WO2003104271A1

WO2003104271A1 - Enzymes which degrade thio compounds, and methods of use thereof

Info

Publication number: WO2003104271A1
Application number: PCT/AU2003/000712
Authority: WO
Inventors: Tara Deane Sutherland; Kahli Michelle Weir; Irene Horne; Robyn Joyce Russell; John Oakeshott
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 2002-06-07
Filing date: 2003-06-06
Publication date: 2003-12-18
Also published as: AUPS282802A0

Abstract

The present invention discloses polypeptides capable of degrading a thio compound such as endosulfan and sulfur containing compounds of fossil fuels. The invention describes polynucleotides encoding these polypeptides, as well as recombinant and non-recombinant cells producing these polypeptides. Methods generally relating to the degradation of thio compounds, as well as methods of desulfurizing fossil fuels, are also provided.

Description

ENZYMES WHICH DEGRADE THIO COMPOUNDS. AND METHODS OF

USE THEREOF

FIELD OF THE INVENTION: The present invention provides novel polypeptides capable of degrading thio compounds. The present invention also provides methods for degrading thio compounds. More particularly, the present invention provides methods for degrading endosulfan.

BACKGROUND OF THE INVENTION:

The chlorinated sulfur ester, endosulfan (Thiodan^®, bicyclo-[2.2.1]-2-heptene- 5,6-bisoxymethylene sulfite), is a broad-spectrum insecticide that has been used extensively for over 30 years on a variety of crops. Endosulfan is often classified as a cyclodiene and has the same primary action and target site as other cyclodienes (Casida, 1993). However, it has significantly different chemical and physical properties from other cyclodiene insecticides that affect both its environmental and biological fates. In particular, endosulfan has a relatively reactive cyclic sulfite diester group (Van Woerden, 1963) and, as a consequence, its environmental persistence is lower than that of other cyclodienes, albeit still higher than many other insecticides. Since the deregistration in many countries of most cyclodiene insecticides, the ongoing availability of endosulfan has become important as an alternative option in resistance management strategies of pest species. Additionally, compared to many other available insecticides, it has low toxicity to many species of beneficial insects, mites and spiders (Goebel et al, 1982). However, endosulfan is extremely toxic to fish and aquatic invertebrates, and it has been implicated increasingly in mammalian gonadal toxicity (Singh and Pandey, 1990; Sinha et al, 1995; Sinha et al, 1997; Turner et al, 1997), genotoxicity (Chaudhuri et al, 1999) and neurotoxicity (Paul and Balasubramaniam, 1997). These environmental and health concerns have led to an interest in post- application detoxification of the insecticide. Commercial endosulfan is synthesised by esterification and cyclisation of endosulfan diol with thionyl chloride. This forms a mixture of two stereoisomers comprising approximately 70% alpha- and 30% beto-endosulfan. These two isomers differ in their chemical properties, physiological effects and behaviour in the environment, and as a result do not contribute equally to residue problems associated with the pesticide. Oxidation of either isomer produces the same compound, endosulfan sulfate, which has similar toxicity to the parent compounds. Oxidation of endosulfan is a widespread biological phenomenon and generally endosulfan sulfate is the predominant residue detected after exposure of biological systems to the pesticide. Endosulfan sulfate is chemically more stable than the parent compound and this is reflected in greater persistence in the environment.

Chemical hydrolysis of either isomer produces the same product, endosulfan diol. This reaction is recognised as detoxifying the pesticide since endosulfan diol does not appear to have significant toxicity in any biological system and the compound is readily degraded by a range of organisms.

Enzymatic detoxification of pesticides is an alternative to existing methods of toxic waste remediation, such as incineration and landfill. Accordingly, there is a need for enzymes which degrade thio compounds, such as beta-endosulfan, alpha-endosulfan and endosulfan sulfate, for use in bioremediation strategies.

SUMMARY OF THE INVENTION:

Using endosulfan as the only available sulfur source, the present inventors enriched soil inocula for microorganisms capable of releasing the sulfur from endosulfan, thereby providing a source of sulfur for growth. Since removal of the sulfur moiety dramatically decreases the vertebrate toxicity of endosulfan (Dorough et al, 1978; Goebel et al, 1982), this results in concurrent detoxification of the insecticide. From the soil culture the present inventors isolated two bacteria that have endosulfan-degrading activity. From these bacteria the present inventors have identified polypeptides which are capable of degrading thio compounds. Accordingly, in a first aspect the present invention provides a substantially purified polypeptide, the polypeptide comprising a sequence selected from the group consisting of:

(i) a sequence provided in SEQ ID NO:l; (ii) a sequence provided in SEQ ID NO:2; and (iii) a sequence which is at least 50% identical to (i) or (ii), wherein the polypeptide is capable of degrading a thio compound.

In a preferred embodiment of the first aspect, the polypeptide is at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 85%>, even more preferably at least 90%, even more preferably at least 92%, even more preferably at least 95%>, even more preferably at least 97%, and more preferably at least 99% identical to the sequence provided in SEQ ID NO:l or SEQ ID NO:2.

Preferably, the polypeptide can be purified from an Mycobacterium sp or an Arthrohacter sp. Preferably, the thio compound is a cyclic thio compound. It is also preferred that the thio compound is a sulfur ester. More preferably, the cyclic thio compound is a cyclic sulfur ester. More preferably, the cyclic sulfur ester is a cyclic sulfur diester. More preferably, the cyclic sulfur diester is selected from the group consisting of α- endosulfan, β-endosulfan and endosulfan sulfate. More preferably, the degradation product of α-endosulfan is endosulfan monoaldehyde, and the degradation product of β-endosulfan is endosulfan hydroxyether and/or endosulfan monoaldehyde.

In another embodiment, the thio compound is an organic sulfur compound contained in fossil fuel. In a further embodiment, the organic sulfur compound contained in fossil fuel is benzothiophene, dibenzothiopene or substituted compounds or derivatives thereof.

In one embodiment, the degradation product lacks a sulfite group, for instance as is the case for the degradation products of α-endosulfan and β-endosulfan. In a further embodiment, the degradation product lacks a sulfur atom. In another embodiment, the thio compound comprises at least one ring structure and the activity of the polypeptide results in the opening of at least one of these rings, for instance as is the case for the degradation products of endosulfan sulfate.

In a further embodiment, the degradation product is the result of hydroxylation of a carbon atom of the thio compound. In this instance, the carbon atom can be covalently bonded to the oxygen atom of a sulfur ester, more preferably covalently bonded to an oxygen atom a sulfur diester. Alternatively, the carbon atom can be covalently bonded to a sulfur atom.

The present inventors have also isolated a novel flavin reductase which provides reduced flavin co-substrate to the polypeptide according to the first aspect.

Thus, in a second aspect the present invention provides a substantially purified polypeptide, the polypeptide comprising a sequence selected from:

(i) a sequence provided in SEQ ID NO:3; and

(ii) a sequence which is at least 65% identical to (i), wherein the polypeptide is capable of reducing flavin.

In a preferred embodiment of the second aspect, the polypeptide is at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, even more preferably at least 92%, even more preferably at least 95%, even more preferably at least 97%, and more preferably at least 99% identical to the sequence provided in SEQ ID NO:3.

Preferably, the polypeptide can be purified from Mycobacterium sp.

Preferably, the polypeptide is capable of reducing flavin mononucleotide (FMN) in the presence of an electron donor. Electron donors include, but are not limited to, NADH and NADPH. Preferably, the electron donor is NADH.

In a third aspect, the present invention is a fusion protein comprising a polypeptide according to the first or second aspects fused to at least one other polypeptide sequence. In a preferred embodiment, the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of a polypeptide of the present invention, and a polypeptide that assists in the purification of the fusion protein.

In a fourth aspect, the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from: (i) a sequence of nucleotides provided in SEQ ID NO:4;

(ii) a sequence of nucleotides provided in SEQ ID NO:5;

(iii) a sequence encoding a polypeptide of the first aspect;

(iv) a sequence of nucleotides which is at least 50% identical to SEQ ID NO:4 or SEQ ID O:5; and (v) a sequence which hybridizes to (i) or (ii) under high stringency conditions.

In a preferred embodiment of the fourth aspect, the polynucleotide is at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, even more preferably at least 92%, even more preferably at least 95%, even more preferably at least 97%, and more preferably at least 99% identical to the sequence provided in SEQ ID NO:4 or SEQ ID O:5.

Preferably, the polynucleotide of the fourth aspect encodes a polypeptide capable of degrading a thio compound.

Preferably, the polynucleotide can be isolated from an Mycobacterium sp or an Arthrobacter sp.

In a fifth aspect, the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from:

(i) a sequence of nucleotides provided in SEQ ID NO: 6;

(ii) a sequence encoding a polypeptide according to the second aspect; (iii) a sequence of nucleotides which is at least 65% identical to SEQ ID NO: 6; and (iv) a sequence which hybridizes to (i) under high stringency conditions.

In a preferred embodiment of the fifth aspect, the polynucleotide is at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, even more preferably at least 92%, even more preferably at least 95%, even more preferably at least 97%, and more preferably at least 99% identical to the sequence provided in SEQ ID NO: 6.

Preferably, the polynucleotide of the fifth aspect encodes a flavin reductase. In a sixth aspect, the present invention provides a polynucleotide encoding a fusion protein according to the invention. The present invention provides a suitable vector for the replication and/or expression of a polynucleotide according to the invention. Thus, in a seventh aspect the present invention provides a vector comprising a polynucleotide of the fourth aspect. In an eighth aspect the present invention provides a vector comprising a polynucleotide of the fifth aspect. In a ninth aspect the present invention provides a vector comprising a polynucleotide of the sixth aspect.

The vectors may be, for example, a plasmid, virus or phage vector provided with an origin of replication, and preferably a promotor for the expression of the polynucleotide and optionally a regulator of the promotor. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian expression vector. The vector may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

The present invention also relates to a host cell comprising a vector of the invention. Thus, in a tenth aspect the present invention provides a host cell comprising a vector of the seventh aspect. In an eleventh aspect the present invention provides a host cell comprising a vector of the eighth aspect. In a twelfth aspect, the present invention provides a host cell comprising a vector of the ninth aspect.

Preferably, the host cell is a bacterial or fungal cell.

Preferably, the bacterial cell is selected from the group consisting of: E. coli K12, E. coli B, Bacillus subtilis, B. licheniformis, Pseudomanas putida strain KT 2440, Streptomyces coelicolor, S. lividans, S. parvulus, S. griseus, Mycobacterium smegmatis and Brevibacillus sp..

In a further aspect, the present invention provides a process for preparing a polypeptide according to the first aspect, the process comprising cultivating a host cell according to the tenth aspect under conditions which allows expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide. In another aspect, the present invention provides a process for preparing a polypeptide according to the second aspect, the process comprising cultivating a host cell according to the eleventh aspect under conditions which allows expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide. The present invention also provides polypeptides produced by a process of the invention.

The present invention also provides a composition comprising a polypeptide, a polynucleotide, a vector or a host cell of the invention, and one or more acceptable carriers. It will be appreciated that the present invention can be used to degrade a thio compound in a sample. For instance, after a crop has been sprayed with, for example, an endosulfan formulation, the endosulfan residue can be degraded from seeds, fruits and vegetables before human consumption. Similarly, endosulfan contaminated soil or water can be treated with a polypeptide of the first aspect of the present invention. Thus, in a further aspect, the present invention provides a composition for degrading a thio compound, the composition comprising a polypeptide according to the first aspect, and one or more acceptable carriers.

Preferably, the composition further comprises a flavin reductase. More preferably, the flavin reductase is a polypeptide according to the second aspect. In a further aspect, the present invention provides a composition for degrading a thio compound, the composition comprising a host cell of the tenth aspect, and one or more acceptable carriers.

In yet another aspect, the present invention provides a method for degrading a thio compound in a sample, the method comprising contacting the thio compound with a polypeptide according to the first aspect.

The present inventors have shown that the activity of the polypeptides of the first aspect of the invention can be enhanced by the presence of an electron.

Accordingly, in a preferred embodiment, the method further comprises means for supplying an electron. Preferably, the means for supplying an electron comprises an electron donor, an electron acceptor, and an enzyme.

Electron donors are inorganic or organic compounds capable of supplying an electron. The electron donor may be any suitable molecule known in the art such as, but not limited to, NADH or NADPH. Preferably, the electron donor is NADH.

The electron acceptor may be any suitable molecule known in the art such as, but not limited to, FMN, riboflavin or FAD. Preferably, the electron acceptor is FMN. The enzyme may be any suitable polypeptide known in the art such as, but not limited to, a flavin reductase. Preferably, the flavin reductase is a polypeptide according to the second aspect.

Preferably, the method is performed in the presence of oxygen. Preferably, the sample is selected from the group consisting of: soil, water or biological material. Preferred biological material includes matter derived from plants such as seeds, vegetables or fruits, as well as matter derived from animals such as meat or wool.

Since at least some thio compounds, for example endosulfans, are very hydrophobic, it is preferable that the method further comprises exposing the sample to a factor which enhances the availability of the thio compound to the polypeptide. Preferably, the factor is selected from the group consisting of detergents, bovine serum albumin, a bacterial cell wall extract, and surfactants. Preferably, the bacterial cell wall extract is obtained from a, Mycobacterium sp. Further, it is preferred that the surfactant is a biosurfactant.

The sample can be exposed to the polypeptide by any appropriate means. This includes providing the polypeptide directly to the sample, with or without carriers or excipients etc. The polypeptide can also be provided in the form of a host cell, typically a microorganism such as a bacterium or a fungus, which expresses a polynucleotide encoding the polypeptide of the first aspect of the invention.

It is preferred that the thio compound is selected from the group consisting of α- endosulfan, β-endosulfan, endosulfan sulfate, and organic sulfur compounds contained in fossil fuel.

Thio compounds in a sample can also be degraded by exposing the sample to a transgenic plant which produces a polypeptide of the present invention.

Accordingly, in another aspect, the present invention provides a transgenic plant which produces a polypeptide according to the first aspect.

Preferably, the transgenic plant also produces a flavin reductase. More preferably, the flavin reductase is a polypeptide according to the second aspect. It is preferred that the polypeptide is at least produced in the roots of the transgenic plant.

In a further aspect, the present invention provides a method for degrading a thio compound in a sample, the method comprising exposing the sample to a transgenic plant according to the invention. Preferably, the sample is soil. In a further aspect, the present invention provides an isolated strain of Mycobacterium sp deposited under accession number NM02/29426 on 6 June 2002 at Australian Government Analytical Laboratories.

In another aspect, the present invention provides an isolated strain of Arthrobacter sp deposited under NM02/29427 on 6 June 2002 at Australian Government Analytical Laboratories.

In yet another aspect, the present invention provides a composition for degrading a thio compound, the composition comprising an isolated strain of the invention, and one or more acceptable carriers. In a further aspect, the present invention provides a method for degrading a thio compound in a sample, the method comprising exposing the sample to an isolated strain of the invention.

The disclosure of the present invention can readily be used to isolate other bacterial species/strains which are capable of degrading a thio compound. For example, other bacterial species/strains may be isolated using a purification procedure as a disclosed herein. Alternatively, probes and/or primers can be designed based on the polynucleotides of the present invention and used to identify bacteria which produce naturally occurring variants of the polypeptides of the present invention. Similarly, antibodies directed to, and which specifically bind, a polypeptide of the first aspect (which also form part of the present invention) may be used in standard procedures to isolate naturally occurring variants of the polypeptides provided as SEQ ID NO:l or SEQ ID NO:2.

Accordingly, in another aspect, the present invention provides an isolated bacterium which produces a polypeptide according to the first aspect. Preferably, the bacterium is an Mycobacterium sp or an Arthrobacter sp.

In a further aspect the present invention provides for the use of an isolated naturally occurring bacterium which produces a polypeptide of the first aspect of the invention for degrading a thio compound in a sample.

In another aspect, the present invention provides a polymeric sponge or foam for degrading a thio compound, the foam or sponge comprising a polypeptide according to the first aspect immobilized on a polymeric porous support.

Preferably, the foam or sponge further comprises a flavin reductase. More preferably, the flavin reductase is a polypeptide according to the second aspect.

Preferably, the porous support further comprises polyurethane. In a preferred embodiment, the sponge or foam further comprises carbon embedded or integrated on or in the porous support. In a further aspect, the present invention provides a method for degrading a thio compound in a sample, the method comprising exposing the sample to a sponge or foam according to the invention.

In yet another aspect, the present invention provides a biosensor for detecting the presence of a thio compound, the biosensor comprising a polypeptide according to the first aspect, and a means for detecting degradation of the thio compound by the polypeptide.

Preferably, the biosensor detects sulfite produced by the activity of the polypeptide. Preferably, the production of sulfite is detected by a colour reaction with 5,5'-dithiobis(2-nitro benzoic acid).

In another aspect, the present invention provides a method for screening for a microorganism capable of degrading a thio compound, the method comprising culturing a candidate microorganism in the presence of a thio compound as the sole sulfur source, and determining whether the microorganism is capable of growth and/or division.

It is preferred that the thio compound is selected from the group consisting of α- endosulfan, β-endosulfan and endosulfan sulfate.

In another aspect, the present invention provides a microorganism isolated according to a method of the invention. It is envisaged that the polypeptide of the first aspect will be useful for desulfurizing fossil fuel containing organic sulfur compounds.

Thus, in yet another aspect the present invention provides a method of desulfurizing fossil fuel containing organic sulfur compounds, the method comprising the steps of: a) contacting the fossil fuel with an aqueous phase containing a polypeptide according to the first aspect to produce a fossil fuel and aqueous phase mixture, b) maintaining the mixture of step a) under conditions sufficient for activity of the polypeptide, resulting in a fossil fuel having a reduced organic sulfur content; and c) separating the fossil fuel having reduced sulfur content from the resulting aqueous phase.

Preferably, step a) also comprises the fossil fuel and aqueous phase mixture further comprising an electron donor. It is also preferred that step a) also comprises the fossil fuel and aqueous phase mixture further comprising a flavin reductase. More preferably, the flavin reductase is a polypeptide according to the second aspect. The polypeptides of the present invention can be mutated, and the resulting mutants screened for altered activity such as changes in substrate specificity. Such mutations can be performed using any technique known in the art including, but not limited to, in vitro mutagenesis and DNA shuffling.

Thus, in a further aspect the present invention provides a method of producing a polypeptide with enhanced ability to degrade a thio compound or altered substrate specificity for a thio compound, the method comprising

(i) altering one or more amino acids of a first polypeptide according to the first aspect,

(ii) determining the ability of the altered polypeptide obtained from step (i) to degrade a thio compound, and (iii) selecting an altered polypeptide with enhanced ability to degrade a thio compound or altered substrate specificity for a thio compound, when compared to the first polypeptide. The present invention also provides a polypeptide produced by this method. The present invention provides kits comprising polypeptides, polynucleotides, vectors, host cells or compositions etc of the invention. Accordingly, in a further aspect the present invention provides a kit for degrading a thio compound, the kit comprising a polypeptide according to the first aspect and a flavin reductase.

Preferably, the flavin reductase is a polypeptide according to the second aspect of the invention. In another aspect, the present invention provides a kit for degrading a thio compound, the kit comprising a polynucleotide according to the fourth aspect, and means for transcribing and translating the polynucleotide.

It is also envisaged that previously known polypeptides that are capable of desulfurizing fossil fuel containing organic sulfur compounds will also be able to degrade endosulfans. Accordingly, the present invention also provides for the use of previously known polypeptides that desulfurize fossil fuel containing organic sulfur compounds, such as those disclosed in US 5,356,801, US 5,811,285 and US application No. 2003/0032100, for degrading endosulfan compounds.

Thus, in a further aspect the present invention provides a method for degrading endosulfan in a sample, the method comprising contacting the sample with a polypeptide comprising a sequence selected from the group consisting of: (i) a sequence provided in SEQ ID NO: 19; (ii) a sequence provided in SEQ ID NO:20; (iii) a sequence provided in SEQ ID NO:21; and (iv) a sequence which is at least 70% identical to any one of (i) to (iii), wherein the endosulfan is selected from the group consisting of α-endosulfan, β- endosulfan and endosulfan sulfate.

In a preferred embodiment, the polypeptide is at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 92%, even more preferably at least 95%, even more preferably at least 97%, and more preferably at least 99% identical to the sequence provided in SEQ ID NO: 19, SEQ ID NO:20 or

SEQ ID NO:21.

In another aspect the present invention provides a transgenic plant which produces a polypeptide comprising a sequence selected from the group consisting of: (i) a sequence provided in SEQ ID NO: 19;

(ii) a sequence provided in SEQ ID NO:20;

(iii) a sequence provided in SEQ ID NO:21; and

(iv) a sequence which is at least 70% identical to any one of (i) to (iii), wherein the polypeptide is capable of degrading an endosulfan compound selected from the group consisting of α-endosulfan, β-endosulfan and endosulfan sulfate.

Such transgenic plants can be used in methods of degrading endosulfan in a sample.

In yet another aspect, the present invention provides a method for degrading endosulfan in a sample, the method comprising exposing the sample to a microorganism encoding a polypeptide comprising a sequence selected from the group consisting of:

(i) a sequence provided in SEQ ID NO: 19;

(ii) a sequence provided in SEQ ID NO:20;

(iii) a sequence provided in SEQ ID NO:21; and (iv) a sequence which is at least 70% identical to any one of (i) to (iii), wherein the endosulfan is selected from the group consisting of α-endosulfan, β- endosulfan and endosulfan sulfate.

As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention. Throughout this specification the word "comprise", or variations such as

"comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

The invention is hereinafter described by way of the following non-limiting Examples.

KEY TO SEQUENCE LISTING:

SEQ ID NO: 1 -Mycobacterium sp. beta-esd polypeptide sequence.

SEQ ID NO:2 - Arthrobacter sp. alpha-esd polypeptide sequence. SEQ ID NO: 3 - Mycobacterium smegmatis flavin reductase.

SEQ ID NO:4 - Open reading frame encoding SEQ ID NO: 1.

SEQ ID NO:5 - Open reading frame encoding SEQ ID NO: 2.

SEQ ID NO:6 - Open reading frame encoding SEQ ID NO: 3.

SEQ ID NO's 7 to 18 - PCR primers. SEQ ID NO: 19 - Paenϊbacillus sp. tdsA flavomonoxygenase (Ishii et al, 2000).

SEQ ID NO:20 - Rhodococcus sp. dszk (Denome et al, 1994).

SEQ ID NO:21 - Aminobacter aminovorans nitrilotriacetate monoxygenase (Knobel et al, 1996 - organism referred to as Chelatobacter heint∑ii in paper).

DETAILED DESCRIPTION OF THE INVENTION:

General Techniques

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques, chemistry and biochemistry).

Unless otherwise indicated, the recombinant DNA techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, JJRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) and are incorporated herein by reference. In the context of the present invention, the terms "degrade", "degrading" or "degradation" relates to the reduction in a particular activity of the thio compound through the activity of the polypeptide of the first aspect, or an enzyme related thereto. For instance, in relation to endosulfans, the activity of the polypeptide of the first aspect results in a product which is less toxic to mammals. As another example, the desulfurization of thio compounds in fossil fuels using the polypeptide of the first aspect results in a product that is less troublesome for refinery processes. However, it is envisaged that at least in some circumstances the activity of the polypeptide of the first aspect may result in a product with an enhanced or new desirable activity.

Polypeptides

By "substantially purified polypeptide" we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.

The % identity of a polypeptide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids.

Amino acid sequence mutants of the polypeptides of the present invention, also referred to herein as "altered polypeptides", can be prepared by introducing appropriate nucleotide changes into a nucleic acid of the present invention, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics. Mutant (altered) polypeptides can be prepared using any technique known in the art. For example, the polynucleotide provided as SEQ ID NO:l can be subjected to in vitro mutagenesis. Such to in vitro mutagenesis techniques include sub-cloning the polynucleotide into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-1 red (Stratagene) and propagating the transformed bacteria for a suitable number of generations. In another example, the polynucleotides of the invention are subjected to DNA shuffling techniques as broadly described by Harayama (1998). These DNA shuffling techniques may include genes related to SEQ ID NO's 1 and 2 as well as those mentioned herein which have previously been used for the desulfurization of fossil fuels. Protein products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they have enhanced and/or altered substrate specificity.

In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues. Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active or binding site(s). Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".

Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention. Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, α-amino isobutyric acid, 4- aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and amino acid analogues in general.

Also included within the scope of the invention are polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention. Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins. In one embodiment, an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide. A preferred cell to culture is a recombinant cell of the present invention. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.

Polynucleotides

By "isolated polynucleotide" we mean a polynucleotide which have generally been separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. Furthermore, the term "polynucleotide" ^: is used interchangeably herein with the term "nucleic acid molecule". The % identity of a polynucleotide is determined by GAP (Needleman and

Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. Even more preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides.

A polynucleotide of the present invention may selectively hybridise to a polynucleotide that encodes a polypeptide of the present invention under high stringency. Furthermore, oligonucleotides of the present invention have a sequence that hybridizes selectively invention under high stringency to a polynucleotide of the present invention. As used herein, high stringency conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodSO₄ at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1%) polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS.

Polynucleotides of the present invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site- directed mutagenesis or DNA shuffling on the nucleic acid as described above). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant.

Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention. The present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, or primers to amplify nucleic acid molecules of the invention.

Recombinant Vectors

One embodiment of the present invention includes a recombinant vector, which comprises at least one isolated polynucleotide molecule of the present invention, inserted into any vector capable of delivering the polynucleotide molecule into a host cell. Such a vector contains heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules of the present invention and that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid. One type of recombinant vector comprises a polynucleotide molecule of the present invention operatively linked to an expression vector. The phrase operatively linked refers to insertion of a polynucleotide molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, other animal, and plant cells. Preferred expression vectors of the present invention can direct gene expression in bacterial, yeast, arthropod and mammalian cells and more preferably in the cell types disclosed herein.

In particular, expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention. In particular, recombinant molecules of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Preferred transcription control sequences include those which function in bacterial, yeast, arthropod and mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda, bacteriophage T7, T71ac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01, metallothionein, alpha-mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other poxvirus, adenovirus, cytomegalovirus (such as intermediate early promoters), simian virus 40, retrovirus, actin, retroviral long terminal repeat, Rous sarcoma virus, heat shock, phosphate and nitrate transcription control sequences as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed polypeptide of the present invention to be secreted from the cell that produces the polypeptide and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion of a protein of the present invention. Preferred signal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments, as well as natural signal sequences. In addition, a nucleic acid molecule of the present invention can be joined to a fusion segment that directs the encoded protein to the proteosome, such as a ubiquitin fusion segment. Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules of the present invention.

Host Cells

Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed polynucleotide molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.

Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins of the present invention or can be capable of producing such proteins after being transformed with at least one polynucleotide molecule of the present invention. Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells. Preferred host cells include bacterial, mycobacterial, yeast, arthropod and mammalian cells. More preferred host cells include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycobacteria, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells (normal dog kidney cell line for canine herpesvirus cultivation), CRFK cells (normal cat kidney cell line for feline herpesvirus cultivation), CV-1 cells (African monkey kidney cell line used, for example, to culture raccoon poxvirus), COS (e.g., COS-7) cells, and Vero cells. Particularly preferred host cells are E. coli, including E. coli K-12 derivatives; Salmonella typhi; Salmonella typhimurium, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246). Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse MH/3T3 cells, LMTK cells and/or HeLa cells. Further preferable host bacterial cells include Rhodococcus sp. such as R. erythropolis, E. coli K12, E. coli B, Bacillus subtilis, B. licheniformis, Pseudomanas putida strain KT 2440, Streptomyces coelicolor, S. lividans, S. parvulus, S. griseus, Mycobacterium smegmatis and Brevibacillus sp..

Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules of the present invention include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.

Transgenic Plants

The term "plant" refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Exemplary dicotyledons include cotton, corn, tomato, tobacco, potato, bean, soybean, and the like. Transgenic plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA techniques to cause or enhance production of at least one protein of the present invention in the desired plant or plant organ.

A polynucleotide of the present invention may be expressed constitutively in the transgenic plants during all stages of development. Depending on the use of the plant or plant organs, the proteins may be expressed in a stage-specific manner.

Furthermore, depending on the use, the polynucleotides may be expressed tissue- specifically.

The choice of the plant species is determined by the intended use of the plant or parts thereof and the amenability of the plant species to transformation.

Regulatory sequences which are known or are found to cause expression of a gene encoding a protein of interest in plants may be used in the present invention. The choice of the regulatory sequences used depends on the target plant and/or target organ of interest. Such regulatory sequences may be obtained from plants or plant viruses, or may be chemically synthesized. Such regulatory sequences are well known to those skilled in the art.

Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence -functioning as such in plants, the choice of which would be obvious to the skilled addressee. An example of such sequences is the 3' flanking region of the nopaline synthase (nos) gene of Agrobacterium tumefaciens.

Several techniques are available for the introduction of an expression construct containing a nucleic acid sequence encoding a protein of interest into the target plants. Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment. In addition to these so-called direct DNA transformation methods, transformation systems involving vectors are widely available, such as viral and bacterial vectors (e.g. from the genus Agrobacterium). After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.

Compositions Compositions of the present invention include excipients, also referred to herein as "acceptable carriers". An excipient can be any material that the animal, plant, plant or animal material, or environment (including soil and water samples) to be treated can tolerate. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosal or o-cresol, formalin and benzyl alcohol. Excipients can also be used to increase the half-life of a composition, for example, but are not limited to, polymeric controlled release vehicles, biodegradable implants, liposomes, bacteria, viruses, other cells, oils, esters, and glycols.

Furthermore, a polypeptide of the present invention can be provided in a composition which enhances the rate and/or degree of degradation of the thio compound, or increases the stability of the polypeptide. For example, the polypeptide can be immobilized on a polyurethane matrix (Gordon et al., 1999), or encapsulated in appropriate liposomes (Petrikovics et al. 2000a and b). The polypeptide can also be incorporated into a composition comprising a foam such as those used routinely in fire- fighting (LeJeune et al., 1998).

As would be appreciated by the skilled addressee, the polypeptide of the present invention could readily be used in a sponge or foam as disclosed in WO 00/64539, the contents of which are incorporated herein in their entirety.

One embodiment of the present invention is a controlled release formulation that is capable of slowly releasing a polypeptide of the present invention into an animal, plant, animal or plant material, or the environment (including soil and water samples). As used herein, a controlled release formulation comprises a composition of the present invention in a controlled release vehicle. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Preferred controlled release formulations are biodegradable (i.e., bioerodible).

A preferred controlled release formulation of the present invention is capable of releasing a composition of the present invention into soil or water which is in an area sprayed with a thio compound, particularly endosulfan. The formulation is preferably released over a period of time ranging from about 1 to about 12 months. A preferred controlled release formulation of the present invention is capable of effecting a treatment preferably for at least about 1 month, more preferably for at least about 3 months, even more preferably for at least about 6 months, even more preferably for at least about 9 months, and even more preferably for at least about 12 months. The concentration of the polypeptide, vector, or host cell of the present invention that will be required to produce effective compositions for degrading a thio compound will depend on the nature of the sample to be decontaminated, the concentration of the thio compound in the sample, and the formulation of the composition. The effective concentration of the polypeptide, vector, or host cell within the composition can readily be determined experimentally, as will be understood by the skilled artisan.

Surfactants

It is envisaged that the use of a surfactant in the methods of the present invention may liberate hydrophobic thio compounds, from any, for example, sediment in the sample. Thus increasing efficiency of the methods of the present invention.

Surfactants are amphipathic molecules with both hydrophilic and hydrophobic (generally hydrocarbon) moieties that partition preferentially at the interface between fluid phases and different degrees of polarity and hydrogen bonding such as oil/water or air/water interfaces. These properties render surfactants capable of reducing surface and interfacial tension and forming microemulsion where hydrocarbons can solubilize in water or where water can solubilize in hydrocarbons. Surfactants have a number of useful properties, including dispersing traits.

Biosurfactants are a structurally diverse group of surface-active molecules synthesized by microorganisms. These molecules reduce surface and interfacial tensions in both aqueous solutions and hydrocarbon mixtures. Biosurfactants have several advantages over chemical surfactants, such as lower toxicity, higher biodegradability, better environmental compatability, higher foaming, high selectivity and specificity at extreme temperatures, pH and salinity, and the ability to be synthesized from a renewable source.

Biosurfactants useful in the bioremediation methods of the present invention include, but are not limited to; glycolipids such as rhamnolipids (from, for example, Pseudomonas aeruginosa), trehalolipids (from, for example, Rhodococcus eiythropolis), sophorolipids (from, for example, Torulopsis bombicold), and cellobiolipids (from, for example, Ustilago zeae); lipopeptides and lipoproteins such as serrawettin (from, for example, Serratia marcescens), surfactin (from, for example, Bacillus subtilis); subtilisin (from, for example, Bacillus subtilis), gramicidins (from, for example, Bacillus brevis), and polymyxins (from, for example, Bacillus polymyxa); fatty acids, neutral lipids, and phospholipids; polymeric surfactants such as emulsan (from, for example, Acinetobacter calcoaceticus), biodispersan (from, for example, Acinetobacter calcoaceticus), mannan-lipid-protein (from, for example, Candida tropicalis), liposan (from, for example, Candida lypolyticd), protein PA (from, for example, Pseudomonas. aeruginosa); and particulate biosurfactants such as vesicles and fimbriae from, for example, A. calcoaceticus.

Biosensors

Biosensors are analytical devices typically consisting of a biologically active material such as an enzyme and a transducer that converts a biochemical reaction into a quantifiable electronic signal that can be processed, transmitted, and measured. An example of a detection system for the presence of sulfur is provided in Ellman et al. (1961).

Preferably the biosensor detects sulfite produced by the activity of a polypeptide of the invention. Furthermore, it is preferred that the production of sulfite is detected by a colour reaction with 5,5'-dithiobis(2-nitro benzoic acid).

Desulfurization of Fossil Fuels Containing Organic Sulfur Compounds

Organic sulfur compounds are found in fossil fuels, the combustion of which causes serious environmental problems, such as acid rain. Hydrodesulfurization is currently performed at refineries to remove sulfur compounds from fossil fuels. This process is done at high temperatures and pressures by metal catalysis and is effective for removing inorganic sulfur and simple organic sulfur compounds, however, it is difficult to remove polycyclic sulfur compounds.

Enzymes and methods for desulfurizing fossil fuels containing organic sulfur compounds have been previously described (US 5,198,341, US 5,344,778, US 5,356,801, US 5,358,870, US 5,578,478, US 5,804,433, US 5,811,285, US 5,952,208, US 5,985,650, WO 01/70996, US application No. 2003/0032100, and Matsubara et al., 2001). As outlined above, it is envisaged that desulfurization of fossil fuels containing organic sulfur compounds could be achieved by replacing the degrading enzyme referred to in the cited documents with a polypeptide according to the first aspect of the present invention. Similarly, these previously described enzymes may be useful for the degradation of α-endosulfan, β-endosulfan or endosulfan sulfate. EXAMPLES

Example 1 - Enriching soil samples for microorganisms with endosulfan degrading activity

(a) Thin layer chromatography (TLC) assay for endosulfan degradation The following TLC assay was used to monitor the degradation of endosulfan by cultures. Cultures (3 mis) were extracted with equal volumes of ethyl acetate. The organic phase was passed through a 6 cm MgSO₄ column in a Pasteur pipette stoppered with glass wool to remove any residual water, gently evaporated under a dry nitrogen stream, dissolved in acetone and then applied to neutral aluminium oxide F₂₅₄ TLC plates (Alltech, NSW, Australia). The plates were developed in either 4:1 petroleum ether-acetone or 3:1 chloroform-ethyl acetate. The aqueous phase was reduced to dryness by rotary evaporation and the resultant residue extracted with dichloromethane (DCM) to recover any hydrophilic metabolites. The DCM-soluble products were spotted onto TLC plates as above and developed in methanol. Chlorine containing constituents were visualised by spraying plates with silver nitrate-saturated methanol then exposing them to UV light. The lower limit of detection of this method for endosulfan and metabolites containing the hexachlorinated ring structure was 0.1 μg. As detection is based on formation of silver chloride, dechlorinated metabolites will have a detection limit relative to the level of dechlorination.

(b) Isolation of soil bacteria capable of degrading endosulfan

Soil was enriched for endosulfan-degrading organisms by the addition of 2 mg technical-grade endosulfan in 100 μl acetone to approximately 15 grams moistened soil, followed by incubation in the dark at room temperature for 1 month. Several soil samples were enriched: the first contained technical grade endosulfan (70:30 alpha to beta endosulfan) (culture 1) and the second contained endosulfan sulfate (culture 2). The soil used was collected from a cotton field near Narrabri, New South Wales, Australia, at the end of the growing season. The field had generally received several applications of endosulfan in the summer months for at least the previous five years. The soil was fertile grey clay at pH 7.5. Top soil was collected from the first 15cm, air dried and stored at 4°C for up to one month prior to enrichment.

Further enrichment was achieved by initiating shake flask enrichment cultures from these samples using either technical endosulfan (culture 1) or endosulfan sulfate (culture 2) as the only added source of sulfur. Sulfur-free medium (SFM, pH 6.9) contained 0.05% Tween 80, 2.0 g KH₂PO₄, 7.5 g K₂HPO₄, 1.0 g NH4CI, 0.5 g NaCl, 1.0 g glucose, 0.1 g MgCl₂, 0.86 mg -amino benzoic acid, 0.86 mg nicotinic acid and 10 ml of a trace element solution per litre. The stock trace element solution contained 20 mg (NH₄)₆Mo₇O₂₄.4H₂O, 50 mg H₃BO₃, 30 mg ZnCl₂, 3 mg CoCl₂.6H₂O, 10 mg (CH₃COO)₂Cu.H₂O, and 20 mg FeCl₂.6H₂O per litre. Technical grade endosulfan (99% pure) was added to 50 μM. Approximately one gram of endosulfan-enriched soil was inoculated into 50 ml SFM and cultured in a 400ml Erlenmeyer flask on a rotary shaker (200 rpm) at 28°C for up to 14 days. Substrate levels were measured using TLC and when approximately 50% of the endosulfan or endosulfan sulfate had degraded relative to sterile controls, 5 ml of the culture was transferred into 50 ml fresh enrichment medium. After approximately six transfers into enrichment media cultures were transferred into "spent sulfur-free media" (SSFM, see below) for further enrichment.

SSFM was designed because contaminating sulfur in SFM could promote culture growth, resulting in increases in optical density at 595 nm (OD₅₉₅) of the culture from 0.05 to 0.3. A second soil culture was initiated for the sole purpose of preparing medium free of contaminating sulfur. SSFM was prepared by growing a soil culture overnight in SFM without endosulfan then removing cells by centrifugation and filtering the supernatant through a 0.22 μm pore filter. After inoculation of this medium with either the endosulfan-degrading culture, the endosulfan sulfate degrading culture, or Escherichia coli strain TGI no growth was observed until the addition of a source of sulfur. After the addition of either 50 μM sodium sulfite or magnesium sulfate both the endosulfan-degrading culture and E. coli strain TGI culture were able to grow to at least an OD₅₉₅ of 0.8. The sterility of the SSFM was confirmed by the absence of growth when aliquots were incubated on rich media agar plates.

Pure bacterial cultures capable of degrading endosulfan (culture 1) or alpha- endosulfan and endosulfan sulfate (culture 2) were obtained from the mixed cultures after approximately six months successive subculture (approximately 30 rounds with 1% inoculum) followed by three rounds of subculturing using very dilute inocula (1% to 0.001%. late-log phase culture). In each of the latter three rounds, the most dilute inoculum to subsequently exhibit growth also demonstrated endosulfan metabolism and was used as the starting culture for another round of dilution subculturing. The isolate that degraded endosulfan from culture 1 was named strain ESD, and the isolate that degraded <- b -endosulfan and endosulfan sulfate from culture 2 was named strain KW. Example 2 - Characterisation of endosulfan metabolites using gas chromatography (GO and gas chromatography/mass spectrometry (GC/MS)

Broth cultures of strain ESD degraded endosulfan to produce endosulfan hydroxyether and a product with properties predicted of endosulfan monoaldehyde. Broth cultures of strain KW degraded c bα-endosulfan to produce endosulfan monoaldehyde and endosulfan sulfate to produce l,2,3,4,7,7-hexachloro-5,6- bis(methylene)bicyclo[2.2. l]-2-heptene and 1,2,3,4,7, 7-hexachloro-5- hydroxymethylene-6-methylenebicyclo[2.2.1]-2-heptene. GC and GC/MS were used to characterise endosulfan and endosulfan sulfate metabolites. As endosulfan and its chlorine-containing metabolites are strongly electronegative, previous studies have employed electron-capture GC (GC-ECD) for detection of these compounds. However, the inventors have discovered that flame ionisation detection (FID) can replace this if preliminary steps are used to recover the metabolites selectively. In addition, FID enables the use of DCM for clean and efficient solvent extraction. Cultures (15 ml) were extracted with DCM (10 ml) and the organic phase dried with MgSO₄, as described above. The solution of endosulfan and its lipophilic metabolites was diluted with hexane to yield a 20% hexane-DCM solution, which was applied to a 5 cm silica column (DCC silica gel, 63-200, Aldrich) within a Pasteur pipette. The column was flushed with a further 3 ml of 20% hexane-DCM. Control experiments demonstrated that endosulfan hydroxyether and endodiol were the only metabolites retained by the silica under these conditions. With the exception of endosulfan diacetate, insecticide and metabolite standards (at least 99% pure) were purchased from Chem. Services Inc. (PA, USA). The O-benzyl oxime of endosulfan monoaldehyde was prepared by the reaction of the putative aldehyde (recovered by TLC on alumina) with a fivefold excess of benzylhydroxylamine hydrochloride (Alltech, NSW, Australia) in dry pyridine at room temperature for 8 hours. Endosulfan diacetate (50 μg) was added as an internal standard. Endosulfan diacetate was synthesised by peracetylation of endosulfan diol with acetic anhydride in dry pyridine at 80°C for 1 hour and purified by silica chromatography. Endosulfan diacetate was added to the combined eluate and washings, which were then concentrated to 25 μl under a gentle stream of nitrogen before storage at -20°C and subsequent GC analysis using FID.

The more polar metabolites, endosulfan hydroxyether and endodiol, were subsequently eluted from the silica column with 10%o methanol-DCM (8 ml). Endosulfate (40 μg) was added as the internal standard and the recovered solution was evaporated to near dryness under a gentle stream of nitrogen. The residue was taken up in DCM (10 μl) and bis(trimethylsilyl) trifluoroacetamide (BSTFA, 25 μl) was added with initial vortex mixing to silylate the metabolites (6 hours, room temperature) before storage at -20°C and GC analysis.

The addition of the internal standards to the fractions enabled both qualitative assessment of the metabolites from their relative retention times by GC and also quantitative evaluation of the metabolic pathways. Losses from volatilisation and extraction efficiencies ranged from 15-40% (depending on length of time incubated, media composition and compound) and were calculated by comparison with stocks of known concentration. GC was performed using a Varian model 3300 with a cool on- column injector, a flame ionisation detector and a computer with data acquisition and processing software. The capillary column was 5% phenyl methylsilicone (SE54, Alltech Econocap, 30 m x 0.32 mm ID, 0.25 μm film thickness) with a helium flow rate of 2 ml min^"1. The column was preceded by a retention gap of deactivated silica (2 m) to preserve the integrity of the column. A typical temperature program for analysis of the endosulfan metabolites comprised an initial period after injection of 2 min at 40°C, temperature gradient of 20°C min^"1 to 200°C for 10 min, followed by a temperature gradient of 10°C min^"1 to 300°C.

The identities of the known metabolites in the fractions were confirmed by GC/MS using a VG Trio 2000 mass spectrometer interfaced to a Hewlett Packard 5890 gas chromatograph (cool on-column injector), with VG MassLynx software for control and data acquisition. The GC column was 5% phenyl methyl silicone (SE54, Alltech Econocap, 30 m x 0.32 mm ID, 0.5 μm film thickness) with a helium flow rate of 1 ml min^"1. Ionisation modes used for mass spectrometry of the metabolites were either electron ionisation (El, 70 eV) or positive-ion chemical ionisation (PCI, ammonia reagent gas, source pressure 60 Pa). The molecular and fragment ions were generally represented by peak distributions over several masses because their respective chlorine compositions included the additional natural isotope ³⁷C1.

GC analysis identified three metabolites, endosulfan hydroxyether, endosulfate and endodiol, on the basis of coincident retention times on GC and structural confirmation by GC/MS. A single additional metabolite, with mobility on TLC similar to that of endosulfate, was also detected. Mass spectral analysis (70 eV El) of the compound indicated a molecular ion of m/z 342 (³⁵C1₆), isomeric with that of endosulfan ether. The fragmentation pattern was also similar to that obtained with endosulfan ether, except for the absence of a prominent fragment ion of m/z 69 derived from the pentacyclic ether moiety. An analogous ion of m/z 85 was observed in the 70 eV El mass spectrum of endosulfan hydroxyether. Thus the molecular structure of the novel isomer does not include a pentacyclic ether ring. The positive-ion chemical ionisation mass spectrum (PCI(NH₃)) of the novel metabolite displayed the molecular parent ions [M+H]⁺ and [M+NfL] ^" of m/z 341 and m/z 358, respectively, confirming the molecular mass (³⁵C1₆) indicated previously in the El mass spectrum. The preliminary evidence indicated that the molecular structure of the novel isomer was that of endosulfan monoaldehyde. The PCI mass spectrum of the metabolite also displayed fragment ions indicating consecutive losses of two molecules of HC1 from [M+H] ions. Since the most probable site for gas-phase proton attachment in the putative structure would be the carbonyl oxygen atom, the initial HC1 loss may be rationalised as elimination of the reagent proton together with the vicinal bridgehead chlorine atom via a favoured six-centred transition structure. Support for the structure of the novel metabolite is provided by the observation that it forms an O-benzyl oxime derivative. Although the expected molecular ion is absent in its 70eV El mass spectrum, an βVI - CH₃]⁺ ion of m/z 430 is present indicating a relative molecular mass M of 445 (³⁵C1₆) for the derivative and substantiating a monoaldehyde structure for the metabolite.

Example 3 - Identification and characterisation of the endosulfan-degrading bacterium

To determine the identity of strain ESD and strain KW, sequence analysis of the 16S rRNA gene was performed. Genomic DNA was extracted as follows. Cells were grown until turbid in LB supplemented with 0.05% Tween 80, then pelleted and resuspended in 1 ml TE plus 200 μg.ml^"1 proteinase K and 10 mg.ml^"1 lysozyme. After 1 hr incubation at 37°C cells were pelleted and resuspended in 750 μl 4 M guanidine thiocyanate, 25 mM sodium citrate, 0.5% sarkosyl. Glass beads (450-600 microns, Sigma, St Louise, MO) were added and the cells and beads vigorously vortexed for ten minutes. The beads were settled by a brief centrifugal pulse, then the supernatant was removed and extracted with phenol/chloroform twice. The DNA was then precipitated with ethanol, resuspended in TE and stored at -20 °C. The 16S rRNA gene of the endosulfan-degrading bacterium (strain ESD) was amplified from extracted genomic DNA by PCR using bacterial universal primers 27f (5' AGAGTTTGATCMTGGCTCAG 3') (SEQ ID NO: 7) and 1492r (5' TACGGYTACCTTGTTACGACTT 3'), (SEQ ID NO: 8) the names of which are based on the numbering system of the E. coli 16S rRNA gene (Lane, 1991). Approximately 1380 bp of the 16S rRNA gene from strain ESD was obtained and sequence similarities were performed using the FASTA algorithm (Pearson & Lipman, 1988). The 16S rDNA sequence and similar sequences in the GenBank database were aligned using the Pileup program of the Genetics Computer Group (Devereux et al, 1994) and a dendrogram showing the phylogenetic position of strain ESD was generated by the distance neighbour-joining method using PAUP* (Swofford, 1998). Analysis of the 16S rDNA gene sequence of strain ESD revealed it to be within the genus Mycobacterium, most similar (98.3%) to Mycobacterium strain LB501T which was described in a study of bacteria degrading polycyclic hydrocarbons (GenBank accession number AJ245702). A distance neighbour joining tree was constructed based on the comparison of related 16S rDNA sequences available on GenBank, which showed strain ESD clustered with the fast growing Mycobacteria.

Analysis of the 16S rDNA gene sequence of strain KW revealed it to be within the genus Arthrobacter, most similar (98.4%) to Arthrobacter pascens (GenBank accession number APRDNA16).

Example 4 - Cloning the gene responsible for endosulfan-degrading activity

(a) Cloning techniques and DNA preparations.

General cloning techniques, unless otherwise indicated were standard and as described by Sambook et al. (1989). Strain ESD and strain KW genomic DNA was extracted as described above.

(b) Construction ofcosmid library.

A Mycobacterium strain ESD genomic library was constructed in the Mycobacterium/E. coli cosmid shuttle vector, pYUB415 as follows. An Arthrobacter strain KW genomic library was constructed in the same vector in a similar manner. Genomic DNA of was partially digested with Sau3A restriction endonuclease and then separated by gel electorphoresis in a 1% low melting point agarose gel. An agarose gel slice containing DNA fragments of 30 to 45 kb was melted and DNA was in-gel ligated to BamHl digested, calf intestinal alkaline phosphatase treated, pYUB415. After ligation, GELase Agarose Gel-Digesting enzyme preparation (Epicenter Technologies, Madison, WI) was added according to manufactures instructions. The ligated DNA was packaged into lambda using MaxPlax Packaging Extracts and used to infect freshly prepared E. coli strain EP1305 cells according to manufactures instructions (Epicenter Technologies, Madison, WI). E. coli containing pYUB415 were grown in the presence of 100 μg.ml^"1 ampicillan and M smegmatis in 100 μg.ml^"1 hygromycin. (c) Activity screening of cosmid clones and subsequent sub-clones.

Cosmid DNA was isolated from 2 ml cultures of individual library clones using alkaline lysis (Sambrook et al, 1989), purified using the QIAquick system (Qiagen, Victoria, Australia), then electroporated into freshly prepared M. smegmatis (prepared according to Jacobs et al, 1991). Concentrations of 5-500 pg DNA in lμl distilled H₂O were incubated with 50μl prepared cells for 1 min on ice then transferred to a cuvette with a 0.2 cm gap (Bio-Rad, NSW, Australia). This was exposed to one electrical pulse at 2500 V, 25 μF with resistance set at 1000 ohms. Electroporated cells were incubated for 3 hrs in Luria Broth plus 0.05% Tween 80 (LBT) then plated onto LBagar containing 100 μg.ml^"1 hygromycin and incubated at 28 °C for four days. Colonies from each electroporation were then combined, washed with sulfur-free media and used to inoculate SFM containing 100 μg.ml^"1 hygromycin and 50 μM beta- endosulfan. After 7 days at 28 °C and 180 rev. min^"1 the culture was analysed for endosulfan degradation activity by thin layer chromatography. Three hundred and seventy clones from the Mycobacterium strain ESD cosmid library were screened in M. smegmatis from which only one demonstrated endosulfan- degrading activity (Cosmid 172). When this clone was electroporated into E. coli strain TGI cells it did not grow in SFM containing endosulfan, or have detectable endosulfan-degrading activity in MLB containing ampicillan and endosulfan. DNA fragments, generated by various restriction nuclease digests of cosmid 172, were cloned into PNUB415 and screened for endosulfan-degrading activity. Fragments with activity were further subcloned and screened in the same manner until the DΝA fragment containing activity was reduced to a 3.0kb ApaJ DΝA fragment (pYUB415::^ α3). Four hundred clones from the Arthrobacter strain KW cosmid library were screened in M. smegmatis from which only one demonstrated endosulfan-degrading activity (Cosmid 3.1.6).

(d) Dot blot and southern hybridisation screening of strain KW cosmid clones and subsequent sub-clones.

Strain KW cosmid DΝA (approximately lOOng) in TE buffer (pH 8.0) was transferred to nitrocellulose (Νitropure Nitrocellulose Membranes) using a dot blot manifold as follows. The cosmid DNA was denatured with 0.1 vol of 3M NaOH and incubated for lhr at 60°C. This was then cooled and 10 vol of 6 x SSC was added. The nitrocellulose membrane was cut to fit the dot blot manifold as were two pieces of filter paper of the same size. The nitrocellulose membrane was soaked first in distilled water in 6 x SSC, the filter paper was soaked in 6 x SSC also. The manifold was assembled as per manufactures instructions and a low vacuum applied. Wells were washed firstly with 500μl of 6 x SSC and then the samples were applied, also under low vacuum. Each well was rinsed after sample application with a further lOOμl of 6 x SSC. The nitrocellulose membrane was air dried and then immobilized by baking for one hour at 80°C.

Southern hybridisation of the dot blotted cosmid DNA was performed by rinsing the membrane for 1 min with 2 x SSC, then incubating it in pre-hybridisation buffer at 50°C for 2 hrs. The pre-hybridisation buffer consisted of 6 x SSC, 5 x Denhardts solution, 0.1% NaPPi, 25% formamide, 0.5% SDS, lOμg/ml salmon sperm (boiled for 5 minutes and then cooled on ice for 30 sec prior to adding to the solution mix) and distilled water to a total volume of 25ml. The nitrocellulose was then hybridized overnight at 55°C with ³²P labelled e-yc-ONA (prepared as described below).

DNA (esd, lOμg) was boiled for 8 min, cooled on ice for 30 sec, then spun briefly to pellet. Dodeconucleotides, G, C & T nucleotides, α-³²-P-dATP and Klenow were added (Gigaprime DNA labelling kit, Bresatec). The reaction was mixed, incubated at 37°C for lhr, then stopped by adding l.Oμl of 0.5M EDTA. TE (75μl) and 7.5μl of lOmg/ml yeast carrier RNA was added and the mix was extracted with an equal volume of phenol/chloroform. The DNA was then precipitate with ethanol and resuspended in 250μg salmon sperm in 500μl distilled water. The DNA was boiled for 5 min and added to the pre-hybridising filter. After over night hybridisation, the nitrocellulose membrane was washed four times with 75ml 2 x SSC/0.1%SDS for 20min at 50°C then exposed to x-ray film for 1 - 48 hrs.

A single cosmid (3.1.6) was isolated which hybridised to the esd probe. The region of hybridisation was identified by Southern blot analysis. A range of endonucleases (BamJrJJ, NotJ, BglJJ and EcoRI) were used individually to digest 3 μg of the isolated cosmid. The digested cosmid DNA was separated on a 1% agarose gel and the DNA fragments transferred to a nitrocellulose membrane via capillary action. The nitrocellulose membrane was baked at 80°C for 2hrs prior to hybridisation. The protocol used for hybridisation and probe preparation was as described above for the dotblot. A l.lkb EcoRI fragment hybridised to the probe. The EcoRI digest was repeated on the cosmid and the l.lkb fragment was gel purified from a 0.8% agarose gel using the Qiagen gel purification kit. The l.lkb fragment was cloned into pBluescript (Stratagene) to create pBlue: : 1. lEcoRI. pBluescript vector specific primers were used to sequence the fragment and an open reading frame with homology to the ESD gene was observed. Full sequence was obtained by designing primers from the known sequence and using the original cosmid as the template.

Example 5 - Nucleotide sequence analysis and homology to other proteins a) ORFfi'om Mycobacterium strain ESD

DNA sequence analysis of the 3.0 kb ApaJ fragment revealed that there were two ORFs which were transcribed in the same orientation. The deduced amino acid sequence of the two ORFs were compared with sequences of other proteins in the SwissProt and SpTrEMBL database. The first ORF (esd) (SEQ ID NO: 3), encoding a protein of 448 amino acids, had significant homology to several other proteins. The highest identity (50%) was to tdsA, a thermophilic flavomonoxygenase of Paenibacillus sp. All-2 that catalyses the conversion of dibenzothiophene-5-5-dioxide to 2-(2'-hydroxyphenyl) benzene sulphinate (Ishii et al, 2000). ORF1 also had significant homology (46% identity) to dszA (formerly soxA), the tdsA homolog in Rhodococcus strain IGTS8 (Denome et al, 1994), and (38% identity) to component A of a nitrilotriacetate monooxygenase of Chelatobacter heintzii ATCC 29600 (Knobel et al, 1996).

The endosulfan degrading activity of Mycobacterium strain ESD is completely inhibited in the presence in low concentrations of sulfate (20μM). We also observed this repression when the endosulfan-degrading activity was expressed in M. smegmatis under the control of its native promotor. ORF1 was amplified by PCR and cloned behind the mycobacterial heat shock promotor of pMV261. This construct (designated pMV261::e-s-£_) transferred the endosulfan-degrading phenotype to M. smegmatis without the repression by sulfate observed with pYUB415::--4pα3. We were surprised to find beta-esd was a member of a monooxygenase family and that catalysis required reduced flavin. Esd appears to perform successive monooxygenations on bet -endosulfan to produce firstly endosulfan monoaldehyde then endosulfan hydroxyether. Although α-endosulfan and β-endosulfan are diasterioisomers with distinct physical and chemical properties we were also surprised to find that beta-esd is apparently inert towards the α-isomer.

b) ORF from Arthrobacter strain KW

The ORF in cosmid 3.1.6 from Arthrobacter strain KW was amplified by PCR and cloned behind the mycobacterial heat shock promotor of pMV261. This construct (designated pMN261:: /j-?bα-e-s'd) confered the ability to degrade alpha-endosulfan and endosulfan sulfate to M. smegmatis. This ORF was designated alpha-esd. Alpha-esd encoding a protein of 475 amino acids, had significant homology to several other proteins. The highest identity (34.3 %) was to betα-esd from Mycobacterium sp strain ESD. Alpha-esd also had significant homology (33.3 % identity) to dszA (formerly sox A), the tdsA homolog in Rhodococcus strain IGTS8 (Denome et al, 1994), and (33.9% identity) component A of a nitrilotriacetate monooxygenase of Chelatobacter heintzii ATCC 29600 (Knobel et al, 1996).

Example 6 - Construction of expression constructs a) Mycobacterium strain ESD constructs To create a mycobacterial esd expression construct, the esd gene was amplified by PCR from the ApaJ DNA fragment from Mycobacterium sp. ESD containing the Esd gene, using pYUB415::-4p 3 as the template and CCTGCAGTGACCCGACAGCTACACCTC (SEQ ID NO:9) forward and CAAGCTTATTACGCGACCGCGTGCGCCA (SEQ ID NO: 10) reverse oligonucleotide primers (PstJ and HindJJI sites respectively are underlined). PCR was performed using Taq polymerase (Gibco BRL) in the buffer provided by the manufacturer with 1.5 mM MgCl₂. After 5 min at 95 °C, 30 cycles of amplification were performed (94 °C for 15 s, 52.5 °C for 30 s, 72 °C for 70 s) followed by a 5 min extension step at 72 °C. The PCR product was cloned into the pGEM T Easy vector (Promega, Madison, WI) following the manufacturer's instructions to create pGEM'.'.esd. This plasmid was then digested with PstJ and HindJ J and cloned into similarly digested pMV261 (Table 1) to produce pMN261::esd.

To create an E. coli expression construct, the esd gene was amplified by PCR using pYUB415:--4/> 3 as the template and CCATATGACCCGACAGCTACACCTC (SEQ ID NO: 11) forward and CAGATCTATTACGCGACCGCGTGCGCCA (SEQ ID NO: 12) reverse primers (NdeJ and BgUJ sites, respectively, are underlined and the initiation codon is shown in boldface). PCR was performed using Taq polymerase (Life Technologies, Rockville, MD) and buffer provided by the manufacturer with 1.5 mM MgCl₂. After 5 min at 95 °C, 30 cycles of amplification were performed (95 °C for 30 s, 65 °C for 30 s, 72 °C for 30 s) followed by a 5 min extension step at 72 °C. The PCR product was cloned into the pGEM T Easy vector (Promega, Madison, WI) following the manufacturer's instructions to create pGEM::esd2. This plasmid was digested with NdeJ and BgUJ and cloned into NdeJ-BamYJJ digested pET14b (Novagen, Madison, WI) to produce ^JiΥlAbv.esd. b) Arthrobacter strain KW constructs

To create a mycobacterial expression construct the gene, alpha-esd, was amplified by PCR using cosmid 3.1.6 as the template and CGGATCCTATGCCGCAGCCTCTGCATTTC 5' (SEQ ID NO: 13) and GAAGCTTTCAAAGGTTGTGCGCTCTATC 3' (SEQ ID NO: 14) oligonucleotide primers (BαmHI and JHndJJ sites are underlined). PCR was performed using Taq polymerase (Gibco BRL) in the buffer provided by the manufacturer with 0.5mM MgCl₂. After 5 minutes at 94°C, 35 cycles of amplification were performed (94°C for 30s, 52.5°C for 30s, 72°C for 90s) followed by a 7 min extension step at 72 °C. The PCR product was cloned into the pGEM T Easy vector (Promega, Madison, WI) following the manufacture's instructions to create pGEM: alpha-esd. This plasmid was then digested with B mHI and H-τ?<ϋII and cloned into similarly digested pMV 261 to produce pMV26l alpha-esd.

To create an E. coli expression construct the gene, alpha-esd, was amplified by PCR using cosmid 3.1.6 as the template and

GCCATATGCCGCAGCCTCTGCATTTC 5' (SEQ ID NO: 15) and GGGATCCTCAAAGGTTGTGCGCTCTATC 3' (SEQ ID NO:16) oligonucleotide primers (N-fel and BαmHI sites are underlined). PCR was performed using Taq polymerase (Gibco BRL) in the buffer provided by the manufacturer with 0.5mM MgCl₂. After 5 minutes at 94°C, 35 cycles of amplification were performed (94°C for 30s, 52.5°C for 30s, 72°C for 90s) followed by a 7 min extension step at 72 °C. The PCR product was cloned into the pGEM T Easy vector (Promega, Madison, WI) following the manufacture's instructions to create pGEM: :alpha-esd2. This plasmid was then digested with NdeJ and BamJU and cloned into similarly digested pET14b to produce pET l^'4b : alpha-esd.

c) Flavin reductase constructs

Initially we did not detect β-endosulfan degrading activity in cell-free enzyme assays of E. coli expressed Esd (data not shown). It has been shown that activity of DszA of Rhodococcus was enhanced by the presence of either endogenous or heterologous flavin reductase (Matsubara et al, 2001). As sequence analysis suggested that Esd was similar to DszA we isolated and overexpressed a flavin reductase gene fromM smegmatis to supply flavin reductase in Esd enzyme assays.

The flavin reductase gene sequence of Mycobacterium smegmatis was identified using the BLAST program to identify sequences in the unannotated M. smegmatis genome sequence (obtained from The Institute for Genomic Research web site at http://www.tigr.org) homologous to the dszD gene sequence of Rhodococcus erythropolis strain D-l (Accession number AB051429, Matsubara et al, 2001). The sequence extends from position 137818 to position 138306 of the M. smegmatis gnl|TIGR-1772|msmeg-3271 genome sequence fragment http://www.ncbi. nlm.nih.gov:80/cgi-bin/Entrez/framik?db=Genome&gi=5073. An

ORF (MsFR) with 67% identity to the R erythropolis dszD gene was amplified by PCR using M. smegmatis total DNA as the template and the upstream GCCATATGGTCACCGCTGAGCAGTATCGCGCGGCG (SEQ ID NO: 17) and downstream GCGGATCCTCAGGTGAGCGGACGGGTGCCCAGATA (SEQ ID NO: 18) primers (Ndel andEαmHI sites respectively underlined and the initiation codon shown in boldface). PCR was performed using Taq polymerase (Life Technologies, Rockville, MD) and buffer provided by the manufacturer with 1.5mM MgCl₂. After 5 min at 95 °C, 30 cycles of amplification were performed (95 °C for 30 s, 65 °C for 30 s, 72 °C for 30 s) followed by a 5 min extension step at 72 °C. The PCR product was cloned into the pGEM T-Easy vector (Promega, Madison, WI) following the manufacturer's instructions to create pGEM::MsFR. The resultant construct was digested with NdeJ and BamHJ and cloned into pET14b (Νovagen, Madison, WI) similarly digested to produce pET14b:: ---ER.

Example 7 - Expression and purification of recombinant flavin reductase and esd proteins

The flavin reductase and Esd proteins were expressed in E. coli in a similar manner. The plasmid pET14b:: s-ER or pET14b::e---v was electroporated into E. coli BL21 (DE3) cells and grown overnight on LB agar containing ampicillin. A single colony was then used to inoculate LB broth containing ampicillin then grown at 37 °C until an OD600 of 0.6 - 0.8 was reached. This culture was then diluted 50 fold in fresh LB containing ampicillin and incubated at 25 °C overnight. IPTG was added to 0.4 mM and cells were grown a further 2 h. Cells were washed in 50 mM HEPES buffer (pH 6.9), resuspended in the same buffer to give an OD600 of 20 and disrupted by sonication. The sonicated cells were centrifuged at 5000 g for 20 min to remove cell debris, then the membranes were removed by centrifugation at 100,000 g in an ultra centrifuge. The soluble protein was bound and eluted from a His-bind column (Νovagen, Madison WI) according to the manufacturer's instructions. After elution from the column, proteins were dialysed against three changes of 50 mM HEPES buffer, pH 6.9 and the purified proteins stored at -20 °C. Protein expression and purification were confirmed by the presence of an approximately 21 kDa protein for MsFR and 50kDa for Esd by SDS-polyacrylamide gel electrophoresis of the supernatant fraction and by enzyme activity (see below).

Example 8 - Analysis of flavin reductase activity The flavin reductase activity of MsFR was determined by a spectophotometric assay measuring a decrease in absorbance at 340 nm due to the disappearance of NAD(P)H. The assay mixture contained 7 μg MsFR and electron acceptors, in 1 ml final volume 50 mM HEPES buffer. Electron acceptors were included at the following concentrations: 10 - 100 μM FMN; 10 - 100 μM riboflavin; 10 - 100 μM FAD; 50 μM methylene blue; 50 μM tetrahydrobiopterin. The reaction was initiated by the addition of 0.5 mg electron donor (NADH or NADPH) and run for up to 5 minutes at 25 °C. Enzyme activity was defined as the amount of oxidation of NAD(P)H per min at 25 °C (E₃₄₀ = 6220M¹.cm^"1).

The expressed purified MsFR protein utilised FMN and NADH as electron acceptor and donor respectively (Table 2). FMN was a better electron acceptor for MsFR than riboflavin and FAD but both the latter could both support some enzyme activity. Methylene blue and tetrahydrobiopterin were not utilised as electron acceptors and NADPH could not replace NADH as electron donor.

Table 2 - Substrate s ecificit of the flavin reductase rotein MsFR.

Electron acceptors were included at the following concentrations: 10 - 100 μM FMN; 10 - 100 μM riboflavin; 10 - 100 μM FAD; 50 μM methylene blue; 50 μM tetrahydrobiopterin. The reaction was initiated by the addition of 0.5 mg electron donor (NADH or NADPH). Electron donors (5 mg.ml^"1) and acceptors (50 μM) were included in standard enzyme assays and endosulfan degradation was analyzed by thin layer chromatography. The specific activity of MsFR is similar to that found with other flavin reductase enzymes of the TC-FDM family that reduce flavin as a substrate rather than a prosthetic group. The substrate specificity of these enzymes vary, with some members acting on FAD and riboflavin better than FMN some with similar activity with the three flavins and some, like MsFR, with higher activity for FMN. Similarly, some of the flavin reductases utilised NADPH preferably to NADH whilst others were inert towards NADPH and demonstrated activity with NADH.

Example 9 - Endosulfan and endosulfan sulfate degradation in cell free extracts Enzyme assays were performed in large glass test-tubes (2 cm diameter) at 180 rpm and 28 °C. Assays typically contained 20 μg Esd, 12 μg MsFR, 50 μM FMN, 4 mM NADH, and 500 μM the isomers of endosulfan or endosulfan sulfate in 1 ml 50mM HEPES buffer, pH 6.9. Also included was either 7.5 mg BSA, 0.08 % Triton XI 00; orM smegmatis cell extract containing 7.5 mg protein (see below) and 10 mM MgCl₂ to increase the 'apparent' solubility of the insecticide.

The endosulfan-degrading activity was confirmed by the appearance of endosulfan monoaldehyde and/or endosulfan hydroxyether, or the disappearance of endosulfan sulfate, in a reaction mix using the TLC after 4 hr incubation. The activity was quantified by measuring the disappearance of endosulfan or endosulfan sulfate using the GC method described below after 5 min to 3 h incubation.

Non-recombinant M. smegmatis cell extracts were prepared by growing a 400 ml culture of M. smegmatis to stationary phase, harvesting the cells by centrifugation, then washing the cells in 50 ml 50 mM HEPES buffer (pH 6.9) and resuspending the cells in the same buffer. Cells were lysed by sonication and the cell debris removed by centrifugation at 16,000 g for 5 min. The supernatant was stored at -20 °C until required.

The results are provided in Table 3. It should be noted that no degradation was observed in the absence of alpha-Esd or betα-Esd.

Activity of the purified E. coli expressed protein was enhanced when M smegmatis cell extracts were included in the cell free assay mixture, although the products of the reaction remained the same. Endosulfan is very hydrophobic (Kow log p = 4.8; solubility in water = 0.32 mg.L^"1) and partitions rapidly out of the aqueous phase to the glass surface of our reaction vessels when introduced in enzyme assays at concentrations that we require for detection (which are significantly higher than the solubility limit of the insecticide). Detergent, BSA or mycobacterial cell extract was added to the reaction mix to increase the 'apparent' solubility of the insecticide to allow degradative activity to be detected. In the absence of these additions the endosulfan partitioned to the glass surface of the reaction vessel and degradative activity was not detected. Our data suggest that esd activity in our enzyme assays is limited by endosulfan solubility rather than activity of the enzyme.

Table 3 - Activity of E. coli expressed alpha-Esd and betα-Εsd¹.

The concentration of substrate used in these assays is significantly higher than their solubility limit. M. smegmatis cell extract is included in the assay to increase the 'apparent' solubility of the substrate and activity is reduced in the absence of this extract.

2 Activity calculated for 1 mg E. coli crude protein extract. ³ Activity calculated for 1 μM pure protein.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. All publications discussed above are incorporated herein in their entirety.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. REFERENCES:

Casida, J.E. 1993. Insecticide action at the GABA-gated chloride channel: Recognition, progress, and prospects. Arch. Insect Biochem. Physiol. 22:13.

Chaudhuri, K., S. Selvaraj, and A.K. Pal. 1999. Studies on the genotoxicity of endosulfan in bacterial systems. Mut. Res. 439:63-67.

Denome, S.A., Oldfield, C, Nash, L.J. and Young, K.D. 1994. Characterisation of the desulfurization genes from Rhodococcus sp. Strain IGTSG. J. Bacteriol. 176:6707- 6716.

Devereux, J., P. Haeberli, and O. Smithies. 1994. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.

Dorough, H. W., K. Huhtanen, T.C. Marshall, and H. E. Bryant. 1978. Fate of endosulfan in rats and toxicological considerations of apolar metabolites. Pest. Biochem. Physiol. 8:241-252. ^■

Ellman, G.L., K.D. Courtney, V. Andres, R.M. Featherstone. 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7:88-95.

Goebel, H., S. Gorbach, W. Knauf, R. H. Rimpau, and H. Huttenbach. 1982. Properties, effects, residues and analytics of the insecticide endosulfan. Residue Reviews. 83:40-41.

Gordon, R.K., Feaster, S.R., Russell, A.J., LeJeune, K.E., Maxwell, M.D., Lenz, D.E., Ross, M. and Doctor, B.P. 1999. Organophosphate skin decontamination using immobilized enzymes. Chem Biol Interact 14: 463-470.

Harayama, S. 1998. Artificial evolution by DNA shuffling. Trends Biotech. 16; 76-

82.

Ishii Y, Ohshiro, T., Aoi, Y., Suzuki, M. and Izumi, Y. 2000. Identification of the gene encoding a NAD(P)H-flavin oxioreductase coupling with dibenzothiophene (DBT)-desulfurizing enzymes from the DBT-nondesulfurizing bacterium Paenibacillus polymyxa A-l. J. Biosci. Bioeng. 90:220-222.

Jacobs, .R., Kalpana, G.V., Cirillo, J.D., Pascopella, L., Snapper, S.B., Udani, R.A., Jones, ., Barletta, R.G., and Bloom B.R. 1991. Genetic systems for Mycobacteria. Methods in Enzymology 204:537-555.

Knobel, H-R., Egli, T. and van der Meer, J. R. 1996. Cloning and characterisation of the genes encoding nitrilotriacetate monooxygenase of Chelatobacter heintzii ATCC 29600. J. Bacteriol. 178:6123-6132.

Lane, D.J. 1991. 16S/23S rRNA sequencing, pi 15-175. In Ε. Stackebrandt & M. Goodfellow (ed.) Nucleic acid techniques in bacterial systematics. John Wiley & Sons, New York.

LeJuene, K.E., Wild, J.R. and Russell, A.J. 1998. Nerve agents degraded by enzymatic foams. Nature 395: 27-28.

Matsubara, T., Ohshiro. T., Nishina, Y. and Izumi, Y. 2001. Purification, characterization, and overexpression of flavin reductase involved in dibenzothiophene desulfurization by Rhodococcus erythropolis D-l. Appl. Environ. Microbiol. 67:1179- 1184.

Needleman, S.B. and Wunsch, CD. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 48: 443-453.

Paul, V., and E. Balasubramaniam. 1997. Effects of single and repeated administration of endosulfan on behaviour and its interaction with centrally acting drugs in experimental animals: a mini review. Environ. Toxicol. Pharmacol. 3:151-157.

Pearson, W.R. & D.J. Lipman. 1988. Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences USA 85: 2444-2448.

Petrikovics, I., Cheng, T.C., Papahadjopoulos, D., Hong, K, Yin, R., DeFrank, J.J., Jaing, J., Zong, Z.H., McGuinn, W.D., Sylvester, D., Pei, L., Madec, J., Tamulinas, C, Jaszberenyi, J.C., Barcza, T. and Way, J.L. 2000a. Long circulating liposomes encapsulating organophosphorus acid anhydrolase in diisopropylfluorophosphate antagonism. Toxicology Science 57: 16-21.

Petrikovics, I., McGuinn, W.D., Sylvester, D., Yuzapavik, P., Jaing, J., Way, J.L., Papahadjopoulos, D., Hong, K, Yin, R., Cheng, T.C., and DeFrank, J.J. 2000b. In vitro studies on sterically stabilized liposomes (SL) as enzyme carriers in organophosphorus (OP) antagonism. Drug Delivery 7: 83-89.

Sambrook, J.E.F. Fritsch and T. Maniatis. 1989. Molecular cloning - A laboratory Manual. 2^nd Ed. Cold Spring Harbour Laboratory Press, USA.

Singh, S. K., and R. S. Pandey. 1990. Effect of subchronic endosulfan on plasma gonadotropins, testosterone, testicular testosterone and enzymes of androgen biosynthesis. Ind. J. Expt. Biol. 28:953-956.

Sinha, N., R. Narayan, R. Shanker, and D. K. Saxena. 1995. Endosulfan induced biochemical changes in the testis of rats. Vet. Hum. Toxicol. 37:547-549.

Sinha, N., R. Narayan, and D. K. Saxena. 1997. Effect of endosulfan on testis of growing rats. Bull. Environ. Contam. Toxicol. 58:79-86.

Swofford, D.L. 1998. PATJP: phylogenetic analysis using parsimony. Version 4.0D64. Illinois Natural History Survey, Champaign, IL.

Turner, K. O., M. Syvanen, and S. Meizel. 1997. The human acrosome reaction is highly sensitive to inhibition by cyclodiene insecticides. J. Androl. 18:571-575.

Van Woerden, H. F. 1963. Organic Sulfites. Chem. Rev. 63:557-571.

Claims

CLAIMS:

1. A substantially purified polypeptide, the polypeptide comprising a sequence selected from the group consisting of: (i) a sequence provided in SEQ ID NO: 1 ;

(ii) a sequence provided in SEQ ID NO:2; and

(iii) a sequence which is at least 70% identical to (i) or (ii), wherein the polypeptide is capable of degrading a thio compound.

2. The polypeptide of claim 1, wherein the polypeptide is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO:2.

3. The polypeptide of claim 1, wherein the polypeptide is at least 95% identical to SEQ ID NO: 1 or SEQ ID NO:2.

4. The polypeptide according to any one of claims 1 to 3, wherein the polypeptide can be purified from an. Mycobacterium sp or an Arthrobacter sp.

5. The polypeptide according to any one of claims 1 to 4, wherein the thio compound is a cyclic sulfur diester.

6. The polypeptide of claim 5, wherein the cyclic sulfur diester is selected from the group consisting of α-endosulfan, β-endosulfan and endosulfan sulfate.

7. The polypeptide of claim 5, wherein the cyclic sulfur diester is α-endosulfan and the degradation product is endosulfan monoaldehyde.

8. The polypeptide of claim 5, wherein the cyclic sulfur diester is β-endosulfan and the degradation product is endosulfan hydroxyether or endosulfan monoaldehyde.

9. The polypeptide of claim 5, wherein the cyclic sulfur diester is endosulfan sulfate.

10. The polypeptide according to any one of claims 1 to 4, wherein the thio compound is an organic sulfur compound contained in fossil fuel.

11. The polypeptide of claim 10, wherein the organic sulfur compound contained in fossil fuel is benzothiophene, dibenzothiopene or substituted compounds or derivatives thereof.

12. A substantially purified polypeptide, the polypeptide comprising a sequence selected from:

(i) a sequence provided in SEQ ID NO:3; and (ii) a sequence which is at least 70% identical to (i), wherein the polypeptide is capable of reducing flavin.

13. The polypeptide of claim 12, wherein the polypeptide is at least 90% identical to SEQ ID NO:3.

14. The polypeptide of claim 12, wherein the polypeptide is at least 95% identical to SEQ ID NO:3.

15. The polypeptide according to any one of claims 12 to 14, wherein the polypeptide can be purified from an Mycobacterium sp.

16. The polypeptide according to any one of claims 12 to 15, which is capable of reducing flavin mononucleotide (FMN) in the presence of an electron donor.

17. A fusion protein comprising a polypeptide according to any one of claims 1 to 16 fused to at least one other polypeptide sequence.

18. An isolated polynucleotide, the polynucleotide comprising a sequence selected from:

(i) a sequence of nucleotides provided in SEQ ID NO:4; (ii) a sequence of nucleotides provided in SEQ ID NO: 5; (iii) a sequence encoding a polypeptide according to any one of claims 1 to 11;

(iv) a sequence of nucleotides which is at least 70% identical to SEQ ID NO:4 or SEQ ID NO:5; and

(v) a sequence which hybridizes to (i) or (ii) under high stringency conditions.

19. The polynucleotide of claim 18, wherein the polynucleotide encodes a polypeptide capable of degrading a thio compound.

20. An isolated polynucleotide, the polynucleotide comprising a sequence selected from:

(i) a sequence of nucleotides provided in SEQ ID NO: 6; (ii) a sequence encoding a polypeptide according to any one of claims 12 to 16;

(iii) a sequence of nucleotides which is at least 70% identical to SEQ ID NO: 6; and

(iv) a sequence which hybridizes to (i) under high stringency conditions.

21. The polynucleotide of claim 20, wherein the polynucleotide encodes a flavin reductase.

22. A polynucleotide encoding a fusion protein according to claim 17.

23. A vector comprising a polynucleotide of claim 18 or claim 19.

24. A vector comprising a polynucleotide of claim 20 or claim 21.

25. A vector comprising a polynucleotide of claim 22.

26. The vector according to any one of claims 23 to 26 which is a viral vector.

27. The vector according to any one of claims 23 to 26 which is a plasmid vector.

28. A host cell comprising a vector according to claim 23.

29. A host cell comprising a vector according to claim 24.

30. A host cell comprising a vector according to claim 25.

31. The host cell according to any one of claims 28 to 30, wherein the host is a bacterial cell selected from the group consisting of: E. coli K12, E. coli B, Bacillus subtilis, B. licheniformis, Pseudomanas putida strain KT 2440, Streptomyces coelicolor, S. lividans, S. parvulus, S. griseus, Mycobacterium smegmatis and Brevibacillus sp..

32. A process for preparing a polypeptide according to any one of claims 1 to 11, the process comprising cultivating a host cell according to claim 28 under conditions which allows expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.

33. A polypeptide produced according to the method of claim 32.

34. A process for preparing a polypeptide according to any one of claims 12 to 16, the process comprising cultivating a host cell according to claim 29 under conditions which allows expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.

35. A polypeptide produced according to the method of claim 34.

36. A composition for degrading a thio compound, the composition comprising a polypeptide according to any one of claims 1 to 11, and one or more acceptable carriers.

37. The composition of claim 36, which further comprises a flavin reductase.

38. The composition of claim 37, wherein the flavin reductase is a polypeptide according to any one of claims 12 to 16.

39. A composition for degrading a thio compound, the composition comprising a host cell of claim 28, and one or more acceptable carriers.

40. A method for degrading a thio compound in a sample, the method comprising contacting the thio compound with a polypeptide according to any one of claims 1 to 11.

41. The method of claim 40 which further comprises means for supplying an electron.

42. The method of claim 41, wherein the means for supplying an electron comprises an electron donor, an electron acceptor, and an enzyme.

43. The method of claim 42, wherein the electron donor is NADH or NADPH.

44. The method of claim 42 or claim 43, wherein the electron acceptor is selected from the group consisting of: FMN, riboflavin and FAD.

45. The method according to any one of claims 42 to 44, wherein the enzyme is a flavin reductase.

46. The method of claim 45, wherein the flavin reductase is a polypeptide according to any one of claims 12 to 16.

47. The method according to any one of claims 40 to 46, which is performed in the presence of oxygen.

48. The method according to any one of claims 40 to 47, wherein the sample is selected from the group consisting of: soil, water or biological material.

49. The method according to any one of claims 40 to 48, which further comprises exposing the sample to a factor which enhances the availability of the thio compound to the polypeptide of any one of claims 1 to 11.

50. The method of claim 49, wherein the factor is selected from the group consisting of detergents, bovine serum albumin, a bacterial cell wall extract, and surfactants.

51. The method of claim 50, wherein the bacterial cell wall extract is obtained from a Mycobacterium sp.

52. The method of claim 50, wherein the surfactant is a biosurfactant.

53. The method according to any one of claims 40 to 52, wherein the polypeptide is produced by a host cell of claim 28.

54. A transgenic plant which produces a polypeptide according to any one of claims 1 to 11.

55. The transgenic plant of claim 54 which further produces a flavin reductase.

56. The transgenic plant of claim 55, wherein the flavin reductase is a polypeptide according to any one of claims 12 to 16.

57. The transgenic plant according to any one of claims 54 to 56, wherein the polypeptide is at least produced in the roots of the transgenic plant.

58. A method for degrading a thio compound in a sample, the method comprising exposing the sample to a transgenic plant according to any one of claims 54 to 57.

59. The method of claim 58, wherein the sample is soil.

60. An isolated strain of Mycobacterium sp deposited under accession number NM02/29426 on 6 June 2002 at Australian Government Analytical Laboratories.

61. An isolated strain of Arthrobacter sp deposited under NM02/29427 on 6 June 2002 at Australian Government Analytical Laboratories.

62. A composition for degrading a thio compound, the composition comprising the strain of claim 60 or claim 61, and one or more acceptable carriers.

63. A method for degrading a thio compound in a sample, the method comprising exposing the sample to the strain of claim 60 or claim 61.

64. An isolated bacterium which produces a polypeptide according to any one of claims 1 to 11.

65. The bacterium of claim 64 which is an Mycobacterium sp or an Arthrobacter sp.

66. Use of an isolated naturally occurring bacterium which produces a polypeptide according to any one of claims 1 to 11 for degrading a thio compound in a sample.

67. A polymeric sponge or foam for degrading a thio compound, the foam or sponge comprising a polypeptide according to any one of claims 1 to 11 immobilized on a polymeric porous support.

68. The polymeric sponge of claim 67 which further comprises a flavin reductase.

69. The polymeric sponge of claim 68, wherein the polymeric flavin reductase is a polypeptide according to any one of claims 12 to 16.

70. The polymeric sponge according to any one of claims 67 to 69, wherein the porous support further comprises polyurethane.

71. The polymeric sponge according to any one of claims 67 to 70, wherein the sponge or foam further comprises carbon embedded or integrated on or in the porous support.

72. A method for degrading a thio compound in a sample, the method comprising exposing the sample to a sponge or foam according to any one of claims 67 to 71.

73. A biosensor for detecting the presence of a thio compound, the biosensor comprising a polypeptide according to any one of claims 1 to 11, and a means for detecting degradation of the thio compound by the polypeptide.

74. The biosensor of claim 73, wherein the biosensor detects sulfite produced by the activity of the polypeptide.

75. The biosensor of claim 74, wherein the production of sulfite is detected by a colour reaction with 5,5'-dithiobis(2-nitro benzoic acid).

76. A method for screening for a microorganism capable of degrading a thio compound, the method comprising culturing a candidate microorganism in the presence of a thio compound as the sole sulfur source, and determining whether the microorganism is capable of growth and/or division.

77. The method of claim 76, wherein the thio compound is selected from the group consisting of α-endosulfan, β-endosulfan and endosulfan sulfate.

78. A microorganism isolated according to a method of claim 76 or claim 77.

79. A method of desulfurizing fossil fuel containing organic sulfur compounds, the method comprising the steps of: a) contacting the fossil fuel with an aqueous phase containing a polypeptide according to any one of claims 1 to 11 to produce a fossil fuel and aqueous phase mixture, b) maintaining the mixture of step a) under conditions sufficient for activity of the polypeptide, resulting in a fossil fuel having a reduced organic sulfur content; and c) separating the fossil fuel having reduced sulfur content from the resulting aqueous phase.

80. The method of claim 79, wherein the fossil fuel and aqueous phase mixture further comprises an electron donor.

81. The method of claim 79 or claim 80, wherein the fossil fuel and aqueous phase mixture further comprises a flavin reductase.

82. The method of claim 81, wherein the flavin reductase is a polypeptide according to any one of claims 12 to 16.

83. A method of producing a polypeptide with enhanced ability to degrade a thio compound or altered substrate specificity for a thio compound, the method comprising

(i) altering one or more amino acids of a first polypeptide according to any one of claims 1 to 11,

(ii) determining the ability of the altered polypeptide obtained from step (i) to degrade a thio compound, and

(iii) selecting an altered polypeptide with enhanced ability to degrade a thio compound or altered substrate specificity for a thio compound, when compared to the first polypeptide.

84. A polypeptide produced by the method according to claim 83.

85. A kit for degrading a thio compound, the kit comprising a polypeptide according any one of claims 1 to 11 and a flavin reductase.

86. The kit of claim 85, wherein the flavin reductase is a polypeptide according to any one of claims 12 to 16.

87. A kit for degrading a thio compound, the kit comprising a polynucleotide according to claim 18 or claim 19, and means for transcribing and translating the polynucleotide.

88. A method for degrading endosulfan in a sample, the method comprising contacting the sample with a polypeptide comprising a sequence selected from the group consisting of:

(i) a sequence provided in SEQ ID NO: 19; (ii) a sequence provided in SEQ ID NO: 20;

89. A transgenic plant which produces a polypeptide comprising a sequence selected from the group consisting of:

(i) a sequence provided in SEQ ID NO: 19;

(ii) a sequence provided in SEQ ID NO:20; (iii) a sequence provided in SEQ ID NO:21; and

90. A method for degrading endosulfan in a sample, the method comprising exposing the sample to a transgenic plant according to claim 79.

91. A method for degrading endosulfan in a sample, the method comprising exposing the sample to a microorganism encoding a polypeptide comprising a sequence selected from the group consisting of:

(i) a sequence provided in SEQ ID NO: 19; (ii) a sequence provided in SEQ ID NO:20; (iii) a sequence provided in SEQ ID NO:21; and (iv) a sequence which is at least 70% identical to any one of (i) to (iii), wherein the endosulfan is selected from the group consisting of α-endosulfan, β- endosulfan and endosulfan sulfate.