WO2003083042A2 - Pathogen-induced promoters - Google Patents

Abstract

The present invention provides compositions comprising pathogen-induced promoters as well as methods of using such promoters to enhance pathogen resistance in plants.

Description

Pathogen-Induced Promoters

FIELD OF THE INVENTION

[01] This invention relates to plant molecular biology and, in particular, to pathogen-induced promoters and uses thereof.

BACKGROUND OF THE INVENTION

[02] Promoters regulate spatial, temporal and stimulus-based gene expression. For instance, plants have promoters that respond to light, high temperature, or pathogen challenge, as well as to many other stimuli. A promoter from one gene can be used to drive expression of a heterologous gene, thereby imparting altered regulatory specificity to the heterologous gene.

[03] Promoters that are highly specific for pathogenesis are needed to express gene products that counter pathogens. Moreover, there is a need in the art for specific promoters that are tightly regulated, thereby avoiding expression of toxic or • detrimental polypeptides when they are not needed. Furthermore, some pathogen-inducible promoters are specific for particular pathogens and therefore may not be induced in response to other pathogens. These and other advantages are provided by the present application.

BRIEF SUMMARY OF THE INVENTION

[04] This invention provides isolated nucleic acids comprising a polynucleotide that specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16. In some embodiments, the promoter hybridizes where the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS.

[05] The invention also provides expression cassettes comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16. In some embodiments, the promoter hybridizes where the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS. In some embodiments, expression ofthe heterologous polynucleotide in a plant enhances resistance ofthe plant to the pathogen.

[06] The present invention also provides plants comprising an expression cassette comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO.l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, In some embodiments, the promoter hybridizes where the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS. In some embodiments, expression of the heterologous polynucleotide enhances resistance ofthe plant to the pathogen.

[07] The present invention also provides methods of enhancing resistance of a plant to a pathogen. In some embodiments, the method comprises introducing into the plant an expression cassette comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 and wherein expression ofthe heterologous polynucleotide enhances resistance ofthe plant to the pathogen. In some embodiments, the promoter hybridizes where the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS. In some embodiments, expression ofthe heterologous polynucleotide in a plant enhances resistance of the plant to the pathogen. DEFINITIONS

[08] A polynucleotide "exogenous to" an individual plant is a polynucleotide which is introduced into the plant by any means other than by a sexual cross. Examples of means by which this can be accomplished are described below, and include Agrobacterium-mediated transformation, biolistic methods, electroporation, and the like. Such a plant containing the exogenous nucleic acid is referred to here as a Ti (e.g., in Arabidopsis by vacuum infiltration) or Ro (for plants regenerated from transformed cells in vitro) generation transgenic plant. Transgenic plants that arise from sexual cross or by selfing are descendants of such a plant. [09] An "expression cassette" refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of an RNA or polypeptide, respectively. Antisense or sense constructs that are not or cannot be translated are expressly included by this definition.

[10] A polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it originates from a different species, or, if from the same species, is modified from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is not naturally associated with the promoter (e.g. a genetically engineered coding sequence or an allele from a different ecotype or variety).

[11 ] The phrase "nucleic acid sequence" refers to a single or double- stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. It includes chromosomal DNA, self-replicating plasmids, and infectious polymers of DNA or RNA. In some embodiments, nucleic acids have fewer than 50,000; 40,000; 30,000; 20,000; 10,000; 5,000; or 2,500 nucleotides.

[12] An "operable linkage" is a linkage in which a promoter sequence or promoter control element is connected to a polynucleotide sequence (or sequences) in such a way as to place transcription ofthe polynucleotide sequence under the influence or control of the promoter or promoter control element. Two DNA sequences (such as a polynucleotide to be transcribed and a promoter sequence linked to the 5' end ofthe polynucleotide to be transcribed) are said to be operably linked if induction of promoter function results in the transcription of mRNA encoding the polynucleotide. [13] "Pathogens" include, but are not limited to, viruses, bacteria, nematodes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA) 1997).

[14] The term "plant" includes whole plants, shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissue (e.g. vascular tissue, ground tissue, and the like) and cells (e.g. guard cells, egg cells, trichomes and the like as well as undifferentiated cell cultures), and progeny of same. The class of plants that can be used in the method ofthe invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid and hemizygous. [15] The term "promoter" refers to sequences located upstream and/or downstream from the start of transcription that are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "pathogen-inducible" or "pathogen-induced" promoter refers to a promoter that drives increased transcription of an operably linked polynucleotide when a pathogen or pathogen elicitor (e.g., an avirulence gene product) is contacted to a tissue of a plant. Exemplary pathogen-induced promoters include those listed in SEQ ID NOs:l-16. In some embodiments, pathogen-inducible promoters are comprised of about 300, 500, 1,000 or 1,500 nucleotide subsequences of SEQ ID NOs:l-16. In some embodiments, exemplary pathogen-induced promoters consist of fewer than about 15,000 nucleotides, and preferably fewer than about 10,000, 6,000, 4,000, 2,000 or 1 ,000 nucleotides. In some embodiments, after contact of a pathogen to a plant tissue, transcription of the heterologous polynucleotide is increased in the plant or plant tissue at least about 1.5 times, and preferably at least about 2, 2.5, 3, 4, 5, 10, 25, 50, or 100 times the transcription that occurs in a plant or plant tissue not contacted by the pathogen. Those of skill in the art will recognize that the ability to induce promoter activity may depend on the particular plant and pathogen combinations. For example, in some cases, a promoter will only be induced if the pathogen carries an avirulence gene product that is recognized by a plant disease resistance gene. See, e.g., U.S. Patent Nos. 6,262,343; 5,571,706 and PCT WO 98/02545. [16] "Recombinant" refers to a human manipulated polynucleotide or a copy or complement of a human manipulated polynucleotide. For instance, a recombinant expression cassette comprising a promoter operably linked to a second polynucleotide may include a promoter that is heterologous to the second polynucleotide as the result of human manipulation (e.g., by methods described in Sambrook et al., Molecular Cloning - A

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (2001) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994- 1998)) of an isolated nucleic acid comprising the expression cassette. In another example, a recombinant expression cassette may comprise polynucleotides combined in such a way that the polynucleotides are extremely unlikely to be found in nature. For instance, human manipulated restriction sites or plasmid vector sequences may flank or separate the promoter from the second polynucleotide. One of skill will recognize that polynucleotides can be manipulated in many ways and are not limited to the examples above.

[17] In the case of both expression of transgenes and inhibition of endogenous genes (e.g., by antisense, or sense suppression), one of skill will recognize that the inserted polynucleotide sequence need not be identical, but may be only "substantially identical" to a sequence ofthe gene from which it was derived. As explained below, these substantially identical variants are specifically covered by the term "pathogen-induced promoter" or "heterologous polynucleotide". [18] In the case where the inserted polynucleotide sequence is transcribed and translated to produce a functional polypeptide, one of skill will recognize that because of codon degeneracy a number of polynucleotide sequences will encode the same polypeptide. These variants are specifically covered by reference to polynucleotides that encode particular polypeptides. [19] Two nucleic acid sequences or polypeptides are said to be "identical" if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties ofthe molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature ofthe substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of I and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).

[20] The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity. Alternatively, percent identity can be any integer from 25% to 100%. More preferred embodiments include at least: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity compared to a reference sequence (e.g., any of SEQ ID NOs: 1-16) using the programs described herein; preferably BLAST using standard parameters, as described below. [21] One of skill in the art will recognize that two polypeptides can also be

"substantially identical" if the two polypeptides are immunologically similar. Thus, overall protein structure may be similar while the primary structure ofthe two polypeptides display significant variation. Therefore a method to measure whether two polypeptides are substantially identical involves measuring the binding of monoclonal or polyclonal antibodies to each polypeptide. Two polypeptides are substantially identical if the antibodies specific for a first polypeptide bind to a second polypeptide with an affinity of at least one third ofthe affinity for the first polypeptide.

[22] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. [23] A "comparison window", as used herein, includes reference to a segment of any one ofthe number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, and sometimes from about 10 to about 100, in which a sequence may be compared to a reference sequence ofthe same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444

(1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection.

[24] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension ofthe word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11 , the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[25] The BLAST algorithm also performs a statistical analysis ofthe similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication ofthe probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison ofthe test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[26] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy ofthe genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any ofthe corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation ofthe nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.

[27] As to amino acid sequences, one of skill will recognize that individual substitutions, in a nucleic acid, peptide, polypeptide, or protein sequence which alter a single amino acid or a small percentage of amino acids in the encoded sequence creates a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art.

[28] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W) (see, e.g., Creighton, Proteins (1984)).

[29] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.

[30] The phrase "selectively (or specifically) hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA). [31] The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, highly stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. Low stringency conditions are generally selected to be about 15-30 °C below the Tm. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% ofthe probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% ofthe probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C or 65°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 time background hybridization. [32] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.

[33] In the present invention, genomic DNA or cDNA comprising nucleic acids ofthe invention can be identified in standard Southern blots under stringent conditions using the nucleic acid sequences disclosed here. For the purposes of this disclosure, suitable stringent conditions for such hybridizations are those which include a hybridization in a buffer of 50% formamide, 5x SSC, and 1 % SDS at 42°C, and at least one wash in 0.2X SSC and 0.1% SDS at a temperature of at least about 50°C, usually about 55°C to about 60°C or about 65 °C, for 20 minutes, or equivalent conditions. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. [34] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such case, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in IX SSC at 45°C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. [35] A further indication that two polynucleotides are substantially identical is if the reference sequence, amplified by a pair of oligonucleotide primers, can then be used as a probe under stringent hybridization conditions to isolate the test sequence from a cDNA or genomic library, or to identify the test sequence in, e.g., an RNA gel or DNA gel blot hybridization analysis.

DETAILED DESCRIPTION

[36] This invention provides pathogen-inducible promoters and methods of using the promoters to enhance pathogen resistance in plants. The present invention is based in part on the identification of genes whose expression is up-regulated during pathogen infection of plant tissue compared to uninfected tissue. The compositions and methods ofthe invention are useful for controlling and preventing infection caused by a variety of pathogens (e.g., bacteria, viruses, fungi, nematodes and insects) in any crop plant of interest. For example, the promoter sequences ofthe invention can be operably linked to polynucleotides encoding "resistance effector gene" (REG) products, as described below.

[37] REGs include any polynucleotide whose expression can bring about disease resistance. Genes such as those encoding transcription factors (TFs), inhibitors of apoptosis (IAPs), antimicrobial polypeptides, phytotoxic peptides and gene products that inhibit genes required for pathogenesis of disease symptoms can each be regulated using the pathogen inducible promoters. The expression of these or other potential REGs during the initial phases of pathogen attack provides a plant with an added weapon to fend off disease.

[38] Generally, the nomenclature and the laboratory procedures in recombinant DNA technology described below are those well known and commonly employed in the art. Standard techniques are used for cloning, DNA and RNA isolation, amplification and purification. Generally, enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like are performed according to the manufacturer's specifications. These techniques and various other techniques are generally performed according to Sambrook et al., Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (2001).

I. Isolation of pathogen-induced promoters

[39] The isolation of sequences ofthe invention, including pathogen- induced promoters, may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the sequences disclosed here can be used to identify the desired gene in a cDNA or genomic DNA library or desired promoter from a genomic DNA library from a desired species. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous coding sequences or promoters in the same plant species or orthologous coding sequences or promoters in or different plant species. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector.

[40] Once a promoter candidate is identified, the sequence can be analyzed to confirm its promoter activity and to identify the minimum region necessary to provide the desired promoter activity. This can be accomplished using deletion analysis ofthe 5' sequence linked to a promoterless reporter gene (e.g., GUS, GFP, luciferase, and the like) to identify those regions that can drive expression ofthe reporter gene under desired conditions, e.g. induction of expression in response to contact with a pathogen. [41] Sequences characteristic of promoter sequences can also be used to identify the promoter. Sequences controlling eukaryotic gene expression have been extensively studied. For instance, promoter sequence elements include the TATA box consensus sequence (TATAAT), which is usually 20 to 30 base pairs upstream ofthe transcription start site. In most instances the TATA box is required for accurate transcription initiation. In plants, further upstream from the TATA box, at positions -80 to -100, there is typically a promoter element with a series of adenines surrounding the trinucleotide G (or T) N G. J. Messing et al., in Genetic Engineering in Plants, pp. 221-227 (Kosage, Meredith and Hollaender, eds. 1983).

[42] Alternatively, a genomic library can be constructed in a vector such that the library DNA is linked a reporter gene (e.g., GFP, luciferase, β-glucuronidase, and the like.). Clones from this library can be screened by introducing the clones into cells of plant tissues (e.g., by biolistic methods or using Agrobacterium), exposing the transformed tissue to a pathogen, elicitor or other avirulence gene product and then examining the tissue for reporter gene expression. These screens can be carried out on pools of clones and can be carried out robotically, thereby allowing for large numbers of candidate sequences to be screened for reporter activity. Promoter sequences can then be identified by identifying the polynucleotide sequence upstream (i.e., 5') ofthe start of transcription.

[43] Alternatively, the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology to amplify the sequences ofthe genes directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone promoters and nucleic acid sequences that code for proteins, to make nucleic acids for use as probes for detecting the presence ofthe desired mRNA in samples, for nucleic acid sequencing, or for other purposes. [44] Appropriate primers and probes for amplifying pathogen-induced promoter sequences can be generated from comparisons ofthe sequences provided herein. For a general overview of PCR, see PCR Protocols: A Guide to Methods and Applications. (Innis, M, Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990). [45] Polynucleotides may also be synthesized by well-known techniques as described in the technical literature. See, e.g., Carruthers et al., Cold Spring Harbor Symp. Quant. Biol. 47:41 1-418 (1982), and Adams et al., J. Am. Chem. Soc. 105:661 (1983). Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

[46] Various methods relying on polymerase chain reaction (PCR) techniques to amplify the desired sequence can also be used. The amplified sequence is then subcloned into a vector where it is then sequenced using standard techniques. For example, PCR can be used to amplify a DNA sequence using a random 5' primer and a defined 3' primer. The 3' primer is based on the sequence of a cDNA isolated by differential screening or subtractive hybridization. The random 5' primer is then used to amplify genomic DNA upstream ofthe cDNA, to identify promoter sequences. Alternatively, genomic DNA can be cut at a suitable restriction site (determined from Southern blotting experiments) upstream from presumed promoter elements. A linker sequence is attached to the fragments and used as a specific 5' PCR priming site, along with the 3' primer based on the cDNA sequence.

IL Polypeptides that inhibit pathogen infection and/or inhibit plant disease symptoms

[47] Pathogen-induced promoter sequences, such as those described here, can be used in a variety of methods using recombinant DNA techniques for the control of pathogens in plants. For instance, the pathogen-induced promoters described herein can be used to drive expression of heterologous sequences (e.g., resistance effector genes) in plants cells. The heterologous sequences can be structural genes encoding polypeptides that inhibit pathogenesis or enhance plant resistance. Alternatively, the heterologous polynucleotides can be sequences that can be transcribed into RNAs capable of inhibiting the expression of genes required pathogenesis or genes that inhibit or down-regulate resistance responses. It is preferred, particularly where the plant is a food plant, that the heterologous sequences encode polypeptides non-toxic to animals, and particularly non-toxic to humans.

[48] Potential resistance effector genes ("REGs") to be put under the control of inducible promoters include, but are not be limited to, transcription factors (e.g., Riechmann, J. L. et al. Science 290: 2105-2110 (2000)), apoptosis inhibitory proteins (such as Bcl-2, Bcl-xl, CED-9 or op-IAP (see, e.g., Dickman, M. B. et al. Proc. Nat. Acad. Sci. 98:6957-6962 (2001)), anti-microbial proteins (e.g., such as cercropins, diptericin (see, e.g., Meister, M., et al. Curr Top Microbiol Immunol. 248: 17-36 (2000)), or synthetic peptides (e.g., Ali, et al. Mol Plant Microbe Interact. 13: 847-859 (2000)).

A. Phytotoxic polypeptides

[49] As noted above, the promoter can be used to drive expression of structural genes encoding polypeptides that inhibit pathogen infection or the disease symptoms caused by a pathogen. A variety of structural genes encoding protein or polypeptide products which inhibit infection can be used. Phytotoxic polypeptides used in

X the invention may either kill the plant cell in which they are expressed or simply disable the cell so that it is less capable of supporting the pathogen. Examples of suitable structural genes encoding phytotoxic polypeptides include genes encoding enzymes capable of degrading nucleic acids (e.g., nucleases, restriction endonucleases micrococcal nuclease, and ribonucleases such as RNAse A and barnase) and enzymes that degrade proteins (e.g., trypsin, pronase A, carboxypeptidase, endoproteinase Asp-N, endoproteinase Glu-C, and endoproteinase Lys-C). Other examples include toxins from plant pathogens (e.g., phaseolotoxin, tabtoxin, bacterio-opsin (see, e.g., Rizhskey, et al, Plant Mol Bio. 46(3):313- 323 (2001) and syringotoxin), Iipases from porcine pancrease and Candida cyclindracea, as well as membrane channel proteins such as glp F and connexins. [50] Structural genes, which specifically target nematodes or insects, include those encoding Bacillus thuringiensis toxins as described, for instance, in EP 517,367 Al and U.S. Patent Nos. 5,767,372 and 5,500,365. Other proteins include proteinase inhibitors such as cowpea trypsin inhibitor as described in WO 92/15690 or proteins which affect nematode sensory behavior such as miraculin. [51] Generally, resistance to any pathogen can be engineered according the methods described herein. Those of skill in the art will recognize that certain gene products are pathogen specific, while expression of other gene products result in preventing most or all pathogens from colonizing a plant. In some embodiments, it is particularly desirable to induce resistance to the following pathogens: Alternaria sp., Anguina sp., Armillaria sp., Belonolaimus sp., Blumeria sp., Botrytis sp., Cercospora sp., Cladosporium sp., Clavibacter sp., Cochliobolus sp., Colletotrichum sp., Cylindrocarpon sp., Ditylenchus sp., Daktulosphaira sp., Erwinia sp., Erysiphe sp., Fusarium sp., Gaeumannomyces sp., Globodera sp., Guignardia sp., Heterodera sp., Magnaporthe sp., Meloidogyne sp., Monilinia sp., Mycoplasmas, Mycosphaerella sp., Peronospora sp., Phaeoacremonium sp., Physopella sp., Phytophthora sp., plant viruses, Plasmopara sp., Pratylenchus sp., Pseudomonas sp., Puccinia sp., Pythium sp., Radopholus sp., Rotylenchulus sp., Sclerotinia sp., Septoria sp., Sphaerotheca sp., Spiroplasmas, Streptomyces sp., Trichodorus sp., Tylenchulus sp., Uncinula sp., Ustilago sp., Venturia sp., Verticillium sp., Xanthomonas sp., Xiphinema sp., and Xylella sp.

B. Polypeptides that induce native plant resistance

[52] In other embodiments, gene products involved in plant disease resistance are expressed under the control ofthe promoters of the invention. Those of skill in the art will recognize that a large number of components of plant disease resistance are known and can be linked to the promoters ofthe invention. For example, classical "gene-for- gene" resistance genes (see, e.g., Dangl, Nature. 411(6839):826-33 (2001); Staskawicz Science 292(5525):2285-9 (2001); Ellis, et al., Trends Plant Sci. 5(9):373-9 (2000)) can be linked to the promoters described herein. Exemplary resistance genes include those containing LRR, NBS or kinase motifs, e.g., Prf (see, e.g. , WO 98/02545), Pto (see, e.g. , Martin et al. (1993) Science 262: 1432-1436), Cf-9, Bs2 (see, e.g., U.S. Patent No. 6,262,343), and the like.

[53] In addition, gene products that are required for resistance to multiple avirulence determinants are also encompassed by the present invention. See, e.g., Dong, Curr Opin Plant Biol. 4(4):309-14 (2001). Examples include NPRl (see, e.g., U.S. Patent No. 6,091,004), NDR1 (see, e.g., U.S. Patent No. 6,166,295), EDS1 (see, e.g., Parker et al., Plant Cell 8:2033 (1996)) and the like.

C. Sequences which inhibit expression of pathogen-induced genes [54] Recombinant techniques can also be used to inhibit expression of particular genes which are required for development of disease symptoms or that inhibit plant resistance responses. For example, nematode feeding site cells require expression of certain genes for proper development. Alternatively, genes that suppress resistance responses, such as CPR (see, e.g., Bowling, et al., Plant Cell 6(12):1845-57 (1994)) and its orthologs, can also be inhibited according to the present methods. In these techniques, inhibitory RNAs

(i.e., those that inhibit the expression of target genes) are transcribed in target cell types (e.g., nematode feeding site cells or other cells infected by a pathogen). Promoters from pathogen- induced genes are preferably used to direct transcription of the inhibitory RNA sequences only in infected cells and thus prevent development ofthe pathogen. The inhibitory RNAs may function in antisense suppression, sense suppression or as ribzoymes.

[55] A number of methods can be used to inhibit gene expression in plants. For instance, antisense technology can be conveniently used. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed. The expression cassette is then transformed into plants and the antisense strand of RNA is produced. In plant cells, it has been suggested that antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the polypeptide of interest, see, e.g., Sheehy et al, Proc. Nat. Acad. Sci. USA, 85:8805-8809 (1988), and Hiatt et a/., U.S. Patent No. 4,801,340.

[56] The antisense nucleic acid sequence transformed into plants will be substantially identical to at least a portion of the endogenous gene or genes to be repressed. The sequence, however, does not have to be perfectly identical to inhibit expression. The vectors ofthe present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.

[57] For antisense suppression, the introduced sequence also need not be full length relative to either the primary transcription product or fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. Normally, a sequence of between about 30 or 40 nucleotides and about full length nucleotides should be used, though a sequence of at least about 100 nucleotides is preferred, a sequence of at least about 200 nucleotides is more preferred, and a sequence of at least about 500 nucleotides is especially preferred.

[58] Catalytic RNA molecules or ribozymes can also be used to inhibit expression of plant genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs.

[59] A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs that are capable of self-cleavage and replication in plants. The RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs). Examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, solanum nodiflorum mottle virus and subterranean clover mottle virus. The design and use of target RNA-specific ribozymes is described in Haseloff et al. Nature, 334:585-591 (1988).

[60] Another method of suppression is sense suppression. Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes. For an example ofthe use of this method to modulate expression of endogenous genes see, Napoli et al., The Plant Cell 2:279-289 (1990), and U.S. Patents Nos. 5,034,323, 5,231,020, and 5,283,184.

[61] Generally, where inhibition of expression is desired, some transcription ofthe introduced sequence occurs. The effect may occur where the introduced sequence contains no coding sequence per se, but only intron or untranslated sequences homologous to sequences present in the primary transcript ofthe endogenous sequence. The introduced sequence generally will be substantially identical to the endogenous sequence intended to be repressed. This minimal identity will typically be greater than about 65%, but a higher identity might exert a more effective repression of expression ofthe endogenous sequences. Substantially greater identity of more than about 80% is preferred, though about 95% to absolute identity would be most preferred. As with antisense regulation, the effect should apply to any other proteins within a similar family of genes exhibiting homology or substantial homology.

[62] One of skill in the art will recognize that using technology based on specific nucleotide sequences (e.g., antisense or sense suppression technology), families of homologous genes can be suppressed with a single sense or antisense transcript. For instance, if a sense or antisense transcript is designed to have a sequence that is conserved among a family of genes, then multiple members of a gene family can be suppressed. Conversely, if the goal is to only suppress one member of a homologous gene family, then the sense or antisense transcript should be targeted to sequences with the most variance between family members.

[63] Another means of inhibiting gene function in a plant is by creation of dominant negative mutations. In this approach, non-functional, mutant polypeptides, which retain the ability to interact with wild-type subunits of polypeptides to be targeted are introduced into a plant.

D. Two-component systems [64] In some embodiments, heterologous polynucleotides can be designed to encode polypeptides useful in a two component system where both components are required for a desired phenotype. For example, in some embodiments, cell lethality only occurs upon sufficient expression of both components. Exemplary two component systems include, e.g., barnase fragments or resistance gene product/avirulence gene product combinations. See, e.g., PCT WO 98/32325. However, any multiple component system that produces a desired phenotype upon expression of all components can be designed. See, e.g., U.S. Patent No. 5,866,776. In some cases, one component will be expressed by the pathogen or the plant prior to infection. For example, in cases where a pathogen already expresses a particular avirulence determinant, resistance can be induced by expressing the corresponding resistance gene under the control ofthe promoters ofthe invention. Similarly, in cases where the pathogen does not express an avirulence determinant recognized by the plant, an avirulence gene can be expressed from a promoter of the invention, thereby inducing a resistance response upon pathogen contact. Alternatively, each component can be expressed from a different pathogen-induced promoter ofthe invention , thereby increasing pathogen- specific lethality.

III. Construction of expression vectors

[65] The methods required for the recombinant expression of desired genes in transgenic plants are well known to those of skill in the art. Briefly, expression cassettes comprising a promoter from a pathogen-induced gene operably linked to desired sequence such as a structural gene encoding a desired protein is introduced into the plant. Construction of appropriate expression vectors is carried out using standard techniques.

[66] The recombinant vectors ofthe present invention typically comprise an expression cassette designed for initiating transcription ofthe desired polynucleotide sequences in plants. Companion sequences, of bacterial origin, can also be included to allow the vector to be cloned in a bacterial host. The vector will preferably contain a broad host range prokaryote origin of replication. A selectable marker should also be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers include resistance to antibiotics such as kanamycin or tetracycline. The selection of vectors and methods to construct them are commonly known to persons of ordinary skill in the art and are described in general technical references. See, in general, Methods in Enzymology Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press. [67] Other DNA sequences encoding additional functions may also be present in the vector, as is known in the art. For instance, in the case of plant transformations using Agrobacte um, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.

[68] For expression of polypeptides in plants, the recombinant expression cassette will contain, in addition to the desired polynucleotide sequence and the promoter derived from a pathogen-induced gene, a transcription initiation site (if the sequence to be transcribed lacks one), and a transcription termination sequence. Unique restriction enzyme sites at the 5' and 3' ends ofthe cassette are typically included to allow for easy insertion into a pre-existing vector. [69] The promoters can be modified as necessary to ensure that the desired polynucleotide sequence is expressed substantially only in response to pathogen infection. A number of methods can be used to identify those sequences within a given promoter that are responsible for a specific response to pathogen infection. As noted above, sequences shared by promoters of pathogen-induced genes can be used to design promoters with the desired specificity. Alternatively, a reporter gene (e.g., GUS) can be operably linked to various deletion mutants of he promoter sequence and the ability ofthe modified promoters to direct expression in infected cells and other tissues can be assayed.

[70] In the construction of heterologous promoter/structural gene combinations, the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

[71] As noted above, an expression cassette should also contain a transcription termination region downstream ofthe structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.

[72] If the mRNA encoded by the structural gene is to be efficiently translated, polyadenylation sequences are also commonly added to the vector construct. Alber and Kawasaki, Mol. and Appl. Genet, 1 :419-434, 1982. Polyadenylation sequences include, but are not limited to the Agrobacterium octopine synthase signal (Gielen et al., EMBO J, 3:835-846, 1984) or the nopaline synthase signal (Depicker et al., Mol. and Appl. Genet, 1 :561-573, 1982).

[73] The vector will also typically contain a selectable marker gene by which transformed plant cells can be identified in culture. Usually, the marker gene will encode antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin. After transforming the plant cells, those cells having the vector will be identified by their ability to grow in a medium containing the particular antibiotic.

IV. Plant Transformation

[74] DNA constructs ofthe invention may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA ofthe plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment.

[75] Microinjection techniques are known in the art and well described in the scientific and patent literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO. J. 3:2717-2722 ( 1984).

Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70-73 (1987).

[76] Alternatively, the DNA constructs may be combined with suitable T- DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion ofthe construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. Agrobacterium tumefaciens-mcdiated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example Horsch et αl. Science 233 :496-498 (1984), and Fraley et αl. Proc. Nαtl.

Acαd. Sci. USA 80:4803 (1983) and Gene Transfer to Plants, Potrykus, ed. (Springer- Verlag, Berlin 1995).

[77] Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype such as increased seed mass. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker that has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).

[78] The nucleic acids ofthe invention can be used to confer desired traits on essentially any plant. Thus, the invention has use over a broad range of plants, including species from the genera Anacardium, Arachis, Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine, Gossypium, Helianthus, Hemerocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannesetum, Persea, Phaseolus, Pistachio, Pisum, Pyrus, Prunus, Raphanus, Ricinus, Secale, Senecio, Sinapis, Solanum, Sorghum, Theobroma, Trigonella, Triticum, Vicia, Vitis, Vigna, and Zea. [79] One of skill will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

[80] Using known procedures one of skill can screen for plants of the invention by detecting the increase or decrease of mRNA or protein ofthe invention in transgenic plants. Means for detecting and quantitating mRNAs or proteins are well known in the art.

V. Methods of enhancing plant resistance to pathogens [81] The present invention provides for method of enhancing plant resistance to pathogens by modulating the expression and/or activity of polynucleotides and/or polypeptides involved in pathogen resistance or pathogenesis. For example, an expression cassette comprising the promoters described herein operably linked to a resistance effector polynucleotide can be introduced into a plant. [82] Plants with enhanced resistance can be selected in many ways. One of ordinary skill in the art will recognize that the following methods are but a few ofthe possibilities. One method of selecting plants with enhanced resistance is to determine resistance of a plant to a specific plant pathogen. Possible pathogens include, but are not limited to, viruses, bacteria, nematodes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA) (1988)). One of skill in the art will recognize that resistance responses of plants vary depending on many factors, including what pathogen or plant is used. Generally, enhanced resistance is measured by the reduction or elimination of disease symptoms when compared to a control plant. In some cases, however, enhanced resistance can also be measured by the production ofthe hypersensitive response (HR) ofthe plant (see, e.g., Staskawicz et al. Science 268(5211): 661-7 (1995)). Plants with enhanced resistance can produce an enhanced hypersensitive response relative to control plants.

[83] Enhanced resistance or decreased pathogenesis can be quantified as a change in symptoms for a given amount of pathogen inoculant. Preferably, disease symptoms are decreased at least 10%, 25%, 50%, 95% or 100% compared with a control (uninoculated) plant. Preferably, the amount of inoculant to produce a particular amount of symptoms in a plant of the invention is at least about 200%, 500% or 1000% the inoculant required to incur the same symptoms in a control plant.

EXAMPLES

[84] The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1: [85] This example shows the identification and cloning of a pathogen- inducible promoter.

[86] Pathogen inducible promoters were identified in an experiment where gene expression was monitored over the course of a Botrytis cinereα infection. Specifically, wild-type Col-0 Arαbidopsis thαliαnα plants were grown for eight weeks under short day conditions (8 hours light) with average evening and daytime temperatures of 17°C/27°C, respectively. Plants were grown in a room fitted with lighted growth racks and temperature control. Plants were sprayed with a B. cinereα spore suspension of 5x10³ spores/ml in potato dextrose broth (PDB), covered with clear plastic domes to retain high levels of humidity and moved to growth racks with reduced light intensity (ambient light). The domes were misted with water daily to maintain 90-100% humidity. Control plants were treated in the same way but were sprayed with a PDB suspension containing no inoculum. Tissue from 6-12 plants for each treatment (inoculated vs. uninoculated at each time point) was collected at 0, 0.5, 24, 48, 72 and 96 hours after inoculation and frozen in liquid nitrogen.

[87] Total RNA was isolated from the frozen plant tissue and processed for analysis with the Affymetrix GeneChip® Arabidopsis Genome Array as per the manufacturer's instructions (Affymetrix, Santa Clara, CA). The expression data for all chips were scaled to the same target intensity (2,500) for direct comparison. The data generated from the chip analysis software (Affymetrix Microarray Suite, v. 4.0) was imported into and^{^} analyzed with GeneSpring™ v. 4.0 (Silicon Genetics, Redwood City, CA). Using GeneSpring™, the signal value from each experimental chip was normalized to the appropriate control chip, thereby translating the results into comparisons of fold-change. The software was then used to find genes that had patterns of expression that indicated they were specifically induced in pathogen treatments, but not in control treatments.

[88] Once genes of interest were identified, the upstream ~3 kb of DNA sequence, containing the putative promoter, was isolated via PCR. For example, the P20 promoter showed a 3-fold increase over the control treatment and was isolated as follows: Genomic DNA from Col-0 Arabidopsis was used as a template for touchdown PCR amplification with Advantage HF DNA polymerase (Clontech). Primers used for amplification are shown below in Table 1. PCR products were directly cloned into the pCR2.1 vector from Invitrogen. Subsequently, the promoter was subcloned into the Notl/Sfil sites ofthe pDK7619 binary vector placing the cloned DNA sequence upstream of a GFP reporter molecule. This construct was transformed with Agrobacterium into Arabidopsis, and plants containing the promoter-GFP transgene were selected on half-strength MS media supplemented with 50 mg/ml kanamycin. See, e.g., Bent et al. Plant Physiology 124:1540- 1547 (2000).

Table 1. Primers used to amplify P20.

Promoter # Primer Sequence (upper case = added sequences such as (Affy ID#) restriction sites, lower case = genomic target sequence)

P20 (!D#l9892_at) 5'- GCATGCGGCCGCagccatagttcattcacacag-3 '

5'- GCATGGCCGCAGTGGCCtactataatcaattgttgtcacac -3' [89] Individual primary transformant plants are subjected to microscopic GFP analysis to confirm that the isolated promoter fragment is inducible by pathogen invasion. Leaves of young plants are inoculated with either Botrytis cinerea or Phytophthora capsici and then both inoculated and uninoculated tissue is examined for GFP expression to confirm pathogen-induced expression. These results will confirm that the promoter sequence was induced by pathogens.

Example 2:

[90] This example shows the identification and cloning of additional pathogen-inducible promoters.

[91] Using the PCR primers listed in Table 2, additional promoters are identified and cloned as in Example 1.

Table 2. Primers used to amplify additional pathogen-inducible promoters

Promoter # Primer Sequence (upper case = added sequences such as (Affy ID#) restriction sites, lower case = genomic target sequence)

P19 (14609_at) 5 '-GCATGCGGCCGCccaaggttagtgtaacagtcg-3 '

5 '-GCATGGCCGCAGTGGCCttcttgaatattgctcatgtaag-3 '

P23 (13680_at) 5 '- GCATGCGGCCGCtctagtacaattcgcataatgat-3 '

5 '- GCATGGCCGCAGTGGCCgggtgaagttgaagttttgatt-3 '

P24 (18508_at) 5 '-GCATGCGGCCGCtcttggcaattccataataagc-3 '

5 '-GCATGGCCGCAGTGGCCgtcttctttcaacttcgaacttt-3 '

P25 (12736_f_at) 5 '-GCATGCGGCCGCgccggagcatttggatcaaaa-3 '

5 '- GCATGGCCGCAGTGGCCttcttccttgtcaaaaactaatt-3 '

P26 (19182_at) 5 '- GCATGCGGCCGCcctctctttatctgaagcttct-3 '

5 '- GCATGGCCGCAGTGGCCgaccactaatataacgaaaggat-3 '

Example 3:

[92] This example shows additional pathogen-inducible promoters that have been identified.

[93] The primers listed in Table 3 were used to PCR-amplify additional promoters that were identified using the methods described in Example 1. These sequences are cloned into an Agrobacterium binary vector containing a promoterless GFP coding sequence and are characterized as in Example 1.

Table 3.

Promoter # Primer Sequence (upper case = added sequences such as (Affy ID#) restriction sites, lower case = genomic target sequence)

P29 (l3100_at) 5 '-GCATGCGGCCGCttgctagccggaacgttatagccaacacttgtcggg-3 '

[94] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope ofthe appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

SEQUENCE LISTING SEQ ID NO: 1

P19 (pDK8007) ccaaggttagtgtaacagtcgaatacttcattcaccaaatttcttagtaaatcttaaaacaactctactgttaaaacagaaaattttccaaatt gaataagtaaacgaataatcaaaattttcatttacaatttaaattaagattttttttttttgtagaatatatgaaaatacatgagctagctatttgta gttgtgaggaatttgagatttttgaagtttggctgactcattcaacaactaagtaacattatatcgggtcgcattcaacagctaagtaagacc ggccgggtaacttacttaacttcagtagtcgacactttgattattttaactaaagtaacttcgttgttgaatgggtaagtcaaacttccaaata aaagtcatcgtatgtttggaaaagtaaaagtcatcatatattctaaaaacataatatattaaaatcatattattatacggatacacgttttaggt cttttacaaaagaaaaccatctacatggcaaataatataattcaaagatgaatttggatcaaacacattttgaatcaaaagtgttaatttggtt tgttaatagacaaataagtcatataaccagcatgtaggacaggggttctcctagtattttacgttaaagggatattatgtgtttataaatgac acatatatatagtagttgtcacatttttttttctttgtgaattaataaccacgtgatgaattctattcatgagaatttctcagctacaaatgaatga cttaaaaatgtggctgcaacaatttaagaagatagattcattgcataaggagctatgtgagaaaaatcattaatagggaatcagtgagga caagataattggttgcacgcacttttacatagaaaagtcctggaagaaaaatcaaatgtttgacagaaataaaagattatttggggaaatg ttttatgaattgtgttggatcaggtccgtcatgccttattaattttttcggtggaaccaaaaaatcatacgatgccttcctgttctacacgagga ctggacaacacatgtcaatacacatctaaactataaaagaaaattttgacaaaatatatataatatactgtatatgaaaggcaaaacatagt tatctatataatattttttcaacccagtaggtcaaaatgtatttagatcaatttgatattcgtttatttaataatttttatctattaaattttttgataggt ctattcaaacaaaatttgattttaaatccgttttcaaaaacttttacaccgaatatttttatatttaaaatataaatatttctaaaatttggttaaaatt taaaactatgaatatacttgtttgatttttaaatattttaaatcatattgtaattttaaatattttaaaaacagacatatattactccgattaacaaaa aatatgtgggtttaatatcatatatataaagtaaaaaatttagacaattattcaaaatcatatcataattaatattaacattaataaaagaaataa gttttttaacgggacaaatttgacagaatattacttaataacaattgtaaattataaaatataaatagtttagaaaaaaatacaatttgcaaact tttatatatactaacttaaaaaaaaaatcgtttcacggtgtatcgcgggataaaatctagtttatccagtaaaatattgttagaattgcaaaaa aaaagttttttccaaattatttgcttctattatctttatgaaataatataaaaaatagtgaaacatttaagaatctgaaattagctttaattacaaa aactaacccttgttttcaaaaatttgaaaaaatacttttagtaagtaataagacaatacacatttgataaaatttgagaaatgcaattactaaat agacaatttttctgaaacgttatatattttagaataaaacaagcttattttaacggtaatatatgttaagatgtacacaagtcatggatatacat cgattttactttgaatccttctaagttcatcatcactagtcttacgaataaacttctatacatcactagatatacatacgacatggatatatatat caatattacgtatgcactcaaaacttctatatacccttaatacgtcacggcaatgtatgtaattctttcgaggtttgaaaaaaaaaaaaaaac tttattttattctttctcacttcaaacgtttgatgaatcacgtcgttctttttatatatatataagaaaacgtcgatcttaagacttatgtacgaatta tataacaaacttttgcaggatttactgagttaaagtagtttacactatatttacaaagattgttgtgacttctctgatatcaaattaaattaaagtt ataagtaactttttatgaaagagaataaaagcttacaacaagaaagtagctagcaaaactaattaaatttggctaataatagtttattattcat atcaatagttatttttcaactcttctttaacttgtataactattgatatttattagtataattattattcaatatttgaattctagttcttaaaaagaaag attacgtttaattccaaaaaataaatttaggatattacttttcttagtacacaaaatagaatcaaaaatataactactatcataggtcggctaaa atgatgttcgtggtcatagttaatggaagtgtttttttttggatatactatactgtgtatttttatgaagaaaaatcaatatataataacgacttaa aagaaaaaaaaacaagatatatttccaaaactaaccatataggatcggattattacttttcaaagtacacaaacaacgaataaaattgacg tcctgcactattgacagaaaacgatgggttccaaaactgtcgctaataaactcttccaattaaccctataaatagcatgcagaatatgagtt aaaaatcaccaatcaaacactttcttacatgagcaatattcaagaaatg

SEQ ID NO:2 P20 (pDK8008) agccatagttcattcacacagcaaaatataacatgatcagcaagtttacaaggcatgtcctactatcatcagttgtaacgaagtgaagatt ggatatgaacctacatgcatatagactatgctcttcatttgtgtacatgaggccgtgtgatagagagaagaattacttgatcatttggcgatt gttcttaatcactacttgcaacttcttttaccagctctgtgattgaatcaaaatgatgaagtcagagctaagtacaatataggctgtatagcat tggtatcatctatacttgtcaaaatcataccggcatttcttcaccagaaacaccgccaccagcatctctatttgatccatctccactctttcct gatcccttattatcaccctatcataatttcacaacaaaacgtaagaagccaatgggcaacactggaatggaatataaagtagaaataagt atgtggtttatttacctccaactgcatcagcaggtggtgtgtcagcaaccaatcccagggaatgaaaagaaccgaattagtctcaactta ataagaaacattttgattttattatgtatgttaacaacaaaagcacaaaagagagagtaataaatgtctttcaaaatttactaatatgcatcct gactgttggtctagatttatctttcttgcttcaaaaattctacacaagacgtattgaagggattgtaaaactgctatcatggcaagcttcgatg ttactcacagctactaatctcttgactaggatattaaggatttcagaacacatgattagggagtcaaagcaacatacctccctgtacctcgc taggtatatctttagaggttccaggtaatcctcaaatcctaatgttgccattgcccacaacaaatcatcaccattcacagttttccttttctcttt ttgacacttatcactggccctgattagcagaaacagataccagtcaattggccattacagtcaacgaatcaacataagaccagcaaaag agacttaagcgcaacatcagacaagcttatcttgaaccaatagataaatcatagtttcatacatgataacttatttcttcctaacaaagaacg ggggcatctgatgttataagaaacataaaactcatcaatcagagacctaaaacgcattcaacacaagcaattccttcatgatgaaaaaca tatcttttgccttaaatgaacaaaaaggaacaaaaacaaacagatcctaaagataaaagaatctttgaaacatgatcaagatacggctttt ataccctaagatggttaaatgaagaaaaaaatctaacaatttatttgacagagttaagatataacacagtagaagcatgtgaaataatctg caaaatggtctataggaaaggaactaggttaaggtaaacccataccaaacaatggttgattaacattgtgacaaaaaaaaaaacataat ctttgctctataaacttcaaaaaactctctgagctaaactcaatccatagctagtttaagaaaactatctctcacaaacccaaagttccaaca aatgatcaatttttttcaccaaagagcaaaatattttccaacaaattcgattgaaagaagaaaaattgggaatgcatactcgctagtgatga agctgatgaactcagagacgcattcctgaactgtatccttagcatcttttccaatcttaccattaggaggcaacgctttcttcatgatcctgc tgatattagctataggaaggtatcgatcctgctccctaacggaaccgccgctttctccgccatctccagctgggctcgaaggcgtatccg ccatttatactctacagaaacagaacaaacactcaatttgaaacctaaacatggtcgatgaagctaaagtaaacaacaaaaaaggaaat cgaaaatggcgtacagattggggaagatggaaaccctagaacttggaattggggatagtcgttttagttttagggctttagagaaatcga atttttctacgaaacgctgcgactggtgtttatatgatatgattacacgtttttttgtatttgttctgtattagcttttgtaaaagttttcagacaag gattaatttggtaattaattagacaatttaagaaaactatatgaacaatttgactaagggtgactttttcaatctattgtataataattagatgag aatttaaacataaattcatttaatttttcaatgaattatctacgtaaataaatcatagaaaattaagatactctaataacaataccaacgacaat gtggattcaaagtgcctaaagaacaaattcttttacttatgtaaaaaatcctaaactttaaagaacaaaaattaaaatacaaagataagtaat taacattttattgggcttctaactggatttggttctatttatttgggcctacgtttgaaaacctcggtcttaaagaatttgtgtccagctccagca caaggagaggcttatagaccatatgtcttttggtgtctgtttcaatgggcttacatgttttgttttcaggcggcctcgtcttcttgacacacac aagtttgtaacattgggcagtgtgaaacatacacaaaactaaacactaattaattctcaaccacaaatatttaagtgtgatggtgacttggt ctcatataatatgtgattttgtaattttgttcgaaacccgcatatagagttgttaccaattaatacctaaatctttattccggatacgtgcttttac caatcttaaacagaccaaaagaaaaactatgactaagttgaactgtatatacgtgttttaaactgtatatacatatcaaattgaatattaacta tatgacaagattatcaaacgggaacaaaaaaaaaactatatgactaagttgtgatgttgtttgtcaaattttatgtacgtcaacaattcaaca taattgacattatcgttgtttgtgtgtgtgacaacaattgattatagtatttttatacatg

SEQ ID NO:3 P23 (pDK8009) tctagtacaattcgcataatgataaaatatagaaaatccaatggtatatatgactggatctgtatcacaaataggttacatacaggttgtaaa ttaacgattacttacacaactttgccaaaatattctttaacaaaaaaaaaaaatcattgccaaaataatttccagagatttcattttcattcatta tgtgagtcaatacatcggtaagataatataaccaacgacagttgtggatgtacgtgtctataactataaccataagaaattagatgatttgc aatatctaaaattaaataaaatatatttgtccattagattctccctttagtaaacatatttaattaaaaactactttctcttgaaatatgttatcttaa ttttaaacatttttatttgcatgttcaaattgatcactataaataatccttaattagaccagttaaaaaaagatttatttatgtacaactttccgtctt tcccctaaaggttctgatgtttagttgacctggtcgagttgaccagacccaaatctccaggtcacgccaatcaccatcttgccttggccac gttaatttcacgtgtcactttttggctagccaattgttgaaaatagagatattcacctctatcaaaaactgttctttttattttttgggcaaaatca aaaactgttcaattttataaacttttgacatattgaattatagatatatacaataacagccgtaatattgttttaacaataacagtttgattagac atcgaaatcagaccgcgaattctcccaaaggacgtttaatttttttttgaaaaaatgacaatgatcatattcatccggagatcttggtgaaag tcatcgaagggatgctacaactatccccgaatgcatgcttgcagttccgtctaatattgaatgcatgcttggtgtaatttgttttttattcaaat ttgattcaatttagtttattttgactaaatgatttaagattatttccttgtagtctattctggctaacatatttgatgcattttcttatattgctacttgtt aattaattacataaagattaaggatgtattaattttaagattcatgagctgaaggagaacaaaaagagttactatgccatttgcgatattgat gatacttgcgcttctaccacgtcaaacaagaacgctgaatactaatgcgaccgcagcgggaagatgatggcagtggccatgcccatg atggtgatccacatcaagattttagatttatatttctatatatatttttaactataatttttagtttcattcttaaaaaaaaaaaatttggtaaaacttt tactagaaattcacatatattccatcgtcactagtttatccctagttagtgcaaatcacaattcgtttttggtcaattacaaaacaacaatgcat atcattttctacattaaaaacaaaaaaaattgttagtaaaaattggtatgtactaatgcaaaaatttcgagacttgaaaaagtttacagcaaa caataaaagtatagatagttgatatatagttcaatcatatttattctcaataaataaaaaggtaggtaaataatcatgagtgaactaaagaaa cggtagaaatacaattgtcaccatccaatcacatttaaggtcacatttattaacaattacagctggctggatcatgattcatgacaaattgta ttcaacaataattttacagtctcggttcaattataaattattctcccttttttggcaatgataaacgagtcattttcggattaacgtatatagttag gtttttggtcaatcttacgaatttgtacgctgtctattgtctacccaatatatggtctttcttcaatcattttcaaacaaattggaaacaaaagga aaaagtctttgaatgtatgcacaatgaaaacatcaatgaatagggaagacttcattacaccaacctaacactcgtgcatgctatgtttcctt gttgtgcgagagcaagtacggtgaacatactctgccgctatggctcttccacaaatcaataagtggctggtcgtcttaccatcttatgtttc gggtatactggatatcggaatccgttccaaacaacctcttatagatatcacactaaacattactaaaagagatcaatgcccattataaaac atcaaaatagagagatacatatttcacagaacatcaccgtagaaattcattaaatttaagagtttactcgctcgtatcatccaatacggttgg tttttctcttaaacgattcttaagcgtcgagagtcttttgaaggccgaataacctttgataatatattccgtaatgcatactttattacgctcaaa attcttcattacatttgcaattttattatgttgtgtttcatttgaaatcaatattatgagttttaattaataatatcatggtattcttataaattatggtat caatttgacaaattttacgtttataattttcgaatctcctaacaagcagtcaataatattctataaataaccaagtggtcgtgatctactggtttc cacttgaggaggaattgccttgttggtctaggttagggatcgattctcctcaagtgccaaattgttagtcatttccataaactaaacgaactt ttcggcgttttttttttttttttttgggatcttcgtcataccctatcataattcaaatacggtggtagtaatgtgtgtgtaatttatagatgaaagaa ataatattaaataaaaagcaaatgtatatattttatggtatactaaagttagaagttttaaaccatttcacatattaaaaatgaaaaaaatgaaa aggcaacacatttttccctataaataccccaaaccgactttaatcgccacaccattcataaacacacaccgagagaaaatcagaaattaa attagagagagagcagagtgaatcaaaacttcaacttcacccaaaaagatg

SEQ ID NO:4 P24 (pDK8010) tcttggcaattccataataagccaaccgttcgcagcattcgtttgctgcaccaaccaaagcatagatatcagtttttggagattaaagaca gaacatgagagaatacaacaagtacattacaagtgaaataaaacaaagtgtttaccaaaaatgaatggacaagctttccagtttcctgtt gtctgcttcaatggtgggtttccatgaatatctattgaaccatcttcagcatataattttacttcttcctggagaaaaacgaattagtcaacaa agatttagaccccaaaacactaaagaaacaatgacaatgaggttgaacctgtataagagattcttcaacttcaagaagtgacctttcttca tcaatggaagccattttttactttctcctcaacatgacaattttcacgtaaagctgatttaagcttctcaacgaaggatcaaataaaatgatcc tcccactgaccaagttgttgttggtggtgtgagtggtcactcaccacagaaccacattctttaaaaaatgttataaaaaaaaagagggaat ataaaaccacacaaactttattaatctgattagacttaagcattaagcaaattttgagccatagcacacttttcccctaacacaacaaaagtt atcaaacaagttagagacttcaagttttaaagaagacatcaaacaaatcttacgaaacctttctagccaaaccggtaaattaacaaagcc aagacagaccaaaagccaaaaatagtaatcaagatgaccgttactaaggttcattgtcgtgaaatatgcaacaagtgtaagaatcaatg agccgagtgaagagtccaagcactacacaaattttgcatctagagattgttcatagaaaaaatcaagccgactaagaaagaacaaaac gctagatgttcccaataaagatatattgagggatatgccaaaaaatgctcattggaacagtgttaccactatcaaccagatcgttggatta ctcttgtctctctcgaagtcgagaagttggtggcggtgaccactggaccataaaatgtgttcttgttaacaacacgttttaagaaattgcaa aattgagtggacctattgggctttaaatattagtgggtttcctaatttgtacttgttgggccaattttatgacctccacaacttggatataaaat atttggtaaggaattaagtaaataaatactattttattttttgaagcaccaaatgcaatttatggtgttaataaagttttatgataataattaattaa tgcaaaataaaaatagttttggggtaaattgattttttttttttgggagaccaacagtcttcaacctcaaaaacgagaagctctagtaaatcat gatcgttttgtaatttattggtttaccaattgattttagtgatatagttttcgaaccgcttaaatgattaataaataaataaattaaattatggattg gtgattttgtctctaaataaaaatgttgaatatgaaaggaatagttttgaattgtccttaataatttaacgttgaactattgaatagtcaataattc ggtcgctaatagttgactagtacaaacaaaaccgaacagagcatgtattaattggccatttcaaaattcgtgttgcaataattaaggaaag tcagaactttagagaagtaaaccggtggcggttacccataattgccggttcggcgagtggcgtctcggtctccatttgccggttcccatt gactaacgcgttagagagtgactgatgggtcgacttttgacttttactatttttcttcttttgtttcttactgccagttatgccccattccctgcct cttaattacgtatgagtgccactcacaaatatttttatttctgaaaatcatttgggggagacaaaaaaaaacaagatataacaaacctgttgt tttacttttgttactgacaagtccttcagtcaaaaaataaaaacaagatagataaagaaaatgaaaactgtatttaataatatcctgaatagtc aaaatagaattgtctataaaatctgattttttaaaaaatataaacatatatgatgaagtattcttgtttcatgtatccattcgaaaatataagtaa atcctatgtacaattgaaaaaaaaaaaaaaaaggtaatctagaaacaatgctgatcaagctgtagtattcaacgtaattaacccaagcta gggctagtggattctagttttcaacaaaattaacccaagctagggctattctaaagctagtctaaacatgtgggaggtttgataaatcgcct aactttatttgtttaattaggtcagaccatgggtttgatgtttatttgaatttttatactttagagatggtaatatgagatcttacaacaaaaagtc aatgtcctttagtggtgataccaatataagttcgaatttggtttctagcttattggtataaattccattgacagcaaaaaggaatcacgaaaa caatataatctagtactatattcacattttacgcgtaacgcgtttgtaatattcacataattatgtaagtgtgaaattgatcaaatcgcgggag atgctaaataaacaaaatcaaaatcactaataaaatgttcacgataacttagaaagatccaataaaaagatgacggtcggaatttgtatac gatagtaataaaagtattcgtgtttctaaaagttagtaattcattggtctaaatattataatgaggaaaagtcattggtaaggaaaaggtttga aaaaggagcacataaataaggaccagcgatgcttcctttcacgatgcaaaacacgaaatgaagagacacattctctctactatatatacc atttgctcctcttcctctaattccacacattcttcttcaactacaaaacaaaaacactactacacattctttcctcttgttcatttcaaacccaaa aatcaaagttcgaagttgaaagaagacatg SEQ ID NO:5 P25 (pDK8011) gccggagcatttggatcaaaacacccaatttcttcaaacatgcctcctcctcccatgaaaaccggtccaaagggctaagaaagatggttt caaaatcagaaaacattgacacagttttgatttgctagattatatattgaaaactgcaacctaatcttgaacaaatctgttctaaccaacttaa aaatcgtctaagcttagatgaattcttgtaatgtatatctaatgatcaggttattaggaataaaagagtaagagaagggtatattgttaccga cttggctgatgatgattctccgaagaactttttccgaattcacgccaagaagagacttaacattaacaactctttctttttctctctctgtctctc tttttgaaatgcctatacgtttgcaatttgagagtaacaaataaaaagagtggaagatgacacatttaactttttttttttgtattaataaaatac gtctgttatttatttgtggtctaacggggaacaaaagtttaatttcaacaactaacatttttttcctttcaatatattttttattttctcaaaacgcta gtgtttttttttgttcgtaccgtaatattcaaaaattgaaaactaaagttttttttttatcaataacaattaatggtggtactctggactggactttg gttaaagttcagattttttttatgtgtgacaatacctactttgatacatcttactgaattgaaatatttggttaccttattggtaaaagaaatagta attttatgacctaagttacaaatttgagttctttttctttataagttgcatcttttagagatttttttttttaagttacatcctttttagaaacgagggttt tggttggatcatgaaatttttgtttgtggcaagacaggccggtggttagttacagtctgtaagttccatgacgtgtctctcttcgcgtgggtc ccgtcacgattctctcaggttttgccgttttggtatatgatctttaggggtatttctgtctattgattatattttctcggtaatattacgcttgatttg aatccttcgactataatagagattttcttaatttcactttcacgttcaaagattttttcgcattgtcttttggaaaaatagcagagttttttaaaaaa taaataagaaacgatacattcaaaaaatattatgtgaagttgagtttttttttacatatagaggaaataaaattgatcatagtcatagacatag aaatttgtcagtggaatcttttctattaggtcaaacaagattcaacttttaacattttatctaggacttctgaattctgatatacaatgatcgatg atattataaataagataaaaaggctttatttgtattatttccttgtaaagtaaagtatttcttaatttcatgtttgttgggtcatgcaaaatatgtttc caaggcaaggtagcggattttttgtgaagaatattagctgggtcccacgtgacacaaaagctatgcggaaaagggtgtttccgtaaact cacttgaaaatttctgctaaccagttttgtccggttaagttcatgttatgtatgttacaatttgggaattgggattcagttaaaccggatcagc cgaagacattattatattcgttttgtaactttttgtttagagggtgtcgagttaggttatcgagctgagctgtatataaaaacatctcaaacaaa ggtgaggaggggatgcatttgcaaaatggaattaaggggtgtttcgtaatcgtgacagttacgtttttggtttctctcctatgaggcttatttt gggcctcaacaagaagtaggcgttttaacacgtttcgtcatctagagccagatgagagggcctaaaccctacctgtggctggttatttatt gctttaacttacccgacagatgcgactcaatttgaaatatctcttttgggcctactgatcttattgacgagaggattcatcacccttttcttcg gccacttggaaagattatatagattgtatgttttctcttttcattttctatcctcgtgaagtttttatttttatttttttattcagattacgaaaatcttga gaaaaagaataagacccggtgagcgaaaggaatgtgtggcgatggcgatgcctacacagccgtgaagccgagtcatcgattataaa atgagatgtgtcgatgataacattgctagtataattcttggtgtggtccattatttgataaatttatggtatgcgtccctcatgggaagtgtgat aagattaaacctagtgttcgatataaaatttcaaattttgtgtcttagccattctattgaattttaaactacggtcagattgaagcttacatatatt tgatgtaaaacataaaaatatgtggctgttactcgtacacatttatggttatataaatgaatagtctcaatcacagccgtgctctgtagttgtc aggtattcgtgtggtttgaagtataacattgtcaactatttgtataaagtttctctatactattagttccatgatctagttatatatacaagtcatat cagtttacactaaaccactcgacactcattgataatcgcataccgttactacaaaactaaattcaccttcattgcttattaaaatcaaatcatc acaatagctgatagatcgtggccttagcatttcctcggtaagacttatgaaaaaattaagataactattctttgaaaaaggtaaaggaaaa gaagttgggaaaactttggcctttgtgtaccaaaagtagaaaaataatttccagcttgtcattttcctacggtcccaattaattatatctctctc tataaatatagtaacacacttagccatcgtacacttactagttacttccaacatttggcttcctttgctttcacgaatagaaaccttagcttcttc catttcttctttctctcctcgtttaaattagtttttgacaaggaagaaaaagatg SEQ ID NO:6 P26 (pDK8012) cctctctttatctgaagcttctgccttcaaaagtcgaggatcattcaatacgtcatgactgctcttaatcttttgctttacaacagccagttcctt ttcctcttcttcagcttcttctccgaatgacagtaaattcaatttcctaattatcacaaagacaacaacaaaaaagtctcaaaagaacagcca aagcaaaattatagctaaagctatcaatcgaccatggataacatcttacttcacgggctttgttgggggttccttgatttcagcagcagatt cttctgatgtctttgctaacactctaggaacaatatcttcaaaagggttccacaaaacctgtcacagaaatatacagagtatcaaaaaatat caagtaaatcacaagaatgacacaccaaagaatcagtatcaatcagagaatgtcctcaatatgaagacatggaacactataatagatca agcattaacaatccttcacctcgacagataatattttcggagcaggatccagaggtcgatcatccttactcgtgtcaacctctcctagtctt aaaagattgtagattgaatcgcccgttacctaaaagaattaaaaacaagttgcagctaaatatgatcaagaactagaaaagaataattgc acgaagcagaaaaacaaaacaaaagaagtaattttgctttaccttgccaaagatagtgtgcttcttatcaagccaatcacacttatccaaa gtgaaaaagaactgacttccattagaattaggtgagctcgcattagccatggcaacaatcccacggtggctaaatctcagccttgaatg gaactcatcggcaaagacacctccatatatactatctccacctgttacatatatcacacataaaactcaattgacctaatccagcgagcaa tcagaagaaaatttgatacaaatgagaggtcttaaaccctaagaataatcagaaagcgtagaagttaccggttccggagccggtggga tcgccgccttgaacgagaaaaccgggaatgacacgatggaagatggtgttgtcaaagtaaccctcgaggcatagttgaacgaagttc cgtacggatttgggcgcttccttaggccaaagctcgacgtcgattggaccatgagtagtatttacaatgacctttccctttgtcggcggct ctagcacgtacaccgtcgacatctctgctacttcttcaccgagatgtctctcagtctcagctcaggttcattggctgggtttcgtaaatagc ctaattatagataaagcacgaggcccaattcaacaatctaagcccagcccattaacttaaaatctgtaagtatttccgatgatttgtttttcat tttatttttttccagatttggtagaatagaaccgtagaagtatttcctggaaacatcccatgcatctctatcactacgtggaagatcagaaatt aaagaaagtcttcgagctagagttgagtggtactccaatctttgtacttttatctttcaaagtctccaatttcagaactactatagcttcgagg aaagtcaatggtaaaattttggaagtttattttctacaattctataaattttggacgtacgtacgacatattccatgtaaataaaacgagttgaa catgttcatatcgatgaagacatataaaacccaaaagtaacccttatcactccttaacaaaataaaattttgtctatcgtgtgaacttgtatga cttgaattatcaattgaaactttaaagatataaaatttcagtagaaatagaaattcttttacaattttaaatgtatatgttatgtttgaccatttgta ggataatgtattcaatagtctcataaactatactttggaacaaataaaactgcgtctgaacgttaatgatagacaggtttttgacaaaagaa ataacacgatttgatttttagtatttctaagatagaaaatacatgtttatattggacaattcgcaaattgacaacttgacgtatttctttgaaccg tttgactttttgatgaattaaaccctagttcaattctttcataatcctcttcttggatatagaccttgtgtaaggatttgagagaattttgttttcaa atgtaaaagtaaacccgttgagtaactctgaaatagcagataattttatagcaaccatacatgtctacatgccgaagatttaatttgtcaaca caagtgcatacaaagttttcaaatgtaaaacgtttatgctcctcgcaaattttgacattcgtgtcatcgtgtgtaataattctacatgaaccatt gtgtgacctaaacttcaccgttagataattaatacgtaaaccctttaaaattattgtgtactaaatatgtagttatttatataattaaataagaac gacaaaattaatgttggaaaaagattatgtgaattgtccttatctcaataacttccatgaacttaccttcgttagcctccatctcttatggctcc ccacatactctgtctcctagttagcctcctctcactattttgtctcttttggtaatattcaacaattcaaacacgccaactttgaatattccgtaat attttttccatattcaacaattttgcaaaaacgaagacttcttactctctcaatagtcttcaactgcctacccttacttatatttatgttaagatctc ttagtcatcattatattcatatccctagttcagttttatctccaaagaacaaaaatcattcttttattctttattctttcaagcttctctgtttcttgtct aaacaaacaccaaggaacgtttgttttgtgtttgatacccacacaaggtacttttatttgttaaaatgtttgaatgagacaaataattggtttg gtatagctaattttaatgcgactactgtttgtttaattaatgtgtgcaggggattttctatattaaatatactttggaattatcctttcgttatattag tggtcatg

SEQ ID NO:7

13100_at ttgctagccggaacgttatagccaacacttgtcgggacccgtgaccgtggtccctaactttccactaccgttacatgaataaaagttcttta tgtttcatagtttttatacctaggagattttattagtgttccatgaccatccaagatgtagtaacagttgatagtaagaagataaaatttgagtg ttgtcactcgttaattagcaaatatcaagagatgcacattaaaggagcaaaccaggtcgagcaacttaacctaacatcagaacaaataca gctaacagtagataaagagagtaacgtacacctaaacacatggttaagctgcctaatagtataattaatgaaattaatgtgaggtttaaca gatgaacagtaatggctacatacaagtttggcaggcggttgtcttgatctcccatgtgtcattatagttttagaatcatatattttttcttgcatg ttttgaatccaattaatgacactaatacaactcactattttacatattatgttctcattgtttatataattagtctgtaccaaaaagaaatcccatg tttgtaagaaatttaggcaagtatgtaaggttcaaactttccataagtgggcatgacaaaaacaaatttttagaaactcagatagtttgtagg tgttataagcagcaataaacatatacattatgcaaccgattgacagtttttgagaacttgtttctccattttagataatatctttaaacttgtgaa taaattcattagaaaaaaaacttaaattcatggatataaaatgcatgattgagttatattttctaggcactctccaatttcattaaacaaggag agtagaacctaaagaaaaaagtggtcgtccaatggacctctcactaattcaaggcatgtctctgcctctctattttctcttaacattattctttt tcttctttgctaccgcaaaaacgcggagaagctctagcaccggcacgcttccaccgggtcctccgatactgccattggtcggaaacata ttccaactcggattcaatcctcaccgttcacttgctgccttttcgaaaacgtacggacctataatgagtttgaagcttggaaggttaaccgc agtggttatatcttcaccagaagcagctaaagaggcacttagaacacacgaccatgtcatgtccgctcgaacctttaacgacgctcttcg agcctttgatcaccataaacattctattgtctggattcccccctctgctcgttggaggtactaactctatctaagatcaacatttcatttcttttta actctctttgtgttgatatcatccgtgtactaaacttcaatttaaaactttaaatctatacacacgtgaagtgattagctacgtacaactccatta aagttctgtatgtatgcattgtcaggtttctgaagaaaacaataacaaaatatttgttatcaccgcaaaacttagatgctattcaatctttaag aatgagaaaggtggaggaactagtgagtttagtaaatgaatttcgcgagagaggagaagctattgacctggctcgtgcttccttcgtca catctttcaatatcatctcaaatgctctgttttcagtagatttagcgacgtatgactctaactcctcgtcttacgaatttcacaacacagtggtt cacctgacggatatcgccggtatacccaacgtaggagactatttccagtatatgaggtttcttgatttgcaaggtacccggaaaaaagcg gtgctctgcatagagaaattgtttagggtttttcaagaattcattgatgctcgattagccaaaagattttctcggacagagaaagagcctaa agaggcttcaagcatcgatatgctagactcccttctggatctcacacagcaaaacgaagcagaattaacaatgaatgatctcaaacactt gcttctcgtaagtctttcacacacaccaatggtaagattaagatattgtttggatgcaaatatcatcagtttacctattttgtgacaggatgtgt ttgttgcgggcacagacacaaactctagtacaatggaatgggcaatgacggagttattccgtagcacggagaagatggtcaaagcac agagtgagatacggcaagtgattggtcaaaacggtttcgttcaagaatctgatatcccgagtctgccttacttacaagcaattgtgaaag agactcttcgtttgcatcctgcagctcctttgatccctagaaaatcagaatccgatgttcagattatgggtttccttgttcctaaaaacaccca ggtttttctcatacttatctttattacaccaacattcattacttgagatattacaccaataaaaaagtttggtttggttaaaatcttccacctctgtt tctcgagattaggttgttgtgaacgtatgggcgataggacgagacgcgagcgtgtgggaaaatccaatgaagttcgagccagagagg ttcttgttacgagaaaccgatgtaaaaggcagagatttcgagttgataccgtttggatcaggaagaaggatgtgtccgggaatctcgatg gctcttaagacaatgcatatggtgcttgcctctcttctctattcctttgactggaagcttcaaaacggtgtcgtccccggaaacattgacatg agcgagactttcggtcttaccttacacaaggccaaatctctttgtgccgtacccgtcaagaaacctacaatatcgtcttcttattaataatcg tatcaatataaagttcgtgtacggatcaatattaataattgaagagaatgaaattataaaagatactgctttttatgtttcaagtaaaaatgtta atattagaaagtcaagaaagaggaaacacaatgcaatttgataaggtgttttatcgtctccgggattgaattgcgtaggtcaaaaaaaga catttgccatttgatatcgacatataatcactcattcacggatacgtatctcttgtgaatggtcgtcggtcaattacaactttactgctcggctt taactgacaagtggcgcctcctggtttcattcagaccctaccggtaggatgtaatttggaccataagtaagaaatatttgtgaaatatttact acacgaatatctttacgtatttaagttggcttttgaagctttgataattcactcatttgaaagaaaatatcacttgagaaaaaatt

SEQ ID NO:8 12449_s_a atttaattttgcctgagatagatgaacttaagcccaatcgtattgtagataagcctatcaatgctcaagatgttttagcattggctcaccgtgt agcaggatgtatctacgagcttaacaccaattggggatcaaaggtaagatataaccaaccctagctcgtacctttatctagtattgatttcc atttgttatattttttcatgaaaactatatctaaaggaaaatggacctaactaatatatataagtgacatacacaaatccactaacgatagggt ttttttttggtaaaacactaacgataggttatcgatagaaaatccataaaagttaatatggtaccagtgatatagaagtgacatgatctagat ccgctcatttttaattgattttgagttgaaagtttatgaacctcaaaaccaaacaagtttcattctaggttaacttattagaattagtttttttttgtt cgttccatgtaagtgaactaagaacaattagtttctctaatcttagataattatagctaatttttagaaacaaacttgatttcttgattgatacga aacatagaaaatatcttctttcataattgatagtctaaagtaagatcattggttgtaaatcataatatatttgtttcctagtttgttataccgtataa cttcattttatcattcaaaactatgcagattggattcagatatgggtctttagtagaagactactacacagggtataggctccattgtgaagg atggagatcagttttttgcagacccaaaagagcagcattttgcggagattccccaaaaagtctaattgatgtagtgagccaacaaaaga gatgggccattgggcttcttgaagttgccatctcaaggtatagccccattacctatggtgtcaaatcaatgggtctagtaacgggagtag gctattgtcaatacgcatgttgggccttttggtcacttcctcttatcgtctatggattcttgccccaacttgctctcctttatcaatctagcgtctt tcccaagtcatcagatccatggttttggctttacatcgttttgttcctcggtgcatatgggcaagatctactcgactttgtattagaaggagg aacttatggcggatggtggaacgatcaaagaatgtggtcgataagaggattctcttcacacctatttggcttcatagagttcactcttaaaa ccctaaacctctccacgcatggattcaacgtcacaagcaaagccaacgatgacgaagaacaaagcaagaggtatgagaaagagattt ttgagttcggcccctcttcgtccatgttcttgcccttgactacggttgccatcgttaacctccttgcttttgtctgggggctttatggtcttttcg cttggggagaaggactcgtccttgagctgatgctggcgagtttcgcggtggtgaactgcttgccgatctatgaggctatggtgttgagg atagacgatggaaaattaccaaaaagggtttgtttcgtagctggaatcctcacatttgtgctgattgtgtcaggttacgtcttcctcaagtaa ctggacccattatggttggttctgtcgtttcagttaaactaatattacatctgtattgtggtaattaggagagaataatgtgatgaatccatttct cacctcattttagaacatacatttcggtatattgcgtctgtattgtagtaattaggagagaataatgtgttgaatccatttctcacctcattttag aacatacatttcggtttattgtataagcttaaattagtaattgaaaacgacatacactatctattgatattttcactgattaatacgactgtattttt tatatttcttaatggatgttttgagcacaatttagtaaatatgggccgtagagatatgctacttcgtcaaaatgttaaaacgtctttgagatattt tgagatataatagacgataagacaacatttatcttgcttacttcgatctattgtatttatttgtatttataattgaagtttcaccgtacaaatacttt atatttatcttaggtttataacaaattaattattccctaaagttttaaaataaaatatttccctagcgagctagtgggatattaattatcatactca aagtagtcgattatagaaactaaatgattaaaattttacgtagtctggctctgtttttatctcaaatttctttgcaaataaaaacacaataaatca tatttacttgggagaaacttctatcacatattaatatttatcaagaaaacttcaatcatatttttcgtaaagtgttacttacctttatacaaatattc cgtgtattcctcggtttacgattctttatgtctgattgtgtggaaaagtacaatcgatatttttgcaagaagttaagaagttggcacttggcag atgcgtgacgtgaatgaatcgtcaaggcagtgactctccaagccccagtcttcatccatttgacattttcgcatctttttcaagctagagaa ttttaacttaagttctccattgaaaatttcaaactatataaataaaactccacatatctcactaaaatctaacacgtgacaaaaatttaattactt aagtgtagtatatgttagtaattttctcaactcgcgagcaaacttcagttaacttgattttgataaaataaataacacatcaattatctgaattct ttttaaaagaaacaaatatttcatagaattagtttttttttcattttagaattctaattgaatattacagaataaaaacttttacttactaccacaca ataatagactttaaagttagttattgtaagtagaatgtattattttgaagttaaaatcgtgtatttatcgtgatgtaaaaatttaccgttctttcttat aaactagtcaggctattctggtgttgaactacttcacttcacacgtgtcttttggagaagtagtttcattaataaacacttatctttaattttggc ttcaacttttcaaaggcacataatgatcacactgtactgtatcatcttatctcataaatgagaaactcgaccataagaactgtctatagtgtgt atattcagaaaagttatcaatagttcaatactaagaaaccggcctatatatatatatttgtggtcactaatttctccaaaaaccagttgccttc cgtaaaaag

SEQ ID NO:9

15162_at gatctttccgcaagaacgtcatgtccggccaaaaaccgaccaccggagatgccaccgaaggaaacgataagacttctggcagcagt ggagccacctcatccgcctccgcatgtgccaccgtggcttatgtgaaggttagcatggacggtgcaccgtacctacggaaaattgactt gaaactctacaaaacttaccaagatctctccaacgccttaagcaaaatgtttagctcttttaccataggtaaataaaaattgacaatatatct atctactaaaacatgatcctttttatcatatattgtttgaaatttgaaattttatttttcaggcaactatggaccacaaggaatgaaagatttcat gaatgagagtaaattgatcgatcttctaaacggatcagattatgttccaacatatgaagataaagatggcgactggatgcttgtaggaga cgtaccgtgggagtgagtatttttatatctttaaatttatatatgaattattattataaatacgtctatacaaaatatttatttacatgttgtttggac tattttaggatgtttgttgattcatgcaaacgtatacgaataatgaagggatcagaagcaatcggacttggttagtattgtttaatccaaaact ggtggtgtaaaattatactatgaatctttgctaatactaattttctatatattgcagctccaagggcattagaaaagtgcaagaacagaagtt gagttctcgacgacatttcgtgttcttacctaaaaaaggaagaaagcctgtttcgatcggttggatatctcgaaccgagaaagctaaacc ggctcgaaactattgttccgagcaaggagtttgcttataatattaattaataataatattaatattgtggtgtattacattttaaaaaattaaatc gtttttgttatatgtattatatacatatattaatatgtatatttaattaggttgcatctatttccgttaaaaccaacttttgtttttacgcattatcgtgtt gtctatatggtctgtgtccgtaaggcatcttaatgtgttactttgacgtaccaaattattacttacattatttcatttctcaacaatctttttttatcc aacattttcaaccaccttaaattatacctttttgtttgtttattctttattttagtaacttttcaataagtggagctaaatgacatgagatggttaac aatcgtaaaaccaacaaacggaagattagtagtgcggatctttttgtatcaatgtaactcgaagaccaattattgtcgtgcgtatatataag gttggcctcaacaggatccaattggtgtttagtgtctatttctttcttttttaataaggttggcctggcctcaattattgtttttttttatttctaatatt acatttatcaatttttggtgttttttcggtgaaacacaaatgaaaaaactttaaatagatcaaggtaatgtgggtggtggaaagggcaagag catgtggataatgtagagttgttgggggacaatattttaatgaattccgagtaaattaataatgtctttaatatgtatgctccattattgatgctt tacgctgtcatcgacatccattgcctcaacaaacaatggttgataatgatgatatttgttttatttattatttatctgattttttagtaaatttgatct agtttgtatccttggttgtcaaattcaccacatgtatttacttgtttgtagaatacttagttcaatataaattggctgattttgctctcgttgtgaatt acaacttgtaacttaacaagtacaaaatgcacaaaagatggttctcaaaaaacagattcacaaaagatgattacaagaagatgaaagat acacaaaaataaacaagaagcacagcttcgtcccaacaataattaagtaatttggggggaaaaacattttgggccatggttaacactag ggaaaaaaaattggggccttacattttctcataataatgggcttttcatcaattttcttaaatattaatgggcctttggcccgataacagctac cctatccatttggtccgggcactctagaatactctcttcgctcttctctttctctcgtgtactctgttttatccaacttataacaatttgaagcgg acttgatatgggctcagtttcggtaaaccaaacccgtattgcccgttaagcccatagacaaacaattcaagttgactttgactgaagtcaa cacttaaagatctgtaggctcgccagcccagtctctatactattttagatcaaagctgaaaattcatctcgtgtcaataaagaaaaattacg aggaagcggatagatttgcttttttacttacgcatcatagaagaaatttgttaaactgctaagtgagttttgagaaacaaaattttaaataatc caaaatggctaattcaatggaccgattatgttaactttgattagtcaatgatcgaaattcaatatttatccaaatgagagcgactcttatctac taggctgctattttctacaaacaaacaaaaacaatcacaattagccgcctctcctcattagtcattatctgtatcgcgatggggaagatacg caatgcttagttataaaccgtccgatcagatgactttgaccagtgaccttccgttcaaagaatatcgacggttcttagacacatttttcaccg gagtctcaccctcacaggtcatcttaatttctcgtaaaagagcatattacattgatattccaaattataccacttcataatttatttttattttcca aataaaattaatttattaaaacttcagcactccaattctgtagagaaattttaagaggagaaacccaattttcttttattttgtaacgaatctcttt taaaaaaatctaacaacagaattatatattttcattattctatcgaatccaacgaaatttcaatatacagatatctatatacaaatatttaaccta catgtgtgtatcatatggtttaagcacgttacctgtaacgtatgtaattaaatcaattgcgtagaatcacaagaaaaacattattatataatta actattgatcctataattttattattttcatatatatatagatatatagatagatgcattagaccaccaagaaaacaaagacttatcgatc

SEQ ID NO: 10 13565_at ttttaacataattgctggtttccatattttcactatgcatcacgtaaacacgtgaaagacttggttgttataatattgtaaataagtggtgaatttt cgtatcctcccacctcgcatgcggtatattttgtttgtgtgttgataaagttgaactggaaaaatcaaattgtcgtatatataagtacagaaaa acttaaagctgtcgaaattattggcggaatggttgttgccaagaagggtcccaagtctatattatccaaagatatcttcacaaatatcgtca gcaacgaaaaaccataaaataaatagtaacgacgccatgccttctttggatctaatctatatatctctctctttaacatagaataatcgtgttc ttttttctttttttcttttttgatagaagttgaattggtcaaattttagtttgtacaaaactaaattcgcttactagatgtttttttttatgatcaaggaaa tctcaggcaaaaaaagtaaaccaatcattaacatatgtaaaaaaaactgtaataatatgttgaaaaatagtcacacattgaaaagactaat catttttatttttatcctctgtttgatttttgttctataaaatctaccaaaactatcgccaaaagtaatctaatgatcatgacattatcactcattcaa ctatggcgtccagtaaatgggctagattgaattaaatgtgcgagttataaattttgattgtcaaatttggattttaaaatggtcgtggaatatta tcatttatcagtactattgcctacctaattcaagggtcaacttgagtactgtataatattgactttaattatatatggacaattgacaacaaatta acgtaaaaaggaccatataaaacaccctatgttttactgtctatatgaacatctatttcaaatttgttttgaaatttacataatatgttacatacta attaattgaatggtaattttgtacaggggacaataaatatcttttagtgaataagaatcagccttccaaaaatatattgataataattattattat agtagtcagcagccttcgaatatatctactattcatataagaaaaagctaatgccgttaaaacaaaatcctactaatatatgagatagttga agtgactattctaatgaacaatttgctccagaagaaaatttgttcccgaaatgtctaatcaaagataatgcattatccgtgcgattagcctctt cctaaaatagcgaccaacgtctttttatttcgttaagttatttataattattggtccctttggctttttaatcttattgttaatattagtactatttaatc aaggcccacatgtcgagcgacccaacgccatgaccgaatttatattctatcaaatatgcatatatcatattgtttataaatggtcttggtgtt gaaacataaatgtatatacagttgatgcattcgtttaaaaaaattccagagtcctattgtggtaaagaaatagactatatataatatagtgaa aactagtgttgtatgtctataacttcaaattagtctatttcagttttgacaaatcgttatccaataaacaaaatttagtaatcataccaaaaatgt agaaacctaattcaatctgcactgcggcataccatttaaaccccgaatgattaaactttattcattggtgattttttttttcttagtttgaaaatat ggtttacctaaacaacggaaaacaaagaagaataaagttttgatgaattattgcaaacacaactacacaaggaacaacaagtaggagat taaagtctcgaaaccatattaaaaggagattggtgacataagtgctctgtaattaccgttgtttgtaaaaagaacgaattttcaggaaaaaa ataaaatgaattaaatggagcaagttggggagggtacagcacgagcgacgatcatgaagccaattaccaaatgaaattgtgatttagg gtgctgatattcataaacttgggttaagtcgttgtttaaaattgtgttttggctgttagcgatgaattatagtaaaacaagaaagagttctagta aaaaacaaaaattgcttagtactaataaatttcacaagaccattcacactatacaacaataatccttcgttgccagcagtctaatgggactg tgttataggttaatctctctttcacggactattaatttttggctcaacctcaatgtaatttatttaaattatatttcaacgcatacacgtgaatttata catcttttcataggatttgcaattccggattctcatccgtcctaggaggttgtatatgtatattattggtaactacagcattaaacaactttaac actaagtacgatgatattatatgtacatgtacgtatgctatagattgatataagaaaaaagtaaagagagagcggatgattgttgattgaac taattaacaatagtgtattaggtaggcttgtatccgacagtcaacttaaacttcatagttgaaaccaataaaaccagaagaaaaaaaattta tatactaatcataatcagcatgatgttagacgatttgatatctaactttcttcgttatgatagagaaataatattcgcaataaatcacatataaa aaaaattactttacgtcatagattatcaacttgcctccaaacacaacaacatgatcccctacgctacaatacataatatgaaaaataaatta atcgttgattaacttaaagtcactccgttaataacgttataagcaaagcttattagtttttttgaccgtcattatcgacgaccaaacaaagaaa gagtcccaacaaattatgccacgtaagtccagaacgacgcctatgaaaccaataagacaaaaattcaaaaaccaaaacatccgtgaaa actcttacgtggcggtgacatgtgggtcccttatgtctccattaactaacataagcttattgtcgactgtaccttttgtcccccgtctcggcta caaccctgtgacaaacaaagatcaagtcaaaatatctaacctaaagtactctcgtccacgtggacattgctgacgtggaacttctcccttc tataaatacaggcttctcttcgccgaattatactcatcaaacgagtaaaacatttgctaatattaaacactttttcttttagaaaaaaaaacaa at

SEQ ID NO: 11

13015_s_at aatatttccgcaaaaaattcaatgttattaacctaatatgtcatattagatgatccagcaattcaaaatacttccgcaaaatattcaatgtcatt aacctaatatgtcatattagatattgatccggtgattagaaatacttcccggtttgctatttgatcaaatctttaaaacattggtttggcataaat aggagtaatggtaccttccaacgaaagaggcgagaaaagtgcgatgtgagtgagcaacaccatcgagatgggcagaagagatttga ggaagatgggcgtgagatcccaagtacactatgtaggactgtaacacagtaggaaacaaattaatgcatatcgatcttacgagcaatgt atatagaaagtgagttacataagaaaaaagagagagaggacctttttaagagcaaaagcaggagagaaaaagagagtgacgagga gaagaagagatgataaactttggaggctcattttgtttgagtattgagtactcgaatatcttctcgtcatactcatatacaaaatactagttct ccataaatctccctctctcgctatatttgctaaatagatcgaatcacgctcagtctcagtctcaacttaattacttttaaagtttgttgagtgattt cagccagaactctatctcttccttcaactgttatctaattcgaaaaaaaaggtaagaggatcttcataatcttctttccatatttatctccctatt atttggaattaaactaaaattttgactttgtgggtgatttgtttgactgcagctgtagaattttgtttatattaattggttgtagttgtaagtttttga atatagatattttattctattaaatatggtttgtaaagttagtaactgacagattgtgccaaatgtaaactttcatgatcagatgtttattatctcttt atgtggtattgcaaacttacacttatgttttattttaaaatgtttaaagcatgtaatcataagtgaaaactaaattttttattgaaaaatatcttata ggatttaaattttcaattacttaattagaagttagtatattcttaactcacttaaaattagtttgcatgaagtaaactaatgtgtaatttatctacatt tttaaccctacgaacggaggtgtgttgaaccttttaggctcgtaaagaatataatttgatgatttaatcttagtataaacaacataaaacgta actaacttagctatctttctacattttaacccctatgaacaagaggtgggttgaacctattaggctattacatgtgacccgctaaatagccaa atgtgggtaaccacctcaaatcactacaaggctcatgtcaaactctcattaccattaatatccgggaatcaagtttatcagaaaatgagatt gtcttgcattcaaactaagaaaagaaaaagaaaaaaaagcaagaagcaatggagatgagtaacgcaatgaatgagtaatagctcaat gtctacataattggactcgtacatatgaactcaataaaataaagcaaatggacccgatttgagaccagtaatggttttgaaatcatatatttc caagcgtaccaaaatacacttacgattaaaacttgaattttttttggcaacaaacgaattatatttttgttagtattaattattgtattcaacgaat tacatttgattggccgtatactctggaagtgtgtaagtataatattttctttggcttacaaagcaaaacaaaaatttgatggagagagtcaaa caaaaaaacaaaagaagtaggtcatatgtttatccattcatacgttggttggtaatcctaaaaaccaacaaacaatcatatatgtatacttgt ccaattatgtaaactactccattgataatataattgttaattattgactcgacttatctactgattatgaaactaccaacaaatgaagaaagtaa agggagtgtgaaaacaagaatcttaaggtataacgaagatttgttccgcgtggaaaaggcattaaaagtgccacgtcactctctcttttta ttttatgattttcgtatctcttcttctacttgcttcccacgtttccatcaagtttccgtacatatcttcttgttatctgatccacgcgatctttcaacg cgtacttttcacgtatttgtgttgtcatgcctttgctgggattgtgttagatgctcattgctgacggtagtttttagagaacattctagaaagaa actatttttctaacaaaaccacgaactttgttttctagttattccactttctagaatacacctgaccaaattagaattctagaaatgaattttaaat aaaccaaaacacctaaacgaaaagcaaaccataggtttttggttttaacatatttcaaattcataaaagtgaaaccaacctacaccatatta accaatatttattagagtttttatatgttttatgatattgttcaaaacttcaaaagagatttattcatataacatacctataccataccaatgaatat taaaattatgaattagtatccttatattatatgaagtcaatcaaaaaacttagaagcatttcaaacggaatcaaaccattcatatatgaagtatt attattatatctagaaggtgttgattttaaactattccgtataatatatctagaagacggctccgcgcgtggggaatgcatcaaactcagag agtttaatagctttttttggttgacgtcaactactcaaaagagtttagtttttgatgtgtatatatccaaataaaatatctttaaaaagaaaataat aataataaatggtttcgagaaaacacgaggaagattctcatccaaccgaaacgactctttcgtttttagtagtctcttaagctacgcggtgt cgcaaatcgtgaccacataacccgttttttccttcttttaccccttatctttccacgtatttacgttaatacctacactcttcgctgccacttcctt acccaccaagtcacaagggtatattcgtcactttccacacgtctttggtccacacaaactcggtatctatatatagttcccaaacggacac gaacacatcatcacaactactatcacaccaaactcaaaaaacacaaaccacaagaggatcatttcattttttattgtttcgttttaatcatcat catcagaagaaaa SEQ ID NO: 12 20239_g_at tcttgttgagcggagacctcgtcgtatttctagagatgagactttggtggcaacggagaaaagatgtctggtggtgccggagggaatcg aaacaggacaaggaacgatgcgaagggcggagtgttcctaaacccagagacagaaccgctgacatagccgccattaccaattcctg aatctcggactcggaggatcgatgttttgctacgtttttggctttctcgtccgaccgaaagaggttcctgagagaaacggcaccgttttaat taaaagtgtaaaaattttgaggcttttgattggctaaatattttgcacttatggcaaaaacaatcccttttttgttacctataaaaggaggcgtt gcttcttctctaacctgtagggatgataagaacagaggaatttaccagtgacgtgatggaaaagcgaaaaccctttgaagaagaaaaag atcagacaaaatgaaaattagggtttcctttttcttctctgcgtcggtgctggcttcgtcttttgcttgtacggcgtcgtctctccccaatgact atgagatatagaacggcgtcgttacattagagtggggccagtgggccaattatgtgtaatttccttttctttttttttgtttggtaagaacttcc aatttgatacaaagatacctgccccgcaaatttggaaaggcccattaaaagattatgtacgcaggaaagaaacgatgacgtttttacaaa tgtgttaaatgtttgactatttttgatataaaaaaaaagtcaaacaaaatctcaacaggtccgttcatataatatacttgtatcatcatcatatca cataaatccgatatgagacgtcattttataataataaattataaatgagtatgatttctttttatatcgactcaatattgtatcaagattatccatta tggtatcaaaatccggatgataaaattggtcgatctgacttttttttgtcatttattgtcctcatgtgtatgtttgtgttgatgtctagttatgggaa tatgtacacacaatgatacaaaaaaaggtccattaattgttgaaaaagatgttaggaaattgttgacggaaaaaggttagaaaaatgaatt ttttagaaagaataatattatgaagtcagccaaaaactttccatattagttatcagagtaaggacctattggcaataacagtaaagaaaaca tatgaatgatgtggaaaattcaagagttttcattcgaagacctaaattttttctcacaatcttatctcgtgagggttgtcgctgaaaatggaat gtctcctttgttattatccatttacgaaaaaataaaattctcccacatctaataaagttattttactaattactatttgaaacaccttttacactttat agcttacttgtgtagaattttattgaaacgaacggaaatgtagtcaactttgatgccctgatacttgggtaatctatatgtaacaagtacaag tatacgagcttgttagttgttaagtgtgaaagagcttgataacaaaatgtcattcttctttgtgtgaattgattttcctgtatgcgaatttttatata ataaagaccataaacatggtgtgggtcttcttcactatccagttcgattctttccttctttctgtttcaaatatttgaccccaagtcccaacaaa tattttaaatatgtatcacaaaagacgcaaaatagcttgcgatttttccgtcaatattaaacaattatctagacttccacatggtgatacctgta tattaatacaacacgccaattttaaaatcgttatattgttctcgttatggtgagatttatagttaagcttaaaaaattaggatatgaattggatac gatcgagagttgccaactattttctttaaaaatcatttatcatcggattaattaacacatggtggtctgaaattcaataattccgatataattttt ctgttgataaaacaaaataaaaaaattgtaataggtcttaaacttgtcgcatattatgtcatttcaattgtatagcttcgatatcaaccatgtgtt tagaacatgcacatgactaaataaagtattcttggttataaaaaaagaaaagaaaggagaagcggattggtgaagaaagtatatcatac aaggtcaatgatactggtttggagcttacaacgctgtaacgggtaaggtctgtttttgttatgtcaaaagataagacagtcgtataaaaaa gtaaagcaggatactactacaaaagggacaaaggtagagtccaaattttgacttttccactataatattcaaatatatattcaattgctcttttt catttcgcaatgcattgtttaatctccacgcctcgtgtatgtccggatggtggagagtccagacacgttctttattaactctggttgaaatctt gacgtgtaaaaatatcaaattcgtagttttattagttttatagtatatagtattatcaaaaaaacaagttatactcgagatttagactcgcataa gcatatattgaacctgacttttttgccaatgaaagcataaaatacttgacttaatgggataaaaacacattcagactcgagcaagtaaaac atattcttacaaataacttacaagttacatgtataacaacactcttatctttatcatgtaaacaaaaaaaaacgctattaattgtaaatatttcat ctgtactttgtaaatttgacatgacaaaaaatttagatacttctaaaaatgtacaactttttagccgttagaaagaaaaggtgtacaacttttca atacgaattcttatattaacttttgttccttcagttttatacatatagtcatatgacattgaaaaaccagcacaaactccttcagttgatcaccaa tagaaacaacaaaatacagtataatatttctaatttttagtgaaaatttacgaatattgtggaaacaacttttatagatgtctgagtctgacttat gtcagtattattttttcttcacttatagcagtataacattcattatttcacattaatgccaaaaaaaaattaaaaactttattatcaaatataatattc aaatctcgatattgacaggtttgccctcgtcctttgcctataaatttgacatgatctacgttcattcaaacaaaaaccaagccacaaagaaa ttaaatacacaca

SEQ ID NO: 13 19284_at ctggtgatcaggagagatgtggatatttctatcgttatctcataatgtaatcactttcatttgacaaatagtattctagattctgacagtcgaca tatttgtcaaatatgtgtatgaaatgagtttattactgagttggtttggtaaaatggtagggataataaatttaattaaaatgatgataattttttat attgctttaaatataaaaaacagtaaaatattaaagagaaagtcaagtctttaaataatataatacaatttttcttttgtcaaaataaattagagt gaaagtgtaagaaaaacataggtgagtggtaaatatttcctattgagttatagagctctttatgtattttctgtttaatctgctttttcattcatac tataatgaggaatcaaattgatgtgacgataacattgcgttgaggtttcatcatcaccgcgagaagtttcggtttgtatactttttgtaataat actgtgtggttattaattctcggcgaccagtcatatccttagcttcatgcccaagtttctatttactactttgtctttgtttatttttccctttttcaac aaaattcgatatttttctaattttgagcaccttttttaaatacaaaactaggtgacttctctagaatctctcgtttcctaaattccttcacgtgttatt ccttgtatggttatcaaaataacaaaagtgttggaatgatttcttcattcacgaaatgacaaattatagtgtgacacgtgcgtggaactagc cagctaggaacaacattctagagatgtgaaacttgttaggccaattttgaatttttttaaaagcatgaacatgacaaaaaaaagcatgtgc caaactaattcattttcaacttaaggtttattatgggttggcagcccaaacccattctacacagtttgggcccaatttgtcttcgagtgatgta caatttggcaattggactcacataagaacaaattttgtgtaacccctacaatagatgaaaactgcaactctcttctaaagtaaaggactaaa gtcaacctagtcccttaaatgaggtttggaaaattctttgtctgcctcgttcacttttattttgcctcgttttatgtatctgttgaaggaacacca cttggttgattatggtacgaaaaacatgttatttggactttcaccaaatttatgtcgatataaaaagatcagtacaaatttgttattgattttatttt tagaggctacatttcctatggtttgtgaccagactatagctagctacaatttttttattgtatttttattgcgaaaaacttagttgcatatattattc actaaaacagagattttttgtatagtaaacagtgaaggtaaaattgttagcaaacaaaaattttgtagagtcaagaaaagaatttttatatata tatatatatatattttttagaaacaacatatttttaataataaaaataggaagcttcaaatacagcattgaaaagagtttaacgaagaatttttgt tttcgattgtatttaaatttatataatatatacaaacaaaaaaaaaaaaaaaaaaaaaattgtcacgtgtgcgtttggtagctgtaaatgaatg catcttacacagtagcccacatgtcgattttggtttttcttcattttttcttcaccacatagctgttgtcttcaaaacaatcaacgagttttttagat ttgttgattttgttgttttggattattgttgattttgccattttagatttttcactttatctataaaaaaaaaaaaaactattttctgccacttaaaagct aaaattttgagaaactttttaaataaaaatatgtatttgagaattttgtttcattatgtttccattttttttttataaaatacataataacaaatattata ccctaaaaaaatagaaccaagtaaacctaaatgtgtaaattgtaactttagatataattttttcggcaaatctatgaatgccactaaaaatcc ttatctggtaattgattcatttatttatttatttatcacactatatcacatcatttacgttcacaatattcaacatattaggcggacaatttcttttgtc aacatcacggatctagtatttccttttgacatatctcgatctagaagatgaaagaaatagatatataggatgaaatgaatttaataccatcta aaagaacgttcctattatatatgctaatgtatagcatcaaaataccatttgtacaaagaaaaacaatagataatcgaatttaacagagttag attgataaatggtatttctttagttgtcacgttttgaaagcgtgattctattctcatgtttaaacatttgtcttaaacgttttgttatatatcatagac atgttagagatataactgaaaaaaaatcatttaaattagtttttgagtattttataattattcttttgggaatttcagtcatccaaaatcattcaac aatgttgcgccaaacagaagatggttcaaccactataatcaaaccatttttcaaatgatttcgttttttttgtttattttttggcttttgtggattac aaaccaaaacaataatttaaattatgatgatctctactttagtctatataaatacaatgaccatgaaaaaaatacactatgggtttggctgtttt cgttccaaatgttggcatgacctccaccgataatctgttgttgattaggtatttttaagtctgtcaatcgtgaatcgacatctgattgtcatcaa actcttattctataagatgcaaaagtagtaaagcataatcatttattttacataaacacattgtttattacttttgtacatgttgcaaaccgtcgc acggcgccgaaattcgttccctatctccttcacttcaaaagtcactgaagacatcaaaaagcaatattgtcgacatttatccacaactctttt aaaaacgtgtcttattaaatttatcatccaactagcttagcatgcaaggttttattatgtcgagtgtcgacctcaatattcaatagaaaaaaaa ggctggaataaaagaatatcatcgtttcattttggttttacaattttccctatttatatccccactcgtccttgtttcttccaccatctacaactttc attcttccactacatttctctccttgagtatcttcttatcctattttccaaattccaaaacaattcacaaa SEQ ID NO: 14 15919_at tttagatctcctaaaatatatatatatatatatttggaatttaaatacatggacaaaccaatatttaatcatataaactttaataataataataaat ggtatatgtgaggtgattatttcaaaaaatagatgtttacataaaaaaatagagcatgataatgaagaaaatacttaaaatatatagataact aaaccatataaaaatccatttgataatatagtggtccaccaaaaatctttcaaaatatttaaaaatcacgtttgttcacttcgacaaaaaaac aatttgtgatttacttgagggttgctagctctcccaacttttgttattggttgcaatttctttatatgaacttagttttgtttgtacgtagttgcctaa ataaaacactgaaaaacgtacaaagactacaaagtattactaattccgtaattactcaaaaatttaatatatgtgatcagtgcaattgatgat atagttagacaccgaacaaccatctgtcaaactcaaaagtcaataattttatataatttcctagtttcaccagccggctcatgatccgcatg caaatcttgaaatattcttgatagcacaataaatttattaaattctttgtatggggttcttatctccatattccatgttttatgtgtccttgtattaaat attgttaacaagagtcgagacatattaaacatgtcatgttccactattactaacttatcgtagataatgcttgccacaagataccgaaataaa tatatcatgttagcacacttctttggtttggtagttggatcgggtcatttccgatttaatctgtcgatttaagtgcaactaaagaaaatattcgat gtcgaccaatagaacaaacatgggctatatagatatatataacatttggtttttattttattttgttaaagaaaacatttggttgctattttcacat ggatcattataaattttggttttggatgctattaatctacaatcctcgtatagttatttattttcttctgtaacctcaaacatatatctaatgtgtgaa ctgaaataaaataagatataacccacttaacaataccaagttcacatgttagctacgccataaagtttcaaaatactaagacttcacgctcg catgctcaagcagcaagcacccacacaagtagtaacatatatatctatattttatttacattgtgctaaaatatctcttctagataagttttaaa acgagaatcatgagaaaaaaataatttataacaaaatttgttgatgatgttaggatgtagatcaatgttttataataatgatgttgtaaaaaag gcgataagtgtactttcaatcttgtttatcattaatatggcctttatcaaagtgtacactactaaaaaagacactgcaaaaacaatataatga gaacaagaacatttggaaattcagttcactataccttcttaatctgaagaatttgaaccactttaatagaacacttgtgatattaccttgaaatt tataaatcaaagttaatatacagattattctttctttaatttgttaatggactatacaagtcaaagatttaccaagacatacatggctaattgtaa ttaacaatctcgagcacacaatctacttttgttataaattgccgcatctatttatgaagacaccatgaagcagtaaaactaaaatacatctac aacgacggacatttaaagatgtttttacttgatataataatcaccatgttaatacggaaattacatgatattgagttatagataaaaatctagt agatacatcctaattatatatagcataataaagctttaaattgaaatgttgacaaggagatgcatgaatttaaaggcataggccatagctta gttaccatttttgtaaacgaccgtcttcgcaaccacttctttttctcgttgacctgacaaaagcttcaaattatagttattgtggattgactttatt ttacatagtgtaggttttgtttatcatcacaaattattttaacaatcaccatctctaatcttttacgccattaatattaatattttcataatatattttag cagtcagatttataaattgtacctatttattttgttttaaacagtaggttaatgataataatattaacaatttacaaaaaattatgtattaaaataac atgattattttttttttgtcgtttttgttacgctgaaaaattacatacccaatttaaatctcacttccaaaagacataaaaggattgttttttactttgt gaaaattacatattgacagtcctattttgatgggcctaaaaatggcccaatagtaattagtttgggcagcagcatttcacctctgcgacggt cggagctcatcttcaatcataacttcatcttcttcaagcaaatcaactaaactctgatcaatccagaaggagcgaaagagaactatagatc ggatgactaaattcccaacaaaccatagtttatccaaaattttccttggactaaaccggaatttccaccggttcagaattaaaccggtacg gtacacccaattcagcaacaacaaacaaaaataaaccagaatctcccgatcaccgcactggttacattcccggcgccggaaaccgcc tctactaccgcgtcgcagcgagtaagcatgtcttctgtcttcttcctcttatacttttcattagcgttgaaattaaggtttgaatatactcgaaat aagattggataaatcttctgcaattcgaagaaattcaacgagagagagattgctgaaaaaaaactaacctaaaaagcacgtcacaagg ccggcgagatatcttcaacaatggtcttcttctctttcgataaacaacaaataaaaaaattccaaaaggaagtaagaatagtcgtctctctg acttctctttaaaatgataagtcaaagtaaacaaattgatgccacggtgcttcctctttagcttgtgaatggtgtataataaaaactcttccttg ctctgactttgtctttcccattttaccaagtctttctttttgtccccaccatagttgcaattcttgattttctctcaggttttgaatcttttgggtcattt ggtctctcttctgctgttttcctctgaagattagagctttaccagagagataacttgttggagaagacaa

SEQ ID NO: 15

20223_at cttcttgtagcaaagctccaacatagaaatctcgttagacttctggggttctctgttgaaggagaagaaaagatacttgtctacgagtatat gccaaataaaagtcttgactattttctctttggtaagaaacatatgatatataggattagattctctgaaacatttgtttttgatctcttacccata gtctaatggctctatacgttggatgtgcagaccatagaaggaggggtcagctggattggagaacacgatacaacataatcaggggagt gactcgagggattttatatctccatcaagattcacggcttacaatcatacaccgtgacctcaaagcgggtaacattctcttagatgtcgata tgaacccgaaaatcgcggattttggtgtggctaggaattttagagtggaccaaactgaagctaccacaggaagagtagttggaacattg taagtaattgttaacttcaattacactctgtctattcccttttctttccctaataaaacttaaagtgatatgtgctgtgttttgcagcggttacatg cctcccgaatatgtggcgaacgggcagttctcgatgaaatctgatgtttatagttttggagtattgattctggagattattgttggcaaaaag agtagtagcttccatgagattgatggttcagtaggaaacttggtcacatatgttagtcctacaaagccaatgcaatcttgaacttatttttga cctctttaaactttgatacaagaatgaacattggtttattgtgacttaacaggtttggaggctttggaacaacgaatcattcttggaacttgta gacccggccatgggggagagttatgataaagatgaagtcatcagatgcatccatataagcttattgtgcgttcaagaaaatcctgcagat cgtccaacaatgtccacagtgtttcagatgctcactaatacttttcttactctgcccgtgcctcaattacctggatttgttttcagggtcagatc cgagccaaacccattagccgagagacttgagcctggtccgtctactaccatgtcgtttgcttgttccattgatgatgcatcgatcacgagt gttgatcttcgttgagattagaggttaatgataatatgcatagcttttcataagccaaaaatctaatggtcactttcattataaactcttcctgtc ttgttttcccacttaaaaagacaaaagcagttgacttatagtagtagtcaatcctctgtttcacgtaacagagagaagaagaaaatattcat aataattaggagattcatgatctgaaacaaaagctgaggaaatcgaacaatgtcttctggtgcctctttcatcttccttttcttcttcctcacta gcttcacagcttctgttgaaaatgttttctatataaagcatatttgcccaaatacgacaacttattcaagaaacagcccttacttgactaatct cagaacccttttgtcttctctttctgcccccaacgcctcttactctactggattccaaagcgccagggcgggacaagcccctgatagagtc accggacttttcctttgccgcggagacgtctcaccggcagtttgtcgtaactgcgtcgccttctccatcaacgacacactcgttcagtgtc cgagtgagagaaaatccgtgttttattatgatgagtgtatgctcagatactctgaccagaatattctctcgacccttgcatacgatggagca tggatcaggatgaacggaaatatttcaattgatcaaaatcaaatgaaccggttcaaagattttgtgtcgtctacgatgaatcaagctgccg tcaaagcggcgagcagtcctagaaagttctatacggtaaaggccacttggacagcactccagacgttgtacggcctggttcagtgcac tcctgatcttacaagacaagactgcttcagctgtctggaaagttccatcaaattaatgcctctttacaaaactggaggaagaactctttact ctagttgtaattcaaggtacgagcttttcgcgttctacaacgaaactactgttagaacacaacaagcaccaccaccgctacctccttcgtc tactcctctggtgacatctccttcactaccaggttaatttctccttcctctgtttcttaccctgatttcttgaaattagtcctttcaatttattttaggt ttgttctgccactatcaaatcttaagccaatgatctttgaaatgcagggaaaagttggaattcaaatgtgttagtggttgcaattgttctgacc atccttgtggctgctctacttttgatagctggttattgttttgcaaaaagggttaagaattcttctgataatgcaccagcctttgatggtaacatt caaatgattaacaatctcaattgggtttgactataatcttgtttgctatttttctgatcacagagacttttattgtgcaacaggagatgatataac aaccgagtcgctgcaacttgattatagaatgattcgagctgcaacaaataagttttcagaaaataataagataggtcaaggtggatttggt gaggtttacaaggtactattactacgaaattctcttaactttgtacgtttaattgaaatgttgtgtcaactcaacacatttggataacgagatg atgttgatgaaaacgaatagggtacattttcgaatggaactgaagtagcggttaagagactgtcaaaatcttcaggacaaggtgacaca gagttcaagaacgaggttgttgttgttgcaaagcttcagcatagaaatctggttaggcttctaggattttctataggaggaggagaaagg atattggtctacgagtatatgcccaacaaaagccttgattactttctctttggtcagttgcattttttgctttatttcaatgattctgtagctattcg tgaaacttgggggactaagcaatatctcacacagatcctgcgaagcaaaatcagctggactggactcgacgatacaaggtcattggag ggattgctcgaggaattttatatcttcatcaagattcaaggctcacaatcatacaccgtgacctcaaagcaagtaacattctcctggatgc ggatatgaatcccaaacttgctgattttggactggcaaggatctttgga SEQ ID NO: 16 15496_at agatttcaaagggaagctgctgctgctgcattgtcagagtttatacgctacaggtataatgttttcaatgtccttaaaactttcttttttttccatt ttgattttatttcctacaggtgtagttttatgtagtcttactcggcttagtgacacattgatctagatgcatgtaaccatctatctagtaagctctg tttggaaaaaaagttaaggtcaaagtgacaataatggttttagttctaagttatgtgtatataaaagataaggaaagaaagtcaaaggact gaagcatcttgcctgacatgtgttgtaaacaaagcacttccttggtaccttatcttcttaacttttctctactaatatttctgagttgcagtggtg attttagttctgtaatggaggagatggtcgaagcactctgtcgccatgtgtccgatgattctccgactgtaaggcgcctttgtctaagagg attagtgcaagtaagagtaattttcagcagtgtttatttacttatcttgattgtctaagagtactagtgcaagaaagagttatacggatcacctt tactccttatcatgatcttctagtaggcttaccataaagtatatgctcctgttggattattacaatgatgtcagatcaacagttaatatctaaag aaccctaaaacactcattatggagatgtgttatcttccactaagtaaaacaactttatacacatatttatagcatgttgatgcaatgagagtta cttgtaacatatgctagaggatagcttatcagtttttggactaaggtggtttacgaaattaaaattggtgtctgctgtttctcttttttcccaaatt tattattcctgagaatcatcacttagctgtttcgtggttttaccagatgccatctgcttgtatgagccactacacaactcaagttattggtgtaa tattagcgttgcttgatgatctggatgagtctgtgcaactaactgcagtgtcatgcttgttgatggtaatgctcaaacccattaacaactcaa ggcttctgaattctgactgtctgtcagatctgttagcaatattttttaatcttcatatacttgttttctttttattaggttacagagtcagcttctaat gatgctgttgaacctatcttgctgaatttatctgttcggcttcgtaaccttcaggtaaggtctagctttaagttacccaaaatgtttttataactg aaattaataaaaataaagcgtttaggccagagtcaagcttgaacagaagaaaaattgcaaaaccagttctctaagttcactatactgtcag atacattttttctgtaggagtgcgttgccactaattttacttgaaattccaatttgtaacaggttagtatggacccgaagatgagagccaatg cattttcagcacttggagctttaagtaaatatgctactggagggcaacgtgagggatttgttgagcaggtgacacaaacccttttcgtttcc ttttcaataatgtcgaggaaagaagtttttttcagttttaatctcattggatgaaaatgtctaatatcagattcattccacccttccacgcttggt agtgcatctccatgacgatgatcctagcataagacaggcttgtcgggtattttttctttatagcctattgctcctttttttgctttgaggtatcttt cagtttacatatccctttttattgaataggtaaccctcaagcggtttgctccactcgtggacataataaactattctaccctctatgattcacgt gcttttggttctgaagataggtatgtctcgccgtcctatgagtaccaaatctattttgtgcactttgaccactgttatctctaaaatggtttgtat tttcagaactgactatgaaaacttcgtaagggatctctcaaagcacttggttcaagagtcggaaagagttgatacttacatggcctcaacc atccaggttcggctctcctcgaataagcatcatagttgccaaattcataaactatatatatacaagaaaaactgaagtgagtactacccgtt gcaggcttttgatgcaccgtggccagtaattcaggcgaatgcaatacacttctccaccaccatgttgtcactctcagaggatcagcacat aatctctctctactacccacaggtatattagagaaactacatataacatgcacataagtctttattagttctcaagcctgtcatcttgttcaggt gtttgaaacgctggttagcaagatgacccggtcgcaagattcagttgtgagagcagcatgctcatcagcctttgggttactgctaagatc aagcaagtcaacactgtggagaggagctcgacttgacgggaccgactcaggtagaaaagccaatgatctcgaatctgttaagaaata acatgtgcattacggtctgtgtgaataccaaccagttactgccgaaaactttgggggggtttgcgatatatatccataggtacagtgtgca atgagaaaccatccaggtttttgtgcttgttgtaaagtgtattatgttttcatcttgtaaaggatattgtcactcgtgtgtcatctctattaccaaa ctcaggaaagaaacattcacacgaaattgttgtaggctgtggtcctctttttattgattataatttttgaggctagtgttggatatacttgtcttg acagagtccaacgtttgatttatcttcagttagtgtttcatatgagagtttaaacggtctttgaagtttcaaacacacattagattttggtaacat tggtaatttatttatgtggcctctatgtttattttgatttttgagacttgacgatagatgtagctatcactatcagtgagccctccaagttgttgttt tgtgtatgtgaattatcttcgttttctttatgaagatatgtttctaaacttttcctgagaaggaaggtcactacgatggtcacatacggacaaac taagtagcaagcacaatctgtggacttaaaaagaggtgtttggcaagtaaaaaactgtttacgtcatctgttacgtcttctgttcactttatgt tttactctccacgcatcttatcctttataagctcgcacaaatcttaaccaaaaccaaagcaaaacttgagagtttcttactaaggttgaatc

Claims

WHAT IS CLAIMED IS:

1. An isolated nucleic acid comprising a polynucleotide that specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l l, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, wherein the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1 % SDS.

X 2. The isolated nucleic acid of claim 1, wherein the sequence is SEQ ID NO:l.

3. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:2.

4. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:3.

5. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:4.

6. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:5.

7. The isolated nucleic acid of claim 1, wherein the sequence is SEQ ID NO:6.

8. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:7.

9. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:8.

10. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:9.

11. The isolated nucleic acid of claim 1 , wherein the sequence is SEQ ID NO: 10.

12. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO: l l.

13. The isolated nucleic acid of claim 1, wherein the sequence is SEQ ID NO: 12.

14. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:13.

15. The isolated nucleic acid of claim 1, wherein the sequence is SEQ ID NO: 14.

16. The isolated nucleic acid ofclaim 1, wherein the sequence is SEQ ID NO:15.

17. The isolated nucleic acid of claim 1, wherein the sequence is SEQ ID NO:16.

18. An expression cassette comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l l, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO: 16, and wherein the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS.

19. The expression cassette of claim 18, wherein expression of the heterologous polynucleotide in a plant enhances resistance of the plant to the pathogen.

20. A plant comprising an expression cassette comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16, and wherein the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS.

21. The plant of claim 20, wherein expression of the heterologous polynucleotide enhances resistance ofthe plant to the pathogen.

22. A method of enhancing resistance of a plant to a pathogen, the method comprising, introducing into the plant an expression cassette comprising a promoter operably linked to a heterologous polynucleotide, wherein the promoter specifically hybridizes to a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l l, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16, wherein the hybridization reaction is incubated at 42°C in a solution comprising 50% formamide, 5x SSC, and 1% SDS and washed at 65°C in a solution comprising 0.2x SSC and 0.1% SDS, and wherein expression ofthe heterologous polynucleotide enhances resistance ofthe plant to the pathogen.