WO2003100014A2

WO2003100014A2 - Method for quantitating negative strand rna synthesis

Info

Publication number: WO2003100014A2
Application number: PCT/US2003/016466
Authority: WO
Inventors: Adam T. Gates; Victor K. Johnston, Jr.; Robert T. Sarisky
Original assignee: Smithkline Beecham Corporation
Priority date: 2002-05-24
Filing date: 2003-05-23
Publication date: 2003-12-04
Also published as: AU2003241614A8; AU2003241614A1; WO2003100014A3

Abstract

The invention provides methods for identifying inhibitors of the synthesis of the negative strand of the HCV polymerase.

Description

METHOD FOR QUANΗTATING NEGATIVE STRAND RNA SYNTHESIS

FIELD OF THE INVENTION The present invention relates to methods that are useful for quantitating negative strand RNA synthesis of positive strand RNA viruses. The present invention also relates to methods that are useful for the screening and identification of inhibitors that specifically inhibit negative strand RNA synthesis of positive strand RNA viruses.

BACKGROUND OF THE INVENTION In the U.S., an estimated 4.5 million Americans are chronically infected with hepatitis

C virus (HCV). Although only 30% of acute infections are symptomatic, greater than 85% of infected individuals develop chronic, persistent infection. Treatment costs for HCV infection have been estimated at $5.46 billion for the U.S. in 1997. World-wide, over 200 million people are estimated to be infected chronically. HCV infection is responsible for 40-60% of all chronic liver disease and 30% of all liver transplants. The CDC estimates that the number of deaths due to HCV will minimally increase to 38,000/yr. by the year 2010.

First identified by molecular cloning in 1989 (Choo, Q-L. et al., (1989) Science 244:359-362), HCV is now widely accepted as the most common causative agent of post- transfusion non A, non-B hepatitis (NANBH) (Kuo,G. et al, (1989) Science 244:362-364). Due to its genome structure and sequence homology, this virus was assigned as a new genus in the Flaviviridae family. Like the other members of the Flaviviridae (such as flaviviruses (e.g., yellow fever virus and Dengue virus types 1-4) and pestiviruses (e.g., bovine viral diarrhea virus, border disease virus, and classic swine fever virus (Choo et al, 1989; Miller, R.H. and R.H. Purcell (1990) Proc. Natl. Acad. Sci. USA 87:2057-2061)), HCV is an enveloped virus containing a single strand RNA molecule of positive polarity. The HCV genome is approximately 9.6 kilobases (kb) with a long, highly conserved, noncapped 5' nontranslated region (NTR) of approximately 340 bases which functions as an internal ribosome entry site (IRES) (Wang CY. Le SY. Ali N. Siddiqui A., Rna-A Publication of the Rna Society. 1(5):526- 537, 1995 Jul). This element is followed by a region which encodes a single long open reading frame (ORF) encoding a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins.

Upon entry into the cytoplasm of the cell, the HCV-RNA is directly translated into a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins. This large polypeptide is subsequently processed into the individual structural and nonstructural proteins by a combination of host and virally-encoded proteinases (Rice, CM. (1996) in B.N. Fields, D.M.Knipe and P.M. Howley (Eds.) Virology, 2nd Edition, p931-960, Raven Press, NY). Following the termination codon at the end of the long ORF, there is a 3' NTR which roughly consists of three regions: an - 40 base region which is poorly conserved among various genotypes, a variable length poly(U)/polypyrimidine tract, and a highly conserved 98 base element also called the "3'X-tail" (Kolykhalov, A. et al., (1996) J. Virology 70:3363-3371 ; Tanaka, T. et ai, (1995) Biochem Biophys. Res. Commun. 215:744-749; Tanaka, T. et al, (1996) J. Virology 70:3307-3312; Yamada, N. et al, (1996) Virology 223:255-261). The 3' NTR is predicted to form a stable secondary structure that is essential for HCV growth in chimps and is believed to function in the initiation and regulation of viral RNA synthesis (replication). The NS5B protein (591 amino acids, 65 kDa) of HCV (Behrens, S.E., et al, (1996)

EMBO J. 15: 12-22), encodes an RNA-dependent RNA polymerase (RdRp) activity and contains canonical motifs present in other RNA viral polymerases. The NS5B protein is fairly well conserved both intra-typically (-95-98% amino acid (aa) identity across lb isolates) and inter-typically (-85% aa identity between genotype la and lb isolates). The essentiality of the HCV NS5B RdRp activity for the generation of infectious progeny virions has been formally proven in chimpanzees (Kolykhalov, A.A., et al, (2000) J. Virology 74:2046-2051). Thus, inhibition of NS5B RdRp activity (inhibition of RNA synthesis/replication) is predicted to cure HCV infection.

Positive strand hepatitis C viral RNA is the nucleic acid strand which is translated and initially copied upon entry of the HCV-RNA into the cell. Once in the cell, positive strand viral RNA is translated to express the viral structural and non-structural proteins. The nonstructural proteins, together with as yet unknown cellular polypeptides, are thought to comprise the HCV replicase complex. This replicase complex will initiate negative strand RNA synthesis from the 3' non-translated region of the viral genome. The negative strand HCV-RNA serves as the replicative intermediate which is used as the template for producing additional positive strand HCV-RNA. Positive strand HCV-RNA represents the RNA that is generally packaged into productive virions.

Inhibition of the formation of positive and negative strand HCV-RNA in an infected cell by antiviral agents would not necessarily require identical replicase conformations, mechanistic requirements, or similar sets of cofactors. Accordingly, an antiviral agent, shown to inhibit the formation of positive strand HCV-RNA in the replicon system, may not necessarily modulate negative strand HCV-RNA synthesis. Currently, it is presumed that the ability of an agent to inhibit positive strand HCV-RNA synthesis will translate into clinical efficacy. However, complete clearance of the hepatitis C virus would be unlikely unless negative strand HCV-RNA synthesis is also inhibited. Presently, HCV antiviral agents are only evaluated for their ability to inhibit positive strand HCV-RNA synthesis. Most laboratories utilize RT-PCR or RNAse protection assays to quantify changes in positive strand HCV-RNA concentration after exposure to antiviral agents. However, the use of standard RT-PCR results in significant false-positive detection of negative strand genomes. When using RNA preparations from HCV-positive patients, or RNA from drug-treated replicon cells, both positive and negative strand genomes are expected to be present. Because the 3' non-translated region of the positive strand viral genome is highly structured, a primer is not required to initiate synthesis of first strand (i.e., negative strand) cDNA. Thus, when an RNA preparation containing positive strand HCV-RNA is added to reverse transcriptase and the appropriate buffers, as in standard RT-PCR assays, new copies of negative strand, or cDNA copy, can be generated. Therefore, quantitation of changes in authentic negative strand HCV-RNA concentration using current techniques is difficult, since the positive strand viral HCV-RNA present in the assay will continue to generate negative strand cDNA in vitro.

Determining whether an agent inhibits negative strand HCV-RNA synthesis in infected cells, or in replicon cells remains difficult. Lanford et al has described the use of a tagged RT-PCR assay followed by southern blot analysis, to detect negative strand RNA, although the dynamic range for detection was limited (Lanford, R.E., et al, Virology 202:606-614 (1994). Quantitation of any changes in concentration of negative strand RNA is further complicated because the concentration of negative strand is very low compared to the concentration of positive strand, often 100-fold lower (Craggs, J. et al, Journal Virological Methods 94: 111-120 (2001)).

Accordingly, it would be desirable to develop a sensitive method that would be useful for quantitating authentic negative strand HCV-RNA concentration, and to use this method to identify changes in authentic negative strand HCV-RNA concentration, and to use such methods to identify antiviral agents that are capable of inhibiting negative strand HCV-RNA synthesis.

SUMMARY OF THE INVENTION This invention is directed to a quantitative assay using tagged RT-PCR for TaqMan analysis. In one embodiment, this invention is directed to a method for determining the concentration of negative strand HCV-RNA in an HCV-containing preparation comprising positive strand HCV-RNA and negative strand HCV-RNA, wherein the method comprises the steps of: a) annealing a cDNA primer to the HCV RNA in the HCV-containing preparation, wherein the cDNA primer comprises a 5' non-HCV sequence element linked in cis to a 3' HCV sequence or a 3' HCV replicon sequence; b) generating first strand cDNA from the negative strand HCV RNA, wherein the first strand cDNA comprises the 5' non-HCV sequence element; c) conducting polymerase chain reaction on the first strand cDNA using a first primer that is homologous to the 5' non-HCV sequence element and a second primer that is homologous to the 3' HCV sequence or the 3' HCV replicon sequence of the cDNA, respectively, to amplify the first strand cDNA containing the 5' non-HCV sequence element; and d) determining the concentration of negative strand HCV-RNA using TaqMan analysis.

In another embodiment, this invention is directed to a method for determining whether a candidate antiviral agent inhibits negative strand HCV-RNA synthesis in an HCV-containing system comprising positive strand HCV-RNA and negative strand HCV-RNA comprising the steps of: a) purifying HCV-RNA from the HCV-containing system to provide an HVC-RNA preparation; b) annealing cDNA primer to the HCV RNA in the HCV-containing preparation, wherein the cDNA primer comprises a 5¹ non-HCV sequence element linked in cis to a 3' HCV sequence or a 3' HCV replicon sequence; c) generating first strand cDNA from the negative strand HCV RNA, wherein the first strand cDNA comprises the 5' non-HCV sequence element; d) conducting polymerase chain reaction on the first strand cDNA using a first primer that is homologous to the 5' non-HCV sequence element and a second primer that is homologous to the 3' HCV sequence or the 3' HCV replicon sequence of the cDNA, respectively, to amplify the first strand cDNA containing the 5' non-HCV sequence element; and e) determining the concentration of negative strand HCV-RNA in the HCV-containing preparation using TaqMan analysis; f) treating the HCV-containing system with a candidate antiviral agent for a time and under conditions sufficient to inhibit HCV synthesis; g) purifying HCV-RNA from the treated HCV-containing system to provide a treated HVC-RNA preparation; h) annealing cDNA primer to the treated HCV-containing preparation from step g) with the cDNA primer according to step b); i) generating first strand cDNA in the treated HCV-containing preparation from step h) according to step c); j) conducting polymerase chain reaction using the first primer and the second primer according to step d); k) determining the concentration of negative strand HCV-RNA in the treated portion of the HCV-containing preparation using TaqMan analysis; and 1) comparing the concentration of negative strand HCV-RNA in the

HCV-containing preparation with the concentration of negative strand HCV-RNA in the treated HCV-containing preparation.

The invention also provides a polynucleotide tag element elected from the group consisting of:

(i) an 18 base tag sequence element comprising nucleotides having at least 70% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO: 5;

(ii) an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO: 5,

(iii) an isolated polynucleotide that is the nucleotide sequence of SEQ ID NO: 5, and (iv) a polynucleotide that is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO: 5.

The present invention further provides methods preparing a cDNA primer whereby the polynucleotide of SEQ ID NO: 5 is linked in cis to any 3' HCV or 3' HCV replicon sequence, to form a cDNA primer, which are tag-linked polynucleotides, such as those defined as SEQ ID NO.: 4 , NO.: 7 and NO.: 10. The present invention further provides methods using the tagged cDNA primer to generate cDNA.

DETAILED DESCRIPTION OF THE INVENTION The invention relates to methods using non-HCV sequences, referred to as 'tag', linked in cis to HCV sequences to selectively enrich and amplify negative strand HCV RNA while minimizing false-positive signals. In particular, the invention relates to methods using polynucleotides of non-HCV sequences such as 5ΑCATGCGCGGCATCTAGA3' (SEQ ID NO.: 5) but not specifically limited to those sequences, linked to any HCV RNA sequence or HCV replicon RNA sequence. The start codon in SEQ ID NO: 5 represents the tag. The cDNA primers used in the methods of this invention contain the 18 base tag sequence element followed by an HCV or HCV replicon sequence.

TABLE 1

HCV Polynucleotide Sequences

(A) SEQ ID NO. 1: 5'CCGGCTACCTGCCCATTC3'

(B) SEQ ID NO. 2: 5'CCAGATCATCCTGATCGACAAG3'

(C) SEQ ID NO. 3: SFAM-ACATCGCATCGAGCGAGCACGTAC-TAMRAS' (D) SEQ ID NO. 4: 5'ACA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3'

(E) SEQ ID NO. 5: 5'ACA TGC GCG GCA TCT AGA3'

(F) SEQ ID NO. 6: 5'CCAGATCATCCTGATCGACAAG3'

(G) SEQ ID NO. 7: 5ΑCATGCGCGGCATCTAGAGGCTCCATCTTAGCCCTAGTCA3'

(H) SEQ ID NO. 8: 5'CAGTATCAGCACTCTCTGCAGTCA3'

(I) SEQ ID NO. 9: SFAM-TAGCTOTGAAAGGTCCCTGAGCCGC-TAMRAS'

(J) SEQ ID NO. 10: 5 'AC ATGCGCGGC ATCTAGATCC AC AGTTACTCTCC AGGTGAG A3 '

(K) SEQ ID NO. 11 : 5OCAAGGGTGGTACCCCAAGT3'

(L) SEQ ID NO. 12: 5FAM-TCCTGAGGCATGAAGCCACCCTATTG-TAMRA3'

In one embodiment of the method of this invention, the cDNA primer comprises a 5' non-HCV sequence element linked in cis to a 3' HCV sequence and the second primer is homologous to the 3' HCV sequence of the cDNA. In another embodiment of the method of this invention, the cDNA primer comprises a 5' non-HCV sequence element linked in cis to a 3' HCV replicon sequence and the second primer is homologous to the 3' HCV replicon sequence of the cDNA.

This invention further provides methods of making and using a non-HCV sequence tag element to generate a cDNA primer, whereby the non-HCV sequence tag element has at least 70% identity to that described in SEQ ID NO: 5. This non-HCV sequence tag element can be linked in cis to any 3' HCV sequence or 3' HCV replicon sequence. Useful linked tag-containing sequences are similar to, but not exclusive of, those defined as SEQ ID NO:4 , NO:7 and NO: 10. Preferably, the non-HCV sequence tag element has at least 80% identity to that described in SEQ ID NO: 5. More preferably, the non-HCV sequence tag element has at least 80% identity to that described in SEQ ID NO: 5. "Polynucleotide(s)" generally refers to any polyribonucleotide or polydeoxyribonucleotide, that may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide(s)" include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded, or triple-stranded regions, or a mixture of single- and double-stranded regions. In addition, "polynucleotide" as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. As used herein, the term "polynucleotide(s)" also includes DNAs or RNAs as described above that comprise one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term "polynucleotide(s)" as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including, for example, simple and complex cells. "Polynucleotide(s)" also embraces short polynucleotides often referred to as oligonucleotide(s).

The term "HCV-containing system" includes any cell based system that contains hepatitis C virus RNA, for example, replicon, yeast, or other cell based systems (e.g., as used in in vitro assays) and includes animal infection or replication models and mammals(human patients) that are infected with the hepatitis C virus. The term "HCV-containing preparation " represents hepatitis C virus RNA, purified from an HCV-containing system.

A candidate antiviral agent is a compound, composition or mixture thereof, that is tested using the methods of this invention to determine whether and to what degree the compounds composition or mixture thereof, inhibits the synthesis of negative strand HCV-RNA. The candidate antiviral agent may inhibit negative strand HCV synthesis either directly or indirectly. In the method of this invention, an HCV-containing system is treated for a time and under conditions sufficient to inhibit HCV synthesis in the HCV-containing system. It will be understood by those skilled in the art that the time of exposure required for an agent to demonstrate inhibition of HCV-RNA synthesis will vary depending upon the system selected. For example, an antiviral agent can demonstrate inhibition of HCV-RNA synthesis in an HCV-containing replicon system in about 40 hours, but an antiviral agent may require 4-10 days to demonstrate inhibition of HCV-RNA synthesis in an HCV-containing animal model. An antiviral agent may demonstrate inhibition of HCV-RNA synthesis in an HCV-infected human in 2 days - 48 months. In addition, it will be understood by those skilled in the art that the quantity/amount of an agent that must be administered to the HCV-containing system for the agent to demonstrate inhibition of HCV-RNA synthesis will vary depending upon the system selected. The quantity of a given agent will also vary depending upon factors such as the particular compound (e.g., the potency (IC₅₀), efficacy (EC₅₀), and the biological half*, life of the particular compound), disease condition and its severity, the identity (e.g., age, size and weight) of the mammal or cell system, but, nevertheless, can be routinely determined by one skilled in the art. For example, when calculating the ability of a candidate antiviral agent to inhibit HCV using the methods of this invention, an 11 -point serial dilution of the candidate agent may be used ranging from 50μM to 0.005μM or from lOμM to O.OOlμM or form 50nM to 5pM.

Compounds that have demonstrated inhibition of both positive strand and negative strand HCV-RNA synthesis include interferon, ribavirin, and the compounds described in: WO 01/85172, WO 01/85720 and WO 01/74883. For example, the benzo-l,2,4-thiadiazine Compounds 1 and 2, prepared as described in WO 01/85172, demonstrated potent inhibition of the HCV Δ21 RdRp with IC₅₀ 's of 0.10 ± 0.05 μM and 0.08 ± 0.01 μM, respectively. Spectral and microanalytical data were consistent with the assigned structures for Compounds 1 and 2.

TaqMan was utilized to monitor both cellular and viral RNA for the viral reduction assay. Cyclophilin RNA levels were normalized to positive-strand HCV viral RNA.

Cell-based inhibition of viral synthesis was confirmed with Compound 1 in the HCV replicon system, with an IC₅₀ of 552 nM (n=8) and a therapeutic index relative to cytotoxicity of

approximately 100. Compound 2 showed activity in the replicon system with an IC₅₀ of 524 nM for reduction in positive strand viral RNA. Percent reduction in viral RNA was 80% for Compound 1, and 91% for Compound 2 at 10 μM.

IC₅₀ (nM)

Pos. strand Neg. strand

Compound 1 552 + 118 400 ± 171

Compound 2 524 ± 108 529 ± 170

In the replicon cells, TaqMan analysis showed that approximately 2200 positive strand replicon RNA copies per cell were present, whereas 200 copies per cell of negative strand were detected. Using this assay, Compounds 1 and 2 showed a similar inhibition profile for reductions in either positive or negative strand RNA, with IC₅₀s ranging from 400 nM to 550 nM. Compounds 1 and 2 shared similar activities of inhibition for both negative and positive strand HCV-RNA synthesis in the biochemical assay.

Test Method 1 Method for positive strand replicon HCV-RNA detection in replicon cells Replicon cells were plated at 3 X 10³ cells per well in a 96-well plate plates at 37° and 5%

CO₂ in DMEM (Dulbecco's Minimal Essential Medium) containing 10% FCS (fetal calf serum), 1% NEAA (nonessential amino acids) and 1 mg/ml Geneticin (G418 neomycin). After allowing 4 h for cell attachment, 1 μl of a solution of candidate antiviral agent was added to the medium (n = 8 wells per dilution). Briefly, eleven 2.5-fold dilutions of 1 mM stock test compound in DMSO (dimethylsulfoxide) were prepared with final concentration ranging from 10000 nM to 1.0 nM. Plates were incubated for 40 h, until reaching 80% confluence. After removal of medium, 150 μl Buffer RLT (Qiagen, Valencia, California, US) was added to each well and RNA purified according to manufacturer's recommendations (Qiagen RNAeasy) and were eluted twice in 45 μl dH₂0 prior to RT-PCR. Approximately 40 μl of TaqMan EZ RT-PCR (Applied Biosystems, Foster City, California, US) master mix ( 1 X TaqMan EZ Buffer, 3 mM Mn(OAc)₂, 0.3 mM dATP, 0.3 mM dCTP, 0.3 mM dGTP, 0.6 mM dUTP, 0.2 mM neo-forward, 0.2 mM neo-reverse, 0.1 mM neo-probe, IX Cyclophilin Mix, 0.1 Unit/μl rTth DNA Polymerase, 0.01 Unit/μl AmpErase UNG, and H₂0 to 40 μl) was added to each tube of 96-tube optical plate along with 10 μl of RNA elution. Primers and probes specific for the positive strand RNA detection of neomycin gene were: neo- forward: 5'CCGGCTACCTGCCCATTC3' (SEQ ID NO 1); neo-reverse:

5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 2); neo-probe: 5'FAM- ACATCGCATCGAGCGAGCACGTAC-TAMRA3' (SEQ ID NO 3). For negative strand RNA detection, the cDNA primer used was 5'ACA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3' (SEQ ID NO 4) whereby the first 18 bases represent SEQ ID NO 5 linked to neo sequences; neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 6); neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ ID NO 3). Additionally, the PDAR control reagent human cyclophilin was used for normalization. Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 60°C, 30 min; and 95°C, 5 min, with cycling parameters set to 94°C, 20 s; 55°C, 1 min for 40 cycles. The relative cDNA levels for neo and cyclophilin were determined compared to DMSO-only treated controls and the ratio of neoxyclophilin was used for IC₅₀ calculation (n = 8).

Test Method 2 Method for negative strand replicon HCV-RNA detection in replicon cells To achieve strand-specific detection, a primer containing HCV RNA (or replicon RNA sequences such as neomycin gene) and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction,

5ΑCATGCGCGGCATCTAGACCGGCTACCTGCCCATTC3' (SEQ ID NO 4). A Thermoscript- RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 μl of the cell-harvested RNA and 1 μl of primer (10 μM) incubated with RT at 60°C for 1 h. Following that incubation, 2 μl of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 μl of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 6); and neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ ID NO 3). Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 95°C, 10 min, with cycling parameters set to 94°C, 15 s; 55°C, 1 min for 40 cycles. The negative strand copy number in each reaction was determined using linear regression analysis based on the slope and intercept generated with a negative strand copy standard curve. The negative strand copies per cell were determined by dividing the total negative strand copies per reaction by the total cells per reaction.

In addition to determining negative strand copy number using primers and probes specific to the neomycin gene found in HCV replicon constructs, similar reactions can be used to quantitate negative strand RNA from any clinical isolate. To achieve strand-specific detection, a primer containing HCV RNA sequences homologous to the 5'NTR/Core region and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction,

5ΑCATGCGCGGCATCTAGAGGCTCCATCTTAGCCCTAGTCA3' (SEQ ID NO 7). A Thermoscript-RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 μl of the cell-harvested RNA and 1 μl of primer (10 μM) incubated with RT at 60°C for 1 h. Following that incubation, 2 μl of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 μl of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, 5'NTR/Core-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); 5'NTR/Core reverse: 5'CAGTATCAGCACTCTCTGCAGTCA3' (SEQ ID NO 8); and 5'NTR/Core probe: 5'FAM-TAGCTGTGAAAGGTCCGTGAGCCGC-TAMRA3' (SEQ ID NO 9). Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 95°C, 10 min, with cycling parameters set to 94°C, 15 s; 55°C, 1 min for 40 cycles. The negative strand copy number in each reaction was determined using linear regression analysis based on the slope and intercept generated with a negative strand copy standard curve. The negative strand copies per cell were determined by dividing the total negative strand copies per reaction by the total cells per reaction.

In addition to determining negative strand copy number using primers and probes specific to the neomycin gene found in HCV replicon constructs, similar reactions can be used to quantitate negative strand RNA from NS5B using strain J4 sequence as the example. To achieve strand-specific detection, a primer containing HCV RNA sequences homologous to the NS5B region and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction, 5ΑCATGCGCGGCATCTAGATCCACAGTTACTCTCCAGGTGAGA3' (SEQ ID NO 10). A Thermoscript-RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 μl of the cell-harvested RNA and 1 μl of primer (10 μM) incubated with RT at 60°C for 1 h. Following that incubation, 2 μl of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 μl of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, NS5B-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); NS5B reverse: 5'GCAAGGGTGGTACCCCAAGT3' (SEQ ID NO 1 1 ); and NS5B probe: 5'FAM-TCCTGAGGCATGAAGCCACCCTATTG-TAMRA3' (SEQ ID NO 12). Samples were mixed briefly and placed in an AB 17700 (Applied Biosystems) at 50°C, 2 min; 95°C, 10 min, with cycling parameters set to 94°C, 15 s; 55°C, 1 min for 40 cycles. The negative strand copy number in each reaction was determined using linear regression analysis based on the slope and intercept generated with a negative strand copy standard curve. The negative strand copies per cell were determined by dividing the total negative strand copies per reaction by the total cells per reaction.

Compound Screening Using the above assay, compounds can be tested for inhibition of HCV polymerase. The above description fully discloses how to make and use the present invention. However, this invention is not limited to the particular embodiments described hereinabove, but includes all modification thereof within the scope of the appended claims and their equivalents. Those skilled in the art will recognise through routine experimentation that various changes and modifications can be made without departing from the scope of this invention.

All publications and references, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicated to be incorporated by reference herein as being fully set forth. Any patent application to which this application claims priority is also incorporated by reference herein in its entirety in the manner described above for publications and references.

Claims

What is claimed is:

1. A method for determining the concentration of negative strand HCV-RNA in an HCV-containing preparation comprising positive strand HCV-RNA and negative strand HCV-RNA, wherein the method comprises the steps of: a) annealing a cDNA primer to the HCV RNA in the HCV-containing preparation, wherein the cDNA primer comprises a 5' non-HCV sequence element linked in cis to a 3' HCV sequence or a 3' HCV replicon sequence; b) generating first strand cDNA from the negative strand HCV RNA, wherein the first strand cDNA comprises the 5' non-HCV sequence element; c) conducting polymerase chain reaction on the first strand cDNA using a first primer that is homologous to the 5' non-HCV sequence element and a second primer that is homologous to the 3' HCV sequence or the 3' HCV replicon sequence of the cDNA, respectively, to amplify the first strand cDNA containing the 5' non-HCV sequence element; and d) determining the concentration of negative strand HCV-RNA using TaqMan analysis.

2. A method for determining whether a candidate antiviral agent inhibits negative strand HCV-RNA synthesis in an HCV-containing system comprising positive strand HCV-RNA and negative strand HCV-RNA comprising the steps of: a) purifying HCV-RNA from the HCV-containing system to provide an HVC-RNA preparation; b) annealing cDNA primer to the HCV RNA in the HCV-containing preparation, wherein the cDNA primer comprises a 5' non-HCV sequence element linked in cis to a 3' HCV sequence or a 3' HCV replicon sequence; c) generating first strand cDNA from the negative strand HCV RNA, wherein the first strand cDNA comprises the 5' non-HCV sequence element; d) conducting polymerase chain reaction on the first strand cDNA using a first primer that is homologous to the 5' non-HCV sequence element and a second primer that is homologous to the 3' HCV sequence or the 3' HCV replicon sequence of the cDNA, respectively, to amplify the first strand cDNA containing the 5' non-HCV sequence element; and e) determining the concentration of negative strand HCV-RNA in the HCV-containing preparation using TaqMan analysis;

- 17 f) treating the HCV-containing system with a candidate antiviral agent for a time and under conditions sufficient to inhibit HCV synthesis; g) purifying HCV-RNA from the treated HCV-containing system to provide a treated HVC-RNA preparation; h) annealing cDNA primer to the treated HCV-containing preparation from step g) with the cDNA primer according to step b); i) generating first strand cDNA in the treated HCV-containing preparation from step h) according to step c); j) conducting polymerase chain reaction using the first primer and the second primer according to step d); k) determining the concentration of negative strand HCV-RNA in the treated portion of the HCV-containing preparation using TaqMan analysis; and

1) comparing the concentration of negative strand HCV-RNA in the

3. The method according to claim 1 or claim 2, wherein the cDNA primer comprises the 5' non-HCV sequence element linked in cis to the 3' HCV sequence and the second primer is homologous to the 3' HCV sequence of the cDNA.

4. The method according to claim 1 or claim 2, wherein the cDNA primer comprises the 5' non-HCV sequence element linked in cis to the 3' HCV replicon sequence and the second primer is homologous to the 3' HCV replicon sequence of the cDNA.

5. The method according to any one of claims 1 -4, wherein the 5 '-non HCV sequence of the cDNA primer is a polynucleotide sequence having at least 70% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

6. The method according to claim 1 or claim 2, wherein the 5'-non HCV sequence of the cDNA primer is a polynucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

18 -

7. The method according to claim 1 or claim 2, wherein the 5'-non HCV sequence of the cDNA primer is a polynucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

8. A polynucleotide tag selected from the group consisting of:

(i) an 18 base tag sequence element comprising nucleotides having at least 70% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5; (ii) an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO:5, (iii) an isolated polynucleotide that is the nucleotide sequence of SEQ ID NO:5, and (iv) a polynucleotide that is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO:5.

9. A polynucleotide selected from the group consisting of:

(i) a polynucleotide sequence comprising nucleotides having at least 70% identity to the nucleotide sequence of SEQ ID NO:4 over the entire length of SEQ ID NO:4;

(ii) an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO:4, (iii) an isolated polynucleotide that is the nucleotide sequence of SEQ ID NO:4, and (iv) a polynucleotide that is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO:4.

10. A polynucleotide selected from the group consisting of:

(i) a polynucleotide sequence comprising nucleotides having at least 70% identity to the nucleotide sequence of SEQ ID NO:7 over the entire length of SEQ ID NO:7;

(ii) an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO:7, (iii) an isolated polynucleotide that is the nucleotide sequence of SEQ ID NO:7, and (iv) a polynucleotide that is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO:7.

11. A polynucleotide selected from the group consisting of:

(i) a polynucleotide sequence comprising nucleotides having at least 70% identity to the nucleotide sequence of SEQ ID NO: 10 over the entire length of SEQ ID NO: 10;

(ii) an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO: 10, (iii) an isolated polynucleotide that is the nucleotide sequence of SEQ ID NO: 10, and (iv) a polynucleotide that is encoded by a recombinant polynucleotide comprising the polynucleotide sequence of SEQ ID NO: 10.

- 19

12. A method for the preparation of the cDNA primer to claim 1 or claim 2, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 70% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

13. A method for the preparation of the cDNA primer to claim 1 or claim 2, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

14. A method for the preparation of the cDNA primer to claim 1 or claim 2, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

15 A method for the preparation of the polynucleotide according to any one of claims 8-11, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 70% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

16. A method for the preparation of the polynucleotide according to any one of claims 8-11, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

20 -

17. A method for the preparation of the polynucleotide according to any one of claims 8-11, comprising linking a polynucleotide sequence element in cis to an HCV polynucleotide sequence or an HCV replicon sequence, wherein the element comprises a polynucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:5 over the entire length of SEQ ID NO:5.

21 -