MXPA99007161A - Amyloid beta protein (globular assembly and uses thereof) - Google Patents

Abstract

The invention provides amyloid beta-derived dementing ligands (ADDLs) that comprise amyloid&bgr;protein assembled into globular non-fibrillar oligomeric structures capable of activating specific cellular processes. The invention also provides methods for assying the formation, presence, receptor protein binding and cellular activity of ADDLs, as well as compounds that block the formation or activity of ADDLs, and methods of identifying such compounds. The invention further provides methods of using ADDLs, and modulating ADDL formation and/or activity, inter alia in the treatment of learning and/or memory disorders.

Description

BETA AMYLOID PROTEIN, GLOBULAR ASSEMBLY AND USES OF THE SAME TECHNICAL FIELD OF THE INVENTION The present invention pertains to a new composition of matter, dementia ligands derived from amyloid beta (ADDL). ADDLs comprise beta amyloid peptide assembled in soluble, non-fibrillar, non-fibrillar oligomeric structures that are capable of activating specific cellular processes. The invention also provides methods for conducting assays regarding the formation, presence, binding of receptor protein and cellular activities of ADDL. Also disclosed are compounds that block the formation or activity of ADDL, and methods for identifying such compounds. The formation and activity of ADDL is relevant, for example, in learning and memory. The modulation of the ADDL formation activity in this manner can be used according to the invention in the treatment of learning and memory disorders, as well as in other diseases, disorders or conditions that are due to ADDL effects.

BACKGROUND OF THE INVENTION Alzheimer's disease is a progressive neurodegenerative disease characterized by different REF .: 30992 pathologies, including neurofibrillary entanglements, neuritic plaques, neuronal atrophy, dendritic pruning and neuronal death. From a historical perspective, the definitive diagnosis of Alzheimer's disease has always been based on the identification of specific pathological markers, specifically the neurofibrillary groups which represent the collapsed cytoskeleton of dead and agonizing neurons, and neuritic plaques, which are extracellular deposits. of various proteins, lipids, carbohydrates and salt compounds, the primary protein component of which is a peptide residue of 39-43 known as amyloid beta. However, from the point of view of the impact of the disease, the symptoms manifested in Alzheimer's disease, specifically memory loss, the erosion of cognitive functions and significant changes in personality and behavior, which are more important . Under these symptomatic changes are specific cellular mechanisms that cause the nerve cells to malfunction and eventually degenerate and die. These cellular mechanisms undoubtedly operate within a background environment that provides a variable level of protection, or exerts contributory and exacerbating effects. The result is a very broad age / incidence distribution curve, some clues from population studies that indicate specific causes. Molecular genetics represents the background of the study where a clear picture of familial Alzheimer's disease emerges. As described in more detail in the following, it is now clear from studies that identify mutations in three different proteins, APP and presenilins 1 and 2, that the final common pathway leading to Alzheimer's disease is the production increased amyloid ß 1-42 (as well as amyloid ß 1-43), which occurs in all these different familial AD mutations. This is particularly notorious, because the ADDL, the central focus of the invention described herein, only form stable entities from their longest form of amyloid, and not in the most prevalent form, the short form Aβ 1- 40 Amyloid β in Alzheimer's disease. In 1984, Glenner and Wong succeeded in isolating and identifying the cerebrovascular amyloid associated with Alzheimer's disease (Glenner et al., Biochem, Biophys, Res. Commun., 120, 885-890, 1984a). Subsequently, the same residual peptides 39-43, now known as β-amyloid, were identified as the main component of the neuritic plaques of Alzheimer's disease (Glenner et al., Biochem. Biophys. Res. Commun., 122, 1131-1135 1984b; Asters et al., EMBO J., 4, 2757-2764, 1985a; Masters et al., Proc. Na ti. Acad. Sci., 82, 4245-4249, 1985b). This was for the first time a discrete molecule that has been linked to Alzheimer's disease, a disease which to this point had been characterized only by neuroanatomical and neuropathological descriptions. Amyloid β was also identified as the plaque component in brains of individuals with Down syndrome (Glenner et al., Biochem. Biophys., Res. Commun., 122, 1131-1135, 1984b).; Masters et al., EMBO J., 4, 2757-2764, 1985a; Masters et al., Proc. Nati Acad. Sci. , 82, 4245-4249, 1985b) which leads to the suggestion that there is possibly a gene that codes on chromosome 21. In 1987, numerous groups have used information on amyloid β sequence and molecular genetic techniques to validate this suggestion by identifying the gene for the amyloid precursor protein (APP) (Kang et al., Na ture, 325, 733, 1987, Tanzi et al., Science, 235, 880-884, 1987). The APP gene is a large, multiple exon gene that is differentially divided into numerous APPs (reviewed in Selkoe, In, Annual Review of Neuroscience, Cowan (Ed), 17, ix + 623 p, 489-517, 1994). Proteins are large transmembrane proteins, which are now known to be processed in various ways, one or more of which can generate β amyloid. Early studies of APP processing have suggested that the formation of amyloid β is not a normal process (Esch et al., Science, 248, 1122-1124 1990; Sisodia et al., Science, 248, 492-495, 1990). , although subsequent studies in cultured cells and analysis of serum and cerebrospinal fluid have shown that the formation of amyloid β occurs as a normal process in many cell types, although its formation may not represent a predominant general pathway. Fundamental genetic DNA studies from individuals afflicted with the early onset of familial Alzheimer's disease show that mutations in a single gene, the same APP gene, are causing this very severe form of the disease. Interestingly, several different mutations have been found in the APP gene that include three different single residue substitutions in Val 717, four residues towards the 3 'end of the C-terminal part of β 1-42 amyloid (Goate et al., Nature, 349, 704-6, 1991, Chartier-Harlan et al., Nature, 353, 844-6 1991, Murrell et al., Science, 254, 97-9, 1991), and two residue mutations (670- 671) immediately towards the 5 'end of the N-terminal part of amyloid β, associated with the early onset of familial Alzheimer's disease, in a Swedish family (Mullan et al., Nature Genetics, 1, 345-347, 1992) . When a vector encoding the cDNA of the Swedish APP mutant gene is transfected into cell lines to evaluate APP processing, it has been found that six to eight times more amyloid β is formed when compared to APP concentrations of type wild (Citron et al., Nature, 360, 672-674, 1992; Cai et al., Sciences 259, 514-516, 1993). It has also been shown that brain tissue extracts that combine native human brain protease activities are capable of procesax the fluorogenic octapeptide substrate spanning the Swedish mutation at a rate 100 times greater than the corresponding substrate based on the sequence of the type. wild (Ladror et al., J. Biol. Chem., 269, 18422-8, 1994). These results suggest that the mechanism by which the Swedish mutation causes early access of familial Alzheimer's disease involves substantial overproduction of amyloid β. Similar studies have also been carried out with respect to the formation of amyloid in cells transfected with the 717 mutant of APP, but the concentrations of amyloid β produced are not different from the concentrations produced by wild-type APP. This is led to mechanistic speculations that there is another pathogenic production of amyloid β for these mutations. A closer evaluation of the processing of mutant APP 717 and the Swedish mutant APP by Younkin et al. (Susuki et al., Science, 264, 1336-1340, 1994) provides a unified picture of these cases of genetic Alzheimer's disease. In this study, not only the total concentrations of β-amyloid production, but also the specific lengths of the β-amyloid peptides produced were evaluated. The results confirm that the 717 mutation leads to an excess of duplication of the ratio of amyloid ß 1-42 to amyloid ß 1-40 (a highly soluble peptide under physiological conditions), although the total amyloid β concentrations do not change. Familial Alzheimer's disease mutations of presenilin 1 and 2 newly discovered in genes residing on chromosome 14 (Sherrington et al., Na ture, 375, 754-758, 1995) and on chromosome 1 (Levy-Lahad , et al., Science, 269, 970-973, 1995), respectively, have also been linked to a significant overproduction of amyloid β 1-42 (Mann et al., Annals of Neurology, 40, 149-56, 1996; Schuener et al., Na ture Medi cine 2, 864-70, 1996). Based on these findings, it seems that the pathogenic process mediated by these different and different familial Alzheimer's disease mutations is the production of higher levels of amyloid β1-42. This is the form of amyloid that is more easily added (Snyder et al., Biophys, J., 67, 1216-28, 1994), which initiates the aggregation of β-amyloid to form neuritic plaques (Roher et al., Neurochem. , 61, 1916-1926, 1993, Tamaoka et al., Biochem. Biophs, Res. Commun., 205, 834-842, 1994), and, as described herein, form which unexpectedly forms higher order assemblies. stable denominated "ADDL".

Non-amyloid plaque components in Alzheimer's disease. Amyloid β is the main protein component of plaques, constituting more than 70% of the total protein. Also present, however, is a variety of other protein, including anti-chymotrypsin (ACT), heparin sulfate proteoglycans (HSPG), apolipoproteins E and J, butyrylcholinesterase (BChE), S-100B and several other complement components. Although the importance of these components in the onset and progression of Alzheimer's disease has not been established, the relationship of the apo E isoforms in the disease has been established through the genetic studies of Roses and colleagues (Strittmatter et al. , Proc. Nati, Acad. Sci. USA, 1990, 1977-81, 1993), who discovered that a polymorphism in the polypeptide E gene, specifically apo E4, correlates with the early onset of Alzheimer's disease in a large set of cases of familial Alzheimer's disease with late onset. Subsequent studies have confirmed that groups of individuals with apo E4 have a significantly higher risk of Alzheimer's disease and the onset of Alzheimer's disease that is in some way parallel to the dosage of the gene. for apo E4. At the mechanistic level, studies have shown that apo E4 binds with lower affinity to amyloid β compared to apo E3 or apo E2, isoforms which are associated with the late onset of Alzheimer's disease. It has been suggested that these isoforms can exert a protective effect by means of a more effective elimination of amyloid deposits ß 1-42 (Ladu et al., J. Biol. Chem., 269, 23403-23406, 1994; Ladu et al., Biol. Chem., 270, 9039-42, 1995). The role of the other components of the plaque is not clear, although recent studies (Oda et al., Exp ti.

Neurology, 136, 22-31, 1995) have shown that apo J (clusterin) can significantly improve the cytotoxicity of β 1-42 amyloid added in vi tro. It has also been reported that HSPG improves the toxicity of β 1-40 amyloid when injected into rat brain (Snow et al., Soc. Neurosci, Abstr., 18, 1465, 1992). Wright et al. (Ann Neurol., 34, 373-384, 1993) demonstrated that amyloid plaques of brain with Alzheimer's disease contain significant concentrations of BChE, whereas amyloid plaques of non-demented elderly individuals do not. The acute phase inflammatory protein ACT is also upregulated in the brain in Alzheimer's disease, and it is known to be associated with the _16 N-terminal residues of amyloid β. Ma et al., (Ma et al., Na ture, 372, 92-94, 1994) have reported that ACT can improve β 1-42 amyloid aggregation, and these authors speculate that increased aggregation contributes to their neurotoxicity. Β-amyloid cell responses and pathology in vivo. Beyond the plaques and tangles that are the hallmarks of Alzheimer's disease, it is clear that a range of cellular responses have been induced, both in the neurons and in the accompanying glia cells. At the biochemical level, hyperphosphorylation of the tau protein is evident, resulting in perturbation of the kinase / phosphatase equilibrium. At the transcriptional level, a variety of genes are activated to produce a spectrum of proteins not normally present or only present at lower concentrations in the brain. There is also significant evidence that inflammatory processes have been activated. In particular, tau phosphorylation has been documented which is introduced by aggregated β 1-42 amyloid in differentiated SH-SY5Y cells (Lambert et al., J., Neurosci Res. 39, 377-384, 1994), and these results have been confirmed in a more recent report by Busciglio et al. (Neuron, 14, 879-88, 1995), in which tau phosphorylation activated by β-amyloid in rat hippocampal neurons in primary culture.

Amyloid β fibrillary and neurodegeneration in Alzheimer's disease. The mechanism by which amyloid ß 1-42 causes Alzheimer's disease has not been elucidated, but the literature contains more than 200 studies of amyloid ß neurotoxicity, many of which have recently been reviewed (eg, Yankner et al. ., Neuron, 16, 921-32, 1996; Iversen et al., Biochmical Journal, 311, 1-16, 1995). The prevailing concept is that in order for amyloid ß to be toxic, it must be assembled into fibrillar structures (Pike et al., "Neurosci., 13, 1676-87, 1993.) Solutions that only contain monomeric ß amyloid repeatedly. have shown no harmful effects on culture neurons, and studies have been correlated with the formation of fibril-containing amyloid leaves and the time and extent of toxicity using techniques such as circular dichroism and electron microscopy (Simmons et al. al., Molecular Pharmacology, 45, 373-9, 1994.) One study explicitly concludes that amyloid ß must exist in a fibrillar form in order to be toxic (Lorenzo et al., Proc. Nati. Acad. Sci. USA, 91, 12243-12247, 1994) Despite this consensus regarding the structure and activity of amyloid β, the ability to reproduce published experimental works involving amyloid toxicity continues to be a problem. loide (Brining, Neurobiology of Agin, 18, 581-589, 1997), and the widespread availability of activity obtained with different lots of amyloid, even from the same batch of amyloid handled in slightly different ways, despite the identical chemical composition (May et al., Neurobiology of Aging, 13, 1676-87, 1993). This has raised doubts about the precise structures of amyloid β that are responsible for its activity. The present invention seeks to solve the problems of the prior art. Accordingly, an object of the present invention is to provide a novel composition of matter, ß amyloid peptide assembled in non-fibrillar, globular and soluble oligomeric structures (ADDL) that are unexpectedly neurotoxic. These and other objects and advantages of the present invention, as well as additional inventive features, will be apparent from the following description.

BRIEF DESCRIPTION OF THE FIGURES - Figure 1 is a computer-generated image of a polyacrylamide gel stained with silver, explored with densitometer, which shows the electrophoretic shift of ADDL with a primary band corresponding to approximately 30 kD, a less abundant band corresponding to approximately 17 kD, and without evidence of fibrils or aggregates. Figure 2 is a computer generated image of an SDS-polyacrylamide gel stained with Coomassie, scanned with densitometer which shows the electrophoretic current of ADDL with a primary band (upper doublet) corresponding to a size of about 17 to about 22 kD, and with another band (lower dark band) indicating abundant 4 kD monomer present, probably a decomposition product. Lanes: first, molecular size markers; second, preparation of ADDL, third heavier load of ADDL preparation. Figure 3 is a computer generated image representative of an ADDL ADM analysis containing "fraction 3" (fractionated on a Superdex 75 gel filtration column). Figure 4 is a computer-generated image of an SDS-polyacrylamide gradient gel stained with Coomassie, screened with ADDL densitometer prepared with coincubation with clusterin (lane A), or cold D12 medium (lane B), and ADDL prepared by coincubation with clusterin and which passed through a 10 kD Centricon cut-off membrane (lane C) or which was retained by a 10 kD Centricon cut-off membrane (lane d): MW, molecular weight markers. Figure 5 is a graph of ADDL concentration measured as β 1-42 amyloid concentration (nM) versus% dead cells for brain slices from mice treated with the ADDL preparations. Figure 6 is a bar diagram showing the % reduction of MTT for control PC12 cells not exposed to ADDL ("Cont"), PC 12 cells exposed only to clusterin ("Apo J"), PC 12 cells exposed to monomeric Aβ ("Aβ"), PC 12 cells exposed to ß amyloid coaggregated with clusterin and aged one day ("Aß.Apo J"). Figure 7 is a FACS scan showing the fluorescence intensity (0-170) versus events (0-300) of B103 cells not exposed to ADDL (unshaded peak) and of B103 cells bound to fluorescent labeled ADDL (shaded peak) . Figure 8 is a FACS scan showing fluorescence intensity (0-200) versus vertex (0-300) for hippocampal cells not exposed to ADDL (non-shaded peak, "-ADDLs") and hippocampal cells bound to fluorescent labeled ADDLs (shaded peak, "+ ADDLs"). Figure 9 is a bar graph of the maximum percent bound ADDL or ADDL that induces death for B103 cells that have not been exposed ("-") or co-exposed ("+") to peptides released by trypsinization of B103 cells. Figure 10 is a graph of the relative concentration of ADDL versus% dead cells for brain slices from mice treated with the ADDL preparations. To determine the relative concentration, an initial concentration of 10 μM Aβ protein is used for the ADDL forms with the highest data point (point "16"), this is subsequently diluted 1/2 (point "8"), 1 / 4 (point "4"). and similar.

Figure 11 is a bar chart showing the optical density that is obtained in the ELISA assay that binds ADDL where B103 cells are co-incubated with ADDL and 6E10 antibody ("cell, ADDL, 6E10" bar), co-incubated B103 cells with ADDL and ("ADDL cell" bar), B103 cells coincubated with 6E10 antibody ("6E10 cell" bar), B103 cells were incubated alone ("cell" bar), 6E10 antibody was incubated alone (bar "6E10"), or the optical density of the diluent is read ("white" bar.) Figure 12 is a bar chart of% dead cells in either fyn + / + (wild type, diagonal / transverse bars "Fyn + ") or fyn - / - (lacking the gene," Fyn- "solid bars) of mice, either untreated (" medium ") or having had contact with the ADDLs (" ADDLs ") Figure 13 is a graph of the Aß concentration (μM) versus activated glia (number) obtained before the incubation of astrocytes with ADDL (black triangles) or Aβ 17-42 (black squares). Figure 14 is a graph of time (minutes) versii% peak amplitude of baseline cell body for control mice not treated with ADDL (black triangles) or mice treated with ADDL (black boxes). Figure 15 is a graph of time (minutes) versus average peak amplitude for control rat hippocampal cuts not exposed to ADDL (black triangles) versus, rat hippocampal slices exposed to ADDL (black boxes).

BRIEF DESCRIPTION OF THE INVENTION The invention encompasses a new composition of material called dementia ligands derived from amyloid β or diffusible ligands derived from amyloid β (ADDL). ADDL consist of β-amyloid peptide assembled in soluble non-fibrillar oligomeric structures that are capable of activating specific similar processes. Another aspect of the invention consists of methods for testing the formation, presence, binding to receptor proteins and cellular activities of ADDL. The invention further encompasses assay methods and methods for identifying compounds that modulate (e.g., increase or decrease) the formation and / or activity of ADDL. Such compounds can be used in the treatment of diseases, disorders or conditions due to the effects of ADDL.

DETAILED DESCRIPTION OF THE INVENTION It has been discovered that neurotoxic ß amyloid samples exist not only as fibrillar structures, but also, unexpectedly, there are some small globular protein structures that appear to be responsible for neurotoxicity. Using novel methods, samples containing predominantly these assemblies of soluble globular protein without fibrillar structures have been generated and described herein. In heterogeneous samples prepared by various methods, the removal of larger fibrillar forms of β-amyloid by centrifugation does not eliminate these soluble globular mounts of β-amyloid in the supernatant fractions. These fractions of supernatant show significantly higher neurotoxicity compared to unfractionated β amyloid samples added under conditions in literature. These novel and unexpected neurotoxic soluble globular forms are referred to herein as "dementia ligands derived from β-aryloid or diffusible ligands derived from β-amyloid.

(ADDL). "Amyloid β" samples have been "aged" under standard literature conditions (eg Pike et al., "Neurosci., 13, 1676-1687, 1993) for more than three weeks and lose their neurotoxicity, even if the samples contain Predominantly fibrillar structures with little or no ADDL This discovery that the globular ADDLs are neurotoxic is particularly surprising since current thinking states that the fibrillar structures are what make up the toxic form of amyloid β (Lorenzo et al., Proc. Nati, Acad. Sci. USA 91, 122243-12247, 1994; Howlett et al., Neurodegen, 4, 23-32, 1995). ADDL can be formed in vi tro. When diluting a solution (e.g., a solution of DMSO) containing monomeric β 1-42 amyloid (or other appropriate β amyloid, as further described herein) in cold tissue culture medium (e.g. F12 cells) and then allowed to incubate at about 4 ° C from about 2 to about 48 hours and centrifuged for about 10 minutes at about 14,000 g at a temperature of 4 ° C, the supernatant fraction contains small, soluble, oligomeric globules which are highly neurotoxic, for example, in neuronal cells and in brain-cut cultures. ADDL can also be formed by coincubation of β-amyloid with certain appropriate agents, for example clusterin (a senile plaque protein that is also known as apo J). Analysis by atomic force microscopy (AFM) of such a supernatant fraction demonstrates numbers of globules of different sizes present in the fraction. These globules are within the range from about 4.7 nm to about 6.2 nm. They can be different species of globules that are within this range. Specifically, a slight variation in the height surface results in the manner in which these particular species settle on the mica surface at the time of analysis. However, despite this slight variation, there appear to be two predominant globule sizes, ie, from about 4.9 nm to about 5.4 nm, and from about 5.7 nm to about 6.2 nm, which constitute approximately 50% of the oligomeric structures in a typical sample. There may also be species of different size of globules having dimensions from about 5.3 nm to about 5.7 nm. It appears that the globules of dimensions from about 4.7 nm to about 6.2 nm in AFM comprise the pentameric and hexamer form of the oligomeric β-amyloid protein. The AFM size of the beads is from about 4.2 nm to about 4.7 nm and appears to correspond to the Aβ tetramer. The "globules of size from about 3.4 nm to about 4.0 nm appear to correspond to the trimer." Globules of size from about 2.8 nm to about 3.4 nm correspond to the dimer (Robert et al., J. Biol. Chem., 271, 20631- 20635, 1996.) The size of the Aβ AFM monomer ranges from about 0.8 nm to about 1.8-2.0 nm.The monomeric and dimeric amyloid ß is not neuxotoxic in neuronal cell cultures or cultures of organotypic brain slices. The present invention provides a soluble and isolated non-fibrillar β-amyloid protein assembly (ie, ADDL), which preferably comprises from about 3 to about 12 β-amyloid proteins, and which desirably comprises at least about 3 to about approximately 6 β-amyloid proteins In particular, the invention provides an assembly of isolated β-amyloid protein where the preferably comprises an oligomeric form which is selected from the group consisting of trimer, tetramer, pentamer and hexamer. The assembly of protein optimally shows neurotoxic activity. The higher order structure of the β-amyloid protein can be formed not only from β 1-42 amyloid, but also from any β-amyloid protein capable of stably forming the assembly of soluble non-fibrillary amyloid β protein. In particular, amyloid β 1-43 can be used. Amyloid ß 1-42 with biocytin in position 1 can also be used. Amyloid β (for example β 1-42 or β 1-43) with a cysteine in the N-terminal part can also be used. Similarly, truncated Aβ can be used in the amino terminal part (eg, particularly where one or more groups have been lost up to the entire amino acid residue sequence 1 to 8 of-Aβ 1-42 or Aβ 1- 43), or Aβ (for example Aβ 1-42 or 1-43) having one or two additional amino acid residues in the carboxyl terminal part. In contrast, β 1-40 amyloid can transiently form ADDL-like structures which can not be toxic, but these structures are not stable and can not be isolated in aqueous solutions, mainly due to the shortened nature of the protein, which limits its ability to form higher order mounts in a stable manner. Desirably, the assembly of isolated β-amyloid protein according to the invention comprises globules of dimensions from about 4.7 nm to about 6.2 nm as measured by atomic force microscopy. In addition, preferably the assembly of isolated β-amyloid protein comprises globules of dimensions from about 4.9 nm to about 5.4 nm, or from about 5.7 nm to about 6.2 nm, as measured by atomic force microscopy. In particular, preferably the assembly of isolated β-amyloid protein according to the invention is such that from about 30% to about 85%, even more preferably from about 40% to about 75% of the assembly comprise two predominant sizes of globules, specifically, of dimensions from about 4.9 nm to about 5.4 nm, and from about 5.7 nm to about 6.2 nm, measured by atomic force microscopy. However, it is also desirable that the protein assembly comprises globules of AFM size from about 5.3 to about 5.7 nm.

By means of non-denaturing gel electrophoresis, the bands corresponding to the ADDL run from approximately 26 kD to approximately 28 kD. Under denaturing conditions (for example, in a 15% SDS-polyacrylamide gel), the ADDLs comprise a band running from about 22 kD to about 24 kD, and may further comprise a band running at about 18 to about 19 kD. Accordingly, the invention preferably provides an assembly of isolated β-amyloid protein (i.e. ADDL) having a molecular weight from about 26 kD to about 28 kD, determined by non-denaturing gel electrophoresis. Preferably, the invention also provides an assembly of isolated amyloid β-protein (ie, ADDL) that runs as a band corresponding to a molecular weight from about 22 kD to about 24 kD, or from about 18 to about 19 kD, determined by electrophoresis in SDS-polyacrylamide 15% gel. The invention further provides a method for preparing the assembly of isolated soluble nonfibrillar β-amyloid protein. This method optionally comprises the steps of: (a) obtaining a solution of monomeric β amyloid protein; (b) dilute the protein solution in an appropriate medium; (c) incubating the medium resulting from step (b) at about 4 ° C; (d) centrifuging the medium at about 14,000 g, at about 4 ° C; and (e) recovering the supernatant resulting from centrifugation such as that contained in the amyloid β protein assembly. In step (c) of this method, the solution is desirably incubated from about 2 hours to about 48 hours, especially from about 12 hours to about 48 hours, and more preferably from about 24 hours to about 48 hours. In step (d) of this method, centrifugation is preferably carried out from about 5 minutes to about 1 hour, especially from about 5 minutes to about 30 minutes, and optimally for about 10 minutes. However, this is generally only a precautionary measure to remove any nascent fibrillary or protofibrillary structures and may not be necessary, particularly when the long-term stability of the ADDL preparation is not a concern. The Aβ protein is diluted in step (b) desirably to a final concentration ranging from about 5 nM to about 500 μM, particularly from about 5 μM to about 300 μM, especially about 100 μM. The "appropriate medium" in which the Aβ protein solution is diluted in step (b) is preferably any medium that will, if not facilitating, support the formation of ADDL. In particular, T12 medium (which is also commercially available and which can also be easily formulated in the laboratory) is preferred for use in this method of the invention. Similarly, a "substitute F12 medium" can also be desirably used. The substitute F12 medium differs from the F12 medium that is commercially available or which can be formulated in the laboratory. According to the invention, the substitute F12 preferably comprises the following components: N, N-dimethylglycine, D-glucose, calcium chloride, copper sulfate pentahydrate, iron (II) sulfate heptahydrate, potassium chloride, magnesium chloride , sodium chloride, sodium bicarbonate, disodium hydrogen phosphate and zinc sulfate heptahydrate. In particular, the synthetic F12 medium according to the invention optionally comprises: N, N-dimethylglycine (from about 600 to about 850 mg / l), D-glucose (from about 1.0 to about 3.0 g / l), calcium chloride (from about 20 to about 40 mg / l "), copper sulfate pentahydrate (from about 15 to about 40 mg / l), iron (II) sulfate heptahydrate (from about 0.4 to about 1.2 mg / l), potassium chloride (from about 160 to about 280 mg / l) , magnesium chloride (from about 40 to about 75 mg / l), sodium chloride (from about 6.0 to about 9.0 g / l), sodium bicarbonate (from about 0.75 to about 1.4 g / l), disodium hydrogen phosphate ( from about 120 to about 160 mg / L), and zinc sulfate heptahydrate (from about 0.7 to about 1.1 mg / L). Optimally, the synthetic F12 medium according to the invention comprises: N, N-dimethylglycine (about 766 mg / l), D-glucose (about 1802 g / l), calcium chloride (about 33 mg / l), copper sulfate pentahydrate (approximately 25 mg / l), iron (II) sulphate heptahydrate (approximately 0.8 mg / l), potassium chloride (approximately 223 mg / l), magnesium chloride (approximately 57 mg / l), chloride sodium (approximately 7.6 g / l), sodium bicarbonate (approximately 1.18 g / l), disodium hydrogen phosphate (approximately 142 mg / l) and zinc sulphate heptahydrate (approximately 0.9 mg / l). In addition, the pH of the preferentially substituted F12 medium is adjusted, for example, using 0.1M sodium hydroxide, desirably to a pH of from about 7.0 to about 8.5, and preferably at a pH of about 8.0.

The above method may desirably be further carried out by forming a slow settling protein assembly in the presence of an appropriate agent such as clusterin. This is done, for example, by adding clusterina in stage (c) and, as stated in the examples that follow. If ADDLs are prepared by the incorporation of biotinylated 10% β-amyloid 1-42 (or other appropriate biotinylated β amyloid protein), they can be used in a receptor binding assay using neural cells and can be carried out, for example, in a fluorescence activated cell sorting instrument (FACS), labeled with a fluorescent avidin conjugate. Alternatively, instead of incorporating biotin into the β-amyloid protein, another reagent capable of binding in ADDL can be used to form a fluorescently labeled molecule, which can already be part of the fluorescent-labeling conjugate. For example, the protein assembly can be formed so that the amyloid protein includes another binding portion, wherein the term "binding portion" as used herein encompasses a molecule (such as avidin, streptavidin, polylysine and the like ) which can be used to bind a reagent to form a fluorescently labeled compound or a conjugate. The "fluorescent reagent" to which the protein assembly binds does not need to fluoresce itself directly, but instead may only be capable of fluorescence through binding to another agent. For example, the fluorescent reagent which binds to the protein assembly may comprise an antibody specific for β-amyloid (for example 6E10), with fluorescence generated by the use of a secondary fluorescent antibody. Together with other experiments, FACS scanning analysis in rat B103 CNS cells is performed without or with incubation with ADDL. The results of this and other studies confirm that the binding of the cell surface is situable, and a brief treatment with trypsin selectively removes a subset of cell surface proteins and eliminates the binding of ADDL. Proteins that can be removed by brief treatment with trypsin from the surface of B103 cells also prevent the binding of ADDL to B103 cells or cultured primary rat hippocampal neurons. These results also support the fact that ADDL acts through a particular cell surface receptor, and that the initial events mediated by the ADDL (i.e., the phenomena before cell death) can be advantageously controlled (e.g. treatment or investigation) by compounds that block the formation and activity (eg, including receptor binding) of ADDL. Therefore, the invention provides a method for identifying compounds that modulate (i.e., facilitate or block) the ADDL receptor binding. This method preferably comprises: (a) contacting separate cultures of neuronal cells with the protein assembly either in the presence or absence of contact with the test compound; (b) add a reagent that binds to the protein assembly, the reagent is fluorescent; (c) analyzing cell cultures separated by fluorescence-activated cell sorting; and (d) comparing the fluorescence of the cultures, with compounds that block receptor binding to the protein assembly that are identified as resulting in reduced fluorescence of the culture, and compounds that facilitate receptor binding that is identified as resulting in a increased fluorescence of the culture, compared to the corresponding culture which is contacted with the protein assembly in the absence of the test compound. Alternatively, instead of adding a fluorescent reagent that in or of itself is capable of binding to the protein complex, the method is desirably carried out where a protein assembly is formed from the beta 1-amyloid protein. 42 (or other β amyloid) prepared so as to comprise a binding portion capable of binding the fluorescent reagent.

Similarly, the method can be used to identify compounds that modulate (i.e., facilitate or block) the formation or binding of receptor to the protein assembly, comprising: (a) preparing samples separately from amyloid β that have been or that have not been mixed with the test compound; (b) forming the protein assembly in the separated samples; (c) contacting separate cultures of neuronal cells with the separated samples; (d) adding a reagent that binds to the protein assembly, the reagent is fluorescent; (e) analyzing cell cultures separated by fluorescence-activated cell sorting; and (f) comparing the fluorescence of the cultures, with compounds that block the formation of receptor binding of the protein assembly that are identified as resulting in reduced fluorescence of the culture, and compounds that facilitate the formation or binding of the receptor of the assembly. of protein that are identified as resulting in increased luorescence of the culture, as compared to the corresponding culture that is contacted with the protein assembly in the absence of the test compound. In addition, instead of adding a fluorescent reagent which in or of itself is capable of binding to the protein complex, the method can be carried out where the protein assembly is formed from β-amyloid protein prepared in a manner that comprises a binding portion capable of binding to the fluorescent reagent. Optionally the fluorescence of the cultures is further compared to the fluorescence of cultures that have been treated in the same manner except that instead of adding or not adding the test compound before the formation of the protein assembly, the test compound is added or not after the formation of the protein assembly. In this situation, the block formation of the protein assembly is identified as resulting in reduced fluorescence of the culture, and the compounds that facilitate the formation of the protein assembly are identified as resulting in an increased fluorescence of the culture, as compared to the culture. corresponding to which the protein assembly is contacted in the absence of the test compound only when the compound is added before the protein assembly. In contrast, compounds that block receptor binding of the protein assembly are identified as resulting in reduced fluorescence of the culture, and compounds that facilitate receptor binding of the protein assembly are identified as resulting in increased fluorescence of the culture, in comparison with the corresponding culture that is contacted with the protein assembly in the absence of the test compound, when the compound is added either before or after protein assembly. In a similar manner, a cell-based assay, particularly a cell-based immunosorbent assay (ELISA) based on cells, according to the invention, can be used to determine the binding activity of ADDL. In particular, the method can be used to detect binding of the protein assembly to a cell surface receptor. This method preferably comprises: (a) forming a protein assembly from β-amyloid protein; (b) contacting a culture of neuronal cells with the protein assembly; (c) adding an antibody (e.g., 6E10) that binds the protein assembly, the antibody includes a conjugating moiety (e.g., biotin or other appropriate agent); (d) removing the unbound antibody by washing; (e) attaching an enzyme (eg, horseradish peroxidase) to the antibody bound to the protein assembly by means of the conjugating moiety; (f) adding a colorless substrate (eg ABTS) that is separated by the enzyme to provide a color change; and (g) determining the color change (e.g., spectrophotometrically) or the rate of color change as a measure of receptor binding of the protein assembly. As described above, the antibody can be an antibody capable of detecting ADDLs (for example an antibody directed to an exposed site of β amyloid), and the conjugating portion of antibody can be any agent capable of attaching a detection means (for example an enzyme) . The enzyme can be any portion (eg, perhaps even different from a protein) that provides a detection means (eg, a color change due to the separation of a substrate) and that can also be bound (eg, covalently). or non-covalent) to the antibody bound to the protein assembly by means of another portion (e.g., a secondary antibody). Furthermore, preferably according to the invention, the cells adhere to a solid substrate (eg plastic in a tissue culture) before carrying out the assay. It is worth mentioning that step (b) may be carried out in a desirable manner as described herein so that the ADDLs are able to bind to the cells. Similarly, step (c) is preferably carried out for a sufficient length of time (eg, from about 10 minutes to about 2 hours, desirably from about 30 minutes) and under appropriate conditions (eg, at room temperature). , preferably with gentle agitation) to allow the antibody to bind to the ADDL. In addition, appropriate blocking steps such as those known to those familiar in the art can be carried out using appropriate blocking agents to reduce any non-specific binding of the antibody. A person familiar with the ELISA technique can use assay modifications such as are known in the art. Desirably, the assay can also be carried out so as to identify compounds that modulate (i.e., facilitate or block) receptor formation or binding of the protein assembly. In this method, as in the assays described above for test compounds, the test compound is added to the ADDL preparation, before contact with the cells with ADDL. In this manner this assay can be used to detect compounds that modulate the formation of the protein assembly (for example as previously described). In addition, the test compound can be added to the ADDL preparation before the cells make contact (but after the formation of ADDL) or to the cells before contact with the ADDL. This method (for example, as previously described) can be used to detect compounds that modulate the binding of ADDL to the surface of the cell. In addition, the test compound can be added to a mixture of cells plus ADDL. This method (e.g., as previously described) can be used to detect compounds that affect ADDL-mediated events that occur downstream of the ADDL receptor binding. The specificity of the compounds can be confirmed to act on a downstream effect mediated by ADDL, for example, by simply adding the test compound in the absence of any coincubation with the ADDL. Of course, additional appropriate controls should be included with all tests (eg, as set forth in the following examples and as known to those familiar with the art). This information regarding compounds that modulate (i.e., facilitate or block) the formation and / or activity that include receptor binding of the protein assembly can be used in the investigation and treatment of diseases, conditions or disorders mediated by ADDL. The methods of the invention can be used to investigate the activity and neurotoxicity of the ADDL itself. For example, when an ADDL or 20 ADDL preparation is injected into the hippocampus region in adult mice 60-70 minutes before carrying out a long-term potentiation (LTP) experiment (eg, Namgung et al., Brain Research, 689, 85-92, 1995), the stimulation phase of the experiment occurs in a manner identical to that which occurs with saline control injections, but the consolidation phase shows a continuous and significant decline in the synaptic activity measured by peak leather cell amplitude, over the subsequent two hours, compared to control animals, in which the synaptic activity remains at a level comparable to that shown during the stimulation phase. The brain cut analysis after the experiment indicates that no cell death has occurred. These results, as well as others described in the following examples, confirm that treatment with ADDL compromises the LTP response. This indicates that ADDL contributes to the learning and compromised memory observed in Alzheimer's disease by interference with a neuronal signaling process, rather than by induction of nerve cell death. ~~ Additional information on the effects of ADDLs can be obtained. (either in the presence or absence of test compounds that potentially modulate the formation and / or activity of ADDL) using additional assays according to the invention. For example, the invention provides a method for testing the effects of ADDL which preferably comprises: (a) administering the protein assembly to the hippocampus of an animal; (b) apply an electrical stimulus; and (c) measuring the amplitude of the cell body peak with respect to time to determine the long-term potentiation response. Optionally the method is carried out where the long-term potentiation response of the animal is compared with the long-term potentiation response of another animal treated in the same manner except that saline has been administered instead of lipoprotein assembly before the application of the electrical stimulus. This method can be further used to identify compounds that modulate (ie increase or decrease) the effects of ADDL, for example, by comparing the LTP response in animals that have been administered ADDL either alone or together with the test compounds. In addition to these lines, the invention provides a method for identifying compounds that modulate the effects of the ADDL protein assembly. The method preferably comprises: (a) administering saline or a test compound to the hippocampus of an animal; (b) apply an electrical stimulus; (c) measuring the peak amplitude of cell body with respect to time to determine the long-term potentiation response; and (d) comparing the long-term potentiation response of animals having saline administered with the long-term potentiation response of animals to which the test compound has been administered. The method optionally further comprises administering protein assembly to the hippocampus either before, along with or after administration of the saline or test compound.

Similarly, the present invention provides a method for identifying compounds that modulate (ie, increase or decrease) the neurotoxicity of the ADDL protein assembly, which method comprises: (a) contacting separate cultures of neuronal cells with the protein assembly either in the presence or absence of contact with the test compound; (b) measuring the proportion of viable cells in each culture; and - (c) comparing the proportion of viable cells in each culture. Compounds that block the neurotoxicity of protein assembly are identified, for example, as a result of an increased proportion of viable cells in the culture as compared to the corresponding culture that is contacted with the protein assembly in the absence of the test compound. . Compounds that increase the neurotoxicity of the protein assembly are identified, for example, as a result of a reduced production of viable cells in the culture as compared to the corresponding culture that is contacted with the protein assembly in the presence of the test compound. . The methods of the invention can also be used to detect ADDL in the test materials (for example, as part of research, diagnosis and / or therapy). For example, ADDLs that perform a rapid morphological change in B103 cells lacking serum and also activate Fyn kinase activity in these cells in the next 30 minutes of treatment with ADDL (data not shown). ADDL also induce rapid complex formation between Fyn and a focal adhesion kinase (FAK; Zhang et al., Neurosci. Letters, 211, 1-4, 1996), and the translocation of several phosphorylated proteins and Fyn-Fak complex in an insoluble fraction in Triton (Berg et al., "Neurosci. res., 50, 979-989, 1997.) This suggests that Fyn and other activated signaling pathways are involved in the neurodegenerative process induced by ADDL. confirmed by experiments in cultures of brain sections from genetically altered mice lacking the functional Fyn gene, where the addition of ADDL results in a lack of increased neurotoxicity compared to the controls to which the vehicle has been administered. , the compounds that block one or more of the functions of Fyn or the relocation of Fyn, specifically when influencing ADDL, can be important neuroprotective drugs for Alzheimer's disease. Similarly, when ADDL is added to the primary astrocyte cultures, the astrocytes are activated and the mRNA is elevated for several proteins, including IL-1, inducible nitric oxide synthase, Apo E, Apo-J and al-anti-chymotrypsin. These phenomena are desirably used according to the invention in a method for detecting ADDL protein assembly in a test material. Such methods optionally comprise: (a) contacting the test material with an antibody (e.g., 6E10 antibody or other antibody); and (b) detecting binding to the protein assembly of the antibody. Similarly, the method may desirably be used wherein: (a) the test material is contacted with neuroblastoma cells lacking serum (eg, neuroblastoma B103 cells); and (b) the morphological changes in the cells are measured by comparing the morphology of the cells against neuroblastoma cells that has not been contacted with the test material. The method can also be preferably used wherein: (a) the test material is contacted with brain cut cultures; and (b) the death of brain cells is measured in comparison to brain cut cultures that have not been brought into contact with the test material. The method may additionally be desirable in which: (a) the test material is brought into contact with neuroblastoma cells (e.g. neuroblastoma B103 cells); and (b) the increases in fyn kinase activity are measured in comparison to the fyn kinase activity in the cells against the fyn kinase activity in neuroblastoma cells that have not been contacted with the test material. In particular, the fyn kinase activity can be compared using commercially available equipment (for example, the # QIA-28 team from Oncogene Research Products, Cambridge, MA) or using an assay analogous to that described in Borowski et al., J. Biochem. (Tokyo), 115, 825-829, 1994. In yet another preferred embodiment of the method for detecting ADDL in the test material, the method desirably comprises: (a) contacting the test material with cultures of primary astrocytes, and (b) determining the activation of astrocytes compared to cultures of primary astrocytes that have not been contacted with the test material.In a variation of this method, the method optionally comprises: (a) contact the test material with cultures of primary astrocytes, and (b) measure in astrocytes increases in mRNA for proteins that are selected from the group consisting of interleukin-1, nitric oxide synthase ible, Apo E, Apo J and Ol-antiquimiotripsina when comparing mRNA levels in astrocytes against the corresponding levels of mRNA in cultures of primary astrocytes that have not been put in contact with the test material. Of course, there are other test methods and variations in addition to those described above that may be apparent to those familiar with the art, particularly in view of the description of the specification herein. Thus, it is clear that ADDLs according to the present invention have utility in vi tro. Such ADDL can be used, for example, as a research tool in the study of the ADDL binding and the interaction within cells, and with a method for testing ADDL activity. Similarly, ADDL and ADDL training, activity and modulation studies can be used in vivo. In particular, the compounds identified using the methods of the present invention can be used to treat any of a number of diseases, disorders or conditions that result in deficiencies in knowledge or learning (i.e., due to memory failure) and / or deficiencies in memory itself. Such treatment or prevention can be carried out by administering compounds that prevent ADDL formation and / or activity, or that modulate (ie, increase or decrease the activity, desirably as a consequence of influencing the ADDL). cellular agents with which ADDLs interact (for example, what are called "downstream" events). Such compounds have the ability to affect the ADDL referred to herein as "ADDL modulator compounds". The ADDL modulator compounds can not only act in a negative manner, but also, in some cases, is preferably used to increase the formation and / or activity of the ADDL. Desirably, when used in vivo, the method can be used to protect an animal against decreases in its knowledge, learning or memory due to the effects of ADDL protein assembly. This method comprises administering a compound that blocks the formation or activity of ADDL. Similarly, to the extent that there are deficiencies in the knowledge, learning and / or memory due precisely to the formation and / or activity of ADDL, the deficiencies can be reversed or restored once the activity has been blocked (and / or formation) of the ADDL. Therefore, the invention preferably provides a method for reverting (or restoring) in an animal that exhibits decreases in knowledge, learning or memory due to the effects of a protein assembly according to the invention. This method preferably comprises blocking the formation of ADDL activity.

In particular, this method can be applied in a desirable manner in the treatment or prevention of a disease, disorder or condition that manifests as a deficiency in knowledge, learning and / or memory and which is due to the formation or activity of ADDL. , especially a disease, disorder or condition that is selected from the group consisting of Alzheimer's disease, adult Down syndrome (i.e., older than 40 years of age) and senile dementia. In addition, this method may be desirable in the treatment or prevention of early harmful effects on cellular activity, knowledge, learning and memory that may be evident before the development of the disease, disorder or condition itself, harmful effects which may contribute to the development of, or finally constitute the disease, disorder or condition itself. In particular, the method can preferably be applied in the treatment or prevention of an early malfunction of nerve cells or other brain cells which may result as a consequence of the formation or activity of ADDL. Similarly, the method can preferably be applied in the treatment or prevention of focal memory impairments (FMD) such as those described in the literature (for example, Linn et al., Arch. Neurol., 52, 485-490. , 1995), in the event that such FMD is due to the formation or activity of ADDL. Desirably, the method can be used in the treatment or prevention of aberrant neuronal signaling induced by ADDL, damage of higher order skills of writings (eg Snowdon et al., JAMA, 275, 528-532, 1996) or other cognitive functions of higher order, decreases in (or absence of) long-term potentiation, which follows as a consequence of the formation or activity of ADDL. In accordance with this invention, an "aberrant neuronal signaling induced by ADDL" can be measured by various means. For example, for normal neuronal signaling (as well as the observation of a long-term potentiation response), it appears, among other things, that Fyn kinase must be activated, the Fyn kinase must phosphorylate the NMDA channel (Miyakawa et al., Science, 278, 698-701, 1997; Grant, J. "Physiol Paris, 90, 337-338, 1996), and Fyn must be present in the appropriate cellular position (which may be impeded by the formation of the Fyn complex). Fak, for example, as it occurs in certain cytoskeletal reorganizations induced by ADDL.) Based on this, the aberrant neuronal signaling induced by ADDL (which is a malfunctioning signaling that is induced by aberrant activation of cellular pathways by the ADDL). ) and the knowledge thereof can be used in these methods of the invention, as will be obvious to a person familiar with the art.For example, the aberrant cell signaling induced by ADDL can be determined (for example This is a consequence of nerve cells in contact with ADDL, which can be carried out additionally in the presence or absence of compounds that are tested for ADDL modulating activity, using any of these measures, or as they would be apparent to a person. familiar to the art, for example activation of Fyn kinase (or alteration thereof), formation of Fyn-Fak complexes (or alteration thereof), cytoskeletal reorganization (or alteration thereof), subcellular localization of Fyn kinase (or alteration thereof), phosphorylation of Fyn kinase of NMDA channel (or alteration thereof). In addition, the ADDL itself can be applied in the treatment. It has been found that these novel mounts described herein have numerous unexpected effects on cells that conceivably can be applied for therapy. For example, ADDL activates endothelial cells, endothelial cells which are known, inter alia, to interact with vascular cells. Along with these lines, ADDL can be used, for example, in wound healing. In addition, by way of example, botulinum toxin type A (BoTox) is a neuromuscular binding blocking agent produced by the bacterium Clostridium um botulinum which acts by blocking the release of the neurotransmitter acetylcholine. It has been shown that BoTox is beneficial in the treatment of disabling muscle spasms, including dystonia. Theoretically, the ADDL itself can be applied to instruct a function of neural cells or, to selectively destroy target neuronal cells (for example in cases of cancer, for example of the central nervous system, particularly of the brain). ADDL appear to be advantageous further in this regard since they have very early effects on the cells, and since their effect on the cells (in addition to their cell-destroying effect) appears to be reversible. As discussed in the foregoing, the ADDL modulator compounds of the present invention, as well as the ADDL itself, can be used to contact cells either in vitro or in vivo. According to the invention, a cell can be any cell and, preferably, it is a eukaryotic cell. A eukaryotic cell is a cell that typically has, at some stage in its life, a nucleus surrounded by a nuclear membrane. Preferably, the eukaryotic cell is of a multicellular species (eg, as opposed to a unicellular yeast cell) and, even more preferably, is a mammalian (optionally human) cell. However, the method can also be effectively carried out using a wide variety of different cell types such as bird cells and mammalian cells that include, but are not limited to, rodent, primate cells (such as chimpanzee, monkey, mandrill, gorilla, orangutan or gibbon), felines, canines, ungulates (such as ruminants or pigs) as well as, in particular, human cells. Preferred cell types are cells that are formed in the brain, including neural cells and glia cells. An especially preferred type of cell according to the invention is a neural cell (either normal or aberrant, for example transformed or cancerous). When used in tissue culture, the neural cell is desirably a neuroblastoma cell. The cell may be present as a single entity, or it may be part of a larger collection of cells. Such a "larger collection of cells" may comprise, for example, a cell culture (either mixed or pure), a tissue (for example neural or other tissue), an organ (for example the brain or other organs), a organ system (for example the nervous system or other organ system) or an organism (e.g. a mammal or the like). Preferably, the organs / tissues / cells of interest in the context of the invention are from the central nervous system (e.g., they are neural cells). Furthermore, according to the invention, "contacting" comprises any means by which these agents physically touch a cell. The method does not depend on any particular means of introduction and is not considered in this way. The means of introduction are well known to those familiar with the art and are also exemplified herein. Accordingly, the introduction can be carried out, for example, either in vi tro (for example in an ex vivo type therapy method or in tissue culture studies) or in vivo. Other methods are also available and are known to those familiar with the art. Such "contact" can be made by any means known to those familiar with the art, and as described herein, whereby the apparent contact or mutual tangency of the ADDLs and ADDL modulator compounds and the cell can be Conducting, for example, contacting can be done by mixing these elements in a small volume of the same solution. Optionally, the elements can be covalently linked, for example, by a chemical means known to those familiar in the art or other medium, or preferably they can be joined by means of non-covalent interactions (eg, ionic bonds, hydrogen bonds, Van forces). der Waals and / or non-polar interactions). In comparison, the cell to be affected and the ADDL or the ADDL modulator compound need not be contacted in a small volume as, for example, in cases where the ADDL or the ADDL modulator compound is administered to a host, and the complex is displaced by the blood stream or other body fluid such as cerebrospinal fluid to the cell with which it binds. The contact of the cell with an ADDL or an ADDL modulator compound is sometimes done before, together with or after another compound of interest is administered. Desirably, this contact is made so that there is at least a certain amount of time where the co-administered agents concurrently exert their effects on a cell or on the ADDL. A person skilled in the art will appreciate that suitable methods of administering an agent (e.g., an ADDL or an ADDL modulator compound) of the present invention to an animal for therapy and / or diagnostic, research or study purposes are available and Although more than one route can be used for administration, a particular route can provide an effective reaction more immediate and more effective than another route. The pharmaceutically acceptable excipients are also well known to those familiar with the art, and are readily available. The choice of excipient will be determined in part by the particular method used to administer the agent. Accordingly, there is a wide variety of formulations suitable for use in the context of the present invention. The following methods and excipients are only exemplary and in no way limiting.

Formulations suitable for oral administration consist of: (a) liquid solutions, such as an effective amount of the compound dissolved in diluents, such as water, saline or orange juice; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, such as solids or granules; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. The tablet forms may include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talcum, magnesium stearate, stearic acid and other excipients, dyes, diluents, buffers, wetting agents, preservatives or preservatives, flavoring agents and pharmacologically compatible excipients. The forms of lozenge may comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as lozenges comprising the active ingredient in an inert base, such as gelatin and glycerin, emulsions, gels and the like containing in addition to the ingredient active, excipients such as those known in the art. An agent of the present invention, alone or in combination with other suitable ingredients, can be manufactured in aerosol formulations to be administered by inhalation. These aerosol formulations can be placed in acceptable pressurized propellants, such as dichlorodifluoromethane, propane, nitrogen and the like. They can also be formulated as pharmaceutical substances for non-pressurized preparations, for example in a nebulizer or in an atomizer. Formulations suitable for parenteral administration are preferred according to the invention and include aqueous and non-aqueous, sterile isotonic solutions for injection, which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the proposed recipient, and sterile aqueous and non-aqueous suspensions including suspending agents, solubilizers, thickening agents, stabilizers and preservatives. The formulations can be presented in unit dose containers or sealed multi-dose containers, such as ampoules and flasks, and can be stored in a freeze-dried (lyophilized) condition that only requires the addition of sterile liquid excipient, eg, water for injections, immediately before use. Solutions and suspensions for extemporaneous injection can be prepared from sterile powders, granules and tablets of the classes previously described. The dose administered to an animal, particularly a human, in the context of the present invention will vary with the agent of interest, the composition used, the method of administration and the particular site and the organism in question. However, preferably, a dose corresponding to an effective amount of an agent (for example an ADDL or an ADDL modulator compound according to the invention) is used. An "effective amount" is one that is sufficient to produce the desired effect in a host, which can be monitored using various endpoints known to those familiar with the art. Some examples of the desired effects include, but are not limited to, a learning effect, memory, LTP response, neurotoxicity, ADDL formation, ADDL receptor binding, antibody binding, cellular morphological changes, Fyn kinase activity, activation of astrocytes and changes in mRNA concentrations for proteins such as interleukin-1, inducible nitric oxide synthase, ApoE, ApoJ and al-anti-chymotrypsin. These described methods are by no means totally inclusive, and additional methods for adapting to specific applications will be apparent to a person, usually familiar with the art. further, with particular applications (for example either in vi tro or in vivo) the actual dose and administration protocol of ADDL or ADDL modulator compounds may vary based on whether the composition is administered in combination with other pharmaceutical compositions, or depending on interindividual differences in pharmacokinetics, drug composition and metabolism. Similarly, amounts may vary in applications in vi tro depending on the type of particular cell used or the medium or solution by which the ADDL or the ADDL modulator compound is transferred to the culture. A person familiar with the art can easily make any necessary adjustment according to the requirements of the particular situation.

E p plos The above descriptions (as well as those that follow), are only exemplary. Other applications of the method and constituents of the present invention will be apparent to a person familiar with the art. Therefore, the following examples further illustrate the present invention but, of course, should not be considered in any way as limiting the scope.

Example 1: Preparation of β amyloid oliqomers In accordance with the invention, ADDLs are prepared by dissolving 1 mg of solid β 1-42 amyloid (eg, synthesized as described in Lambert et al., J.) Neurosci. Res., 39, 377-395, 1994 ) in 44 μl of anhydrous DMSO This 5 mM solution is then diluted in cold (12 ° C) F12 medium (Gibco BRL, Life Technologies) to a total volume of 2.20 ml (50-fold dilution) and vortexed for approximately 30 minutes. The mixture is allowed to incubate from about 0 ° C to about 8 ° C for about 24 hours, followed by centrifugation at 14,000 g for about 10 minutes at about 4 ° C. The supernatant is diluted by factors of 1:10 at 1.10,000 in the particular defined medium, before incubation with brain cut culture, cell cultures or binding protein preparations.However, in general, ADDLs are formed at an Aβ protein concentration of 100 μM. , the highest concentration uti for experiments is 10 μM and, in some cases, the ADDL (measured as initial concentration Aβ) are diluted (eg, in cell culture medium) to 1 nM. For analysis by atomic force microscopy (AFM), a 20 μl aliquot of the 1: 100 dilution is applied to the freshly separated mica disk surface and analyzed. Other manipulations are described in the following, or as they are known. Alternatively, the formation of ADDL was carried out as described above, except that the F12 medium was replaced by a buffer (ie, "substitute F12 medium") containing the following components: N, N-dimethylglycine (766 mg / l), D-glucose (1,802 g / l), calcium chloride (33 mg / l), copper sulphate pentahydrate (25 mg / l), iron (II) sulfate heptahydrate (0.8 mg / l) ), potassium chloride (223 mg / l), magnesium chloride (57 mg / l), sodium chloride (7.6 g / l), sodium bicarbonate (1.18 g / l), disodium hydrogen phosphate (142 mg / l) ) and zinc sulfate heptahydrate (0.9 mg / l). The pH of the buffer is adjusted to 8.10 using 0.1M sodium hydroxide.

Example 2: Cross-linking of β-amyloid oligomers Glutaraldehyde has been used successfully in various biochemical systems. Glutaraldehyde tends to crosslink proteins that are directly in contact, as opposed to non-specific reaction with high concentrations of monomeric protein. In this example, the crosslinking induced by glutaraldehyde of amyloid β was investigated. An oligomer preparation was carried out as described in Example 1, with the use of substitute F12 medium. The supernatant that is obtained after centrifugation (and in some cases, fractionation) is treated with 0.22 ml of a 25% aqueous solution of glutaraldehyde (Aldrich) followed by 0.67 ml of 0.175M sodium borohydride in 0.1M NaOH (in accordance with Levine's method, Neurobiology of Aging, 1995). The mixture is stirred at 4 ° C for 15 minutes and is suspended by the addition of 1.67 ml of 20% aqueous sucrose. The mixture is concentrated 5 times in a SpeedVac device and dialyzed to remove smaller components of 1 kD. The material is analyzed by SDS-PAGE. The chromatography is carried out in gel filtration, according to the following: a column of Superóse 75PC 3.2 / 3.0 (Pharmacia) is equilibrated with 0.15% ammonium carbonate buffer, filtered and degassed (pH = 7.8) at a rate of flow of 0.02 ml / min during the course of 18 hours at room temperature. The flow rate was changed to 0.04 ml / min and 20 ml of solvent was eluted. 50 microliters of the reaction solution was loaded into the column and a flow rate of 0.04 ml / min was again assumed. The elution of the compound is monitored via UV detection at 220 nm, and fractions of 0.5-1.0 ml are collected during the course of chromatography. Fraction No. 3 is isolated, which corresponds to the third UV absorbance peak and is demonstrated by AFM containing globules of 4.9 +/- 0.8 nm (by broad analysis). This fraction is highly neurotoxic when placed in contact with brain-cutting neurons, as described in the examples that follow.

Example 3; Size characterization of ADDL This example establishes the size characterization of ADDLs formed as in example 1, and that uses various methods (for example native gel electrophoresis, SDS-polyacrylamide gel electrophoresis, AFM, field flow fractionation and immuno-recognition) . AFM is carried out essentially as previously described (eg, Stine et al., J., Protein Chem., 15, 193-203, 1996.) Specifically, images are obtained using a multiple-mode atomic force microscope. of Digital Instruments (Santa Barbara CA), Nanoscope Illa Multimode Atomic using a J scanner with an x and a range of 150. The connection mode is used for all images using TESP nanoprobes recorded in silicon (Digital Instruments). AFMs are analyzed using Nanoscope Illa programming elements (software) in the IGOR Pro ™ waveform analysis software. For the analysis by AFM, 4μ scans are carried out (ie, determinations of a square of 4 μm x 4 μm.) Typically, the reported dimensions are obtained by section analysis, and when broad analysis is used, it is specified. s of separate analyzes in the programming elements (software) Nanoscope Illa. Generally, for ADDL analysis, there is a systematic deviation between the sizes obtained by section analysis and those obtained by broad analysis. Specifically, for a 4 μ scan section analysis, it provides heights that are usually about 0.5 nm higher, resulting in a deviation of about 0.5 nm in the values obtained for the globule sizes. The analysis by gel electrophoresis is carried out in 15% polyacrylamide gels and visualized by Coomassie blue staining. The ADDL are separated in 4-20% tris-glycine gels under non-denaturing conditions (Novex). Electrophoresis is carried out at 20 mA for approximately 1.5 hours. The proteins are separated with SDS-PAGE as described in Zhang et al., J ". Biol. Chem., 269, 25247-25250, 1994. The protein is subsequently visualized using silver staining (for example as described in Sherchenko. et al., Anal.Chem., 68, 850-858, 1996.) The proteins in the gel of both native gels and SDS are transferred to nitrocellulose membranes according to Zhang et al., (J. Biol. Chem. ., 269, 25247-50, 1994.) Immunoblotting (immunoblots) with biotinylated 6E10 antibodies is carried out.

(Senetak, Inc., St. Louis, Missouri) at 1: 5000 and visualized using ECL (Amersham). Typically, the gels are scanned using a densitometer. This allows to provide computer generated images of the gels (for example versus photographs of the gels themselves). Size characterization of ADDLs by AFM section analysis (for example as described in Stine et al., J "Protein Chem., 15, 193-203, 1996) or with extensive analysis (programming elements (software Nanoscope III) indicate that the predominant species are globules of approximately .7 nm to approximately 6.2 nm throughout the period.The comparison with small globular proteins (monomer Aβ 1-40, aprotinin, bFGF, carbonic anhydrase) suggests that ADDL have a mass between 17-42 kD. They can recognize what appear to be distinct species.These appear to correspond to the globules of dimensions from about 4.9 nm to about 5.4 nm, from about 5.4 nm to about 5.7 nm, and from about 5.7 nm to approximately 6.2 nm The globules of approximately 4.9-5.4 nm and 5.7-6.2 nm dimensions appear to comprise approximately 50% of the globules. FM, SDS-PAGE immunoblots of ADDLs identify Aβ oligomers from approximately 17 kD to approximately 22 kD, with abundant 4 kD monomer present, probably a separation product. Consistent with this interpretation, the denaturing polyacrylamide gels of the ADDL show a sparse monomer, with a primary band close to 30 kD, a less abundant band at -17 kD, and without evidence of fibrils or aggregates. Computer-generated images of a native gel stained with silver and an SDS-polyacrylamide gel stained with Coomassie are set forth in Figures 1 and 2, respectively. The correspondence between SDS and the non-denaturing gels confirms that the small oligomeric size of the ADDL is not due to detergent action. The oligomers seen in preparations of ADDL are smaller than clusterin (Mr 80 kD, 40 kD in denatured gels), as expected from the use of low concentrations of clusterin (1/40 in relation to Aβ, which prevents the association of Aβ as complexes of Aß-clusterin 1: 1). An ADDL preparation according to the invention is fractionated on a Superdex 75 column (Pharmacia, Superpose 75PC 3.2 / 3.0 column). The fraction comprising the ADDL is the third fraction of UV absorbance that elutes from the column and is analyzed by AFM and SDS-polyacrylamide gel electrophoresis. A representative analysis of AFM of fraction 3 is shown in Figure 3. Fractionation results in greater homogeneity for ADDL, where most of the globules have dimensions from about 4.9 nm to about 5.4 nm. The SDS-polyacrylamide gel electrophoresis of the fraction demonstrates a heavy lower band corresponding to the monomeric / dimeric form of Aβ. It is also observed for the unfractionated preparation of the ADDL, it seems to be a separation product of the ADDL. A heavier load of the fraction shows a wider band of larger size (maybe a doublet). This further confirms the stability of the non-fibrillar oligomeric Aβ structures to SDS.

Example 4; Amyloid Clusterine Treatment ß Although it has been proposed that the fibrillar structures represent the toxic form of Aβ (Lorenzo et al., Proc. Nati. Acad., USA, 91, 12243-12247, 1994, Howlett et al., Neurodegen, 4, 23-32, 1995), novel neurotoxins that do not behave like settable fibrils will be formed when Aβ 1-42 is incubated with low doses of clusterin, which is also known as "ApoJ" (Oda et al., Exper. Neurol., 136, 22-31, 1995; Oda et al., Biochem. Biophys., Res Commun., 204, 1131-1136, 1994). To test whether these slow-set toxins can still contain small or nascent fibrils, Aβ preparations treated with clusterin are examined by atomic force microscopy. The treatment with clusterin is carried out as described in Oda et al., (Exper. Neurol., 136, 22-31, 1995) basically by adding clusterin in the incubation described in example 1. Alternatively, to Aß 1- Initial 42 can be dissolved in Ol N HCl, instead of DMSO, and this initial Aβ 1-42 may even have fibrillar structures in its result. However, incubation with clusterin for 24 hours at room temperature of 37 ° C results in preparations that are predominantly free of fibrils, consistent with their slow sedimentation. This is confirmed by experiments that show that fibril formation decreases as the amount of aggregated clusterin increases. The preparations resulting from the clusterin treatment comprise only small globular structures of approximately 5-6 nm in size determined by AFM analysis of the fractionated ADDLs on a Superdex 75 gel column. Equivalent results are obtained by conventional electron microscopy. In contrast, Aβ 1-42 which has been self-associated under standard conditions (Snyder et al., Biophys. J., 67, 1216-28, 1994), in the absence of clusterin show mainly non-diffusible and large fibrillar species. In addition, the resultant preparations of ADDL are passed through a 10 kD Centricon shear membrane and analyzed on a gradient SDS-polyacrylamide gel. As can be seen in Figure 4, only the monomer passes through the Centricon 10 filter, while the ADDL is retained by the filter. The monomer found after separation can only be formed from larger molecular weight species retained by the filter. These results confirm that toxic preparations of ADDL comprise small fibrillar oligomers of Aβ 1-42 and that ADDL can be obtained by appropriate treatment of β amyloid clusterin.

Example 5; Physiological formation of ADDL The toxic portions in Example 4 may comprise rare structures containing oligomeric Aβ and clusterin. While Oda et al. (Exper. Neurol., 136, 22-31, 1995) reported that clusterin is found to increase the toxicity of Aβ 1-42 solutions, other researchers have found that clusterin at stoichiometric concentrations protects against the toxicity of Aβ 1 -40 (Boggs et al., J. Neurochem., 61, 1324-1327, 1997). Accordingly, the formation of ADDL in the absence of clusterin is further characterized in this example. When monomeric solutions of β 1-42 are maintained at low temperature in an appropriate medium, the formation of settleable Aß fibrils. It is almost completely blocked. However, Aß self-associates in these low temperature solutions, forming ADDL essentially indistinguishable from those that are escorted by clusterin. Finally, ADDL are also formed when Aß monomeric solutions are incubated at 37 ° in brain culture culture medium but at a very low concentration (50 nM), indicating a potential for physiological formation. All ADDL preparations are relatively stable and do not show conversion to fibrils during the 24-hour tissue culture experiments.

These results confirm that ADDL are formed and are stable under physiological conditions and suggest that they can similarly form and be stable in vivo.

Example 6: ADDL are diffusible and extremely potent neurotoxins of the CNS When ADDL are induced by clusterin, low temperature or low Aβ concentration, the stable oligomers that are formed are potent neurotoxins. The toxicity is examined in organotypic mouse brain cut cultures, which provide a physiologically important model for the mature CNS. The brain tissue is supported at an atmosphere-medium interface by a filter in order to maintain high -viability in the controls. For these experiments, brain slices are obtained from strains B6 129 F2 and JR 2385 (Jackson Laboratories) and are cultured as previously described (Stoppini et al., J. "Neurosci, Meth., 37, 173- 182, 1991), with modifications, specifically, an adult mouse is sacrificed by inhalation of carbon dioxide, followed by rapid decapitation.The head is immersed in cold sterile dissecting buffer (94 ml of Gey's balanced salt solution, pH 7.2, supplemented with 2 ml of 0.5M MgCl2, 2 ml of glucose 25% and 2 ml of Hepes 1.0 M), after which the brain is removed and placed on a plate covered with sterile Sylgar. a cut in the line measured to separate the cerebral hemispheres, each hemisphere is cut separately, the hemisphere is placed with the midline cut down, and a 30 ° cut is made from the dorsal side to orient the hemisphere. Stick with the cut side or down on the plastic plate of a Campden fabric cutter (previously moistened with ethanol) and immersed in cold sterile cushion with ice. Cuts of 200 μm thickness are made from a lateral to a medium direction, collecting those in which the hippocampus is visible. Each cut is transferred with the upper end of a sterile pipette to a small petri dish containing Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum, S / P / F 2% (streptomycin, penicillin and fungizone; Life Technologies (Gibco, BRL), Gaithersburg, MD), observed with a microscope to verify the presence of the hippocampus, and placed on a Millicell-CM insert.

(Millipore) in a deep well tissue culture vessel (Falcon, vessel with 6 wells). Each well contains 1. 0 ml of growth medium and usually two cuts are placed in each insert. The cuts are placed in an incubator (C02 6%, humidity 100%), during the night. The growth medium is removed and the wells are washed with 1.0 ml of warm Hanks BSS (Gibco, BRL, Life Technologies). To each defined medium well (DMEM, supplements N2, SPF, for example, as described in Bottenstein et al., Proc. Nati, Acad. Sci., 76, 514-517, 1979) containing the amyloid oligomers is added. ß, with or without inhibitor compounds, and incubation is continued for 24 hours. Cell death is measured using the LIVE / DEAD1111 assay kit (Molecular Probes, Eugene, OR). This is a double label fluorescence assay in which living cells are detected by the presence of an esterase separating calcein-AM from calcein, resulting in green fluorescence. Dead cells capture ethidium homodide, which is interspersed with DNA and has a red fluorescence. The assay is carried out according to the manufacturer's instructions with 2 μM ethidium homodimer and 4 μM calcein. Images are obtained in the next 30 minutes using a Nikon Diaphot microscope equipped with epifluorescence. The MetaMorph image analysis system (Universal Imaging Corporation, Philadelphia, PA) is used to quantify the amount and / or area of cells that show green or red fluorescence. For these experiments, ADDL are present for 24 hours at a maximum dose of 5 μM of total Aβ (ie, the total Aβ is never more than 5 μM in any ADDL experiment). Cell death, as shown by "false yellow staining" is almost completely confined to the pyramidal stratum (CA 3-4) and the dentate gyrus (DG), strongly suggesting that the main neurons of the hippocampus (pyramidal and granular cells, respectively) are the targets of ADDL-induced toxicity. In addition, the viability of the glia is not affected by a 24-hour treatment with primary rat brain gland ADDL, determined by trypan blue exclusion and MTT assay (Finch et al., Unpublished). The dentate gyrus (DG) and CA3 regions are particularly sensitive and show an ADDL-induced cell death in each culture obtained from animals of age p20 (newly weaned animals) at P84 (young adult). Up to 40% of the cells in this region die after chronic exposure to ADDL. The pattern of neuronal death is not identical to that observed for NMDA, which kills neurons in DG and CAI, but scarcely in CA3. Some cultures for the DG and CA3 hippocampus regions of animals older than 20 days old are treated with conventional preparations of fibrillar Aβ. Consistent with the non-diffusible nature of the fibrils, cell death (yellow staining) is not evident even at 20 μM. The staining pattern for living cells in this culture verifies that the CA3 / dentate gyrus of the hippocampus is examined. The extent of cell death observed after conventional treatment with Aβ (ie preparations of fibrillar Aβ) are not differentiable from negative controls in which the cultures are administered medium, or medium with clusterin supplement. In typical controls, cell death is less than 5%. In fact, high viability can be found in controls even in cultures that remain several days beyond typical experiments, confirming that cell survival is not compromised by standard culture conditions. A dose-response experiment is carried out to determine the potency of ADDL in inducing cell death. Image analysis is used to quantify staining of dead cells and living cells in fields containing the DG / CA3 areas. Figure 5 illustrates the% of dead cells versus concentration of ADDL measured as the initial concentration of amyloid β 1-42. Due to the difficulties of quantifying brain slices, the results are not detailed enough to determine the EC50 accurately. However, as can be seen in Figure 5, even after a 1000-fold dilution (~ 5 nM Aβ), cell death induced by ADDL is more than 20%. Toxicity is observed even with 0.3 nM ADDL. This contrasts with results obtained with conventionally aged Aß, which is toxic to neurons in cultures from about 20 to about 50 μM. These data show that ADDL are effective at doses 1000-10,000 times smaller than those used in fibrillary Aβ experiments. These data from hippocampal cuts therefore confirm the ultratoxic nature of ADDL. In addition, because the ADDL must pass through the culture-support filter to cause cell death, the results validate that the ADDLs are diffusible, consistent with their small oligomeric size. In addition, the methods set forth herein can be used as a test for ADDL-mediated changes in cell viability. In particular, the assay can be carried out by coincubation or co-administration together with the ADDL agents which can potentially increase or decrease the formation and / or activity of the ADDL. The results obtained with such co-incubation or co-administration can be compared with the results obtained with the inclusion of only the ADDL.

Example 7; Oxidative stress toxicity test MTT - PC12 cells This example establishes an assay that can be used to detect a change in early toxicity in response to β amyloid oligomers.

For these experiments, PC12 cells are passaged at 4 x 104 cells / well in a 96-well culture plate and grown for 24 hours in DMEM + 10% fetal bovine serum + S / P / F 1% (streptomycin , penicillin and fungizone). Plates are treated with 200 μg / ml poly-1-lysine for 2 hours before plating the cells to improve cell adhesion. A set of six wells is left untreated and fed with fresh medium, while another set of wells is treated with vehicle control (PBS containing 10% HCl 0.01 N, aged o / n at room temperature). Positive controls are treated with Triton (1%) and Na Azide (0.1%) in normal growth medium. Β-amyloid oligomers are prepared as described in Example 1, or are obtained by coincubation with clusterin, with or without inhibitor compounds present, which are added to the cells for 24 hours. After 24 hours of incubation, MTT (0.5 mg / ml) is added to the cells for 2.5 hours (11 μl of a 5 mg / ml concentrate solubilized in PBS in 100 μl of medium). Healthy cells reduce MTT to a blue formazan product. After incubation with MTT, the medium is aspirated and 100 μl of 100% DMSO is added to lyse the cells and dissolve the blue crystals. The plate is incubated for 15 min at room temperature and read on a plate reader (ELISA) at 550 nm.

The results of such an experiment are shown in Figure 6. As can be seen from this figure, the control cells not exposed to the ADDL ("Cont"), the cells exposed to clusterin alone ("ApoJ"), and the Cells exposed to monomeric Aβ ("Aβ") do not show cellular toxicity. In contrast, cells exposed to β-amyloid coaggregated with clusterin and aged one day ("Aβ: Apo J") show a reduction in MTT reduction, which evidences an early change in toxicity. The last amyloid preparations are confirmed by AFM as lacking amyloid fibrils. The results of this experiment therefore confirm that the preparations of ADDL obtained from coaggregation of Aβ mediated by clusterin have increased toxicity. In addition, the results confirm that the oxidative stress response of PC12 can be used as an assay to detect early cellular changes due to ADDL. The assay can be carried out by coincubation or co-administration together with the ADDL agents that can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone.

Example 8; Oxidative stress toxicity test MTT HN2 cells This example establishes an additional assay of changes in cells mediated by ADDL. Specifically, the oxidative stress toxicity test by MTT presented in the preceding example is carried out in HN2 cells, instead of PC12 cells. Other appropriate cells can be used in a similar manner. For this assay, HN2 cells are passed to 4 x 104 cells / well in a 96-well culture plate and grown for 24 hours in DMEM + 10% fetal bovine serum + S / P / F 1% (streptomycin, penicillin and fungizone). Plates are treated with 200 μg / ml poly-lysine for 2 hours before plating the cells to improve cell adhesion. Cells are differentiated for 24-48 hours with 5 μM retinoic acid and growth is further inhibited with 1% serum. A set of wells is left untreated and fresh media is supplied. Another set of wells is treated with vehicle control (DMSO 0.2%). Positive controls are treated with Triton (1%) and sodium azide (0.11%). The β-amyloid oligomers prepared as described in Example 1 are added to the cells for 24 hours., with or without inhibitor compounds present. After 24 hours of incubation, MTT (0.5 mg / ml) is added to the cells for 2.5 hours (11 μl of a 5 mg / ml concentrate in 100 μl of medium). After incubation with MTT, the medium is aspirated and 100 μl of 100% DMSO is added to lyse the cells and dissolve the blue crystals. The plate is incubated for 15 minutes at room temperature and read on a plate reader (ELISA) at 550 nm. This assay can be carried out similarly by proincubation or co-administration together with the ADDL agents which can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone.

Example 9; Cell morphology by phase microscopy This example establishes yet another additional test of ADDL-mediated cell changes of cell morphology by phase microscopy. For this assay, cultures at low density (50-60% confluence) are grown to start the experiment. The cells are deprived of serum in F12 medium for 1 hour. The cells are then incubated for 3 hours with β-amyloid oligomers prepared as described in Example 1, with and without inhibitory compounds added to the cells, for 24 hours. After 3 hours, the cells are examined for morphological differences or fixed for immunofluorescence labeling. The samples are examined using a MetaMorph image analysis system and an MRI video camera (Universal Imagin, Inc.). The results of such tests are presented in the examples that follow. In particular, the assay can be carried out by coincubation or co-administration together with the ADDL agents that can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone.

Example 10; FACS scanning assay for binding ADDL to cell surfaces Because cell surface receptors have recently been identified in glia cells for conventionally prepared Aß (Yan et al., Wature, 382, 658-691, 1996; El Khoury et al., Na ture, 382, 716-719, 1996), and because neuronal death at low doses of ADDL suggests a possible relationship of signaling mechanisms, and carried out experiments to determine if there are specific binding sites on the cell surface on neurons for ADDL.

For flow cytometry, cells are dissociated with 0.1% trypsin and plated at least overnight on a tissue culture plastic at low density. Cells are removed with cold phosphate buffered saline (PBS) / 0.5 nM EDTA, washed three times and resuspended in ice-cold PBS to a final concentration of 500,000 cells / ml. The cells are incubated in cold PBS with ß-amyloid oligomers prepared as described in example 1, except that 10% of the β-amyloid is an amyl analogue of β 1-42 containing biocytin in the 1-position substituting the aspartate. Oligomers with and without inhibitor compounds present are added to the cells for 24 hours. The cells are washed twice in cold PBS to remove free, unbound, β-amyloid oligomers, resuspended in a 1: 1000 dilution of fluorescein-conjugated avidin, and incubated for one hour at 4 ° C with gentle shaking. Alternatively, antibodies specific for β-amyloid and fluorescent secondary antibodies are used instead of avidin, which eliminates the need to incorporate 10% biotinylated β-amyloid analogue. Specifically, biotinylated monoclonal antibody 6E10 (1 μl Senetec, Inc., St. Louis, Missouri) is added to the cell suspension and incubated for 30 minutes. The bound antibody is detected after pelleting the cells and resuspending in 500 μl of PBS, using streptavidin conjugated with FITC (1: 500 Jackson Laboratories) for 30 minutes. The cells were analyzed by a Becton-Dickinson fluorescence activated cell scanner (FACScan). Typically, 10,000 or 20,000 events were collected for both forward (size) dispersion and fluorescence intensity, and the data was analyzed by the Consort 30 software element (Becton-Dickinson). The binding is quantified by multiplying the mean fluorescence by the total number of events, and subtracting the value for the fluorescence of background cells in the presence of 6E10 and FITC. For these experiments, the analysis by exploration FACS is performed to compare the immunoreactivity of ADDL in suspensions in yeast cells in logarithmic phase (a surface mainly of carbohydrates) and the neuronal cell line of SNC B103 (Schubert et al., Na ture. , 249, 224-227, 1974). For B103 cells, the addition of the ADDL causes a major increase in the fluorescence associated with the cells, as shown in Figure 7. Trypsin treatment of B103 cells for 1 minute eliminates the binding of ADDL. In contrast, control yeast cells (data not shown) demonstrates that there is no ADDL binding, verifying the selectivity of ADDL by proteins present on the cell surface. Suspensions of hippocampal cells (trypsinized tissue followed by a 2-hour metabolic recovery) also bind ADDL, but with a reduced number of binding events compared to B103 cells, as is evident from the reduced fluorescence intensity of the peak labeled. This appears in Figure 8 as a shift to the left of the labeled peak. Therefore, these results suggest that ADDL exert their effects by binding to a specific cell surface receptor. In particular, the trypsin sensitivity of B103 cells shows that their ADDL binding sites are cell surface proteins and that the binding is selective for a subset of particular domains within these proteins. In addition, the present assay can also be used as an assay for ADDL-mediated cell binding. In particular, the assay can be carried out by coincubation or co-administration together with the ADDL agents that can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone.

Example 11; Inhibition of ADDL formation by gossypol This example establishes the manner in which the formation of ADDL can be inhibited using, for example, gossypol. For these experiments, the ADDLs were prepared as described in Example 1. Gossypol (Aldrich) is added at a concentration of 100 μM during the incubation of the Aβ protein to form the ADDL. The neurotoxicity of the resulting preparation is determined using the LIVE / DEAD assay kit ** as previously described. The amount of cell death that occurs after 24 hours of exposure to the gossypol / ADDL preparation is less than 5%. This is comparable to the level of toxicity that is obtained for a corresponding control preparation of DMSO (ie 6%), or a gossypol control preparation that does not contain any ADDL (ie, 4%). Therefore, these results confirm that Compounds such as gossypol can be used to inhibit the formation of ADDL.

Example 12; Inhibition of ADDL binding by tryptic peptides Because it was found that trypsinization of B103 cells blocks the subsequent binding of ADDL, experiments were performed as set forth in this example to test whether triptych fragments released from the cell surface retard the binding activity of ADDL. Tryptic peptides are prepared using confluent B103 cells from 4 100-mm vessels that are removed by trypsinization (0.025%, Life Technologies) for approximately 3 minutes. The trypsin-chymotrypsin inhibitor (Sigma, 0.5 mg / ml in Hank's buffered saline) is added and the cells are removed by centrifugation at 500 x g for 5 minutes. The supernatant is concentrated (-12 ml) to about 1.0 ml using a Centricon 3 filter (Amicon) and frozen after the protein concentration is determined. For block experiments, sterile concentrated tryptic peptides (0.25 mg / ml) are added to the organotypic brain cut or to B103 cells suspended in the FAC assay at the same time that the ADDLs are added. In FACS screening assays, tryptic peptides released in the culture medium (0.25 mg / ml) inhibit the binding of ADDL > 90% as shown in Figure 9. For comparison, control cells exposed to BSA, even at 100 mg / ml, have no binding loss. The tryptic peptides, if added after the ADDLs were already bound to the cells, do not significantly decrease the fluorescence intensities. This indicates that the peptides do not compromise the ability of the assay to quantify bound ADDL. In addition to blocking ADDL binding, tryptic peptides are also antagonists of cell death induced by ADDL. Specifically, as shown in Figure 9, the addition of tryptic peptides results in a 75% reduction in cell death, p <; 0.002. These data confirm that particular cell surface proteins mediate the binding of ADDL, and that tryptic peptides solubilized from the cell surface provide neuroprotective activity, which neutralizes ADDL. In addition, the present assay can also be used for agents that mediate cell binding of ADDL or that affect cell activity with respect to ADDL. In particular, the assay can be carried out by coincubation or co-administration together with the ADDL agents that can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone. In addition, the addition of the agents before or after the binding of the ADDL to the cell surface can be compared to identify agents that alter or affect such binding, or that act after the binding has occurred.

Example 13; ADDL cell binding dose-response curve This example establishes the dose-response experiments performed to determine if the binding of ADDL to the cell surface is saturable. Such saturability would be expected if the ADDL in fact interacted with a particular cell surface receptor. For these studies, B103 cells are incubated with increasing amounts of the ADDL, and the ADDL binding is quantified by FACS screening analysis. The results are presented in Figure 10. These results confirm that a different rocket is obtained for the binding of ADDL. The binding saturability of ADDL occurs at a relative concentration Aβ 1-42 (ie, concentration of ADDL relative to Aβ) of about 250 nm. These results therefore confirm that the binding of ADDL is saturable. Such saturation or saturability capacity of ADDL binding, especially when considered with the results of trypsin studies, validates that ADDLs act through a particular receptor on the surface of the cell.

Example 14; Cell-based ELISA for ADDL binding activity This example establishes a cell-based assay, particularly a cell-based enzyme-linked immunosorbent assay (ELISA) that can be used to determine the binding activity of ADDL. For these studies, 48 hours prior to conducting the experiment, 2.5 × 10 4 B103 cells present as a suspension in 100 μl of DMEM are placed in each test well of a 96-well microtiter plate and kept in an incubator 37 ° C. 24 hours before carrying out the experiment, the ADDLs are prepared according to the method described in example 1. To start the assay, each well of the microtiter plate containing cells is treated with 50 μl of fixative ( 3.7% formalin in DMEM) for 10 minutes at room temperature. This fixative / DMEM solution is removed and a second treatment is carried out with 50 μl of formalin (without DMEM) for 15 minutes at room temperature. The fixative is removed and each well is washed twice with 100 μl of phosphate buffered saline (PBS). 200 μl of blocking agent (1% BSA in PBS) is added to each well and incubated at room temperature for 1 hour. After two washes with 100 μl of PBS, 50 μl of the ADDL (previously diluted 1:10 in PBS) or PBS alone as a control are added to the appropriate wells, and the resulting wells are incubated at 37 ° C for 1 hour . Three washes are carried out with 100 μl of PBS and 50 μl of biotinylated 6E10 antibodies (Senetek) diluted 1: 1000 in 1% BSA / PBS are added to the appropriate wells. In the other wells, PBS is added as a control. After incubation for 1 hour at room temperature on a rotator, the wells are washed three times with 50 μl of PBS, and 50 μl of ABC reagent (Elite ABC kit, Vector Labs) is added and incubated for 30 minutes at room temperature on the rotator. After washing four times with 50 μl of PBS, 50 μl of ABTS substrate solution is added to each well and the plate is incubated in the dark at room temperature. The plate is analyzed to determine the absorption each time greater than 405 nm. Only when ADDL, cells and 6E10 are present, is there a significant signal, as illustrated in Figure 11. This result further confirms that the cell-based ELISA assay can be used as an ADDL-mediated cell-binding assay. In particular, the assay can be carried out by coincubation or co-administration together with the ADDL agents that can potentially increase or decrease the formation and / or activity of ADDL. The results obtained with such coincubation or co-administration can be compared with the results obtained with the inclusion of the ADDL alone.

Example 15; The elimination of the gene fvn kinase protects against neurotoxicity by ADDL To further investigate the potential relationship of signal transduction in ADDL toxicity, the experiments in this example compared the impact of ADDL on the brain slices of isogenic animals end - / - and end + / +. Fyn belongs to the Src family of protein tyrosine kinases, which are central to multiple cellular signals and responses (Clarke et al., Science, 268, 233-238). Fyn is of particular interest because it is upregulated in neurons afflicted with AD (Shirazi et al., Neuroreport, 4, 435-437, 1993). It also appears to be activated by conventional preparations of Aβ (Zhang et al., Neurosci, Letts., 211, 187-190, 1996) which subsequently have been shown to contain ADDL by AFM. In addition, mice lacking the Fyn gene have reduced apoptosis in the developing hippocampus (Grant et al., Science, 258, 1903-1910, 1992). For these studies, mice lacking the Fyn gene (Grant et al., Science, 258, 1903-1910, 1992) were treated in the preceding examples, by comparing images of brain slices from treated or untreated mice with the ADDL for 24 hours. hours to determine the dead cells in the DG and CA3 area. A quantitative comparison (presented in Figure 12) is obtained with error bars representing the means +/- SEM (standard error mean) for 4-7 slices. In contrast to wild-type animal cultures, fyn - / - animal cultures show negligible ADDL-induced cell death, as shown in Figure 12. For ADDLs, the cell death level in fyn + / cuts + is more than five times that in fyn - / - crops. In fyn - / - cultures, cell death in the presence of ADDL is at the background level. The neuroprotective response is selective; Hippocampal cell death induced by NMDA receptor agonists (Bruce et al., Exper. Neurol., 132, 209-219, 1995; Vornov et al., Neurochem., 56, 996-1006, 1991) is unaffected ( not shown). The analysis (ANOVA) using Tukey's multiple comparison provides a value of P < 0.001 for ADDL data fyn + / + compared to all other conditions. These results confirm that the loss of fyn kinase protects the DG and CA3 hippocampus regions from cell death induced by ADDL. The results validate that the toxicity of ADDL is mediated by a mechanism blocked by elimination of the Fyn protein tyrosine kinase gene. These results also suggest that neuroprotective benefits can be obtained by treatments that abrogate the activity of the Fyn protein tyrosine kinase or the expression of the gene encoding the Fyn protein kinase.

Example 16; Astrocyte activation experiments To further investigate the potential relationship of signal transduction in ADDL toxicity, the experiments in this example compare the impact of ADDL on astrocyte activation. For these experiments, cultures of cortical astrocytes were prepared from neonatal Sprague-Dawley baby rats (1-2 days of age) by the method of Levison and McCarthy (Levison et al., In: Banker et al. (Eds), Cul turing Nerve Cells, MIT Press, Cambridge, MA., 309-36, 1991), as previously described (Hu et al., J., Biol. Chem., 271, 2543-2547, 1996). dissect the cerebral cortex, tripzinize and cells are cultured in a-MEM (Gibco, BRL) containing 10% fetal bovine serum / Hyclone Laboratories Inc., Logan UT) and antibiotics (100 U / ml penicillin, 100 mg / ml of streptomycin) After 11 days of culture, the cells are trypsinized and replated in plates, in 100 mm plates at a density of -6 x 10 5 cells / plate and grown to confluence (Hu et al. ., J. "Biol. Chem., 271, 2543-2547, 1996). Astrocytes are treated with the ADDL prepared according to Example 1, or with Aβ 17-42 (synthesized as indicated by Lambert et al., J. "Neurosci. Res., 39, 377-384, 1994; also available commercially.) The treatment is performed by trypsinizing confluent cultures of astrocytes and plating on tissue culture boxes of 60 mm at a density of 1 x 106 cells / vessel (for example, for RNA and ELISA analysis), in plates of 4-well chamber at 5 x 10 4 cells / well (for example, for immunohistochemistry) or in 96-well plates at a density of 5 x 10 4 cells / well (for example, for NO tests) After 24 hours of incubation, the cells are washed twice with PBS to remove serum, and the cultures are incubated in a-MEM containing N2 supplements for an additional 24 hours before the addition of the Aβ peptides or the control buffer (ie buffer containing diluent) The examination of the morphology of astrocytes is real It hoists when examining the cells under the inverted Nikon TMS microscope equipped with a Javelin SmartCam camera, a Sony video monitor and a color video printer. Typically, four arbitrarily selected microscopic fields (20X magnification) are photographed for each experimental condition. Morphological activation is quantified from photographs with NIH Image by counting the number of activated cells (defined as a cell with one or more processes in at least one cell body in length) in the four fields. The levels of mRNA in the cultures were determined with the use of Northern blots and slot blots. This is done by exposing the cells to the ADDL or control buffer for 24 hours. After this time, the cells are washed twice with PBS treated with diethyl pyrocarbonate (DEPC), and the total RNA is isolated by RNeasy purification minicolumns (Qiagen, Inc., Chatsworth, CA), as recommended by the manufacturer. Typical yields of RNA are from 8 to 30 mg of total RNA per container. For Northern blot analysis, 5 mg of total RNA per sample is separated on agarose-formaldehyde gel, transferred by capillary action to a Hybon-N membrane (Amersham, Arlington Heights IL), and UV cross-linked. For the slot transfer analysis (slot blot), 200 ng of total RNA per sample is transferred onto a Duralon-UV membrane (Stratagene, La Jolla CA), under vacuum and reticulated with UV. Confirmation of equivalent RNA charges is performed with ethidium bromide staining or by hybridization and normalization with a GAPDH probe. The probes are generated by restriction enzyme digests of plasmids, and subsequent gel purification of the appropriate fragment. Specifically, cDNA fragments are prepared by RT-PCR using total RNA from rat cortical astrocytes. The RNA is subjected to reverse transcription with the Superscript II system (GIBCO / BRL), and PCR is performed on a PTC-100 thermal controller (MJ Research Inc., Watertown, MA) using 35 cycles with the following settings: 52 ° C for 40 seconds; 72 ° C for 40 seconds; 96 ° C for 40 seconds. The pairs of primers used to amplify a 447 bp fragment of rat IL-1β were: Direct: 5 'GCACCTTCTTTCCCTTCATC 3' [SEC. FROM IDENT. NO: l]. Inverse: 5 'TGCTGATGTACCAGTTGGGG 3' [SEC. FROM IDENT. NO: 2]. The primer pairs used to amplify a 435 bp fragment of rat GFAP were: Direct: 5 'CAGTCCTTGACCTGCGACC 3' [SEC. OF IDNET. NO: 3]. Reverse: 5 'GCCTCACATCACATCCTTG 3' [SEC. FROM IDENT. NO: 4]. The PCR products were cloned into the PCR2.1 vector with the Invitrogen TA cloning kit, and the constructs (constructs or recombinant plasmids) were verified by DNA sequencing. The probes were prepared by digestion with EcoRI of the vector, followed by gel purification of the appropriate fragments. The plasmids were the rat iNOS pAstNOS-4 cDNA plasmid, which corresponds to the bases 3007-3943 of rat iNOS cDNA (Galea et al., J., Neurosci, Res., 37, 406-414, 1994). , and the rat GAPDH cDNA plasmid, pTRI-GAPDH (Ambion, Inc., Austin TX). Probes (25 ng) were labeled with 32P-dCTP by using the Prime-to-Gene tagging kit.

Random-Prime (Promega, Madison Wl) and separate from unincorporated nucleotides by using push columns (Stratagene). Hybridization was performed under restriction conditions with QuikHyb solution (Stratagene) using the recommended protocol for restriction hybridization.

Briefly, prehybridization was carried out at 68 ° C for about 30 to 60 minutes, and hybridization was carried out at 68 ° C for about 60 minutes. The spots are then washed under restriction conditions and exposed to autoradiography or phosphoimage formation plates. The autoradiograms are scanned with a BioRad GS-670 laser scanner, and the band density is quantified with the Molecular Analys v2.1 image analysis software (BioRad, Hercules CA). The phosphoimages are captured in a Storm 840 system (Molecular Dynamics, Sunnyvale CA), and the band density is quantified with the image analysis software (Image Quant vi .1 (Molecular Dynamics). For the measurement of NO by the nitrite assay, the cells are incubated with Aβ peptides or control buffer for 48 hours and then the nitrite concentrations in the conditioned medium are measured by the Griess reaction as previously described (Hu et al. J, "Biol. Chem., 271, 2543-2547, 1996.) When the NOS inhibitor N-nitro-L-arginine methyl ester (L-name) or the inactive D-name isomer is used, these agents are added to the cultures at the same time as Aß. The results of these experiments are presented in figure 13. As can be seen in this figure, the activation of glia increases when the astrocytes are incubated with the ADDL, but not when the astrocytes are incubated "with Aβ 17-42. These results confirm that ADDL activates glial cells. It is possible that glia proteins may contribute to neuronal deficiencies, for example as they occur in Alzheimer's disease, and that certain effect of ADDL can actually be mediated indirectly by activation of glial cells. In particular, glial proteins can facilitate the formation of ADDL, or ADDL-mediated effects downstream of the receptor binding can occur. In addition, it is known that clusterin is upregulated in the brain of a subject with Alzheimer's disease, and clusterin is found at high levels only in cells of the glia that are activated. Based on this, the activation of glial cells by a stimulus that is not ADDL and not amyloid, can produce clusterin which in turn can lead to ADDL, which, in turn, can damage the neurons and cause additional activation of the cells of the glia. Regardless of the mechanism, these results also suggest that neuroprotective benefits can be obtained by treatments that modulate (that is, increase or decrease) the activation of ADL-mediated glia cells. In addition, these results suggest that blocking these effects on glia cells, in addition to blocking neuronal effects, may be beneficial. ___ Example 17; LTP trial - ADDL interrupts LTP Long-term potentiation (LTP) is a classic paradigm for synaptic plasticity and a model for memory and learning, faculties that are selectively lost in the early stages of AD. This example establishes the experiments carried out to examine the effects of ADDL in LTP, particularly cellular LTP of medium perforating trajectory.

Intact animal injections: Mice were anesthetized with urethane and placed in a stereotaxic apparatus.

The body temperature was maintained using a coating pad with heated water. The surface of the brain was exposed through holes in the skull. The positions Bregma and lambda for injection in the middle molecular layer of the hippocampus are 2 mm posterior to Bregma, 1 mm lateral to the midline and 1.2-1.5 mm ventral to the surface of the brain. The ß amyloid oligomer injections were with a nitrogen cushion through glass pipettes of diameter -10 nm. Volumes of 20-50 or n-amyloid oligomer solution (180 nm of β amyloid in phosphate-buffered saline, PBS) were delivered over the course of one hour. The control mice received an equivalent volume of PBS alone. The animal was allowed to rest for varying periods of time before the LTP stimulus (typically 60 minutes) was delivered.

LTP in injected animals: The experiments follow the paradigm established by Routtenberg and collaborators for LTP - in mice (Namgung et al., Brain Research, 689, 85-92, 1995). Stimulation of the perforating trajectory was used for the entorhinal cortex, with registration from the molecular layer of the midline and the body of cells of the dentate gyrus. We observed a population of excitatory postsynaptic potential (by-EPSP) and a population spike potential (pop-spike) before electrical stimulation. LTP can be induced in these responses by a stimulus of 3 pulse trainings of 8 x 0.4 ms of 400 Hz / training (Namgung et al., Brain Research., 689, 85-92, 1995). The records are taken for 2-3 hours after the stimulus (ie, applied at time 0) to determine if LTP is retained. Then the animal is immediately slaughtered, or allowed. that recovers either for 1, 3 or 7 days, and then sacrifices as in the previous. The brain is cryoprotected with 30% sucrose and then sectioned (30 μM) with a microtome. Some sections or sections are placed on gelatin-embedded plates and others are analyzed using a free-floating protocol. Immunohistochemistry is used to monitor changes in GAP-43, in the PKC subtypes, and in phosphorylation of tau protein (PHF-1), paxilin and focal adhesion kinase. The machine waveforms were analyzed as previously described (Colley et al., J. Neurosci., 10, 3353-3360, 1990). A 2-tailed ANOVA compares changes in spike amplitude between treated and untreated groups. Figure 14 illustrates the spindle amplitude effect of ADDL in whole animals. As can be clearly seen in this figure, ADDL blocks the persistence phase of LTP induced by the high frequency electrical stimuli applied to the entorhinal cortex and measured as a cell body spike amplitude in the middle molecular layer of the dentate gyrus. After the LTP experiments are performed, the animals are allowed to recover for different times and then sacrificed using sodium pentobarbital anesthetic and perfusion with 4% paraformaldehyde. For feasibility studies, times of 3 hours, 24 hours, 3 days and 7 days were used. The brain is cryoprotected with 30% sucrose and then cut (30 μM) with a microtome. The slices are placed on plates embedded with gelatin and initially stained with cresyl violet. The loss of cells is measured by counting the cell bodies in the dentate gyrus, CA3, CAI, and the entorhinal cortex, and correlates with the dose and time of exposure of the ADDL. The results of these experiments confirm that cell death does not occur up to 24 hours after the experiments with LTP. Similarly, the LTP response is examined in hippocampal sections of young adult rats. As can be seen in Figure 15, incubation of rat hippocampal cuts with ADDL avoids LTP long before any sign of reversion of cell degeneration. The hippocampal cuts (n = 6) exposed to the 500 nM ADDL for 45 minutes before show no potentiation in the population spikes 30 minutes after the tetanic stimulation (mean amplitude 99% +/- 7.6), despite a continuous capacity for action potentials. In contrast, LTP is easily reduced in sections incubated with vehicle (n = 6), with an amplitude of 138% +/- 8.1 during the last 10 minutes; this value is comparable with that previously demonstrated in the group of this age (Trommer et al., Exper. Neurol., 131, 83-92, 1995). Although LTP is absent in sections treated with ADDL, its cells are competent to generate action potentials and show no signs of degeneration. These results validate that in complete animals as well as in tissue sections, the addition of ADDL results in a significant interruption of LTP in less than one hour, before any degeneration or destruction of cells. Thus, these experiments support that ADDL exert very early effects, and interference with the formation and / or activity of ADDL in this way can be used to obtain a therapeutic effect prior to the advancement of the disease, disorder or condition (e.g. Alzheimer's) to a stage where cell death results. In other words, these results confirm that a decrease in memory occurs before the neuron dies. Interference before such cell death can therefore be used to reverse the progress and potentially restore the decreases in memory Example 18; Early effects of ADDL in vivo This example establishes the early effects of the ADDL in vivo and the way that knowledge of such early effects can be manipulated. The primary symptoms of Alzheimer's disease involve deficiencies in learning and memory. However, it has been difficult to establish the relationship between behavioral deficiencies and aggregate amyloid deposits. In transgenic mice, overexpressing mutant APP under the control of the platelet-derived growth factor promoter results in the deposition of large amounts of amyloid (Games et al., Nature, 373, 523-527, 1995). In contrast, no behavioral deficiencies have been reported using this system. Other researchers (ie, Nalbantoglu et al., Na ture, 387, 500-509, 1997 and Holcomb et al., Na t. Med., 4, 97-100, 1998) work with a report of transgenic mice and observe that significant behavioral and cognitive deficits occur long before any significant deposition of aggregated amyloid is observed. These behavioral and cognitive defects include a failure to potentiate in the long term (? Albantoglu et al., Supra). These models collectively suggest that the non-deposited forms of amyloid are responsible for the cognitive and early behavioral deficiencies that occur as a result of an induced neuronal malfunction. It is consistent with these models that the novel ADDLs described herein present in this non-deposited form of amyloid that causes early cognitive and behavioral defects. In view of these, the compounds that modulate ADDL according to the invention can be used in the treatment and / or prevention of these early cognitive and behavioral deficiencies, resulting from a neuronal malfunction induced by ADDL, or the ADDL themselves they can be applied, for example, in animal models to study such induced neuronal malfunction.

Similarly, in older humans, cognitive declines and focal memory deficiencies may occur long before a diagnosis of probable stage I Alzheimer's disease is made (Linn et al., Arch. Neurol., 52, 485-490, 1995 ). These focal memory deficiencies may result from aberrant signaling induced in neurons, rather than cell death. Other functions, such as higher order writing skills (Snowdon et al., JAMA, 275, 528-532, 1996) can also be affected by aberrant neuronal function that occurs long before cell death. This is consistent with what is known about these defects, and the information regarding ADDL provided herein, that ADDL induce these defects in a manner similar to the compromised LTP function such as that induced by ADDL. In addition to these lines, the ADDL modulator compounds according to the invention can be used in the treatment and / or prevention of this early cognitive decline and focal memory impairment, and a damage of higher order writing skills, which it results from the formation or activity of ADDL or the ADDL can be applied by themselves, for example, in animal models, to study such defects. In particular, such studies can be carried out as is known to those familiar with the art, for example when comparing subjects parity in age, treated or treated with placebo.

All of the references mentioned herein, including patents, patent applications, publications and the like are incorporated herein by reference in their entirety. Although the invention has been described with emphasis with respect to the preferred embodiments, it will be obvious to those of ordinary skill in the art that variations of the preferred embodiments may be used and that it is understood that the invention may be practiced in a manner different from that of the invention. the one specifically described here. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention, as defined in the following claims.

SEQUENCE LIST (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: Acumen Pharmaceuticals, Inc. et al. (ii) TITLE OF THE INVENTION: Amyloid beta protein, globular assembly and uses thereof (iii) SEQUENCE NUMBER: 4 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESS: McDonell Boehnen Hulbert Berghoff (B) STREET: 300 South Wacker Drive (C) CITY: Chicago (D) STATE: IL (E) CITY: USA (F) ZIP: 60606 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible Disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (US) (vi) CURRENT APPLICATION DATA (A) APPLICATION NUMBER: PCT / US (B) SUBMISSION DATE: 05-FEB-1998 (C) CLASSIFICATION DATA: (vii) PREVIOUS APPLICATION DATA: (A) APPLICATION NUMBER: US 08 / 796,089 (B) SUBMISSION DATE: 05-FEB-1997 (2) INFORMATION FOR SEC. FROM IDENT. NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: l GCACCTTCTT TCCCTTCATC 20 (2) INFORMATION FOR SEC. FROM IDENT. NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE. (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2 TGCTGATGTA CCAGTTGGGG 20 (2) INFORMATION FOR SEC. FROM IDENT. NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3 CAGTCCTTGA CCTGCGACC 19 (2) INFORMATION FOR SEC. FROM IDENT. NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4 GCCTCACATC ACATCCTTG 19 It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is the conventional one for the manufacture of the objects or products to which it refers.

Claims (51)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An isolated, soluble, non-fibrillar, non-fibrillar, amyloid oligomeric structure, characterized in that it comprises at least 3 to 12 β-amyloid proteins and which shows neurotoxicity.

2. The isolated oligomeric structure according to claim 1, characterized in that the oligomeric structure comprises an oligomeric form that is selected from the group consisting of trimer, tetramer, pentamer and hexamer.

3. The isolated oligomeric structure according to claim 1 or 2, characterized in that the oligomeric structure has a molecular weight from about 26 kD to about 28 kD determined by non-denaturing gel electrophoresis.

4. The isolated oligomeric structure according to any of claims 1 to 3, characterized in that the oligomeric structure has a molecular weight from about 22 kD to about 24 kD, or from about 18 kD to about 19 kD, determined by electrophoresis in SDS-polyacrylamide gel 15%.

5. The isolated oligomeric structure according to any of claims 1 to 4, characterized in that the oligomeric structure comprises globules of dimensions from approximately 4.7 nm to approximately 6.2 nm as measured by atomic force microscopy.

6. The isolated oligomeric structure according to any of claims 1 to 5, characterized in that the oligomeric structure comprises globules of dimensions from approximately 4.9 nm to approximately 5.4 nm, measured by atomic force microscopy.

7. The isolated oligomeric structure according to any of claims 1 to 5, characterized in that the oligomeric structure comprises globules of dimensions from approximately 5.7 nm to approximately 6.2 nm as measured by atomic force microscopy.

8. The isolated oligomeric structure according to any of claims 1 to 5, characterized in that from about 40% to about 75% of the oligomeric structure comprises globules of dimensions from about 4.9 nm to about 5.4 nm, and dimensions from about 5.7 nm to approximately 6.2 nm, measured by atomic force microscopy.

9. A method for determining the effects of an oligomeric structure, according to any of claims 1 to 8, characterized in that it comprises: (a) administering the oligomeric structure to the hippocampus of an animal; (b) apply an electrical stimulus; and (c) measuring the cell body spike amplitude over time to determine the long-term potentiation response, with the proviso that administration of the oligomeric structure is not performed for therapy.

The method according to claim 9, characterized in that the long-term potentiation response of the animal is compared to the long-term potentiation response of another animal treated in the same manner except that saline has been administered instead of the oligomeric structure before the application of the electrical stimulus.

11. A method for protecting an animal against decreases in learning in memory due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises administering a compound that blocks the formation of the oligomeric structure.

12. A method for protecting an animal against decreases in learning in memory due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises administering a compound that blocks the activity of the structure oligomeric that leads to decreases in learning or memory.

13. A method for investing in an animal decreases in learning or memory due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises administering a compound that blocks the formation of the oligomeric structure.

14. A method for reversing in an animal decreases in learning or memory due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises administering a compound that blocks the activity of the structure oligomeric that leads to decreases in learning or memory.

The method according to any of claims 11 to 14, characterized in that it is applied in the treatment of a disease, disorder or condition that is selected from the group consisting of Alzheimer's disease, adult syndrome and senile dementia.

16. A method for protecting a nerve cell against decreases in long-term potentiation due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises contacting the cell with a compound that blocks the formation of the oligomeric structure.

17. A method for protecting a nerve cell against decreases in long-term potentiation due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises contacting the cell with a compound that blocks the activity of the oligomeric structure that leads to decreases in long-term potentiation.

18. A method for reversing in a nerve cell decreases in long-term potentiation due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises contacting the cell with a compound that blocks the formation of the oligomeric structure.

19. A method for reversing in a nerve cell decreases in long-term potentiation due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises contacting the cell with a compound that blocks the activity of the oligomeric structure that leads to decreases in long-term potentiation.

20. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with the 6E10 antibody; and (b) detecting binding to the oligomeric structure of the antibody.

21. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with neuroblastoma cells lacking serum; and (b) measuring the morphological changes in the cells by comparing the morphology of the cells against neuroblastoma cells that have not been contacted with the test material.

22. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with brain cut cultures; and (b) measuring the death of brain cells compared to brain cut cultures that have not been in contact with the test material.

23. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with neuroblastoma cells; and (b) measuring the increases in Fyn kinase activity by comparing the activity of Fyn kinase in the cells against Fyn kinase activity in neuroblastoma cells that have not been contacted with the test material.

24. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with cultures of primary astrocytes; and (b) determining the activation of the astrocytes compared to cultures of primary astrocytes that have not been contacted with the test material.

25. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting the test material with cultures of primary astrocytes; and (b) measuring the increases of astrocytes in the mRNA for proteins that are selected from the group consisting of interleukin-1., inducible nitric oxide synthase, ApoE, ApoJ and al-antichymotrypsin when comparing the levels of mRNA in astrocytes against the corresponding mRNA levels in cultures of primary astrocytes that have not been contacted with the test material.

26. A method for identifying compounds that modulate the effects of an oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) administering either saline or a test compound to the hippocampus of an animal; (b) apply an electrical stimulus; (c) measuring the amplitude of spikes of the body of the cell with respect to time to determine the long-term potentiation response; and (d) comparing the long-term potentiation response of animals having saline administered with respect to the long-term potentiation response of animals to which the test compound has been administered with the proviso that administration of the Oligomeric structure is not performed for therapy.

27. The method according to claim 26, characterized in that it further comprises administering an oligomeric structure to the hippocampus either before, together with or after administering saline or test compound.

28. A method for identifying compounds that block the neurotoxicity of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting separate cultures of neuronal cells with the oligomeric structure and either in the presence or absence of contact with the test compound; (b) measuring the proportion of viable cells in each culture; and (c) comparing the proportion of viable cells in each culture with compounds that block the neurotoxicity of the oligomeric structure that is identified resulting in an increased proportion of viable cells in the culture as compared to the corresponding culture that is placed in the culture. contact with the oligomeric structure in the absence of the test compound.

29. A method for identifying compounds that block binding to a cell surface protein of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) contacting separate cell cultures neuronal with the oligomeric structure either in the presence or absence of contact with the test compound; (b) adding a reagent that binds to the oligomeric structure, the reagent is fluorescent; (c) analyzing cell cultures separated by fluorescence-activated cell sorting; and (c) comparing the fluorescence of the cultures with compounds that block binding to a cell surface protein of the oligomeric structure that is identified resulting in a reduced fluorescence of the culture compared to the corresponding culture that is contacted with the oligomeric structure in the absence of the test compound.

30. A method for identifying compounds that block binding to a cell surface protein of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) forming the oligomeric structure from the β-amyloid protein so as to become a tagged or labeled oligomeric structure comprising a binding portion capable of binding a fluorescent reagent; (b) contacting separate cultures of neuronal cells with the labeled oligomeric structure either in the presence or absence of contact with the test compound; (c) adding a fluorescent reagent that binds to the oligomeric structure; (d) analyzing cell cultures separated by fluorescence-activated cell sorting; and (e) comparing the fluorescence of the cultures with compounds that block binding to a cell surface protein of the oligomeric structure that is identified resulting in a reduced fluorescence of the culture compared to the corresponding culture that is contacted with the oligomeric structure in the absence of the test compound.

31. A method for identifying compounds that block the cell-surface protein binding formation of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) preparing separate samples of amyloid protein ß that have been mixed or not with the test compound; (b) forming the oligomeric structure in separate samples; (c) contacting separate cultures of neuronal cells with the separated samples; (d) adding a reagent that binds to the oligomeric structure, the reagent is fluorescent; (e) analyzing cell cultures separated by fluorescence activated cell sorting; and (f) comparing the fluorescence of the cultures with compounds that block binding to a cell surface protein of the oligomeric structure that is identified resulting in reduced fluorescence of the culture compared to the corresponding culture that is contacted with the oligomeric structure in the absence of the test compound.

32. A method for identifying compounds that block the formation of binding to a cell surface protein of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) preparing separate samples of β-amyloid protein which have been mixed or not with the test compound; (b) forming the oligomeric structure in separate samples so as to become a labeled oligomeric structure comprising a binding portion capable of binding a fluorescent reagent in each of the separated samples; (c) contacting separate cultures of neuronal cells with the separated samples; (d) adding a fluorescent reagent that binds to the oligomeric structure; (e) analyzing cell cultures separated by fluorescence activated cell sorting; and (f) comparing the fluorescence of the cultures with compounds that block binding to a cell surface protein of the oligomeric structure that is identified resulting in reduced fluorescence of the culture compared to the corresponding culture that is contacted with the oligomeric structure in the absence of the test compound.

33. The method according to claim 31 or 32, characterized in that the fluorescence of the cultures is further compared with the fluorescence of cultures that have been treated in the same manner except that instead of adding or not the test compound before the formation of the oligomeric structure, the test compound is added or not after the formation of the oligomeric structure, with compounds that block the formation of the oligomeric structure that are identified as resulting in a reduced fluorescence of the culture compared to the corresponding culture that it is contacted with the oligomeric structure in the absence of the test compound, only when the compound is first added to the oligomeric structure, and compounds that block binding to a cell surface protein of the oligomeric structure are identified as resulting in a reduced fluorescence of the crop compared to the crop or corresponding which is contacted with the oligomeric structure in the absence of the test compound, when the test compound is added either before or after the oligomeric structure.

34. A method for detecting binding to a cell surface protein of the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) forming the oligomeric structure from β-amyloid protein; (b) contacting a culture of neuronal cells with the oligomeric structure; (c) adding an antibody that binds the oligomeric structure, the antibody includes a conjugating moiety; (d) removing the unbound antibody by washing; (f) attaching an enzyme to the antibody bound to the oligomeric structure by means of the conjugating portion; (g) adding a colorless substrate that is separated by the enzyme to provide a color change; and (h) determining the color change as a measure of binding to a cell surface protein of the oligomeric structure.

35. A method for identifying compounds that block binding to a cell surface protein of the oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises: (a) preparing separate samples of β-amyloid protein that have been mixed or not with the test compound; (b) forming the oligomeric structure in the separated samples; (c) contacting separate cultures of neuronal cells with the separated samples; (d) adding an antibody that binds to the oligomeric structure, the antibody includes a conjugating moiety; (e) removing the unbound antibody by washing; (f) attaching an enzyme to the antibody bound to the oligomeric structure by means of a conjugating moiety; (g) adding a colorless substrate that is separated by the enzyme to provide a color change; (h) comparing the color change produced by each of the separated samples with compounds that block the formation or binding to a cell surface protein of the oligomeric structure that is being identified resulting in a reduced color change produced by the culture compared to the corresponding culture which is contacted with the oligomeric structure in the absence of the test compound.

36. The method according to claim 35, characterized in that the color change produced by the crops is further compared with the color change produced by the crops that have been treated in the same manner except that instead of adding or not the test compound before the formation of the oligomeric structure, the test compound is added or not after the formation of the oligomeric structure, with compounds that block the formation of the oligomeric structure that are identified resulting in a color change reduced or produced by the culture compared to the corresponding culture that is contacted with the oligomeric structure in the absence of the test compound, only when the test compound is added before the oligomeric structure, and compounds that block the receptor binding of the oligomeric structure that are identified and that result in a reduced color change that is The culture is compared to the corresponding culture which is contacted with the oligomeric structure in the absence of the test compound, when the compound is added either before or after the oligomeric structure.

37. A method for identifying compounds that block the formation of the oligomeric structure, according to any of claims 1 to 8, the method is characterized in that it comprises: (a) preparing separate samples of β-amyloid protein that have been mixed or not with the test compound; (b) forming the oligomeric structure in separate samples; (c) determining whether any protein assembly has been formed into separate samples using a method that is selected from the group consisting of electrophoresis, immunorecognition and atomic force microscopy; and (f) comparing the formation of the protein mounts in the separate samples, compounds which block the formation of the oligomeric structure that is identified and which results in a decreased formation of the oligomeric structure in the sample, compared to the sample in which the oligomeric structure has been formed in the absence of the test compound.

38. A method for preparing a soluble, isolated, non-fibrillar, non-fibrillar, amyloid oligomer structure, according to any one of claims 1 to 8, the method is characterized in that it comprises: (a) obtaining a monomeric β-amyloid protein solution, the β-amyloid protein is capable of forming the oligomeric structure; (b) dilute the protein solution in an appropriate medium to a final concentration from about 5 nm to about 500 μM; (c) incubating the media resulting from step (b) at about 4 ° C for about 2 hours to about 48 hours; (c) centrifuging the solution at about 14,000 g at about 4 ° C; and (d) recovering the supernatant resulting from the centrifugation as containing the oligomeric structure of β-amyloid.

39. The method according to claim 38, characterized in that the method comprises incubating the medium resulting from step (b) at about 4 ° C in the presence of clusterin.

40. An isolated, soluble, non-fibrillar, non-fibrillar, amyloid γ-amyloid structure characterized in that it is prepared according to claim 38 or 39.

41. The use of an insoluble, isolated, non-fibrillar, non-fibrillar, amyloid oligomer structure. according to any of claims 1 to 8, for altering the long-term potentiation response of a nerve cell, characterized in that it comprises contacting the cell with the oligomeric structure.

42. The use of an isolated, soluble, non-fibrillar, non-fibrillar, amyloid oligomer structure, according to any of claims 1 to 8, to alter the learning or memory of an animal, characterized in that it comprises administering the oligomeric structure to the animal .

43, The use of an isolated, soluble, non-fibrillar, non-fibrillar, amyloid oligomer structure, according to any of claims 1 to 8, to cause a morphological change of a nerve cell, characterized in that it comprises contacting the cell with the oligomeric structure.

44. The use according to claim 3, characterized in that the morphological change includes an effect that is selected from the group consisting of cell destruction, alteration of the Fyn kinase activity, alteration of the subcellular localization of Fyn kinase and alteration of the mRNA levels or concentrations for proteins including interleukin-1, inducible nitric oxide synthase, ApoE, ApoJ and al-anti-chymotrypsin.

45. The use of an insoluble, isolated, non-fibrillar, non-fibrillar, amyloid structure of amyloid according to any one of claims 1 to 8, for causing astrocyte activation, characterized in that it comprises contacting the astrocyte with the oligomeric structure.

46. The use of a structure. Non-fibrillar, isolated, soluble, non-fibrillar amyloid oligomeric, according to any of claims 1 to 8, to identify test compounds that block the neurotoxicity of the oligomeric structure, characterized in that it comprises contacting a nerve cell with the structure oligomeric and the test compound.

47. The use of an isolated, soluble, globular, non-fibrillar, non-fibrillar, amyloid oligomeric structure according to any one of claims 1 to 8, to identify test compounds that block binding to a cell surface protein of the oligomeric structure, characterized in that it comprises contacting a nerve cell with the oligomeric structure and the test compound.

48. The use of an isolated, soluble, globular, non-fibrillar, non-fibrillar amyloid oligomeric structure according to any of claims 1 to 8, to identify test compounds that block the formation of the oligomeric structure, characterized in that it comprises putting into contact the β-amyloid protein with the test compound during incubation to form the oligomeric structure.

49. A method for protecting nerve cells against aberrant neuronal signaling induced by ADDL due to the effects of an oligomeric structure according to any of claims 1 to 8, the method is characterized in that it comprises contacting the cell with a blocking compound. the activity of the oligomeric structure that leads to the aberrant neuronal signaling induced by ADDL.

50. A method for detecting in a test material the oligomeric structure according to any of claims 1 to 8, characterized in that it comprises: (a) contacting the test material with a nerve cell; and (b) determining whether the cell shows aberrant neuronal signaling induced by ADDL.

51. The use of an isolated, soluble, non-fibrillar, non-fibrillar, amyloid oligomeric structure according to any one of claims 1 to 8, to cause aberrant neuronal signaling induced by ADDL of a nerve cell, characterized in that it comprises contacting to the cell with the oligomeric structure.