REGULATION OF HUMAN ADENYLATE CYCLASE, TYPE II
TECHNICAL FIELD OF THE INVENTION
The invention relates to human adenylate cyclase type II (hAC2) and its regulation for therapeutic uses.
BACKGROUND OF THE INVENTION
Cyclases play important roles in the transduction of extracellular signals via their synthesis of "secondary messengers" such as adenosine 3', 5 '-cyclic phosphate (cyclic adenosine monophosphate, cAMP) and guanosine 3', 5 '-cyclic phosphate (cyclic guanosine monophosphate, cGMP). Cell surface receptors mediate the transduction of an extracellular signal, such as the binding of a ligand to a receptor, into a signal that is transmitted internally within the cell. The internal signal is carried by secondary messengers, which typically are produced in response to the binding of an external signal. The secondary messengers in turn activate particular proteins and other regulators within the cell which have the potential to regulate expression of specific genes or to alter a metabolic process.
Cyclic AMP and cGMP play important roles in the regulation of a multitude of cellular activities. For example, cAMP responds to cellular signals through a specific protein kinase (cAMP-dependent protein kinase or protein kinase A) to phosphorylate target molecules, e.g., other protein kinases or proteins involved in transport or cellular morphology. Through stimulation of the kinase, intracellular cAMP mediates many of the effects of hormones in the regulation of cellular metabolism and cell growth. Cyclic GMP also acts as an intracellular messenger, for example, by activating cGMP-dependent kinases and regulating cGMP sensitive ion channels. The role of cGMP as a secondary messenger has been well established in vascular smooth muscle relaxation and retinal phototransduction.
Adenylate Cyclase
The synthesis of cAMP from adenosine triphosphate (ATP) is catalyzed by adenylate cyclase (also referred to as adenylyl cyclase and adenyl cyclase). In mammalian cells, adenylate cyclase is usually an integral membrane protein. Adenylate cyclase activity may be affected by a factor/receptor binding event transmitted through an associated G protein. Interaction of several different external factors with their distinct receptors causes alterations in cAMP intracellular concentration (Broach et al., U.S. Patent 6,001,553). Different receptors are associated with their own particular G-protein intermediary, which itself is associated with adenylate cyclase.
At least nine distinct isoenzymes of mammalian adenylate cyclase have been identified and are designated as adenylate cyclases types 1-9 (Antoni et al., U.S. Patent 6,090,612). These adenylate cyclases have a general structure consisting of 12 transmembrane helices and two cytoplasmic, catalytic domains (Hurley, 1998, Curr.
Opin. Struct. Biol. 8:770-77). Some of these enzymes have been analyzed functionally and appear to confer unique signal processing capacities to cells (Taussig et al, 1995, J. Biol. Chem. 270:1-4).
Although the nine adenylyl cyclases share common sequences and functional similarities (e.g., all can be activated by the Gsα proteins), each is under very distinct regulatory mechanisms and expressed in a tissue-specific manner (1-5). Thus, AC3, AC5 and AC6 have been shown to be sensitive to inhibition by Gi protein, AC2, but not AC3 or AC6 can be stimulated by Gβγ subunits. In addition to the direct interaction with subunits of membrane-anchored G proteins, adenylyl cyclases also respond indirectly as a consequence of stimuli-induced alteration of intracellular ionic composition and kinase activity, or both. AC1, AC3 and AC8 are stimulated by Ca2+/calmodulin. AC5 and AC6 are inhibited by low levels of Ca2+. AC2 and AC7 are stimulated by activation of protein kinase C, while Gs-stimulated but not basal activity of AC7 is inhibited by protein kinase C. AC1, AC3, and AC8 with significant expression in the central nervous system, but not other isoforms,
demonstrate robust stimulation by Ca2/CaM. AC5 and AC6 are expressed dominantly in the heart.
Diversity in activation mechanism, and differences in distribution of adenylyl cyclase isoforms, may contribute to tissue specific regulation of cAMP level. The distinct features in structure and biochemical properties strongly suggest that isoform specific modulators can be discovered and are effective in a tissue- and pathology-specific manner.
The nucleotide sequence and the amino acid sequence of human adenylate cyclase II are available (GenBank ACCESSION # AB028983), but the characteristics of adenylate cyclase type II has not been studied in detail yet.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide reagents and methods for regulating adenylate cyclase type II. This and other objectives of the invention are provided by one of the embodiments described below.
One embodiment of the invention is a method of screening for agents which can regulate the activity of adenylate cyclase type II. A test compound is contacted with a polypeptide comprising an amino acid sequence which is at least about 70% identical to the amino acid sequence shown in SEQ ID NO: 2. Binding of the test compound to the polypeptide is detected. A test compound which binds to the polypeptide is thereby identified as a potential therapeutic agent for regulating the activity of adenylate cyclase type II.
Another embodiment of the invention is a method of screening for agents which regulate the activity of adenylate cyclase type II. A test compound is contacted with a polynucleotide encoding a adenylate cyclase polypeptide, wherein the polynucleo-
tide comprises a nucleotide sequence which are at least about 70% identical to the nucleotide sequence shown in SEQ NO:l .
Another embodiment of the invention is a method of screening for agents which regulate a biological activity mediated by a adenylate cyclase type II. A test compound is contacted with a polypeptide comprising an amino acid sequence which is at least about 70% identical to the amino acid sequence shown in SEQ ID NO: 2. A biological activity mediated by the polypeptide is detected.. A test compound which increases the biological activity is thereby identified as a potential therapeutic agent for increasing the biological activity of the human adenylate cyclase type II.
Yet another embodiment of the invention is a method of screening for agents which regulate an activity of a human adenylate cyclase type II. A test compound is contacted with a product encoded by a polynucleotide which comprises a nucleotide sequence which is at least 70% identical to the nucleotide sequence shown in SEQ ID
NO: 1. Binding of the test compound to the product is detected. A test compound which binds to the product is thereby identified as a potential therapeutic agent for regulating the activity of the human adenylate cyclase type II.
Even another embodiment of the invention is a method of regulating activity of a human adenylate cyclase type II. A cell is contacted with a reagent which specifically binds to a product encoded by a polynucleotide comprising a nucleotide sequence which is at least 70% identical to the nucleotide sequence shown in SEQ ID NO: 1. The activity of the human is adenylate cyclase type II thereby reduced.
Even another embodiment of the invention is a pharmaceutical composition comprising a reagent which specifically binds to a product encoded by a polynucleotide comprising a nucleotide sequence which is at least 70% identical to the nucleotide sequence shown in SEQ ID NO: 1 and a pharmaceutically acceptable carrier.
Another embodiment of the invention is the use of a reagent which specifically binds to a product encoded by a polynucleotide comprising a nucleotide sequence which is at least about 70% identical to the nucleotide sequence shown in SEQ ID NO: 1 in the preparation of a medicament for the treatment of diseases that are caused by aberrant activity of this enzyme and diseases whose symptoms can be ameliorated by stimulating or inhibiting the activity of type II adenylyl cyclase. Such diseases include urinary disorders such as urinary incontinence and benign prostatic hyperplasia including prostate enlargement, bladder outlet obstruction and lower urinary tract symptoms, among others.
Thus, the invention provides a human adenylate cyclase type II, which can be regulated to provide therapeutic effects.
BRIEF DESCRIPTION OF THE DRAWING
Fig. 1 shows the expression profiles of hAC isoforms in various tissues. Fig. 2 shows the expression profiles of hAC 2 in various tissues.
DETAILED DESCRIPTION OF THE INVENTION
It is a discovery of the present invention that human adenylate cyclase type II (AC2) can be regulated to control diseases that are caused by aberrant activity of this enzyme and diseases whose symptoms can be ameliorated by stimulating or inhibiting the activity of type II adenylyl cyclase.
The function of the lower urinary tract, to store and periodically release urine, is dependent on the acitivty of smooth and striated muscles in the urinary bladder, urethra and external urethral sphincter. In benign prostatic hyperplasia (BPH), the main symptoms includes urinary frequency, nocturia and a slow urinary stream, which is related to increased tone of prostate smooth muscle and urethral obstruction.
Therefore, modulation of smooth muscle contraction in urological tissues is thought to provide therapeutic significance in urinary disorders.
Cyclic AMP increasing agents, forskolin (adenylyl cyclase activator) and rolypram (PDE4 inhibitor), exerted the relaxing effect on human prostate and urethra (Kuhn R et al. Urol Res (2000) 28:110-5, Uckert S et al. J. Urol (2001) 166:2484-90). This indicates that cAMP play an important role in prostatic and urethral smooth muscle relaxation.
Further, the endogenous substance lysophosphatidic acid (LPA) has been found to generate proliferation of cultured smooth muscle cells from BPH patients. Folskoline and papaverine (non-selective PDE inhibitor) inhibited LPA-promoted smooth muscle cell growth (Adolfsson PI et al. Prostate (2002) 51:50-8). This indicates that cAMP regulates smooth muscle proliferation.
Present inventors' findings that the expression of AC1 and AC2 is dominant in human prostate, and AC2 in human urethra supports the idea that AC2 may act as a central enzyme for the regulation of cAMP production to modulates smooth muscle tone in human prostate and urethra and prostatic smooth muscle cell proliferation.
Therefore, the modulation of AC2 may be useful approach to provide an effective and selective therapy on urinary disorders such as urinary incontinence and benign prostatic hyperplasia including prostate enlargement, bladder outlet obstruction and lower urinary tract symptoms
Polypeptides
Human adenylate cyclase polypeptides according to the invention comprise at least 6,
10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 887 contiguous amino acids selected from SEQ ID
NO:2 or at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350,
400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, or 1086 contiguous amino acids selected from SEQ ID NO:2 or a biologically active variant thereof, as defined below. An adenylate cyclase polypeptide of the invention therefore can be a portion of an adenylate cyclase protein, a full-length adenylate cyclase protein, or a fusion protein comprising all or a portion of a adenylate cyclase protein.
Biologically Active Variants
Human adenylate cyclase polypeptide variants which are biologically active, e.g., retain an adenylate cyclase activity, also are adenylate cyclase polypeptides. Preferably, naturally or non-naturally occurring adenylate cyclase polypeptide variants have amino acid sequences which are at least about 95, 96, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO:2 or a fragment thereof. Percent identity between a putative adenylate cyclase polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of
Henikoff & Henikoff, 1992.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 85:2444(1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2) and a test sequence that have either the highest density of identities (if the ktup
variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to foπn an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the
Needleman-Wunsch-Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:787 (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical j-roperties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a adenylate cyclase polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
Whether an amino acid change results in a biologically active adenylate cyclase polypeptide can readily be determined by assaying for adenylate cyclase activity, as described for example, in U.S. Patent 5,795,756.
Fusion Proteins
Fusion proteins are useful for generating antibodies against adenylate cyclase polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a adenylate cyclase polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A adenylate cyclase polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 887 contiguous amino acids selected from SEQ ID NO:2 or at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, or 1086
variant, such as those described above. The first polypeptide segment also can comprise full-length adenylate cyclase protein.
The second polypeptide segment can be a full-length protein or a protein fragment.
Proteins commonly used in fusion protein construction include β-galactosidase, β-
glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-
G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the adenylate cyclase polypeptide-encoding sequence and the heterologous protein sequence, so that the adenylate cyclase polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from the complement of SEQ ID NO:l,
3, 5, or 6 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
Many kits for constructing fusion proteins are available from companies such as
Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH
(Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL
International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
Identification of Species Homologs
Species homologs of human adenylate cyclase polypeptide can be obtained using adenylate cyclase polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such
- l i ¬
as mice, monkeys, or yeast, identifying cDNAs which encode homologs of adenylate cyclase polypeptide, and expressing the cDNAs as is known in the art.
Polynucleotides
A adenylate cyclase polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a adenylate cyclase polypeptide. Coding sequences for human adenylate cyclase are shown in SEQ ID NO:l.
Degenerate nucleotide sequences encoding human adenylate cyclase polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:l or its complements also are adenylate cyclase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homo- logs, and variants of adenylate cyclase polynucleotides which encode biologically active adenylate cyclase polypeptides also are adenylate cyclase polynucleotides.
Polynucleotide fragments comprising 8, 10, 12, 15, 18, 20, 25, 50, 75, 100, 200, 300, 400, or 500 contiguous nucleotides selected from SEQ ID NO:l or its complements also are adenylate cyclase polynucleotides.
Identification of Polynucleotide Variants and Homologs
Variants and homologs of the adenylate cyclase polynucleotides described above also are adenylate cyclase polynucleotides. Typically, homologous adenylate cyclase polynucleotide sequences can be identified by hybridization of candidate poly- nucleotides to known adenylate cyclase polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions-2X SSC
(0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50 °C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each—homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably
5-15% basepair mismatches.
Species homologs of the adenylate cyclase polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of adenylate cyclase polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973). Variants of human adenylate cyclase polynucleotides or adenylate cyclase polynucleotides of other species can therefore be identified by hybridizing a putative homologous adenylate cyclase polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to adenylate cyclase polynucleotides or their complements following stringent hybridization and/or wash conditions also are adenylate cyclase polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a adenylate
cyclase polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5 °C - 16.6(logιo[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600//), where / = the length of the hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C. Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C.
Preparation of Polynucleotides
A adenylate cyclase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated adenylate cyclase polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprises adenylate cyclase nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
Human adenylate cyclase cDNA molecules can be made with standard molecular biology techniques, using adenylate cyclase mRNA as a template. Human adenylate cyclase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989).
An amplification technique, such as PCR, can be used to obtain additional copies of
polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesizes adenylate cyclase polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a adenylate cyclase polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof.
Extending Polynucleotides
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2,
318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al., Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer
Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al., Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
Obtaining Polypeptides
Human adenylate cyclase polypeptides can be obtained, for example, by purification from human cells, by expression of adenylate cyclase polynucleotides, or by direct chemical synthesis.
Protein Purification
Human adenylate cyclase polypeptides can be purified from any cell which expresses the enzyme, including host cells which have been transfected with adenylate cyclase expression constructs. A purified adenylate cyclase polypeptide is separated from other compounds which normally associate with the adenylate cyclase polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromato- graphy, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. A preparation of purified adenylate cyclase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
Expression of Polynucleotides
To express a adenylate cyclase polynucleotide, the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding adenylate cyclase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et
al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a adenylate cyclase polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those non-translated regions of the vector ~ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life
Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and sfor&ge protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a adenylate cyclase polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
Bacterial and Yeast Expression Systems
In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the adenylate cyclase polypeptide. For example, when a large quantity of a adenylate cyclase polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the adenylate cyclase polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al., Methods Enzymol. 153, 516-544, 1987.
Plant and Insect Expression Systems
If plant expression vectors are used, the expression of sequences encoding adenylate cyclase polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMN (Takamatsu, EMBO J. 6,
307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al., EMBO J. 3, 1671-1680, 1984; Broglie et al., Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
An insect system also can be used to express a adenylate cyclase polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPN) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding adenylate cyclase polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of adenylate cyclase polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which adenylate cyclase polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
Mammalian Expression Systems
A number of viral-based expression systems can be used to express adenylate cyclase polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding adenylate cyclase polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a adenylate cyclase polypeptide in infected host cells (Logan & Shenk, Proc. Natl.
Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the
Rous sarcoma virus (RSN) enhancer, can be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DΝA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding adenylate cyclase polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a adenylate cyclase polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals
(including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert.
Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Schaxf et al., Results Probl. Cell Differ. 20, 125-162, 1994).
Host Cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed adenylate cyclase polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
Different host cells which have specific cellular machinery and characteristic
mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, NA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express adenylate cyclase polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced adenylate cyclase sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al., Cell 22, 817-23, 1980) genes which can be employed in tk~ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J. Mol. Biol. 150,
1-14, 1981), and als and at confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its
substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
Detecting Expression
Although the presence of marker gene expression suggests that the adenylate cyclase polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a adenylate cyclase polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a adenylate cyclase polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a adenylate cyclase polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the adenylate cyclase polynucleotide.
Alternatively, host cells which contain a adenylate cyclase polynucleotide and which express a adenylate cyclase polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a adenylate cyclase polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a adenylate cyclase polypeptide.
Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a adenylate cyclase polypeptide to detect transformants which contain a adenylate cyclase polynucleotide.
A variety of protocols for detecting and measuring the expression of a adenylate cyclase polypeptide, using either polyclonal or monoclonal antibodies specific for the
polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a adenylate cyclase polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et -./., SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al., J. Exp. Med. 158, 1211-1216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding adenylate cyclase polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a adenylate cyclase polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical).
Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and Purification of Polypeptides
Host cells transformed with nucleotide sequences encoding a adenylate cyclase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing
polynucleotides which encode adenylate cyclase polypeptides can be designed to contain signal sequences which direct secretion of soluble adenylate cyclase polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound adenylate cyclase polypeptide.
As discussed above, other constructions can be used to join a sequence encoding a adenylate cyclase polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein
A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the adenylate cyclase polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a adenylate cyclase polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al., Prot. Exp. Purif 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the adenylate cyclase polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al., DNA Cell Biol. 12, 441-453, 1993.
Chemical Synthesis
Sequences encoding a adenylate cyclase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a adenylate cyclase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by
direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of adenylate cyclase polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND
MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic adenylate cyclase polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the adenylate cyclase polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
Production of Altered Polypeptides
As will be understood by those of skill in the art, it may be advantageous to produce adenylate cyclase polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular pro- karyotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter adenylate cyclase polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA
shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic ohgonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a adenylate cyclase polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a adenylate cyclase polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a adenylate cyclase polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
Typically, an antibody which specifically binds to a adenylate cyclase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to adenylate cyclase polypeptides do not detect
other proteins in immunochemical assays and can immunoprecipitate a adenylate cyclase polypeptide from solution.
Human adenylate cyclase polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
If desired, a adenylate cyclase polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances
(e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.
Monoclonal antibodies which specifically bind to a adenylate cyclase polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497, 1985; Kozbor et al., J Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80,
2026-2030, 1983; Cole etal, Mol. Cell Biol. 62, 109-120, 1984).
In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al,
Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent
antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies which specifically bind to a adenylate cyclase polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to adenylate cyclase polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 55, 11120-23, 1991).
Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J Biol. Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81- 91).
Antibodies which specifically bind to adenylate cyclase polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO
94/13804, also can be prepared.
Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a adenylate cyclase polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
Antisense Oligonucleotides
Antisense ohgonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of adenylate cyclase gene products in the cell.
Antisense ohgonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Ohgonucleotides can be synthesized manually or by an auto-
mated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
Modifications of adenylate cyclase gene expression can be obtained by designing antisense ohgonucleotides which will form duplexes to the control, 5', or regulatory regions of the adenylate cyclase gene. Ohgonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC
APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a adenylate cyclase polynucleotide. Antisense ohgonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a adenylate cyclase polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent adenylate cyclase nucleotides, can provide sufficient targeting specificity for adenylate cyclase mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the
calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular adenylate cyclase polynucleotide sequence.
Antisense ohgonucleotides can be modified without affecting their ability to hybridize to a adenylate cyclase polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3',
5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified ohgonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542,
1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a adenylate cyclase polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the adenylate cyclase polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
Specific ribozyme cleavage sites within a adenylate cyclase RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate adenylate cyclase RNA targets also can be evaluated by testing accessibility to hybridization with complementary ohgonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be-=used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease adenylate cyclase expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements,
such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
Differentially Expressed Genes
Described herein are methods for the identification of genes whose products interact with human adenylate cyclase. Such genes may represent genes which are differentially expressed in disorders including, but not limited to, urinary disorders such as urinary incontinence and benign prostatic hyperplasia including prostate enlargement, bladder outlet obstruction and lower urinary tract symptoms.
Further, such genes may represent genes which are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human adenylate cyclase gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
Identification of Differentially Expressed Genes
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects.
Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed.„ CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc.
Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human adenylate cyclase. For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human adenylate cyclase. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human adenylate cyclase gene or gene product are up-regulated or down-regulated.
Screening Methods
The invention provides assays for screening test compounds which bind to or modulate the activity of a adenylate cyclase polypeptide or a adenylate cyclase poly- nucleotide. A test compound preferably binds to a adenylate cyclase polypeptide or polynucleotide. More preferably, a test compound decreases or increases adenylate cyclase activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100%) relative to the absence of the test compound.
Test Compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et /., J Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J.
Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution
(see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl. Acad. Sci. 97, 6378-6382,
1990; Felici, J. Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).
High Throughput Screening
Test compounds can be screened for the ability to bind to adenylate cyclase polypeptides or polynucleotides or to affect adenylate cyclase activity or adenylate cyclase gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for
Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at
the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al., Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding Assays
For binding assays, the test compound is preferably a small molecule which binds to and occupies, for example, the active site of the adenylate cyclase polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the adenylate cyclase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the adenylate cyclase polypeptide can then be accomplished, for example, by direct counting of
radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a adenylate cyclase polypeptide can be determined without labeling either of the interactants. For example, a microphysio- meter can be used to detect binding of a test compound with a adenylate cyclase polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a adenylate cyclase polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
Determining the ability of a test compound to bind to a adenylate cyclase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345,
1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a adenylate cyclase polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the adenylate cyclase polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay
utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a adenylate cyclase polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g. , GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the adenylate cyclase polypeptide.
It may be desirable to immobilize either the adenylate cyclase polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the adenylate cyclase polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a adenylate cyclase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the adenylate cyclase polypeptide is a fusion protein comprising a domain that allows the adenylate cyclase polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed adenylate cyclase polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above.
Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a adenylate cyclase polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated adenylate cyclase polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a adenylate cyclase polypeptide, polynucleotide, or a test compound, but which do not interfere-wife a desired binding site, such as the active site of the adenylate cyclase polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the adenylate cyclase polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the adenylate cyclase polypeptide, and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a adenylate cyclase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a adenylate cyclase polypeptide or polynucleotide can be used in a cell-based assay system. A adenylate cyclase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a adenylate cyclase polypeptide or polynucleotide is determined as described above.
Enzyme Assays
Test compounds can be tested for the ability to increase or decrease the adenylate cyclase activity of a human adenylate cyclase polypeptide. Adenylate cyclase activity can be measured, for example, as described in U.S. Patent 5,795,756.
Enzyme assays can be carried out after contacting either a purified adenylate cyclase polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound which decreases enzyme activity of a adenylate cyclase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing adenylate cyclase activity.
A test compound which increases enzyme activity of a human adenylate cyclase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%o is identified as a potential therapeutic agent for increasing human adenylate cyclase activity.
Gene Expression
In another embodiment, test compounds which increase or decrease adenylate cyclase gene expression are identified. A adenylate cyclase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the adenylate cyclase polynucleotide is determined. The level of
expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
The level of adenylate cyclase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a adenylate cyclase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a adenylate cyclase polypeptide.
Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses a adenylate cyclase polynucleotide can be used in a cell-based assay system. The adenylate cyclase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
Pharmaceutical Compositions
The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the in-
vention can comprise, for example, a adenylate cyclase polypeptide, adenylate cyclase polynucleotide, ribozymes or antisense ohgonucleotides, antibodies which specifically bind to a adenylate cyclase polypeptide, or mimetics, activators, or inhibitors of a adenylate cyclase polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be ad- ministered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired,
disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabihzers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular
barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of ad- ministration.
Therapeutic Indications and Methods
The human adenylate cyclase II of the invention can be regulated to treat urinary disorders such as urinary incontinence and benign prostatic hyperplasia including prostate enlargement, bladder outlet obstruction and lower urinary tract symptoms.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an anti-
sense nucleic acid molecule, a specific antibody, ribozyme, or a adenylate cyclase polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
A reagent which affects adenylate cyclase activity can be administered to a human cell, either in vitro or in vivo, to reduce adenylate cyclase activity. The reagent preferably binds to an expression product of a human adenylate cyclase gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a hpid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about
10 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988);
Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. USA. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991).
Determination of a Therapeutically Effective Dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases adenylate cyclase activity relative to the adenylate cyclase activity which occurs in the absence of the therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED5o (the dose therapeutically effective in
50% of the population) and LD5o (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LDso/EDso.
Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
Factors which can be taken into account include the severity of the disease state,
general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about
50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dpsages^ ire in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about
100 μg of DNA.
If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides which express antisense ohgonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a adenylate cyclase gene or the activity of a adenylate cyclase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a adenylate cyclase gene or the activity of a adenylate cyclase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to adenylate cyclase-specific mRNA, quantitative RT-PCR, immunologic detection of a adenylate cyclase polypeptide, or measurement of adenylate cyclase activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act syner- gistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
Diagnostic Methods
Human adenylate cyclase also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding adenylate cyclase in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85,
4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed
by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of a adenylate cyclase also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Expression of recombinant human adenylate cyclase II
The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human adenylate cyclase polypeptides in yeast. The adenylate cyclase-encoding DNA sequence is derived from SEQ ID NO:l. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5'-end an initiation codon and at its 3'-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the corresponding restriction enzymes the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human adenylate cyclase polypeptide is obtained.
EXAMPLE 2
Identification of test compounds that bind to adenylate cyclase II polypeptides
Purified adenylate cyclase polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates
are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Human adenylate cyclase polypeptides comprise the amino acid sequence shown in SEQ ID NO:2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a adenylate cyclase polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15 > relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a adenylate cyclase polypeptide.
EXAMPLE 3
Identification of a test compound which increases adenylate cyclase II gene expression
A test compound is administered to a culture of human cells transfected with a adenylate cyclase expression construct and incubated at 37 °C for 10 to 45 minutes.
A culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled adenylate cyclase-specific probe at 65 ° C in Express- hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:3. A test compound which increases the adenylate cyclase-specific signal relative to the signal obtained in the absence of the test compound is identified as an activator of adenylate cyclase gene expression.
EXAMPLE 4
Identification of a test compound which increases adenylate cyclase II activity
A test compound is administered to a culture of human cells transfected with a adenylate cyclase expression construct and incubated at 37 °C for 10 to 45 minutes. A culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control. Adenylate cyclase activity is measured using the method of U.S. Patent 5,795,756.
A test compound which increases the enzyme activity of the adenylate cyclase relative to the enzyme activity in the absence of the test compound is identified as an activator of adenylate cyclase activity.
EXAMPLE 5
Tissue-specific expression of human adenylate cyclase II
The qualitative expression pattern of adenylate cyclase in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT-PCR). To demonstrate that adenylate cyclase II is involved in the disease process of urological disorder, the expression panel consists of RNA samples from various human tissues.
Body map profiling is carried out, using total RNA panels purchased from Clontech. The tissues are heart, coronary artery, ileum, colon, liver, cerebral artery, lung, bladder, prostate, testis, adrenal gland, thyroid gland, urethra, brain, kidney, lung, trachea, bone marrow, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, uterus, cerebelllum, spinal cord, placenta, pancreas, and salivary gland.
Quantitative expression profiling. Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
If the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome
Res. 6, 995-1001, 1996).
The amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction. In this kind of experiment, the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used.
All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
RNA extraction and cDNA preparation. Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
Fifty μg of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/μl RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/μl RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; 10 mM MgCl2; 50 mM NaCl; and 1 mM DTT.
After incubation, RNA is extracted once with 1 volume of phenolxhloro- formάsoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M NaAcetate, pH 5.2, and 2 volumes of ethanol.
Fifty μg of each RNA from the autoptic tissues are DNase treated with the DNA- free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/μL. Reverse transcription is carried out with 2.5μM of random hexamer primers.
TaqMan quantitative analysis. Specific primers and probe are designed according to the recommendations of PE Applied Biosystems and are listed below:
forward primer 1: 5'-(TGATGTGTGCCCAGATCGTT)-3' (SEQ ID NO:3)
reverse primer 1: 5'-(CGCTCCTTπCCCTr-TGCT)-3' (SEQ ID NO:4)
probe 1 : 5'-(FAM) -(TGCCACTTGCACTGTGCTTGCTCC) (TAMRA)-3' (SEQ ID
NO:5)
Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
The assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix
(from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ml.
Each of the following steps are carried out once: pre PCR, 2 minutes at 50° C, and
10 minutes at 95 °C. The following steps are carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
The experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
The results are shown in Fig. 1 and 2. In the figures, each number represent the tissue as follows: 1. Heart, 2. Coronary artery, 3. Ileum, 4. Colon, 5. Liver, 6. Cerebral artery, 7. Lung, 8. Bladder: body, 9. Bladder: trigone, 10. Prostate, 11. Testis, 12. Adrenal gland, 13. thyroid gland, and 14. Urethra.
EXAMPLE 6
Organ bath assay to evaluate the effect of an adenylate cyclase II activator on the prostate/urethra contraction
New Zealand white male rabbits (12 weeks old) are anesthetized with Nembutal and sacrificed by exsanguination. The whole prostate/urethra excise and place in
oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KC1, 1.2mM MgC12, 1.2mM NaH2PO4, 2mM CaC12, 2.5mM NaHCO3, 12mM glucose). After decapsulation the prostate/urethra is longitudinally dissected into 8 strips. Strips are suspended with a wire to a force transducer at one end and fixed to a metallic support at the opposite end. Isometric tissue tone is measured with a force transducer and voltage amplifier, and recorded on a polygraph under a load of lg tension. Prostate/urethra strips are equilibrated for 60 min before each stimulation. Contractile response to 5μM phenylephrine is determined at 15min intervals until reproducible responses are obtained. The effects of the compounds are investigated by incubating the strips with compounds for 10 min prior to the stimulation with 5μM phenylephrine. The effects of compounds on the phenylephrine-induced contraction are evaluated by calculating the ratios of each contraction to the control without test compounds.
EXAMPLE 7
Organ bath assay to evaluate the effect of an adenylate cyclase II activator on prostate contraction in anesthetized rats
Measurement of prostate contraction in anesthetized rats is carried out as described previously (Shiraoya C and Kontani H: Japan. J. Pharmacol. 85: 213P, 2001). Male Sprague-Dawley rats (200-250 g / Charles River Japan) are used. Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.2 g/kg. The abdomen is opened through a midline incision, and ventral part of prostate is suspended with a wire to a force transducer. Isometric prostate tone under a load lg resting tention in the anesthetized rat is measured with a force transducer and voltage amplifier, and recorded on a polygraph. Phenylephrine is injected intravenously at dose of 0.03 mg/kg. Contractile response of the prostate to phenylephrine is determined at 15min intervals until reproducible responses are obtained. The effects of the compounds are investigated by intravenous injection of the compounds for 5 min prior to the stimulation with phenylephrine. The effects of compounds on the
phenylephrine-induced contraction are evaluated by calculating the ratios of each contraction to the control without test compounds and Student's t-test. A probability- level less than 5% is accepted as significant difference. Test compound is dissolved in the mixture of dimethylsulphoxide (Sigma) and PEG400 (Sigma) (1 : 9, v/v) for the administration..