WO2003089669A1

WO2003089669A1 - Novel method of assaying nucleic acid

Info

Publication number: WO2003089669A1
Application number: PCT/JP2003/005118
Authority: WO
Inventors: Shinya Kurata; Ichiro Watanabe; Takahiro Kanagawa; Yoichi Kamagata
Original assignee: Kankyo Engineering Co., Ltd.; National Institute Of Advanced Industrial Science And Technology
Priority date: 2002-04-22
Filing date: 2003-04-22
Publication date: 2003-10-30
Also published as: JP2009077736A

Abstract

A complex sample frequently contains a substance inhibiting PCR. A novel method of assaying a nucleic acid whereby a specific gene (hereinafter referred to as the target gene) in such a sample containing at least one target nucleic acid can be accurately and quickly detected and quantified by the real time quantitative PCR. This method comprises adding a nucleic acid (an internal standard nucleic acid) having a partial mutation in the base sequence of the target nucleic acid at a known concentration to an assay system, further adding a target nucleic acid probe specifically hybridizable with the target nucleic acid and an internal standard nucleic acid probe specifically hybridizable with the internal standard nucleic acid to the assay system, performing PCR, simultaneously assaying the target nucleic acid and the internal standard nucleic acid, and determining the concentration of the target nucleic acid from the concentration of the internal nucleic acid thus measured.

Description

Description New nucleic acid measurement method Technical field

The present invention relates to a method for measuring a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye.

Specifically, in the method, a target nucleic acid probe that specifically hybridizes to a target nucleic acid in a measurement system or a reaction system in which a nucleic acid hybridization reaction and Z or a substance that inhibits a nucleic acid amplification reaction is present. This is a method for specifically and accurately measuring at least one type of target nucleic acid by adding an internal standard nucleic acid probe that specifically hybridizes to an internal standard nucleic acid corresponding to the target nucleic acid.

In addition, the target is characterized in that after all nucleic acids including the target nucleic acid are cleaved by at least one restriction enzyme that does not cut the target nucleic acid base sequence region, only the nucleic acid fraction containing the target nucleic acid base sequence is separated and recovered. This is a nucleic acid separation and recovery / concentration method.

Further, the present invention is characterized in that a gene is amplified using an artificially synthesized single-stranded oligonucleotide nucleic acid nucleic acid having an arbitrary sequence of 50 bp or more having a type I and a double-stranded DNA having an arbitrary sequence is obtained. This is a method for obtaining artificially synthesized genes. Background art

There are many known methods for measuring a corresponding nucleic acid using a nucleic acid probe. You. For example,

(1) Method using FRET (fluorescence energy transfer) phenomenon using a probe (Morrison et al., Anal. Biochem., Vol. 183, 23 g 244, 1989; ergney et al., Nucleic acid Res., Vol. 22, 920-928, 1994; Tyagi et al., Nature Biotech., Vol. 14, 303-308, 1996; JP-A-10-26270; JP-A-10- 8 4 9 8 3),

(2) Fluorescent dyes interact with specific nucleobases to reduce the amount of fluorescent light using probes. Method for measuring the concentration or copy number of DNA (KURATA et al., Nucleic acids Research, 2001, vol. 29, No. 6 e34),

And many other examples.

In either method, a probe labeled with a fluorescent dye is used in a measurement system in which one kind of corresponding nucleic acid is present (meaning that there is more than one nucleic acid species in the measurement system, but one corresponding nucleic acid exists). Or two types {in this case, a donor probe (may be simply referred to as a luminescent probe or a nucleic acid probe) and an acceptor probe (sometimes simply referred to as a quencher probe)}. In this method, a fluorescence reaction and / or a nucleic acid amplification reaction is performed to measure the fluorescence intensity of the measurement system. In particular, a method using a nucleic acid amplification reaction is a method in which a corresponding nucleic acid is amplified by a PCR method in the presence of a nucleic acid probe, and the PCR product is monitored in real time to measure the corresponding nucleic acid before amplification. Known as real-time monitoring quantitative PCR.

In addition, complex samples often contain inhibitors of the hybridization reaction or nucleic acid amplification reaction. In particular, the real-time monitor ring setting In the quantitative PCR method, a calibration curve is created based on the assumption that the inhibitor is not contained.In such a case, the target nucleic acid in a complex sample or the target nucleic acid before the nucleic acid amplification reaction is used in such a case. Can not be measured accurately. In the real-time monitoring quantitative PCR method, the corresponding nucleic acids before amplification were quantified using an exponential calibration curve.

The total number of gene types present in a particular sample is enormous, and the amount is often biased toward one. In many cases, the target gene of interest is rarely present in such a sample. The amount of genes that can be added to a measurement system for detecting and measuring the target gene (PCR methods, real-time quantitative PCR methods, etc. can be mentioned as suitable examples) is limited. Even if such a gene is added to the limit amount, a case may occur in which only a small amount of the target gene of interest or an undetectable amount is present in the added gene. This is often the case when detecting and measuring a target gene in a sample having the above characteristics. In this case, it is impossible or difficult to accurately and specifically detect and measure the target gene. For this reason, it is preferable to isolate and collect the target gene. Further, it is particularly desirable to concentrate the separated and recovered material. However, at present there is no such means.

When producing an artificial gene having an arbitrary sequence, a single-stranded oligonucleotide (DNA) of an arbitrary sequence and an arbitrary length is synthesized using a commercially available nucleic acid synthesizer. There are many cases. However, since the efficiency of synthesizing a single base is not 100%, the longer the base length of the oligonucleotide, the more the synthesis stops, and the sequence other than the target sequence is not included. The proportion of oligonucleotides that increase is increased. For this reason, it is generally said that the limit at which oligonucleotides can be synthesized is up to about 100 bases (hereinafter referred to as bp). When the length is about 50 bp or more, the ratio of oligonucleotides having a sequence other than the target increases, so that a complicated separation operation is required. Even when the above operation is performed, when a long oligo DNA having a length of 5 O bp or more is synthesized, the acquisition ratio of the target oligonucleotide is often lower than that obtained with a short oligo DNA. Therefore, there has been a demand for a method for easily obtaining an artificial gene having an arbitrary sequence of 50 bases or more.

An object of the present invention is to solve the above problems.

An object of the present invention is to provide a method for specifically measuring a target nucleic acid by a simple method when at least one or more target nucleic acids are present in a measurement system including a complicated sample. A new method that can measure accurately, in a short time, in a short time, easily and accurately, a novel nucleic acid amplification method, a method for determining the concentration or copy number of a target nucleic acid before nucleic acid amplification using it, and the data obtained by these methods. The purpose of the present invention is to provide a method for analyzing, and a method for applying these methods to various methods. Further, a device such as a DNA chip used in the method, a measuring reagent kit, a computer-readable recording medium in which a procedure for causing a computer to execute a process of a data analysis method is recorded as a program, and a target according to the method of the present invention. An object of the present invention is to provide a measuring device for measuring nucleic acids, a measuring device incorporating a computer-readable recording medium, a method for separating, collecting and concentrating a target nucleic acid, a method for synthesizing an artificial gene having an arbitrary sequence, and the like.

Disclosure of the invention The present inventors have conducted intensive studies using the method of 2) KURATA et al. (KURATA et al., Nucleic acid Reseach, 2001, vol. 29, No. 6 e34) and found that the target A nucleic acid in which a part of the base sequence of the nucleic acid is mutated (hereinafter, referred to as an internal standard nucleic acid) is added to a measurement system at a known concentration, and a target nucleic acid probe (hereinafter, referred to as a hybridizer) that specifically hybridizes to the target nucleic acid is added. A target nucleic acid probe that hybridizes specifically with the internal standard nucleic acid (hereinafter referred to as an internal standard nucleic acid probe) is added to the measurement system, and the hybridization reaction and the Z or nucleic acid amplification reaction are performed. The target nucleic acid and the internal standard nucleic acid are simultaneously measured, and the total nucleic acid containing the target nucleic acid is cleaved by at least one or more restriction enzymes so as not to cut the target nucleic acid base sequence region. By separating and recovering only the nucleic acid fraction containing the base sequence, and by performing gene amplification using an artificially synthesized single-stranded oligonucleic acid having an arbitrary sequence of 50 bp or more as type III. We have found that the above problems can be solved. The present invention has been completed based on such findings.

That is, the present invention

[Claim 1] A nucleic acid probe comprising at least one kind of oligonucleotide labeled with at least one kind of fluorescent dye (hereinafter, simply referred to as “nucleic acid probe”), which is hybridized to a corresponding nucleic acid (target nucleic acid). A method for measuring a target nucleic acid using at least one kind of nucleic acid probe that changes the fluorescent character of the labeled fluorescent dye (hereinafter, simply referred to as “a method for measuring nucleic acid using a nucleic acid probe”). The target nucleic acid in the assay system contains at least one target nucleic acid and at least one known amount of an internal standard nucleic acid corresponding to the target nucleic acid, and is labeled with at least one fluorescent dye specific to the target nucleic acid. A nucleic acid probe consisting of a leotide (hereinafter simply referred to as It is called “target nucleic acid probe”. ) Or at least one nucleic acid probe (hereinafter simply referred to as "internal standard nucleic acid probe") consisting of an oligonucleotide labeled with at least one fluorescent dye specific to the internal standard nucleic acid. Alternatively, in a reaction system containing at least one target nucleic acid probe and at least one internal standard nucleic acid probe, a hybridization reaction and / or a nucleic acid amplification reaction is carried out, and the reaction is caused by the hybridization between the target nucleic acid probe and the target nucleic acid. The change or amount of change in the fluorescence character of the target nucleic acid probe before and after hybridization, and the hybridization of the fluorescent character of the internal standard nucleic acid probe caused by the hybridization between the internal standard nucleic acid probe and the internal standard nucleic acid. The change or amount of change before and after the A novel nucleic acid measurement method, comprising measuring a target nucleic acid and Z or a target nucleic acid before a nucleic acid amplification reaction based on a measured value obtained at a constant wavelength and the amount of the internal standard nucleic acid added.

[2] The novel nucleic acid measurement method according to [1], wherein the internal standard nucleic acid has at least one of the following characteristics.

1) The internal standard nucleic acid has a base sequence that can be distinguished from the target nucleic acid based on the change or the amount of change in the fluorescent character obtained by hybridization with the corresponding nucleic acid probe.

2) The internal standard nucleic acid has a base sequence that hybridizes only with the internal standard nucleic acid probe under certain conditions and does not hybridize with the target nucleic acid.

3) The internal standard nucleic acid has a base sequence partially different from that of the target nucleic acid.

4) The base length of the internal standard nucleic acid is different from that of the target nucleic acid.

5) The internal standard nucleic acid can be amplified simultaneously with the target nucleic acid using the same primer.

[Claim 3] The internal standard nucleic acid probe has at least the following characteristics: 3. The novel method for measuring a nucleic acid according to claim 1, wherein the method has one.

1) The internal standard nucleic acid probe has a base sequence capable of hybridizing with the corresponding nucleic acid.

2) The internal standard nucleic acid probe has a base sequence that hybridizes only with the internal standard nucleic acid under certain conditions and does not hybridize with the target nucleic acid.

3) The target nucleic acid hybridizes to the target nucleic acid probe due to the change in the fluorescent character or the amount of change of the fluorescent dye labeled on the internal standard nucleic acid probe caused by the hybridization of the internal standard nucleic acid probe with the internal standard nucleic acid. Thus, the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe can be clearly distinguished.

[Claim 4] Each of the target nucleic acid probe and the Z or internal standard nucleic acid probe is a single-stranded oligonucleotide that hybridizes to a corresponding nucleic acid, and is a kind of a single dye (including a reporter dye). ) And at least one nucleic acid probe obtained by labeling or a type of an acceptor dye (including a quencher dye or a quencher substance), wherein the nucleic acid probe hybridizes to a corresponding nucleic acid. Use a target nucleic acid probe and / or an internal standard nucleic acid probe with a donor dye and an acceptor dye labeled on the oligonucleotide so that the change or the amount of change in the fluorescent character of the hybridization reaction system increases. A novel method for measuring a nucleic acid according to any one of claims 1 to 3.

[5] The novel nucleic acid measurement method according to [4], wherein the target nucleic acid probe and / or the internal standard nucleic acid probe has any one of the following forms.

1) By hybridizing with the corresponding nucleic acid in the form of a kind of oligonucleotide labeled with a donor dye and an acceptor dye, The change or amount of change in the fluorescent character of the donor dye before and after the localization.

2) Hybridization with the corresponding nucleic acid in the form of a type of oligonucleotide labeled with a donor dye and an acceptor dye, thereby changing or changing the fluorescent character of the donor dye and the acceptor dye before and after hybridization. Is negative.

3) A kind of probe consisting of one kind of oligonucleotide labeled with one kind of dye and one kind of probe consisting of one kind of oligonucleotide and one kind of oligonucleotide labeled with one receptor dye Is a form in which two kinds of probes of the acceptor probe form a pair, and the donor probe and / or the acceptor probe hybridize with the corresponding nucleic acid, so that the donor dye and the acceptor dye before and after hybridization are formed. The change or amount of change in the fluorescent character is negative or positive.

[Claim 6] The target nucleic acid probe and Z or the internal standard nucleic acid are hybridized with the corresponding nucleic acid in the form of one kind of oligonucleotide labeled with a donor dye and an acceptor dye, so as to be before and after hybridization. The change or the amount of change in the fluorescent character of the donor dye and the acceptor dye is negative, and the terminal is labeled with a donor dye or an acceptor dye, and the nucleic acid probe is supported at the corresponding end. The base sequence of the lobe should be one to three bases away from the terminal base of the corresponding nucleic acid hybridized to the probe when hybridized to the nucleic acid, so that at least one base G (guanine) is present in the base sequence of the corresponding nucleic acid. Target nucleic acid probe and / or internal standard nucleic acid probe for which New measurements how the nucleic acid according to claim 4 for use. 05118

9

[Claim 7] The target nucleic acid probe and / or the internal standard nucleic acid is hybridized with the corresponding nucleic acid in the form of one kind of oligonucleotide labeled with a donor dye and an acceptor dye, so that the nucleic acid before and after the hybridization is obtained. The change or the amount of change in the fluorescent character of the donor dye and the acceptor dye is negative, and when hybridized to the corresponding nucleic acid, the probe or nucleic acid hybrid at the donor or acceptor dye-labeled portion has multiple nucleotides Use a target nucleic acid probe and a 7 or internal standard nucleic acid probe whose base sequence is designed so that the pair forms at least one pair of G (guanine) and C (cytosine). A novel method for measuring a nucleic acid according to claim 4.

[Claim 8] The target nucleic acid probe and / or the internal standard nucleic acid probe is composed of a single-stranded oligonucleotide labeled with at least one kind of fluorescent dye, and has at least one of the following characteristics. The novel nucleic acid measurement method according to any one of claims 1 to 3, wherein a probe for which the probe is designed is used.

1) A function can be exhibited with a kind of probe in the reaction system or the measurement system.

2) When hybridized to the target nucleic acid and Ζ or the internal standard nucleic acid, the fluorescent dye reduces the change or the amount of change of the fluorescent character in the absence of quencher dye and Ζ or quencher probe. To increase.

3) The probe is labeled at least with a fluorescent dye at its end.

4) When the nucleic acid probe hybridizes to the target nucleic acid, it is 1 to 3 bases away from the dye-labeled base of the probe (the labeled base is counted as 1), and at least G (guanine) is present. 1 base present I do.

5) When the nucleic acid probe has hybridized to the target nucleic acid at the terminal portion, at least one G (guanine) and C (cytosine) primer in the terminal portion has a plurality of probe-nucleic acid hybrid base pairs. To form

[Claim 9] The target nucleic acid probe and / or the internal standard nucleic acid probe according to claim 8, wherein the 3′-terminal ribose or deoxyribose 3′-carbon hydroxyl group, or the 3′-terminal ribose 3 ′ or 2′-carbon 9. The novel nucleic acid measurement method according to claim 8, wherein a target nucleic acid probe having a phosphorylated hydroxyl group and Z or an internal standard nucleic acid probe are used.

[Claim 10] The target nucleic acid probe according to claim 8 and the internal standard nucleic acid probe are labeled with the fluorescent dye at a portion other than the OH group at the 3 ′ end, and the nucleic acid probe is When hybridized to the corresponding nucleic acid, the target nucleic acid probe and Z or the target nucleic acid probe, in which a plurality of base pairs of the probe-nucleic acid hybrid form at least one G (guanine) and C (cytosine) primer in the modified portion. 9. The novel nucleic acid measurement method according to claim 8, wherein an internal standard nucleic acid probe is used.

[Claim 11] The target nucleic acid probe and Z or the internal standard nucleic acid according to any one of claims 2 to 10, wherein the target nucleic acid and the internal standard nucleic acid having a known concentration or a copy number are subjected to the nucleic acid amplification method. Amplification is performed with or without using a probe, and the amplification product is further hybridized with the target nucleic acid probe and / or the internal standard nucleic acid probe according to any one of claims 2 to 10. It is characterized in that the change or the amount of change in the fluorescence character of the reaction system before and after hybridization is measured, and the concentration or copy number of the target nucleic acid before amplification is measured from the measured value and the concentration of the internal standard. 18

11

New method for measuring nucleic acids.

[Claim 12] By using the target nucleic acid probe and / or the internal standard nucleic acid probe according to any one of claims 2 to 10 by a nucleic acid amplification method, a target nucleic acid and an internal standard nucleic acid probe having a known concentration or copy number. Fluorescence character or fluorescence of a reaction system in which the probe is decomposed and removed by a polymerase during a nucleic acid extension reaction during a nucleic acid amplification reaction of a standard nucleic acid, or a reaction system during a nucleic acid denaturing reaction or a nucleic acid denaturing reaction is completed The fluorescent character of the dye and the fluorescent character of the reaction system when the target nucleic acid or the amplified target nucleic acid and the target nucleic acid probe and the internal standard nucleic acid or the amplified internal target nucleic acid and the internal standard nucleic acid probe are hybridized. The fluorescent character of the fluorescent dye is measured, and the reduction rate of the measurement value of the character from the former is calculated. New method for measuring a nucleic acid, characterized in that the concentration or copy number of the standard nucleic acid, measuring the number of concentration or copy prior to amplification of the target nucleic acid.

[Claim 13] A target nucleic acid and a known concentration are determined by using the target nucleic acid probe according to any one of claims 2 to 10 and Z or an internal standard nucleic acid probe as a primer by a nucleic acid amplification method. Alternatively, a nucleic acid amplification reaction of a copy number of the internal standard nucleic acid is performed, and the target nucleic acid or the amplified target nucleic acid and the target nucleic acid probe and the internal standard nucleic acid or the amplified internal target nucleic acid and the internal standard nucleic acid probe are not hybridized. Reaction system fluorescent character or fluorescent dye fluorescent character, and reaction system when target nucleic acid or amplified target nucleic acid and target nucleic acid probe and internal standard nucleic acid or amplified internal target nucleic acid and internal standard nucleic acid probe are hybridized Measurement of the fluorescent character or fluorescent dye of the fluorescent dye, and measurement of the character from the former By calculating the rate of decrease, the decrease ratio A novel method for measuring nucleic acid, comprising measuring the concentration or copy number of a target nucleic acid before amplification from the concentration or copy number of an internal standard nucleic acid.

[Claim 14] The method for amplifying a nucleic acid according to any one of the PCR method, the ICAN method, the LAMP method, the NASBA method, the RCA method, the TAMA method, and the LCR method. 14. The novel method for measuring a nucleic acid according to any one of 13 to 13.

[Claim 15] The method for measuring an amplified nucleic acid by the PCR method according to claim 14, wherein the PCR method is a quantitative PCR method or a real-time quantitative PCR method.

[16] In a method for analyzing data obtained by the nucleic acid measurement method according to any one of [1] to [15], a target nucleic acid and a labeled nucleic acid probe, and Z or an internal standard nucleic acid and an internal standard A nucleic acid measurement method comprising: correcting a measured value of a fluorescent character of a reaction system when a nucleic acid probe is hybridized with a measured value of a fluorescent character of a reaction system when a hybridized product is dissociated; Data analysis method for.

[Claim 17] In the method for analyzing data obtained by the real-time quantitative PCR method according to claim 15, wherein the amplified target nucleic acid and the target nucleic acid probe in each cycle, and Z or the amplified internal standard nucleic acid are used. Computes the measured value of the fluorescent character of the reaction system when hybridized with the internal standard nucleic acid probe by the measured value of the fluorescent character of the reaction system when the hybridized product is dissociated in each cycle A data analysis method for a real-time quantitative PCR method, characterized by having a process (hereinafter, referred to as a “correction calculation process”).

[Claim 18] A method for measuring the nucleic acid according to any one of claims 1 to 10 or / and amplifying the nucleic acid according to any one of claims 11 to 15 Hire 118

13

Analysis of polymorphisms and / or mutations characterized by analyzing, analyzing, or quantifying polymorphisms and Zs or mutations using the method for analyzing or Z and the data analysis method according to claims 16 and 17. , Analysis, or quantification methods.

[Claim 19] A method for measuring the nucleic acid according to any one of claims 1 to 10 and / or a method for amplifying the nucleic acid according to any one of claims 11 to 15 or Any of the FISH method, LCR method, SD method, and TAS method, wherein nucleic acid is measured and Z or obtained data is analyzed using Z and the data analysis method according to claims 16 and 17. Or one way.

[Claim 20] The internal standard nucleic acid according to claim 2, the target nucleic acid probe according to at least any one of claims 1 and 3 to 10, or a primer probe of the target nucleic acid and Z or an internal standard. A nucleic acid probe or a primer probe for an internal standard nucleic acid, and a target nucleic acid and / or a primer probe for a target nucleic acid in the target nucleic acid probe and / or an internal standard nucleic acid probe or an internal standard in a primer probe for an internal standard nucleic acid. Claims 1 to 15 and claim 1, wherein the nucleic acid is hybridized, and the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe and / or the internal standard nucleic acid probe is measured. A reaction liquid or a measurement kit characterized in that the method according to any one of 8 or 19 can be performed. [Claim 21] A plurality of the target nucleic acid probes and Z or internal standard nucleic acid probes according to at least any one of Claims 1 and 3 to 10 are bound to the surface of a solid support, and the target nucleic acid probe is provided. Then, the target nucleic acid and / or the internal standard nucleic acid probe is hybridized with the internal standard nucleic acid, and the change or the amount of the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe and / or the internal standard nucleic acid probe is measured. By doing, Claims 1-10, 10. A device characterized in that the method according to claim 18 can be performed.

[Claim 22] Any of claims 1 to 10, claim 18, or 19, comprising the internal standard nucleic acid according to claim 2, using the device according to claim 21. A reaction solution or reagent kit characterized in that the method according to item 1 can be carried out.

[Claim 23] In the device for nucleic acid measurement according to the above, the target nucleic acid probe and Z or an internal standard probe are arrayed and bound to the surface of the solid support in an array form to measure one or more target nucleic acids, respectively. 22. The devices according to claim 21, wherein a device (DNA chip) is used.

[Claim 24] A device (DNA) in which at least one temperature sensor and a heater are provided on the target nucleic acid group bound to the surface of the solid support, and the temperature of the nucleic acid probe binding region can be adjusted to the optimal temperature condition (DNA The device according to claim 21, wherein the device is a chip.

[Claim 25] A measuring device for performing the method according to any one of claims 1 to 19.

[Claim 26] The measuring device according to claim 25, which is a device capable of measuring fluorescence while changing the temperature.

[Claim 27] A computer-readable recording medium characterized by recording, as a program, a procedure for causing a computer to execute the steps of the data analysis method according to claim 16 to 19.

[Claim 28] The measuring device according to claim 25 or 26, wherein the computer-readable recording medium according to claim 27 is incorporated.

[Claim 29] At least such that the target nucleic acid base sequence region is not cleaved. A target nucleic acid separation / collection / concentration method, which comprises cleaving all nucleic acids including a target nucleic acid with a kind of restriction enzyme, and then separating and collecting only a nucleic acid fraction containing a target nucleic acid base sequence.

[Claim 30] It is intended to obtain a double-stranded DNA having an arbitrary sequence by performing gene amplification using an artificially synthesized single-stranded oligonucleotide nucleic acid having an arbitrary sequence of 50 bp or more as a 錶 type. How to obtain the characteristic synthetic artificial gene.

That is, the present invention

1) An internal standard nucleic acid corresponding to the target nucleic acid, a nucleic acid probe specifically hybridizing to the target nucleic acid (hereinafter, simply referred to as a target nucleic acid probe), and an internal standard nucleic acid in a measurement system containing at least one target nucleic acid. A method for measuring a target nucleic acid by adding or allowing a nucleic acid probe (hereinafter simply referred to as an internal standard nucleic acid probe) that specifically hybridizes to a nucleic acid;

2) An internal standard nucleic acid (described later) that can be suitably used in the above-described novel nucleic acid measurement method;

3) An internal standard nucleic acid probe (described later) that can be suitably used in the above-described novel nucleic acid measurement method, and

4) a target nucleic acid probe and / or an internal standard nucleic acid probe (described later) that can be suitably used in the above-described novel nucleic acid measurement method; and 5) a preferably-used novel nucleic acid measurement method of the present invention. A novel nucleic acid amplification method using a target nucleic acid probe and Z or an internal standard nucleic acid probe (described later) that can be used as a mere nucleic acid probe or a nucleic acid amplification primer in a nucleic acid amplification method, and a nucleic acid of a target nucleic acid by the method A novel method for measuring the concentration or copy number of a target nucleic acid before amplification (preferred specific methods will be described later), and 6) A method of analyzing data obtained by the method of the present invention (preferred specific methods are described later), and

7) Reaction solutions or measurement kits that can be used in the method of the present invention and that can carry out the method of the present invention, comprising an internal standard nucleic acid, a target nucleic acid probe and / or an internal standard nucleic acid probe, and ,

8) A plurality of target nucleic acid probes and / or internal standard nucleic acid probes that can be used in the method of the present invention are bound to the surface of the solid support, and the target nucleic acid probe and / or the internal standard nucleic acid probe are attached to the target nucleic acid probe and / or the internal standard nucleic acid probe. And measuring the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe and Z or the internal standard nucleic acid probe so that the method of the present invention can be carried out. , And a reaction solution or a measurement kit containing the internal standard nucleic acid and capable of performing the method of the present invention using the devices; and 9) a measuring apparatus for performing the method of the present invention; and ,

10) a computer-readable recording medium which records a procedure for causing a computer to execute the process of the data analysis method as a program; and

11) Cleavage of all nucleic acids containing the target nucleic acid by at least one restriction enzyme that does not cleave the target nucleic acid base sequence region, and then separating and collecting only the nucleic acid fraction containing the target nucleic acid base sequence Target nucleic acid separation

12) Gene amplification using an artificially synthesized single-stranded oligonucleotide nucleic acid having an arbitrary sequence of 50 bp or more as a 铸 type to obtain a double-stranded DNA having an arbitrary sequence. It provides a method for obtaining a characteristic artificially synthesized gene. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the position of each primer hybridizing to a gene (target nucleic acid) in the gene.

Fig. 2 shows a hybridization product of a target nucleic acid (gene (wild type)) or an internal standard nucleic acid (nec1 mutated type) and a target nucleic acid probe (NECB-24) (target nucleic acid probe). Dissociation curve of the complex).

a: Blank

b: Internal standard nucleic acid (necl mutated type) c: Target nucleic acid (necl gene (wild type))

Probe: Target nucleic acid probe NECB-24

FIG. 3 shows a hybridization product of a target nucleic acid (necl gene (wild type)) or an internal standard nucleic acid (necl mutated type) and an internal standard nucleic acid probe (NECM B-24). Dissociation curve of the nucleic acid probe complex).

a: Blank

Probe: Internal standard nucleic acid probe ^ 18-24

Fig. 4 shows real-time monitoring of PCR using a target nucleic acid probe as a type II mixture of target nucleic acid and internal standard nucleic acid.

→ ~ Blank: 铸 type nucleic acid 0

1 Target nucleic acid Mix ratio of internal standard nucleic acid is 14 4 Target nucleic acid Mix ratio of internal standard nucleic acid is 4 1

10 Target nucleic acid Mix ratio of internal standard nucleic acid is 10

2 1 Target nucleic acid Mix ratio of internal standard nucleic acid is 2 1

6 1 Target nucleic acid Mix ratio of internal standard nucleic acid 6 1

8 Target nucleic acid Mix ratio of internal standard nucleic acid 8 1

Replacement paper Fig. 5 shows real-time monitoring of PC'R using a mixture of target nucleic acid and internal standard nucleic acid with an internal standard nucleic acid probe.

B l ank 核酸 type nucleic acid 0

1 Target nucleic acid Mix ratio of internal standard nucleic acid is 1

2 1 Target nucleic acid Mix ratio of internal standard nucleic acid is 2 40 Target nucleic acid Mix ratio of internal standard nucleic acid is 40

0 1 Target nucleic acid Mix ratio of internal standard nucleic acid 0 1

6 1 Target nucleic acid Mix ratio of internal standard nucleic acid 6 1

8 1 Target nucleic acid The mixing ratio of the internal standard nucleic acid is 8 1 FIG. 6 is a diagram showing the relational expression between the DNA concentration and the change in the fluorescence intensity (rate) of the dye labeled on the target nucleic acid probe.

A: Target nucleic acid ''

B Internal standard nucleic acid

Figure 7 shows

A: Real-time monitoring rig of PCR at various DNA concentrations in a measurement system to which no soil sample was added. B: calibration curve based on A.

FIG. 8 shows real-time monitoring by a conventionally known quantitative PCR method.

Type III nucleic acid: 700,000 PCR products that set the a and b probes of the necl gene.

Fig. 9 shows the positional relationship between the probes during hybridization. Fig. 10 shows the dissociation curves of the Nec-donor and NECB-24 accep tor probe sets for the internal standard gene and the necl gene.

Fig. 11 shows the dissociation curves of the Nec-donor and NECMB-24 acceptor probe sets for the internal standard gene and the necl gene.

Fig. 12 shows the relationship between the ratio of the increase in the fluorescence intensity derived from the amplification product of the target nucleic acid and the ratio of the concentration of the target nucleic acid to the internal standard nucleic acid before amplification and the increase in the fluorescence intensity derived from the amplification product of the internal standard nucleic acid. .

Fig. 13 shows the dissociation curves of the NECMB-24 beacon internal control gene and necl gene.

Fig. 14 shows the dissociation curves of the NECMB-24 beacon internal control gene and necl gene.

'' Fig. 15 shows the relationship between the fluorescence intensity increase rate derived from the target nucleic acid amplification product and the fluorescence intensity increase rate derived from the internal standard nucleic acid amplification product with respect to the concentration ratio of the target nucleic acid and the internal standard nucleic acid before amplification. Formula (when using a sunrise primer).

Fig. 16 shows the dissociation curves of the NECB-23 LAMP internal control gene and necl gene.

Fig. 17 shows the dissociation curves of the NECB-23 LAMP internal control gene and necl gene. BEST MODE FOR CARRYING OUT THE INVENTION

Next, the present invention will be described in more detail with reference to preferred embodiments. The present invention relates to a nucleic acid probe labeled with at least one kind of fluorescent dye (to be simply referred to as a nucleic acid probe), which comprises a corresponding nucleic acid {a nucleic acid that can be simply hybridized (all bases do not necessarily have to be complementary). That is, all the bases do not have to correspond to hydrogen bonds. The method for measuring the corresponding nucleic acid using at least one kind of nucleic acid probe, which changes the fluorescent character of the labeled fluorescent dye by hybridizing to a nucleic acid (simply a nucleic acid measurement method using a nucleic acid probe), is at least used for hybridization. A target nucleic acid probe labeled with at least one kind of internal standard nucleic acid corresponding to the target nucleic acid and addressed to a known concentration in a measurement system containing one kind of target nucleic acid (described later in detail), and at least one kind of fluorescent dye And / or by adding an internal standard nucleic acid probe, performing a hybridization reaction and / or a nucleic acid amplification reaction, and performing a hybridization reaction between the target nucleic acid probe and the target nucleic acid, and a Z or internal standard nucleic acid probe and an internal standard. Fluorescent dye labeled on each nucleic acid probe generated by the hybridization reaction with nucleic acid The change or amount of change in the fluorescence character of the measurement system before and after hybridization is measured at least at one wavelength, and the concentration of the target nucleic acid and / or nucleic acid amplification reaction is determined based on the measured value and the concentration of the internal standard nucleic acid. This is a new concept measurement method that specifically measures the concentration or copy number of the previous target nucleic acid.

This method is based on the principle of the present invention and aims to solve various problems when at least one kind of target nucleic acid is measured using various nucleic acid probes, preferably in a homogeneous system.

Then, all nucleic acids including the target nucleic acid are cleaved by at least one or more restriction enzymes so as not to cleave the target nucleobase sequence region, and only a nucleic acid fraction containing the target nucleobase sequence is separated / collected, and / or Target nucleic acids to be further concentrated This is a concentration method.

Furthermore, artificial synthesis of a single-stranded oligonucleic acid of 50 bp or more having an arbitrary sequence is performed, and gene amplification is performed using this as a type II to obtain double-stranded DNA having an arbitrary sequence. This is a method for preparing a gene.

Unless otherwise specified, the terms used in the present invention have the same meanings as those generally used in biology, molecular biology, genetics or genetic engineering, microbiology or microbiological engineering, etc. is there.

In the present invention, the fluorescent character refers to fluorescent characteristics such as fluorescence intensity, fluorescence lifetime, fluorescence polarization, and fluorescence anisotropy (hereinafter, abbreviated as “fluorescence intensity” for simplicity).

In addition, a complex of a probe and a nucleic acid by hybridization of a nucleic acid probe and a corresponding nucleic acid is referred to as a hybrid (or a hybrid) complex, or simply a nucleic acid / probe complex or a probe / nucleic acid complex. That. Further, the measurement of the nucleic acid or the measurement of the nucleic acid concentration means not only the measurement of the concentration of the target nucleic acid, but also the quantitative detection, or the mere detection.

"A method for measuring a target nucleic acid using at least one kind of a target nucleic acid probe, which is a target nucleic acid probe and changes the fluorescence intensity of a labeled fluorescent dye by hybridizing to a corresponding nucleic acid" The term simply refers to a method for measuring a nucleic acid using a nucleic acid probe. It may be known or unknown. For example, the presently known method described below and the method of the present invention can be mentioned. The “corresponding nucleic acid” is as described above.

In the present invention, the target nucleic acid refers to a nucleic acid or a gene for measuring a nucleic acid. With or without purification. Also, the size of the concentration does not matter. Various nucleic acids may be mixed. For example, complex microbial systems (multiple micro A mixed system of biological RNA or gene DNA, for example, nucleic acids and genes in soil can be mentioned. ) Or a symbiotic microbial system (mixed system of RNA or gene DNA of multiple animals and plants and / or multiple microorganisms). Specific examples of the above nucleic acid include DNA, RNA, PNA, oligodeoxyribonucleotides, oligoribonucleotides, and chemically modified nucleic acids of the nucleic acids. be able to. Chemically modified nucleic acids include 2′-O.-methyl (Me) RNA and the like.

In the present invention, an internal target nucleic acid is a nucleic acid corresponding to a target nucleic acid, preferably having at least one of the following characteristics:

1) The internal standard nucleic acid has a base sequence that can be distinguished from the target nucleic acid based on the change or the amount of change in the fluorescence intensity of the fluorescent dye labeled on the probe caused by the nucleic acid being hybridized with the internal standard nucleic acid probe. You. This embodiment is shown in FIGS. 2 and 3 of the first embodiment. That is, based on the change in the fluorescence intensity or the amount of change in the fluorescent intensity of the internal standard nucleic acid and the internal standard nucleic acid probe, and the fluorescent dye labeled on the probe nucleic acid complex of the target nucleic acid and the target nucleic acid probe or each probe of the reaction system, The difference in base sequence between the target nucleic acid and the internal target nucleic acid can be identified.

2) The internal standard nucleic acid hybridizes only with the internal standard nucleic acid probe that specifically hybridizes with the internal standard nucleic acid under certain conditions (the method for obtaining suitable conditions is described later), and does not hybridize with the target nucleic acid probe. It has a base sequence.

3) The nucleotide sequence of the internal standard nucleic acid is partially different from that of the target nucleic acid. The partial sequence is 1 to 30, preferably 1 to 10, and particularly preferably 1 to 6, the number of bases. And a continuous or discontinuous base arrangement Column.

4) The base length of the internal standard nucleic acid may be different from that of the target nucleic acid.

6) An internal standard nucleic acid is, for example, a nucleotide sequence in which a part of the base sequence of a target nucleic acid is substituted or deleted with another base, and is a mutant nucleic acid or a kind of polymorphic nucleic acid. It is said that. Nucleotide sequences that produce the following effects are preferred: the effect of hybridization of the target nucleic acid and the target nucleic acid probe is the same as or less than the effect of hybridization of the internal standard nucleic acid and the internal standard nucleic acid probe. They are similar (they need not be exactly the same).

Similarly, the site of inhibition or the inhibitory effect of the substance that inhibits nucleic acid amplification of the target nucleic acid is similar or similar to that of the substance that inhibits nucleic acid amplification of the internal standard nucleic acid (need to be exactly the same). It is preferable to have a site of inhibition or a base sequence that produces the inhibitory effect. The above-mentioned internal standard nucleic acid can be prepared or synthesized by the methods described in Examples 1 and 7 and the nucleic acid probe described later.

In the present invention, the “measurement system in which at least one or more target nucleic acids are present” means that one or more target nucleic acids are present in the measurement system.

When a single type of target nucleic acid is present in the measurement system, the type of the target nucleic acid probe and Z or the internal standard nucleic acid probe to be present in the measurement system may be one or more. The expression “there may be more than one” means that a kind of target nucleic acid has a plurality of sites having different base sequences, and a plurality of kinds of target nucleic acid probes that hybridize to the site may be used. Internal standard nucleic acid The same can be said for.

In the present invention, when a plurality of types of target nucleic acids are present in the measurement system and Z or the reaction system, a plurality of types of target nucleic acid probes and / or internal standard nucleic acids and / or internal standard nucleic acid probes are present. ing. The target nucleic acid and the target nucleic acid probe are at least the same in the number of types. The same can be said for the internal standard nucleic acid and the internal standard nucleic acid probe. The “at least the same number” means that a base sequence site where multiple types of nucleic acid probes hybridize is set in one type of target nucleic acid, and multiple types of nucleic acid probes are set in the measurement system for one type of target nucleic acid. This means that it may exist.

Further, when the single and multiple target nucleic acids are present in the measurement system, the “plurality of target nucleic acids and / or internal standard nucleic acid and Z or internal standard nucleic acid probe” “Probe, plural kinds of internal standard nucleic acid probes” have the following meanings. That is, (a) a plurality of different types of probes in the nucleic acid probe of the present invention. For example, probes having the same form or structure but different dyes for labeling each other can be exemplified. (B) A combination of nucleic acid probes having different probe forms or structures, but different types of labeling dyes. That is, it means that a combination of nucleic acid probes having different forms described later may be used.

"Measurement of the change or the amount of change in the fluorescence intensity of the nucleic acid probe before and after the hybridization" is, for example, a difference between the measured value of the fluorescence intensity of the nucleic acid probe before and after the hybridization, and It refers to the rate of change in fluorescence intensity as a function of the time of the hybridization reaction system. In the nucleic acid amplification reaction, the change in the fluorescence intensity with respect to the reaction cycle Or rate of change.

The invention of the present application comprises the first to eighth inventions.

The first invention relates to a method for measuring a nucleic acid without performing a nucleic acid amplification reaction.

That is, the first invention is as described above, but in a method for measuring a nucleic acid using a nucleic acid probe (whether known or unknown), a measurement system or a reaction system containing at least one or more target nucleic acids. (Hereinafter simply referred to as a measurement system), a known amount of an internal standard nucleic acid corresponding to a target nucleic acid and at least one fluorescent dye specific to the target nucleic acid. Contains at least one internal nucleic acid probe consisting of at least one oligonucleotide labeled with a target nucleic acid probe or at least one fluorescent dye specific to an internal nucleic acid or an internal standard nucleic acid Alternatively, in a measurement system containing at least two types of the target nucleic acid probe and the internal standard nucleic acid probe in total, the hybridization reaction The change in the fluorescence intensity of the fluorescent dye modified on the target nucleic acid probe caused by the hybridization of the target nucleic acid probe and the target nucleic acid, and the hybridization between the internal standard nucleic acid probe and the internal standard nucleic acid. The change or the amount of change in the fluorescence intensity of the fluorescent dye modified to the internal standard nucleic acid probe caused by the zeosion is reduced to the number of nucleic acid probe types (sum of the number of target nucleic acid probe types and the number of internal standard nucleic acid probe types). Both are measured at the same number of wavelengths. This is a novel nucleic acid measurement method for measuring a target nucleic acid from the measured value and the amount of the internal standard nucleic acid.

In the present invention, the target nucleic acid probe and / or the internal standard nucleic acid probe suitably used in the method take the following forms. 1) Target nucleic acid probe and internal or standard nucleic acid probe A single-stranded oligonucleotide that hybridizes to a nucleic acid, and identifies one kind of donor dye (including a reporter dye) and z or one type of acceptor dye (including a Taentia dye or a quencher substance). At least one kind of nucleic acid probe, and when the nucleic acid probe is hybridized to the corresponding nucleic acid, the change or the amount of change in the fluorescent character of the hybridization reaction system is increased. A donor dye and an acceptor dye are labeled on the oligonucleotide. 2) The target nucleic acid probe and Z or the internal standard nucleic acid probe according to 1) have any of the following forms:

(1) By hybridizing with the corresponding nucleic acid in the form of a type of oligonucleotide labeled with a donor dye and an acceptor dye, the change or amount of change in the fluorescent character of the donor dye before and after hybridization is positive thing,

(2) By hybridizing with the corresponding nucleic acid in the form of a type of oligonucleotide labeled with a donor dye and an acceptor dye, it is possible to change the fluorescence characteristics of the de-monochrome and the acceptor dye before and after hybridization. The amount of change is negative,

(3) One kind of donor probe consisting of one kind of oligonucleotide labeled with one kind of donor dye, and one kind of receptor probe consisting of one kind of oligonucleotide labeled with one kind of receptor dye The two types of probes form a pair, and the change or amount of change in the fluorescent character of the donor dye and the acceptor dye before and after hybridization due to the hybridization of the donor probe and / or the acceptor probe with the corresponding nucleic acid. Is minus or plus. 3) The target nucleic acid probe and / or the internal standard nucleic acid of 1) is By hybridizing with the corresponding nucleic acid in the form of a type of oligonucleotide labeled with an element and an acceptor dye, the change or the amount of change in the fluorescent character of the donor dye and the acceptor dye before and after hybridization is reduced. When the nucleic acid probe has been labeled with a donor dye or an acceptor dye at its terminal and the nucleic acid probe has hybridized to the corresponding nucleic acid at the terminal, the corresponding probe hybridized to the probe. The base sequence of the probe is designed so that at least one base is G (guanine) in the base sequence of the corresponding nucleic acid at a distance of one to three bases from the terminal base of the nucleic acid.

4) Hybridization by hybridizing the target nucleic acid probe and Z or the internal standard nucleic acid of the above 1) in the form of a kind of oligonucleotide labeled with a donor dye and an acceptor dye with a corresponding nucleic acid. The change or the amount of change in the fluorescent character of the donor dye and the acceptor dye before and after the reaction is negative, and when the corresponding nucleic acid is hybridized, the probe is not detected in the labeled portion of the donor dye or the acceptor dye. The nucleotide sequence of the probe is designed so that a plurality of base pairs of the nucleic acid hybrid form at least one pair of G (guayun) and C (cytosine).

5) The target nucleic acid probe and the Z or internal standard nucleic acid probe are each composed of a single-stranded oligonucleotide labeled with at least one kind of fluorescent dye, and have at least one of the following characteristics. The probe is designed for:

(1) In the reaction system or the measurement system, a function can be exhibited with a kind of nucleic acid probe,

(2) hybridization to target nucleic acid and / or internal standard nucleic acid Sometimes, the fluorescent dye negatively increases the change or amount of change of the fluorescent character in the absence of the quencher dye and / or the quencher probe,

(3) The probe is labeled at least with a fluorescent dye at its end,

(4) When the nucleic acid probe is hybridized to the target nucleic acid, the nucleic acid probe

One to three bases apart (however, the number of labeled bases is counted as 1), and at least one G (guanine) is present in the base sequence of the target nucleic acid.

(5) When the nucleic acid probe hybridizes to the target nucleic acid at the end, at least one base pair of the probe nucleic acid hybrid at the end has at least one G (guanine) binding (cytosine) pair. To form

6) The target nucleic acid probe and Z or the internal standard nucleic acid probe of the above 5), wherein the 3′-carbon hydroxyl group of 3′-terminal ribose or deoxyribose or the 3′- or 2′-carbon hydroxyl group of 3′-terminal ribose is phosphorous. Oxidized.

7) The target nucleic acid probe and the internal or standard nucleic acid probe of the above 5) are labeled with the fluorescent dye at a portion other than the OH group at the 3 ′ end, and the nucleic acid probe is hybridized to the corresponding nucleic acid. A target nucleic acid probe and a non-standard or internal standard nucleic acid probe in which, when subjected to quenching, a plurality of probe-nucleic acid hybrids form at least one G (guanine) -binding (cytosine) pair in the modified portion. Is used.

The fluorescent color of the fluorescent dye labeling the target nucleic acid probe and the fluorescent color of the fluorescent dye labeling the internal standard nucleic acid probe are mutually different. Therefore, it is preferable to design a target nucleic acid probe and an internal standard nucleic acid probe. Specifically, it is preferable that the type of the fluorescent dye labeling the target nucleic acid probe and the fluorescent dye labeling the internal standard nucleic acid probe be different.

Specific examples of the nucleic acid measurement method using the above-described nucleic acid probe are described below.

I. Examples of known methods

The currently known methods refer to all currently known methods, for example, as follows. It should be noted that the present invention is not limited by these examples.

A) When using the FRET phenomenon:

(1) A method represented by the method of Morri son et al. (Morr son et al., Anal. Biochem., 183: 31-24, 1989).

The method uses double-stranded DNA as the corresponding nucleic acid and uses two types of nucleic acid probes. One of the two types hybridizes to a leading chain, and the other hybridizes to a coding chain. In addition, one of the probes is labeled with one fluorescent dye at the 5 'end, and the other is labeled with one fluorescent dye at the other end. One of the dyes of the probe is a donor dye having a quenching effect (also called a reporter dye), and the other dye is also called an acceptor (quencher) dye. ) It is a pigment. The nucleotide sequences of the two probes are designed so that they can hybridize with each other. When the two types of probes form a hybrid complex, the FRET phenomenon acts to suppress the fluorescence intensity of the measurement system to a low level.

In the measurement system, two types of probes forming a hybrid complex The corresponding nucleic acid forming the strand is present. Then, the probe and the corresponding nucleic acid dissociate their own hybrid complex, and the probe and the corresponding nucleic acid competitively form a hybrid complex. When the probe and the corresponding nucleic acid form a hybrid complex, the FRET phenomenon between the dyes is eliminated, and the change rate of the fluorescence intensity or time of the measurement system as a function of time increases. Since the increase in the fluorescence intensity change value and the change rate of the measurement system is proportional to the concentration of the corresponding nucleic acid, the concentration of the corresponding nucleic acid can be measured.

In this case, first add two types of probes to the measurement system, measure the fluorescence intensity, and then add a sample containing the corresponding nucleic acid to measure the fluorescence change value or change rate before and after In some cases, two types of probes are added to a measurement system containing the corresponding nucleic acid, and the rate of change in fluorescence intensity as a function of time is measured. In this way, the concentration of the corresponding nucleic acid can be measured. This is because the magnitude or rate of change of the fluorescence intensity is proportional to the concentration of the corresponding nucleic acid.

(2) A method represented by the method of Mergney et al. (Mergney et al., Nucl e acid Res., 22: 920-928, 1994)

It is characterized in that two kinds of nucleic acid probes are hybridized to a single-stranded corresponding nucleic acid. If one of the two probes is labeled with one donor dye, the other is labeled with one receptor dye. In addition, one of the probes is labeled at the 5 'terminal site with a fluorescent dye, and the other is labeled at the 3' terminal site. The donor dye can act on the receptor dye to increase the fluorescence emission of the receptor dye at a specific wavelength. Donor dyes, also called reporter dyes, weaken their own fluorescence when applied to an acceptor dye. Acceptor dyes are also referred to as dyes. When the two types of probes hybridize to the corresponding nucleic acid, the dye-labeled terminal site of one probe and the dye The terminals are designed so that they face each other. The nucleotide sequences are designed so that the distance between the dye-labeled bases of both probes is 1 to 9 bases apart and both probes hybridize to the corresponding nucleic acid.

The actual measurement procedure is the same as the Morrison method.

(3) Molecular beacon method (Tyagi et al., Nature Biotech., 14: 303-308, 1996; Schofield et al., Applied and Environ. Microbiol., 63: 1143-1147, 1997) Yerpin probe (Sunrise probe) (Nazarenko, IA, Bhatnagar, SK and Hohraan, RJ (1997) A closed tube format for araplir ication and detect ion of DNA based on energy transfer.Nucleic Acids Res., 25, 2ol6-2521 ); Scorpion probe (Theaker, J., Guy, SP, Brown, T. and Little, S. (1999) Detection of PCR products using self-probing amp 丄 icons and flu orescence. Nature Biotechnol., 17, 804 -807.)

The above probe is generally labeled with a fluorescent dye at one end and a quencher substance which does not emit fluorescence in the other region. Then, when not hybridized to the corresponding nucleic acid, a stem-loop structure is formed from the homology of the base sequence in the probe molecule. Due to the formation of the structure, the fluorescent dye and the quencher substance are arranged at positions close to each other. The FRET phenomenon occurs due to this arrangement, and the fluorescence emission of the donor dye is suppressed. However, when the probe hybridizes to the corresponding nucleic acid, the conformation of the probe changes, and the stem 'loop structure becomes loose. This will eliminate the FRET phenomenon and increase the fluorescence emission of the fluorescent dye. The concentration of the corresponding nucleic acid is proportional to the increase in the fluorescence intensity of the fluorescent dye in the measurement system. The actual measurement procedure is the same as the Morrison method.

(4) A method represented by the method of Livak et al. (US patent No. 5, 538, 848) A probe in which one quench dye and one reporter dye are labeled at different positions at the end of a single-stranded oligonucleotide. Further, no stem loop structure is formed between the base where the fluorescent substance is labeled and the base where the quencher substance is labeled. When the probe is not hybridized to the corresponding nucleic acid, the reporter dye is inhibited by the action of the kininichia dye to suppress fluorescence, but when hybridized to the corresponding nucleic acid, the suppression is released and the reporter dye is released. Are designed to increase fluorescence.

The actual measurement procedure is almost the same as the method of Morri son et al.

B) A method using a probe that utilizes the property that a fluorescent dye interacts with a specific nucleobase to reduce the amount of fluorescence emission

(1) typified by the method of ATA et al. (KURATA et al., Nucleic acids Research, 2001, vol. 29, No. 6 e34; EP 1 046 717 A9; JP 200 286300 (P200 286300A)) Method (T. Horn, et al., Nucleic acid Research, 1997, 25, 4842-4849, 1997; US Patent Application Publication No.US2001 / 0009 760A1, Pub.Date: Jul. 26, 2001; US Patent No. 6 , 140, 054)

A nucleic acid probe in which single-stranded oligonucleotides are labeled with a single fluorescent dye.When a site labeled with a fluorescent dye hybridizes with a corresponding nucleic acid, the corresponding nucleic acid corresponding to the base at the labeled site A nucleic acid probe designed so that at least one G exists at or near the base thereof, and that a GC pair exists in the probe nucleic acid complex at or near the labeling site. When the probe is hybridized to the corresponding nucleic acid, the intensity of the fluorescence emission of the hybrid complex is significantly reduced as compared to that before the hybridization. Since the amount of decrease in the fluorescence intensity of the measurement system is proportional to the concentration of the corresponding nucleic acid, the corresponding nucleic acid can be measured. The actual measurement procedure is almost the same as the method of Morrison et al. Except that the decrease value or the decrease rate of the fluorescence intensity is measured. In addition, in this measurement method, before the hybridization reaction, the measurement may be performed by adding a helper probe for allowing the hybridization reaction system to efficiently perform the hybridization reaction.

C) Other methods

1) The method represented by the method of Davis et al. (Davis et al., Nucleic acids Res., 24: 702-706, 1996)

The corresponding nucleic acid is measured using a probe in which a fluorescent dye is attached to the 3 ′ end of the oligonucleotide via a spacer having 18 carbon atoms. When the probe is hybridized to the corresponding nucleic acid, the fluorescence intensity becomes 10 times higher than when a probe having the dye directly bonded to the 3 ′ end is used.

2) The method represented by the method of HORN et al. (US Patent Application Publication No. US2001 / 0 009760A1, Pub.Date: Jul.26, 2001)

A probe consisting of a single-stranded oligonucleotide, but labeled at one end with a BODIPY dye. The base sequences at both ends are designed to hybridize with each other. In the measurement system, when the corresponding nucleic acid is not present, both ends are hybridized to form one loop. The emission of the fluorescent dye is suppressed. However, when the corresponding nucleic acid is present, the loop shape is broken because the probe hybridizes to the corresponding nucleic acid. Then, since the fluorescent dye emits light, the concentration of the corresponding nucleic acid can be determined by measuring the fluorescence intensity.

II. Examples of nucleic acid probes of the present invention and methods using the same These are summarized below.

1) Method A of the present invention

i) In a method of measuring a corresponding nucleic acid using a nucleic acid probe labeled with a fluorescent dye, in a measurement system in which at least one kind of the corresponding nucleic acid is present, the corresponding nucleic acid hybridizes to the corresponding nucleic acid and emits a different fluorescent color. At least the same number of nucleic acid probes as the number of the corresponding nucleic acids are present, and the hybridization reaction and the Z or nucleic acid amplification reaction are performed.At least as many wavelength species as the number of the nucleic acid probe species before and after hybridization. This is a novel method for measuring nucleic acid by measuring the change in the fluorescence intensity of the nucleic acid probe or the increase in the amount of change in brass, and measuring the concentration of the corresponding nucleic acid or the nucleic acid concentration or copy number before amplification.

ii) The nucleic acid probe is a nucleic acid probe comprising a single-stranded oligonucleotide that hybridizes to the corresponding nucleic acid and a fluorescent dye (donor dye) and a quencher dye labeled, and the nucleic acid probe hybridizes to the corresponding nucleic acid. When soybean is used, the fluorescent dye (donor dye) and quencher dye are labeled on the oligonucleotide, and the fluorescent dye (donor dye) is labeled so that the fluorescence intensity of the hybridization reaction system increases. Using a nucleic acid probe comprising an oligonucleotide that does not form a stem-loop structure between the base chain where the quencher dye is labeled and the base where the quencher dye is labeled. Measuring method. iii) The nucleic acid probe according to i) above further comprises at least one of the following:

It has the characteristics described in item 1.

(1) A fluorescent dye (donor dye) and a quencher dye are labeled at the same base of a single-stranded oligonucleotide.

(2) Fluorescent dye (donor dye) and quencher dye are labeled The base position of the single-stranded oligonucleotide is the 3 'end or the 5' end.

(3) The distance between the base where the fluorescent dye (donor dye) is labeled and the base where the quencher dye is labeled is 1 to 20 or {(3 to 8 + 1 0 n} (where n is an integer including 0).

(4) Fluorescent dye (donor dye) or quencher dye is labeled at the 5 ′ end or 3 ′ end of the oligonucleotide, and the corresponding quencher dye or fluorescent dye is labeled in the chain.

(5) A fluorescent dye (donor dye) or quencher dye is labeled at the 5 'end of the oligonucleotide, and a corresponding quencher dye or fluorescent dye is labeled at the 6th to 8th base from the 5' end. ing.

(6) The single-stranded oligonucleotide has the same length as the corresponding nucleic acid.

(7) The phosphoric acid groups at the 5 'end and 3' end of the nucleic acid probe are labeled with a fluorescent dye (donor dye).

(8) Fluorescent dye (donor dye) that labels nucleic acid probes: TexaSet K Texas red), EDANS (5- (2,1-aminoethy 丄 atninonaphthalene-1—sulfonic acid), Tetramethizolerota, Mine (tetramethylrhodomine) or a derivative thereof, FITC or a derivative thereof, bodypi (BODIPY) F, bodypi (BODIPY) R6G, bodypi (BODIPY) TMR, bodypi (BODIPY) TR, or at least one of 6-TAMU RA is there.

(9) The quencher dye that labels the nucleic acid probe is Dabcyl (4-(4

'-dime thy 1 ami nophenylazo) benzoic acid), Ferrocene or its own, methyl viologen, N, N'-dimethyl-2, 9-diazopyreniutn. In the nucleic acid probe used in the above-described nucleic acid measurement method, the fluorescent dye (donor dye) and the quencher dye labeled on one kind of nucleic acid probe are each one kind, and the labeled portions of the oligonucleotides are respectively At least one location.

2) Method B of the present invention

i) In a measurement system in which at least one or more corresponding nucleic acids are present, the nucleic acid measurement method hybridizes to the corresponding nucleic acid and causes at least the same number of nucleic acid probes having different fluorescent colors to be present as the number of the corresponding nucleic acid species. After hybridizing the nucleic acid probe and the corresponding nucleic acid, the change in the fluorescence intensity of the nucleic acid probe before and after the hybridization or the change in the negative change at least at the same number of wavelengths as the number of the nucleic acid probe species is observed. A novel method for measuring nucleic acids, characterized by measuring an increase.

ii) The nucleic acid probe forms at least one pair of a fluorescent dye pair that causes the FRET phenomenon, that is, a pair of a fluorescent dye (donor dye) that can be a donor dye and a fluorescent dye (acceptor dye) that can be an acceptor dye. In the case of a nucleic acid probe consisting of a single-stranded oligonucleotide labeled with a plurality of types of fluorescent dyes as described above, when the probe hybridizes to the corresponding nucleic acid, hybridization of the axceptor dye is performed in the absence of the quencher probe. The novel nucleic acid measurement method according to i), wherein the nucleotide sequence is designed so that the change or the amount of change in the fluorescence intensity before and after the hybridization is negatively increased and the dye is labeled.

iii) a nucleic acid probe wherein the change or the amount of change in the fluorescence intensity of the donor dye and the acceptor dye increases in the absence of the quenching nucleic acid probe when the nucleic acid probe hybridizes to the corresponding nucleic acid; I) or ii) using the nucleic acid probe described in A novel method for measuring a nucleic acid according to the above.

i V) The novel nucleic acid measurement method according to i) above, wherein the nucleic acid probe according to i i) or i i i) uses a nucleic acid probe having at least any one of the following characteristics. .

(1) Fluorescent dye in which the dye labeling the nucleic acid probe can be a donor dye, and is at least one kind of BODIPY F BODIPY 493/503, 5-FAM, Tetramethylrhodamine, or 6-TAMRA.

(2) The nucleic acid probe is labeled with one dye pair of a donor dye and an acceptor dye.

(3) The nucleic acid probe is labeled at its end with a donor dye or an acceptor dye, and when the nucleic acid probe is hybridized to a corresponding nucleic acid, the base labeled with the donor dye or the acceptor dye in the probe is used. 1 to 3 bases away from the base (in this case, the terminal base is counted as one base. The same applies to the following invention), and at least one base G (guanine) is contained in the base sequence of the corresponding nucleic acid. The base sequence of the lobe is designed to be present.

(4) When the nucleic acid probe is hybridized to the corresponding nucleic acid, at least one G (guanine) and C (cytosine) pair of one or more base pairs of the probe-nucleic acid hybrid at the donor dye labeling site The base sequence of the probe is designed so as to form

(5) The donor dye labels the 5 'end (including the 5' end) of the nucleic acid probe.

(6) The donor dye labels the 3 'end (including the 3' end) of the nucleic acid probe.

(7) The 5 'terminal base of the nucleic acid probe is G or C and the 5' terminal is Labeled with one dye.

(8) The nucleotide at the 3 ′ end of the nucleic acid probe is G or C, and the 3 ′ end is labeled with a donor dye.

(9) The acceptor dye labels the 5 'end (including the 5' end) of the nucleic acid probe.

(10) An acceptor dye labels the 3 'end of the nucleic acid probe (including the 3' end).

(11) The 5 ′ terminal base of the nucleic acid probe is labeled with G or C, and the 5 ′ terminal is labeled with an acceptor dye.

(12) The 3 'terminal base of the nucleic acid probe is labeled with G or C, and the 3' terminal is labeled with an acceptor dye.

(13) When the nucleotide sequence of the nucleic acid probe is one to three bases away from the base labeled with the donor dye or the acceptor dye in the probe when the probe binds to the corresponding nucleic acid, the base sequence of the corresponding nucleic acid Is designed so that G (guan) is present in at least one base.

V) A nucleic acid probe comprising a single-stranded oligonucleotide labeled with a fluorescent dye, wherein when the nucleic acid probe hybridizes to a corresponding nucleic acid, the fluorescent dye is replaced with a quenching probe or a quenching probe. In the absence of the dye, the change in the fluorescence intensity or the amount of change is negatively increased, and the probe is labeled with the fluorescent dye at its end, and the nucleic acid probe is labeled with the corresponding nucleic acid at the end. When hybridized to the probe, the probe should be 1 to 3 bases away from the terminal base of the corresponding nucleic acid hybridized to the probe, and at least one G (guanine) should be present in the base sequence of the corresponding nucleic acid. The nucleus according to the above i), wherein the nucleic acid probe whose nucleotide sequence is designed is used. A new method for measuring acids.

V i) The novel nucleic acid measurement method according to i), wherein the nucleic acid probe according to V) uses a nucleic acid probe having at least one of the following characteristics.

(1) The nucleic acid probe is labeled at the 3 'end with a fluorescent dye. (2) The nucleic acid probe is labeled at the 5 'end with a fluorescent dye.

V ii) a nucleic acid probe consisting of a single-stranded oligonucleotide labeled with a fluorescent dye, wherein when the nucleic acid probe is hybridized to the corresponding nucleic acid, the fluorescent dye is in the absence of the quencher probe A nucleic acid probe whose change or amount of change in fluorescence intensity increases negatively, and the probe is labeled with the fluorescent dye at the end thereof, and the nucleic acid probe is hybridized to the corresponding nucleic acid. When the probe is subjected to hybridization, the nucleotide sequence of the probe is determined so that a plurality of base pairs of the probe-nucleic acid hybrid form at least one G (guanine) binding (cytosine) pair at the terminal portion. The novel method for measuring a nucleic acid according to the item i), wherein the designed nucleic acid probe is used.

Viii) The novel method for measuring nucleic acid according to i), wherein the nucleic acid probe according to vii) uses a nucleic acid probe having at least one of the following characteristics.

(1) The 3′-terminal base of the nucleic acid probe is G or C, and the 3′-terminal is labeled with a fluorescent dye.

(2) The nucleic acid probe is labeled with a G or C at the 5'-terminal base and labeled with a fluorescent dye at the 5'-terminal.

(3) A nucleic acid probe whose G-terminal is G or C and whose 5′-terminal is labeled with a fluorescent dye is a 3′-terminal ribose or The hydroxyl group of 3 'carbon of oxyribose or the 2' carbon of ribose at the 3 'end is phosphorylated.

(4) The phosphate group at the 5 'end and / or 3' end of the nucleic acid probe is labeled with a fluorescent dye.

ix) A nucleic acid probe consisting of a single-stranded oligonucleotide labeled with a fluorescent dye, and when hybridized to the corresponding nucleic acid, the fluorescent dye is used in the absence of the quencher-nucleic acid probe. The probe is a nucleic acid probe whose fluorescence intensity changes or the amount of change increases negatively, and the probe has a fluorescent dye at a portion other than the phosphate group at the 5 ′ end or the OH group at the 3 ′ end. When the nucleic acid probe is hybridized to the corresponding nucleic acid, at least a plurality of base pairs of the probe mononucleotide complex in the labeled portion is bound to at least one G (guanine). The novel method for measuring a nucleic acid according to i), wherein a nucleic acid probe whose nucleotide sequence is designed to form a pair is used.

In the present invention, in order to apply the above-mentioned various known methods, and the methods A and B of the present invention to the novel method for measuring a nucleic acid of the present invention, the nucleic acid probe must be at least one kind of fluorescent dye ( It is necessary to use a kind of target nucleic acid probe and / or an internal standard nucleic acid probe labeled with a fluorescent dye which can be used in the present invention, including a donor dye and an acceptor dye. The nucleic acid probe to be added to the measurement system, that is, the target nucleic acid probe and the internal standard nucleic acid probe are at least one each.

In the present invention, “measurement of a change in the fluorescence intensity of the nucleic acid probe before and after hybridization or an increase in a negative change” is, for example, a nucleic acid probe before and after hybridization. Minus the difference in the measured fluorescence intensity of It refers to a negative change rate of the fluorescence intensity as a function of the reaction time. or,

In PCR, it refers to the change or rate of change of the fluorescence intensity as a function of the reaction cycle. "The change in the fluorescence intensity or the amount of the negative change increases" means that the simplest case in this case is that the decrease in the fluorescence intensity of the measurement system increases.

For example, Wl gdMorri son ¾ (Morri son et al., Anal. Biochem., 18

3: 231-244 (1989)), without using a nucleic acid probe such as the quencher probe, the measured value of the change (eg, decrease) in the fluorescence intensity after hybridization of a measurement system derived from the luminescence of the nucleic acid probe. This means that the decrease rate of the fluorescence intensity as a function of the time during the hybridization reaction is measured. In PCR, it means that the rate of change (for example, the rate of decrease) of the fluorescence intensity as a function of the reaction cycle is measured. The terms quencher probe and quencher nucleic acid probe mean a nucleic acid probe that acts on the nucleic acid probe and suppresses the luminescence of the nucleic acid probe. Refers to a probe.

1) The nucleic acid probe used in the method A of the present invention is described in detail below.

The feature of this probe is that when it does not hybridize to the corresponding nucleic acid, the emission of the fluorescent dye is inhibited by quencher dye, but when it hybridizes, the inhibition is released and the fluorescence intensity is released. Is a probe that changes (eg, increases).

In the present invention, the fluorescent substance is a kind of fluorescent dye which is generally used for measuring and detecting nucleic acid by labeling a nucleic acid probe. For example, fluorescein or derivatives thereof (eg, fluorescein Sochioshiane ¹ Bok (f luoresce ini sothiocyanate) (FITC ) or its derivatives such as, Alexa 488, Alexa 532, cy3 , cy5, 6_joe, EDANS, rhodamine (rhodamine) 6G (R6G) or derivatives thereof (e.g., Te Toramechiruro Teramethy lrhodamine (TMR), artof;>■> tetramethy lrhodaraine i sothiocyanate (T RITC), x —rogue min x—rhodamine, Texas red BODIPY FL (BODIPY is a trade name, FL is a trade name; Molecular Probes, USA; the same applies hereafter), BODIPY FL / C3, BODIPY ( BODIPY) FL / C6, BODIPY 5-FAM, BODIPY TMR, or a derivative thereof (eg, BODIPY (BODIPY) TR), BODIPY (BODIPY) R6G, BODIPY (BODIPY) 564, BODIPY (BODIPY) ) 581, 6-TA MURA and the like can be mentioned. Among these, FITC, EDANS, Texas Red, 6-joe, TMR, Alexa 488, Alexa 532, BODIPY FL / C3, BODIPY R6G, BODIPY (BODIPY) FL, Alexa532, BODIPY (BODIPY) ) FL / C6, BODIPY (TMR), TMR, 5-FAM, BODIPY (BODIPY) 493/503, BODIPY (BODIPY) 564, BODIPY (BODIPY) 581, 6-TAMURA, Cy3, Cy5, Texas red, x-Rhodami ne And the like can be cited as preferable ones.

A quencher substance is a substance that acts on the fluorescent substance to suppress or extinguish its emission. For example, Dabcyl, QSY7 (Molecular 'probe), QSY33 (Monolecular' probe), Ferrocene or its derivative, methyl viologen, N, N'-dimethyl_2,9-diazopyrenium, preferably Dabcyl, etc. Can be.

By labeling a fluorescent substance and a quencher substance at a specific position on the oligonucleotide as described above, the luminescence of the fluorescent substance JP03 / 05118

43

A quenching effect is caused by one substance.

In the present invention, a single-stranded strand that forms the nucleic acid probe of the present invention and does not form a stem 'loop structure between the base strand where the fluorescent substance is labeled and the base strand where the quencher substance is labeled Oligonucleotides in the self-chain due to the complementarity of at least two or more base sequences between the base where the fluorescent substance is labeled and the base where the quencher is labeled In the above, the term refers to an oligonucleotide which forms a double chain and does not form a stem-loop structure.

When the nucleic acid probe of the present invention is hybridized to the corresponding nucleic acid, the fluorescent substance and the quencher substance are combined with the oligonucleotide of the present invention so that the fluorescence intensity of the hybridization reaction system changes (eg, increases). In order to label nucleotides, the following may be performed. The distance between the base where the fluorescent substance is labeled and the base where the quencher substance is labeled is zero in terms of the number of bases, i.e., the same nucleotide of the single-stranded oligonucleotide with the fluorescent substance and the quencher substance. Or the number of bases is 1 to 20 or the number of bases, or {(3 forces, any integer of 8) + 10n} (where n is an integer including 0) . Preferably, 10 is added to the position of the same nucleotide in the single-stranded oligonucleotide, or 3 to 8 or any number thereof. More preferably, it is at the same nucleotide position of a single-stranded oligonucleotide, or 3 to 8. Thus, it is preferable to label each substance on the oligonucleotide. However, the distance between bases strongly depends on the nucleotide sequence of the probe, the fluorescent substance and the labeling substance used for labeling, and the length of the linker that binds them to the oligonucleotide. Therefore, it is difficult to completely specify the base interval, and the above base interval is a general example to the last, and there are many exceptions. When labeling a single-stranded oligonucleotide at the same nucleotide, it is preferable to label one on the base and the other on the non-base, that is, the phosphate, ribose or deoxyribose moiety. It is suitable. In this case, it is preferable to label the 3 'end or the 5' end.

Alternatively, when the distance between the fluorescent substance and the base that labels the quencher substance is set as described above, each substance may be labeled in the oligonucleotide chain, and one of the substances may be labeled at the 5 ′ end of the oligonucleotide. Alternatively, it may be labeled at the 3 ′ end, and another corresponding substance may be labeled in the chain. Preferably, a fluorescent substance or a quencher is labeled at the 5 ′ end or 3 ′ end of the oligonucleotide, and a corresponding quencher or fluorescent substance is labeled from the terminal at the above-mentioned base number interval. Is good. In this case, when labeling at the 3′-end or the 5′-end, a base, a phosphate, or a ribose or deoxyribose moiety, preferably a phosphoric acid, ribose or deoxyribose moiety, more preferably Is preferably labeled on the phosphate moiety. In the case of labeling in a chain, it is preferable to label a base in the chain.

2) The nucleic acid probe used in the nucleic acid measurement methods i) to iii) of the method B of the present invention will be described in detail below.

The donor dye that can be a donor dye in the present invention is at least a. That is excited at a specific wavelength and emits light at a specific wavelength, and b. Transfers luminescence energy to a specific dye (a dye that can be an acceptor dye). Yes, c. A complex of GC base pairs generated when a nucleic acid probe hybridizes with the corresponding nucleic acid (GC base pair hydrogen bond) (hereinafter sometimes referred to as GC hydrogen bond for the sake of simplicity) Force donor dye , The energy can be transferred to the base pair. Defined to be satisfied. That is, any dye that satisfies this condition may be used. In general, dyes that can be donor dyes in the FRET phenomenon and that change (eg, decrease) the fluorescence intensity of a probe when a nucleic acid probe that is itself labeled alone hybridizes to a corresponding nucleic acid are preferably used ( Nucleic Acid, Vol. ²⁹ , No. 6 e ³⁴ , 2001).

The dyes used are specifically the same as the dyes used in the present invention A. Among them, BODIPY FL, BODIPY FL-based dyes described above, and BODIPY 493/503), -FAM, bodypy (BODIPY) 5-FAM, Tetramethylrhodamine 6-TAMRA, and the like are more preferable, and B0DIP YF BODIPY 493/503, 5-FAM, Tetramethylrhodamine, 6-TAMRA and the like can be mentioned. However, the present invention is not limited to these examples.

In general, an acceptor dye can undergo energy transfer from an acceptor dye, ie, a donor dye, in a FRET phenomenon in a pair with a donor dye. (In other words, the donor dye has a quenching effect on the donor dye.) It works) Any pigment can be used. And it depends on the kind of the donor dye forming the pair. For example, if BODIPY FL, the above-mentioned dye of BODIPY FL system, BODIPY 493/503, 5-FAM, bodepy (BODIPY) 5-FAM, Tetramethylrhodamine, 6-TAMRA, etc. are used as donor dyes, Rhodamine X, BODIPY 581/591, etc. can be used as the acceptor dye. However, the present invention is not limited to these examples.

A preferred nucleic acid probe structure is labeled with a donor dye at its end, and when the nucleic acid probe hybridizes to the corresponding nucleic acid at the end, the end of the corresponding nucleic acid hybridized to the probe is obtained. T JP03 / 05118

46

The base sequence of the probe is designed so that at least one to three bases apart from the terminal base are present in the base sequence of the amino acid with C (cytosine) or G (guanine).

More preferably, when the nucleic acid probe is hybridized to the corresponding nucleic acid, at least one base pair of the probe-nucleic acid hybrid in the donor dye-labeled portion has at least one G (guanine) bond (cytosine). The base sequence of the probe is designed to form a pair>.

Particularly preferably, the donor dye labeling site is a G (guanine) or C (cytosine) base, or a phosphate group of a nucleotide having the base, or an OH group of ribose.

The labeling site of the donor dye or the acceptor dye is determined when the donor dye or the acceptor dye labels the base, phosphate, deoxyribose, or ribose at the 5 ′ end of the nucleic acid probe. The dye or donor dye is in the nucleic acid probe strand or at the 3 'end (including the 3, terminal base). When the donor dye labels a base, a phosphate, a deoxyribose, or a ribose at the 3 ′ end of the nucleic acid probe, the donor dye or the acceptor dye may be in the nucleic acid probe strand or It is the 5 'terminal (including the 5' terminal base). When labeling the terminal end, both ends may be labeled. That is, for example, one of the two may be labeled with a phosphate moiety, and the other may be labeled with a deoxyribose moiety, a reporter moiety, or a base moiety (for example, when the distance between the labeled moiety of the donor dye and the acceptor dye is 0). Case (described below.)) Alternatively, both may be bonded to one spacer using a spacer having a side chain. In the present invention, both the donor dye and the acceptor dye have chains. It goes without saying that even if the inside is marked, the above conditions only need to be satisfied. It is preferable that the binding position of the fluorescent dye at each of the above-mentioned sites is bonded to an OH group or an amino group via a spacer. The distance between the labeled dye bases of the donor dye and the acceptor dye depends essentially on the kind of the dye pair of the donor dye and the acceptor dye, but generally ranges from 0 to 50 bases, preferably from 0 to 4 bases. It has 0 bases, more preferably 0 to 35 bases, and particularly preferably 0 to 15 bases. Beyond 50 bases, the FRET phenomenon becomes unstable. At 15 to 50 bases, the fluorescent intensity of the acceptor dye changes (eg, decreases), but the fluorescent intensity of the donor dye may also change (eg, increases). That is, when a nucleic acid probe hybridizes to a corresponding nucleic acid, the three-dimensional structure of the nucleic acid probe may change. The change may eliminate the FRET phenomenon between the dyes of the nucleic acid probe. Depending on the magnitude of the quenching effect of the acceptor dye on the donor dye (quenching effect) and the quenching effect of the hydrogen bond of the GC on the donor dye (quenching), the fluorescence intensity of the donor dye may increase from before the hybridization, Or decrease. The quenching effect of the hydrogen bond of the GC decreases when it is larger, but may increase when it is smaller.

Therefore, in a preferred form of the probe of the present invention, the labeled part of the donor dye and the receptor dye has a distance between bases, and the donor dye is BODIPY FL, B0DIP Y 493/503, 5-FAM, Tetramethylrhodatine, or 6-. Whether the TAMRA, the receptor dye is 6-TAMRA, BODIPY 581/591, X-rhodamine, the 5 'terminal base is G or J, and the 5' terminal is labeled with a donor dye or receptor dye, Or, the 3 'terminal base of the nucleic acid probe is labeled with G or C, and the 3' terminal is labeled with a donor dye or an acceptor dye. Is what it is. In a particularly preferred embodiment, the base of the corresponding nucleic acid corresponding to the dye labeling site is G. In this case, the base at the dye labeling site does not necessarily need to be C.

The structure of the novel nucleic acid probe for nucleic acid measurement of the present invention is as described above. With such a structure, the energy of the excited donor dye is transferred to the acceptor dye when it is not hybridized to the corresponding nucleic acid, so that the acceptor dye emits light and has a strong fluorescence intensity. ing. Therefore, the fluorescence intensity is kept at a low level because the emission of the donor dye is suppressed. However, when the nucleic acid probe hybridizes to the corresponding nucleic acid, the energy of the dye or the acceptor dye is transferred to the GC hydrogen bond formed by the probe nucleic acid hybrid complex or to the G of the corresponding nucleic acid. I do.

In the nucleic acid probe of the present invention, when hybridized to the corresponding nucleic acid, the fluorescence intensity of the emitted light of the nucleic acid probe is significantly reduced as compared to before the hybridization. Further, in the present invention, since a plurality of receptor dyes can be combined with one kind of donor dye, a number of nucleic acid probes corresponding to the combination can be obtained. Moreover, it has the above-mentioned properties.

In actual nucleic acid measurement, the decrease in the fluorescence intensity of the acceptor dye is measured, so that one nucleic acid probe can be used simultaneously at one excitation wavelength. This means that when there are many kinds of corresponding nucleic acids in the same measurement system, if such nucleic acid probes are simultaneously added, many kinds of nucleic acids can be measured at the same excitation wavelength. That is, many kinds of nucleic acids can be measured simultaneously with a simple device.

In the nucleic acid probe used in the nucleic acid measurement methods described in i) to iii) above, a fluorescent dye and a fluorescent dye labeled on one nucleic acid probe may be used. Each of the enchia dyes is unique, and the number of labeled oligonucleotides is at least one each.

3) The nucleic acid probe used in the nucleic acid measurement methods V) to iX) of the method B of the present invention will be described in detail below.

This is a nucleic acid probe used in a method represented by the method of KURATA et al.

This nucleic acid probe is characterized by being composed of a single-stranded oligonucleotide labeled with at least one kind of fluorescent dye. When hybridized to the corresponding nucleic acid, the presence of the quencher probe or quencher dye ( In other words, the fluorescence intensity of the nucleic acid probe changes (eg, decreases) without interaction with the quencher dye (ie, without the presence of the quencher probe in the measurement system).

In principle, it is based on the phenomenon that the luminescence energy of a nucleic acid probe is transferred to the GC pair (hydrogen bond complex) of the probe and the corresponding nucleic acid, particularly G of the corresponding nucleic acid, and the luminescence is suppressed.

The number of bases of the probe of the present invention is the same as in the above invention. The base sequence of the probe is not particularly limited as long as it specifically hybridizes to the corresponding nucleic acid. Preferably, when the nucleic acid probe is labeled with a fluorescent dye and hybridized to the corresponding nucleic acid,

(1) a base sequence for which the base sequence of the probe is designed such that G (guanine) is present in the base sequence of the corresponding nucleic acid at least one base at a distance of one to three bases from the fluorescently labeled base;

(2) The base sequence of the probe so that G (guanine) is present in the base sequence of the corresponding nucleic acid at least one or three bases apart from the terminal base of the corresponding nucleic acid hybridized to the probe. Is designed Base sequence,

(3) At the terminal portion of the probe, a plurality of base pairs of the nucleic acid hybrid complex form at least one pair of G (guanine) and (cytosine) pairs, or correspond to a fluorescent dye labeling site. A nucleotide sequence in which the nucleotide sequence of the probe is designed so that the nucleotide of the nucleic acid is G;

(4) In a probe labeled with a fluorescent dye at a portion other than the 5 ′ terminal phosphate group and the 3 ′ terminal 0H group, at least one pair of G (guanine) base pairs in the portion labeled with the fluorescent dye It is preferable that the base sequence of the probe is designed so that a pair of C and cytosine is formed, or the base of the nucleic acid corresponding to the fluorescent dye labeling site is G.

The fluorescent dye to be labeled on the oligonucleotide is the same as described above. Among the above, FITC, EDANS, Texas Red (Texas red), 6-joe, TMR, x-rhodaraine, Cy3, Cy5, A1 exa 488, Alexa 532, 5-FAM, Bodepi (BODIPY) FL, BODIPY (BODIPY) 493/503, BODIPY (BODIPY) R6G, BODIPY (BODIPY) 564, BODIPY (BODIPY) 581, BODIPY (BODIPY) FL / C3 _N PODEPY (BODIPY) FL / C6, PODIPYE (BODIPY) TMR, 6- TAMURA etc. are preferred, and among them, 5-FAM, BODIPY 493/503, BODIPY Fle 6-joe, TMR, 6-TAMURA etc. are more preferred (fluorescence intensity reduction). Rate is 60% or more.)

The method of labeling the oligonucleotide with a fluorescent dye is the same as in the above invention. '

It is also possible to introduce a fluorescent dye molecule into the probe nucleic acid chain (ANALYTICAL BIOCHEMISTRY 225, pp. 32-38 (1998)).

A preferred probe form is one in which the 3 'or 5' end is labeled with a fluorescent dye. And the base at the labeled terminal is G or C, or the base of the corresponding nucleic acid at the fluorescent dye labeling site is G. If the 5 'end is labeled and the 3' end is unlabeled, the OH group at the 3 'end of ribose or deoxyribose at the 3' end is a phosphate group, etc., and the 2 'carbon of the 3' end ribose is The OH group may be modified with a phosphate group or the like, and there is no limitation.

Further, bases in the probe chain, particularly C or G, may be modified.

In the nucleic acid probes used in the nucleic acid measurement methods described in V) to ix), one nucleic acid probe has at least one type of fluorescent dye and at least one labeling site. .

The nucleic acid probes used in the nucleic acid measurement methods A and B of the present invention (hereinafter, for the sake of simplicity, may be referred to as nucleic acid probes A or B, respectively) are oligodeoxyribonucleotides or oligonucleotides. It may be composed of goribonucleotides. Alternatively, chimeric oligonucleotides containing both of them may be used. The oligonucleotides may be chemically modified. Chemically modified oligonucleotides may be interposed in the chains of chimeric oligonucleotides.

Examples of the modification site of the oligonucleotide to be subjected to the chemical modification include a terminal hydroxyl group or a terminal phosphate group at the end of the oligonucleotide, a nucleoside phosphate site in the chain, a carbon at position 5 of the pyrimidine ring, and Mention may be made of sugar (repos or deoxyribose) sites on nucleosides. A preferred example is a report or dexoxy report site.

The oligonucleotide of the nucleic acid probe of the present invention may be a common general oligonucleotide. It can be produced by a method for producing nucleotides. It is also preferable to use a commercially available nucleic acid synthesizer (for example, ABI394 (Perkin Elmer, USA)).

In order to label the oligonucleotide with a fluorescent dye, any of the conventionally known labeling methods can be used (Nature Biotechnology, vol. 14, p. 303-308, 1996; Applied and Environmental Microbiology, 63). Vol., 1143-1147, 1997; Nucleic acids Research, 24, 4532-4535, 1996). For example, when a fluorescent dye molecule is bound to the 5 ′ end, first, for example,-(CH ₂ ) -SH is introduced into the phosphate group at the 5 ′ end as a spacer according to a conventional method. These transductants are commercially available and may be purchased commercially (Midland Certified Reagent Company), where n is 3-8, preferably It is 6. The fluorescent dye-labeled oligonucleotide can be synthesized by binding a fluorescent dye having SH group reactivity or a derivative thereof to this spacer. The oligonucleotide thus obtained can be purified by chromatography such as reverse phase or the like to obtain the nucleic acid probe of the present invention.

Also, the 3 ′ terminal base of the oligonucleotide can be labeled.

In this case, for example,-(CH ₂ ) „-NH ₂ is introduced into the OH group at the 3′-position C of ribose or deoxyribose as a spacer. In addition, a phosphoric acid group is introduced, and for example,-(CH ₂ ) SH is introduced as a spacer to the OH group of the phosphoric acid group. In the above case, n is from 3 to 8, preferably from 4 to 7. An orifice labeled with a fluorescent dye by binding a fluorescent dye or a derivative thereof reactive to an amino group or SH group to this spacer. Gonutale Can be synthesized. ,

In addition, bases in the oligonucleotide nucleotides can also be labeled.

The amino group or OH group of the base may be labeled with the dye of the present invention in the same manner as in the method for the 5 ′ or 3 ′ terminal (ANALYTICAL BIOCHEMI STRY 225, pp. 32-38 (1998)).

When introduced into an amino group, kit reagents (for example, Unilink aminomodi ﬁ ier (manufactured by CLONTECH, USA), Funole 'Lipo-kit (FluoReporter Kit) F-6082, F-6083, F_6084, F-10220 ( In each case, it is convenient to use Molecular Probes (Molecular Probes, USA)). Then, a fluorescent dye molecule can be bound to the oligoribonucleotide according to a conventional method.

The oligonucleotide synthesized in this manner can be purified by a method such as reverse phase chromatography or the like to obtain the nucleic acid probe of the present invention. The internal standard probe of the present invention utilizes the form of the nucleic acid probe described above, and has the following characteristics:

1) Labeled with at least one fluorescent dye.

2) The internal standard nucleic acid probe has a sequence that hybridizes only with the internal standard nucleic acid under certain conditions and does not hybridize with the target nucleic acid.

3) A fluorescent dye labeled on the target nucleic acid probe, which is caused by a change or an amount of change in the fluorescence intensity of the labeled fluorescent dye due to hybridization with the internal standard nucleic acid, resulting from hybridization of the target nucleic acid probe with the target nucleic acid. Is clearly distinguishable from the change or the amount of change in the fluorescence intensity.

4) (1) When the internal standard nucleic acid probe forms a probe-nucleic acid complex with the target nucleic acid:

The base sequence of the internal standard nucleic acid is the same as the internal standard nucleic acid probe and the internal standard nucleic acid. P Employee 18

54

The Tm value of the nucleic acid complex is 3 ° C or more, preferably 6 ° C or more, more preferably 1 ° C or more, as compared with the Tm value of the probe nucleic acid complex between the internal standard nucleic acid probe and the target nucleic acid. It has a difference of 0 ° C or more.

(2) When the target nucleic acid probe forms a probe 'nucleic acid complex with the internal standard nucleic acid:

The base sequence of the internal standard nucleic acid is such that the Tm value of the probe / nucleic acid complex is 3 ° C or more, preferably 6 ° C, as compared with the Tm value of the probe / nucleic acid complex between the target nucleic acid probe and the target nucleic acid. It has a difference of not less than C, more preferably not less than 6 ° C.

The target nucleic acid probe has a base sequence that specifically hybridizes to the target nucleic acid, and has a base sequence that does not specifically hybridize to the internal standard nucleic acid.

Similarly, an internal standard nucleic acid probe has a base sequence that specifically hybridizes to an internal standard nucleic acid, and has a base sequence that does not specifically hybridize to a target nucleic acid.

In the present invention, at least one probe is used for one type of target nucleic acid or internal standard nucleic acid.

The internal standard nucleic acid, the internal standard nucleic acid probe, the target nucleic acid, and the target nucleic acid probe are as described above. The same applies to the nucleic acid measurement method using the nucleic acid amplification method described later. However, this is only an example, and the present invention is not limited to these examples.

The present invention relates to the use of at least one kind of target nucleic acid probe and at least one kind of internal standard nucleic acid probe as described above, together with at least one kind of internal standard nucleic acid of known concentration. To the measurement system containing, and allow the hybridization reaction to proceed. The change or the amount of change in the fluorescence intensity of the fluorescent dye labeled on the target nucleic acid probe and / or the internal standard nucleic acid probe of the re-digestion reaction system is measured at least at one wavelength, and the measured value and the internal standard nucleic acid nucleic acid probe are measured. The target nucleic acid concentration is measured from the concentration.

In the present invention, the measurement system or the hybridization reaction system may be a solution system or a solid system.

Hybridization reaction may be performed under ordinary known conditions. In particular, for the temperature, as shown in Example 1, it is preferable to conduct an experiment of the following procedure to obtain a suitable temperature condition:

(1) Determine the dissociation curve of the target nucleic acid and the target nucleic acid probe or internal standard nucleic acid probe.

(2) Determine the dissociation curve between the internal standard nucleic acid and the internal standard nucleic acid probe or target nucleic acid probe.

(3) From the above dissociation curve, the target nucleic acid and the target nucleic acid probe are hybridized, but the target nucleic acid and the internal standard nucleic acid probe are the temperature at which the nucleic acid probe complex dissociates, and the internal standard. Determine the temperature at which the nucleic acid and the internal standard nucleic acid probe are hybridized, but the probe-nucleic acid probe complex of the internal standard nucleic acid and the target nucleic acid is dissociated. The temperature common to both is the hybridization temperature.

The buffer, metal ions and the like may be under ordinary known conditions.

The “change amount” is more specifically exemplified as follows. It refers to the difference in fluorescence intensity or the rate of change in fluorescence intensity at a specific measurement wavelength in a measurement system before and after hybridization between a target nucleic acid and a target nucleic acid probe or between an internal standard nucleic acid and an internal standard nucleic acid probe. In this case, the measurement wavelength is at least one or more. This targets one nucleic acid probe. 03 05118

56

It comes from the procedure of measuring one known fluorescent dye at at least ^seven or more wavelengths.

The change rate of the fluorescence intensity is the amount of change in the fluorescence intensity with respect to the fluorescence intensity before the start of the reaction as a function of the time after the start of the hybridization reaction, the change rate, and before the reaction as a function of the number of cycles in PCR. Means the rate of change of the fluorescence intensity after the start of the reaction with respect to the fluorescence intensity value.

`` Change or amount of change in the fluorescence character of the target nucleic acid probe caused by hybridization between the target nucleic acid probe and the target nucleic acid, internal standard nucleic acid probe generated by hybridization between the internal standard nucleic acid probe and the internal standard nucleic acid The target nucleic acid is measured from the change or the amount of change in the fluorescence intensity of the target nucleic acid and the amount of the internal standard nucleic acid added, '' for example, `` the amount or concentration of the internal standard nucleic acid at a known concentration, The relationship between the change or the amount of change in the fluorescence intensity of the internal standard nucleic acid probe upon hybridization and the amount of change can be visually visualized, or a mathematical relational expression can be used to determine the fluorescence of the target nucleic acid probe. This refers to determining the amount or concentration of the target nucleic acid by inserting the intensity change or the amount of change into a rough or relational expression. Alternatively, the procedure for determining the amount or concentration of the target nucleic acid from the graph or the relational expression is recorded on a computer-readable recording medium, and is derived from the target nucleic acid probe when the target nucleic acid and the target nucleic acid probe are hybridized. This refers to determining the amount or concentration of the target nucleic acid by inputting the change or the change in the fluorescence intensity into a computer.

In particular,

1) First, a reaction system (measurement system) that is deemed not to inhibit the hybridization reaction between nucleic acids and the nucleic acid amplification reaction (here, a reaction using a nucleic acid probe; the same applies hereinafter). , Known concentration of target nucleic acid, internal target nucleic acid 5118

57 Add the appropriate probe and perform each reaction.

2) Measure the amount or rate of change in the fluorescence intensity of the reaction system (measurement system) derived from the hybridization reaction and nucleic acid amplification reaction.

3) Graph or formulate the relationship between each nucleic acid concentration and the amount or rate of change of the fluorescence intensity.

4) A hybridization reaction and a nucleic acid amplification reaction are performed using an unknown sample containing at least one type of target nucleic acid, a target nucleic acid probe, an internal standard nucleic acid of various known concentrations, and an internal standard nucleic acid probe. Then, a change amount and a change rate of the fluorescence intensity of the reaction system due to each fluorescent dye labeled on the target nucleic acid probe and the internal standard nucleic acid probe of the reaction system are measured and calculated.

5) Graph the relationship between the change amount and the change rate of the fluorescence intensity of the reaction system derived from the fluorescent dye of the internal standard nucleic acid probe and the concentration of the internal standard nucleic acid or the concentration of the internal standard nucleic acid before amplification in 4) above. Or, formulate it.

6) The graph or formula for the internal standard nucleic acid obtained in the above 3) is compared and examined with that obtained in the above 5). If there is no difference

The graph or formula obtained in 3) can be used as it is. If there is a difference, calculate the difference coefficient manually or by computer.

7) Correct the graph or formula for the target nucleic acid of 3) using the coefficient.

8) By applying the change or the change in the fluorescence intensity of the target nucleic acid obtained in 4) to the collected graph or mathematical formula, the concentration or copy of the target nucleic acid in the unknown sample, or before the amplification of the target nucleic acid Determine the density or copy number of

The method for determining the concentration of the target nucleic acid has various variations and is not limited to the above example. For example, a known amount of an internal standard nucleic acid is added to an unknown sample. A hybridization reaction is performed using a target nucleic acid probe and an internal standard nucleic acid probe. The amount of change in the fluorescence intensity of the fluorescent dye labeled on each probe is measured. The relationship between the amount of change and the concentration of the internal standard nucleic acid for the internal standard nucleic acid is considered to be applicable to the target nucleic acid (note that this relationship is not applicable to a system in which no hybridization inhibitor or polymorphism is present). Make sure that it can be considered). Therefore, the relational expression between the amount of change and the concentration of the internal standard nucleic acid for the internal standard nucleic acid is determined in advance using the unknown sample. From the relational expression, the concentration of the target nucleic acid in the unknown sample can be estimated.

A feature of the present invention is that the measurement of the fluorescence intensity is performed at least at one or more wavelengths. For example, when one type of target nucleic acid is present in one measurement system, at least two target nucleic acids are measured simultaneously with the measurement of the target nucleic acid and the target nucleic acid probe hybridizing thereto and the internal standard nucleic acid and the internal standard nucleic acid probe hybridizing thereto. Some kind of wavelength is needed. If there are two types of target nucleic acids, the measurement wavelength will be at least 4 wavelengths.

However, in the present invention, it is not always necessary to perform the measurements at the same time. That is, when measuring the change or the amount of change in the fluorescence intensity of each probe at the time of hybridization between the internal standard nucleic acid and the internal standard nucleic acid probe, or between the target nucleic acid and the target nucleic acid probe, the measurement is not necessarily performed at the same time. May be performed for different measurement systems. In this case, the measurement wavelength may be at least one. It is preferable that the measurement system contains the target nucleic acid or the internal standard nucleic acid even if the measurement is performed separately. Of course, the method of the present invention can be carried out even if these nucleic acids are not included.

In the present invention, the fact that at least one kind of probe may be present in one target nucleic acid means that a plurality of kinds of probes are present in one target nucleic acid. 5118

59

This means that there may be a plurality of hybridizing base sequences without overlapping the hybridizing regions. In this case, the measurement wavelength increases by the type of probe.

In the present invention, the measurement conditions may be the known conditions described above, and may be changed as appropriate according to the method of measuring the target nucleic acid.

Next, the second invention of the present invention will be described below.

According to a second aspect of the present invention, there is provided a measurement system or a nucleic acid amplification reaction system containing at least one target nucleic acid, wherein at least one kind of an internal standard nucleic acid having a known concentration, at least one kind of a target nucleic acid probe and / or at least one kind. The target nucleic acid and Z or the internal standard nucleic acid are amplified by the nucleic acid amplification method with the addition or presence of the internal standard nucleic acid probe, and the nucleic acid amplification in each cycle of the fluorescence intensity of the fluorescent dye labeled on each nucleic acid probe This method measures the change or the amount of change before and after the reaction in real time, and measures the concentration or copy of the target nucleic acid before amplification from the measured value and the concentration of the internal standard nucleic acid. The nucleic acid amplification method referred to in the present invention refers to a method for amplifying a nucleic acid in vitro.

For example, it may be known or unknown. For example, PCR method, quantitative PCR method, LCR method (ligase chain reaction), real time monitoring quantitative polymerase chain reaction assays, TAS method, RT-PCR, RNA -Methods such as -primed PCR, Stretch PCR, reverse PCR, PCR using Alu sequence, multiplex PCR, PCR using mixed primers, and PCR using PNA (Protein 'nucleic acid' enzyme: Vol. 35, No. 17, 1990 Year, Kyoritsu Shuppan Co., Ltd .; Experimental Medicine, Vol. 15, No. 7, 1997, Yodosha; Guide to Using PCR, Yoshio Yazaki, 1998, Chugai Medical Co., Ltd., ICAN (Isothermal and Chimeric pr iraer-initiated) Amplification of Nucleic acids) Method, LAMP Manpo, N TJP03 / 05118

60

The ASRA method, RCA method, TAMA method, UCAN method, etc. are all included. In addition, the term “quantitative” means the quantitative measurement of the degree of detection in addition to the original quantitative measurement, as described above. It should also include the analysis of the melting curve or the method of analysis.

I) Known method

The PCR method will be described as an example.

The PCR method is divided into the following two cases depending on the method of using the following probe.

A) When a nucleic acid probe is simply hybridized to an amplification product by PCR and a change in fluorescence intensity is simply used as a signal (Witwer et al., US Patent No. 6, 174, 670 Bl Livak et al., US Patent No. 5, 538, 848; KU RATA et al., Nucleic acids Research, 2001, vol. 29, No. 6 e34; EP 1 0 46 717 A9; JP 200-286286 (P200-286300A)); (US Patent No. 6, 495, 326)

In this case, there are two cases depending on how the nucleic acid probe is used.

a) Method using two nucleic acid probes

The method of Morrison et al. (Morrison et al., Anal. Biochera., 183: 231-244, 1989), and the method of Mergney et al. (Mergney et al., Nucleic acid Res., 22: 920-928, 1994) This is a typical method. That is, a method using a donor nucleic acid probe and an acceptor nucleic acid probe.

(a) The method of Mergney et al. involves two nucleic acid probes hybridizing to an amplified nucleic acid. Then, the fluorescence intensity of the nucleic acid probe during the annealing reaction and the fluorescence intensity of the receptor dye released from the amplified nucleic acid due to the degradation of the nucleic acid probe by the DNA polymerase during the nucleic acid extension reaction are measured. I do. Real difference of this measurement value for each cycle This is a method of measuring time.

(b) Morrison et al .:

The structure, operation, and measurement are as described in the first invention and above.

b) When using one nucleic acid probe

This case is also divided into the following three cases.

(a) Molecular beacon method (Tyagi et al., Nature Biotech., 14: 303-308, 1996; Schofield et al., Applied and Environ. Microbiol., 63: 1143-1147, 1997); Hairpin probe (Sunrise probe), trade name: Amplifluor haipin primers: Ampl if luor haipm primers; Nazarenko, IA, Bhatnagar, SK and Hohman, RJ (1997) Ac loss tube format for amplification and detection of DNA based on energy transfer.Nucleic Acids Res., 25, 2516-2521.); Scorch on probe ((Whitcorabe, D., Theaker, J., Guy, SP, Brown, T. and Little, S. (1999) Detection of PCR products using self-probing araplicons and fluorescence. Nature Biotechnol., 17, 804-807.) o A method using a probe.

— A donor fluorescent dye and an acceptor fluorescent dye are labeled on different sites of the oligonucleotide. Both dyes cause the FRET phenomenon based on the stereostructure of the oligonucleotide. When encountering the amplified nucleic acid, the three-dimensional structure becomes loose and hybridizes to the amplified nucleic acid. Due to the change in steric structure, the phenomenon of FRET between the dyes is eliminated. Nucleic acid probes that hybridize to the amplified nucleic acid have the same fate as above. Then, the difference between the fluorescence intensities is measured as described above.

(b) Method represented by the method of Livak et al. (US Patent No. 5, 538, 848) The structure, operation, and measurement are as described in the first invention and described above. (c) A method represented by the method of KURATA et al. (KURATA et al., Nucleic acids Research, 2001, vol. 29, No. 6 e34; EP 1 046 717 A9; JP 200 286300 (P200 286300A)) (T. Horn, et al., Nucleic acid Research, 1997, 25, 4842-4849, 1997; US Patent Application Publication No. US2001 / 0009 760A1, Pub.Date: Jul. 26, 2001; US Patent No. 6, 140, 054).

B) When the above-mentioned specific nucleic acid probe is used as a PCR primer

This is a method according to the method of KURATA et al. (KURATA et al., Nucleic acids Research, 2001, vo 1.29, No. 6 e34; EP 1 046 717 A9);

A probe consisting of a single-stranded oligonucleotide, which is labeled with a fluorescent dye at a portion other than the 3 ′ end of the probe, preferably at the 5 ′ end side, more preferably at the 5 ′ end or 5 ′ end, This probe keeps the 3,0H group of ribose or deribose at the 3 'end free. That is, this is a method in which the probe is used as a primer for PCR (also referred to as a pramer probe in the present invention). The corresponding nucleic acid to be amplified is labeled with a fluorescent dye. In this method, the change in the fluorescence intensity of the PCR measurement (reaction) system in a state in which the amplified nucleic acid is denatured and in a state in which the amplified nucleic acid is hybridized is monitored in real time. Then, in the same manner as described above, the concentration of the corresponding nucleic acid before amplification is determined from the power of the change rate.

I I) The method of the present invention

This is a method using the nucleic acid probe described in Methods A and B of the present invention. The structure, operation, and measurement are the same as those described in the first invention and the above, and thus are omitted here. Various nucleic acid amplification methods that can be suitably used in the second invention are as described above. Therefore, the method of amplifying a target nucleic acid and measuring the concentration or copy number of the target nucleic acid before amplification in the present invention is a method in which the principle of the present invention is applied to the above-described nucleic acid amplification method.

That is, in the nucleic acid amplification, the measurement system contains at least one kind of target nucleic acid and at least one kind of a known amount of an internal standard nucleic acid, and contains a target nucleic acid probe or an internal standard nucleic acid probe, or A nucleic acid amplification reaction is performed in a measurement system containing at least two types of lobes and an internal standard nucleic acid probe in combination, and is generated by hybridization between the target nucleic acid and the target nucleic acid probe before and after the reaction. The change or change in the fluorescence intensity of the fluorescent dye labeled on the target nucleic acid probe is measured, and the concentration or copy number of the target nucleic acid before amplification is determined from the measured value and the amount of the internal standard nucleic acid added. Is a method of measuring

The following is an example of application to a real-time quantitative PCR method.

The real-time quantitative PCR method of the present invention comprises the steps of: adding a target nucleic acid probe or / and an internal standard nucleic acid probe to a measurement system containing at least one target nucleic acid and a known concentration of an internal standard nucleic acid; In the amplification process, the change or the amount of change in the fluorescence intensity of the measurement system before and after the reaction of the fluorescent dye labeled on each probe is monitored (measured) in real time during the amplification process. It is characterized by the following. In the real-time quantitative PCR of the present invention, any of the above-described nucleic acid probes can be suitably used as the target nucleic acid probe or the internal standard nucleic acid probe, regardless of whether they are known or those of the present invention. 5 to 50, preferably 10 to 25, and particularly preferably 15 to 20 as long as they hybridize with the target nucleic acid and its amplification product during the PCR cycle. JP03 / 05118

64

It may be something like That is, the probe may be designed as either a forward-type primer or a reverse-type primer even with a simple probe.

As the simple nucleic acid probe and the primer, various nucleic acid probes used in the above-mentioned known methods and the nucleic acid probes described in the methods A and B of the present invention can be suitably used. More preferably, they are the nucleic acid probes described in the methods A and B of the present invention. Particularly preferred probes are those of the above-mentioned V) to ix) of the method B of the present invention.

When used as a primer, it is not always necessary to label both the forward primer and the reverse primer with a fluorescent dye. Either one is acceptable as the present invention can be achieved.

Among the nucleic acid probes of the method B of the present invention, a nucleic acid probe in which the 3′-OH group of deoxyribose or ribose at the 3 ′ end is not modified can be used as a primer. In this case, various types of nucleic acid probes used in a known method have a similar form.

When used as a primer, if the 3 'or 5' end of the target nucleic acid probe or internal standard nucleic acid probe cannot be designed to G or C from the base sequence of the target nucleic acid or internal standard nucleic acid, Addition of 5'-guanylic acid or guanosine or 5'-monocytidylic acid or cytidine to the 5'-end of the oligonucleotide, or addition of 5'-guanylic acid or 5'-cytidylic acid to the 3'-end Even so, the object of the present invention can be suitably achieved. Therefore, in the present invention, the target nucleic acid probe and the internal standard nucleic acid probe designed so that the base at the 3 ′ or 5 ′ end is G or C are designed based on the base sequences of the target nucleic acid and the internal standard nucleic acid. Other probe 05118

65

5'-Guanylic acid or guanosine or 5'-cytidylic acid or cytidine at the 5 'end of the probe, and 5'-guanylic acid or 5'-cytidylic acid at the 5' end Defined to include the added probe.

When a target nucleic acid probe or an internal standard nucleic acid probe is used as a primer for PCR, a specific example of a method for measuring a target nucleic acid is described in Data analysis method obtained by real-time quantitative PCR (described later). Here, the description is omitted.

Among the nucleic acid probes, a nucleic acid probe having a modified 3 ′ OH group of 3 ′ terminal deoxyribose or ribose cannot be used as a primer, but the probe can be used in a PCR reaction system by using a reverse primer and a forward primer. And PCR can be performed. In this case, at the time of the nucleic acid extension reaction, the target nucleic acid probe or the internal standard nucleic acid probe hybridized to the target nucleic acid or the amplified target nucleic acid or the internal standard nucleic acid or the amplified internal standard nucleic acid is degraded by the polymerase, and Decomposed and removed from the lobe complex. That is, it is used as a mere probe. However, in the probe, the nucleotide sequence region that can hybridize to the target nucleic acid and the internal standard nucleic acid is between the regions where both primers can hybridize.

At this time, the change or the amount of change in the fluorescence intensity of the dye that has labeled the target nucleic acid probe is measured (for example, the fluorescence intensity of the reaction system is measured). In addition, when the target nucleic acid or amplified target nucleic acid or the internal standard nucleic acid or the amplified internal standard nucleic acid is hybridized with each probe, the fluorescence intensity (value) of the dye labeling the target nucleic acid probe (as an example) In the former, the probe is used to target the target nucleic acid by an aering reaction and polymerase. The reaction system during the nucleic acid extension reaction until it is removed from the probe complex, and the latter can be the fluorescence intensity value of the reaction system in which the nucleic acid denaturation reaction has been completed. ) Is measured.

When measuring the change or change in the fluorescence intensity of the internal standard nucleic acid probe, the hybridization reaction is performed on the internal standard nucleic acid at various concentrations, and the change or the change in the fluorescence intensity is measured. This measurement is performed in real time for each cycle.

For each concentration of the internal standard nucleic acid, calculate the change (rate) in the fluorescence intensity (value) for each cycle for the fluorescent dye labeled on the internal standard nucleic acid probe.

Next, the relational expression of the concentration of the internal standard nucleic acid before amplification is determined from these changes (rates). (As an example, the calibration curve of the change (rate) as a function of the concentration of the internal standard nucleic acids before amplification is obtained. In addition, the data analysis method is the same as when the target nucleic acid probe is used as a primer. Normally, the concentration of the internal standard nucleic acid and the amount of change are linearly proportional to a specific number of cycles. Therefore, the cycle can be found by performing measurement in real time.

Next, for the target nucleic acid, the same amount of change (rate) in the cycle number as described above is determined. This change (rate) is applied to the above calibration curve or relational expression. Thus, the target nucleic acid can be measured. A specific example is shown in the embodiment.

When a nucleic acid probe is used as a primer, when the target nucleic acid probe hybridizes with the target nucleic acid, or when the internal standard nucleic acid probe hybridizes with the internal standard nucleic acid, the Tm value of the nucleic acid complex is the same as the nucleic acid complex of the primer. Tm of the body ± 15. C, preferably ± 5 ° C 05118

67

It is desirable that the base sequence of the target nucleic acid probe be designed.

Then, as the PCR reaction of the present invention proceeds, each amplified nucleic acid is secondarily labeled with a fluorescent dye useful for carrying out the present invention. Therefore, the fluorescence intensity of the reaction system in which the nucleic acid denaturing reaction is completed is large or small, but in the reaction system in which the annealing reaction is completed or the nucleic acid extension reaction is performed, the fluorescence intensity of the reaction system is the former. Decrease or increase from the fluorescence intensity of

The PCR reaction can be performed under the same reaction conditions as in ordinary PCR methods. In particular, in the nucleic acid probes A and B of the present invention, nucleic acid amplification can be carried out in a reaction system having a low Mg ion concentration (1-2 mM). Of course, the reaction can also be carried out in a reaction system in the presence of a high concentration (2 to 4 mM) of Mg ions used in conventionally known quantitative PCR.

The third invention of the present invention relates to various methods such as the above-described nucleic acid measurement method (first invention), nucleic acid amplification method (second invention), polymorphism measurement / analysis / analysis method (described later), and FISH. The invention is an invention of a method for analyzing data obtained when an analysis method (described later) or the like is performed, or when various methods are performed using various devices (described later).

Hereinafter, for the sake of simplicity, among the nucleic acid amplification methods, the real-time quantitative PCR method will be particularly described, but data may be analyzed according to the other methods.

The real-time quantitative PCR method currently consists of a reaction device that performs PCR, a device that detects the emission of fluorescent dyes, a user interface, that is, a computer that programs each procedure of the data analysis method and records it. It is a device that consists of a readable recording medium (also called Sequence Detection Software System) and a computer that controls them and analyzes the data, and is measured in real time. So, the measurement of the present invention JP03 / 05118

68

It is performed with a simple device.

First, an analysis apparatus for real-time quantitative PCR will be described below. The device used in the present invention may be any device as long as it can monitor PCR in real time. For example, an ABI PRI SM ™ 7700 base sequence detection system (Sequence Detection System SDS 7700) (Pakkin. - applied Bio systems, Inc. (Perkin Elmer App l ied Biosytems, Inc., USA)), Rye Tosaikura one ^{τ Μ} system (Roche ■ Daiagunosuti box Co., Ltd., Germany), and the like can be mentioned as a particularly suitable one.

The above-described PCR reaction apparatus is an apparatus that repeatedly performs a thermal denaturation reaction, an annealing reaction, and a nucleic acid extension reaction of a target nucleic acid. The detection system consists of an argon laser for fluorescence excitation and a CCD camera for a spectrograph. Further, a computer-readable recording medium in which each procedure of the data analysis method is programmed and recorded is used by being installed in a computer, controlling the above system via the computer, and outputting from the detection system. It records a program that analyzes and processes the data obtained.

A data analysis program recorded on a computer-readable recording medium uses a process of measuring the fluorescence intensity for each cycle, and the measured fluorescence intensity is used as a function of the cycle, that is, a PCR amplification program. The process of displaying on the computer display as t, the process of calculating the PCR cycle number (threshold cycle number: Ct value) at which the fluorescence intensity starts to be detected, and the creation of a calibration curve that calculates the copy number of the sample nucleic acid from the Ct value It consists of a process, the process of printing the data of each process described above, and plot values. If the PCR is progressing exponentially, the concentration or concentration of the target nucleic acid at the start of the PCR A linear relationship holds between the peak number (Log value) and the change (rate) of the fluorescence intensity or the Ct value. Therefore, a calibration curve is prepared in advance using known concentrations or copy numbers of the target nucleic acid and the internal standard nucleic acid, and the change in the fluorescence intensity of a sample containing the target nucleic acid of unknown concentration or copy number is determined. The concentration or copy number of the target nucleic acid before nucleic acid amplification can be calculated by measuring the amount (rate) or Ct value of the target nucleic acid.

The features of the method for analyzing the data obtained by the real-time quantitative PCR method as described above are described below.

The first characteristic is that in the method for analyzing data obtained by the real-time quantitative PCR method, the nucleic acid to be analyzed in each cycle (in addition to the target nucleic acid, the internal standard nucleic acid is included here). The fluorescence intensity of the fluorescent dye that labeled the probe when hybridized to a nucleic acid probe corresponding to (specifically hybridizes to) the nucleic acid is converted from the probe nucleic acid complex to the polymerase in each cycle. When the probe is further decomposed and the fluorescent dye is released, or when the complex is dissociated by the nucleic acid denaturation reaction, an arithmetic processing step of correcting the fluorescence intensity value of the dye, that is, a correction arithmetic processing step It is. In the present invention, the above-mentioned “nucleic acid to be analyzed and a nucleic acid probe corresponding to (specifically hybridizing to) the nucleic acid” include an internal standard nucleic acid and an internal standard nucleic acid probe, and a target nucleic acid and a target nucleic acid probe. (The same applies hereinafter).

The “fluorescence intensity value of the fluorescent dye that labeled the probe when the amplified nucleic acid to be analyzed corresponds to the nucleic acid (specifically hybridizes) to the nucleic acid probe” For example, when the probe is used simply as a nucleic acid probe, annealing at 40 to 85 ° C, preferably 50 to 80 ° C at each PCR site is performed. Examples include the fluorescence intensity value of the fluorescent dye that has labeled the nucleic acid probe in the reaction system (more specifically, the fluorescence intensity value of the reaction system measured at a measurement wavelength specific to the dye) ( The same applies hereinafter.) And, it means the reaction system where the reaction is completed. When the probe is used as a primer, it is an annealing reaction system or a nucleic acid extension reaction system at 40 to 85 ° C, preferably 50 to 80 ° C. The actual temperature depends on the length of the amplified nucleic acid.

Further, "the fluorescence intensity value of the dye when the probe is decomposed by the polymerase and the fluorescent dye is released from the dissociation of the lobe nucleic acid complex, or when the complex is dissociated by the nucleic acid denaturation reaction" A reaction system for heat denaturation of nucleic acid in each PCR cycle, specifically, a reaction system at a reaction temperature of 90 to 100 ° C, preferably 94 to 96 ° C, in which the reaction is completed The fluorescence intensity value of the reaction system when measured at the measurement wavelength relating to the dye of the target nucleic acid probe in Example 1 (hereinafter the same applies). In this case, if the probe is simply used as a nucleic acid probe, a reaction system in which the probe is decomposed by the polymerase from the probe's nucleic acid complex and the fluorescent dye is released may be used. Shall be included.

The correction calculation process in the correction calculation process may be any as long as it meets the object of the present invention. Specifically, the following [Formula 1] is used. Can be exemplified.

f „= f _hyb . _Π Ζ f _n (Equation 1)

f „= f, = f (Equation 2)

(In the formula,

f ：: Correction calculation processing value in the nth cycle calculated by [Equation 1] or [Equation 2], JP03 / 05118

71

. f _hyb _n: the n th cycle, fluorescence intensity of the reaction system when amplified analyte nucleic acid is a nucleic acid probe hybridization Dizu corresponding to the nucleic acid,

f _n : In the nth cycle, when the probe is decomposed by the polymerase from the probe-nucleic acid complex to release the fluorescent dye, or when the probe-nucleic acid complex is dissociated by the nucleic acid denaturation reaction Fluorescence intensity value of the above dye)

In this process, the correction calculation processing value obtained by the above processing is displayed on a computer display and / or the value is similarly displayed in the form of a graph as a function of each cycle, and Z is similarly displayed. Or printing sub-steps.

The second feature is that, in each cycle, the value of the correction calculation processing by [Equation 1] or [Equation 2] is substituted into the following [Equation 3] or [Equation 4], and the change in fluorescence between samples (fluorescence change) This is a data analysis method that calculates the rate of change or the rate of change in fluorescence and compares them.

F _n = f _n Z f, (Equation 3)

F „= f, / f _n (Equation 4)

(In the formula,

F „: Fluorescence change amount (fluorescence change rate or fluorescence change rate) calculated by [Equation 3] or [Equation 4] in the nth cycle,

f _n : The value of the correction operation by [Equation 1] or [Equation 2] in the nth cycle

f:. In the correction processing value by [Equation 1] or [Equation 2], but those numbers any previous cycle changes in f _n is observed, usually, For example, 1 0-4 0 cycles, preferably 15 to 30 cycles, More preferably, 20 to 30 cycles are employed. ]

In this process, the calculated value obtained in the above process is displayed on a computer display and printed or printed, or the comparison value or the value is similarly displayed as a graph function as a function of the number of cycles. And Z or a printing sub-step, but the above-described sub-step may or may not be applied to the correction operation processing value obtained by [Equation 1] or [Equation 2].

The third feature is

(3.1) Using the data of the fluorescence change amount (fluorescence change rate or fluorescence change rate) calculated by [Equation 3] or [Equation 4], [Equation 5], [Equation 6] or [Equation 7] The process of computing by

1 og _b (FJ, In (FJ (Equation 5)

1 og _b {(1-FJXA}, In {(1-F „) XA} [Equation 6] log, {(F _n -1) XA}, In {(F„-1) XA} [Equation 6 7]

A, b: arbitrary numerical values, preferably integer values, more preferably natural numbers. When A = 100 and b = 10, {(F „-1) XA} is expressed as a percentage (%).

F _n : Fluorescence change amount (fluorescence change rate or fluorescence change rate) in n cycles calculated by [Equation 3] or [Equation 4]],

(3.2) An arithmetic processing step of calculating the number of cycles in which the arithmetic processing value of (3.1) above has reached a certain value,

(3.3) Calculate the relationship between the number of cycles in a sample containing known concentrations of target nucleic acid and Z or internal standard nucleic acid and the concentration or copy number of the target nucleic acid and internal standard nucleic acid at the start of the reaction before nucleic acid amplification. Arithmetic processing process, (3.4) a process for calculating the concentration or copy number of the target nucleic acid before amplification of the nucleic acid in the sample containing the target nucleic acid,

This is a data analysis method having the following. A process consisting of (3.1) → (3.2) → (3.3) → (3.4) is preferred.

In each of the above-mentioned steps (3.1) to (3.3), the arithmetic processing value obtained in each processing is displayed on a computer display and / or the value is used as a function of the number of cycles, and is used as a function of each cycle. It may include the sub-steps of displaying and printing or printing in the same manner as described above. Since the processed value obtained in the process of (3.4) needs to be printed at least, the process includes a printing sub-step. The processing value obtained in the above (3.4) may be further displayed on a computer display.

The correction processing value obtained by [Equation 1] or [Equation 2] and the processing value calculated by [Equation 3] or [Equation 4] are displayed on a computer display in the form of a graph as a function of the number of cycles. The display and / or printing may or may not be performed, and the display and / or printing sub-steps may be added as necessary.

In the above method, the reaction system for measuring the internal standard nucleic acid and the reaction system for measuring the target nucleic acid may be used together or separately.

The data analysis method is particularly effective when the real-time quantitative PCR method is used to measure the amount of decrease in the emission of a fluorescent dye.

Although the data analysis method of the present invention has the above characteristics, it is preferable to perform the following analysis in actual analysis.

1) A reaction system in which the substance that inhibits the hybridization reaction and / or the nucleic acid amplification reaction between the nucleic acid and the nucleic acid probe or the polymorphic nucleic acid is considered to be absent. All or any of the processes with features Implement up to.

2) Next, for unknown samples (things containing target nucleic acids) in which the inhibitor or polymorphic nucleic acid is supposed to be present, nucleic acid probes, internal standard nucleic acids of various concentrations, internal standard nucleic acids Perform a nucleic acid amplification reaction using the probe. In this case, a calibration curve can be obtained for the internal standard nucleic acid, but not for the target nucleic acid.

3) Compare and examine the processed data for the target nucleic acid and the internal standard nucleic acid obtained in the above 1) and 2).

(1) If the processed data of the internal standard nucleic acid (the data processed by the data analysis method described above; the same applies hereinafter) is the same or substantially the same, the inhibitor or polymorphism is contained in the sample. Not considered. Therefore, various graphs, relational expressions, and calibration curves for the target nucleic acid and the internal standard nucleic acid obtained in 1) above can be used for the unknown sample.

(2) If the processed data for the internal standard nucleic acid is not the same or substantially the same, it is considered that the inhibitor or polymorphism is contained in the sample. Calculate the rate of change of the various graphs, relational expressions, and calibration curves for the internal standard nucleic acid obtained in 1) and 2), that is, the change coefficient.

(3) Apply the coefficient of change to the target nucleic acid obtained in 1) to various darafts, relational expressions, and calibration curves.

The various graphs, relational expressions, and calibration curves obtained in this way are graphs, relational expressions, and calibration curves for determining the concentration or copy of the target nucleic acid before the nucleic acid amplification of the target nucleic acid.

The method for determining the concentration or copy number of the target nucleic acid before amplification of the present invention includes various modifications, and any method can be adopted as long as the object of the present invention is achieved. For example, this is shown in Example 1. P03 05118

75

As a simple method, an internal standard nucleic acid is added to a sample in which the inhibitor is considered to be contained in the sample, and the target nucleic acid probe of the present invention and Z or the internal standard nucleic acid probe are used. Instead, amplify the target nucleic acid and internal standard nucleic acid in the sample using real-time monitoring quantitative PCR. For each amplified nucleic acid, a hybridization reaction is performed using the target nucleic acid probe and the internal standard nucleic acid probe of the present invention. The amount of change in the fluorescence intensity of the fluorescent dye labeled on each probe is measured. Of course, when obtaining this variation, it is preferable to use the data analysis method of the present invention. The relationship between the amount of change and the concentration of the internal standard nucleic acid for the internal standard nucleic acid is considered to be applicable to the target nucleic acid. (Note that inhibitors or polymorphisms in the hybridization reaction and the nucleic acid amplification reaction may be considered.) Make sure that this can be done in a system that does not exist). Therefore, the relational expression between the amount of change and the concentration of the internal standard nucleic acid for the internal standard nucleic acid is obtained in advance using the known sample.

From the relational expression, the concentration or copy number of the amplified target nucleic acid and internal standard nucleic acid can be determined. Since the concentration or copy number of the internal standard nucleic acid before amplification is known, the concentration or copy number of the amplified target nucleic acid before amplification can be estimated.

A fourth feature is that, in a real-time quantitative PCR analysis apparatus, measurement and / or analysis of real-time quantitative PCR having an arithmetic and storage means for executing the data analysis method for the real-time quantitative PCR method of the present invention. Device.

In this case, since the measurement system includes at least one or more target nucleic acids, a measurement device capable of measuring at least one or more wavelengths is preferable. Further, any device that can excite a fluorescent dye at at least one wavelength is more preferable. 03 05118

76

Les,

A fifth feature is that each step of a data analysis method for analyzing PCR using a real-time quantitative PCR analyzer is programmed, and the program of the present invention is recorded on a computer-readable recording medium on which the program is recorded. This is a computer-readable recording medium that stores a program that allows a computer to execute each procedure of the analysis method.

A fourth invention of the present invention is an invention in which the above various methods are applied to a method for analyzing or measuring a polymorphism (including SNP) and / or mutation of a target nucleic acid.

It is also a computer-readable recording medium in which the measurement kit, the data analysis method for the measurement, the measurement device, and the procedure for causing a computer to execute the data analysis process are recorded as a program.

When analyzing data obtained by a method for analyzing or measuring polymorphism (polymorphism) and / or mutation (tnutation) of a target nucleic acid of the present invention, the nucleic acid to be analyzed is a nucleic acid probe corresponding thereto. Process of correcting the fluorescence intensity value of the fluorescent dye that has labeled the probe when hybridized with the probe with the fluorescence intensity value of the fluorescent dye that has labeled the probe when the probe is not hybridized With this, the processed data will be highly reliable (applying data analysis methods).

A fourth invention is a measuring device for analyzing or measuring a polymorphism (polymorphism) or Z and a mutation (mutation) of a target nucleic acid, wherein the data obtained by the data analysis method is processed. It is a measuring device having means. In addition, a procedure for causing a computer to execute the above-described process for correcting data obtained by a method for analyzing or measuring a polymorphism and / or a mutation of a target nucleic acid is recorded as a program. Computer-readable recording medium.

The fifth invention of the present invention is an invention in which the novel nucleic acid measuring method of the present invention is applied to various nucleic acid measuring methods, for example, the FISH method, the LCR method, the SD method, the TAS method and the like.

An example is described below.

When applying to the F I SH method

That is, the method of the present invention can suitably utilize, as a sample for nucleic acid measurement, a complex microbial system, a symbiotic microbial system, or a cell homogenate. The complex microbial system or the symbiotic microbial system is a substance that inhibits the hybridization (and, of course, the hybridization of an internal standard nucleic acid and its internal standard nucleic acid probe) of the present invention, and a substance that inhibits the Z or nucleic acid amplification reaction. This is because the nucleic acid probe may contain a substance that inhibits the emission of a fluorescent dye.

A novel nucleic acid measurement method, a nucleic acid amplification method,

Using one or more of data analysis methods, their measuring devices (including those incorporating a computer-readable recording medium) and various devices (described below), complex or symbiotic microbial systems By determining the copy number of the 5 S r RNA, 16 S r RNA, or 23 S r RNA of the specific strain or the DNA of the gene DNA, the abundance of the specific strain in the system can be measured. it can. This is because the number of copies of gene 5NA of 5S rRNA, 16SrRNA or 23SrRNA is constant depending on the strain.

The sixth invention of the present invention relates to a reaction solution, a measurement kit, and a device (for example, a DNA chip described below) which can be conveniently used when the novel nucleic acid measurement method of the present invention is carried out. Is possible.) The reaction solution or assay kit contains at least one kind of internal standard nucleic acid, at least one kind of target nucleic acid probe or target nucleic acid, and Z or at least one kind of internal standard nucleic acid probe or internal nucleic acid. It contains a primer probe of the standard nucleic acid. Preferably, it appropriately contains other components (buffer solution, trace metal ions, etc.). However, since these components can be added to the measurement system at the time of use, the reaction liquids or the measurement kits are not limited to these components. The form may be either a dry state or a liquid state. In the second invention (a nucleic acid measurement method using a nucleic acid amplification reaction) of the present invention, primers (when no primer probe is used), polymerase, etc. It is preferable to include reagents necessary for the nucleic acid amplification reaction of the present invention.

The devices may be any devices as long as they can carry out the method of the present invention, and examples thereof include the following DNA chips.

That is, at least one kind of internal standard nucleic acid probe and / or at least one kind of target nucleic acid probe that can be used in the present invention are bound to the surface of the solid support, and the target nucleic acid probe contains the target nucleic acid and the internal standard. The nucleic acid probe is hybridized with an internal standard nucleic acid, and the change or the amount of change (before and after hybridization) of the fluorescence intensity specific to the fluorescent dye of the nucleic acid probe derived from each probe 'nucleic acid complex is measured. It is a device capable of measuring the amount or concentration of at least one kind of target nucleic acid.

In the device, at least one target nucleic acid probe and z or at least one internal standard nucleic acid probe are arrayed on a solid support surface. The devices are arranged and coupled in a matrix, and for each nucleic acid probe bound to the surface of the solid support, at least one temperature sensor and heater are installed on the opposite surface, and the nucleic acid probe binding region has the optimal temperature. A device whose temperature can be adjusted to meet conditions.

That is, the target nucleic acid probe and the internal standard nucleic acid probe of the present invention can be immobilized on the surface of a solid (support layer), for example, the surface of slide glass. This format is now called a DNA chip. Monitoring of gene expression (gene express! On), determination of base sequence, mutation analysis, polymorphism analysis such as 1 (single nucleotide polymorphism (S NP)) Etc. can be used. Of course, it can also be used as a nucleic acid measurement device (chip).

Therefore, the fifth invention of the present invention is a method for achieving these items in addition to the measurement of the target nucleic acid.

In the present invention, many target nucleic acid probes having different base sequences and / or internal standard nucleic acid probes are individually bound on the same solid surface to simultaneously measure many types of target nucleic acids. it can. Therefore, the target nucleic acid can be measured in exactly the same way as a DNA chip, so it is a new DNA chip. Under optimal reaction conditions, nucleic acids other than the target nucleic acid do not hybridize to the target nucleic acid probe, and thus do not change the amount of fluorescence emitted. Therefore, there is no need to perform an operation of washing nucleic acids that do not specifically hybridize to the target nucleic acid probe.

The basic operation of the novel nucleic acid measurement method using the device of the present invention is as follows: a solution containing a nucleic acid to be analyzed is placed on a solid surface to which a target nucleic acid probe corresponding to the nucleic acid to be analyzed is bound; It only hybridizes the corresponding target nucleic acid probe. As a result, a change in the fluorescence intensity of the fluorescent dye labeled on the target nucleic acid probe occurs before and after hybridization according to the amount of the nucleic acid to be analyzed, and the nucleic acid to be analyzed can be measured from the change (rate) in the fluorescence intensity. It becomes possible.

In the actual measurement, first, using the internal standard nucleic acid and the corresponding internal standard nucleic acid probe, the change in the fluorescence intensity (rate) of the fluorescent dye labeled with the internal standard nucleic acid probe and the internal standard nucleic acid Create a relational equation or calibration curve with the amount or concentration. The target nucleic acid can be measured by applying the change (rate) of the fluorescence intensity related to the target nucleic acid to this. This operation is as described above.

Further, in the device of the present invention, by controlling the temperature of each target nucleic acid probe with a micro heater, it is possible to control the reaction conditions to the optimum for each probe, so that accurate measurement of the concentration becomes possible. In addition, the dissociation curve between the target nucleic acid probe of the present invention and the target nucleic acid can be analyzed by continuously changing the temperature with a micro heater and measuring the amount of fluorescence during that. From the difference in the dissociation curves, it is possible to determine the properties of the hybridized nucleic acid and detect SNP.

The specific conditions for the measurement are described below.

These methods can be carried out by usual known methods (Analytical Biochemistry, Vol. 183, pp. 231-244, 1989; Nature Biotechnology, Vol. 14, pp. 303-308, 1996; Applied and Environmental Microbiology, 63, 1 143-1147, 1997).

Conditions for the hybridization are, for example, that the salt concentration is 0 to 2 molar, preferably 0.1 to 1.0 molar, ρρ is 6 to 8, preferably 6.5 to 7.5. is there.

The reaction temperature is determined by the target nucleic acid product, which is the product of the hybridization reaction. It is preferable that the Tm value of the composite bead is within the range of 10 ° C. By doing so, non-specific hybridization can be prevented. When Tm is lower than 10 ° C, non-specific hybridization occurs. When it exceeds Ttn + 10 ° C, hybridization does not occur. The Tm value can be determined in the same manner as in the experiment necessary for designing a target nucleic acid probe.

The reaction time is 1 second to 180 minutes, preferably 5 seconds to 90 minutes. If it is shorter than 1 second, the hybridization is not completed sufficiently. There is no point in making the reaction time too long. The reaction time is greatly affected by the nucleic acid species, that is, the length of the nucleic acid, or the base sequence. The concentration of the nucleic acid to be analyzed in the reaction solution is preferably from 0.1 to 10〜 {η}. The concentration of the target nucleic acid probe corresponding to the analyte in the device of the present invention per spot is preferably 1.0 to 25. {η}.

When preparing a calibration curve or a relational expression for the internal standard nucleic acid, the internal standard nucleic acid of the present invention is used in an amount of 0.4 to 0.4 with respect to the internal standard nucleic acid probe.

It is desirable to use a ratio of 1.0.

It should be noted that the devices of the present invention include reaction liquids or measurement kits that enable the method of the present invention to be performed using the devices. The reaction solution or the measurement kit contains at least one kind of internal standard nucleic acid. Other components are the same as those in the above-mentioned reaction liquids or measurement kits.

The seventh invention of the method of the present invention is a method for separating, recovering, and concentrating a target nucleic acid, which enables each of the above-described methods of the present invention to be carried out simply, quickly, accurately, and specifically. The method includes at least one step that does not cleave the target nucleobase sequence region. This is a target nucleic acid separation / recovery method in which all nucleic acids including a target nucleic acid are cleaved by more than one kind of restriction enzyme, and then only a nucleic acid fraction containing a target nucleic acid base sequence is separated and recovered. For example, preferably, a method comprising the following means should be adopted. However, the method of the present invention is not limited by this example.

(1) Treat nucleic acids such as genomes containing the target nucleic acid base sequence region with at least one type of restriction enzyme.

(2) The treated product is subjected to molecular fractionation.

In addition, it is preferable to add the following means.

(3) Concentrate the molecular fraction.

The restriction enzyme is not particularly limited as long as it does not cleave the target nucleotide sequence region. That is, it can be changed according to the purpose. Known ones can be suitably used. For example, Bfa I, Bsa JI. Bss KI, Ddel, Mse I, Bso FI, Hha I, Hph I, Mnl I, Rca I, Alu I, Msp I and the like can be mentioned. It is preferable to use these in an appropriate combination according to the purpose. However, these do not limit the present invention. Restriction enzyme treatment conditions may be in accordance with the description (protocol) attached to the kit of the restriction enzyme reagent.

The molecular fraction may be appropriately selected from those known at present according to the purpose. For example, there can be mentioned a molecular fractionation method such as a filtration method using various filters and a gel filtration method (including the HPLC method and the like) using various fillers.

As the concentration method, a usual method may be adopted according to the purpose. For example, a concentration method using a solvent such as ethanol, freeze-drying, and air-drying can be used.

The seventh invention of the method of the present invention is characterized in that it has a high base of 50 bp or more having an arbitrary nucleotide sequence. This is a simple method for preparing artificial genes of high purity (double-stranded DNA).

The preparation method comprises the following means.

1) A single-stranded oligonucleotide having 50 bp or more having an arbitrary base sequence is artificially synthesized using a DNA synthesizer.

2) Using the synthesized single-stranded oligonucleotides of 50 bp or more as type I, perform nucleic acid amplification reactions by various gene amplification methods.

As the DNA synthesizer, any type can be used as long as the object of the present invention is achieved. Preferably, a DNA synthesizer (ABI394) (Perkin Elmer Japan Applied Co., Ltd.) may be used. The gene amplification method may be any method as long as the object of the present invention is achieved. Preferably, the PCR method may be used.

In order to prevent the risk of single-stranded oligonucleotides other than the target being mixed into the gene amplification product, it is desirable to use sufficiently diluted type III. The dilution ratio of this type III is not particularly limited. Also, by diluting the gene amplification product and performing the gene amplification again using the diluent as type II, the risk of contamination due to single-stranded oligonucleic acid other than the above-mentioned purpose can be eliminated. It is possible. The number of times this gene amplification is repeated may be determined according to the purpose of the present invention, and is not particularly limited.

The first to eighth inventions of the present invention can be used in various fields such as medicine, forensic medicine, anthropology, ancient biology, biology, genetic engineering, molecular biology, agriculture, and plant breeding. Also known as complex microbial systems or symbiotic microbial systems, microorganisms of various types are mixed or at least one type of microorganism is mixed with cells derived from other animals or plants and cannot be isolated from each other. It can be suitably used for analysis and analysis of systems. The term “microorganism” used herein refers to a general microorganism, and is not particularly limited. Example

Next, the present invention will be described more specifically with reference to examples.

Example 1

As a target nucleic acid (gene), the nec1 gene from soil was quantified using the nec1 gene, which is thought to be the causative gene for potato scab.

A) Various methods

1) Synthesis method of oligogodoxyribonucleotide (nucleic acid):

Unless otherwise specified, oligodeoxysiliponnucleotides (hereinafter referred to as oligonucleotides) were synthesized using a DNA synthesizer (ABI394) (PerkinElmer Japan Applied Co., Ltd.). .

2) Labeling of oligonucleotides with fluorescent dyes

(1) Modification of oligonucleotide by linker

5 '5 terminal nucleotide''Amino- Modifier C6 Kit Bok (Glen Research Corp., USA) 5 Te use Rere a' - modified by (CH ₂₎ SH - re phospho groups linker scratch. Using this modified nucleotide, an oligonucleotide in which the phosphoric acid group at the 5 ′ end was modified with the linker was synthesized using a DNA synthesizer (ABI394). The DNA was synthesized by the 3-terminal-cyanoethylphosphoramidite (] 3-cy-blocked ethylphosphoramidite) method, using the 5-terminal TrON method. After synthesis, the elimination of the protecting group is 28 ° /. The reaction was performed at 55 ° C for 5 hours with aqueous ammonia.

(2) Purification of compound:

The synthetic oligonucleotide obtained above was dried to obtain a dried product. Which was dissolved in 0.5M NaHC0 _₃ ZNa ₂ C0 ₃ buffer (p H 9. 0). The lysate The gel was filtered through a NAP-10 column (Pharmacia) to remove unreacted substances.

(3) Dye labeling:

The gel filtrate was dried and dissolved in 150 // L of sterile water (oligonucleotide solution). 1 mg of the fluorescent dye (e.g., BODIPY FL) -Chloride (M olecular Probes Inc., USA) was溶角army to DM F of 1 0 0 μ L, the oligonucleotide _{_{solution, 1M NaHC0 3 / Na 2 C0}} 3 After adding 150 L of buffer and stirring, the mixture was reacted at room temperature for 1 hour, and a fluorescent dye was bound to the linker 1- (CH ₂ ) ₆ -SH at the 5 ′ end.

(4) Purification of compound:

The reaction product was subjected to gel filtration using NAP-25 (manufactured by Pharmacia) to remove unreacted substances. SEP - PAC by reverse phase HPLC using a C18 column, the oligonucleotide of the linker one - (CH ₂₎ ₇ -丽₂ fluorescent dye was partitioned the purpose things conjugated min. The fraction was subjected to gel filtration with NAP-10 (Pharmacia). Thus, an oligonucleotide having a fluorescent dye bound to the 5 ′ end was obtained.

(5) The measurement was carried out by measuring the value of 260 mn with a spectrophotometer of an oligonucleotide having a fluorescent dye bound to the 5 ′ end of the present invention. For the probe, use a spectrophotometer for 650 nti! Scanning at an absorbance of ~ 220nra confirmed that there was absorption of the fluorescent dye and DNA. Further, the purity of the purified product was determined using the same reverse-phase HPLC as described above, and it was confirmed that the purified product was a single peak.

(6) Reversed phase chromatography

The conditions for the above reverse phase chromatography are as follows.

■ Eluted Solvent A: 0.05N TEAA 5% CH ₃ CN 'Eluent Solvent B (for gradient): 0.05N TEAA 40% CH ₃ CN

'' Column: SEP— PAK C18; 6X250mm

• Elution rate: 1. Oral / rain

· Temperature: 40 ° C

• Detection: 254nm

3) Method of phosphorylation of OH group at 3, terminal 3 position

During the synthesis of the oligonucleotide, a 3 'phosphate group was generated by a deprotection reaction (Glen Research Cat No. 20-29 13).

4) Agarose electrophoresis method

Performed in the usual way. That is,

• Agarose concentration: 0.5%

-Buffer: TBE buffer, pH9.3

• Temperature: room temperature

5) Preparation of internal standard nucleic acid (DNA gene)

Primers NEC-F and NEC_R, NECM-F and NECM-R, which consist of oligonucleotides having the nucleotide sequences shown in Table 1, were prepared. Using these primers, mutations were introduced into the target nucleic acid by the overlap extention PCR method (Guide to PCR method, pages 29-37, Chugai Medical Co., Ltd., 1998). F means forward primer and R means reverse primer. table 1

Incidentally, oligonucleotide having the nucleotide sequence of Table 1, Haiburidizu where regions of necl gene _t that shown (corresponding) either is 1 Further, NECM- R nucleotide sequence in the table The nucleotide sequences at positions 11, 12, 13, and 15 (from the 5 'end) are different from the sequence of the target nucleic acid (gene) (see Table 2 below). Similarly, the nucleotide sequence of NECM-F is the one in which the 11th, 13th, 14th, and 15th bases (from the 5 'end) in the table are changed (see Table 2 below).

Table 2 Base sequence of target nucleic acid probe

The operation procedure is as follows.

(1) The genomic DNA of Streptomyces turgidiscabies IF016080 (purchased from here) was used as type III, primers a and d were used as one set, and primers b and c were used as one set. PCR was performed for each. The genomic DNA was prepared as follows.

(2) The product was subjected to agarose gel electrophoresis. Then, bands corresponding to amplified nucleic acids were cut out, and amplified nucleic acids were extracted.

(3) Each extract was mixed and PCR was performed without adding new primers.

(4) The product was subjected to electrophoresis in the same manner as in 2) above. Only the band corresponding to the product from A to B in length was cut out, and the amplification product was extracted.

(5) Using the extract as type III, PCR was performed using the primers a and b as a set.

(6) The product was subjected to electrophoresis in the same manner as in 2) above. Only the band corresponding to the length from A to B was cut out again.

(7) Mutation insertion was confirmed by the sequencer. Further, _c 6 DNA was quantified amount) Preparation of target nucleic acid probe and internal standard nucleic acid probe

NECB-24 shown in Table 2 is the base sequence of the target nucleic acid probe. -24 is for the internal standard nucleic acid probe. In this example, the target nucleic acid probe is called NECB-24 and the internal standard nucleic acid probe is called NECMB-24.

NECB-24 was labeled at the 5 ′ end with BODIPY FL by the method described above, and NECMB-24 was labeled at the 5 ′ end with 6-TAMRA by the method described above. In both cases, the 3 'OH group at the 3' end was phosphorylated and used.

In the table, the 10th, 11th, 12th and 14th bases T, G and A of NECB-24 are mutated to A, G, C and T respectively in NECMB-24.

7) PCR was performed under the following conditions.

· Denaturation reaction: 95 ° C, 15sec

• Annealing and detection: 62 ° C, 18sec

-Extension: 72 ° C, 14sec

■ Taq polymerase: Gene Taq (Nippon Gene Co., Ltd.)

'Primer addition concentration: 500 nM, e and 前記 above (see Fig. 1 and Table 1)' Probe addition concentration: 50ηΜ

• Type 核酸 nucleic acid (Template): mixture of PCR fragment of internal standard nucleic acid NECM1 and target nucleic acid NECB1 (PCR amplification product with a and b primer set: about 700 bp)

• Measuring device: Smart Cycler System (Takara Bio Inc.) (hereinafter referred to as Smart Cycler for convenience).

• Use channel:

Channel 1 (Ex, 450-495 nm; Em, 505-537 nm).

Channel 3 (Ex, 527-555 nm; Em, 565-605 nm).

The fluorescence intensity of BOD IPY FL was measured in channel 1 and the fluorescence intensity of 6-TAMRA was measured in channel 3 at the same time. 8) Extraction of DNA from soil

The target nucleic acid was extracted from the soil using the BiolOl kit (for soil), and further purified using the Wizard DNA Clean-Up system to obtain a soil sample (sample).

B) Experimental example

1) Evaluation of fabricated probe

Correspondence of target nucleic acid probe NECB-24 and internal standard nucleic acid probe NECMB-24 Corresponding nucleic acid (target nucleic acid or internal standard nucleic acid) Fluorescence intensity change (decrease) rate and dissociation curve when hybridized. The same reaction buffer as that used in the PCR reaction was used.

The results are shown in FIGS. The maximum fluorescence intensity change rate of both probes was about 70%, indicating a reasonable change rate. In NECB-24, the difference in Tm value between the target nucleic acid and the internal standard nucleic acid is slightly less than 20 ° C, and if it is detected around 62 ° C, only the target nucleic acid is detected without detecting the internal standard nucleic acid. It became clear that we could do it. Similarly, in the case of NECMB-24, the difference between the Tm value of the internal standard nucleic acid and the target nucleic acid is slightly less than 20 ° C, and if detected at around 62 ° C, only the target nucleic acid is detected without detecting the target nucleic acid. It was found that can be detected. Therefore, detection of PCR amplification products was performed at 62 ° C. for both probes.

2) Specificity of probe

Under the PCR reaction conditions described in 7) of A) above, real-time monitoring of PCR of the target nucleic acid using NECB-24 as the nucleic acid probe and primers a and b above The results are shown in FIG. Similarly, FIG. 5 shows the results of real-time monitoring when PCR of the internal standard nucleic acid was performed using the above c and d with NECMB-24 as the nucleic acid probe and primer. High fluorescence intensity change rate of about 30% for both probes (Fluorescence quenching rate). In both probes, the obtained fluorescence intensity change rates varied depending on the mixing ratio of the target nucleic acid and the internal standard nucleic acid. From these results, it was considered that the target nucleic acid could be quantitatively quantified by this method.

3) Formulation of relational expression between DNA concentration and fluorescence intensity change rate

The rate of change in fluorescence intensity at various DNA concentrations was measured with both probes. The results are shown in FIGS. 6A and 6B (in preparing this figure, the processing described in the data analysis method of the present invention described above was performed to determine the fluorescence intensity change rate.).

The method for determining the concentration or copy number of the target nucleic acid in the unknown sample from each figure is described below. First, an unknown sample containing a target nucleic acid is added with an internal standard nucleic acid whose copy number is known, a target nucleic acid probe and an internal standard nucleic acid probe, and PCR is performed. When the amplification of both nucleic acids becomes visible from the change in the fluorescence intensity of the reaction system, the change rate of the fluorescence intensity of both nucleic acids is determined. By applying the rate of change in fluorescence intensity to FIGS. 6A and 6B, the amount of amplified internal standard nucleic acid (referred to as A) and the amount of target nucleic acid (referred to as B) when indicating the rate of change in fluorescence are determined. Assuming that the copy number of the internal standard nucleic acid before the nucleic acid amplification is A ', the copy number of the target nucleic acid before the amplification is B'. B 'can be obtained by the following equation:

B '= (B / A) A'

4) Quantification of target nucleic acid by a smart cycler using a conventional calibration curve Can a nucleic acid extract sample actually extracted from a soil sample be mixed with a known concentration of a target gene sample at different concentrations to accurately quantify it? I considered. The internal standard nucleic acid probe and the target nucleic acid probe were both added to a reaction tube, and the internal standard nucleic acid and the target nucleic acid were simultaneously detected, respectively. First, a calibration curve was prepared using known concentrations of the external standard gene (necl gene) (Figs. 7A and 7B). Samples containing nucleic acids extracted from soil 0 μl, 1 μl, 2 μl, 31 plus 6,690,000 copies of the target gene (necl gene) were added as type II. The quantification of the necl gene in this sample was performed using the above calibration curve. As a result, it became clear that the graph shifted to the right as the amount of soil sample to be added increased, that is, amplification occurred later (Fig. 8). This delay increased the Ct value, and as a result, the quantitative value was found to be calculated lower than the actually added target gene (necl gene) (see Table 13). From the above results, it was clarified that the existing method (real-time quantitative PCR) using a calibration curve based on an external standard gene could not accurately quantify the target gene in samples containing PCR inhibitors. . Table 3 Difference in copy number of target nucleic acid due to difference in method

(The standard deviation is shown in Katsuko)

The values for each method in Table 3 are the average values obtained by performing the analysis five times.

5) Quantification of target nucleic acid by smart cycler using the method of the present invention The number of copies of the target nucleic acid before amplification was determined by the method of adding the internal standard nucleic acid of the present invention. Table 3 shows the differences in the quantitative values due to the differences in the methods. As a result, the graph shifts to the right as more soil sample is added. In the present invention, a decrease in amplification efficiency (delay in amplification) was observed, but the amplification of the internal standard gene was similarly reduced. It became clear that the quantitative values were almost the same.

From the above results, the usefulness of the novel measurement method of the present invention, in which the concentration or copy number of the target nucleic acid is determined from the change amount or change rate of the fluorescence intensity derived from the target nucleic acid and the internal standard nucleic acid by adding the internal standard nucleic acid, Became. Further, it was revealed that the standard deviation value of the method of the present invention was smaller than that of the conventional real-time quantitative PCR method, and the fluctuation of the quantitative value was small. From these results, it was proved that the present invention is superior to the conventional method in the accuracy in the presence of the PCR inhibitor, as well as in the absence thereof.

6) Implementation of the method of the present invention in a model system

Based on the experimental examples, the addition ratio of the target nucleic acid to the internal standard nucleic acid was changed, and the amplification products of each PCR were monitored in real time for the change in the fluorescence intensity of the two types of probes. As a result, it was confirmed that the amount of change in fluorescence intensity was obtained according to the addition ratio.

7) Quantification of actual soil samples

Based on the above experimental example, a soil sample (including a target nucleic acid) whose copy number of the target gene (necl gene) is unknown was quantified using a known amount of an internal standard nucleic acid.

To 1 μl and 2 μl of the nucleic acid sample extracted from soil, about 66.9 copies of an internal standard nucleic acid was added to the measurement system, and the target gene (necl gene) was quantified by the method of the present invention. As a result, in the system to which 1 μl of the nucleic acid sample extracted from soil was added, the amount was determined to be 67.5 copies. In addition, 2 μl of the nucleic acid sample extracted from soil was added. The quantitative value of the system was 142.5 copies. Since this quantitative value is about twice that of the system containing 1 μl of the soil extract nucleic acid sample, it is judged that the target gene (necl gene) in the soil extract nucleic acid sample was almost accurately quantified. Is performed.

Example 2

Using the probe of Mergney et al., The same examination as in Example 1 was performed.

1) Probe synthesis

For the synthesis of the probe, a probe synthesized by Japan Genetic Research Institute (http: ngrl. Co. Jp /) was used.

2) Internal standard nucleic acid (DNA gene)

This is the same as in the first embodiment.

3) Preparation of target nucleic acid probe and internal standard nucleic acid probe

The nucleotide sequence of the NECB-24 acceptor shown in Table 4 is the nucleotide sequence of the target nucleic acid probe described in Example 1, and the nucleotide sequence of the NECMB-24 acceptor is the internal standard nucleic acid described in Example 1 as described above. It is that of a probe. In this embodiment, the target nucleic acid probe is referred to as NECB-24 acceptor, and the internal standard nucleic acid probe is referred to as NECMB-24 acceptor. The NECB-24 acceptor has its 5 'end labeled with a fluorescent dye called LCRed640, and the NECMB-24 acceptor has its 5' end labeled with a fluorescent dye called LCRed705. Both phosphorylated the 3 'OH group at the 3' end. Fluorescent dyes (LCRed705, LCRed640) modified with the above two types of probes function as receptor dyes for the FRET phenomenon. The probe modified with the donor dye necessary to excite these dyes is Necdon (see Table 4 for the sequence). The 3 'end of the probe is modified to FITC, and when the respective target genes are present, the two salts are placed so that the dye-labeled sites face each other. It is designed to hybridize at a base interval (see Fig. 9). In this way, if the Nec-donor and NECB-24 acceptor are adjacent to each other and the Nec-donor and NECMB-24 acceptor are hybridized adjacent to each other, the FRET phenomenon occurs and the fluorescent character changes significantly. Thus, the corresponding nucleic acid of each probe set can be detected.

The base sequence of the probe is the same as that of NECMB-24 used in Example 1 in the NECMB-24 acceptor, and the base sequence of NECB-24 acceptoi is the same as that of NECB-24 used in Example 1. -Same as 24. Table 4 Sequence of the probe of Mergney et al.

4) PCR was performed under the same conditions as in Example 1 except for the conditions described below. 'Additional concentration of each probe (NECB-24 acceptor, NECBM-24 acceptor, ec-don or): 200nM

• Measuring device: Light cycler system (Kuchishu Co., Ltd.) (hereinafter referred to as light cycler for convenience).

'' Fluorescence measurement channel used

Channel 2 (Ex, 470-490 nm; Em, 640nra).

Channel 3 (Ex, 470-490 nm; Em, 710 nm).

The LCRed640 was measured in channel 2 and the fluorescence of LCRed705 was measured in channel 3 at the same time.

5) Extraction of DNA from soil This was carried out in the same manner as in Example 1.

B) Experimental example

1) Evaluation of fabricated probe

Correspondence of target nucleic acid probe (set of Nec-donor and NECB-24 acceptor) and internal standard nucleic acid probe (set of Nec-donor and NECMB-24 acceptor) When hybridized with nucleic acid (target nucleic acid or internal standard nucleic acid) The produced probe was evaluated by preparing the change rate of the fluorescence of the receptor and the dissociation curve. The same reaction buffer as that used in the PCR reaction was used.

The results are shown in FIGS. 10 and 11. The increase in the fluorescent intensity of the acceptor was about 40% for both probes, and the fluorescent intensity of the acceptor was remarkably increased. As in the case of NECB-24 and NECMB-24 used in Example 1, the T m of a completely complementary nucleic acid (a target nucleic acid and a target nucleic acid probe, or an internal standard nucleic acid and an internal standard nucleic acid probe) and a mismatched nucleic acid The difference between the values is slightly lower than 20 ° C. If detected at around 62 ° C, the mismatched nucleic acid (target nucleic acid and internal standard nucleic acid probe, or internal standard nucleic acid and target nucleic acid probe) will not be detected. It was clarified that only a nucleic acid completely complementary to DNA could be detected. From the above results, as in Example 1, the detection of PCR amplification products for both probes was performed at 62 ° C.

2) Formulating the relational expression between the increase rate of the fluorescence intensity derived from the target nucleic acid and the increase rate of the fluorescence intensity derived from the internal standard nucleic acid with respect to the concentration ratio of the target nucleic acid and the internal standard nucleic acid

Since the target nucleic acid (base sequence and the concentration to be added are known, it should be called a standard nucleic acid, but in the present invention, it is referred to as a target nucleic acid for convenience.) PCR was performed under the reaction conditions described in 7) of A) of Example 1). Then, the amplification product derived from the target nucleic acid and the amplification product derived from the internal nucleic acid were respectively monitored in real time by the probes of Mergney et al. From the results, the fluorescence intensity increase rate derived from the amplification product of the target nucleic acid (the fluorescence intensity increase rate of the NECB-24 acceptor probe) and the fluorescence intensity increase rate derived from the amplification product of the internal standard nucleic acid (the fluorescence intensity of the NECMB-24 acceptor probe) The ratio between the target nucleic acid and the internal standard nucleic acid before PCR was determined (see Figure 12). As a result, there is a high correlation between the concentration ratio of the target nucleic acid before PCR and the internal standard nucleic acid, and the ratio between the increase rate of the fluorescence intensity derived from the amplification product of the target nucleic acid and the fluorescence intensity derived from the amplification product of the internal standard nucleic acid. It became clear that there was. Therefore, it was shown from this relational equation that the concentration ratio between the target nucleic acid and the internal standard nucleic acid before PCR can be known. In preparing this figure, the processing described in the data analysis method of the present invention described above was performed, and the rate of change in fluorescence intensity was determined.

The method for determining the concentration or copy number of the target nucleic acid in the unknown sample from Fig. 12 is described below. First, an unknown sample containing a target nucleic acid is added with an internal standard nucleic acid having a known copy number, a target nucleic acid probe, and an internal standard nucleic acid probe, and PCR is performed. When the amplification of both nucleic acids becomes visible from the change in the fluorescence intensity of the reaction system, the rate of increase in the fluorescence intensity derived from the amplification products of both nucleic acids is determined. From the fluorescence intensity increase rate, the fluorescence intensity increase rate derived from the amplification product of the target nucleic acid and the fluorescence intensity increase rate derived from the amplification product of the internal standard nucleic acid are determined. By applying this ratio to FIG. 12, the ratio (BZA) between the target nucleic acid (B) and the internal standard nucleic acid (A) is determined. Since the copy number (Α ') of the internal standard nucleic acid before nucleic acid amplification is known, the copy number (Β') of the target nucleic acid before amplification can be calculated by the following formula:

Β '= (B / A) A' 3) Quantification of target nucleic acid by light cycler using calibration curve of external target (standard) nucleic acid (gene) by conventional method

Except for using the probe of Mergney et al., Under the same conditions and under the same conditions as in Example 1, a nucleic acid extraction sample actually extracted from a soil sample was added to a target gene sample with a known concentration (hereinafter referred to as a soil extraction nucleic acid extraction sample). Were mixed at different concentrations to determine whether accurate quantification could be performed. The soil used was confirmed beforehand to be free of the Necl gene, which is the target gene. Also, the internal standard nucleic acid detection probe (NECMB-24 acceptor), the target nucleic acid probe (NECB-24 acceptor) and the Nec-donor were both added to the reaction tube, and the internal standard nucleic acid and target nucleic acid were simultaneously added, respectively. Detected.

First, 6.690,000 copies of the eel gene were added to 3 μl of a sample containing nucleic acid extracted from soil, and the necl gene was quantified. The necl gene was also quantified for a sample to which the same number of necl genes had been added without adding the soil-extracted nucleic acid sample. As a result, as in Example 1, it was clarified that the amplification with the addition of the nucleic acid sample extracted from the soil occurred later than the sample without the nucleic acid sample added with the soil. This result suggests that the nucleic acid sample extracted from soil contains a PCR inhibitor that reduces amplification efficiency. This delay caused the Ct value to increase, and as a result, the quantitative value was calculated to be low (see Table 5). From the above results, it is clear that the conventional method (real-time quantitative PCR method) using the calibration curve of the external target nucleic acid (gene) cannot accurately quantify the target gene for samples containing PCR inhibitors. It became.

4) Quantification of target nucleic acid by light cycler using the method of the present invention

The method of adding the internal standard nucleic acid of the present invention was performed using the probe of Mergney et al. And the copy number of the target nucleic acid before amplification was determined. Table 5 shows the differences in the measured values due to the differences in the methods. As a result, in the sample to which the nucleic acid sample extracted from soil was added, similar to the above-described conventional method (real-time quantitative PCR). A decrease in amplification efficiency (delay in amplification reaction) was observed, but amplification of the internal standard gene was observed. Efficiency also decreased, indicating that the measurements remained constant. From these results, the novel measurement method of the present invention for adding the internal standard nucleic acid and determining the concentration or the copy number of the target nucleic acid from the change amount or the change rate of the fluorescence intensity derived from the target nucleic acid and the internal standard nucleic acid is described by Mergney It was found that using these probes was effective.

The values for each method in Table 5 are the average values obtained by performing the analysis five times. Table 5 Target nucleic acids due to differences in methods

(Probe used: Mergney et al. Probe)

5) Measurement on actual soil samples

Based on the above experimental example, the copy number of the target gene (necl gene) was measured using a known amount of an internal standard nucleic acid for a soil sample whose copy number was unknown. The soil sample used was the one used in the measurement on the actual soil sample of Example 1 (67.5 copies per 11 soil extraction solution). The same as for the target gene (necl gene).

As in Example 1, about 66.9 copies of the internal standard nucleic acid were added to 1 μl and 2 / i 1 of the nucleic acid sample extracted from soil, and the target nucleic acid (gene) (necl gene) was measured. Was performed by the method of the present invention. As a result, 83.2 copies were measured in the system to which 1 μl of the nucleic acid sample extracted from soil was added. The measured value was almost the same as the measured value of Example 1 (6.7.5 copies). The measured value of the system to which 2 μl of the nucleic acid sample extracted from soil was added was 152.7 copies. Since the measured value was about twice that of the system to which the soil-extracted nucleic acid sample was added in 1 // 1, it was judged that the target gene (necl gene) in the soil-extracted nucleic acid sample could be measured almost accurately. Is done. These results strongly suggest that the target gene in soil can be measured accurately even using the probe of Mergney et al.

Example 3

The same study as in Examples 1 and 2 was performed using a molecular beacon probe (described in (3) of the above-mentioned known invention method).

1) Probe synthesis

The probe used was synthesized by Espec Origo Service Co., Ltd. (http: @ww. Busine ss-zone, cora / espec-oligo /).

2) Target nucleic acid probe and internal standard nucleic acid probe

The nucleotide sequence of NECB-24 beacon shown in Table 6 is the nucleotide sequence of the target nucleic acid probe, and the nucleotide sequence of NECM0-24 beacon is that of the internal standard nucleic acid probe. NECB-24 beacon has four bases added to form a stem 'loop structure.The 5' end is a fluorescent dye called FAM, and the 3 'end is a quencher substance called DABCYL. Been I have. NECMB-24 beacon also has 4 bases added to form a stem 'norepe structure, the 5' end is a fluorescent dye called 6-TAMRA, and the 3 'end is a quencher substance called DABCYL. It is labeled.

The probe sequence is as shown in Table 6. Table 6 Molecular beacon distribution! 1

(Base sequence with artificial addition of base sequence with a line)

3) PCR was performed under the same conditions as in Example 2, except for the conditions described below. 'Each probe addition concentration: 200nM

• Measuring device: Smart Cycler System (Takara Bayo Co., Ltd.) (hereinafter referred to as “Smart Cycler” for convenience).

• Channel used:

Cyannone 1 (Ex, 450-495 nm; Em, 505-537 nm).

Channenore 3 (Ex, 527-555 nm; Em, 565-605 nm).

The fluorescence measurement of FAM labeled on NECB-24 beacon was performed on channel 1, and the fluorescence measurement of 6-TAMRA labeled on NECB-24 beacon was performed on channel 3 at the same time.

4) Extraction of DNA from soil

This was carried out in the same manner as in Example 1.

B) Experimental example 1) Evaluation of fabricated probe

A fluorescence intensity increase rate and a dissociation curve were prepared when the target nucleic acid probe (NECB-24 beacon) and the internal standard nucleic acid probe (NE CMB-24 beacon) were hybridized with the corresponding nucleic acid (target nucleic acid or internal standard nucleic acid). The same reaction buffer as that used in the PCR reaction was used as described above.

The results are shown in FIGS. 13 and 14. When perfectly complementary nucleic acid was added, the fluorescence intensity of both probes increased by about 2000%. When a nucleic acid having a mismatch was added, almost no increase in fluorescence intensity was observed for both probes. From these results, it was determined that both probes hardly hybridized with the mismatched nucleic acid (the target nucleic acid and the internal standard nucleic acid probe did not hybridize, and the internal standard nucleic acid and the target nucleic acid probe did not hybridize). Based on the above results, as in Example 1, detection of PCR amplification products was performed at 62 ° C. for both probes.

The relational expression between the increase rate of the fluorescence intensity derived from the target nucleic acid and the increase rate of the fluorescence intensity derived from the internal standard nucleic acid with respect to the concentration ratio of the target nucleic acid and the internal standard nucleic acid was determined in the same manner as in Example 2. The method for determining the concentration or copy number of the target nucleic acid in the unknown sample is also the same as in Example 2.

3) Comparison of the target nucleic acid measurement result by the conventional method using the calibration curve of the external standard gene and the target nucleic acid measurement result by the method of the present invention when Molecular beacon is used as a probe

The measurement was performed in the same manner as in Examples 1 and 2, except that the Molecular beacon probe was used. Under the same conditions as for the sample, the measurement results of the target nucleic acid by the conventional method using the calibration curve of the external standard gene and the measurement of the target nucleic acid by the method of the present invention. The results were compared with the results. As a result, a decrease in amplification efficiency (delay in the amplification reaction) was observed in the test sample to which the soil-extracted nucleic acid sample was added, as in Examples 1 and 2, but the added target nucleic acid (gene) was accurately measured. It was possible (see Table 7). From these results, it has been clarified that the novel measurement method of the present invention can be suitably performed even when molecular beacon is used as a probe. Table 7 Differences in quantitative values of target nucleic acids (genes) due to differences in methods

(Used probe: molecular beacon)

Example 4

This is an example in which the method using the nucleic acid probe having the characteristics (1) to (3) of i) to iv) of the method B of the present invention is applied.

1) Target nucleic acid and internal standard nucleic acid

It was the same as in Example 1.

2) Synthesis of target nucleic acid probe

The nucleotide sequence was the same as that of NECB-24 described in Example 1 (see Table 2). The fluorescent substance Texas Red (Texas Red) was labeled on the 5 'terminal cytidylic acid, and the quencher substance Dabcyl was labeled on the sixth thymine from the 5' terminal.

The synthesis of the nucleic acid probe was outsourced to SK Oligo Service. 3) Synthesis of internal standard nucleic acid probe

The nucleotide sequence was the same as that of NECMB-24 described in Example 1, and the fluorescent substance Alexa 594 was labeled on the 5'-terminal cytidylic acid, and the quencher substance Dabcyl was labeled on the sixth thymine from the 5'-terminal. The preparation was commissioned in the same manner as the target nucleic acid probe.

4) Hybridization of target nucleic acid and target nucleic acid probe, and internal standard nucleic acid and internal standard nucleic acid probe

It was the same as in Example 1.

5) Measurement conditions

The excitation wavelength and the measured fluorescence wavelength are as follows.

• Target nucleic acid probe: excitation wavelength: 590 nm (4 rim width); measured fluorescence wavelength: 610 nra (4ηπιΦΙ) _D

• Internal standard nucleic acid probe: excitation wavelength: 560 nm (4 nra width); measured fluorescence wavelength: 580 nm (4 nm width).

6) Measurement of Target Gene (necl Gene) in Actual Soil Nucleic Acid Extraction Sample The target gene (necl gene) in the soil nucleic acid extraction sample was determined by the above-mentioned (1)-(1)-(i)-(iv) of Method B of the present invention. Using a nucleic acid probe having the characteristic of 3), a gene measurement method was performed by a PCR method in which an internal standard nucleic acid was added in the same manner as in Example 1 and measurement was performed. The PCR conditions and the like are the same as in Example 1. As a result, the target gene (η eel gene) contained in 1 μL of the soil nucleic acid extract sample was 63.2 copies, and the target gene (necl gene) contained in the soil nucleic acid extract sample 2 / L was 14.8. One copy. Since these measured values are almost equivalent to the results obtained in Examples 1 to 3, the nucleic acid probes having the characteristics (1) to (3) of i) to iv) of the method B of the present invention are used. It was also shown that the novel measurement method of the present invention can be suitably implemented. As described above, in Examples 1 to 4, a common target gene (necl gene) was measured by a similar method (a method of adding an internal standard nucleic acid) using different types of nucleic acid probes. As a result, almost the same good results were obtained. It has become clear that any probe capable of real-time monitoring of the gene amplification process can be applied to the novel measurement method of the present invention regardless of the type of probe.

Example 5

Nucleic acid amplification of target nucleic acid by performing real-time quantitative PCR using the hairpin probe described in V) to ix) as a primer (sunrise primer) when utilizing the FRET phenomenon of the known method This is an example in which the method of the present invention is applied to the method for determining the number of copies in the preceding step.

1) Base sequence of target nucleic acid

Necl gene used in Examples 1-3

2) Internal standard nucleic acid base sequence

Internal standard gene corresponding to the Necl gene used in Examples 1-3

3) Primer

(1) Forward primer for target nucleic acid detection

• Nucleotide sequence: CTCCATGAACTGTACCGCGACCAG (underline: added sequence)

· The 5 'end was labeled with the donor dye FAM, and the 12th base T from the 3' end was labeled with the quencher monodye DABCYL.

(2) Forward primer for internal standard nucleic acid detection

• Nucleotide sequence: agcttt, CTCCATGAAagcTtCCGCGACCAG (underline: added sequence, lowercase letter: site whose sequence is different from the target nucleic acid detection foreprimer. That is, site where the target nucleic acid differs from the internal standard nucleic acid sequence) -The 5 'terminal phosphorus group was labeled with the donor dye 6—TAMRA, and the 12th base T from the 3' terminal was labeled with the quencher monodye DABCYL in the same manner as described above. (3) Reverse primer

• Nucleotide sequence: f (NECS-R) in Table 1 above

The forward primer (forward primer for detecting a target nucleic acid and forward primer for detecting an internal standard nucleic acid) is designed to function as a sunrise primer, and is designed to function as a secondary primer in the primer by gene amplification. It is designed to emit fluorescence by eliminating the structure. Therefore, real-time monitoring of the amplification product is possible by measuring this fluorescence emission. Further, each forward primer is designed to recognize sites having different base sequences between the internal standard gene and the target gene, and to specifically bind and extend each of them. Therefore, each forward primer (forward primer for detecting a target nucleic acid and forward primer for detecting an internal standard nucleic acid) can specifically amplify the target nucleic acid or the internal standard nucleic acid. In addition, since the forma primer for detecting a target nucleic acid and the forma primer for detecting an internal standard nucleic acid are labeled with different fluorescent dyes, amplification products derived from the target nucleic acid and amplification products derived from the internal standard nucleic acid are used. Can be detected simultaneously in the same reaction system.

The primer was synthesized with ESPEC ORIGO SERVICE CO., LTD. (Http: //www.business-zone, com / espec-oligo /).

4) PCR was performed under the following conditions.

-Denaturation reaction: 95 ° C, 15sec

• Annealing and detection: 55 ° C, 5se _C

"Extension: 72 ° C, lOsec ■ Taq polymerase: Gene Taq (Nippon Gene Co., Ltd.)

-Primer addition concentration: {η}

• Type I nucleic acid (Template): A mixture of the internal standard nucleic acid NECM1 and the target nucleic acid NEC1 PCR fragment (PCR amplification product of a and b pramers: about 700 bp)

-Measuring device: Smart cycler system (Takara Bayo Co., Ltd.) • Channel used:

Channel 1 (Ex, 450-495 nm; Em, 505-537 nm).

Channel 3 (Ex, 527-555 nm; Em, 565-605 nm).

FAM labeled on the forma primer for detecting a target nucleic acid was measured in channel 1, and at the same time, fluorescence of 6-TAMRA labeled on a forma primer for detecting an internal standard nucleic acid was measured in channel 3.

5) Formulating the relational expression between the increase rate of the fluorescence intensity derived from the target nucleic acid and the increase rate of the fluorescence intensity derived from the internal standard nucleic acid with respect to the concentration ratio of the target nucleic acid and the internal standard nucleic acid

PCR was performed under the reaction conditions described in Example 2-4) above, with the concentration ratio of the target nucleic acid and the internal standard nucleic acid varied as various types, and amplification was performed based on the target nucleic acid. The product and the amplification product derived from the internal standard nucleic acid were each monitored in real time. The results show that the rate of increase in fluorescence intensity from the amplification product of the target nucleic acid (NECB-24 acceptor probe) and the rate of increase in fluorescence intensity from the amplification product of the internal standard nucleic acid (NEMB-24 acceptor probe). The ratio between the target nucleic acid and the internal standard nucleic acid before PCR was determined (see Figure 15). As a result, there is a high correlation between the concentration ratio of the target nucleic acid and the internal standard nucleic acid before PCR, and the ratio between the increase rate of the fluorescence intensity derived from the amplification product of the target nucleic acid and the fluorescence intensity derived from the amplification product of the internal standard nucleic acid. It became clear that there was. Therefore, the relational expression From this, it was shown that the concentration ratio between the target nucleic acid before PCR and the internal target nucleic acid can be known. From the above results, in the method using the sunrise primer, as in Examples 2 and 3, the rate of increase in the fluorescence intensity derived from the amplification product of the target nucleic acid and the increase in the fluorescence intensity derived from the amplification product of the internal standard nucleic acid were obtained. From the ratio with the ratio, it became clear that the concentration ratio between the target nucleic acid before PCR and the internal standard nucleic acid can be determined.

4) Measurement of target nucleic acid by smart cycler using calibration curve of conventional method

A nucleic acid extract sample actually extracted from a soil sample was mixed with a target gene sample of known concentration at different concentrations, and it was examined whether accurate measurement could be performed. Both the primer for the internal standard nucleic acid and the primer for the target nucleic acid were added to the reaction tube, and the internal standard nucleic acid and the target nucleic acid were simultaneously detected, respectively.

First, a calibration curve was prepared using a known concentration of an external target gene (necl gene). A sample obtained by adding 6,690,000 copies of the target gene (necl gene) to 3 μl of a sample containing nucleic acid extracted from soil was designated as type I. The necl gene in this sample was measured as described above. This was performed using a calibration curve. The necl gene was also measured for a sample to which the same number of necl genes had been added without adding the soil-extracted nucleic acid sample. As a result, as in the case of Examples 1 to 3, the addition of the soil-extracted nucleic acid sample shifts the graph to the right compared to the sample without the soil-extracted nucleic acid sample, that is, the amplification reaction. Was found to occur late. This delay increased the Ct value, and as a result, the measured value was found to be calculated lower than the actually added target nucleic acid (gene) (necl gene) (see Table 8). Based on the above results, the conventional method using a calibration curve with an external target nucleic acid (gene) (real-time The quantitative PCR method) revealed that even when sunrise primers were used, it was not possible to accurately measure target genes in samples containing PCR inhibitors. Table 8 Differences in measured values of target nucleic acids (genes) due to differences in methods

(Used primer: Sunrise primer)

5) Measurement of target nucleic acid by smart cycler using the method of the present invention The number of copies of the target nucleic acid before amplification was determined by the method of adding the internal standard nucleic acid of the present invention (see Table 8). As a result, the graph shifts to the right as the amount of soil sample to be added increases, as described above. However, in the present invention, a decrease in amplification efficiency (a delay in amplification reaction) was observed. However, since the amplification of the internal standard gene was similarly reduced, it became clear that the amount of the added target gene almost coincided with the value measured by the method of the present invention.

Based on the above results, the internal standard nucleic acid corresponding to the target nucleic acid was added to the reaction system, and the amount or rate of change in the fluorescence intensity derived from the target nucleic acid and the internal standard nucleic acid was determined using a sunrise primer. The usefulness of the novel measurement method of the present invention for determining the copy number has been clarified.

In addition, the same examination as in the above (Example) was carried out, and when a nucleic acid probe whose fluorescence was reduced by hybridization as described in the method (iX) of the present invention was used as a primer, the same as above was used. The result showing the trend Obtained (data not shown). These results revealed that any primer capable of real-time monitoring of the gene amplification process can be applied to the novel measurement method of the present invention regardless of the type of primer. Example 6

The same examinations as in Examples 1 to 4 were performed by changing the gene amplification method from the PCR method to the LAMP (Loop-Mediated Isothermal Amplification) method (one nucleic acid amplification method).

1) Target gene

As in Examples 1 to 5, the necl gene was used.

2) Extraction of DNA from soil

This was carried out in the same manner as in Example 1.

3) Probe synthesis

Probes and primers were manufactured by Espec Oligo Service Co., Ltd. (htp: // www. Business-zone, com / espec-oligo /).

4) Preparation of internal standard nucleic acid (DNA gene)

Example 8 was prepared by an artificial gene acquisition method described later.

5) LAMP primer design and sequence

Primers were designed using the primer design software for the LAMP method on the website of Eiken Chemical Co., Ltd. (http://www.eiken.co.jp/). This primer has a sequence completely complementary to the target nucleic acid and the internal standard nucleic acid, and is a primer capable of simultaneously amplifying the target nucleic acid and the internal standard nucleic acid. Table 9 Probe sequence for detecting LAMP amplification products

6) Target nucleic acid probe and internal standard nucleic acid probe

NECB-23 LAMP shown in Table 9 is a nucleotide sequence of a probe for detecting an amplification product derived from a target nucleic acid amplified by the LAMP method.NEMB-23 LAMP is derived from an internal standard amplified by LAMP. This is a nucleic acid probe for detecting the amplification product. In this example, the target nucleic acid probe is called NECB-24 and the internal standard nucleic acid probe is called NECMB-24.

NECB-24 is labeled at the 5 ′ end with BODIPY FL by the method described above, and NECMB-24 is labeled at the 5 ′ end with 6-TAMRA by the method described above. In both cases, the 3'OH group at the 3 'end was phosphorylated and used.

This probe is the type of nucleic acid probe used in Example 1 that reduces the fluorescence intensity by hybridizing with the corresponding nucleic acid.

In the table, the 9th, 10th, 11th, 12th and 14th bases t, a, c and t of NECB-23 LAMP are changed to A, T, G and A respectively in NECMB-23 LAMP. It is a thing.

B) Experimental example

1) Evaluation of fabricated probe

Fluorescence intensity change rate (quenching (decrease rate) rate) when the target nucleic acid probe (NECB-23 LAMP) and internal standard nucleic acid probe (NECM B-23 LAMP) are hybridized with the corresponding nucleic acid (target nucleic acid or internal standard nucleic acid) And create a dissociation curve Was. The same reaction buffer as that used in the LAMP method was used. The results are shown in FIGS. 16 and 17. For NECB-23 LAMP, the difference in Tm value between the target nucleic acid and the internal standard nucleic acid is about 20 ° C or more, and if it is detected in the range of 60 to 70 ° C, the internal standard nucleic acid will not be detected. It was clarified that only the target nucleic acid was successfully detected. Similarly, in the case of NECMB-23 LAMP, the difference in Tm between the internal standard nucleic acid and the target nucleic acid is about 20 ° C slightly higher than that of the NECB-23 LAMP, and is within the range of 60 to 70 ° C. It has been clarified that the detection can detect only the target nucleic acid without detecting the target nucleic acid. Based on the above results, detection of PCR amplification products was performed at 65 ° C, the reaction temperature of the LAMP method, for both probes.

2) Gene amplification by the LAMP method was performed under the following conditions.

■ Reaction temperature: 65 ° C, 60min

Amplification kit containing polymerase, dNTP, etc .: Loopamp DNA amplification reagent kit (Eiken Chemical Co., Ltd.)

· Primer addition concentration: 800 nM (NEC FIP, NEC BIP), 200 nM (NEC F3, NEC B3) (See Table 10)

■ Probe addition concentration: 200nM each

-铸 nucleic acid (Template): mixture of internal standard nucleic acid NECM1 and target nucleic acid NEC1 PCR fragment (PCR amplification product: about 700 bp with a and b primers in Table 1)

■ Measuring device: Smart Cycler System (Takara Bio Inc.) (hereinafter referred to as “Smart Cycler” for convenience).

• Use channel:

Cyanenne 1 (Ex, 450-495 nm; Em, 505-537 mn).

Channel 3 (Ex, 527-555 nm; Em, 565-605 nm). The measurement of BODIPY FL was performed on channel 1 and the fluorescence measurement of 6-TAMRA was performed on channel 3 at the same time. Table 10 Primer sequences for detection of 10 L AMP amplification products

Probe sequence (5'-3,)

NEC F3 CTGCTGTGGGGTATTGCG

NEC FIP CGGCCCGTCATCGAAATTCACTACACGAATTACCAGTGTGCG

NEC B3 GTTTCATTCGGGTGATTGGC

NEC BIP TGACCTCCATGAACTGTACCGCCTCCCGAGAATGCGAAAGG

3) Formulating the relational expression between the increase rate of the fluorescence intensity derived from the target nucleic acid and the increase rate of the fluorescence intensity derived from the internal nucleic acid with respect to the concentration ratio of the target nucleic acid and the internal standard nucleic acid

The LAMP reaction was carried out under the reaction conditions described in 2) above, with the concentration ratio of the target nucleic acid and the internal standard nucleic acid varied as various types, and the amplification product derived from the target nucleic acid and the internal The amplification products derived from the standard nucleic acids were monitored in real time with the nucleic acid probes shown in Table 10 respectively. Based on the results, the fluorescence intensity change {quenching (decrease) rate} (hereinafter simply referred to as the fluorescence quenching rate) derived from the amplification product of the target nucleic acid (NECB-23 LAMP fluorescence quenching rate) and the internal standard nucleic acid amplification product The ratio with the fluorescence quenching rate of the origin (the fluorescence quenching rate of NECMB-23 LAMP) was determined, and the relationship between the ratio and the concentration ratio of the target nucleic acid and the internal standard nucleic acid before the LAMP reaction was determined. As a result, similar to the PCR shown in Examples 2 to 4, the concentration ratio between the target nucleic acid and the internal standard nucleic acid before amplification, the fluorescence quenching rate derived from the amplification product of the target nucleic acid, and the amplification ratio derived from the amplification product of the internal standard nucleic acid A high correlation was observed between the ratio to the fluorescence quenching rate (data not shown). Therefore, in the case of the PCR method Similarly to this, it was shown from this relational equation that the concentration ratio between the target nucleic acid before gene amplification and the internal standard nucleic acid can be known.

4) Measurement of target gene (necl gene) in soil by LAMP method

Based on the experimental examples described above, a soil-extracted nucleic acid sample whose target gene (necl gene) copy number is unknown using the internal standard nucleic acid and the novel gene measurement method of the present invention via the LAMP method. The amount of target nucleic acid present in the sample was measured.

In the experiment, similar to the PCR-based method in Examples 1 to 5, about 66.9 copies of the internal standard nucleic acid were added to the soil extraction nucleic acid samples (μμΐ and 2μ1) and the target gene (Necl gene) was measured by a gene measurement method via the LAMP method. The same nucleic acid sample as in Examples 1 to 5 was used as the nucleic acid sample for soil extraction. As a result, it was measured as 79.6 copies in the system to which 11 nucleic acid samples were added. The measured value of the system to which 2 μl of the nucleic acid sample extracted from soil was added was 13.9.2 copies. Since the measured values are almost the same as the results obtained in Examples 1 to 5, it is judged that the target gene (necl gene) in the nucleic acid sample extracted from soil can be accurately measured.

Based on the above results, the novel nucleic acid (gene) measurement method of the present invention, which comprises adding an internal standard nucleic acid and detecting the target nucleic acid and the internal standard nucleic acid with a nucleic acid probe, includes a gene amplification method other than the PCR method. The power is proven to be adaptable.

Example 7

If it was necessary to separate and concentrate necl gene from the kenom DNA power of Streotorayces turgidiscabies, it was separated and concentrated by the following methods. The restriction enzymes used were Bfal, BsaJl, BssKl, Ddel, Msel, and Mspl (all purchased from New England BIOLABS Power). These are double-stranded D Because it is a restriction enzyme that recognizes and cuts a specific 4-base sequence of NA, double-stranded DNA is considered to be cut to a length of about 40 bases on a probability basis (arbitrary 4-base sequence). Since there are 256 sequences, the site that is cleaved by one type of restriction enzyme that recognizes four bases is thought to appear every 256 bases. , 256 = 62.6, which is considered to be cleaved on average about every 40 bases.) However, the necl gene is treated with the above-mentioned six types of restriction enzymes, so that the necl gene has a length of 536 bases and exists as a relatively long double-stranded DNA. Therefore, the fraction containing the target gene can be easily collected using the length of the DNA as an index.

1 μl of each of the above six restriction enzymes, 101 of xlO buffer attached to Msel, and a nucleic acid solution (80 μl) extracted from soil in which potato scab had developed in the same manner as in Example 1 above. ) Were mixed and reacted at 37 ° C. for 8 hours, and further reacted at 60 ° C. for 8 hours. necl The fraction containing this fragment was passed through a filter {microcon 100 (divided molecular weight = 100,000), Millipore}. Since only DNA less than 100 bp passes through this filter, the 536 base necl gene remains on the filter. The fraction containing the necl gene remaining on the necl filter was collected, dried, and then redissolved in 1/21 pure Millipore water.

The necl gene during the redissolution was measured in the same manner as in Experimental Example 7) of Example 1. Also, in order to confirm the presence or absence of concentration, the necl gene of the nucleic acid solution before the restriction enzyme treatment was measured in the same manner as described above. The added amount of the nucleic acid solution was set to {ΙμΙ}. As a result, the number of necl genes in the nucleic acid solution subjected to the concentration treatment was 470 copies Ζμ1, and the number of the genes in the nucleic acid solution without concentration was 63 copies 1. based on the above results, By this method, it was proved that the target nucleic acid (necl gene) can be easily concentrated.

Example 8

Synthesis of a long-chain artificial gene having an arbitrary nucleotide sequence was performed by the following method. 1) Synthesis of single-stranded oligonucleotide DNA

The single-stranded oligonucleotide gene to be synthesized was an internal standard gene corresponding to the necl gene used in Example 6. The sequence is shown below. The number of bases is 274 bp, and the part shown in lowercase letters and underline is a part different in sequence from the nec1 gene which is the target nucleic acid. The one-piece Origo Nuku Leotide DNA was commissioned to Espec Origo Service Co., Ltd. and synthesized.

The synthesized oligo DNA was subjected to electrophoresis, and it was confirmed whether a band derived from the desired single-stranded oligo DNA gene (274 bp) was obtained, but a clear band could be confirmed around 270 bp. Did not. In addition, the electrophoresis pattern was smeared as a whole, and no clear band was confirmed other than 270 bp. The above results are thought to suggest that single-stranded oligo DNAs of various lengths have been synthesized, and that the ratio of the target single-stranded oligo DNA genes is extremely low. From the above results, it was strongly suggested that it is impossible to obtain a long-chain gene having an arbitrary sequence by a conventional technique for synthesizing oligo DNA.

nec l mutant for LAMP:

5 'TTCACTGCTG TGGGGTATTG CGACACGAAT

TACCAGTGTG CGGGAGGTAG TGGCTCGtca

tTGCAGATGG TCAGTGAATT TCGATGACGG

GCCGACGGTA TCGACAATTG ACCTCCATGA ACTGTACCGC GACCAGAGCG ACACCATGTC

CTCCTTTCGC ATTCTCGGGA GTGTGATGTC GCGCGCCAAT CACCCGAATG AAACAGTCAC GATTCATCAG CAATTTTATC GAGACAATGG CGGGCAGGTG CCGCTCGGAG AGTACGAAAC ACGGT 3 '

2) —PCR reaction using the main chain oligonucleotide DNA as 铸 type

In order to obtain the target DNA, PCR amplification was performed using the single-stranded oligonucleotide DNA gene described above as type III. The sequences of the primers used are shown in Table 11. The conditions of PCR are as shown below.

■ Denaturation reaction: 95 ° C, 60sec

'' Annealing and detection: 62 ° C, 60sec

• extension: 72. C, 60sec

-Number of cycles: 40 cycles

• Taq polymerase: Gene Taq (Nippon Gene Co., Ltd.)

-Primer addition concentration: 500nM each

• PCR device: i Cycler (BioRad) Table 11 Primer sequences

After completion of the PCR reaction, electrophoresis was performed. However, no clear band was observed around 270 bp. Therefore, the obtained PCR product was diluted 100-fold, this was used as type 铸, and PCR was performed again under the same conditions. The product was confirmed by electrophoresis. As a result, a band was confirmed at around 270 bp. However, since the electrophoresis pattern was not clear and the whole was smeared, PCR was again performed using the PCR product diluted 100-fold as type I, and the product was confirmed by electrophoresis. A clear band was observed around 0 bp. In order to confirm that the desired product was actually obtained, the base sequence of the PCR product was determined. The steps are described below.

The PCR product was purified using a Microspin S-400HR column (Amersham Fanolemasa). The sequencing reaction was performed using a didoxy terminator / sequencing kit (manufactured by Applied Biosystems), and the obtained product was analyzed using an automatic base sequencer (AB I PRISM ™ 377, Applied Biosystems, Inc.). The base sequence was determined using Biosystems). As a result, it was confirmed that the PCR product had the sequence of the target internal standard gene.

From the above results, it was proved that a long-chain artificial gene having an arbitrary sequence can be easily synthesized by the method of the present invention.

Example 9

The type of dye to be labeled on the nucleic acid probe of the method B of the present invention was examined. A deoxyribopolynucleotide having the following base sequence was used as a nucleic acid probe, and a deoxyribopolynucleotide having the following base sequence was used as a corresponding nucleic acid. Each deoxyribopolynucleotide was prepared using the nucleic acid synthesizer described above.

• For target nucleic acid probe: 5 'CCCCCCCCCTTTTTT3'

• For target nucleic acid: 5 'AAAAAAGGGGGGGGGGGG3'

In order to label the dye on the deoxyribopolynucleotide for the target nucleic acid probe, the same method as in Example 1 was used. The fluorescence measurement was performed under the following conditions.

(1) Components of the hybridization solution

Synthetic DNA 320 nM (final concentration)

Nucleic acid probe 80 nM (final concentration)

NaC 1 50 mM (final concentration)

M g C 1 ₂ ImM (final concentration)

Tris-HCl buffer (pH = 7.2) lOOraM (final concentration)

Milli Q pure water 1.6992ml

2. 0000ml

(2) Temperature of hybridization: 51 ° C

(3) Measurement conditions:

Excitation light: listed in Table 9

Fluorescent color measured: listed in Table 9

The results are shown in Table 9. As can be seen from the table, as the fluorescent dye used for reducing the fluorescent intensity of the fluorescent dye of the present invention, those which are also preferable in the above description include those having a reduction rate of the fluorescent intensity of 15% or more. Can be mentioned.

Example 10

Example applying the method of Morri son et al. (This is a method using two types of nucleic acid probes. Before the nucleic acid probes hybridize to the target nucleic acid, the probes are hybridized to each other. ).

1) Target nucleic acid and internal standard nucleic acid

It was the same as in Example 1.

2) Synthesis of target nucleic acid probe The target nucleic acid probe consists of the following two oligonucleotides.

a) 5'-TCCATGAACT GTACCGCGAC-CAG-3 '(base sequence of the target nucleic acid probe NECB-24 of Example 1 with the cytidylic acid at the 5' end removed)

b) 5'-TCGCGGTACA GTTCATGGA 1 3 '(above a) t

In a), a fluorescent substance 6-TAMRA was labeled on the O H group of the phosphate group at the 5 ′ end. In b), the quencher dye Dabcyl was labeled at the 3'-position C O H group of adenosine deoxyribose at the 3 'end.

3) Internal standard nucleic acid probe

Like the target nucleic acid, it is a probe used in the method of Morrison et al.

The following base sequence is composed of two oligonucleotides.

a) 5'-TCCATGAAAGCTTCCGCGACCAG-3 '(Target nucleic acid probe NE CMB-24 of Example 1 with the 5' end removed at the base)

b) 5, -TCGAA GTTCATGGA-1 '(above-mentioned a) [This / dibrita, is a base of the base (J) a) is labeled with a fluorescent substance FAM at the OH group of the phosphate group at the 5' end. did. In b), the quencher dye Dabcyl was labeled at the 3'-position C O H group of adenosine deoxyribose at the 3 'end.

4) Preparation method of target nucleic acid probe and internal target nucleic acid probe

Performed in the same manner as in Example 4.

5) Hybridization conditions for target nucleic acid and target nucleic acid probe, and internal standard nucleic acid and internal standard nucleic acid probe:

The procedure was the same as in Example 4.

6) Measurement conditions The excitation wavelength and the measured fluorescence wavelength are as follows.

-Target nucleic acid probe: excitation wavelength: 527-555 nm; measured fluorescence wavelength: 565-605 nm ₀

• Internal standard nucleic acid probe: excitation wavelength: 450 to 495 nm; measured fluorescence wavelength: 505 to 537 ntn.

7) Fluorescence intensity measurement of the hybridization reaction in a measurement system that does not contain a soil sample (inhibitor of the hybridization reaction)

The concentration of the target nucleic acid and the internal standard nucleic acid were variously changed, and the amount of change in the fluorescence intensity before and after hybridization was measured to prepare a calibration curve of the target nucleic acid and the internal standard nucleic acid.

Target nucleic acid probe concentration: 500nM

Internal standard nucleic acid probe concentration: 500 nM

8) Soil sample

A soil containing no target nucleic acid was prepared in the same manner as in Example 1. The absence of the target nucleic acid was confirmed by the method of Example 1.

9) Target nucleic acid recovery test using a measurement system containing soil samples (inhibitors of hybridization reaction) Measurement of target nucleic acids

(1) 100 μL of a soil sample was added to 100 iL of the measuring system to make the measuring system complicated. Further, a target nucleic acid was added so as to be 2.5 × 10 ⁸ copies // 10 L. The fluorescence intensity was measured at various concentrations of the internal standard nucleic acid. As a result, a calibration curve for the internal standard nucleic acid was obtained. The rate of change for the calibration curve of the internal standard nucleic acid was calculated and applied to the target nucleic acid. As a result, a calibration curve for the target nucleic acid in a complex system was obtained (actually, the simplification method was used. The slope (slope) of the two calibration curves for the internal standard nucleic acid was determined, and the two calibration curves at the same concentration were determined. The difference was found and the internal standard core The slope of the calibration curve for the complex system for the acid and the difference between the two calibration curves at the same concentration were directly applied to the target nucleic acid. ).

(2) Copy number of target nucleic acid in soil sample.

The measurement result was 2.8 ^× 10 ^s copy Z 10 L, and the recovery rate of the target nucleic acid was 112%. Industrial applicability

Since the novel nucleic acid measurement method of the present invention is configured as described above, it contains a substance that inhibits a hybridization reaction and / or a nucleic acid amplification reaction between a target nucleic acid and a target nucleic acid probe, or contains a polymorphic nucleic acid. Even in a sample, the target nucleic acid can be specifically measured in a very small amount, accurately, simply, and in a short time. In addition, a plurality of target nucleic acids can be measured simultaneously.

Claims

The scope of the claims

: \ Ι, I A nucleic acid probe consisting of at least one kind of oligonucleotide labeled with at least one kind of fluorescent dye (hereinafter simply referred to as “nucleic acid probe”) that hybridizes to the corresponding nucleic acid (target nucleic acid). Changes the fluorescent character of the identified fluorescent dye, and measures the target nucleic acid using at least one kind of nucleic acid probe (hereinafter simply referred to as “method of measuring nucleic acid using nucleic acid probe”). )), The assay system contains at least one target nucleic acid and at least one known amount of an internal standard nucleic acid corresponding to the target nucleic acid, and is labeled with at least one fluorescent dye specific to the target nucleic acid. Nucleic acid probes consisting of oligonucleotides (hereinafter simply referred to as

It is called “target nucleic acid probe”. Or at least one nucleic acid probe (hereinafter simply referred to as "internal standard nucleic acid probe") consisting of an oligonucleotide labeled with at least one fluorescent dye specific to the internal standard nucleic acid. Alternatively, in a reaction system containing at least one target nucleic acid probe and at least one internal standard nucleic acid probe, a hybridization reaction and a Ζ or nucleic acid amplification reaction are carried out, and the target generated by the hybridization between the target nucleic acid probe and the target nucleic acid. The change or amount of change in the fluorescent character of the nucleic acid probe before and after hybridization, and the change in the fluorescent character of the internal standard nucleic acid probe caused by hybridization between the internal standard nucleic acid probe and the internal standard nucleic acid before and after hybridization. At least one type of change or change Measured at a constant wavelength, the amount of measured values and internal standard nucleic acid obtained, a new method of measuring nucleic acid and measuring the target nucleic acid and Ζ or nucleic acid amplification reaction prior to the target nucleic acid.

2. The novel nucleic acid measurement method according to claim 1, wherein the internal standard nucleic acid has at least one of the following characteristics. 1) The internal standard nucleic acid has a nucleotide sequence that can be distinguished from the target nucleic acid based on the change or the amount of change in the fluorescent character obtained by hybridization with the corresponding nucleic acid probe.

: '3, The novel nucleic acid measurement method according to claim 1 or 2, wherein the internal standard nucleic acid probe has at least one of the following characteristics.

3) The change or amount of change in the fluorescent character of the fluorescent dye labeled on the internal standard nucleic acid probe caused by the hybridization of the internal standard nucleic acid probe with the internal standard nucleic acid causes the target nucleic acid to hybridize to the target nucleic acid probe. Thus, the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe can be clearly distinguished. i | 4. '; each of the target nucleic acid probe and / or the internal standard nucleic acid probe is a single-stranded oligonucleotide that hybridizes to a corresponding nucleic acid, and is a kind of donor dye (including a reporter dye). ) And at least one nucleic acid probe which is labeled with one or one of the acceptor dyes (including quencher dyes or quencher substances). When the nucleic acid probe is hybridized to the corresponding nucleic acid, the target in which the donor dye and the acceptor dye are labeled on the oligonucleotide so that the change or the amount of change in the fluorescent character of the hybridization reaction system increases. The novel nucleic acid measurement method according to any one of claims 1 to 3, wherein the nucleic acid probe and / or the internal standard nucleic acid probe is used.

The novel nucleic acid measuring method according to claim 4, wherein the ^ _5ij target nucleic acid probe and Z or the internal standard nucleic acid probe have any one of the following forms.

1) In the form of a type of oligonucleotide labeled with a donor dye and an acceptor dye, by hybridization with the corresponding nucleic acid, the change or the amount of change in the fluorescent character of the donor dye before and after hybridization is positive. .

2) By hybridizing with the corresponding nucleic acid in the form of a type of oligonucleotide labeled with a donor dye and an acceptor dye, the change or the amount of change in the fluorescent character of the donor dye and the acceptor dye before and after hybridization is observed. Things that will be negative.

3) — A kind of donor probe consisting of one kind of oligonucleotide labeled with one kind of donor dye, and a kind of receptor consisting of one kind of oligonucleotide labeled with one kind of receptor dye The probe is a paired form of a probe, and the donor probe and / or the acceptor probe hybridize with the corresponding nucleic acid to change the fluorescent character of the donor dye and the acceptor dye before and after hybridization. Or, the amount of change is minus or plus. Γ (6. A form of an oligonucleotide in which the target nucleic acid probe and Z or the internal standard nucleic acid are labeled with a donor dye and an acceptor dye. By hybridizing with the corresponding nucleic acid, the change or the amount of change in the fluorescent character of the donor dye and the acceptor dye becomes negative before and after the hybridization, and at the end of the donor dye. Or, when the nucleic acid probe is hybridized to the corresponding nucleic acid at the end portion, the nucleotide sequence of the corresponding nucleic acid is separated by 1 to 3 bases from the terminal base of the corresponding nucleic acid hybridized to the probe. 5. The novel nucleic acid measurement method according to claim 4, wherein a target nucleic acid probe and / or an internal standard nucleic acid probe whose base sequence is designed such that at least one base of G (guanine) is present in the lobe.

17: I The target nucleic acid probe and / or internal standard nucleic acid is hybridized with the corresponding nucleic acid in the form of a kind of oligonucleotide labeled with a donor dye and an acceptor dye, thereby hybridizing. The change or the amount of change in the fluorescent character of the donor dye and the acceptor dye before and after the hybridization is negative, and when hybridization is performed with the corresponding nucleic acid, the change in the fluorescent label of the donor dye or the acceptor dye is caused by a change in the fluorescent dye. A target nucleic acid probe and / or a target nucleic acid probe whose base sequence is designed so that a plurality of base pairs of a boo nucleic acid hybrid form at least one pair of G (guanine) and C (cytosine). 5. The novel nucleic acid measurement method according to claim 4, wherein an internal standard nucleic acid probe is used.

8: The target nucleic acid probe and / or the internal standard nucleic acid probe is composed of a single-stranded oligonucleotide labeled with at least one kind of fluorescent dye, and has at least one of the following characteristics. The novel method for measuring a nucleic acid according to any one of claims 1 to 3, wherein a probe for which the probe is designed is used. 1) A function can be exhibited with a kind of probe in the reaction system or the measurement system.

2) When hybridized to a target nucleic acid and / or an internal standard nucleic acid, the fluorescent dye reduces the change or the amount of change of the fluorescent character in the absence of quencher dye and Z or quencher probe. To increase.

3) The probe is labeled at least with a fluorescent dye at its end.

4) When the nucleic acid probe is hybridized to the target nucleic acid, G (guanine) is separated from the dye-labeled base of the probe by one to three bases (the labeled base is counted as 1). There is at least one base.

5) When the nucleic acid probe hybridizes to the target nucleic acid at the end, at least one base pair of the probe-nucleic acid hybrid at the end is a G (guanine) and C (cytosine) primer. To form

! :: "9 ;. I The target nucleic acid probe and / or the internal standard nucleic acid probe according to claim 8 is a 3'-terminal hydroxyl group of a 3'-terminal report or deoxylipose, or a 3'- or 2'-terminal ribose. 9. The novel method for measuring a nucleic acid according to claim 8, wherein a target nucleic acid probe and / or an internal standard nucleic acid probe in which a hydroxyl group of carbon is phosphorylated is used.

The target nucleic acid probe and / or the internal standard nucleic acid probe according to claim 8, which is labeled and recognized by the fluorescent dye at a portion other than the 3′-terminal nucleotide, and wherein the nucleic acid probe is When the corresponding nucleic acid is hybridized, at least one base pair of the probe-nucleic acid hybrid in the modified portion is at least one G (guanine) and a pair of cytosine. 9. The novel method for measuring a nucleic acid according to claim 8, wherein a target nucleic acid probe and / or an internal standard nucleic acid probe forming one is used.

Γ —— 1 1,! An internal standard nucleic acid having a known concentration or a copy number with a target nucleic acid by a nucleic acid amplification method is used, or the target nucleic acid probe and Z or the internal standard nucleic acid probe according to any one of claims 2 to 10 are used or not used. The amplification product is further hybridized with the target nucleic acid probe and / or the internal standard nucleic acid probe according to any one of claims 2 to 10, and the reaction system before and after hybridization is amplified. A novel nucleic acid measurement method characterized by measuring a change or a change amount of a fluorescent character and measuring a concentration or a copy number of a target nucleic acid before amplification from the measured value and the concentration of an internal standard.

The target nucleic acid and the internal standard nucleic acid probe having a known concentration or copy number can be obtained by using the target nucleic acid probe and / or the internal standard nucleic acid probe according to any one of claims 2 to 10 according to the ί ′ 12 J nucleic acid amplification method. Fluorescence character or fluorescence of a reaction system in which the probe is decomposed and removed by a polymerase during a nucleic acid extension reaction during a nucleic acid amplification reaction of a standard nucleic acid, or a reaction system during a nucleic acid denaturing reaction or a nucleic acid denaturing reaction is completed The fluorescent character of the dye and the fluorescent character or the reaction character of the reaction system when the target nucleic acid or amplified target nucleic acid and the target nucleic acid probe and the internal standard nucleic acid or the amplified internal target nucleic acid and the internal standard nucleic acid probe are hybridized. The fluorescent character of the fluorescent dye is measured, and the reduction rate of the measurement value of the character from the former is calculated, and the reduction rate and the internal standard are calculated. A novel nucleic acid measurement method, comprising measuring the concentration or copy number of a target nucleic acid before amplification from the nucleic acid concentration or copy number.

——-3. According to any one of claims 2 to 10, depending on the method of amplifying nucleic acid. Using the described target nucleic acid probe and z or the internal standard nucleic acid probe as a primer, a nucleic acid amplification reaction of the target nucleic acid with a known concentration or copy number of the internal standard nucleic acid is performed, and the target nucleic acid or the amplified target nucleic acid and the target nucleic acid are amplified. Nucleic acid probe and internal standard nucleic acid or amplified internal target nucleic acid and fluorescent character of fluorescent dye or fluorescent dye of reaction system when internal standard nucleic acid probe is not hybridized, and target nucleic acid or amplified target nucleic acid and target nucleic acid The fluorescent character of the reaction system or the fluorescent character of the fluorescent dye is measured when the probe and the internal standard nucleic acid or the amplified internal target nucleic acid and the internal standard nucleic acid probe are hybridized, and the measured value of the character from the former is measured. And the concentration of the internal standard nucleic acid. New method for measuring nucleic acids from the copy number, and measuring the number of concentration or copy prior to amplification of the target nucleic acid.

:: 14l I The method of amplifying nucleic acid is PCR method, ICAN method,

The novel method for measuring a nucleic acid according to any one of claims 11 to 13, which is any one of a LAMP method, a NASBA method, an RCA method, a TAMA method, and an LCR method.

;: 15:.! 15. The method according to claim 14, wherein the PCR method is a quantitative PCR method or a real-time quantitative PCR method.

116 ′. において A method for analyzing data obtained by the nucleic acid measurement method according to any one of claims 1 to 15, wherein the target nucleic acid and the labeled nucleic acid probe, and / or the internal standard nucleic acid and the internal standard nucleic acid are used. A nucleic acid measurement method characterized in that the measured value of the fluorescent character of the reaction system when hybridized with the probe is corrected by the measured value of the fluorescent character of the reaction system when the hybridized product dissociates. Data analysis method for. ΐ1 7. The method for analyzing data obtained by the real-time quantitative PCR method according to claim 15, wherein the amplified target nucleic acid and the target nucleic acid probe, and Z or the amplified internal standard nucleic acid in each cycle are used. Computes the measured value of the fluorescent character of the reaction system when hybridized with the internal standard nucleic acid probe by the measured value of the fluorescent character of the reaction system when the hybridized product is dissociated in each cycle A data analysis method for a real-time quantitative PCR method, characterized by having a process (hereinafter, referred to as a “correction calculation process”).

UI The method or method for measuring nucleic acids according to any one of claims 1 to 10 and the method or the method for amplifying nucleic acids according to any one of claims 11 to 15 and claim 1 A method for analyzing, analyzing, or quantifying polymorphisms and / or mutations, characterized by analyzing, analyzing, or quantifying polymorphisms and / or mutations using the data analysis method described in 6 and 17.

-! 19: A method for measuring the nucleic acid according to any one of claims 1 to 10 or a method for amplifying the nucleic acid according to any one of claims 11 to 15 or Z And any of a FISH method, an LCR method, an SD method, and a TAS method, wherein nucleic acid is measured and Z or obtained data is analyzed using the data analysis method according to claims 16 and 17. One way.

\ 20! The internal standard nucleic acid according to claim 2, the target nucleic acid probe or the target nucleic acid primer according to at least one of claims 1 and 3 to 10, and the internal standard nucleic acid probe or the internal standard nucleic acid primer The target nucleic acid probe or the primer probe of the target nucleic acid is hybridized with the target nucleic acid and / or the internal standard nucleic acid probe or the primer probe of the internal standard nucleic acid. Or internal standard The method according to any one of claims 1 to 15, claim 18, or 19 can be performed by measuring the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the nucleic acid probe. A reaction liquid or a measurement kit characterized in that:

! 2 1;. Claims 1 and 3 to: A plurality of the target nucleic acid probes and Z or internal standard nuclear probes according to at least one of L 0 are bound to the surface of a solid support, and the target The target nucleic acid and / or the internal standard nucleic acid probe is hybridized with the internal standard nucleic acid by the nucleic acid probe, and the change or the amount of change in the fluorescent character of the fluorescent dye labeled on the target nucleic acid probe and the internal standard nucleic acid probe. 10. A device characterized in that the method according to any one of claims 1 to 10 and any one of claims 18 or 19 can be performed by measuring the device.

; 22;.] Comprising the internal standard nucleic acid according to claim 2; and using the device according to claim 21 to any of claims 1 to 10, claim 18, or 19 A reaction solution or a reagent kit, wherein the method according to item 1 can be performed.

: - ^"; in 2 3 ;. nucleic measuring device according to the target nucleic acid probes and or arranged in an array of internal standard probe to a solid support surface, the singular species bound or plural kinds of target nucleic acids, respectively 22. The devices according to claim 21, wherein a device (a DNA chip) that can be measured is used.

24 At least one temperature sensor and heater are installed on the target nucleic acid probe bound to the surface of the solid support, and a device (DNA chip) capable of controlling the temperature so that the nucleic acid probe binding region is at the optimal temperature condition. The devices according to claim 21 or 23, wherein A measurement apparatus for performing the method according to any one of claims 1 to 19.

26. The measuring device according to claim 25, wherein the measuring device is capable of measuring fluorescence while changing the temperature.

'27,7 A computer-readable recording medium, wherein a procedure for causing a computer to execute the data analysis method according to any one of claims 16 to 19 is recorded as a program.

__J28: The measurement device according to claim 25 or 26, wherein the computer-readable recording medium according to claim 27 is incorporated.

2/2 9 'Separate and collect only the nucleic acid fraction containing the target nucleobase sequence after cleaving all nucleic acids including the target nucleic acid with at least one restriction enzyme so as not to cleave the target nucleobase sequence region. Characteristic target nucleic acid separation and recovery / concentration methods.

/ 30, ./ Gene amplification using an artificially synthesized single-stranded oligonucleotide nucleic acid of 50 bp or more having an arbitrary sequence as a type A to obtain a double-stranded DNA having an arbitrary sequence. How to obtain the characteristic artificially synthesized gene.