% 0.01 N HCl, aged o/n at RT). Positive controls were treated with triton (1%) and Na Azide (0.1 %) in normal growth media.
- Amyloid ⁇ oligomers prepared as described in Example 1 were added to the cells for 24 hours.
- MTT 0.5 mg/mL
- Healthy cells reduce the MTT into a formazan blue colored product.
- the media was aspirated and 100 ⁇ L of 100% DMSO was added to lyse the cells and dissolve the blue crystals.
- the plate was incubated for 15 min at RT and read on a plate reader (ELISA) at 550 nm.
- Fig. 6 The results of one such experiment are depicted in Fig. 6.
- control cells not exposed to ADDLs (“Cont")
- cells exposed to clusterin alone (“Apo J”)
- cells exposed to monomeric A ⁇ ⁇ "A ⁇ ” show no cell toxicity.
- cells exposed to amyloid ⁇ co-aggregated with clusterin and aged one day (“A ?:Apo J”) show a decrease in MTT reduction, evidencing an early toxicity change.
- the lattermost amyloid preparations were confirmed by AFM to lack amyloid fibrils.
- results of this experiment thus confirm that that ADDL preparations obtained from co-aggregation of A ⁇ mediated by clusterin have enhanced toxicity. Moreover, the results confirm that the PC 12 oxidative stress response can be employed as an assay to detect early cell changes due to ADDLs.
- the assay can be carried out by co-incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such co-incubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- This example sets forth a further assay of ADDL-mediated cell changes.
- the MTT oxidative stress toxicity assay presented in the preceding example can be carried out with HN2 cells instead of PC12 cells.
- Other appropriate cells similarly can be employed.
- HN2 cells were passaged at 4 x 10 4 cells/well on a 96-well culture plate and grown for 24 hours in DMEM + 10% fetal calf serum + 1 % S/P/F (streptomycin, penicillin, and fungizone). Plates were treated with 200 ⁇ g/mL poly l-lysine for 2 hours prior to cell plating to enhance cell adhesion.
- the cells were differentiated for 24-48 hours with 5 ⁇ M retinoic acid and growth was further inhibited with 1% serum.
- One set of wells was left untreated and given fresh media.
- Another set of wells was treated with the vehicle control (0.2% DMSO).
- Positive controls were treated with triton (1%) and sodium azide (0.1%).
- Amyloid ⁇ oligomers prepared as described in example 1 were added to the cells for 24 hours. After the 24 hour incubation, MTT (0.5 mg/mL) was added to the cells for 2.5 hours (11 ⁇ L of 5 mg/mL stock into 100 ⁇ L of media).
- the media was aspirated and 100 ⁇ L of 100% DMSO is added to lyse the cells and dissolve the blue crystals.
- the plate was incubated for 15 minutes at RT and read on a plate reader (ELISA) at 550 nm.
- This assay similarly can be carried out by co-incubating or co- administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such coincubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- This example sets forth yet another assay of ADDL-mediated cell changes
- the assay For this assay, cultures were grown to low density (50-60% confluence). To initiate the experiment, the cells were serum-starved in F12 media for 1 hour. Cells were then incubated for 3 hours with amyloid ⁇ oligomers prepared as described in example 1 , with and without inhibitor compounds added to the cells, for 24 hours. After 3 hours, cells were examined for morphological differences or fixed for immunofluorescence labeling. Samples were examined using the MetaMorph Image Analysis system and an MRI video camera (Universal Imaging, Inc.). Results of such assays are presented in the examples which follow. In particular, the assay can be carried out by co-incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such co-incubation or co- administration can be compared to results obtained with inclusion of ADDLs alone.
- cells were dissociated with 0.1 % trypsin and plated at least overnight onto tissue culture plastic at low density.
- Cells were removed with cold phosphate buffered saline (PBS) /0.5 mM EDTA, washed three times and resuspended in ice-cold PBS to a final concentration of 500,000 cells/mL.
- Cells were incubated in cold PBS with amyloid ⁇ oligomers prepared as described in Example 1 , except that 10% of the amyloid ⁇ is an amyloid ⁇ 1-42 analog containing biocytin at position 1 replacing aspartate. Oligomers with and without inhibitor compounds present were added to the cells for 24 hours.
- the cells were washed twice in cold PBS to remove free, unbound amyloid ⁇ oligomers, resuspended in a 1 :1 ,000 dilution of avidin conjugated to fluorescein, and incubated for one hour at 4°C with gentle agitation.
- avidin conjugated to fluorescein conjugated to fluorescein
- amyloid ⁇ -specific antibodies and fluorescent secondary antibody were employed instead of avidin, eliminating the need to incorporate 10% of the biotinylated amyloid ⁇ analog.
- biotinylated 6EI0 monoclonal antibody (1 ⁇ L Senetec, Inc., St. Louis, Missouri) was added to the cell suspension and incubated for 30 minutes. Bound antibody was detected after pelleting cells and resuspending in 500 ⁇ L PBS, using FITC-conjugated streptavidin (1 :500, Jackson Laboratories) for 30 minutes.
- FACScan Becton-Dickenson Fluorescence Activated Cell Scanner
- 10,000 or 20,000 events typically were collected for both forward scatter (size) and fluorescence intensity, and the data were analyzed by Consort 30 software (Becton-Dickinson). Binding was quantified by multiplying mean fluorescence by total number of events, and subtracting value for background cell fluorescence in the presence of 6E10 and FITC.
- the ADDLs exert their effects by binding to a specific cell surface receptor.
- the trypsin sensitivity of B103 cells showed that their ADDL binding sites were cell surface proteins and that binding was selective for a subset of particular domains within these proteins.
- the present assay can also be employed as an assay for ADDL- mediated cell binding.
- the assay can be carried out by co- incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such co-incubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- This example sets forth the manner in which ADDL formation can be inhibited using, for instance, gossypol.
- ADDLs were prepared as described in Example 1.
- Gossypol Aldrich
- the resulting preparation was assessed for neurotoxicity using the LIVE/DEAD® assay kit as previously described.
- the amount of cell death that occurred after 24 hours of exposure to the gossypol/ADDL preparation was less than 5%. This is comparable to the level of toxicity obtained for a corresponding DMSO control preparation ⁇ i.e., 6%), or a gossypol control preparation that did not contain any ADDLs ⁇ i.e., 4%).
- Tryptic peptides were prepared using confluent B103 cells from four 100 mm dishes. Medium was collected after a 3 minute trypsinization (0.025%, Life Technologies), trypsin-chymotrypsin inhibitor (Sigma, 0.5 mg/mL in Hank's Buffered Saline) was added, and cells were removed via centrifugation at 500 x g for 5 minutes. Supernatant (-12 mL) was concentrated to approximately 1.0 mL using a Centricon 3 filter (Amicon), and was frozen after the protein concentration was determined.
- trypsin-chymotrypsin inhibitor Sigma, 0.5 mg/mL in Hank's Buffered Saline
- sterile concentrated tryptic peptides (0.25 mg/mL) were added to the organotypic brain slice or to the suspended B103 cells in the FACs assay at the same time as the ADDLs were added.
- tryptic peptides released into the culture media (0.25 mg/mL) inhibited ADDL binding by > 90% as shown in Fig. 9.
- control cells exposed to BSA even at 100mg/mL, had no loss of binding. Tryptic peptides, if added after ADDLs were already attached to cells, did not significantly lower fluorescence intensities. This indicates that the peptides did not compromise the ability of the assay to quantify bound ADDLs.
- the tryptic peptides also were antagonists of ADDL- evoked cell death. Namely, as shown in Fig. 9, addition of tryptic peptides resulted in a 75% reduction in cell death, p ⁇ 0.002.
- the present assay can also be employed as an assay for agents that mediate ADDL cell binding or ADDL effects on cell activity. In particular, the assay can be carried out by co-incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity.
- Results obtained with such co-incubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- addition of the agents before or after binding of the ADDLs to the cell surface can be compared to identify agents that impact such binding, or that act after binding has occurred.
- This example sets forth dose response experiments done to determine whether ADDL binding to the cell surface is saturable. Such saturability would be expected if the ADDLs in fact interact with a particular cell surface receptor.
- ADDL binding Saturability of ADDL binding occurs at a relative A ⁇ 1-42 concentration ⁇ i.e., ADDL concentration relative to A ⁇ ) of about 250 nm.
- ADDL binding is saturable.
- Such saturability of ADDL binding especially when considered with the results of the trypsin studies, validates that the ADDLs are acting through a particular cell surface receptor.
- This example sets forth a cell-based assay, particularly a cell-based enzyme-linked immunosorbent assay (ELISA) that can be employed to assess ADDL binding activity. , .
- ELISA enzyme-linked immunosorbent assay
- ADDLs were prepared according to the method described in Example 1. To begin the assay, each microtiter plate well containing cells was treated with 50 ⁇ L of fixative (3.7% formalin in DMEM) for 10 minutes at room temperature. This fixative/DMEM solution was removed and a second treatment with 50 ⁇ L formalin (no DMEM) was carried out for 15 minutes at room temperature.
- fixative 3.7% formalin in DMEM
- the fixative was removed and each well was washed twice with 100 ⁇ L phosphate buffered saline (PBS). 200 ⁇ L of a blocking agent (1% BSA in PBS) was added to each well and incubated at room temperature for 1 hour. After 2 washes with 100 ⁇ L PBS, 50 ⁇ L of ADDLs (previously diluted 1 :10 in PBS), were added to the appropriate wells, or PBS alone as a control, and the resulting wells were incubated at 37°C for 1 hour.
- PBS phosphate buffered saline
- the plate was analyzed for increasing absorption at 405 nm. Only when ADDLs, cells, and 6E10 were present was there a significant signal, as illustrated in Fig. 11. These results further confirm that a cell-based ELISA assay can be employed as an assay for ADDL-mediated cell binding.
- the assay can be carried out by co-incubating or co-administering along with the ADDLs agents that potentially may increase or decrease ADDL formation and/or activity. Results obtained with such co-incubation or co-administration can be compared to results obtained with inclusion of ADDLs alone.
- Example 15 Fyn kinase knockout protects against ADDL neurotoxicity
- Fyn belongs to the Src- family of protein tyrosine kinases, which are central to multiple cellular signals and responses (Clark, E.A. & Brugge, J.S. (1995) Science, vol. 268, pp. 233- 239). Fyn is of particular interest because it is up-regulated in AD-afflicted neurons (Shirazi ef al. (1993) Neuroreport, vol. 4, pp. 435-437). It also appears to be activated by conventional A ⁇ preparations (Zhang ef al.
- Fyn knockout mice moreover, have reduced apoptosis in the developing hippocampus (Grant et al. (1992) Science, vol. 258, pp. 1903-1910). For these studies, Fyn knockout mice (Grant ef al. (1992) Science, vol.
- cortical astrocyte cultures were prepared from neonatal (1-2 day old) Sprague-Dawley rat pups by the method of Levison and McCarthy (Levison ef al. (1991) in Culturing Nerve Cells (Banker et al, Eds.), pp. 309-36, MIT Press, Cambridge, MA), as previously described (Hu et al. (1996) J. Biol. Chem., vol. 271 , pp. 2543-2547).
- cerebral cortex was dissected out, trypsinized, and cells were cultured in -MEM (Gibco, BRL) containing 10% fetal bovine serum (Hyclone Laboratories Inc., Logan UT) and antibiotics (100 U/mL penicillin, 100 mg/mL streptomycin). After 11 days in culture, cells were trypsinized and repiated into 100-mm plates at a density of -6 x10 5 cells/plate and grown until confluent (Hu ef al. (1996) J. Biol. Chem., vol. 271 , pp. 2543- 2547).
- Astrocytes were treated with ADDLs prepared according to Example 1 , or with A ⁇ 17-42 (synthesized according to Lambert ef al. J. Neurosci. Res., vol. 39, pp. 377-384 (1994); also commercially available). Treatment was done by trypsinizing confluent cultures of astrocytes and plating onto 60 mm tissue culture dishes at a density of 1 x 10 6 cells/dish (e.g., for RNA analysis and ELISAs), into 4-well chamber slides at 5 x 10 4 cells /well (e.g., for immunohistochemistry), or into 96-well plates at a density of 5 x 10 4 cells/well (e.g., for NO assays).
- astrocyte morphology was done by examining cells under a Nikon TMS inverted microscope equipped with a Javelin SmartCam camera, Sony video monitor and color video printer. Typically, four arbitrarily selected microscopic fields (20X magnification) were photographed for each experimental condition. Morphological activation was quantified from the photographs with NIH Image by counting the number of activated cells (defined as a cell with one or more processes at least one cell body in length) in the four fields. The mRNA levels in the cultures was determined with use of Northern blots and slot blots. This was done by exposing cells to ADDLs or control buffer for 24 hours.
- RNA was isolated by RNeasy purification mini-columns (Qiagen, Inc., Chatsworth, CA), as recommended by the manufacturer. Typical yields of RNA were 8 to 30 mg of total RNA per dish.
- RNeasy purification mini-columns Qiagen, Inc., Chatsworth, CA
- Typical yields of RNA were 8 to 30 mg of total RNA per dish.
- For Northern blot analysis 5 mg total RNA per sample was separated on an agarose-formaldehyde gel, transferred by capillary action to Hybond-N membrane (Amersham, Arlington Heights IL), and UV crosslinked.
- slot blot analysis 200 ng of total RNA per sample was blotted onto Duralon- UV membrane (Stratagene, La Jolla CA) under vacuum, and UV crosslinked. Confirmation of equivalent RNA loadings was done by ethidium bromide staining or by hybridization and normalization with a GAPDH probe.
- Probes were generated by restriction enzyme digests of plasmids, and subsequent gel purification of the appropriate fragment. Namely, cDNA fragments were prepared by RT-PCR using total RNA from rat cortical astrocytes. RNA was reverse transcribed with a Superscript II system (GIBCO/ BRL), and PCR was performed on a PTC-100 thermal controller (MJ Research Inc, Watertown, MA) using 35 cycles at the following settings: 52°C for 40 seconds; 72°C for 40 seconds; 96°C for 40 seconds. Primer pairs used to amplify a 447 bp fragment of rat IL-1 were: Forward: 5' GCACCTTCTTTCCCTTCATC 3' [SEQ ID NO:1].
- PCR products were cloned into the pCR2.1 vector with the Invitrogen TA cloning kit, and constructs were verified by DNA sequencing. Probes were prepared by EcoRI digestion of the vector, followed by gel purification of the appropriate fragments.
- the plasmids were the rat iNOS cDNA plasmid pAstNOS-4, corresponding to the rat iNOS cDNA bases 3007-3943 (Galea ef al. (1994) J. Neurosci. Res., vol. 37, pp. 406-414), and the rat GAPDH cDNA plasmid pTRI-GAPDH (Ambion, Inc., Austin TX).
- the probes (25 ng) were labeled with 32 P-dCTP by using a Prime-a-Gene Random-Prime labeling kit (Promega, Madison WI) and separated from unincorporated nucleotides by use of push-columns (Stratagene). Hybridization was done under stringent conditions with QuikHyb solution (Stratagene), using the protocol recommended for stringent hybridization. Briefly, prehybridization was conducted at 68°C for about 30 to 60 minutes, and hybridization was at 68°C for about 60 minutes. Blots were then washed under stringent conditions and exposed to either autoradiography or phosphoimaging plate.
- ADDLs activate glial cells. It is possible that glial proteins may contribute to neural deficits, for instance, as occur in Alzheimer's Disease, and that some effects of ADDLs may actually be mediated indirectly by activation of glial cells. In particular, glial proteins may facilitate formation of ADDLs, or ADDL-mediated effects that occur downstream of receptor binding. Also, it is known that clusterin is upregulated in the brain of the Alzheimer's diseased subject, and clusterin is made at elevated levels only in glial cells that are activated. Based on this, activation of glial cells by a non- ADDL, non-amyloid stimulus could produce clusterin which in turn might lead to ADDLs, which in turn would damage neurons and cause further activation of glial cells.
- neuroprotective benefits can be obtained by treatments that modulate ⁇ i.e., increase or decrease) ADDL-mediated glial cell activation. Further, the results suggest that blocking these effects on glial cells, apart from blocking the neuronal effects, may be beneficial.
- LTP Long-term potentiation
- Injections of intact animals Mice were anesthesized with urethane and placed in a sterotaxic apparatus. Body temperature was maintained using a heated water jacket pad. The brain surface was exposed through holes in the skull. Bregma and lambda positions for injection into the middle molecular layer of hippocampus are 2 mm posterior to bregma, 1 mm lateral to the midline, and 1.2-1.5 mm ventral to the brain surface. Amyloid ⁇ oligomer injections were by nitrogen puff through - 10 nm diameter glass pipettes.
- ADDLs block the persistence phase of LTP induced by high frequency electrical stimuli applied to entorhinal cortex and measured as cell body spike amplitude in middle molecular layer of the dentate gyms.
- animals were allowed to recover for various times and then sacrificed using sodium pentobarbitol anesthetic and perfusion with 4% paraformaldehye.
- times of 3 hours, 24 hours, 3 days, and 7 days were used.
- the brain was cryoprotected with 30% sucrose and then sectioned (30 ⁇ M) with a microtome. Sections were placed on slides subbed with gelatin and stained initially with cresyl violet.
- LTP was absent in ADDL-treated slices, their cells were competent to generate action potentials and showed no signs of degeneration.
- ADDLs in both whole animals and tissue slices, the addition of ADDLs results in significant disruption of LTP in less than an hour, prior to any cell degeneration or killing.
- These experiments thus support that ADDLs exert very early effects, and interference with ADDL formation and/or activity thus can be employed to obtain a therapeutic effect prior to advancement of a disease, disorder, or condition (e.g., Alzheimer's disease) to a stage where cell death results.
- a disease, disorder, or condition e.g., Alzheimer's disease
- these results confirm that decreases in memory occur before neurons die. Interference prior to such cell death thus can be employed to reverse the progression, and potentially restore decreases in memory.
- This example sets forth early effects of ADDLs in vivo and the manner in knowledge of such early effects can be manipulated.
- ADDL modulating compounds according to the invention can be employed in the treatment and/or prevention of these early cognitive and behavioural deficits resulting from ADDL-induced neuronal malfunction, or ADDLs themselves can be applied, for instance, in animal models, to study such induced neuronal malfunction.
- ADDLs induce these defects in a manner similar to compromised LTP function such as is induced by ADDLs.
- ADDL modulating compounds according to the invention can be employed in the treatment and/or prevention of these early cognitive decline and focal memory deficits, and impairment of higher order writing skills, resulting from ADDL formation or activity, or ADDLs themselves can be applied, for instance, in animal models, to study such induced defects. In particular, such studies can be conducted such as is known to those skilled in the art, for instance by comparing treated or placebo-treated age-matched subjects.
- This Example describes an alternative method for making ADDLs that can be employed instead of, for instance, the methods described in Examples 1 and 4.
- Amyloid ⁇ monomer stock stock solution is made by dissolving the monomer in hexafluoroisoproanol (HFIP), which is subsequently removed by speed vacuum evaporation.
- HFIP hexafluoroisoproanol
- the solid peptide is redissolved in dry DMSO at 5 mM to form a DMSO stock solution, and the ADDLs are prepared by diluting 1 ⁇ l of the DMSO stock solution into 49 ⁇ l of F12 media (serum-free, phenol-red free). The mixture is vortexed and then incubated at 4°C for 24 hours.
- This Example describes further gel studies done on amyloid ⁇ oligomers.
- 1 ⁇ l of the oligomer solution is added to 4 ⁇ l of F12 and 5 ⁇ l of tris-tricine loading buffer, and then loaded on a pre-made 16.5% tris-tricine gel (Biorad). Electrophoresis is carried out for 2.25 hours at 100 V. Following electrophoresis, the gel is stained using the Silver Xpress kit (Novex).
- the amyloid ⁇ species are transferred from the gel to Hybond-ECL (Amersham) in SDS- containing transfer buffer for 1 hour at 100 V at 4°C
- the blot is blocked in TBS- T1 containing 5% milk for 1 hour at room temperature. Following washing in TBS-T1 , the blot is incubated with primary antibody (26D6, 1 :2000,) for 1.5 hours at room temperature. The 26D6 antibody recognizes the amino terminal region of amyloid ⁇ . Following further washing, the blot is incubated with secondary antibody (anti-mouse HRP, 1 :3500) for 1.5 hours at room temperature. Following more washing, the blot is incubated in West Pico Supersignal reagents (500 ⁇ l of each, supplied by Pierce) and 3 mis of ddH 2 0 for 5 minutes. Finally, the blot is exposed to film and developed.
- Fig. 16 shows a computer-generated image of a densitometer-scanned 16.5% tris-tricine SDS- polyacrylamide gel (Biorad).
- the figure confirms a range of oligomeric, soluble ADDLs (labeled "ADDLs”), dimer (labeled "Dimer”), and monomer (labeled "Monomer”).
- This gel system thus enables visualization of distinct ADDLs comprising from at least 3 monomers (trimer) up to about 24 monomers. What is not depicted in Fig.
- This Example describes further AFM studies done on amyloid ⁇ oligomers.
- AFM was done as described in Example 3 except that fractionation on a Superdex 75 column was not performed, and the field was specifically selected such that larger size globules in the field were measured. The analysis is the same from a technical standpoint as that done in Example 3, but in this instance the field that was specifically selected for and examined allows visualization of oligomers that have larger sizes than those that were measured by the section analysis.
- AFM was carried out using a NanoScope ® III MultiMode AFM (MMAFM) workstation using TappingMode ® (Digital Instruments, Santa Barbara, CA).
- MMAFM NanoScope ® III MultiMode AFM
- Fig. 17 is a computer- generated image of an AFM analysis of ADDLs showing various sized structures of different amyloid ⁇ oligomers.
- the adhered structures range in size from 1 to 10.5 nm in z height. Based on this characterization, the structures comprise from 3 to 24 monomeric subunits, consistent with the bands shown on Tris-tricine SDS-PAGE. In separate experiments (not shown) species as high as about 11 nm have been observed.
- a ? ⁇ - 2 was obtained from American Peptide.
- Cell culture products were obtained from CellGro and Life Technologies. Unless otherwise indicated, chemicals and reagents were from Sigma-Aldrich. The following kits were used: the Boehringer Mannheim Cell Proliferation (MTT) kit, the Novex Silver Xpress kit, and the Pierce West Femto kit for chemiluminescence. SDS- PAGE gels and buffers were from BioRad.
- Antibodies 6E10, 6E10Bi, and 4G8 were obtained from Senetek. 26D6 was a gift of Sibia Corporation. Conjugated secondary antibodies were obtained from Jackson Labs and Amersham.
- a ⁇ derived diffusible ligand (ADDL) preparation A ? ⁇ - 2 was dissolved in hexafluoro-2-propanol (HFIP) and aliquoted to microcentifuge tubes. HFIP was removed by lyophylization and the tubes were stored at -20°C An aliquot of A ? ⁇ _ 2 was dissolved in anhydrous DMSO to make a 5 mM solution. The DMSO solution was then added to cold F12 medium (Life Technologies) to make a 100 ⁇ M solution. This solution was incubated at 4°C for at least 24 hours and then centrifuged at 14,000 x g for 10 min. The supernatant is ADDLs, used usually at a 1 :10 or 1 :20 dilution in medium.
- HFIP hexafluoro-2-propanol
- MTT assay PC12 cells were plated at 30,000 cells/well in 96-well plates and grown overnight. This medium was removed and ADDLs (5 or 10 ⁇ M) or vehicle were added in new medium (F12K, 1 % horse serum, antibiotic/antimycotic). After 4 hrs at 37°C, MTT (10 ⁇ l) was added to each well and allowed to incubate for 4 hours at 37°C The solubilization buffer (100 ⁇ l) was added and the plate was placed at 37°C overnight. The assay was quantified by reading at 550 or 550/690 nm on a plate reader; data were plotted as averages with standard error of the mean (SEM).
- Antibody preparation The polyclonal antibodies were produced and purified by Bethyl Laboratories, Inc.Texas. The initial 24-hour material was sent overnight on ice to the antibody company. It was diluted with complete Freund's adjuvant at 1 :1 and injected the day it was received. Antigen labeled +48 hours was thus the material injected. Booster injections continued over several weeks and used incomplete adjuvant. Hyperimmune serum produced in two rabbits was quantified by ELISA against the original antigen solution in a 96-well format. After attainment of an appropriate antibody titer, the animals were bled and antibodies were then collected and purified using an affinity column.
- the affinity column was prepared by linking an A/J40 solution (50 ⁇ g/ml gel) to agarose via a cyanogen bromide method. Binding of the appropriate antibodies to the column was monitored by ELISA. The polyclonal antibodies were then removed from the column, fractionated using ammonium sulfate precipitation and ion-exchange chromatography, and sent to us as an IgG preparation of > 95% purity. We received antibodies from two rabbits (M93 and M94) which were each bled a total of three times.
- the sample was incubated with primary antibody for 1.5 hr at RT and washed 3 x 15 min.
- Primary antibody was usually used at a dilution of 1 :2000, equivalent to a protein concentration between 0.3 and 0.6 ⁇ g/ml, depending on the antibody used.
- the membrane was incubated with secondary antibody for 1 hr at RT (usually a dilution of 1 :20,000) and washed the same way. Proteins were visualized with chemiluminescence. Quantification utilized Kodak 1 D Image Analysis software for the IS440CF Image Station.
- Plating medium was NeurobasalTM-E/B27, supplemented with 0.5mM glutamine, 5ng/ml ?-FGF, and antibiotic/antimycotic (Life Technologies). This procedure usually gave us clean, primarily neuronal, cultures and cells that developed long processes. If cultures were not used by three days, the medium was replaced with fresh medium.
- ADDL immunofluorescence Cells were cultured on coated glass coverslips as described previously (Stevens, G.R. et al. (1996) J. Neurosci. Res., vol. 46, pp. 445-455). ADDLs were added to cells in serum-free medium for varied times. Free ADDLs were removed by washing with warm medium.
- ADDL solutions should contain only monomer and toxic oligomers (Lambert, M.P. ef al. (1998) Proc. Natl. Acad. Sci. USA, vol. 95, pp. 6448-6453).
- a ? ⁇ -42 from the supplier was first monomerized by dissolving in hexafluoro-isopropanol (HFIP) and then dried for storage (Stine, W.B. ef al. (2000) Soc. Neurosci. Abstr., vol. 26, p. 800).
- the time points show the status of the initial preparation and the same preparation one day later. There was no change in composition with time. Each preparation also was tested for toxicity to PC12 cells as assayed by impact on MTT reduction. Whether measured immediately after preparation, or one day later, the ADDL solutions showed consistent potency in blocking MTT reduction (Fig. 1B). Impact was essentially maximal by 5 ⁇ M.
- ADDL solutions prepared as above (0.23 mg/ml total protein, see Methods) were mixed with 1 ml complete Freund's adjuvant and injected immediately into two rabbits (0.12 mg protein/animal).
- Booster injections (5) used incomplete adjuvant and continued over 10 weeks.
- the rabbits were bled three times to obtain antsera (M93 and M94) which were purified by affinity chromatography and fractionated giving an IgG preparation >95% pure.
- the three monoclonals recognize monomers as well as oligomeric species. 4G8 also is particularly effective at binding small amounts of dimer. In contrast, the new polyclonal antibodies showed strong preference for oligomeric species.
- M94 and M93 recognized only trimer and tetramer (Figs. 19 and 20).
- Dose response data showed that M93 can bind monomer but only at high concentrations of antibody (Fig. 20).
- the M93 antibodies bind only oligomers. Dimer is not recognized by either antibody.
- Trimer and tetramer were detected, and in addition, the antibodies recognized higher molecular weight species. The most prominent .of these bands are indicated by the open arrow, with trace amounts showing up at higher molecular weights.
- the higher molecular weight species may be larger oligomers, as previously found in human brain (Guerette, P.A. ef al. (2000) Soc. Neurosci. Abstr, vol. 25, p. 2129), or perhaps a complex between ADDLs and a second protein such as ApoE (LaDu, M.J. et al. (1995) J. Biol. Chem., vol. 270, pp. 9039-9042).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Neurology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Neurosurgery (AREA)
- Hematology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2003253673A AU2003253673A1 (en) | 2002-06-11 | 2003-06-11 | Anti-addl antibodies and uses thereof |
| JP2004511497A JP2006509721A (en) | 2002-06-11 | 2003-06-11 | Anti-ADDL antibodies and uses thereof |
| EP03757505A EP1551447A4 (en) | 2002-06-11 | 2003-06-11 | Anti-addl antibodies and uses thereof |
| CA002489195A CA2489195A1 (en) | 2002-06-11 | 2003-06-11 | Anti-addl antibodies and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/166,856 US20030068316A1 (en) | 1997-02-05 | 2002-06-11 | Anti-ADDL antibodies and uses thereof |
| US10/166,856 | 2002-06-11 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003104437A2 true WO2003104437A2 (en) | 2003-12-18 |
| WO2003104437A3 WO2003104437A3 (en) | 2004-02-26 |
Family
ID=29732155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/019640 Ceased WO2003104437A2 (en) | 2002-06-11 | 2003-06-11 | Anti-addl antibodies and uses thereof |
Country Status (6)
| Country | Link |
|---|---|
| US (3) | US20030068316A1 (en) |
| EP (1) | EP1551447A4 (en) |
| JP (1) | JP2006509721A (en) |
| AU (1) | AU2003253673A1 (en) |
| CA (1) | CA2489195A1 (en) |
| WO (1) | WO2003104437A2 (en) |
Cited By (62)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6905686B1 (en) | 1997-12-02 | 2005-06-14 | Neuralab Limited | Active immunization for treatment of alzheimer's disease |
| US6913745B1 (en) | 1997-12-02 | 2005-07-05 | Neuralab Limited | Passive immunization of Alzheimer's disease |
| US6946135B2 (en) | 1997-12-02 | 2005-09-20 | Neuralab Limited | Prevention and treatment of amyloidogenic disease |
| US6962707B2 (en) | 1997-12-02 | 2005-11-08 | Neuralab Limited | Prevention and treatment of amyloidogenic disease |
| WO2006014478A1 (en) * | 2004-07-02 | 2006-02-09 | Northwestern University | MONOLOCAL ANTIBODIES THAT TARGET PATHOLOGICAL ASSEMBLIES OF AMYLOID β (ABETA) |
| WO2006014638A3 (en) * | 2004-07-19 | 2006-03-16 | Gen Hospital Corp | ANTIBODIES TO CROSS-LINKED AMYLOID β OLIGOMERS |
| US7179892B2 (en) | 2000-12-06 | 2007-02-20 | Neuralab Limited | Humanized antibodies that recognize beta amyloid peptide |
| US7189819B2 (en) | 2000-12-06 | 2007-03-13 | Wyeth | Humanized antibodies that recognize beta amyloid peptide |
| WO2007050359A2 (en) | 2005-10-21 | 2007-05-03 | Merck & Co., Inc. | Anti-addl monoclonal antibody and use thereof |
| US7256273B2 (en) | 2002-03-12 | 2007-08-14 | Elan Pharma International Limited | Humanized antibodies that recognize beta amyloid peptide |
| JP2007524574A (en) * | 2003-01-31 | 2007-08-30 | アボット ゲゼルシャフト ミット ベシュレンクテル ハフツング ウント コンパニー コマンディトゲゼルシャフト | Amyloid-β (1-42) -oligomer, derivative thereof and antibody thereof, production method thereof and use thereof |
| JP2008520553A (en) * | 2004-10-25 | 2008-06-19 | メルク・アンド・カンパニー・インコーポレーテッド | Anti-ADDL antibodies and uses thereof |
| JP2008531635A (en) * | 2005-03-05 | 2008-08-14 | アボット ゲーエムベーハー ウント カンパニー カーゲー | Screening method, purification method of non-diffusible Abeta oligomer, selective antibody against the non-diffusible Abeta oligomer, and method for producing the antibody |
| WO2008104580A1 (en) | 2007-03-01 | 2008-09-04 | Probiodrug Ag | New use of glutaminyl cyclase inhibitors |
| WO2009051220A1 (en) * | 2007-10-19 | 2009-04-23 | Immunas Pharma, Inc. | Antibody capable of specifically binding to aβ oligomer, and use thereof |
| WO2009099176A1 (en) * | 2008-02-08 | 2009-08-13 | Immunas Pharma, Inc. | Antibody capable of binding specifically to aβ-oligomer, and use thereof |
| US7575880B1 (en) | 2000-05-26 | 2009-08-18 | Elan Pharma International Limited | Method of screening an antibody for activity in clearing an amyloid deposit |
| US7588766B1 (en) | 2000-05-26 | 2009-09-15 | Elan Pharma International Limited | Treatment of amyloidogenic disease |
| US7625560B2 (en) | 2004-12-15 | 2009-12-01 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| US7700719B2 (en) | 2000-07-07 | 2010-04-20 | Bioarctic Neuroscience Ab | Arctic β amyloid protofibril |
| US7700751B2 (en) | 2000-12-06 | 2010-04-20 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize β-amyloid peptide |
| US7731962B2 (en) | 2005-02-14 | 2010-06-08 | Merck & Co., Inc. | Anti-ADDL monoclonal antibody and use thereof |
| US7790856B2 (en) | 1998-04-07 | 2010-09-07 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| WO2010119704A1 (en) * | 2009-04-17 | 2010-10-21 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| US7871615B2 (en) | 2003-05-30 | 2011-01-18 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| WO2011016238A1 (en) | 2009-08-06 | 2011-02-10 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| WO2011016239A1 (en) | 2009-08-06 | 2011-02-10 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| US7893214B2 (en) | 1997-12-02 | 2011-02-22 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| WO2011029920A1 (en) | 2009-09-11 | 2011-03-17 | Probiodrug Ag | Heterocylcic derivatives as inhibitors of glutaminyl cyclase |
| EP2298807A2 (en) | 2004-07-30 | 2011-03-23 | Rinat Neuroscience Corp. | Antibodies directed against amyloid-beta peptide and methods using same |
| US7964192B1 (en) | 1997-12-02 | 2011-06-21 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidgenic disease |
| US8003097B2 (en) | 2007-04-18 | 2011-08-23 | Janssen Alzheimer Immunotherapy | Treatment of cerebral amyloid angiopathy |
| WO2011107530A2 (en) | 2010-03-03 | 2011-09-09 | Probiodrug Ag | Novel inhibitors |
| WO2011110613A1 (en) | 2010-03-10 | 2011-09-15 | Probiodrug Ag | Heterocyclic inhibitors of glutaminyl cyclase (qc, ec 2.3.2.5) |
| US8025878B2 (en) | 2006-03-23 | 2011-09-27 | Bioarctic Neuroscience Ab | Protofibril selective antibodies and the use thereof |
| WO2011131748A2 (en) | 2010-04-21 | 2011-10-27 | Probiodrug Ag | Novel inhibitors |
| US8106164B2 (en) | 2004-06-21 | 2012-01-31 | Bioarctic Neuroscience Ab | Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof |
| WO2012123563A1 (en) | 2011-03-16 | 2012-09-20 | Probiodrug Ag | Benz imidazole derivatives as inhibitors of glutaminyl cyclase |
| US8303954B2 (en) | 2009-08-07 | 2012-11-06 | Kyowa Hakko Kirin Co., Ltd | Anti-Aβ oligomer humanized antibody |
| US8333967B2 (en) | 2009-08-07 | 2012-12-18 | Kyowa Hakko Kirin Co., Ltd | Anti-Aβ oligomer humanized antibody |
| WO2013007839A1 (en) | 2011-07-14 | 2013-01-17 | Adx Neurosciences Nv | Antibodies to phosphorylated tau aggregates |
| US8420093B2 (en) | 2005-02-14 | 2013-04-16 | Merck Sharp & Dohme Corp. | Anti-ADDL monoclonal antibody and use thereof |
| US8613920B2 (en) | 2007-07-27 | 2013-12-24 | Janssen Alzheimer Immunotherapy | Treatment of amyloidogenic diseases |
| US8784810B2 (en) | 2006-04-18 | 2014-07-22 | Janssen Alzheimer Immunotherapy | Treatment of amyloidogenic diseases |
| US8916165B2 (en) | 2004-12-15 | 2014-12-23 | Janssen Alzheimer Immunotherapy | Humanized Aβ antibodies for use in improving cognition |
| US8962677B2 (en) | 2007-07-12 | 2015-02-24 | Acumen Pharmaceuticals, Inc. | Methods of restoring cognitive ability using non-peptidic compounds |
| US9006283B2 (en) | 2007-07-12 | 2015-04-14 | Acumen Pharmaceuticals, Inc. | Methods of modifying amyloid β oligomers using non-peptidic compounds |
| EP2865670A1 (en) | 2007-04-18 | 2015-04-29 | Probiodrug AG | Thiourea derivatives as glutaminyl cyclase inhibitors |
| US9062101B2 (en) | 2010-08-14 | 2015-06-23 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| US9067981B1 (en) | 2008-10-30 | 2015-06-30 | Janssen Sciences Ireland Uc | Hybrid amyloid-beta antibodies |
| US9085614B2 (en) | 2008-08-01 | 2015-07-21 | Immunas Pharma, Inc. | Antibodies that specifically bind to Aβ oligomers and uses thereof |
| US9573994B2 (en) | 2014-07-10 | 2017-02-21 | Bioarctic Neuroscience Ab | Aβ protofibril binding antibodies |
| US9644025B2 (en) | 2007-10-17 | 2017-05-09 | Wyeth Llc | Immunotherapy regimes dependent on ApoE status |
| US9822171B2 (en) | 2010-04-15 | 2017-11-21 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| US9833420B2 (en) | 2003-02-27 | 2017-12-05 | JoAnne McLaurin | Methods of preventing, treating, and diagnosing disorders of protein aggregation |
| US9951125B2 (en) | 2006-11-30 | 2018-04-24 | Abbvie Inc. | Aβ conformer selective anti-Aβ globulomer monoclonal antibodies |
| US10208109B2 (en) | 2005-11-30 | 2019-02-19 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| EP3461819A1 (en) | 2017-09-29 | 2019-04-03 | Probiodrug AG | Inhibitors of glutaminyl cyclase |
| US10538581B2 (en) | 2005-11-30 | 2020-01-21 | Abbvie Inc. | Anti-Aβ globulomer 4D10 antibodies |
| WO2021048324A1 (en) * | 2019-09-10 | 2021-03-18 | Ac Immune Sa | Novel molecules for diagnosis |
| WO2021011673A3 (en) * | 2019-07-16 | 2021-07-01 | Ming Jin | Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease |
| US12630615B2 (en) | 2020-07-15 | 2026-05-19 | The Brigham And Women's Hospital, Inc. | Neutralizing anti-amyloid beta antibodies for the treatment of Alzheimer's disease |
Families Citing this family (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030068316A1 (en) * | 1997-02-05 | 2003-04-10 | Klein William L. | Anti-ADDL antibodies and uses thereof |
| WO2010011999A2 (en) * | 2008-07-25 | 2010-01-28 | The Regents Of The University Of California | Methods and compositions for eliciting an amyloid-selective immune response |
| EP1545582A4 (en) * | 2002-10-01 | 2008-09-17 | Univ Northwestern | DIFFUSABLE LIGANDS (ADDLS) DERIVED FROM AMYOLIDE BETA, ADDL REAGENTS, ADDL-BINDING MOLECULES AND USES THEREOF |
| EP1633786A4 (en) * | 2002-10-09 | 2007-07-25 | Rinat Neuroscience Corp | Methods of treating alzheimer s disease using antibodies directed against amyloid beta peptide and compositions thereof |
| US20080044356A1 (en) * | 2004-10-22 | 2008-02-21 | Regents Of The University Of Minnesota | Assemblies of Oligomeric Amyloid Beta Protein and Uses Thereof |
| AU2012232964B2 (en) * | 2004-10-25 | 2014-05-01 | Merck Sharp & Dohme Corp. | Anti-ADDL antibodies and uses thereof |
| WO2006066233A1 (en) * | 2004-12-15 | 2006-06-22 | Neuralab Limited | An immunoprecipitation-based assay for predicting in vivo efficacy of beta-amyloid antibodies |
| US20060257396A1 (en) * | 2004-12-15 | 2006-11-16 | Jacobsen Jack S | Abeta antibodies for use in improving cognition |
| PE20061323A1 (en) | 2005-04-29 | 2007-02-09 | Rinat Neuroscience Corp | ANTIBODIES TARGETED AGAINST AMYLOID BETA PEPTIDE AND METHODS USING THEM |
| WO2007016357A1 (en) * | 2005-07-29 | 2007-02-08 | Regents Of The University Of Minnesota | Amyloid beta receptor and uses thereof |
| EP1951892A4 (en) * | 2005-11-22 | 2009-01-14 | Univ Pennsylvania | ANTIBODY TREATMENT OF MORBUS ALZHEIMER AND RELATED DISEASES |
| MX2008007477A (en) * | 2005-12-12 | 2008-09-03 | Ac Immune Sa | A beta 1-42 specific monoclonal antibodies with therapeutic properties. |
| NZ574188A (en) | 2006-07-14 | 2012-05-25 | Ac Immune Sa | Humanized antibody against amyloid beta |
| EP2124952A2 (en) | 2007-02-27 | 2009-12-02 | Abbott GmbH & Co. KG | Method for the treatment of amyloidoses |
| EP2146746A4 (en) * | 2007-04-18 | 2011-03-23 | Janssen Alzheimer Immunotherap | Prevention and treatment of cerebral amyloid angiopathy |
| US8048420B2 (en) * | 2007-06-12 | 2011-11-01 | Ac Immune S.A. | Monoclonal antibody |
| DK2170389T3 (en) * | 2007-06-12 | 2015-01-19 | Ac Immune Sa | Humanized antibodies against amyloid beta |
| US8613923B2 (en) | 2007-06-12 | 2013-12-24 | Ac Immune S.A. | Monoclonal antibody |
| US20110098309A1 (en) * | 2007-07-12 | 2011-04-28 | Acumen Pharmaceuticals, Inc. | Methods of inhibiting the formation of amyloid-beta diffusable ligands using acylhydrazide compounds |
| EP2650308A3 (en) * | 2007-10-05 | 2014-11-12 | Genentech, Inc. | Use of anti-amyloid beta antibody in ocular diseases |
| EP2586795B1 (en) * | 2007-10-05 | 2018-05-16 | Genentech, Inc. | Use of anti-amyloid beta antibody in ocular diseases |
| US20090246191A1 (en) * | 2007-10-11 | 2009-10-01 | University Of Tennessee Research Foundation | Preparation of Purified Covalently Cross-linked Abeta Oligomers and Uses Thereof |
| US20100291071A1 (en) * | 2008-08-01 | 2010-11-18 | Immunas Pharma, Inc. | Antibody Specific Binding to A-Beta Oligomer and the Use |
| WO2009079566A2 (en) | 2007-12-18 | 2009-06-25 | Acumen Pharmaceuticals, Inc. | Novel addl receptor polypeptides, polynucleotides and host cells for recombinant production |
| EP2116260A1 (en) * | 2008-04-16 | 2009-11-11 | Freie Universität Berlin | Screening method for agents suitable for prophylaxis and therapy of Alzheimer's disease (AD) |
| AU2011282536B2 (en) | 2010-07-30 | 2015-12-24 | Ac Immune S.A. | Safe and functional humanized anti beta-amyloid antibody |
| US9377472B2 (en) | 2012-04-30 | 2016-06-28 | Amoneta Diagnostics | Biological complex specific for Alzheimer's disease detection in vitro and use thereof |
| CA3185336A1 (en) | 2017-11-06 | 2019-05-09 | Acelot, Inc. | Small molecule drugs and related methods for treatment of diseases related to a.beta.42 oligomer formation |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5530101A (en) * | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5786180A (en) * | 1995-02-14 | 1998-07-28 | Bayer Corporation | Monoclonal antibody 369.2B specific for β A4 peptide |
| US20030068316A1 (en) * | 1997-02-05 | 2003-04-10 | Klein William L. | Anti-ADDL antibodies and uses thereof |
| US6218506B1 (en) * | 1997-02-05 | 2001-04-17 | Northwestern University | Amyloid β protein (globular assembly and uses thereof) |
| US6172277B1 (en) * | 1997-10-28 | 2001-01-09 | The Miriam Hospital | Non-transgenic rodent model of alzheimer's disease |
| EP1571158B1 (en) * | 1999-08-04 | 2009-10-14 | University Of Southern California | Globular assembly of amyloid beta protein and uses thereof |
| US6294171B2 (en) * | 1999-09-14 | 2001-09-25 | Milkhaus Laboratory, Inc. | Methods for treating disease states comprising administration of low levels of antibodies |
-
2002
- 2002-06-11 US US10/166,856 patent/US20030068316A1/en not_active Abandoned
-
2003
- 2003-06-11 EP EP03757505A patent/EP1551447A4/en not_active Withdrawn
- 2003-06-11 JP JP2004511497A patent/JP2006509721A/en active Pending
- 2003-06-11 CA CA002489195A patent/CA2489195A1/en not_active Abandoned
- 2003-06-11 AU AU2003253673A patent/AU2003253673A1/en not_active Abandoned
- 2003-06-11 WO PCT/US2003/019640 patent/WO2003104437A2/en not_active Ceased
-
2006
- 2006-07-31 US US11/496,149 patent/US20070048312A1/en not_active Abandoned
-
2009
- 2009-06-17 US US12/486,313 patent/US20090285804A1/en not_active Abandoned
Cited By (115)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7893214B2 (en) | 1997-12-02 | 2011-02-22 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| US8642044B2 (en) | 1997-12-02 | 2014-02-04 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
| US6946135B2 (en) | 1997-12-02 | 2005-09-20 | Neuralab Limited | Prevention and treatment of amyloidogenic disease |
| US6962707B2 (en) | 1997-12-02 | 2005-11-08 | Neuralab Limited | Prevention and treatment of amyloidogenic disease |
| US6972127B2 (en) | 1997-12-02 | 2005-12-06 | Neuralab Limited | Prevention and treatment of amyloidogenic disease |
| US8034339B2 (en) | 1997-12-02 | 2011-10-11 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
| US8034348B2 (en) | 1997-12-02 | 2011-10-11 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
| US7964192B1 (en) | 1997-12-02 | 2011-06-21 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidgenic disease |
| US6913745B1 (en) | 1997-12-02 | 2005-07-05 | Neuralab Limited | Passive immunization of Alzheimer's disease |
| US6905686B1 (en) | 1997-12-02 | 2005-06-14 | Neuralab Limited | Active immunization for treatment of alzheimer's disease |
| US9051363B2 (en) | 1997-12-02 | 2015-06-09 | Janssen Sciences Ireland Uc | Humanized antibodies that recognize beta amyloid peptide |
| US8535673B2 (en) | 1997-12-02 | 2013-09-17 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
| US7790856B2 (en) | 1998-04-07 | 2010-09-07 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| US7582733B2 (en) | 1998-11-30 | 2009-09-01 | Elan Pharma International Limited | Humanized antibodies that recognize beta amyloid peptide |
| US7575880B1 (en) | 2000-05-26 | 2009-08-18 | Elan Pharma International Limited | Method of screening an antibody for activity in clearing an amyloid deposit |
| US7588766B1 (en) | 2000-05-26 | 2009-09-15 | Elan Pharma International Limited | Treatment of amyloidogenic disease |
| US7700719B2 (en) | 2000-07-07 | 2010-04-20 | Bioarctic Neuroscience Ab | Arctic β amyloid protofibril |
| US8409575B2 (en) | 2000-07-07 | 2013-04-02 | Bioarctic Neuroscience Ab | Antibodies specific for amyloid beta protofibril |
| US7700751B2 (en) | 2000-12-06 | 2010-04-20 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize β-amyloid peptide |
| US7179892B2 (en) | 2000-12-06 | 2007-02-20 | Neuralab Limited | Humanized antibodies that recognize beta amyloid peptide |
| US7189819B2 (en) | 2000-12-06 | 2007-03-13 | Wyeth | Humanized antibodies that recognize beta amyloid peptide |
| US8128928B2 (en) | 2002-03-12 | 2012-03-06 | Wyeth Llc | Humanized antibodies that recognize beta amyloid peptide |
| US7256273B2 (en) | 2002-03-12 | 2007-08-14 | Elan Pharma International Limited | Humanized antibodies that recognize beta amyloid peptide |
| JP2014005295A (en) * | 2003-01-31 | 2014-01-16 | Abbott Gmbh & Co Kg | PREPARATION CONTAINING AMYLOID-β(1-42)-OLIGOMER OR DERIVATIVE THEREOF, PRODUCTION METHOD THEREOF, AND USE THEREOF |
| EP2336159A3 (en) * | 2003-01-31 | 2012-03-07 | Abbott GmbH & Co. KG | Amyloid-beta(1-42) oligomers, derivatives thereof, antibodies for the same, method for production and use thereof. |
| JP2007524574A (en) * | 2003-01-31 | 2007-08-30 | アボット ゲゼルシャフト ミット ベシュレンクテル ハフツング ウント コンパニー コマンディトゲゼルシャフト | Amyloid-β (1-42) -oligomer, derivative thereof and antibody thereof, production method thereof and use thereof |
| JP2010168385A (en) * | 2003-01-31 | 2010-08-05 | Abbott Gmbh & Co Kg | Formulation containing amyloid-beta(1-42)-oligomer or derivative thereof, preparative method thereof, and use thereof |
| EP2336160A3 (en) * | 2003-01-31 | 2012-03-07 | Abbott GmbH & Co. KG | Amyloid-beta(1-42) oligomers, derivatives thereof, antibodies for the same, method for production and use thereof. |
| JP2012250981A (en) * | 2003-01-31 | 2012-12-20 | Abbott Gmbh & Co Kg | AMYLOID-β(1-42)-OLIGOMER, DERIVATIVE THEREOF AND ANTIBODY THEREOF, AS WELL AS MANUFACTURING METHOD AND USE THEREFOR |
| US10464976B2 (en) | 2003-01-31 | 2019-11-05 | AbbVie Deutschland GmbH & Co. KG | Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof |
| US9833420B2 (en) | 2003-02-27 | 2017-12-05 | JoAnne McLaurin | Methods of preventing, treating, and diagnosing disorders of protein aggregation |
| US7871615B2 (en) | 2003-05-30 | 2011-01-18 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| US8404459B2 (en) | 2004-06-21 | 2013-03-26 | Bioarctic Neuroscience Ab | Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof |
| US8999936B2 (en) | 2004-06-21 | 2015-04-07 | Bioarctic Neuroscience Ab | Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof |
| US8106164B2 (en) | 2004-06-21 | 2012-01-31 | Bioarctic Neuroscience Ab | Antibodies specific for soluble amyloid beta peptide protofibrils and uses thereof |
| WO2006014478A1 (en) * | 2004-07-02 | 2006-02-09 | Northwestern University | MONOLOCAL ANTIBODIES THAT TARGET PATHOLOGICAL ASSEMBLIES OF AMYLOID β (ABETA) |
| US8507206B2 (en) | 2004-07-02 | 2013-08-13 | Northwestern University | Monoclonal antibodies that target pathological assemblies of amyloid β (Abeta) |
| US7955812B2 (en) | 2004-07-19 | 2011-06-07 | The General Hospital Corporation | Methods of diagnosing alzheimer's disease by detecting antibodies to cross-linked β-amyloid oligomers |
| WO2006014638A3 (en) * | 2004-07-19 | 2006-03-16 | Gen Hospital Corp | ANTIBODIES TO CROSS-LINKED AMYLOID β OLIGOMERS |
| EP2298807A2 (en) | 2004-07-30 | 2011-03-23 | Rinat Neuroscience Corp. | Antibodies directed against amyloid-beta peptide and methods using same |
| US7780963B2 (en) | 2004-10-25 | 2010-08-24 | Merck & Co., Inc. | Anti-ADDL antibodies and uses thereof |
| US8889138B2 (en) | 2004-10-25 | 2014-11-18 | Merck Sharp & Dohme Corp. | Anti-ADDL antibodies and uses thereof |
| JP2012097096A (en) * | 2004-10-25 | 2012-05-24 | Merck Sharp & Dohme Corp | Anti-addl antibody and use thereof |
| EP1812062A4 (en) * | 2004-10-25 | 2012-12-19 | Merck Sharp & Dohme | ANTI-ADDL ANTIBODIES AND USES THEREOF |
| JP2008520553A (en) * | 2004-10-25 | 2008-06-19 | メルク・アンド・カンパニー・インコーポレーテッド | Anti-ADDL antibodies and uses thereof |
| US8128930B2 (en) | 2004-10-25 | 2012-03-06 | Northwestern University | Anti-ADDL antibodies and uses thereof |
| US7811563B2 (en) | 2004-10-25 | 2010-10-12 | Northwestern University | Anti-addl antibodies and uses thereof |
| JP2013035843A (en) * | 2004-10-25 | 2013-02-21 | Merck Sharp & Dohme Corp | Anti-addl antibody and use thereof |
| US8383113B2 (en) | 2004-10-25 | 2013-02-26 | Northwestern University | Anti-ADDL antibodies and uses thereof |
| US8916165B2 (en) | 2004-12-15 | 2014-12-23 | Janssen Alzheimer Immunotherapy | Humanized Aβ antibodies for use in improving cognition |
| US7625560B2 (en) | 2004-12-15 | 2009-12-01 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
| US7731962B2 (en) | 2005-02-14 | 2010-06-08 | Merck & Co., Inc. | Anti-ADDL monoclonal antibody and use thereof |
| US8420093B2 (en) | 2005-02-14 | 2013-04-16 | Merck Sharp & Dohme Corp. | Anti-ADDL monoclonal antibody and use thereof |
| US8105593B2 (en) | 2005-02-14 | 2012-01-31 | Merck Sharp & Dohme Corp. | Anti-ADDL monoclonal antibody and use thereof |
| JP2008531635A (en) * | 2005-03-05 | 2008-08-14 | アボット ゲーエムベーハー ウント カンパニー カーゲー | Screening method, purification method of non-diffusible Abeta oligomer, selective antibody against the non-diffusible Abeta oligomer, and method for producing the antibody |
| WO2007050359A2 (en) | 2005-10-21 | 2007-05-03 | Merck & Co., Inc. | Anti-addl monoclonal antibody and use thereof |
| EP1940466A4 (en) * | 2005-10-21 | 2010-04-07 | Merck Sharp & Dohme | ANTI-ADDL MONOCLONAL ANTIBODIES AND THEIR USE |
| JP2009519895A (en) * | 2005-10-21 | 2009-05-21 | メルク・アンド・カンパニー・インコーポレーテッド | Anti-ADDL monoclonal antibody and use thereof |
| US10208109B2 (en) | 2005-11-30 | 2019-02-19 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| US10323084B2 (en) | 2005-11-30 | 2019-06-18 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| US10538581B2 (en) | 2005-11-30 | 2020-01-21 | Abbvie Inc. | Anti-Aβ globulomer 4D10 antibodies |
| US8025878B2 (en) | 2006-03-23 | 2011-09-27 | Bioarctic Neuroscience Ab | Protofibril selective antibodies and the use thereof |
| US9034334B2 (en) | 2006-03-23 | 2015-05-19 | Bioarctic Neuroscience Ab | Protofibril selective antibodies and the use thereof |
| US8784810B2 (en) | 2006-04-18 | 2014-07-22 | Janssen Alzheimer Immunotherapy | Treatment of amyloidogenic diseases |
| US9951125B2 (en) | 2006-11-30 | 2018-04-24 | Abbvie Inc. | Aβ conformer selective anti-Aβ globulomer monoclonal antibodies |
| WO2008104580A1 (en) | 2007-03-01 | 2008-09-04 | Probiodrug Ag | New use of glutaminyl cyclase inhibitors |
| EP2481408A2 (en) | 2007-03-01 | 2012-08-01 | Probiodrug AG | New use of glutaminyl cyclase inhibitors |
| EP2865670A1 (en) | 2007-04-18 | 2015-04-29 | Probiodrug AG | Thiourea derivatives as glutaminyl cyclase inhibitors |
| US8003097B2 (en) | 2007-04-18 | 2011-08-23 | Janssen Alzheimer Immunotherapy | Treatment of cerebral amyloid angiopathy |
| US9006283B2 (en) | 2007-07-12 | 2015-04-14 | Acumen Pharmaceuticals, Inc. | Methods of modifying amyloid β oligomers using non-peptidic compounds |
| US8962677B2 (en) | 2007-07-12 | 2015-02-24 | Acumen Pharmaceuticals, Inc. | Methods of restoring cognitive ability using non-peptidic compounds |
| US8613920B2 (en) | 2007-07-27 | 2013-12-24 | Janssen Alzheimer Immunotherapy | Treatment of amyloidogenic diseases |
| US9644025B2 (en) | 2007-10-17 | 2017-05-09 | Wyeth Llc | Immunotherapy regimes dependent on ApoE status |
| WO2009051220A1 (en) * | 2007-10-19 | 2009-04-23 | Immunas Pharma, Inc. | Antibody capable of specifically binding to aβ oligomer, and use thereof |
| CN101965365A (en) * | 2007-10-19 | 2011-02-02 | 伊缪纳斯制药株式会社 | Antibody capable of combining the soluble ass oligomer specifically and application thereof |
| JPWO2009051220A1 (en) * | 2007-10-19 | 2011-03-03 | イムナス・ファーマ株式会社 | Antibody specifically binding to Aβ oligomer and use thereof |
| KR101616136B1 (en) * | 2008-02-08 | 2016-04-27 | 이무나스 파마 가부시키가이샤 | Antibody capable of binding specifically to A-oligomer and use thereof |
| CN102936287A (en) * | 2008-02-08 | 2013-02-20 | 伊缪纳斯制药株式会社 | Antibody capable of binding specifically to A beta-oligomer, and use thereof |
| KR20100113623A (en) * | 2008-02-08 | 2010-10-21 | 이무나스 파마 가부시키가이샤 | ANTIBODY CAPABLE OF BINDING SPECIFICALLY TO Aβ-OLIGOMER, AND USE THEREOF |
| EP3121277A1 (en) * | 2008-02-08 | 2017-01-25 | Immunas Pharma, Inc. | Antibody capable of binding specifically to ab-oligomer, and use thereof |
| AU2009211635B2 (en) * | 2008-02-08 | 2014-06-26 | National Center For Geriatrics And Gerontology | Antibody capable of binding specifically to Abeta-oligomer, and use thereof |
| CN102936287B (en) * | 2008-02-08 | 2015-09-09 | 伊缪纳斯制药株式会社 | Can the antibody of specific binding A beta oligomers and application thereof |
| US9090680B2 (en) | 2008-02-08 | 2015-07-28 | Immunas Pharma, Inc. | Antibodies that specifically bind to abeta oligomers and uses thereof |
| WO2009099176A1 (en) * | 2008-02-08 | 2009-08-13 | Immunas Pharma, Inc. | Antibody capable of binding specifically to aβ-oligomer, and use thereof |
| US8378081B2 (en) | 2008-02-08 | 2013-02-19 | Immunas Pharma, Inc. | Antibodies that specifically bind to Aβ oligomers and uses thereof |
| US9085614B2 (en) | 2008-08-01 | 2015-07-21 | Immunas Pharma, Inc. | Antibodies that specifically bind to Aβ oligomers and uses thereof |
| US9067981B1 (en) | 2008-10-30 | 2015-06-30 | Janssen Sciences Ireland Uc | Hybrid amyloid-beta antibodies |
| JP2012524023A (en) * | 2009-04-17 | 2012-10-11 | イムナス・ファーマ株式会社 | Antibody specifically binding to Aβ oligomer and use thereof |
| WO2010119704A1 (en) * | 2009-04-17 | 2010-10-21 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| US9090679B2 (en) | 2009-04-17 | 2015-07-28 | Immunas Pharma, Inc. | Antibodies that specifically bind to A beta oligomers and use thereof |
| EP2462161A4 (en) * | 2009-08-06 | 2013-05-29 | Immunas Pharma Inc | Antibodies that specifically bind to a beta oligomers and use thereof |
| US8613924B2 (en) | 2009-08-06 | 2013-12-24 | Immunas Pharma, Inc. | Antibodies that specifically bind to A beta oligomers and use thereof |
| CN102574915A (en) * | 2009-08-06 | 2012-07-11 | 伊缪纳斯制药株式会社 | Antibodies that specifically bind to A beta oligomers and use thereof |
| CN102574915B (en) * | 2009-08-06 | 2014-10-22 | 伊缪纳斯制药株式会社 | Antibodies specifically binding to Aβ oligomers and uses thereof |
| US8858949B2 (en) | 2009-08-06 | 2014-10-14 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| WO2011016238A1 (en) | 2009-08-06 | 2011-02-10 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| EP2462162A4 (en) * | 2009-08-06 | 2013-05-22 | Immunas Pharma Inc | Antibodies that specifically bind to a beta oligomers and use thereof |
| WO2011016239A1 (en) | 2009-08-06 | 2011-02-10 | Immunas Pharma, Inc. | Antibodies that specifically bind to a beta oligomers and use thereof |
| US9181332B2 (en) | 2009-08-07 | 2015-11-10 | Kyowa Hakko Kirin Co., Ltd | Anti-A(β) oligomer humanized antibody |
| US8333967B2 (en) | 2009-08-07 | 2012-12-18 | Kyowa Hakko Kirin Co., Ltd | Anti-Aβ oligomer humanized antibody |
| US8303954B2 (en) | 2009-08-07 | 2012-11-06 | Kyowa Hakko Kirin Co., Ltd | Anti-Aβ oligomer humanized antibody |
| WO2011029920A1 (en) | 2009-09-11 | 2011-03-17 | Probiodrug Ag | Heterocylcic derivatives as inhibitors of glutaminyl cyclase |
| WO2011107530A2 (en) | 2010-03-03 | 2011-09-09 | Probiodrug Ag | Novel inhibitors |
| WO2011110613A1 (en) | 2010-03-10 | 2011-09-15 | Probiodrug Ag | Heterocyclic inhibitors of glutaminyl cyclase (qc, ec 2.3.2.5) |
| US9822171B2 (en) | 2010-04-15 | 2017-11-21 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| WO2011131748A2 (en) | 2010-04-21 | 2011-10-27 | Probiodrug Ag | Novel inhibitors |
| US10047121B2 (en) | 2010-08-14 | 2018-08-14 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| US9062101B2 (en) | 2010-08-14 | 2015-06-23 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| WO2012123563A1 (en) | 2011-03-16 | 2012-09-20 | Probiodrug Ag | Benz imidazole derivatives as inhibitors of glutaminyl cyclase |
| WO2013007839A1 (en) | 2011-07-14 | 2013-01-17 | Adx Neurosciences Nv | Antibodies to phosphorylated tau aggregates |
| US9573994B2 (en) | 2014-07-10 | 2017-02-21 | Bioarctic Neuroscience Ab | Aβ protofibril binding antibodies |
| EP3461819A1 (en) | 2017-09-29 | 2019-04-03 | Probiodrug AG | Inhibitors of glutaminyl cyclase |
| WO2021011673A3 (en) * | 2019-07-16 | 2021-07-01 | Ming Jin | Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease |
| WO2021048324A1 (en) * | 2019-09-10 | 2021-03-18 | Ac Immune Sa | Novel molecules for diagnosis |
| US12630615B2 (en) | 2020-07-15 | 2026-05-19 | The Brigham And Women's Hospital, Inc. | Neutralizing anti-amyloid beta antibodies for the treatment of Alzheimer's disease |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1551447A4 (en) | 2007-03-07 |
| US20030068316A1 (en) | 2003-04-10 |
| CA2489195A1 (en) | 2003-12-18 |
| AU2003253673A1 (en) | 2003-12-22 |
| US20070048312A1 (en) | 2007-03-01 |
| WO2003104437A3 (en) | 2004-02-26 |
| JP2006509721A (en) | 2006-03-23 |
| EP1551447A2 (en) | 2005-07-13 |
| US20090285804A1 (en) | 2009-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20030068316A1 (en) | Anti-ADDL antibodies and uses thereof | |
| CA2381323C (en) | Amyloid .beta. protein (globular assembly and uses thereof) | |
| AU2003279728B2 (en) | Amyloid beta-derived diffusible ligands (addls), addl-surrogates, addl-binding molecules, and uses thereof | |
| AU735825B2 (en) | Amyloid beta protein (globular assembly and uses thereof) | |
| US7902328B2 (en) | Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof | |
| US20070213512A1 (en) | Amyloid beta peptide analogs and assemblies thereof | |
| KR20020097157A (en) | Nogo receptor-mediated blockade of axonal growth | |
| US20060178302A1 (en) | Amyloid beta protein (globular assembly and uses thereof) | |
| US20210386879A1 (en) | Method for detecting soluble oligomeric amyloid beta | |
| US20250262337A1 (en) | Method for detecting soluble oligomeric amyloid beta | |
| MXPA99007161A (en) | Amyloid beta protein (globular assembly and uses thereof) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2489195 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004511497 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003253673 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003757505 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003757505 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2003757505 Country of ref document: EP |




