WO2003093437A2 - Production of papillomavirus vaccines in plants - Google Patents

Abstract

The present invention relates to a method of producing papillomavirus virus-like particles or capsomeres. This method involves providing a transgenic plant or plant seed transformed with a nucleic acid molecule comprising a papillomavirus L1 capsid protein coding sequence and growing the transgenic plant or a transgenic plant grown from the transgenic plant seed under conditions effective to produce virus-like particles containing the papillomavirus L1 capsid protein. The plant or a component part or a fruit thereof can be administered to a subject under conditions effective to immunize the subject against disease resulting from infection by a papillomavirus. DNA constructs, expression vectors, host cells, plants, and plant seeds are also disclosed.

Description

PRODUCTION OF PAPILLOMAVIRUS VACCINES IN PLANTS

This application claims the benefit of U.S. Provisional Patent Application Serial No. 60/377,467 filed May 2, 2002, which is hereby incorporated by reference in its entirety.

The United States Government may have certain rights in this invention pursuant to a Public Health Service award from the National Institutes of Health (Grant No. 1RO1 CA 84105-01).

FIELD OF THE INVENTION

The present invention relates to the production of papillomavirus viruslike particles plants.

BACKGROUND OF THE INVENTION

The family Papovaviridae constitutes a group of DNA viruses that induce both lytic infections and either benign or malignant tumors. Structurally, all are naked icosahedral virions with 72 capsomeres and contain double-stranded circular DNA. Viruses included in the family are: (1) human and animal papillomaviruses, (2) mouse polyomavirus, (3) simian vacuolating virus, and (4) human viruses BK and JC.

Human papillomaviruses (HPV) infect cutaneous, genital, oral, and respiratory epithelia in a tissue-specific manner. Infection with HPV has been associated closely with the development of both benign lesions and malignancies (Reichman et al., Papillomaviruses, pp. 1191-1200 (1990); and Mandell et al., Principles and Practice of Infectious Diseases, 3rd Edition, Churchill Livingstone, New York, N.Y.). For example, HPV type 1 (HPV-1) is present in plantar warts, HPV types 6 or 11 (HPV-6 or HPV-11) in condylomata acuminata (anogenital warts), while HPV types 16 or 18 (HPV- 16 or HPV- 18) are common in premalignant and malignant lesions of the cervical squamous epithelium (See Cru et al., "Human Papillomavirus Infection and Cervical Neoplasia: New Perspectives," Int. J. Gynecol. Pathol. 3:376-388 (1984); zur Hausen, Genital Papillomavirus Infections, pp. 83-90 (1985); Rigby et al., Viruses and Cancer, Cambridge University Press, Cambridge, UK; and Koutsky et al., "Epidemiology of Genital Human Papillomavirus Infection," Epidemiol. Rev. 10:122-163 (1988)).

However, difficulties in propagating HPV in vitro has led to the development of alternative approaches to antigen production for immunologic studies. For example, Bonnez et al., "The Pstl-XhoII Restriction Fragment of the HPV-6b LI ORF Lacks hnmunological Specificity as Determined by Sera from HPV 6 Condyloma Acuminatum Patients and Controls," UCLA Symp. Mol. Cell. Biol., New Series, 124:77-80 (1990); Jenison et al., "Identification of Immunoreactive Antigens of Human Papillomavirus Type 6b by Using Escherichia c /z-Expressed Fusion Proteins," J. Virol. 62:2115-2123 (1988); Li et al., "Identification of the Human Papillomavirus Type 6b LI Open Reading Frame Protein in Condylomas and Corresponding Antibodies in Human Sera," J. Virol. 61:2684-2690 (1987); Steele et al., "Humoral Assays of Human Sera to Disrupted and Nondisrupted Epitopes of ^• Human Papillomavirus Type 1," Virology 174:388-398 (1990); and Strike et al.,

"Expression in Escherichia coli of Seven DNA Segments Comprising the Complete LI and L2 Open Reading Frames of Human Papillomavirus Type 6b and the Location of the 'Common Antigen'," J. Gen. Virol. 70:543-555 (1989), have expressed recombinant capsid protein coding sequences in prokaryotic systems, and used them in Western blot analyses of sera obtained from individuals with HPV infection of the genital tract. Results from these studies have suggested that antibodies to denatured, i.e. linear, epitopes of HPV capsid proteins can be detected in the sera of some infected individuals.

Whole virus particles have also been used to detect antibodies in human sera, including antibodies directed against conformational epitopes. These studies have been difficult to conduct, because most naturally occurring HPV-induced lesions produce few particles. Whole virus particles can be obtained, however, in amounts sufficient to conduct immunologic assays from HPV type 1 -induced plantar warts (Kienzler et al., "Humoral and Cell-Mediated Immunity to Human Papillomavirus Type 1 (HPV-1) in Human Warts," Br. J. Dermatol. 108:65-672 (1983); "Pfister et al., Seroepidemiological Studies of Human Papilloma Virus (HPV-1) Infections," In L_Cancer 21:161-165 (1978); and Steele et al., "Humoral Assays of Human Sera to Disrupted and Nondisrupted Epitopes of Human Papillomavirus Type 1," Virology 174:388-398 (1992)) and experimentally-induced HPV-11 athymic mouse xenographs (Kreider et al., "Laboratory Production in vivo of Infectious Human Papillomavirus Type 11," J. Virol. 61 : 590-593 (1991); and Kreider et al., "Morphological Transformation in vivo of Human Uterine Cervix With

Papillomavirus from Condylomata Acuminata," Nature 317:639-641 (1985)). More particularly, U.S. Patent No. 5,071,757 to Kreider et al., discloses a method of propagating infectious HPV-11 virions in the laboratory using an athymic mouse xenograph model system. Although this system is capable of producing quantities of infectious virus that could be used for the development of a serologic test for genital HPV infection, this system is very expensive and cumbersome. Furthermore, only one genital HPV type has so far been propagated in this system, thus, limiting its usefulness. In addition, the infectious virus produced using this system represents a biohazard and, therefore, would be difficult to use in a vaccine formulation. Zhou et al., in "Expression of Vaccinia Recombinant HPV 16 LI and

L2 ORF Proteins in Epithelial Cells is Sufficient for Assembly of HPV Virion-like Particles", Virology 185:251-257 (1992), have reported the formation of HPV-16 virus-like particles in CV-1 cell nuclei following infection with a vaccinia virus HPV-16 L1/L2 double recombinant expression vector. However, the authors were not able to produce VLPs with a vector expressing LI alone. Furthermore, the VLPs produced lacked a well-defined symmetry, and were more variable in' size and smaller, only about 35-40 nm in diameter, than either HPV virions (55 nm) or the VLPs of the present invention (baculo virus produced HPV-11 VLPs, about 50 nm in diameter). U.S. Patent No. 5,045,447, to Minson, discloses a method of screening hybridoma culture supernatants for monoclonal antibodies with desired specificities. Minson's method is exemplified by the production of antibodies to the LI protein of human papillomavirus type 16 (HPV-16) using this protein as the target antigen in mice. However, Minson fails to disclose the expression of the LI protein or production of HPV virus-like particles (VLPs).

U.S. Patent No. 4,777,239, to Schoolnik et al., discloses short peptide sequences derived from several of the papillomavirus early region open reading frames which elicit type-specific antibodies to papillomavirus. However, the inventors fail to disclose any sequences directed to the major late open reading frame, LI.

U.S. Patent No. 5,057,411 to Lancaster et al., discloses a polynucleotide sequence of about 30 nucleotides of the papillomavirus LI capsid protein open reading frame that the inventors contend encode a papillomavirus type-specific epitope. However, the inventors do not disclose infected animals that produced antibodies which recognize this sequence. Instead, they synthesized a bovine papillomavirus type 1 (BPV-1) version of the sequence (a 10 amino acid peptide, or decapeptide), then immunized rabbits and tested the antiserum's ability to react with either BPV-1 or BPV-2 induced fibropapilloma tissue. The peptide antiserum only reacted with BPV-1 and not BPV-2 tissue. The inventors then concluded that the peptide contained an antigenic determinant that was type-specific, and, therefore, all papillomavirus LI coding sequences contain a type-specific epitope at this locus. This is theoretical speculation on the part of the inventors, who give no supporting data for this hypothesis. In addition, the amino acid sequences disclosed (i.e. 10 amino acids) are generally thought not to be capable of adopting higher order antigenic structures, i.e., conformational epitopes that possess a three-dimensional structure such as those produced by the method described herein. Another problem associated with papillomavirus infections is the need for alternative therapeutic and prophylactic modalities. In 1944, Biberstein treated condyloma acuminatum patients with an autogenous vaccine derived from the patients' warts (Biberstein, "hnmunization Therapy of Warts," Arch. Dermatol Svphilol. 50:12-22 (1944)). Thereafter, Powell et al., developed the technique typically used today for preparing autogenous wart vaccines for the treatment of condyloma acuminatum (Powell et al., "Treatment of Condylomata Acuminataby Autogenous Vaccine," South Med. J. 63:202-205 (1970)). Only one double-blind, placebo-controlled study has attempted to evaluate the efficacy of the autogenous vaccine (Malison et al., "Autogenous Vaccine Therapy for Condyloma Acuminatum: A Double-blind Controlled Study," Br. J. Vener. Dis. 58:62-65 (1982)). The authors concluded that autogenous vaccination was not effective in the treatment of condylomata acuminata, although this interpretation may be erroneous. The small number of patients studied precluded drawing valid negative conclusions. In any event, autogenous vaccines, as presently described, have several disadvantages. First, the patient needs to have relatively large warts (2g to 5g) in order to prepare the vaccine. Secondly, the practitioner needs access to laboratory equipment and expertise each time a new patient is to be treated. Thus, vaccine preparation is very expensive, tedious, and, in cases involving relatively small lesion mass, not possible. The present invention is directed to overcoming these deficiencies in the art.

SUMMARY OF THE INVENTION

The present invention relates to a method of producing papillomavirus virus-like particles or capsomeres. This method includes providing a transgenic plant or plant seed transformed with a nucleic acid molecule comprising a papillomavirus LI capsid protein coding sequence and growing the transgenic plant or a transgenic plant grown from the transgenic plant seed under conditions effective to produce virus-like particles containing the papillomavirus LI capsid protein.

Another aspect of the present invention relates to a genetic construct which includes a papillomavirus LI capsid protein coding sequence, a plant promoter, and a terminator. The plant promoter and the terminator are operatively coupled to the papillomavirus LI capsid protein coding sequence. Expression systems, host cells, plants, and plant seeds containing such a construct are also disclosed.

The present invention is also directed to a method of immunizing a subject against disease resulting from infection by a papillomavirus. This method involves administering the plant or a component part or a fruit thereof to a subj ect under conditions effective to immunize the subject.

Administration (i.e. feeding), in accordance with the present invention, could be given by untrained personnel, and is amenable to self-application. Large- scale field administration could occur given the easy accessibility to treatment. Additionally, a simple administration procedure would improve access to treatment by pediatric patients and the elderly, and populations in Third World countries. For previous vaccines, their formulations were injected through the skin with needles. Injection of vaccines using needles carries certain drawbacks including the need for sterile needles and syringes, trained medical personnel to administer the vaccine, discomfort from the injection, and potential complications brought about by puncturing the skin with the needle. Immunization without the use of needles represents a major advance for vaccine delivery by avoiding the aforementioned drawbacks.

The administration of plant products in accordance with the present invention is also not concerned with penetration of intact skin by sound or electrical energy.

Roughly 450,000 new cases of invasive uterine cervical carcinoma are diagnosed annually worldwide (Munos, N., "Disease-Burden Related to Cancer Induced by Viruses and H.pylori," World Health Organization (WHO) Vaccine Research and Development: Report of the Technical Review Group Meeting (1997), which is hereby incorporated by reference in its entirety). Therefore, efficient methods of vaccine delivery will be needed for the immunization of large numbers of susceptible individuals. Thus, treatment strategies involving the administration of plant parts will certainly facilitate implementation of mass immunization programs designed to reduce the incidence of cervical cancer and other HPV-associated diseases.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A-B are schematic representations of HPV11L1 expression cassettes (not drawn to scale). Figure 1 A shows a construct for constitutive expression of HPV11 LI synthetic plant-optimized gene in plants. kan^r: neomycin phosphotransferase gene, conferring resistance to kanamycin. TEV5': tobacco etch virus 5' leader sequence. VSP3': soybean vegetative storage protein 3' untranslated region. 2x35S: cauliflower mosaic virus 35S promoter. LB: T-DNA left border. RB: T-DNA right border. TAA depicts the stop codon present only in construct

HP VI 1 LI st. Figure IB is a construct for constitutive expression of fusion protein with green fluorescent protein (GFP) and HPV11 LI synthetic plant-optimized gene in plants. 2x35S: cauliflower mosaic virus promoter. TEV 5': tobacco etch virus 5' untranslated region for translation enhancement. VSP 3': soybean vegetative storage protein 3' region.

Figures 2A-D illustrate the expression of GFP:HPV11 LI fusion proteins in tobacco cells. Plasmid DNA constructs expressing either full-length (Lls) (Figures 2A-B) or truncated (List) (Figures 2C-D) LI coding sequences fused in- frame at the carboxy-terminus of GFP were delivered biolistically into 4-day old tobacco cells grown in suspension. Fluorescence is observed as bright areas (arrows). Figures 3A-B illustrate nucleic acid blot analyses of selected HPV11 List potato transformants. In Figure 3 A, plant genomic DNA was prepared and

Southern blotted as described in the Examples. DNA extracted from several HPV11 List lines (lines 8, 10, 15, 22 and 23) contained bands that varied in molecular weight, consistent with A. tumefaciens-mediated random insertion, that were reactive with an HPV11 LI -specific nucleic acid probe. In Figure 3B, total RNA extracted from the same lines was Northern blotted and probed as above. Upper panel, methylene blue stained blot to verify loading (ribosomal RNA bands); lower panel, blot hybridized with HPV11 LI probe.

Figures 4A-C illustrate immunological analyses of transgenic LI potato. Figure 4 A illustrates the results of an ELISA. Homogenates of wild-type and transgenic List lines 10, 22 and 23 were prepared and evaluated by ELISA as described in the Examples. A previously characterized HPV11 virion-neutralizing polyclonal antiserum was used at high dilution (1:10,000) to evaluate these preparations by ELISA, as indicated. HPV11 N-PAb was most immunoreactive with extract from line ST22, and to a lesser extent with extracts from lines ST 10 and ST23, but was not immunoreactive with control extract. Figure 4B illustrates the results of an ELISA against fractions prepared by ultracentrifugation of ST22 extract. HPV genotype-specific virion-neutralizing polyclonal antisera against HPV11 (filled bars) or HPVlδ (open bars) were diluted (1:10,000) and tested. (1) Unfractionated ST22 Extract; (2) 100,000 x g supernatant; (3) 100,000 x g pellet. Figure 4C illustrates the results of a Western Blot. Extracts from unfransformed control and transgenic tuber lines were centrifuged at 100,000 x g, and the pellet was resuspended and immunoblotted as described in the Examples. Lane 1, full-length HPV11 LI (25 ng) produced in insect cells; lane 2, unfransformed control extract; lane 3, ST22 extract (transgenic LI tuber). Immunoblot probed with polyclonal antiserum raised against PV LI common epitope (Strike et al., "Expression hi Escherichia coli of seven DNA fragments comprising the complete LI and L2 open reading frames of human papillomavirus type 6b and localization of the 'common antigen' region," J. Gen. Virol. 70:543-555 (1989), which is hereby incorporated by reference in its entirety). Arrow denotes position of plant-expressed List (~53 kD M_r).

Figure 5 illustrates the results of an ELISA demonstrating the conformational dependence and genotype-specificity of HPVl 1 LI expressed in potato. HPVl 1 LI Transgenic (ST22) and parental (Control) homogenates were prepared as described in the Examples and tested in an ELISA using previously characterized HPV virion-neutralizing polyclonal antisera, as indicated. ST22/Control homogenates were either untreated (open bars) or denatured with heat (filled bars) before being added to ELISA wells. Figures 6A-B are images prepared using electron microscopy of

HPVl 1 transgenic LI potato extract. Specimens were prepared as described in the Examples and examined by electron microscopy. Figure 6A shows abundant, 55 nm diameter spherical capsids present in extract prepared from ST22 transgenic LI potato tuber (35,000 X; Bar = 0.25 μM). Figure 6B shows the same field at higher magnification (105,000 X; Bar = 0.1 μM). Arrows denote representative VLP. Figures 7A-B illustrate the results of ELISA demonstrating the activation of VLP immune responses by ingestion of transgenic LI potato. Mice (female BALB/c) were immunized as described in the Examples. In Figure 7A, sera were collected at 0, 4, 8 and 11 weeks after primary immunizations and evaluated in an ELISA against insect cell-derived HPVl 1 LI VLPs. Mice received weekly meals consisting of 5 grams of non-transgenic (circles) or transgenic (ST22) potato with (squares) or without (triangles) LT(R192G) (5 μg). At six and nine weeks after primary immunizations groups were divided into subgroups (A and B, see Examples for details). Subgroups A (filled symbols) continued the same feeding regimen, while subgroups B (open symbols) were boosted by oral gavage with a subimmunogenic dose of purified HPVl 1 VLPs (0.5 μg) in combination with LT(R192G) (5 μg). Figure 7B illustrates HPVl 1 VLP ELISA seroreactivity in mice boosted by oral gavage (sera collected 11 weeks after primary immunizations). Responses to VLP oral booster immunizations were significantly enhanced by prior ingestion of transgenic LI potato with LT(R192G) (P=0.01).

Figure 8 shows the structure of expression vector PG1 lLlst for HPVl 1 LI gene driven by tuber-specific promoter. The granule-bound starch synthase promoter of potato (FL1607 GBSS) drives high transcription in potato tubers. The tobacco etch virus (TEV) 5' UTR provides enhanced translation efficiency. The plant-optimized HPVl 1 LI gene is truncated at the C-terminus to delete the nuclear localization signal. Transcript maturation is mediated by the soybean vspB 3 ' region. The neomycin phosphotransferase gene (Nptll) allows selection of transformed plants on kanamycin. The T-DNA Left and Right Border sequences delineate the DNA segment that is integrated into the plant cell nuclear chromosomal DNA.

Figure 9 shows the structure of expression vector pE8-l lLlst for HPVl 1 LI gene driven by tomato fruit-specific promoter. The E8 promoter of tomato (P E8) drives high transcription in ripening tomato fruit. The plant-optimized HPVl 1 LI gene is truncated at the C-terminus to delete the nuclear localization signal. Transcript maturation is mediated by the soybean vspB 3 ' region. The neomycin phosphotransferase gene (Nptll) allows selection of transformed plants on kanamycin. The T-DNA Left and Right Border sequences delineate the DNA segment that is integrated into the plant cell nuclear chromosomal DNA.

Figure 10 shows the structure of expression vector pE8-16Llst for HPVl 6 LI gene driven by tomato fruit-specific promoter. The E8 promoter of tomato (P E8) drives high transcription in ripening tomato fruit. The plant-optimized HPVl 6 LI gene is truncated at the C-terminus to delete the nuclear localization signal. Transcript maturation is mediated by the soybean vspB 3 ' region. The neomycin phosphotransferase gene (Nptll) allows selection of transformed plants on kanamycin. The T-DNA Left and Right Border sequences delineate the DNA segment that is integrated into the plant cell nuclear chromosomal DNA. Figure 11 illustrates the immunodetection of HPVl 1 and HPVl 6 LI st protein expression in transgenic tomato. HPVl 1 and HPVl 6 List sequences were expressed in tomato as described in the Examples. Extracts from non-transgenic and transgenic tomato lines were prepared and immunoblotted using standard methods as described in the Examples. Lane A, insect cell-expressed HPV LI VLPs (positive control); Lane B, extract prepared from non-transgenic (i.e., parental) tomato line; Lane C, extract prepared from HPVl 1 List transgenic tomato; Lane D, extract prepared from HPV16 List transgenic tomato. Immunoblot was developed with

Papillomavirus LI (PVL1) "common epitope" antiserum (Strike et al., "Expression in Escherichia coli of seven DNA fragments comprising the complete LI and L2 open reading frames of human papillomavirus type 6b and localization of the 'common antigen' region," J. Gen. Virol. 70:543-555 (1989), which is hereby incorporated by reference in its entirety).

Figure 12 illustrates the ELISA detection of native HPV Virion antigenicity in extracts prepared from HPVl 1 and HPVl 6 LI transgenic tomato lines. Extracts prepared from non-transgenic (control) and transgenic LI tomato lines were prepared and evaluated by ELISA using previously characterized conformationally dependent and virus genotype-specific HPVl 1 or HPVl 6 virion-neutralizing rabbit hyperimmune sera (Rose et al., "Serological Differentiation of Human Papillomavirus Types 11, 16 and 18 Using Recombinant Virus-like Particles," J. Gen. Virol. 75:2445- 2449 (1994); Rose et al., Human Papillomavirus (HPV) Type 11 Recombinant Viruslike Particles Induce the Formation of Neutralizing Antibodies and Detect HPV- specific Antibodies in Human Sera," J. Gen. Virol. 75 :2075-2079 (1994); White et al., "In vitro Infection and Type-restricted Antibody-mediated Neutralization of Authentic Human Papillomavirus Type 16," J. Virol. 72:959-964 (1998), which are hereby incorporated by reference in their entirety). Tomato extracts were applied to ELISA plates in either untreated form ("Native") or following heat-denaturation ("Denatured").

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a method of producing papillomavirus virus-like particles or capsomeres. This method includes providing a transgenic plant or plant seed transformed with a nucleic acid molecule comprising a papillomavirus LI capsid protein coding sequence and growing the transgenic plant or a transgenic plant grown from the transgenic plant seed under conditions effective to produce virus-like particles containing the papillomavirus LI capsid protein.

As used herein, "virus-like particle(s) (VLPs)" refer to a virus-like particle(s), fragment(s), capsomer(s) or ρortion(s) thereof produced from the capsid protein coding sequence of papillomavirus and comprising antigenic characteristic(s) similar to those of infectious papillomavirus particles. As used herein, "antigenic characteristic(s)" refers to (1) the ability of the virus-like particle(s) to cross-react with wild-type particles (native infectious virus particles of the same HPV type) as determined by antisera generated in animals and/or humans by immunization with either VLPs or infectious virus; and/or (2) the ability to recognize or detect antibodies in human sera from persons known to be infected with homologous virus. Virus-like particles possessing one or, preferably, both of these antigenic characteristics are said to be conformationally correct, meaning that the virus-like particles possess conformational epitopes of the native infectious virus particles of the same HPV type. Conformational epitopes of the native virion are presented on the VLP surface upon proper folding of the LI protein and its formation of assembled capsomers, which themselves assemble to form the VLP. Conformational epitopes are readily distinguished from linear epitopes, because conformational epitopes are destroyed upon denaturation of the virus-like particle whereas linear epitopes are not. It was further discovered that the VLPs possessed morphological characteristics similar to those of native virions. The morphological characteristics of native virion include, without limitation, the presence of T=7 structure with regular arrays of capsomers and a size that is between about 50-55 nm when measured by electron microscopy. It has been determined that conformational epitopes of native HPV virions (and of native HPV VLPs) are highly i munogenic and induce high-titer antibody responses that efficiently neutralize infectious homologous virions. Thus, the VLPs of the present invention that contain conformational epitopes are expected to be useful as vaccines to treat or prevent papillomavirus infection. It is understood that the capsid protein coding sequences are used here for purposes of illustration only, and that any LI capsid protein coding sequence for any animal or human papillomavirus type can be used without deviating from the intended scope of the invention. As used herein, "LI protein coding sequence" or "LI capsid protein coding sequence" or "LI coding sequence" refers to the open reading frame which codes for the LI protein in papillomavirus. When expressed, the LI protein coding sequence produces a protein, or protein complex, or aggregate, which possesses immunological and morphological characteristics similar to those of native papillomavirus virions. The LI coding sequence used in the invention can be isolated and purified from papillomavirus genomic DNA or synthesized using standard genetic engineering techniques.

Many HPV LI DNAs have been reported in the literature and are publicly available. (See, e.g., Baker, "Sequence Analysis of Papillomavirus",

Genomes, pp. 321-384; U.S. Patent No. 5,437,931 to Long et al., Cole et al., J. Mol. Biol. 193:599-608 (1987); Danos et al., EMBO J., 1:231-236 (1982); Cole et al., Virol., 38(3)991-995 (1986).) Also, it is well known that HPV LI DNAs exhibit significant homology. Therefore, a desired HPV LI DNA can easily be obtained, e.g., by the use of a previously reported HPV LI DNA or a fragment thereof as a hybridization probe or as a primer during polymerization chain reaction (PCR) amplification. Indeed, numerous HPV LI DNAs have been cloned and expressed.

Preferably, the HPV LI DNA of the present invention will be derived from an HPV which is involved in cancer or condyloma acuminata, e.g., HPV-16, HPV-18, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51, HPV-52, and HPV-56, which are involved in cancer, and HPV-6, HPV-11, HPV-30, HPV-42, HPV-43, HPV-44, HPV-54, HPV-55, and HPV-70, which are involved in warts. However, the subject virus-like particles may be produced from any desired HPV LI DNA. In addition to HPV LI DNA or fragments thereof, the LI DNA of animal papillomaviruses can also be used to prepare animal papillomavirus VLPs. The DNA of numerous animal papillomavirus VLPs has been sequenced and is publicly available.

The DNA constructs of the present invention may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art. Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gtl 1, gt WES.tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC1084, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKClOl, SV 40, pBluescript II SK +/- or KS +/- (see "Stratagene Cloning Systems" Catalog (1993) from Stratagene, La Jolla, CA, which is hereby incorporated by reference in its entirety), pQE, pIH821, pGEX, pET series (see F.W. Studier et. al., "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Gene Expression Technology vol. 185 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., which are hereby incorporated by reference in their entirety. In preparing a DNA vector for expression, the various DNA sequences may normally be inserted or substituted into a bacterial plasmid. Any convenient plasmid may be employed, which will be characterized by having a bacterial replication system, a marker which allows for selection in a bacterium, and generally one or more unique, conveniently located restriction sites. Numerous plasmids, referred to as transformation vectors, are available for plant transformation. The selection of a vector will depend on the preferred transformation technique and target species for transformation. A variety of vectors are available for stable transformation using Agrobacterium tumefaciens, a soilbo ne bacterium that causes crown gall. Crown gall are characterized by tumors or galls that develop on the lower stem and main roots of the infected plant. These tumors are due to the transfer and incorporation of part of the bacterium plasmid DNA into the plant chromosomal DNA. This transfer DNA (T-DNA) is expressed along with the normal genes of the plant cell. The plasmid DNA, pTi, or Ti-DNA, for "tumor inducing plasmid," contains the vir genes necessary for movement of the T-DNA into the plant. The T- DNA carries genes that encode proteins involved in the biosynthesis of plant regulatory factors, and bacterial nutrients (opines). The T-DNA is delimited by two 25 bp imperfect direct repeat sequences called the "border sequences." By removing the oncogene and opine genes, and replacing them with a gene of interest, it is possible to transfer foreign DNA into the plant without the formation of tumors or the multiplication of Agrobacterium tumefaciens. Fraley, et al., "Expression of Bacterial Genes in Plant Cells," Proc. Nat'l Acad. Sci. 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety.

Further improvement of this technique led to the development of the binary vector system. Bevan, M., "Binary Agrobacterium Vectors for Plant Transformation," Nucleic Acids Res. 12:8711-8721 (1984), which is hereby incorporated by reference in its entirety. In this system, all the T-DNA sequences (including the borders) are removed from the pTi, and a second vector containing T-DNA is introduced into Agrobacterium tumefaciens. This second vector has the advantage of being replicable in E. coli as well as A. tumefaciens, and contains a multiclonal site that facilitates the cloning of a transgene. An example of a commonly used vector is pBinl9. Frisch, et al., "Complete Sequence of the Binary Vector Binl9," Plant Molec. Biol. 27:405-409 (1995), which is hereby incorporated by reference in its entirety. Any appropriate vectors now known or later described for genetic transformation are suitable for use with the present invention.

U.S. Patent No. 4,237,224 issued to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including procaryotic organisms and eukaryotic cells grown in tissue culture.

Certain "control elements" or "regulatory sequences" are also incorporated into the vector-construct. These include non-translated regions of the vector, promoters, and 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used.

A constitutive promoter is a promoter that directs expression of a gene throughout the development and life of an organism. Examples of some constitutive promoters that are widely used for inducing expression of transgenes include the nopaline synthase (NOS) gene promoter, from. Agrobacterium tumefaciens (U.S. Patent No. 5,034,322 issued to Rogers et al., which is hereby incorporated by reference in its entirety), the cauliflower mosaic virus (CaMV) 35S and 19S promoters (U.S. Patent No. 5,352,605 issued to Fraley et al., which is hereby incorporated by reference in its entirety), those derived from any of the several actin genes, which are known to be expressed in most cells types (U.S. Patent No. 6,002,068 issued to Privalle et al., which is hereby incorporated by reference in its entirety), and the ubiquitin promoter, which is a gene product known to accumulate in many cell types.

An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent, such as a metabolite, growth regulator, herbicide, or phenolic compound, or a physiological stress directly imposed upon the plant such as cold, heat, salt, toxins, or through the action of a pathogen or disease agent such as a virus or fungus. A plant cell containing an inducible promoter maybe exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating, or by exposure to the operative pathogen. An example of an appropriate inducible promoter for use in the present invention is a glucocorticoid-inducible promoter (Schena et al., " A Steroid-Inducible Gene Expression System for Plant Cells," Proc. Natl. Acad. Sci. 88:10421-5 (1991), which is hereby incorporated by reference in its entirety). Expression of the transgene- encoded protein is induced in the transformed plants when the transgenic plants are brought into contact with nanomolar concentrations of a glucocorticoid, or by contact with dexamethasone, a glucocorticoid analog. Schena et al., " A Steroid-Inducible Gene Expression System for Plant Cells," Proc. Natl. Acad. Sci. USA 88:10421-5 (1991); Aoyama et al., "A Glucocorticoid-Mediated Transcriptional Induction System in Transgenic Plants," Plant J. 11: 605-612 (1997), and McNellis et al., "Glucocorticoid-inducible Expression of a Bacterial Avirulence Gene in Transgenic Arabidopsis Induces Hypersensitive Cell Death, Plant J. 14(2):247-57 (1998), which are hereby incorporated by reference in their entirety. In addition, inducible promoters include promoters that function in a tissue specific manner to regulate the gene of interest within selected tissues of the plant. Examples of such tissue specific or developmentally regulated promoters include seed, flower, fruit, or root specific promoters as are well known in the field (U.S. Patent No. 5,750,385 issued to Shewmaker et al., which is hereby incorporated by reference in its entirety). In the preferred embodiment of the present invention, a heterologous promoter is linked to the nucleic acid of the construct, where "heterologous promoter" is defined as a promoter to which the nucleic acid of the construct is not linked in nature.

The DNA construct of the present invention also includes an operable 3' regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a modified trait DNA molecule of the present invention. A number of 3 ' regulatory regions are known to be operable in plants. Exemplary 3' regulatory regions include, without limitation, the nopaline synthase ("nos") 3 ' regulatory region (Fraley, et al., "Expression of Bacterial Genes in Plant Cells," Proc. Nat'l Acad. Sci. USA 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus ("CaMV") 3' regulatory region (Odell, et al., "Identification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter," Nature 313 (60051 : 810-812 (1985), which is hereby incorporated by reference in its entirety). Virtually any 3 ' regulatory region known to be operable in plants would suffice for proper expression of the coding sequence of the nucleic acid of the present invention.

The different components described above can be ligated together to produce the expression systems which contain the DNA constructs of the present invention, using well known molecular cloning techniques as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY., which are hereby incorporated by reference in their entirety. The DNA construct of the present invention is configured to encode

RNA molecules which are translatable. As a result, that RNA molecule will be translated at the ribosomes to produce the protein encoded by the DNA construct. Production of proteins in this manner can be increased by joining the cloned gene encoding the DNA construct of interest with synthetic double-stranded oligonucleotides which represent a viral regulatory sequence (i.e., a 5' untranslated sequence) (U.S. Patent No. 4,820,639 to Gehrke, and U.S. Patent No. 5,849,527 to Wilson, which are hereby incorporated by reference in their entirety).

Once the DNA construct of the present invention has been prepared, it is ready to be incorporated into a host cell. Accordingly, another aspect of the present invention relates to a recombinant host cell containing one or more of the DNA constructs of the present invention. Basically, this method is carried out by transforming a host cell with a DNA construct of the present invention under conditions effective to yield transcription of the DNA molecule in the host cell, using standard cloning procedures known in the art, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Springs Laboratory, Cold Springs Harbor, New York (1989), which is hereby incorporated by reference in its entirety. Suitable host cells include, but are not limited to, bacteria, virus, yeast, mammalian cells, insect, plant, and the like. Preferably the host cells are either a bacterial cell or a plant cell. Methods of transformation may result in transient or stable expression of the DNA under control of the promoter. Preferably, a DNA construct of the present invention is stably inserted into the genome of the recombinant plant cell as a result of the transformation, although transient expression can serve an important purpose, particularly when the plant under investigation is slow-growing.

Plant tissue suitable for transformation include leaf tissue, root tissue, meristems, zygotic and somatic embryos, callus, protoplasts, tassels, pollen, embryos, anthers, and the like. The means of transformation chosen is that most suited to the tissue to be transformed.

Transient expression in plant tissue is often achieved by particle bombardment (Klein et al., "High- Velocity Microprojectiles for Delivering Nucleic Acids Into Living Cells," Nature 327:70-73 (1987), which is hereby incorporated by reference in its entirety). In this method, tungsten or gold microparticles (1 to 2 μm in diameter) are coated with the DNA of interest and then bombarded at the tissue using high pressure gas. In this way, it is possible to deliver foreign DNA into the nucleus and obtain a temporal expression of the gene under the current conditions of the tissue. Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells. Other variations of particle bombardment, now known or hereafter developed, can also be used. An appropriate method of stably introducing the nucleic acid construct into plant cells is to infect a plant cell with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the nucleic acid construct. As described above, the Ti (or RI) plasmid of Agrobacterium enables the highly successful transfer of a foreign DNA into plant cells. Another approach to transforming plant cells with a gene which imparts resistance to pathogens is particle bombardment (also known as biolistic transformation) of the host cell, as disclosed in U.S. Patent Nos. 4,945,050, 5,036,006, and 5,100,792, all to Sanford et al., and in Emerschad et al., "Somatic Embryogenesis and Plant Development from Immature Zygotic Embryos of Seedless Grapes (Vitis vinifera)," Plant Cell Reports 14:6-12 (1995), which are hereby incorporated by reference in their entirety. Yet another method of introduction is fusion of protoplasts with other entities, either minicells, cells, lysosomes, or other fusible lipid-surfaced bodies (Fraley, et al., Proc. Natl. Acad. Sci. USA 79: 1859-63 (1982), which is hereby incorporated by reference in its entirety). The DNA molecule may also be introduced into the plant cells by electroporation (Fromm et al., Proc. Natl. Acad. Sci. USA 82:5824 (1985), which is hereby incorporated by reference in its entirety). In this technique, plant protoplasts are electroporated in the presence of plasmids containing the expression cassette. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and regenerate. The precise method of transformation is not critical to the practice of the present invention. Any method that results in efficient transformation of the host cell of choice is appropriate for practicing the present invention.

After transformation, the transformed plant cells must be regenerated. Plant regeneration from cultured protoplasts is described in Evans et al., Handbook of Plant Cell Cultures, Vol. 1: (MacMillan Publishing Co., New York, 1983); Vasil I.R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I, 1984, and Vol. Ill (1986), and Fitch et al, "Somatic Embryogenesis and Plant Regeneration from Immature Zygotic Embryos of Papaya (Carica papaya L.) " Plant Cell Rep. 9:320 (1990), which are hereby incorporated by reference in its entirety. Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.

Preferably, transformed cells are first identified using a selection marker simultaneously introduced into the host cells along with the nucleic acid construct of the present invention. Suitable selection markers include, without limitation, markers encoding for antibiotic resistance, such as the nptll gene which confers kanamycin resistance (Fraley, et al., Proc. Natl. Acad. Sci. USA 80:4803- 4807 (1983), which is hereby incorporated by reference in its entirety), and the genes which confer resistance to gentamycin, G418, hygromycin, streptomycin, spectinomycin, tetracycline, chloramphenicol, and the like. Cells or tissues are grown on a selection medium containing the appropriate antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow. Other types of markers are also suitable for inclusion in the expression cassette of the present invention. For example, a gene encoding for herbicide tolerance, such as tolerance to sulfonylurea is useful, or the dhfr gene, which confers resistance to methotrexate (Bourouis et al., EMBO J. 2:1099-1104 (1983), which is hereby incorporated by reference in its entirety). Similarly, "reporter genes," which encode for enzymes providing for production of an identifiable compound are suitable. The most widely used reporter gene for gene fusion experiments has been uidA, a gene from Escherichia coli that encodes the β-glucuronidase protein, also known as GUS. Jefferson et al., "GUS Fusions: β Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher Plants," EMBO J. 6:3901-3907 (1987), which is hereby incorporated by reference in its entirety. Similarly, enzymes providing for production of a compound identifiable by luminescence, such as luciferase, are useful. The selection marker employed will depend on the target species; for certain target species, different antibiotics, herbicide, or biosynthesis selection markers are preferred.

Plant cells and tissues selected by means of an inhibitory agent or other selection marker are then tested for the acquisition of the viral gene by Southern blot hybridization analysis, using a probe specific to the viral genes contained in the given cassette used for transformation (Sambrook et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor, New York: Cold Spring Harbor Press (1989), which is hereby incorporated by reference in its entirety).

After the fusion gene containing a DNA construct of the present invention is stably incorporated in transgenic plants, the transgene can be transferred to other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

Once transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedure so that the DNA construct is present in the resulting plants. Alternatively, transgenic seeds are recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.

The present invention can be utilized in conjunction with a wide variety of plants or their seeds. Suitable plants include dicots and monocots. More particularly, useful crop plants can include: alfalfa, rice, wheat, barley, rye, cotton, sunflower, peanut, corn, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, brussel sprout, beet, parsnip, turnip, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, citrus, strawberry, grape, raspberry, pineapple, soybean, tobacco, tomato, sorghum, papaya, and sugarcane.

The present invention is also directed to a method of immunizing a subject against disease resulting from infection by a papillomavirus. This method involves administering the plant or a component part or a fruit thereof to a subject under conditions effective to immunize the subject. Such administration is desirably carried out by feeding the plant or a component part or a fruit thereof to the subject. Following an initial feeding administration, there can be booster administration by further feedings. Such booster administrations are useful in achieving a higher degree of protection. Alternatively, booster administration can be carried by parenteral injection or transcutaneous administration.

Subjects which can be treated according to the method of immunizing a subject against disease (resulting from infection by a papillomavirus) are preferably human but can be another animal whose corresponding papillomavirus(es) is/are capable of inducing disease following infection of the animal.

EXAMPLES

The following Examples are intended to be illustrative and in no way are intended to limit the scope of the present invention.

Example 1 - Construction of the Synthetic HPV11 LI Gene.

A plant-optimized gene for HPVl 1 LI gene was designed with the nucleotide sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) as shown below. SEQ ID NO: 1 atgtggagac cttctgacag cacagtttat gttcctcctc ctaaccctgt ttcaaaggtg 60 gtggccactg acgcctatgt gaaaagaacc aacattttct accatgcctc aagctcaagg 120 cttcttgctg tgggacaccc ttactactct atcaagaagg tgaacaagac agtggtacca 180 aaggtgtcag gctaccaata cagagtgttc aaggttgtgc tcccagaccc taacaagttt 240 gcattgcctg actcctccct ctttgaccςc actacacaaa ggttggtctg ggcctgcaca 300 ggattggagg tgggaagagg tcaacctttg ggagtgggtg tgagtggaca cccacttctc 360 aacaaatatg atgatgtgga gaacagtggt ggatatggtg gtaatcctgg tcaagataac 420 agggtgaatg ttggtatgga ttacaagcaa actcagctct gcatggtggg ctgtgctcca 480 ccattgggtg agcactgggg taagggcaca caatgctcca acacttctgt gcaaaatggt 540 gattgcccac cattggagct tatcacaagt gtgatccaag atggagatat ggtggataca 600 ggctttggtg ctatgaactt tgctgacctc cagactaaca aatcagatgt gccccttgat 660 atctgtggaa ctgtctgcaa ataccctgac taccttcaga tggctgctga tccttatggt 720 gacaggcttt tcttctacct caggaaggaa cagatgtttg ctaggcactt cttcaatagg 780 gctggtactg ttggcgagcc agttcctgat gatctcttgg ttaagggagg caacaacaga 840 tcttcagttg cttcatcaat ctatgtgcac accccaagtg gctccttggt ttcttcagag 900 gctcagttgt tcaacaaacc atactggctt caaaaggctc agggacacaa caatggtatc 960 tgctggggaa atcacctctt tgttactgtg gttgacacaa ccagatcaac taacatgaca 1020 ctttgtgcat ctgtgtccaa gtctgctact tacactaact cagattacaa ggagtacatg 1080 aggcatgtgg aggagtttga cctccagttc atcttccagc tctgtagcat caccttgtct 1140 gctgaggtca tggcctacat tcacaccatg aatccatctg ttttggagga ttggaatttt 1200 ggcttgagcc caccaccaaa tggcactctt gaggacacct acagatatgt tcaatcacaa 1260 gccatcacat gccagaagcc tactccagag aaagagaaac aagaccccta caaggacatg 1320 agtttctggg aggtgaactt gaaggagaag ttctcaagtg agttggacca attccccctt 1380 ggaaggaagt tcttgcttca gagtggatat agaggaagga cctctgccag aacaggcatt 1440 aaaaggccag ctgtgtctaa gccttctaca gcccctaaga gaaagaggac caagactaaa 1500 aagtaa 1506

SEQ ID NO: 2

Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val Pro Pro Pro Asn Pro 1 5 10 15

Val Ser ys Val Val Ala Thr Asp Ala Tyr Val Lys Arg Thr Asn lie 20 25 30

Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala Val Gly His Pro Tyr 35 40 45

Tyr Ser lie Lys Lys Val Asn Lys Thr Val Val Pro Lys Val Ser Gly 50 55 60 Tyr Gin Tyr Arg Val Phe Lys Val Val Leu Pro Asp Pro Asn Lys Phe 65 70 75 80

Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr Thr Gin Arg Leu Val 85 90 95

Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly Gin Pro Leu Gly Val 100 105 110

Gly Val Ser Gly His Pro Leu Leu Asn Lys Tyr Asp Asp Val Glu Asn 115 120 125

Ser Gly Gly Tyr Gly Gly Asn Pro Gly Gin Asp Asn Arg Val Asn Val 130 135 140 Gly Met Asp Tyr Lys Gin Thr Gin Leu Cys Met Val Gly Cys Ala Pro 145 150 155 160

Pro Leu Gly Glu His Trp Gly Lys Gly Thr Gin Cys Ser Asn Thr Ser 165 170 175

Val Gin Asn Gly Asp Cys Pro Pro Leu Glu Leu lie Thr Ser Val lie 180 185 190

Gin Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asn Phe Ala 195 200 205

Asp Leu Gin Thr Asn Lys Ser Asp Val Pro Leu Asp lie Cys Gly Thr 210 215 220 Val Cys Lys Tyr Pro Asp Tyr Leu Gin Met Ala Ala Asp Pro Tyr Gly 225 230 235 240

Asp Arg Leu Phe Phe Tyr Leu Arg Lys Glu Gin Met Phe Ala Arg His 245 250 255

Phe Phe Asn Arg Ala Gly Thr Val Gly Glu Pro Val Pro Asp Asp Leu 260 265 270 Leu Val Lys Gly Gly Asn Asn Arg Ser Ser Val Ala Ser Ser lie Tyr 275 280 285

Val His Thr Pro Ser Gly Ser Leu Val Ser Ser Glu Ala Gin Leu Phe 290 295 300

Asn Lys Pro Tyr Trp Leu Gin Lys Ala Gin Gly His Asn Asn Gly lie 305 310 315 320

Cys Trp Gly Asn His Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser 325 330 335

Thr Asn Met Thr Leu Cys Ala Ser Val Ser Lys Ser Ala Thr Tyr Thr 340 345 350 Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu Glu Phe Asp Leu 355 360 365

Gin Phe He Phe Gin Leu Cys Ser He Thr Leu Ser Ala Glu Val Met

370 375 380

Ala Tyr He His Thr Met Asn Pro Ser Val Leu Glu Asp Trp Asn Phe

385 390 395 400

Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp Thr Tyr Arg Tyr 405 410 415

Val Gin Ser Gin Ala He Thr Cys Gin Lys Pro Thr Pro Glu Lys Glu 420 425 430 Lys Gin Asp Pro Tyr Lys Asp Met Ser Phe Trp Glu Val Asn Leu Lys 435 440 445

Glu Lys Phe Ser Ser Glu Leu Asp Gin Phe Pro Leu Gly Arg Lys Phe 450 455 460

Leu Leu Gin Ser Gly Tyr Arg Gly Arg Thr Ser Ala Arg Thr Gly He 465 470 475 480

Lys Arg Pro Ala Val Ser Lys Pro Ser Thr Ala Pro Lys Arg Lys Arg 485 490 495

Thr Lys Thr Lys Lys 500

From these sequences, a C-terminally truncated version, which has the following nucleotide sequence (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4), was prepared to delete the nuclear localization signal. SEO IDNO: 3 atgtggagac cttctgacag cacagtttat gttcctcctc ctaaccctgt ttcaaaggtg 60 gtggccactg acgcctatgt gaaaagaacc aacattttct accatgcctc aagctcaagg 120 cttcttgctg tgggacaccc ttactactct atcaagaagg tgaacaagac agtggtacca 180 aaggtgtcag gctaccaata cagagtgttc aaggttgtgc tcccagaccc taacaagttt 240 gcattgcctg actcctccct ctttgacccc actacacaaa ggttggtctg ggcctgcaca 300 ggattggagg tgggaagagg tcaacctttg ggagtgggtg tgagtggaca cccacttctc 360 aacaaatatg atgatgtgga gaacagtggt ggatatggtg gtaatcctgg tcaagataac 420 agggtgaatg ttggtatgga ttacaagcaa actcagctct gcatggtggg ctgtgctcca 480 ccattgggtg agcactgggg taagggcaca caatgctcca acacttctgt gcaaaatggt 540 gattgcccac cattggagct tatcacaagt gtgatccaag atggagatat ggtggataca 600 ggctttggtg ctatgaactt tgctgacctc cagactaaca aatcagatgt gccccttgat 660 atctgtggaa ctgtctgcaa ataccctgac taccttcaga tggctgctga tccttatggt 720 gacaggcttt tcttctacct caggaaggaa cagatgtttg ctaggcactt cttcaatagg 780 gctggtactg ttggcgagcc agttcctgat gatctcttgg ttaagggagg caacaacaga 840 tcttcagttg cttcatcaat ctatgtgcac accccaagtg gctccttggt ttcttcagag 900 gctcagttgt tcaacaaacc atactggctt caaaaggctc agggacacaa caatggtatc 960 tgctggggaa atcacctctt tgttactgtg gttgacacaa ccagatcaac taacatgaca 1020 ctttgtgcat ctgtgtccaa gtctgctact tacactaact cagattacaa ggagtacatg 1080 aggcatgtgg aggagtttga cctccagttc atcttccagc tctgtagcat caccttgtct 1140 gctgaggtca tggcctacat tcacaccatg aatccatctg ttttggagga ttggaatttt 1200 ggcttgagcc caccaccaaa tggcactctt gaggacacct acagatatgt tcaatcacaa 1260 gccatcacat gccagaagcc tactccagag aaagagaaac aagaccccta caaggacatg 1320 agtttctggg aggtgaactt gaaggagaag ttctcaagtg agttggacca attccccctt 1380 ggaaggaagt tcttgcttca gagtggatat agaggaagga cctctgccag aacaggcatt 1440 taa 1443

SEQ ID NO: 4

Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val Pro Pro Pro Asn Pro 1 5 10 15

Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val Lys Arg Thr Asn He 20 25 30 Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala Val Gly His Pro Tyr 35 40 45

Tyr Ser He Lys Lys Val Asn Lys Thr Val Val Pro Lys Val Ser Gly 50 55 60

Tyr Gin Tyr Arg Val Phe Lys Val Val Leu Pro Asp Pro Asn Lys Phe 65 70 75 80

Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr Thr Gin Arg Leu Val 85 90 95 Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly Gin Pro Leu Gly Val 100 105 110

Gly Val Ser Gly His Pro Leu Leu Asn Lys Tyr Asp Asp Val Glu Asn 115 120 125

Ser Gly Gly Tyr Gly Gly Asn Pro Gly Gin Asp Asn Arg Val Asn Val 130 135 140 Gly Met Asp Tyr Lys Gin Thr Gin Leu Cys Met Val Gly Cys Ala Pro 145 150 155 160

Pro Leu Gly Glu His Trp Gly Lys Gly Thr Gin Cys Ser Asn Thr Ser 165 170 175

Val Gin Asn Gly Asp Cys Pro Pro Leu Glu Leu He Thr Ser Val He 180 185 190

Gin Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asn Phe Ala 195 200 205

Asp Leu Gin Thr Asn Lys Ser Asp Val Pro Leu Asp He Cys Gly Thr 210 215 220 Val Cys Lys Tyr Pro Asp Tyr Leu Gin Met Ala Ala Asp Pro Tyr Gly 225 230 235 240

Asp Arg Leu Phe Phe Tyr Leu Arg Lys Glu Gin Met Phe Ala Arg His 245 250 255

Phe Phe Asn Arg Ala Gly Thr Val Gly Glu Pro Val Pro Asp Asp Leu 260 265 270

Leu Val Lys Gly Gly Asn Asn Arg Ser Ser Val Ala Ser Ser He Tyr 275 280 285

Val His Thr Pro Ser Gly Ser Leu Val Ser Ser Glu Ala Gin Leu Phe

290 295 300 Asn Lys Pro Tyr Trp Leu Gin Lys Ala Gin Gly His Asn Asn Gly He

305 310 315 320

Cys Trp Gly Asn His Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser 325 330 335

Thr Asn Met Thr Leu Cys Ala Ser Val Ser Lys Ser Ala Thr Tyr Thr 340 345 350

Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu Glu Phe Asp Leu 355 360 365

Gin Phe He Phe Gin Leu Cys Ser He Thr Leu Ser Ala Glu Val Met 370 375 380 Ala Tyr He His Thr Met Asn Pro Ser Val Leu Glu Asp Trp Asn Phe 385 390 395 400

Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp Thr Tyr Arg Tyr 405 410 415

Val Gin Ser Gin Ala He Thr Cys Gin Lys Pro Thr Pro Glu Lys Glu 420 425 430 Lys Gin Asp Pro Tyr Lys Asp Met Ser Phe Trp Glu Val Asn Leu Lys 435 440 445 Glu Lys Phe Ser Ser Glu Leu Asp Gin Phe Pro Leu Gly Arg Lys Phe 450 455 460

Leu Leu Gin Ser Gly Tyr Arg Gly Arg Thr Ser Ala Arg Thr Gly He 465 470 475 480

The synthetic HPVl 1 LI open reading frame and the truncated synthetic HPVl 1 LI open reading frame are reported in Genbank accessions AY191838 (HPVl 1 Lls) and AY191839 (HPVl 1 List), which are hereby incorporated by reference in their entirety.

The synthetic HPVl 1 LI gene was assembled utilizing the method of Stemmer, et. al., "Single-Step Assembly of a Gene and Entire Plasmid from Large Numbers of Oligodeoxyribonucleotides," Gene 164: 49-53 (1995), which is hereby incorporated by reference in its entirety. In brief, 75 oligodeoxyribonucleotides were synthesized, collectively encoding both strands of the plant-optimized HPVl 1 LI gene. In addition, Xbal and Kpnl restriction sites were introduced adjacent the 5'- and the 3' end, respectively. Oligos were 34-46 nucleotides in length with melting temperatures for the overlaps in a range of 58-62°C. Gene assembly and amplification was basically carried out as described before (Stemmer, et. al., "Single-Step Assembly of a Gene and Entire Plasmid from Large Numbers of

Oligodeoxyribonucleotides," Gene 164: 49-53 (1995), which is hereby incorporated by reference in its entirety). The amplified single band of about 1530 bp was eluted from an agarose gel and subcloned into pCR2.1 (InVitrogen), resulting in the clone pCRLls (with the "s" denoting "synthetic"). After sequencing and confirmation of the DNA identity, the synthetic HPVl 1 LI gene was subcloned into the plant expression vector pPSl. The resulting plasmid was named pi 1 Lls.

For site directed mutagenesis, the following primers were used, introducing a stop codon in position 480. l lLltruncfor: 5' CCAGAACAGGCATTTAAAGGCCAGCTGTG 3' (SEQ. ID. NO: 5), and 1 ILltruncrev: 5' CACAGCTGGCCTTTAAATGCCTGTTCTGG 3' (SEQ. ID. NO: 6). Plasmid pCRLls was amplified with Pfu polymerase (Stratagene, La Jolla/CA) in a PCR process involving 12 cycles 95 °C for 30 sec; 55 °C for 1 min; 68 °C for 10 min. The reaction mix was digested with Dpnl for 1 hour and subsequently transformed into E. coli. The resulting plasmid pCRLlst was re-checked by sequencing and the LI -gene subcloned into pPSl, resulting in the plasmid pi lLlst (with "st" denoting "synthetic truncated"). For the GFP :L1 -fusions, both clones Lls and List were PCR-modified to obtain a BamHI restriction site at the 5'-end. The forward primer was 1 lLlBam; 5' CTGGATCCATGTGGAGACCTTC 3' (SΕQ. ID. NO: 7). The resulting fragments were cloned into the vector pIBT210 having GFP under the control of the 35S promoter. The GFP gene used in this construct was the re-engineered version for plant expression described Chiu, W. et al., "Engineered GFP as a Vital Reporter in Plants," Curr. Biol. 6: 325-30 (1996), which is hereby incorporated by reference in its entirety. These constructs are illustrated in Figure IB.

The plasmid vector pGl lLlst is illustrated in Figure 8.

Example 2 - Transformation of Plants and Cell Suspensions.

For potato transformation, plasmids pi 1 Lls and pi 1 List were mobilized into Agrobacterium tumefaciens LBA4404 via electroporation. Potato internode segments from 6-week-old in-vitro-grown plants (Solanum tuberosum cv Desiree) were immersed for 10 minutes in a suspension of A. tumefaciens grown to an early log phase and then co-cultivated on agar plates containing 1 mg/L 6- benzylaminopurine (BAP) and 2 mg/L 1-naphthaleneacetic acid (NAA) in MS medium. After 48 h, internode segments were transferred to plates containing 4.3 g/L MS salts; 1 mg/L thiamine HCl; 0.5 mg/L nicotinic acid; 0,5 mg/L pyridoxine; 100 mg/L myo-inositol; 30 g/L sucrose; 0.5 mg/L indole-3 -acetic acid (IAA); 3 mg/L zeatin riboside; 100 mg/L carbeniciUin; and 75 mg/L kanamycin. After approximately 8 weeks, regenerated shoots were transferred to rooting medium (4.4 g MS salts; 100 mg/L myo-inositol; 0.4 mg/L thiamine HCl; 20 g/L sucrose; 100 mg/L carbeniciUin; and 75 mg/L kanamycin). Plantlets rooting on selection medium were clonally propagated and tested for transgene expression. Positive transformants were planted into soil and initially grown in a light chamber prior to transfer to the greenhouse. The potted plants in the greenhouse were maintained at 20-26 °C with 16 h light per day (additionally lighting with sodium vapor lamps). To obtain transient expression of GFP :L1 -fusions in cell suspension cultures, the biolistic delivery system with a particle gun (PDSIOOO/He device, Bio- Rad) was employed. Expression vectors were coated onto gold particles (1 μm) as described in Sanford, et. al., "Optimizing the Biolistic Process for Different Biological Applications," Methods Enzvmol 217: 483-509 (1993), which is hereby incorporated by reference in its entirety. Tobacco NT-1 cell suspension cultures were grown in liquid NT 1 -medium (MS salts; 500 mg Mes/L; 1 mg/L thiamin HCl; 100 mg L myo-inositol; 180 mg/L K₂HPO , 2.21 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), and 30 g/L sucrose (pH 5.7)) in 250-ml flasks on a shaker (27 °C, 250 rpm). For bombardment, 1 ml NT-1 cells grown for four days after inoculation were spread on a plate containing solidified NT1 medium (0.8% agar) covered with a filter disk. Bombardment was carried out as described before and cells were kept for 24 h at room temperature in the dark. For visualization of green fluorescence, an Olympus IX 70 system was used.

Example 3 - Isolation and Detection of Nucleic Acids.

Total RNA from plant tissue was isolated with Trizol reagent (Life Technologies, Rockville, MD) according to the manufacturers protocol. 10 μg RNA per lane were loaded on a 1% denaturing gel. DNA purification was performed with the CTAB-method described in Rogers, et. al., "Extraction of DNA from Milligram Amounts of Fresh, Herbarium and Mummified Plant Tissues," Plant Mol. Biol. 5: 69- 76 (1985), which is hereby incorporated by reference in its entirety. 30 μg of DNA were digested with Xhol (100 U) overnight and then separated on a 0.8% agarose gel. Electrophoretic separation of RNA and DNA, transfer to a membrane, and detection was performed as described in standard protocols (Sambrook, et. al., Molecular

Cloning - A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989), which is hereby incorporated by reference in its entirety). For PCR amplification with the PCR DIG probe synthesis kit (Roche Molecular Biochemicals, Indianapolis), two internal oligos were used to generate a 552 bp digoxigenin-11-dUTP-labled DNA fragment, representing the stretch between base 457 and 1009 of the synthetic HPVl 1 LI gene. This probe was subsequently used for detection of HPVl 1 LI RNA and DNA in Northern and Southern blots, respectively. Example 4 - Protein Extraction and Analysis.

For biochemical and immunological analyses, wild-type and transgenic LI tubers were peeled, sliced, diced and ground under liquid nitrogen. The resulting powder was suspended in 5 volumes of extraction buffer (phosphate-buffered saline (PBS), pH 7.2; 0.5 M NaCl; 50 mM Na-ascorbate; protease inhibitor mix, Roche) and kept on ice. For purification of LI complexes, ground tuber tissue was resuspended in extraction buffer (10 sample volumes) and clarified by sequential low-speed centrifugation (30 minutes/1, 500 x g, followed by 30 minutes/10,000 x g). Clarified supernatants were then centrifuged at high speed (3.5 hours/100,000 x g) and final pellets were resuspended in 1 ml of extraction buffer. Quantitation of plant-expressed LI was accomplished by polyacrylamide gel electrophoresis and Western blot analysis of freeze-dried specimens, using purified insect cell-produced HPVl 1 LI VLPs as standard. To freeze-dry specimens, tubers were harvested, washed in a 1 % bleach solution, rinsed well with water, and air-dried at 23°C. Tubers were then cut into approximately 1 cm³ pieces with a knife, placed in a 1% sodium ascorbate solution to avoid oxidation, placed in stainless steel trays, frozen at -40°C and freeze- dried in a commercial food freeze-drier (Virtis Model 100-SRC Sublimator; Virtis, Inc., Gardiner, NY) for 4 days at a maximum shelf temperature of 20°C. Dried tuber material was ground to powder, sealed in air-tight plastic bags, and stored at 23°C.

Example 5 - Immunological Analyses

Samples were prepared for evaluation by ELISA as follows. Wild-type (wt) or transgenic HPV-11 LI ST line 22 (ST22) tuber material was washed, peeled, cubed and then homogenized in a laboratory blender apparatus. Homogenates were centrifuged briefly at low speed to pellet solid debris and clarified supernatants were then centrifuged at high-speed to fractionate material into 100 K supernatant and pellet fractions. Pellets were resuspended by pipeting and supernatant and pellet fractions from wt and ST22 tuber were diluted 1 : 100 with PBS and 100 ml aliquots were pipeted into wells of a 96- well plate. Following incubation overnight at 40°C, wells were blocked with BSA (2%) and then reacted with rabbit polyclonal antisera raised against VLPs of either HPV-11 or HPV-16.

Freeze-dried specimens prepared from control and ST22 potato tubers were evaluated by Western blot immunoassay essentially as described (Rose et al., "Expression of the Full-Length Products of the Human Papillomavirus Type 6b

(HPV-6b) and HPV-11 L2 Open Reading Frames by Recombinant Baculo virus, and Antigenic Comparisons with HPV-11 Whole Virus Particles," J. Gen. Virol. 71:2725- 2729 (1990) and Strike et al., "Expression in Escherichia Coli of Seven DNA Fragments Comprising the Complete LI and L2 Open Reading Frames of Human Papillomavirus Type 6b and Localization of the 'Common Antigen' Region," J. Gen. Virol. 70:543-555 (1989), which are hereby incorporated by reference in their entirety). Briefly, extracts were loaded on 10% denaturing polyacrylamide gels, electrophoresed and blotted, and probed with a previously characterized rabbit polyclonal antiserum reactive with denatured papillomavirus LI (Strike et al., "Expression in Escherichia Coli of Seven DNA Fragments Comprising the Complete LI and L2 Open Reading Frames of Human Papillomavirus Type 6b and Localization of the 'Common Antigen' Region," J. Gen. Virol. 70:543-555 (1989), which is hereby incorporated by reference in its entirety). To obtain evidence of adoption of higher- order LI structure, tuber extracts were evaluated by enzyme-linked immunosorbent assay (ELISA) using previously characterized conformationally dependent type- restricted HPVl 1 or HPVl 6 virion-neutralizing polyclonal antisera, as previously described (Giroglou et al., "Immunological Analyses of Human Papillomavirus Capsids," Vaccine 19:1783-93 (2001); Rose et al, "Serological Differentiation of Human Papillomavirus Types 11, 16 and 18 Using Recombinant Virus-Like Particles," J. Gen. Virol. 75 :2445-2449 (1994); Rose et al., "Human Papillomavirus (HPV) Type 11 Recombinant Virus-Like Particles Induce the Formation of Neutralizing Antibodies and Detect HPV-Specific Antibodies in Human Sera," Gen. Virol. 75:2075-2079 (1994); and White et al., "In Vitro Infection and Type- Restricted Antibody-Mediated Neutralization of Authentic Human Papillomavirus Type 16," J. Virol. 72:959-964 (1998), which are hereby incorporated by reference in their entirety). Briefly, lysates were aliquoted (100 μl) into wells, and plates were incubated overnight at 4°C and then washed 3 times. Following this, HPVl 1 or HPV16 N-PAb were diluted, added to plates, and incubated 90 minutes at room temperature. Plates were then developed with secondary antibody (anti-rabbit IgG polyclonal antibody/enzyme conjugate) and colorimetric substrate as previously described (Giroglou et al., "Immunological Analyses of Human Papillomavirus Capsids," Vaccine 19: 1783-93 (2001), which is hereby incorporated by reference in its entirety). Purified insect cell-derived VLPs (Rose et al., "Serological Differentiation of Human Papillomavirus Types 11, 16 and 18 Using Recombinant Virus-Like Particles," J. Gen. Virol. 75:2445-2449 (1994); Rose et al., "Expression of Human Papillomavirus Type 11 LI Protein in Insect Cells: In Vivo and In Vitro Assembly of Viruslike Particles," J. Virol. 67:1936-1944 (1993); and Rose et al.,

"Human Papillomavirus (HPV) Type 11 Recombinant Virus-Like Particles Induce the Formation of Neutralizing Antibodies and Detect HPV-Specific Antibodies in Human Sera," J. Gen. Virol. 75:2075-2079 (1994), which are hereby incorporated by reference in their entirety) were used as reference standard to quantify LI protein in the plant samples by densitometry, using Kodak Digital Science™ ID Image Analysis Software (Kodak, "Digital Science ID Image Analysis Software, 3.0 ed. Eastman Kodak Company Scientific Imaging Systems, Rochester, New York (1995), which is hereby incorporated by reference in its entirety).

Example 6 - Antigen Denaturation

Conformational dependence and genotype-specificity are two properties of VLP antibody responses that are associated closely with, and thus are good surrogate markers for, virus-neutralizing activity (Schiller, "Papillomavirus-Like Particle Vaccines for Cervical Cancer," Molecular Medicine Today 5:209-215 (1999), which is hereby incorporated by reference in its entirety). To assess conformational dependence of HPVl 1 LI immunoreactivity detected in transgenic LI tuber, homogenates prepared from parental (control) and line ST22 tubers were diluted in carbonate buffer (pH 9.5; 0.01 mg/ml final concentration) and incubated in a boiling water bath for 10 minutes prior to evaluation by ELISA, as previously described (Dillner et al., "Antigenic and hnmunogenic Epitopes Shared by Human

Papillomavirus Type 16 and Bovine, Canine, and Avian Papillomaviruses," J. Virol. 65:6862-6871 (1991), which is hereby incorporated by reference in its entirety). As a control, an equivalent amount of each preparation was diluted in phosphate-buffered saline (PBS, pH 7.1) and kept on ice prior to evaluation.

Example 7 - Electron Microscopy Pelleted material recovered by high-speed centrifugation (see above) was further purified by sucrose sedimentation (40% w/v; 100,000 x g; 2 hours). Final pellets were resuspended in PBS (1 ml). Small amounts of these preparations (5 μl) were placed on formvar grids for approximately 1 minute. Excess liquid was drained by capillary action and grids were stained with 2% phosphotungstic acid for 1 minute, as previously described (Bonnez et al., "Use of Human Papillomavirus Type 11 Virions in an ELISA to Detect Specific Antibodies in Humans with Condylomata Acuminata," J. Gen. Virol. 72:1343-1347 (1991); Bonnez et al., "Antibody-Mediated Neutralization of Human Papillomavirus Type 11 (HPV-11) Infection in the Nude Mouse: Detection of HPV-11 mRNAs," J. Infect. Dis. 165:376-380 (1992); and Rose et al., "Expression of Human Papillomavirus Type 11 LI Protein in Insect Cells: In Vivo and In Vitro Assembly of Viruslike Particles," J. Virol. 67:1936-1944 (1993), which is hereby incorporated by reference in its entirety). Grids were imaged on a Hitachi 7100 transmission electron microscope.

Example 8 - Feeding Study

Female BALB/c mice (N=10/group) were fed meals consisting of 5 grams of either wild-type or transgenic LI tuber at weekly intervals as follows: 1), parental (non-transgenic) tuber; 2), transgenic HPVl lLlst-22 tuber; or 3), transgenic HPVl lLlst-22 tuber in combination with LT(R192G) (5 μg). Sera were collected at 4 weeks after primary immunizations (wpi) and evaluated in an enzyme-linked immunosorbent assay (ELISA). Following this, each group was divided into subgroups "A" and "B" (4-5 animals per subgroup). At six and nine wpi, subgroups A were fed as before, whereas subgroups B received VLP oral booster immunization (by gavage) as previously described (Gerber et al., "Human Papillomavirus Virus-Like Particles are Efficient Oral hnmunogens When Co-Administered with Escherichia Coli Heat-Labile Enterotoxin Mutant R192G or CpG DNA," J. Virol. 75:4752-4760 (2001) and Rose et al., "Oral Vaccination of Mice with Human Papillomavirus Virus- Like Particles Induces Systemic Virus-Neutralizing Antibodies," Vaccine 17:2129- 2135 (1999), which are hereby incorporated by reference in their entirety) with a subimmunogenic oral dose of insect cell-produced HPVl 1 LI VLPs (0.5 μg) in combination with adjuvant (LT(R192G); 5 μg). Post-boost sera were collected at 8 and 11 wpi and evaluated by ELISA as described (Giroglou et al., "Immunological Analyses of Human Papillomavirus Capsids," Vaccine 19:1783-93 (2001), which is hereby incorporated by reference in its entirety).

To evaluate papillomavirus LI expression in a plant-based system, GFP fusion constructs (i.e., GFP:1 ILls and GFP:1 lLlst) were transiently introduced into tobacco cells (NT-1) by microprojectile bombardment, and examined cells by fluorescence microscopy 24 hours later. Results indicated that full-length GFP/Lls localized essentially entirely within the nucleus, whereas cells that received the truncated form of LI (i.e., GFP:1 lLlst) exhibited a more diffuse pattern of fluorescence throughout the entire cell (compare Figures 2A-B to Figures 2C-D). HPVl 1 Lls and List genes were cloned into a plant expression cassette featuring the nptll gene for selection on kanamycin, the 35 S promoter for strong, constitutive expression, the TEV 5' UTR for enhanced translation, and the VSP 3' -UTR and polyadenylation signal. For each construct, 100 potato internode segments were transformed via A. tumefaciens mediated transformation. With both transformations only a low number of plants could be regenerated (3 for 1 ILls and 7 for 1 lLlst), indicating that LI expression may interfere with plant growth and viability. Since genome-integration of DNA via Agrobacterium is a random event and can occur multiple times, the number of transgene copies in the genome of the viable transformants was checked. The restriction enzyme Xhol has one recognition site inside the expression cassette, upstream of the 11L1 coding sequence. DNA analysis by Southern blot revealed that only 11 List Line #8 (ST8) showed two insertion sites, while all other lines contained only a single copy (Figure 3A). RNA analysis by Northern blot demonstrated that all 11 List lines generated transcripts of the expected size (~2 kb) (Figure 3B); however, none of the 1 ILls lines contained RNA of the expected size. Failure of LI mRNA to accumulate in 1 ILls transgenic lines suggests the possibility that nuclear localization of LI protein may alter plant viability. HPVl 1 Llst lines were transferred to the greenhouse for development of tubers. From 7 lines found to express List mRNA, only 3 yielded tubers (lines ST10, ST22, and ST23). Two other lines were not transferred to the greenhouse due to poor growth of tissue culture plantlets, and line ST8 showed stunted growth in the greenhouse and did not form tubers. Line ST 15 had a normal phenotype but did not yield tubers.

Extracts were prepared from the potato host line, and from lines ST10, ST22 and ST23, and evaluated in an ELISA for immunoreactivity with previously characterized conformationally dependent, genotype-restricted HPVl 1 virion- neutralizing polyclonal antibodies (N-PAb) (Rose et al., "Human Papillomavirus (HPV) Type 11 Recombinant Virus-Like Particles Induce the Formation of

Neutralizing Antibodies and Detect HPV-Specific Antibodies in Human Sera," Gen. Virol. 75:2075-2079 (1994), which is hereby incorporated by reference in its entirety). Results indicated that extracts from each of the transgenic LI lines examined were immunoreactive with this antiserum (Figure 4A), suggesting that plant-expressed LI was capable of correct self-assembly into higher order LI structures (i.e., capsomeres and/or capsids). The strongest level of immunoreactivity with HPVl 1 N-PAb was exhibited by ST22 extract (Figure 4A), and further analysis indicated that this activity could be enriched by centrifugal fractionation (Figure 4B). Control and ST22 extracts were evaluated by Western blot immunoassay after partial purification by sedimentation at 100,000 x g to pellet

VLPs. The ST22 extract, but not the control extract, contained an LI -immunoreactive band with an apparent mobility consistent with that expected for truncated LI lacking 21 C-terminal amino acids (i.e., -53 kDa; Figure 4C, arrow). Densitometric quantitation of this band, using purified insect cell-produced HPVl 1 LI VLPs as standard, indicated that ST22 potato tuber contained approximately 23 ng of LI VLP per gram of fresh tuber. LI immunoreactivity was also detected in the 100,000 x g supernatant, perhaps due to the presence of partially or fully assembled capsomeres.

To characterize the antigenic specificity of HPVl 1 LI transgenic tuber homogenates were prepared from control and ST22 tubers and evaluated in an ELISA in either native or denatured forms using HPVl 1 and HPVl 6 N-PAb. As seen in

Figure 5, HPVl 1 N-PAb reacted well with non-denatured extract prepared from ST22 tuber, but was relatively much less immunoreactive with the same extract following heat denaturation, and did not react with homogenate prepared from control tuber in either native or denatured form (Figure 5). With regard to HPV genotype-specificity, HPVl 6 N-PAb was not immunoreactive when tested against control or ST22 homogenates in either native or denatured forms (Figure 5). Thus, antigenic properties correlated previously with neutralization of authentic HPV virions (Rose et al.,

"Human Papillomavirus (HPV) Type 11 Recombinant Virus-Like Particles Induce the Formation of Neutralizing Antibodies and Detect HPV-Specific Antibodies in Human Sera," J. Gen. Virol. 75:2075-2079 (1994); Schiller, "Papillomavirus-Like Particle Vaccines for Cervical Cancer," Molecular Medicine Today 5:209-215 (1999); and White et al., "In Vitro Infection and Type-Restricted Antibody-Mediated

Neutralization of Authentic Human Papillomavirus Type 16," J. Virol. 72:959-964 (1998), which are hereby incorporated by reference in their entirety) were detected in HPVl 1 transgenic LI tuber.

Wild-type and ST22 tuber extracts were prepared for electron microscopy as described. Electron microscopic analyses of specimens prepared from line ST22, but not parental tuber, revealed the presence of capsid-like structures with size and morphology consistent with those of native HPVl 1 virions (i.e., 55 nanometer diameter spherical particles) (Figures 6A-B).

Post-immune sera were collected at the indicated timepoints (see Example 8) and evaluated in a VLP ELISA as described (Gerber et al., "Human Papillomavirus Virus-Like Particles are Efficient Oral Immunogens When Co- Administered with Escherichia Coli Heat-Labile Enterotoxin Mutant R192G or CpG DNA," J. Virol. 75:4752-4760 (2001), which is hereby incorporated by reference in its entirety). Evaluation of sera obtained at 4 wpi indicated that ingestion of transgenic LI potato with or without adjuvant had only minor effects on VLP ELISA seroreactivity (Figure 7A). However, following oral boosting, mice fed with transgenic LI potato with adjuvant demonstrated anti-VLP titers that were significantly greater than titers in mice fed with non-transgenic potato (Figure 7B; P=0.01). An effective orally delivered HPV prophylactic vaccine could facilitate efforts to control cervical HPV disease, particularly in low-resource settings where this disease is most prevalent. The results described above demonstrate that HPVl 1 Ll capsid protein can be expressed in an edible plant (i.e., potato tuber) to form empty capsids that are appropriately antigenic, as judged by the ability to bind antibodies that react specifically with, and efficiently neutralize, native HPVl 1 virions (Rose et al., "Serological Differentiation of Human Papillomavirus Types 11, 16 and 18 Using Recombinant Virus-Like Particles," J. Gen. Virol. 75:2445-2449 (1994); Rose et al., "Human Papillomavirus (HPV) Type 11 Recombinant Virus-Like Particles Induce the Formation of Neutralizing Antibodies and Detect HPV-Specific Antibodies in Human Sera," J. Gen. Virol. 75:2075-2079 (1994); and Rose et al., "Human Papillomavirus Type 11 Recombinant LI Capsomeres Induce Virus-Neutralizing Antibodies," Virol. 72(7):6151-6154 (1998), which are hereby incorporated by reference in their entirety). Importantly, these results demonstrate that ingestion of transgenic LI tubers activates anti-VLP immune responses that can be boosted by subsequent administration of purified VLPs. From this it can be concluded that HPV transgenic LI plants offer a feasible and potentially useful alternative strategy for immunization against anogenital HPV disease.

The requirement for co-administered adjuvant for induction of observed responses to potato-derived antigen suggests that the effective dose of HPVl 1 LI VLPs in these experiments was relatively low. Previous reports demonstrated the induction of anti-VLP responses in mice following oral administration of as little as 1 μg of purified insect cell-derived VLPs (Gerber et al., "Human Papillomavirus Virus-Like Particles are Efficient Oral Immunogens When Co- Administered with Escherichia Coli Heat-Labile Enterotoxin Mutant R192G or CpG DNA," J. Virol. 75:4752-4760 (2001), which is hereby incorporated by reference in its entirety). In the present study, responses induced by ingestion of transgenic LI potato were dependent on co-administration of adjuvant. Consistent with this observation, the quantitative analysis of LI expression in transgenic tuber indicated that the concentration of LI VLPs was approximately 20 ng per gram of fresh tuber. Thus, the effective oral dose level of VLPs in these experiments was approximately 100 ng per 5 gram feeding, or roughly one-tenth the amount of immunogen previously determined to represent the minimum oral dose level of purified insect cell-derived VLPs without adjuvant (Gerber et al., "Human Papillomavirus Virus-Like Particles are Efficient Oral Immunogens When Co-Administered with Escherichia Coli Heat- Labile Enterotoxin Mutant R192G or CpG DNA," J. Virol. 75:4752-4760 (2001), which is hereby incorporated by reference in its entirety). While such a low level of expression in plants precludes the direct use of the material of the present study in human subjects, the present results nevertheless demonstrate that this immunization strategy can be utilized effectively.

The ability of an immunogen to establish a memory response is a key element in the design of an efficacious vaccine. Responses to oral boosting observed in mice that ingested transgenic LI potato with adjuvant indicated the generation of antigen-specific memory cells. The absence of response to oral boosting in mice fed only non-transgenic potato supports this conclusion. The ability of plant-expressed LI to establish VLP-specific immune memory, even though VLPs were expressed at a relatively low level in potato, encourages further study of this vaccine material.

Previous studies have shown that transgene expression in plants often leads to low expression levels, presumably due to RNA instability or to the use of codons that are unfavorable in plants (Meyer, "Understanding and Controlling

Transgene Expression," Trends In Biotechnology 13:332-337 (1995), which is hereby incorporated by reference in its entirety). It has also been shown that re-synthesis of complete genes and their adaptation to the plant host can mediate much higher levels of heterologous protein expression (Koziel et al., "Optimizing Expression of Transgenes with an Emphasis on Post-Transcriptional Events," Plant Mol. Biol. 32:393-405 (1996) and Mason et al., "Edible Vaccine Protects Mice Against Escherichia Coli Heat-Labile Enterotoxin (It) - Potatoes Expressing a Synthetic lt-b Gene," Vaccine 16: 1336-1343 (1998), which are hereby incorporated by reference in their entirety). The analysis of the HPV11 LI coding sequence revealed several internal polyadenylation signals, intron splice recognition sequences, and mRNA destabilizing motifs that could yield truncated mRNA or decrease mRNA stability in plant cells. The synthetic LI sequence spares those signals and additionally provides a pattern of codon usage that is highly preferred for expression in dicotyledonous plants (Ausubel et al., Current Protocols in Molecular Biology, vol. 3. John Wiley & Sons, Brooklyn, NY (1994), which is hereby incorporated by reference in its entirety). With the optimized version of LI, expression of LI protein was observed only in plants transformed with a truncated form that lacked the C-terminal arm domain, which contains a well-characterized nuclear localization signal sequence (Merle et al., "Nuclear Import of HPVl 1 LI Capsid Protein is Mediated by Karyopherin Alpha 2/Beta 1 Heterodimers," J. Cell. Biochem. 74:628-637 (1999), which is hereby incorporated by reference in its entirety). The observations that (a) full-length HPVl 1 LI protein directed fused GFP specifically to the nucleus of plant cells and (b) that full-length LI protein was not expressed in transgenic potato plants are consistent with the conclusion that expression of full-length LI protein is not well tolerated in plants. Relatively low expression and poor transformation efficiency with the truncated LI gene suggests that even with the C-terminal NLS removed, LI protein could be toxic to plant cells. Use of developmentally regulated or chemically inducible promoters to control expression is likely to solve this problem. Preliminary results on HPVl 1 LI expression in tomato show promise for a fruit-specific promoter strategy.

The study of plant-based expression and oral delivery of vaccine antigens has expanded greatly in recent years, with a large number of papers showing faithful expression of antigenic proteins (Mason et al., "Edible Plant Vaccines: Applications for Prophylactic and Therapeutic Molecular Medicine," Trends Mol Med 8:324-9 (2002), which is hereby incorporated by reference in its entirety). Three human clinical trials have been published with orally delivered vaccines produced in plants, all showing stimulation of immune responses against the recombinant antigens expressed in edible plant tissues. The first (Tacket et al., "Immunogenicity in Humans of a Recombinant Bacterial Antigen Delivered in a Transgenic Potato," Nature Medicine 4:607-609 (1998), which is hereby incorporated by reference in its entirety) used potatoes expressing E. coli labile toxin B-subunit (LT-B), a strong mucosal immunogen that binds GMI gangliosides displayed on epithelial cell surfaces.

Ingestion of raw potato containing up to 750 μg LT-B on days 0, 7, and 21 resulted in toxin-neutralizing serum IgG antibodies in 10 of 11 subjects as late as day 59, and LT-B-specific IgA in fecal samples of some volunteers A human study with potato- expressed capsid protein of another enteric pathogen, Norwalk virus, also showed promising results (Tacket et al., "Human Immune Responses to a Novel Norwalk Virus Vaccine Delivered in Transgenic Potatoes," J. Infect. Pis. 182:302-5 (2000), which is hereby incorporated by reference in its entirety), with 95% of subjects showing increases in antibody-secreting cells of the IgA subtype. However, the serum IgG and fecal IgA levels produced by orally delivered antigen in this study were less impressive than in the LT-B study, suggesting that higher doses were needed. The only published human study with a non-enteric vaccine used hepatitis B surface antigen expressed in lettuce, and stimulated serum IgG at protective levels in 2 of 3 volunteers with 2 doses containing only 1 μg antigen (Kapusta et al., "A Plant- Derived Edible Vaccine Against Hepatitis B Virus," FASEB J. 13:1796-9 (1999), which is hereby incorporated by reference in its entirety).

Recent evidence of the remarkable protective efficacy of a parenterally administered HPV VLP vaccine (Koutsky et al., "A Controlled Trial of a Human Papillomavirus Type 16 Vaccine," N. Engl. J. Med. 347:1645-51 (2002), which is hereby incorporated by reference in its entirety) bodes well for the possibility of controlling cervical HPV disease through vaccination. Alternative immunization strategies are needed, however, to address the difficulties associated with distribution of parenteral vaccines in developing regions. As with other promising non-invasive methods of VLP administration (Balmelli et al., "Nasal Immunization of Mice With Human Papillomavirus Type 16 Virus-Like Particles Elicits Neutralizing Antibodies in Mucosal Secretions," J. Virol. 72:8220-8229 (1998); Dupuy et al., "Nasal Immunization of Mice with Human Papillomavirus Type 16 (HPV-16) Virus-Like Particles or with the HPV-16 LI Gene Elicits Specific Cytotoxic T Lymphocytes in Vaginal Draining Lymph Nodes." J.Virol. 73:9063-9071 (1999); Gerber et al., "Human Papillomavirus Virus-Like Particles are Efficient Oral Immunogens When Co-Administered with Escherichia Coli Heat-Labile Enterotoxin Mutant R192G or CpG DNA," J.Virol. 75:4752-4760 (2001); and Rose et al., "Oral Vaccination of Mice with Human Papillomavirus Virus-Like Particles Induces Systemic Virus- Neutralizing Antibodies," Vaccine 17:2129-2135 (1999), which are hereby incorporated by reference in their entirety), low cost and ease of delivering an edible HPV vaccine could facilitate vaccine distribution in economically disadvantaged regions, which carry a large burden of anogenital HPV disease. Example 9 - Synthetic HPV16 LI Gene

HPVl 6 is a serotype that is commonly associated with cervical cancer and is thus an important target for vaccines. As with the HPVl 1 LI, the native coding sequence of HPVl 6 LI gene was examined and multiple problems were found, including rarely used codons for plants, mRNA processing signals (polyadenylation and splicing), and mRNA instability motifs. Therefore, a plant-optimized coding sequence was designed that incorporates the most frequently used codons and eliminates spurious mRNA processing signals, mRNA instability motifs, and "CCGG" methylation sites. The designed sequence has a deletion of the C-terminal nuclear localization sequence in order to prevent deleterious nuclear targeting, which may interfere with cellular metabolism. The sequence shown below (i.e., the nucleotide sequence of SEQ ID NO: 8 and the amino acid sequence of SEQ ID NO: 9) was synthesized by the same method used for the synthetic HPVl 1 LI gene, and was incorporated into expression cassettes using the tuber-specific granule-bound starch synthase promoter for potato transformation (see Example 11), and the fruit- specific E8 promoter for tomato transformation (see Example 10)

HPVl 6 LI Plant-optimized, NLS-deleted gene "16Llst" is shown below. SEQ ID NO: 8 atgtctcttt ggctcccttc tgaagccact gtctacttgc ctcctgtccc agtttctaag 60 gttgtcagca ctgatgagta tgttgctaga acaaatatct actaccatgc tggaacatcc 120 agactccttg ctgttggaca tccctacttc cctattaaga aacctaacaa caacaagatc 180 ttggttccta aggtttcagg actccaatac agagtcttca ggatctatct tcctgacccc 240 aacaagtttg gattccctga cacctcattc tacaatccag acacacaaag gttggtttgg 300 gcctgtgttg gagttgaagt gggtagagga cagccattgg gagttggcat ctcaggccat 360 cctttactca acaaattgga tgacacagag aatgcttctg cttatgctgc taatgctggt- 420 gtggataata gagaatgcat ctccatggat tacaagcaaa cacagttgtg ccttattggt 480 tgcaagccac ctattgggga acactggggc aagggatcac catgtaacaa cgtggctgtt 540 actccaggag attgcccacc attggaattg atcaatacag tcatccaaga tggtgatatg 600 gtggatactg gctttggtgc tatggacttt actacacttc aggcaaacaa gtctgaagtt 660 ccattggata tctgtacatc catttgcaag tacccagatt acataaagat ggtctcagaa 720 ccatatggag acagcctctt cttctacctt cgtagggagc aaatgtttgt gagacatctc 780 tttaatagag ctggtactgt tggtgagaat gttccagatg atctctacat caagggctct 840 gggtctactg caaatttggc cagctcaaat tactttccta caccttctgg ttctatggtg 900 acctctgatg cccagatctt caacaagcct tactggttac aacgtgcaca gggccacaac 960 aatggcattt gctggggtaa tcaactcttt gttactgtgg tggacactac acgtagcaca 1020 aacatgtcac tttgtgctgc catatccact tcagagccta catacaagaa cactaacttc 1080 aaggaatacc ttaggcatgg ggaagagtat gatctccagt tcattttcca actctgcaag 1140 attaccctta ctgctgatgt tatgtcatac atccactcta tgaactccac tatcttggaa 1200 gactggaact ttggacttca gcctccccca ggaggcacat tggaggacac ttacagattt 1260 gttacatccc aagcaattgc ttgccagaag cacacacctc cagcacctaa agaagatccc 1320 cttaagaaat acactttttg ggaggttaac ctcaaagaga agttctctgc tgacttggat 1380 caattccctt tgggaaggaa attcctcctc caggctggat aa 1422

SEQ ID NO: 9

Met Ser Leu Trp Leu Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val 1 5 10 15

Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn 20 25 30

He Tyr Tyr His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro 35 40 45 Tyr Phe Pro He Lys Lys Pro Asn Asn Asn Lys He Leu Val Pro Lys 50 55 60

Val Ser Gly Leu Gin Tyr Arg Val Phe Arg He Tyr Leu Pro Asp Pro 65 70 75 80

Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gin 85 90 95

Arg Leu Val Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gin Pro 100 105 110

Leu Gly Val Gly He Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp 115 120 125 Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg 130 135 140

Glu Cys He Ser Met Asp Tyr Lys Gin Thr Gin Leu Cys Leu He Gly 145 150 155 160

Cys Lys Pro Pro He Gly Glu His Trp Gly Lys Gly Ser Pro Cys Asn 165 170 175

Asn Val Ala Val Thr Pro Gly Asp Cys Pro Pro Leu Glu Leu He Asn 180 185 190

Thr Val He Gin Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met 195 200 205 Asp Phe Thr Thr Leu Gin Ala Asn Lys Ser Glu Val Pro Leu Asp He 210 215 220

Cys Thr Ser He Cys Lys Tyr Pro Asp Tyr He Lys Met Val Ser Glu 225 230 235 240

Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gin Met Phe 245 250 255 Val Arg His Leu Phe Asn Arg Ala Gly Thr Val Gly Glu Asn Val Pro 260 265 270

Asp Asp Leu Tyr He Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser 275 280 285

Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala 290 295 300 Gin He Phe Asn Lys Pro Tyr Trp Leu Gin Arg Ala Gin Gly His Asn 305 310 315 320

Asn Gly He Cys Trp Gly Asn Gin Leu Phe Val Thr Val Val Asp Thr 325 330 335

Thr Arg Ser Thr Asn Met Ser Leu Cys Ala Ala He Ser Thr Ser Glu 340 345 350

Pro Thr Tyr Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu 355 360 365

Glu Tyr Asp Leu Gin Phe He Phe Gin Leu Cys Lys He Thr Leu Thr 370 375 380 Ala Asp Val Met Ser Tyr He His Ser Met Asn Ser Thr He Leu Glu 385 390 395 400

Asp Trp Asn Phe Gly Leu Gin Pro Pro Pro Gly Gly Thr Leu Glu Asp 405 410 415

Thr Tyr Arg Phe Val Thr Ser Gin Ala He Ala Cys Gin Lys His Thr 420 425 430

Pro Pro Ala Pro Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu 435 440 445

Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gin Phe Pro Leu 450 455 460 Gly Arg Lys Phe Leu Leu Gin Ala Gly 465 470

Example 10 - Construction of Expression Vectors Containing the Fruit-specific E8 Promoter

The tomato fruit-ripening dependent promoter from the E8 gene was obtained from pE8mutRN2.0(-), kindly provided by R.L. Fischer, U. California, Berkeley (Deikman et al., "Organization of Ripening and Ethylene Regulatory Regions in a Fruit-Specific Promoter from Tomato (Lycopersicon esculentum)," Plant Phvsiol. 100:2013-2017 (1992) and Giovannoni et al., "Expression of a Chimeric

Polygalacturonase Gene in Transgenic rin (Ripening Inhibitor) Tomato Fruit Results in Polyuronide Degradation but not Fruit Softening," Plant Cell 1 :53-63 (1989), which are hereby incorporated by reference in their entirety). The E8 promoter was subcloned into pBluescriptKS(+) (Strategene, La Jolla, CA) by digestion of pE8mutRN2.0(-) with EcoRI and Sail and purification of the 2.2 kbp promoter fragment, to make pKS-E8-RS. The 2.2 kbp E8 promoter fragment was then obtained by digestion of ρKS-E8-RS with Pstl and partial digestion with Xbal. The HPVl 1 LI expression cassette was assembled to make pUCE8-l lLlst by Hgation of the E8 promoter fragment (Pstl-Xbal) with pTH210 (Mason et al., "Edible Vaccine Protects Mice Against E. coli Heat-labile Enterotoxin (LT): Potatoes Expressing a Synthetic LT-B gene," Vaccine 16:1336-1343 (1998), which is hereby incorporated by reference in its entirety) digested with Pstl and Sa (providing the vspB 3 ' element in pUCl 9), and the C-terminal truncated plant-optimized HPVl 1 LI gene obtained by digestion of pi lLlst (described supra) with Xbal and Sad. The HPV16 LI expression cassette was assembled to make pUCE8-16Llst by Hgation of the E8 promoter fragment (Pstl-Xbal) with pTH210 (Mason et al., "Edible Vaccine Protects Mice Against E. coli Heat-labile Enterotoxin (LT): Potatoes Expressing a Synthetic LT-B gene," Vaccine 16:1336-1343 (1998), which is hereby incorporated by reference in its entirety) digested with Pstl and Sad (providing the vspB 3' element in pUC19), and the C-terminal truncated plant-optimized HPVl 6 LI gene obtained by digestion of pCR2-16Llst (described supra) with Xbal and Sad. The expression cassettes were transferred to an Agrobacterium binary vector by digestion of pUCE8- 1 lLlst or pUCE8-16Llst with Hindlll and Sad, and Hgation with pllLlst digested likewise, to produce pE8-l lLlst and pE8-16Llst. Maps of these plasmids are shown in Figures 9 and 10, respectively.

Tomato plants were transformed as described (McCormick et al., "Leaf Disc Transformation of Cultivated Tomato (L. esculentum) Using Agrobacterium tumefaciens," Plant Cell Rep 5:81-84 (1986), which is hereby incorporated by reference in its entirety). Transgenic lines were identified by selection on media containing kanamycin and confirmed by PCR of genomic DNA. Selected lines were grown to maturity in the greenhouse for evaluation of expression of LI protein in ripening fruits. The fruits were extracted and extracts were evaluated for LI antigen and VLP by ELISA and Western immunoblot as described in Example 5.

The Western immunoblot demonstrates the presence of HPVl 1 List and HPVl 6 List in extracts prepared from HPVl 1 List transgenic tomato and HPV16 List transgenic tomato, respectively (Figure 11). Because the immunoblot was performed under denaturing conditions and utilizes antiserum to the "common epitope" (Strike et al., "Expression in Escherichia coli of seven DNA fragments comprising the complete LI and L2 open reading frames of human papillomavirus type 6b and localization of the 'common antigen' region," J. Gen. Virol. 70:543-555 (1989), which is hereby incorporated by reference in its entirety), an ELISA was performed to assess whether conformational LI epitopes were present in the extracts. The ELISA results, performed using previously characterized conformationally dependent and virus genotype-specific HPVl 1 or HPVl 6 virion-neutralizing rabbit hyperimmune sera (Rose et al., "Serological Differentiation of Human Papillomavirus Types 11, 16 and 18 Using Recombinant Virus-like Particles," J. Gen. Virol. 75:2445- 2449 (1994); Rose et al., Human Papillomavirus (HPV) Type 11 Recombinant Viruslike Particles Induce the Formation of Neutralizing Antibodies and Detect HPV- specific Antibodies in Human Sera," J. Gen. Virol. 75:2075-2079 (1994); White et al., "In vitro Infection and Type-restricted Antibody-mediated Neutralization of Authentic Human Papillomavirus Type 16," J. Virol. 72:959-964 (1998), which are hereby incorporated by reference in their entirety), demonstrate the presence of conformationally correct epitopes in the fruit extracts from HPVl 1 List transgenic tomato and HPVl 6 List transgenic tomato (Figure 12). Selected lines can be propagated by seeds of self-fertilized plants, and homozygous lines can be selected by evaluation of transgene in the progeny plants grown from the seeds. The presence of the transgene in 100% of progeny indicates that the parent is homozygous for the transgene.

Example 11 - Regulated Expression of HPV Ll Genes With Tissue-Specific Promoters in Potato

Poor efficiency of transformation of potato was observed when using constructs in which the HPV Ll genes were driven by a strong constitutive promoter, and low expression was observed in transgenic lines that were regenerated. The transformation efficiency was substantially better using a truncated HPVl 1 Ll gene lacking the C-terminal nuclear localization signal (NLS). Only nuclear localization of GFP fusion proteins with HPVl 1 Ll containing the NLS was observed (Figures 2A- B), while GFP fusions with HPVl 1 Ll lacking the NLS was distributed throughout the cell, including the nucleus (Figures 2C-D). Thus it is likely that nuclear deposition of the Ll protein perturbs nuclear function and results in poor cell growth and plant development. When the Ll gene is expressed with a strong constitutive promoter, efficiency of transformation is thus decreased due to interference with organogenesis and plant development. Therefore, the use of developmentally regulated or chemically inducible promoters to drive Ll expression is preferred for optimal accumulation of Ll protein in tissues of transgenic plants.

Potato tuber-specific expression vectors were constructed using the granule bound starch synthase (GBSS) promoter from potato (Visser et al.,

"Expression of a Chimeric Granule-Bound Starch Synthase-GUS Gene in Transgenic Potato Plants," Plant Mol. Biol. 17: 691-699 (1991), which is hereby incorporated by reference in its entirety). The 811 bp GBSS promoter was obtained by PCR of genomic DNA from Solanum tuberosum L. cv. "FL1607" using primers designed from the sequence in Genbank accession X83220 (which is hereby incorporated by reference in its entirety) for the Chinese potato cultivar "Dongnong". A mutagenic primer "GSS-Xho" (5'-agctcGAGCTGTGTGAGTGAGTG) (SEQ ID NO: 10) was used to create a Xhol site just 3 ' of the transcription start site, along with forward primer "GSS-1.8F" (5'-gatctgacaagtcaagaaaattg) (SEQ ID NO: 11) complementary to the 5 ' region at -1800 bp; the 1550 bp PCR product was cloned in T-tailed pBluescriptKS to make pKS-GBX, and sequenced. The 811 bp Hindlll/Xhol fragment of pKS-GBX was then subcloned into pHPVl lLlst (Figure 1) to yield pGl lLlst (Figure 8). A similar construct was made using the plant-optimized HPVl 6 List gene, to make pG16Llst. Potato plants were transformed as described in Example 2. In order to evaluate tuber-specific expression, microtubers are produced in tissue culture using stem node explants from the regenerated plantlets as described (Wenzler et al., "Analysis of a Chimeric Class-I Patatin-GUS Gene in Transgenic Potato Plants: High-Level Expression in Tubers and Sucrose-Inducible Expression in Cultured Leaf and Stem Explants," Plant Mol. Biol. 12:41-50 (1989), which is hereby incorporated by reference in its entirety). Microtubers are extracted as described in Example 4 and extracts are evaluated for Ll antigen and VLP by ELISA as described in Example 5. Selected plants are grown to maturity in the greenhouse for evaluation of expression of Ll protein in soil-grown tubers.

Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.

Claims

WHAT IS CLAIMED:

1. A method of producing papillomavirus virus-like particles or capsomeres, said method comprising: providing a transgenic plant or plant seed transformed with a nucleic acid molecule comprising a papillomavirus Ll capsid protein coding sequence and growing the transgenic plant or a transgenic plant grown from the transgenic plant seed under conditions effective to produce virus-like particles containing the papillomavirus Ll capsid protein.

2. The method according to claim 1, wherein the papillomavirus is a human papillomavirus.

3. The method according to claim 2, wherein the human papillomavirus is selected from the group consisting of HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, and HPV-34.

4. The method according to claim 1, wherein the plant is selected from the group consisting of rice, wheat, barley, rye, cotton, sunflower, peanut, corn, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, strawberry, grape, raspberry, pineapple, soybean, tobacco tomato, sorghum, sugarcane, and banana.

5. The method according to claim 1 , wherein a transgenic plant is provided.

6. The method according to claim 1 , wherein a transgenic plant seed is provided.

7. The method according to claim 1, wherein said providing comprises: providing a genetic construct comprising a papillomavirus Ll capsid protein coding sequence and transforming a plant cell with the genetic construct.

8. The method according to claim 7 further comprising: propagating plants from the transformed plant cell.

9. The method according to claim 7, wherein the genetic construct further comprises: a plant promoter and a terminator, wherein the plant promoter and the terminator are operatively coupled to the papillomavirus Ll capsid protein coding sequence.

10. The method according to claim 9, wherein genetic construct is in an expression vector.

11. The method according to claim 7, wherein said transforming is carried out by Agrobacterium-medi&ted transformation, biolistic transformation, or electroporation.

12. The method according to claim 1 , wherein the virus-like particles comprise a conformational epitope that reacts with an antibody raised against a native papillomavirus virion.

13. A genetic construct comprising: a papillomavirus Ll capsid protein coding sequence; a plant promoter; and a terminator, wherein the plant promoter and the terminator are operatively coupled to the papillomavirus Ll capsid protein coding sequence.

14. The genetic construct according to claim 13, wherein the papillomavirus is a human papillomavirus.

15. The genetic construct according to claim 14, wherein the human papillomavirus is selected from the group consisting of HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, and HPV-34.

16. The genetic construct according to claim 13, wherein the papillomavirus Ll capsid protein coding sequence is formed from a full length papillomavirus Ll capsid protein coding sequence having a truncated carboxy terminus, whereby the coding sequence's nuclear localization site has been removed.

17. An expression system containing the genetic construct according to claim 13.

18. The expression system according to claim 17, wherein the papillomavirus Ll capsid protein coding sequence is in proper sense orientation.

19. A host cell transformed with the genetic construct according to claim 13.

20. The host cell according to claim 19, wherein the host ceU is a plant cell or a bacterial cell.

21. A plant transformed with the genetic construct according to claim 13.

22. The plant according to claim 21 , wherein the papillomavirus is a human papillomavirus.

23. The plant according to claim 22, wherein the human papillomavirus is selected from the group consisting of HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, and HPV-34.

24. The plant according to claim 21 , wherein the plant is selected from the group consisting of rice, wheat, barley, rye, cotton, sunflower, peanut, com, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, strawberry, grape, raspberry, pineapple, soybean, tobacco tomato, sorghum, sugarcane, and banana.

25. The plant according to claim 21 , wherein the promoter is from a developmentally-regulated gene or an inducible promoter.

26. The plant according to claim 21 , wherein the plant is transformed in its chloroplasts.

27. A component part of the plant according to claim 21.

28. A fruit of the plant according to claim 21.

29. A plant seed produced from the plant according to claim 21.

30. A plant seed transformed with the genetic construct according to claim 13.

31. The plant seed according to claim 30, wherein the papillomavirus is a human papillomavirus.

32. The plant seed according to claim 31 , wherein the human papillomavirus is selected from the group consisting of HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, and HPV-34.

33. The plant seed according to claim 30, wherein the plant is selected from the group consisting of rice, wheat, barley, rye, cotton, sunflower, peanut, corn, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, strawberry, grape, raspberry, pineapple, soybean, tobacco tomato, sorghum, sugarcane, and banana.

34. A method of growing a plant transformed with a papillomavirus Ll capsid protein coding sequence comprising: providing a plant seed according to claim 30 and growing the plant seed under conditions effective to produce a plant transformed with a papillomavirus Ll capsid protein coding sequence.

35. A method of immunizing a subject against disease resulting from infection by a papillomavirus, said method comprising: administering the plant according to claim 21 or a component part or a fruit thereof to the subject under conditions effective to immunize the subject.

36. The method according to claim 35, wherein a fruit is administered.

37. The method according to claim 35, wherein a component part of the plant is administered.

38. The method according to claim 35, wherein the papillomavirus is a human papillomavirus.

39. The method according to claim 38, wherein the human papillomavirus is selected from the group consisting of HPV-6, HPV-11, HPV-1 , HPV-18, HPV-33, and HPV-34.

40. The method according to claim 35, wherein the plant is selected from the group consisting of rice, wheat, barley, rye, cotton, sunflower, peanut, corn, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, strawberry, grape, raspberry, pineapple, soybean, tobacco tomato, sorghum, sugarcane, and banana.

41. The method according to claim 35, wherein said administering is carried out by feeding the plant or the component part or fruit thereof to the subject.