WO2003095658A1

WO2003095658A1 - Homologous recombination into bacterium for the generation of polynucleotide libraries

Info

Publication number: WO2003095658A1
Application number: PCT/DK2003/000301
Authority: WO
Inventors: Mads Eskelund BJØRNVAD; Per Linå JØRGENSEN; Peter Kamp Hansen
Original assignee: Novozymes A/S
Priority date: 2002-05-07
Filing date: 2003-05-07
Publication date: 2003-11-20
Also published as: AU2003223928A1

Abstract

A method for generating an expression library of polynucleotides, wherein each polynucleotide is integrated by homologous recombination into the genome of a competent Gram-positive bacterium host cell, using a non-replicating linear integration cassette comprising at least one strong promoter operably linked to a polynucleotide encoding one or more polypeptide(s) of interest, a 5' flanking polynucleotide segment upstream of the promoter of step (a), said segment comprising a first homologous region located in the 3' end of the segment, and a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment.

Description

HOMOLOGOUS RECOMBINATION INTO BACTERIUM FOR THE GENERATION OF

POLYNUCLEOTIDE LIBRARIES

Field of invention

The present invention relates to a method for generating a library of polynucleotides integrated by homologous recombination on the host cell genome in a Gram-positive bacterium. Further the present invention relates to a non self-replicating linear DNA integration construct, and to the use of such constructs, and to a method for producing a polypeptide.

Background of the invention

The construction of DNA libraries is generally applied when looking for either random polynucleotide fragments providing screenable or selectable properties to a host cell, or when searching for new or improved encoded polypeptides. The traditional way of library construction has been the use of plasmid libraries, wherein the plasmid carries an origin of replication capable of autonomous replication in the host cell, as well as a suitable promoter and a marker gene for selection of presence of the plasmid. Often when trying to isolate new and better proteins, in particular enzymes, with either altered activity, specificity, stability, or other functional property, it is important to obtain as many clones as possible with a stable and comparable level of expression in each clone.

Expression plasmids can be transformed into bacteria with high transformation efficiency, thereby generating plasmid libraries with high complexity. However, plasmids are unstable and are often lost from the host cells and the copy-number of the different clones within the library may vary leading to different levels of expression of the studied proteins. This further complicates a reliable and consistent comparison of the properties of different proteins expressed in these cells. Previously libraries have been constructed and screened for interesting candidates, which have then subsequently been integrated into the host cell chromosome in order to avoid copy-number effects and instability.

It has been described how to integrate a gene into the chromosome by double homologous recombination without using antibiotic markers (Hone et a/., Microbial Pathogenesis, 1988, 5: 407-418); integration of two genes has also been described (Novozymes: WO 91/09129 and WO 94/14968). Integrating several copies of a gene into the chromosome of a host cell could lead to instability, but the integration of two genes closely spaced in anti-parallel tandem to achieve better stability has been described (Novozymes: WO 99/41358)as well as the stable chromosomal multi-copy integration of genes (Novozymes: WO 02/00907). It has also been described to integrate linear polynucleotide constructs into the genome of competent Bacillus cells by tranformation and subsequent homologous recombination (Genencor: WO 02/14490). Directed integration by homologous recombination ensures, that the expression levels of different clones are more comparable since all integrants are located in the same locus.

After constructing libraries of polynucleotides integrated into the genome of a host cell, it is time-consuming and laborious to initially select and isolate a set of clones that express polynucleotides of interest, and subsequently to cultivate the selected clones in order to achieve sufficiently high amounts of the product of interest to allow characterization or selection of the best clone.

Thus, a need exists for an improved method, that combines the high transformation efficiency of plasmid based libraries with the stability of clones integrated on the host cell genome, and also ensures comparable expression levels of such magnitude that the method allows immediate selection of the best clone, without intermediate selection and cultivation steps of subsets of clones.

Summary of the invention

The present invention provides a highly efficient method for generating DNA-Iibraries integrated into a Gram-positive host cell genome based on both the DNA-uptake mechanism known as competency of certain prokaryotes, and the mechanism of homologous recombination of a linear integration cassette, comprising a very strong promoter operably linked to a polynucleotide, e.g. encoding one or more polypeptide(s) of interest, into a preselected region on the host cell genome. This method combines a high transformation efficiency with a stable and uniformly high expression level.

In a first aspect the present invention relates to a method for generating an expression library of polynucleotides, wherein the polynucleotides are integrated by homologous recombination into the genome of a competent Gram-positive bacterium host cell, the method comprising the steps of: i) providing a non-replicating linear integration cassette comprising: a) a polynucleotide encoding one or more polypeptide(s) of interest b) a 5' flanking polynucleotide segment upstream of the polynucleotide of step (a), said segment comprising a first homologous region located in the 3' end of the segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment, wherein the first and second homologous regions are at least 500 bp, particularly at least 1000 bp, more particularly at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome; and ii) introducing the linear integration cassette into the host cell, and selecting or screening for host cells that produce the polypeptide(s) of interest.

In another aspect the present invention relates to a method for generating an expression library of polynucleotides, wherein each polynucleotide is integrated by homologous recombination into the genome of a competent Gram-positive bacterium host cell, the method comprising the steps of: i) providing a non-replicating linear integration cassette comprising: a) at least one promoter which is a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region, and/or which is derived from one or more of the following genes: amyL, amyQ, amyE, amyM, crylllA, dagA, aprH, penP, sacB, spot, tac, xylA, and xylB, said promoter(s) being operably linked to a polynucleotide encoding one or more polypeptide(s) of interest, b) a 5' flanking polynucleotide segment upstream of the promoter of step (a), said segment comprising a first homologous region located in the 3' end of the segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment, wherein the first and second homologous regions are at least 500 bp, particularly at least 1000 bp, more particularly at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome; and ii) introducing the linear integration cassette into the host cell, and selecting or screening for host cells that produce the polypeptide(s) of interest. In a second aspect the present invention relates to a non-replicating linear Gram-positive host cell integration cassette comprising: a) a polynucleotide encoding one or more polypeptide(s) of interest, 5 b) a 5' flanking polynucleotide segment upstream of the polynucleotide of step (a), said segment comprising a first homologous region located in the 3' end of the segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the o segment, wherein the first and second homologous regions are at least 500 bp, particularly at least 1000 bp, more particularly at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome. 5

In another aspect the present invention relates to a non-replicating linear Gram-positive host cell integration cassette comprising: a) at least one promoter which is a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region, and/or which is 0 derived from one or more of the following genes: amyL, amyQ, amyE, amyM, crylllA, dagA, aprH, penP, sacB, spol, tac, xylA, and xylB, said promoter(s) being operably linked to a polynucleotide encoding one or more polypeptide(s) of interest, b) a 5' flanking polynucleotide segment upstream of the promoter of step (a), said 5 segment comprising a first homologous region located in the 3' end of the segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment, o wherein the first and second homologous regions are at least 500 bp, particularly at least 1000 bp, more particularly at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome. In a third aspect the present invention relates to a use of the integration cassette according to the previous aspect for making a genomically integrated polynucleotide library in a Gram- positive host cell.

In a fourth aspect the present invention relates to a method for producing a polypeptide of interest comprising culturing Gram-positive host cells, comprising an integration cassette as defined in the previous aspects integrated into the genome, under conditions promoting expression of the polypeptide of interest, wherein the host cells have been selected or screened for by a method as defined in the first aspects of the invention.

Brief description of drawings

Figure 1 : Graphical presentation of the amount of BPN' expressed as relative proteolytic activity, measured as KNPU(S)/g from ten randomly picked clones (MB1341-1 to MB1341- 10). The Y-axis shows the relative proteolytic activity, and each of the ten different clones are presented on the X-axis.

Definitions

Prior to a discussion of the detailed embodiments of the invention, a definition of specific terms related to the main aspects of the invention is provided.

The term "DNA-library" denotes a collection of cloned DNA fragments, usually representing an entire genome, or alternatively allelic or synthetic variants of a gene or a gene family.

The term "allelic variants" denotes any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

"Synthetic variants" denotes variants of one or more gene(s) or family of gene(s) that have been manufactured synthetically e.g. by genetic manipulation techniques such as gene- shuffling, in vitro or in vivo recombinations, mutagenesis or other means as well known in the art. The term "gene family" denotes a set of genes with similarities in their nucleotide sequences, and which are thought to be descended by duplication and subsequent variation from the same ancestral gene.

The term "non self-replicating" denotes the absence from the integration cassette of an origin of replication capable of supporting autonomous replication of the cassette in the host cell.

The term "homology" in the context of the present invention denotes homologous polynucleotides or polypeptides. If two or more polynucleotides or two or more polypeptides are homologous, this means that the homologous polynucleotides or polypeptides have a "degree of identity" of at least 60%, more preferably at least 70%, even more preferably at least 85%, still more preferably at least 90%, more preferably at least 95%, and most preferably at least 98%. Whether two polynucleotide or polypeptide sequences have a sufficiently high degree of identity to be homologous as defined herein, can suitably be investigated by aligning the two sequences using a computer program known in the art, such as "GAP" provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711)(Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453). Using GAP with the following settings for DNA sequence comparison:

GAP creation penalty of 5.0 and GAP extension penalty of 0.3."

The term "coding sequence" or "encoding" is intended to cover a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon. The coding sequence typically include DNA, cDNA, and recombinant polynucleotide sequences.

The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The polypeptide may also be a naturally occurring allelic or engineered variant of a polypeptide.

The term "polynucleotide" denotes a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. "Nucleic acid construct" is defined herein as a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined and juxtaposed in a manner which would not otherwise exist in nature.

The term "operon" denotes a polynucleotide comprising several genes that are clustered and perhaps even transcribed together into a polycistronic mRNA, e.g. genes coding for the enzymes of a metabolic pathway. The transcription of an operon may be initiated at a promoter region and controlled by a neighboring regulatory gene, which encodes a regulatory protein, which in turn binds to the operator sequence in the operon to respectively inhibit or enhance the transcription.

The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.

The term "promoter" denotes a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.

"Tandem promoter" or "triple promoter" is defined herein as two, three, or more promoter sequences each of which is operably linked to the same polynucleotide coding sequence, and acting in concert they mediate the transcription of the coding sequence into mRNA.

"Operably linked" is defined herein as a configuration in which a control sequence, e.g. a promoter sequence, is appropriately situated in a position relative to a polynucleotide coding sequence, such that the control sequence directs the transcription of the coding sequence. "An mRNA processing/stabilizing sequence" is defined herein as a sequence located downstream of one or more promoter sequences and upstream of a coding sequence to which each of the one or more promoter sequences are operably linked such that all mRNAs synthesized from each promoter sequence may be processed to generate mRNA transcripts 5 with a stabilizer sequence at the 5' end of the transcripts. The presence of such a stabilizer sequence at the 5' end of the mRNA transcripts increases their half-life (Agaisse and Lereclus, 1994, supra, Hue et al., 1995, supra). The mRNA processing/stabilizing sequence is complementary to the 3¹ extremity of a bacterial 16S ribosomal RNA. In a preferred embodiment, the mRNA processing/stabilizing sequence generates essentially single-size o transcripts with a stabilizing sequence at the 5' end of the transcripts.

The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger 5 peptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.

The term "isolated", when applied to a polynucleotide molecule, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other o extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones. Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such 5 as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316:774-78, 1985). The term "an isolated polynucleotide" may alternatively be termed "a cloned polynucleotide". When applied to a protein/polypeptide, the term "isolated" indicates that the protein is found in a condition other than its native environment. In a preferred form, the isolated protein is o substantially free of other proteins, particularly other homologous proteins (i.e. "homologous impurities" (see below)). It is preferred to provide the protein in a greater than 40% pure form, more preferably greater than 60% pure form. Even more preferably it is preferred to provide the protein in a highly purified form, i.e. greater than 80% pure, more preferably greater than 95% pure, and even more preferably greater than 99% pure, as determined by 5 SDS-PAGE. The term "isolated protein/polypeptide may alternatively be termed "purified protein/polypeptide". The term "homologous impurities" means any impurity (e.g. another polypeptide than the polypeptide of the invention), which originate from the homologous cell where the polypeptide of the invention is originally obtained.

The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion.

The term "expression vector" covers a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of the invention, and which is operably linked to additional segments that provide for its transcription.

The term "host cell", as used herein, includes any Gram-positive bacterium which is susceptible to transformation with a nucleic acid construct.

Detailed description of the invention

In the first embodiment of the present invention, the polynucleotides of interest that comprise the polynucleotide-library, are cloned into an integration cassette resulting in the polynucleotides of interest being flanked by a first and a second DNA sequence. These flanking sequence should be homologous to parts of the host cell genome in order for the integration cassette to integrate into the host cell genome by homologous recombination with high efficiency. Integration by homologous recombination relies on nucleic acid sequences, the flanking sequences, for directing integration by homologous recombination into the genome of the Gram-positive host bacterium.

The term "flanking" polynucleotide segment in the present context means, that the segment is located no more than 10.000 bases from what it is flanking, preferably no more than 5.000 bases from what it is flanking, even more preferably no more than 2.000 bases away, and most preferably no more than 1.000 bases away from what it is flanking. These flanking nucleic acid sequences enable the cassette to be integrated into the host cell genome at a precise and predetermined location on the chromosome. The external ends of the flanking sequences may also contain non-homologous regions, however, at least a subsequence, homologous to a part of the host cell genome and of sufficient size, should be present in each flanking sequence in the proximal ends of the flanking sequences to the polynucleotide encoding the polypeptide of interest. To increase the likelihood of integration at a precise location, the integrational elements, the subsequences, should preferably contain a sufficient number of nucleic acids, such as at least 100 to at least 1 ,500 base pairs, particularly at least 800 base pairs to at least 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. In general the larger the size of the homologous subsequences the more efficient integration is obtained. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the Gram-positive bacterium. Furthermore, the integrational elements may be non- encoding or encoding nucleic acid sequences. The integration cassette contains no origin of replication and is introduce to the host cell in a linear form, thus forcing the construct to integrate in order not to be lost from the population.

Accordingly, in a preferred embodiment of the first aspect, the 5' and the 3' flanking polynucleotide segments each comprise at least 500 bp, preferably at least 1000 bp, more preferably at least 1500 bp, and most preferably at least 2000 bp of non-homologous polynucleotides located in the 5' and the 3' end of the 5' and the 3' flanking segments, respectively

The cassette comprising the polynucleotide of interest can be introduced into the host cell by any known method in the art, such as electroporation or natural uptake, and cells comprising the cassette integrated on the genome can be selected for or screened for in case the polynucleotide itself encodes a selectable or screenable marker protein. In another preferred embodiment of the first aspect, the integration cassette further comprises a marker gene located between the 5' and 3' flanking segments

A selectable marker permits easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, erythromycin, chloramphenicol or tetracycline resistance. Furthermore, selection may be accomplished by co-transformation, e.g., as described in WO 91/09129, where the selectable marker is on a separate vector.

In one embodiment of the invention the cassette comprises a transcriptional control region. A control region may be native or foreign to the nucleic acid sequence encoding the polypeptide. In addition to the tandem or "consensus" promoter, described earlier, such control sequences include, but are not limited to, a leader, a signal sequence, and a transcription terminator. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the 5 coding region of the nucleic acid sequence encoding a polypeptide.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a Gram-positive bacterium to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the o polypeptide. Any terminator which is functional in the Gram-positive bacterium of choice may be used in the present invention.

The control sequence may also be a suitable leader sequence, a non-translated region of an mRNA which is important for translation by the Gram-positive bacterium. The leader s sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence which is functional in the Gram-positive bacterium of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region that codes for an amino o acid sequence linked to the amino terminus of the polypeptide which directs the expressed polypeptide into the cell's secretory pathway. The signal peptide coding region may be native to the polypeptide or may be obtained from foreign sources. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region 5 which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to that portion of the coding sequence which encodes the secreted polypeptide. The foreign signal peptide coding region may be required where the coding sequence does not normally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply 0 replace the natural signal peptide coding region in order to obtain enhanced secretion of the polypeptide relative to the natural signal peptide coding region normally associated with the coding sequence. The signal peptide coding region may be obtained from an amylase or a protease gene from a Gram-positive bacterium species. However, any signal peptide coding region capable of directing the expressed polypeptide into the secretory pathway of a Gram- 5 positive bacterium of choice may be used in the present invention. In one embodiment the cassette comprises at least one promoter. In another embodiment the integration cassette comprises a mRNA processing/stabilizing sequence located downsteam of the 5' flanking segment and/or downstream of the at least one promoter, and upsteam of the polynucleotide of interest. In a further embodiment the cassette comprises a terminator downstream of the polynucleotide of interest.

The promoter comprised in the control region may be operably linked to the polynucleotide of interest and alternatively also to an mRNA processing/stabilizing sequence, as well as one or more additional control sequences which direct the expression of the coding sequence in a Gram-negative bacterium under conditions compatible with the control sequences. Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

The promoter could be any promoter suitable for directing or controlling expression of the polynucleotide of interest in the host cell of choice. The promoter could e.g. be an inducible promoter, or a tandem promoter. Each promoter sequence of the tandem promoter may be any nucleic acid sequence which shows transcriptional activity in the Gram-positive bacterial cell of choice including a mutant, truncated, and hybrid promoter, and may be obtained from genes encoding extracellular or intracellular polypeptides that are either homologous or heterologous to the Gram-positive bacterial cell. Each promoter sequence may be native or foreign to the polynucleotide sequence which it is operably linked to. The promoter sequences of tandem or triple promoters may be the same promoter sequence or different promoter sequences.

In a particular embodiment, the promoter sequences may be obtained from a bacterial source. In a more particular embodiment, the promoter sequences may be obtained from a Gram-positive bacterium such as a Bacillus strain, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium,

Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis; or a Streptomyces strain, e.g., Streptomyces lividans or Streptomyces murinus; or from a Gram- negative bacterium, e.g., E. coli or Pseudomonas sp.

An example of a suitable promoter for directing the transcription of a nucleic acid sequence in the methods of the present invention is the promoter obtained from the E. coli lac operon. Another example is the promoter of the Streptomyces coelicolor agarase gene (dagA). Another example is the promoter of the Bacillus lentus alkaline protease gene (aprH). Another example is the promoter of the Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene). Another example is the promoter of the Bacillus subtilis 5 levansucrase gene (sacB). Another example is the promoter of the Bacillus subtilis alpha- amylase gene (amyE). Another example is the promoter of the Bacillus licheniformis alpha- amylase gene (amyL). Another example is the promoter of the Bacillus stearothermophilus maltogenic amylase gene (amyM). Another example is the promoter of the Bacillus amyloliquefaciens alpha-amylase gene (amyQ). Another example is a "consensus"

10 promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region. Another example is the promoter of the Bacillus licheniformis penicillinase gene (penP). Another example are the promoters of the Bacillus subtilis xylA and xylB genes. Another example is the promoter of the Bacillus thuringiensis subsp. tenebrionis CrylllA gene or portions thereof (Novozymes: WO 99/43835). Another example is the promoter of is the prokaryotic beta-lactamase gene (Villa-Kamaroff et a/., 1978, Proceedings of the National Academy of Sciences USA 75:3727-3731). Another example is the promoter of the spol bacterial phage promoter. Another example is the tac promoter (DeBoer et a/., 1983, Proceedings of the National Academy of Sciences USA 80:21-25). Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980,

20 242:74-94; and in Sambrook, Fritsch, and Maniatus, 1989, Molecular Cloning, A Laboratory

Manual, 2d edition, Cold Spring Harbor, New York.

The two or more promoter sequences of the tandem promoter may simultaneously promote the transcription of the nucleic acid sequence. Alternatively, one or more of the promoter 25 sequences of the tandem promoter may promote the transcription of the nucleic acid sequence at different stages of growth of the Bacillus cell.

In a particular embodiment, the tandem promoter contains at least the amyQ promoter of the Bacillus amyloliquefaciens alpha-amylase gene. In another embodiment, the tandem

30 promoter contains at least a "consensus" promoter having the sequence TTGACA for the "-

35" region and TATAAT for the "-10" region. In another embodiment, the tandem promoter contains at least the amyL promoter of the Bacillus licheniformis alpha-amylase gene. In another embodiment, the tandem promoter contains at least the crylllA promoter or portions thereof (Agaisse and Lereclus, 1994, supra).

35 In a more particular embodiment, the tandem promoter contains at least the amyL promoter and the crylllA promoter. In another more particular embodiment, the tandem promoter contains at least the amyQ promoter and the crylllA promoter. In another more particular embodiment, the tandem promoter contains at least a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region and the cty///>4 promoter. In another more particular embodiment, the tandem promoter contains at least two copies of the amyL promoter. In another more particular embodiment, the tandem promoter contains at least two copies of the amyQ promoter. In another more particular embodiment, the tandem promoter contains at least two copies of a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region. In another more particular embodiment, the tandem promoter contains at least two copies of the crylllA promoter.

The construction of a "consensus" promoter may be accomplished by site-directed mutagenesis to create a promoter which conforms more perfectly to the established consensus sequences for the "-10" and "-35" regions of the vegetative "sigma A-type" promoters for Bacillus subtilis (Voskuil et al., 1995, Molecular Microbiology 17: 271-279). The consensus sequence for the "-35" region is TTGACA and for the "-10" region is TATAAT. The consensus promoter may be obtained from any promoter which can function in a Bacillus host cell.

In a particular embodiment, the "consensus" promoter is obtained from a promoter obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus lentus alkaline protease gene (aprH), Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis alpha-amylase gene (amyE), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha- amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis subsp. tenebrionis CrylllA gene or portions thereof, or prokaryotic beta-lactamase gene spol bacterial phage promoter.

In a more particular embodiment, the "consensus" promoter is obtained from Bacillus amyloliquefaciens alpha-amylase gene (amyQ). In a most particular embodiment, the consensus promoter is the "consensus" amyQ promoter contained in nucleotides 1 to 185 of SEQ ID NO. 26 or SEQ ID NO. 27 in WO 99/43835 which are incorporated herein by reference. In another most particular embodiment, the consensus promoter is the short "consensus" amyQ promoter contained in nucleotides 86 to 185 of SEQ ID NO. 26 or SEQ ID NO. 27 in WO 99/43835.

In a preferred embodiment of the first aspect, the at least one promoter comprises two 5 promoters derived from an amyL, amyQ, or crylllA gene. Even more preferably the at least one promoter comprises three promoters derived from an amyL, amyQ, or crylllA gene.

Another preferred embodiment relates to a method of the first aspect, wherein the at least one promoter comprises a "consensus" promoter having the sequence TTGACA for the "- o 35" region and TATAAT for the "-10" region.

In still another preferred embodiment, the integration cassette comprises a mRNA processing/stabilizing sequence located downstream of the at least one promoter and upstream of the polynucleotide encoding the polypeptide(s) of interest, preferably the mRNA s processing/stabilizing sequence is derived from the cryl I Va-gene.

In a preferred embodiment, the at least one promoter is one that results in that the host cells produce the polypeptide(s) of interest in a yield of at least 10 mg/l.

0 One preferred embodiment relates to where the integration cassette comprises a terminator downstream of the polynucleotide encoding the polypeptide(s) of interest.

The polynucleotide of interest can be inserted into the integration cassette by standard cloning procedures and may be inserted in a multiple cloning site, and in one embodiment 5 the integration cassette comprises a multiple cloning site with at least one recognition site for a restriction nuclease.

The techniques used to isolate or clone a polynucleotide or a nucleic acid sequence encoding a polypeptide are well known in the art and include, for example, isolation from o genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleic acid sequences from such genomic DNA can be effected, e.g., by using antibody screening of expression libraries to detect cloned DNA fragments with shared structural features or the well known polymerase chain reaction (PCR). See, for example, Innis et a/., 1990, PCR Protocols: A Guide to Methods and Application, Academic Press, New York. Other nucleic 5 acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT), and nucleic acid sequence-based amplification (NASBA) may be used. The cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into a Bacillus cell where clones of the nucleic acid sequence will be replicated. The nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.

The polynucleotide comprised in the integration cassette, which polynucleotide is a part of the DNA library, can in the context of the present invention originate from several sources. In one embodiment the polynucleotide can be obtained from random DNA fragments, e.g. genomic DNA digested with a restriction enzyme and inserted into the integration cassette in a suitable cloning site. In another embodiment the DNA library of polynucleotides comprises mutants or variants of the same native polynucleotide, allelic variants, or comprises homologous polynucleotides isolated from nature, gene families, or both. In still another embodiment the DNA library of polynucleotides originates from at least two wild type organisms of different genera or preferably from different species.

Mutants or variants of the same native polynucleotide can be obtained by known techniques in the art, like e.g. random mutagenesis and/or DNA recombination like e.g. DNA shuffling. Shuffling between two or more homologous input polynucleotides (starting-point polynucleotides) involves fragmenting the polynucleotides and recombining the fragments, to obtain output polynucleotides (i.e. polynucleotides that have been subjected to a shuffling cycle) wherein a number of nucleotide fragments are exchanged in comparison to the input polynucleotides.

DNA recombination or shuffling may be a (partially) random process in which a library of chimeric genes is generated from two or more starting genes. A number of known formats can be used to carry out this shuffling or recombination process.

The process may involve random fragmentation of parental DNA followed by reassembly by PCR to new full-length genes, e.g. as presented in US5605793, US5811238, US5830721 , US6117679. In-vitro recombination of genes may be carried out, e.g. as described in US6159687, WO98/41623, US6159688, US5965408, US6153510. The recombination process may take place in vivo in a living cell, e.g. as described in WO 97/07205 and WO 98/28416. The parental DNA may be fragmented by DNA'se I treatment or by restriction endonuclease digests as descriobed by Kikuchi et al (2000a, Gene 236:159-167). Shuffling of two parents may be done by shuffling single stranded parental DNA of the two parents as described in Kikuchi et al (2000b, Gene 243:133-137).

5

A particular method of shuffling is to follow the methods described in Crameri et al, 1998, Nature, 391: 288-291 and Ness et al. Nature Biotechnology 17: 893-896. Another format would be the methods described in US 6159687: Examples 1 and 2.

o Accordingly, a preferred embodiment relates to where the polynucleotide encoding the polypeptide(s) of interest comprises natural homologues or variants of a gene or operon, synthetic homologues or variants of a gene or operon, or a library of shuffled or recombined homologues or variants of a gene or operon. Even more preferably the synthetic homologues or variants of a gene or operon, or the library, are provided by DNA breeding or s DNA shuffling. Still more preferably the polynucleotide encoding the polypetide(s) of interest is a recombinant polynucleotide.

The polynucleotide of interest may encode a polypeptide, which polypeptide comprises a hormone or variant thereof, enzymes, receptors or portion thereof, antibodies or portion o thereof, or reporters.

In a preferred embodiment, the polypeptide(s) of interest is one or more enzyme(s), a membrane associated protein(s), or an anti-microbial peptide(s). Preferably the one or more enzyme(s) is an enzyme(s) of a class selected from the group of enzyme classes consisting 5 of oxidoreductases (EC 1), transferases (EC 2), hydrolases (EC 3), lyases (EC 4), isomerases (EC 5), and ligases (EC 6).

In another embodiment the one or more enzyme(s) is an enzyme(s) selected from the group of enzymes consisting of aminopeptidase, amylase, amyloglucosidase, mannanase, o carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, 5 transglutaminase, and xylanase. In one particular embodiment the enzyme is an amylase or a mannanase, in particular the amylase commercially available as Termamyl™ or the mannanase commercially available as Mannaway™ (both Novozymes A/S, Denmark).

In a most particular embodiment, the polypeptide is a serine protease, for example, a subtilisin. In another most particular embodiment, the polypeptide is a maltogenic amylase. In another most particular embodiment, the polypeptide is a pullulanase.

In yet another embodiment the polypeptide comprises cellulose binding domains, starch binding domains, antibodies, antimicrobial peptides, hormones, or fusion polypeptides.

In still a further embodiment the polynucleotide comprises an operon or several genes encoding polypeptides comprised in a metabolic pathway.

Another embodiment relates to where the one or more enzyme(s) is an enzyme(s) involved in the biosynthesis of hyaluronic acid.

The method according to the present invention relates to the generation of a library of polynucleotides integrated on the host cell genome in a Gram-positive bacterium as described above. In a particular embodiment the Gram-positive bacterium comprises Bacillus sp or Lactobacillus sp. In a more particular embodiment the Bacillus sp. comprises Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.

In one particular embodiment the Bacillus sp is Bacillus subtilis.

According to the invention the integration cassette integrates by homologous recombination into the host cell genome. This integration event should preferably take place in the two flanking sequences and not in the polynucleotide of interest. Further the integration should not result in an integration into, or a disruption of the expression of an essential gene of the host cell.

In one particular embodiment the homologous region of the 5' and/or the 3' flanking segment is comprised in the yfmD-yfmC-yfmB-yfmA-pelB-yflS-citS region of the Bacillus subtilis genome or is comprised in the cryllla promoter. As exemplified below, the integration cassette may also be introduced as comprised in a plasmid. It may be of advantage to include the cassette in a plasmid which is not able to replicate in Bacillus but which replicates well in another host for ease of handling, such as in E. coli. Accordingly, in a preferred embodiment of the invention, the non-replicating linear integration cassette is comprised in a plasmid, and is introduced into the host cell in this form. In addition, the plasmid may be capable of replicating in an E. coli host cell, but not in a Bacillus host cell. In one embodiment, an additional step is carried out between steps i) and ii) of the first aspects, said step comprising introducing the plasmid into an intermediate E.coli host cell and propagating it therein by replication.

In a second aspect the present invention relates to a DNA construct or a non-replicating linear Gram-positive host cell integration cassette for use in the integration of a polynucleotide of interest into the host cell genome. The construct must comprise the polynucleotide of interest flanked by two polynucleotide sequences, a first and a second DNA sequence, which flanking sequences each must comprise at least one subsequence of sufficient homology to a region on the host cell genome in order for efficient recombination to occur as describe for the method of the invention.

In one embodiment the DNA construct or integration cassette further comprises at least one promoter which is a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region, and/or which is derived from one or more of the following genes: amyL, amyQ, amyE, amyM, crylllA, dagA, aprH, penP, sacB, spol, tac, xylA, and xylB, said promoter(s) being located between the flanking segments and being being operably linked to the polynucleotide encoding one or more polypeptide(s) of interest.

In one embodiment the bacterial genome comprises a Bacillus sp. genome and more particularly genomes selected from the group consisting of Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis genomes.

In another embodiment the integration cassette is comprised in a plasmid, and preferably the plasmid is capable of replicating in an E. coli host cell, but not in a Bacillus host cell. In still another aspect the present invention relates to a use of the DNA construct according to the invention for making a genomically integrated polynucleotide library in a Gram-positive host cell, like e.g. a Bacillus sp.

After integration the host cells of the present invention are cultivated in a suitable nutrient medium under conditions permitting the production of the desired polypeptide, after which the resulting polypeptide optionally is recovered from the cells, or the culture broth.

In another aspect the invention therefore relates to a method for producing a polypeptide of interest comprising culturing cells containing the DNA construct of the invention integrated on the host cell genome under conditions promoting expression of the polypeptide of interest, wherein the said cells have been selected or screened for by the method of the invention. The produced polypeptide can optionally be purified or isolated.

The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). The media are prepared using procedures known in the art (see, e.g., references for bacteria and yeast; Bennett, J.W. and LaSure, L., editors, More Gene Manipulations in Fungi, Academic Press,

CA, 1991).

If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates. The polypeptide may be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gelfiltration chromatography, affinity chromatography, or the like, dependent on the type of polypeptide in question.

The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide. The resulting polypeptide may be recovered by methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The polypeptides encoded by the polynucleotides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art.

The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Examples Materials and methods

B.subtilis PL2306. This strain is the B.subtilis DN1885 with disrupted apr and npr genes (Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, B. R., Sjøholm, C. (1990) Cloning of aldB, which encodes alpha-acetolactate decarboxylase, an exoenzyme from Bacillus brevis. J. Bacteriol., 172, 4315-4321) which is also disrupted in the transcriptional unit of the known Bacillus subtilis cellulase gene, resulting in cellulase negative cells. The disruption was performed essentially as described in ( Eds. A.L. Sonenshein, J.A. Hoch and Richard Losick (1993) Bacillus subtilis and other Gram-Positive Bacteria, American Society for microbiology, p.618).

Competent cells were prepared and transformed as described by Yasbin, R.E., Wilson, G.A. 5 and Young, F.E. (1975) Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol, 121:296-304.

Unless otherwise stated, all the DNA manipulations and transformations were performed o using standard methods of molecular biology (Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology". John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990). nzymes for DNA manipulations were used according to the manufacturer's s instructions (restriction endonucleases, ligases etc. are obtainable from New England Biolabs, Inc.).

The Bacillus subtilis strain used as donor organism for cromosomal DNA was propagated in liquid medium 3 as specified by ATCC (American Type Culture Collection, USA). After 18 o hours incubation at 37°C and 300 rpm, the cells were harvested, and genomic DNA was isolated by the method described by Pitcher et al. [Pitcher, D. G., Saunders, N. A., Owen, R. J; Rapid extraction of bacterial genomic DNA with guanidium thiocyanate; Lett Appl Mjcrobioi 1989 8 151-156)

5 PS-1 medium, sterilized after mixing:

Sugar 100.0 g

Crushed soy 40.0 g

Na₂HPO₄*12H₂O 10.0 g

CaCO₃ 5.0 g 0 Pluronic PE 6100 0.1 ml

Water up to 1,000.0 ml

Example 1 : Establishing an integrational cassette for BPN' libraries

The invention will be further illustrated by a first embodiment of an integration cassette 5 comprising: The coding sequence of the subtilisin BPN' operationally linked to a triple promoter, a marker gene (a spectinomycin resistance gene surrounded by resolvase res- sites), and pectate lyase encoding genes from Bacillus subtilis as flanking segments comprising the following homologous 5' polynucleotide region upstream of the polynucleotide [yfmD-ytmC-yfmB-yfmA-Pel-start], and the 3' polynucleotide region downstream of the polynucleotide [Pel-end-yflS-citS(start)], respectively.

The cassette was made by the joining of several different PCR fragments. After the final PCR reaction the PCR product was used for transformation of naturally competent B. subtilis. One clone denoted PL3598-37 was confirmed by sequencing to contain the correct construct.

10

The PL3598-37 clone thus contains the following:

1. The flanking regions 100% homologous to region of the B.subtilis genome (appears as the upstream fragment yfmD-ytmC-yfmB-yfmA-Pelstart and the downstream fragment Pel-end-yflS-citS(start)). i5 2. The Spectinomycin resistance gene flanked by Resolvase sites (res).

3. The triple promoter region plus CrylllA mRNA stabilising leader sequence.

4. The BPN' Open Reading Frame.

Construction of triple promoter BPN' cassette

20 A PCR fragment comprising the integrational cassette for a BPN' library was constructed by PCR, thus operably linking a triple promoter (as described in WO 99/43835; Novozymes) to a BPN' expression cassette from a Bacillus strain. The triple promoter is a fusion of an optimized Bacillus amyL-derived promoter (as shown in WO 9310249; Novozymes) in fusion with two promoters scBAN and crylllA, where the first is a consensus version of the Bacillus

25 amyloliquefaciens amylase BAN promoter, and the latter includes a mRNA-stabilising sequence (as described in WO 99/43835; Novozymes). Suitable primers can be derived from the publicly available sequences (Vasantha, N. et al. Genes for alkaline protease and neutral protease from Bacillus amyloliquegaciens contain a large open reading frame between the regions coding for signal sequence and mature protein. J. Bacteriol. 159:811

30 (1984) EMBL: accession No. K02496). A Kpnl and a Sail restriction site was introduced to flank the PCR fragment at each end, using the primers:

#252639 (SEQ ID NO: 1) 5' catgtgcatgtgggtaccgcaacgttcgcagatgctgctgaagag #251992 (SEQ ID NO: 2) 5' catgtgcatgtggtcgaccgattatggagcggattgaacatgcg

35 The Kpnl and Sail restriction sites in the PCR fragment were subsequently used to clone the the fragment into a Kpnl-Sall digested Peel-Spec PCR fragment. The Peel-Spec fragment comprises a Spectinomycin resistance gene inserted in the middle of the B.subtilis Pectate lyase gene plus approx. 2.3 kb of upstream genomic DNA and approx. 1.7 kb downstream 5 genomic DNA. The Peel-Spec fragment was produced by PCR amplification of genomic DNA from the B.subtilis strain MB1053, using the primers:

#179541 (SEQ ID NO: 3): 5' gcgttgagacgcgcggccgcgagcgccgtttggctgaatgatac #179542 (SEQ ID NO: 4): 5' gcgttgagacagctcgagcagggaaaaatggaaccgctttttc 0

Construction of MB1053

The MB1053 B.subtilis strain was constructed by deletion of the Pectate lyase gene through direct integration of a PCR product into a wild-type B.subtilis typestrain genome. This was achieved by a PCR amplification of genomic DNA directly downstream and upstream of the s Pectate lyase gene of the B.subtilis.

The ends of the genomic DNA directly preceding and proceeding the Pel gene are elongated through primer insertion of sequences being 100% homologous to DNA sequences defined by the ends of a third PCR fragment encoding a marker gene surrounded by Resolvase 0 (Res) sites. In this particular case the marker gene is that of Spectinomycin with surrounding Res sites altogether present on the plasmid pSJ3358 (described In US patent 5882888). Three different PCR fragments were initially produced.

Fragment 1: this fragment covers from the yfmD gene to the middle of the Pel gene and 5 introduces an overhang to the Res-Spec-Res cassette at the Pel gene. The size of fragment 1 is 2.8 kb. The fragment was produced by a PCR amplification chromosomal DNA from the B.subtilis strain PL2306, using the primers:

#179541 (SEQ ID NO: 3), and o #179539 with overlap to #179154 Spec primer (SEQ ID NO: 5):

5' ccatttgatcagaattcactggccgtcgttttacaaccattgcggaaaatagtcataggcatcc

Fragment 2: this fragment covers from the middle of the Pel gene to after the end of the CitS gene and introducing an overhang to the Res-Spec-Res cassette at the middle of the Pel 5 gene. The size of fragment 2 is 2.3 kb. The fragment was produced by a PCR amplification of chromosomal DNA from the B.subtilis strain PL2306, using the primers: #179542 (SEQ ID NO: 4), and

#179540 with overlap to #179153 Spec primer (SEQ ID NO: 6):

5' ggatccagatctggtacccgggtctagagtcgacgcggcggttcgcgtccggacagcaca

Fragment 3: this fragment contains the Spectinomycin gene surrounded by Res sites and DNA sequences in the ends overlapping with PCR fragment 1 and 2. The size of fragment 3 is 1.6 kb. Fragment 3 was produced by PCR amplification of plasmid pSJ3358, using the primers:

#179154 (SEQ ID NO: 7): 5' gttgtaaaacgacggccagtgaattctgatcaaatgg #179153 (SEQ ID NO: 8): 5' ccgcgtcgacactagacacgggtacctgatctagatc

Standard conditions for the PCR reaction For the PCR amplifications of fragment 1-3 the HiFi Expand™ PCR system (Roche) was used together with the following cycling scheme: 5 μl Buffer 2

14 μl dNTP's (1.25 mM each) 2.5 ud 20 μM primer 1 2.5 μl 20μM primer 2 x μl water To this mix 3 μl of DNA (apx. 100 ng) and 0.75 μl Enzyme mix (use hot start) is added. Total volume is 50 μl. The cycling profile is: 1 cycle of 120 sec at 94^°C

Break.

10 cycles of 15 sec at 94°C, 60 sec at 60^°C, 240 sec at 72°C.

20 cycles of 15 sec at 94°C, 60 sec at 60°C, (180 sec at 72^°C add 20 sec pr cycle)

1 cycle 600 sec at 68^°C.

The three PCR fragments were made and joined in later JOINING-PCR reactions. The three PCR fragments were single sharp bands and no gel purification was necessary. Only Qiagen™ PCR purification was performed prior to the following JOINING-PCR. JOINING of fragment 1 + 3 (same procedure for fragment 2 + 3): 5 μl Buffer 2

8 μl dNTPs (1.25 mM each) 5.0 μl Fragment 3 5.0 μl Fragment 1 9.25 μl water

1 cycle of 120 sec at 94^°C.

Break. Add Enzyme

10 cycles of 15 sec at 94^°C, 60 sec at 60^°C, 240 sec at 72^°C. Break. Add Primers

15 cycles of 15 sec at 94"C, 60 sec at 60^°C,(180 sec at 72^°C add 20 sec pr cycle) 1 cycle 600 sec at 68^° C.

After the first cycle at 94°C for 120 sec there is a break, where 0.75 μl Enzyme mix is added. Total volume is now 45.0 μl.

After the initial 10 cycles, there is another break in the cycling and for fragment 1+3: 2.5 μl (20μM #179541) and 2.5 μl (20 μM #179153) are added and for fragment 2+3: 2.5 μl (20μM #179542) and 2.5 μl (20 μM #179154) are added and the cycling is continued for 15 cycles more.

The PCR products were then gel purified: The size of fragment 1 +3 should be 3.4 kb and the size of fragment 2+3 should be 3.4 kb.

These two fragments were joined in a last PCR reaction:

Last JOINING-PCR (Expand™ long system, Roche). 5 μl Buffer 1 14 μl dNTP's (1.25 mM each)

5.0 μl Fragment 1+3 5.0 μl Fragment 2+3 17.75 μl water After the first cycle at 94°C for 120 sec there is a break, where 0.75 μl Enzyme mix is added. Total volume is now 45.0 μl.

After the initial 10 cycles, there is another break in the cycling and 2.5 μl (20μM #179541) and 2.5 μl (20 μM #179542) is added and the cycling is continued for 15 cycles more.

1 cycle of 120 sec at 94°C. Break. Add Enzyme 10 cycles of 15 sec at 94^°C, 60 sec at 60°C, 240 sec at 68^°C.

Break. Add Primers 15 cycles of 15 sec at 94^°C, 60 sec at 60^°C, 180 sec at 68^°C add 20 sec pr cycle 1 cycle 600 sec at 68° C.

The size of the joined PCR fragment is 6.8 kb. This PCR fragment was purified using Qiagen PCR purification kit and 5 μl of the 50 μl eluted DNA was used to transform a standard B.subtilis strain. After transformation cells were spread onto LBPG-120μg/ml of Spectinomycin. Next day more than 1000 colonies were seen. 8 of these were checked using PCR primers from last JOINING PCR amplification yielding PCR fragment of 6.8 kb rather than the 5.2 kb expected if deletion had not occurred. Furthermore the Pectyate lyase activity of the clones was checked with the Mancini Immunoassay, which showed no reactivity towards the Pectate lyase activity. This taken together with the Spec resistance tells us that deletion had occurred. One such clone was selected and denoted MB1053.

Insertion of BPN' expression cassette adjacent to the res-spec-res in MB1053 The ligation mix of the digested PCR amplified triple promoter BPN' expression cassette and the Kpnl-Sal digested Peel-Spec PCR fragment was used as template in a PCR amplification using the PCR primers #179541 and #179542. This resulted in a PCR fragment of approx. 9 kb, which was used to transform B.subtilis PL1801 (Diderichsen, B et al. 1990. Cloning of aldB, which encodes alpha-acetolactate decarboxylase, an exoenzyme from Bacillus brevis. J. Bacteriol., 172, 4315-4321) competent cells. The transformed cells were plated on LB-120 μg/ml Spectinomycin agar plates with skim milk. Spectinomycin resistant colonies with large skim milk clearing zones were restreaked on Spectinomycin agar plates and analysed for the integration of the PCR fragment with PCR using the primers #179541 and #179542.

Appearance of a 9 kb fragment indicates that the PCR fragment has been integrated into the host cell genome. Several of these clones were sequenced to confirm integration of the expression cassette, one such clone was selected and denoted PL3598-37.

Example 2: Data from 10 different clones fermented in PS-1.

Chromosomal DNA purified from PL3598-37 was used as template in a PCR amplification using the PCR primers #179541 and #179542 (see example 1). The amplified 9 kb PCR fragment was used to transform B.subtilis PL1801 competent cells. Ten randomly picked Spectinomycin resistant colonies with large skim milk clearing zones were reisolated and analysed by PCR for the integration of the PCR fragment using the PCR primers #179541 and #179542. These ten clones were named MB1341-1 to MB1341-10.

The clones were fermented in PS-1 at 30°C, 300 rpm for 4 days. Culture broth was analyzed for the quantity of BPN' by measuring the proteolytic activity in KNPU(S)/g (assay below). The results are shown in Figure 1. These results indicate that the expression levels are high and that they are comparably even in all ten clones, There was a 13.3% difference between the lowest value to the average and 15.6% difference between the highest value to the average. These differences are believed to be within the deviation of the different methods and assays involved.

Proteolytic Activity assay (KNPU):

In the context of this invention proteolytic activity is expressed in Kilo NOVO Protease Units (KNPU). The activity is determined relatively to an enzyme standard (SAVINASE), and the determination is based on the digestion of a dimethyl casein (DMC) solution by the proteolytic enzyme at standard conditions, i.e. 50°C, pH 8.3, 9 min. reaction time, 3 min. measuring time. A folder AF 220/1 is available upon request to Novo Nordisk A/S, Denmark, which folder is hereby included by reference.

Example 3: Transformation efficiency as a function of fragment size To test the relation between fragment size of the DNA to be integrated into the genome of a host cell and the transformation efficiency of integration, were different sizes of fragments constructed with PCR. Chromosomal DNA purified from PL3598-37 was used as template in a series of PCR amplifications. PCR primer pairs were designed to amplify the given region of the cassette plus varying lengths of the upstream and downstream sequences surrounding the Pectate lyase gene. The use of different sizes of flanking homologous region was tested to identify the sizes most appropriate for making large libraries.

The following were tested:

I) A PCR fragment designed to have the whole pelB but no extra bp up or downstream of pelB, using primers:

#243366 (SEQ ID NO: 9) 5' gtacctcgcgagcggccgcttcttaatttaatttacccgcacccgc #243364 (SEQ ID NO: 10) 5' cattctgcagccgcggcagctgatttaggccaccagacg II) A PCR fragment designed to have the whole pelB as well as 500 bp upstream and 500 bp downstream, using primers:

#258977 (SEQ ID NO: 11) 5' tgtagaggaattgcagaaaatgggtg #258978 (SEQ ID NO: 12) 5' ccgaatttctgaacgaatacatacg

III) A PCR fragment designed to have the whole pelB as well as 1.0 kbp upstream and 1.0 kbp downstream, using primers:

#258980 (SEQ ID NO: 13) 5'gcaccaaaagaaacacgataaccatg #258979 (SEQ ID NO: 14) 5'gtgctgagataaccggacaatttcttttc

IV)A PCR fragment designed to have have the whole pelB as well as 2.3 kbp upstream and 1.7 kbp downstream, using primers: #179541 (SEQ ID NO: 3), and #179542 (SEQ ID NO: 4)

V) A PCR fragment designed to have have the whole pelB as well as 3.3 kbp upstream and 2.6 kbp downstream, using primers: #260558 (SEQ ID NO: 15) 5' gagtatcgccagtaaggggcg #260559 (SEQ ID NO: 16) 5' gcagccctaaaatcgcataaagc

V) A PCR fragment designed to have the whole pelB as well as 3.3 kbp upstream and 2.6 kbp downstream.

The transformation efficiencies of fragments I to IV were compared. This was done using the same pool of competent cells and transforming 80 μl of competent cells mixture. The amounts of DNA of each fragment (l-V) were measured using spectrophotometer and each solution was measured three times to get accurate measures. In order to have the same number of DNA molecules of each fragment in the transformation, the amount of DNA was adjusted according to its number of bp. This should make it possible to compare the transformation efficiencies directly. Using the data from the data series using 0.5 μg of fragment IV and identical number of molecules of the other fragments gave the following transformation titers:

I) 2; II) 5; III) 25; IV) 355.

This result clearly indicates that the larger the length of flanking regions used, the higher is the transformation efficiency. In a new experiment the fragments III, IV and V were tested and compared as described above. The transformation titers were (less material and worse competent cells were used, therefore 0 transformants in 111): 111) 0; IV) 27; V) 118.

Again the results clearly indicate that the larger the length of flanking regions used, the higher is the transformation efficiency.

If comparing the transformation efficiency of the fragments in the first and the second round of transformation a comparable theoretical value for fragment V under the conditions of the first experiment can be calculated:

V) 1551 (*Calculated from the results in the second series).

In conclusion we get approximately 4 times higher transformation efficiencies when using fragment V compared to fragment IV.

The total size of fragment V is around 10 kb. With the use of fragment V it is possible to create libraries in Bacillus at a size equal to the size of standard multimerized plasmid libraries, i.e. 100-200.000 transformed cells in a single library.

Example 4: Establishing the preferred amount of DNA to be used in transformation.

To optimize the transformation using PCR fragments we tested the use of different DNA amounts in transformation of the same batch of competent cells.

An integration cassette containing the Savinase gene with a size of 10 kbp (constructed in a similar way to the preceding examples) rather than the BPN', was used in the following experiment.

The amounts of DNA were measured using spectrophotometer and the solutions were measured three times each to get an accurate measure of the DNA concentrations. The transformation was performed using standard techniques. The transformed cells were plated on LB-skimmilk-4μg/ml CAM and incubated overnight at 37°C. The results were: Amount of DNA used Total number of transformants 250 ng 33.300

500 ng 55.800 1250 ng 76.500

2500 ng 156.600 5000 ng 150.300

From these results it can be concluded that there is a near linear increase in the number of transformants as the amount of added DNA increases, but at a certain point the amount of DNA reaches a saturation level and there is no further increase in the number of transformants. It is clear that the highest transformation efficiency per ng DNA is achieved around 250 ng, and that even lower amounts of DNA could give a higher transformation efficiency per ng DNA. Further experiments would be required to determine the optimum concentration more precisely.

Example 5: E.coli plasmid-borne integrational cassette for a library constructed In vivo An integration cassette to be used according to the method of the invention may be present on a E.coli plasmid (capable only of E.coli replication of the plasmid, not B.subtilis replication), the plasmid comprising: i) The DNA sequence encoding the Pre-Pro-domains of the subtilisin protease commonly known as Savinase, preceeded by and operably linked to ii) a DNA sequence comprising a mRNA stabilising segment derived in this particular case from the Cryllla gene; iii) a marker gene (a chloramphenicol resistance gene), and iv) genomic DNA from Bacillus subtilis as 5' and 3' flanking segments: The homologous 5' polynucleotide region upstream of the polynucleotide [yfmD-ytmC-yfmB- yfmA-Pel-start], and the 3' polynucleotide region downstream of the polynucleotide [Pel- end-yflS-citS(start)], respectively.

The cassette was made by several cloning steps involving digestion of pUC19 plasmid and PCR fragments with appropriate restriction endonuclease sites of several different PCR fragments in the generally used plasmid pUC19. After each ligation of a PCR fragment into a plasmid, the ligation mixture was transformed into electrocompetent DHδalpha E.coli cells that were prepared for and transformed by electroporation using a Gene Pulser™ electroporator from BIO-RAD as described by the supplier. One final plasmid construct (pMB1508) was confirmed by sequencing to contain the correct construct as outlined above.

The pMB1508 plasmid thus contains the following: i) The CrylllA mRNA stabilising leader sequence including a ribosome binding sequence (RBS), operationally linked to ii) DNA encoding the Pre-Pro-domains of the subtilisin commonly known as Savinase, including Kpnl and Notl sites for cloning; iii) The chloramphenicol resistance operon; iv) The 3' downstream flanking region [Pel-end-yflS-citS(start)] which is 99-100% homologous to the region of the B.subtilis.

The four elements listed were cloned in the pUC19 vector (Isolated from E.coli ATCC 37254; Vieira J, Messing J. The^' pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19: 259-268, 1982.) in the EcoRI and Sail sites to give pMB1508. In order for the resulting plasmid to integrate effeciently to a specified site of th B.subtilis genome, a new strain was established. The new strain is a derivative of Bacillus subtilis 168 BGSC ACCESSION NUMBER: 1A1 168 trpC2 . The strain was made competent and transformed as described above. Using elements from the PL3598-37 clone described above, the new integration strain denoted MB1510 was established and characterised to contain the following elements from PL3598-37: i) The triple promoter and the mRNA stabilising element. ii) Flanking segments comprising the following homologous polynucleotide region [yfmD- ytmC-yfmB-yfmA-Pel-start] upstream of the triple-promoter, and the polynucleotide region [Pel-end-yflS-citS(start)] downstream of the mRNA stabilizing element.

Thus, when using MB1510 competent cells, it is possible for the pMB1508 (or derivatives therof) to directly integrate into the genome of MB1510 where the two flanking regions in fusion with the triple-promoter and mRNA stabilising element is located, resulting in a construction where the incoming PrePro encoding encoding DNA of pMB1508DNA has been integrated in the correct reading frame with the tripel-promoter, the mRNA stabilising element and the RBS. Thus resulting in high expression of the integrated gene from the promoter elements already present on the genome of MB1510.

Transformation effeciency was established for the B.subtilis strain MB1510 transformed with E.coli prepared plasmid pMB1508. The efficiency of the transformation was comparable to those obtained by using the wholly PCR based integration cassette approach described above.

For further testing of the potential of using this approach, the Savinase encoding gene of

Bacillus clausii was PCR amplified using the two PCR primers: Primer #317 (SEQ ID NO: 17) 5' tggcgcaatcggtaccatgggg

Primer #139 Notl (SEQ ID NO: 18) 5' catgtgcatgcggccgcattaacgcgttgccgcttctgcg The resulting ~0.8 kb of the Savinase fragment and the pMB1508 plasmid are digested with Kpnl and Notl, and the resulting fragments are then purifiied by agarose gel electrophoresis. The two fragments are ligated, and the ligation mixture is used to transform competent E. coli cells which are then plated on LB-agar plates or placed in liquid media for growth overnight at 37°C; both types of media containing 50-100μg/ml of Ampicillin. After incubation, a plasmid prep is made of the liquid culture. The purified plasmid is used for transformation of competent cells of MB1510 (using 100-10.000 ng of plasmid per transformation. The transformed cells are plated onto TY medium with 2% skimmilk and 6 μg/ml of chloramphenicol for selection. After overnight incubation at 37°C clearing zones appear around those colonies wherein the integration cassette is integrated properly into the cells, indicating high Savinase expression.

This approach can also be used to make highly diverse libraries of any gene of interest expressable in B.subtilis, where rather than a gene encoding one enzyme, any expressable polynucleotide is inserted into the plasmid pMB1508 and integrated into the MB1510 strain for subsequent screening.

Seguence of plasmid PMB1508 (SEQ ID NO: 19) The plasmid pMB1508 has the following components, indicated by basepair positions:

BP 5186-395: pUC19 sequence from E.coli clone ATCC 37254, Vieira J, Messing J. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19: 259-268, 1982. BP 396-1021 : CrylllA mRNA stabilising element. (Described in WO 9634963-A1) BP 1022-1412: Encodes the Pre-Pro sequence of Savinase and the Notl cloning site. (Pre- Pro part described in eg. WO 9623073-A1 , the Notl site and the spacing between the Pre- Pro and Notl was introduced by the PCR primer.

BP 1413-2512: Chloramphenicol acetyl-transferase operon of pDN1050 (Described in eg. Diderichsen.B.; Poulsen.G.B.; Joergensen.S.T.; A useful cloning vector for Bacillus subtilis. Plasmid 30:312 (1993)).

BP 2513-5185: The polynucleotide region [Pel-end-yflS-citS(start)] downstream of the pelB locus of the B.subtilis genome, (as it appeaars from the publication and corresponding database of: F. Kunst, N. Ogasawara, I. Moszer, <146 other authors>, H. Yoshikawa, A. Danchin. "The complete genome sequence of the Gram-positive bacterium Bacillus subtilis" Nature (1997) 390:249-256). The Bacillus subtilis strain MB1510

MB1510 has the following specific features in and around the pelB locus: i) The triple promoter and the mRNA stabilising element including a RBS (Ribosome binding sequence). ii) Flanking segments comprising the following homologous polynucleotide region [yfmD- ytmC-yfmB-yfmA-Pel-start] upstream of the triple-promoter, and the polynucleotide region [Pel-end-yflS-citS(start)] downstream of the mRNA stabilizing sequence.

Genomic sequence of MB1510 integration region (SEQ ID NO: 20)

BP 1-2873: corresponds to sequence of Bacillus subtilis genome yfmD-ytmC-yfmB-yfmA- Pel-start (as it appeaars from the publication and corresponding database of: F. Kunst et al. "The complete genome sequence of the Gram-positive bacterium Bacillus subtilis" Nature (1997) 390:249-256). BP 3102-4082: The triple promoter and CrylllA mRNA stabilising element plus RBS. (Described above in PL3598-37 construct).

BP 4083-5718: The polynucleotide region [Pel-end-yflS-citS(start)] end of and downstream of the pelB locus of the B.subtilis genome (as it appeaars from the publication and corresponding database of: F. Kunst, N. Ogasawara, I. Moszer, <146 other authors>, H. Yoshikawa, A. Danchin. "The complete genome sequence of the Gram-positive bacterium Bacillus subtilis" Nature (1997) 390:249-256).

Claims

1. A method for generating an expression library of polynucleotides, wherein the polynucleotides are integrated by homologous recombination into the genome of a competent Gram-positive bacterium host cell, the method comprising the steps of: i) providing a non-replicating linear integration cassette comprising: a) a polynucleotide encoding one or more polypeptide(s) of interest b) a 5' flanking polynucleotide segment upstream of the polynucleotide of step (a), said segment comprising a first homologous region located in the 3' end of the segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment, wherein the first and second homologous regions are at least 500 bp, particularly at least 1000 bp, more particularly at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome; and ii) introducing the linear integration cassette into the host cell, and selecting or screening for host cells that produce the polypeptide(s) of interest.

2. The method according to claim 1, wherein the integration cassette further comprises at least one promoter which is a consensus promoter having the sequence TTGACA for the -35 region and TATAAT for the -10 region, and/or which is derived from one or more of the following genes: amyL, amyQ, amyE, amyM, crylllA, dagA, aprH, penP, sacB, spot, tac, xylA, and xylB, said promoter(s) being located between the flanking segments and being operably linked to the polynucleotide encoding one or more polypeptide(s) of interest.

3. The method according to claim 1 or 2, wherein the 5' and the 3' flanking polynucleotide segments each comprise at least 500 bp, preferably at least 1000 bp, more preferably at least 1500 bp, and most preferably at least 2000 bp of non-homologous polynucleotides located in the 5' and the 3' end of the 5' and the 3' flanking segments, respectively.

4. The method according to any of the preceeding claims, wherein the integration cassette further comprises a marker gene located between the 5' and 3' flanking segments.

5. The method according to any of claims 2 - 4, wherein the at least one promoter comprises two promoters derived from an amyL, amyQ, or crylllA gene.

6. The method according to claim 5, wherein the at least one promoter comprises 5 three promoters derived from an amyL, amyQ, or crylllA gene.

7. The method according to any of claims 2 - 6, wherein the at least one promoter comprises a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region.

10

8. The method according to any of claims 2 - 7, wherein the at least one promoter is one that results in that the host cells produce the polypeptide(s) of interest in a yield of at least 10 mg/l.

is

9. The method according to any of the preceding claims wherein the integration cassette comprises a mRNA processing/stabilizing sequence which is located downstream of the 5' flanking segment or downstream of the at least one promoter, and upstream of the polynucleotide encoding the polypeptide(s) of interest; preferably the mRNA processing/stabilizing sequence is derived from the cty///a-gene.

20

10. The method according to any of the preceding claims wherein the integration cassette comprises a terminator downstream of the polynucleotide encoding the polypeptide(s) of interest.

25 11. The method according to any of the preceding claims, wherein the integration cassette comprises a multiple cloning site with at least one recognition site for a restriction nuclease.

12. The method according to any of the preceding claims, wherein the polynucleotide 30 encoding the polypeptide(s) of interest comprises natural homologues or variants of a gene or operon, synthetic homologues or variants of a gene or operon, or a library of shuffled or recombined homologues or variants of a gene or operon.

13. The method according to claim 12, wherein the synthetic homologues or variants of 35 a gene or operon, or the library, are provided by DNA breeding or DNA shuffling.

14. The method according to any of the preceding claims, wherein the polynucleotide encoding the polypetide(s) of interest is a recombinant polynucleotide.

15. The method according to any of the preceding claims, wherein the polypeptide(s) of 5 interest is one or more enzyme(s), a membrane associated protein(s), or an anti-microbial peptide(s).

16. The method according to claim 15, wherein the one or more enzyme(s) is an enzyme(s) of a class selected from the group of enzyme classes consisting of lo oxidoreductases (EC 1), transferases (EC 2), hydrolases (EC 3), lyases (EC 4), isomerases (EC 5), and ligases (EC 6).

17. The method according to claim 16, wherein the one or more enzyme(s) is an enzyme(s) selected from the group of enzymes consisting of aminopeptidase, amylase, is amyloglucosidase, mannanase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase,

2o protease, ribonuclease, transferase, transglutaminase, and xylanase.

18. The method according to claim 15, wherein the one or more enzyme(s) is an enzyme(s) involved in the biosynthesis of hyaluronic acid.

25 19. The method according to any of the preceding claims, wherein the Gram-positive bacterium host cell is of the genus Bacillus or Lactobacillus.

20. The method according to claim 19 wherein the host cell is of the genus Bacillus, and is of the species β. alkalophilus, B. amyloliquefaciens, B. brevis, B. circulans, B. clausii,

3o B. coagulans, B. lautus, B. lentus, B. licheniformis, B. megaterium, B. stearothermophilus, B. subtilis, and B. thuringiensis.

21. The method according to claim 20 wherein the host cell is Bacillus subtilis.

22. The method according to any of the preceding claims, wherein the homologous region of the 5' and/or the 3' flanking segment is comprised in the yfmD-yfmC-yfmB-yfmA- pelB-yflS-citS region of the Bacillus subtilis genome or is comprised in the cryllla promoter.

5 23. The method according to any of the preceding claims, wherein the non-replicating linear integration cassette is comprised in a plasmid, and is introduced into the host cell in this form.

24. The method according to claim 23, wherein the plasmid is capable of replicating in lo an E. coli host cell but not in a Bacillus host cell.

25. The method according to claim 24, wherein an additional step is carried out between steps i) and ii), said step comprising introducing the plasmid into an intermediate E.coli host cell and propagating it therein by replication.

15

26. A non-replicating linear Gram-positive host cell integration cassette comprising: a) a polynucleotide encoding one or more polypeptide(s) of interest, b) a 5' flanking polynucleotide segment upstream of the polynucleotide of step (a), said segment comprising a first homologous region located in the 3' end of the

20 segment, c) a 3' flanking polynucleotide segment downstream of the polynucleotide of step (a), said segment comprising a second homologous region located in the 5' end of the segment, wherein the first and second homologous regions are at least 500 bp, particularly at least 25 1000 bp, more particulariy at least 1500 bp, and wherein each homologous region has a sequence identity of at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably between 95-100% with a region of the host cell genome.

27. The integration cassette according to claim 26, which further comprises at least one 30 promoter which is a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region, and/or which is derived from one or more of the following genes: amyL, amyQ, amyE, amyM, crylllA, dagA, aprH, penP, sacB, spol, tac, xylA, and xylB, said promoter(s) being located between the flanking segments and being being operably linked to the polynucleotide encoding one or more polypeptide(s) of interest.

35

28. The integration cassette according to claim 26 or 27, wherein the host cell genome is a Bacillus sp genome.

29. The integration cassette according to claim 28, wherein the Bacillus sp is a Bacillus 5 alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii,

Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.

30. The integration cassette according to any of the claims 26 - 29, which is comprised lo in a plasmid.

31. The integration cassette according to claim 30, wherein the plasmid is capable of replicating in an E coli host cell, but not in a Bacillus host cell.

is 32. A use of the integration cassette according to any of the claims 26 - 31 for making a genomically integrated polynucleotide library in a Gram-positive host cell.

33. The use according to claim 32, wherein the host cell is a Bacillus sp.

20 34. A method for producing a polypeptide of interest comprising culturing Gram-positive host cells, comprising an integration cassette as defined in any of claims 26 - 31 integrated into the genome, under conditions promoting expression of the polypeptide of interest, wherein the host cells have been selected or screened for by a method as defined in any of claims 1 - 25.

25

35. The method of claim 34, further comprising isolating and/or purifying the polypeptide of interest.