WO2003076633A2 - Inhibition of germination in plants - Google Patents

Abstract

The invention concerns a method for controlled germination in plants wherein a plant is provided with a nucleotide sequence which when expressed is able to inhibit in the seeds of said plant an enzyme in the gibberellic acid (GA) biosynthesis pathway. Also provided in the invention is a novel rice P450 protein and its coding sequence which plays in role in the GA biosynthesis pathway. Inhibition of germination can be restored by (chemical) treatment with gibberellins.

Description

Title: Inhibition of germination in plants

The invention is in the field of plant biotechnology, more specifically in the area of controlled germination in plants, more specifically by inhibition of genes coding for enzymes in the gibberellic acid biosynthesis pathway.

Introduction

As a starting material, seeds derived from the reproductive development on the mother plants have well-controlled germination regulation. Some seeds can germinate right after maturation, some require desiccation to occur, some require conditional treatments such as low or high temperature, light, humidity, photoperiod etc. Dormancy is defined as the inability of a viable seed to germinate under conditions otherwise adequate for germination. Proper control of seed dormancy is essential for survival of plants. Dormant seeds can remain in the soil for a long period of time before germinating. Without proper dormancy control, germination may occur at undesirable moments such as: unfavorable weather conditions, while seeds still on the plant (pre-harvest sprouting), earlier or later than others (resulting in non-uniformity), or much later (becoming weeds for the following crop).

Expression of dormancy is affected by genetic and environmental factors, particularly the conditions prevailing during seed development and storage after harvest. Low temperature and high humidity during grain development are the main environmental factors inducing dormancy in barley. In most cereal plants, tissues peripheral to the kernel, rather than the embryo itself, may induce or maintain dormancy. The seedcoat is considered to exert its influence on embryonic activity and emergence by limiting oxygen supply.

Inception of dormancy occurs at early stages of seed development. In some species, artificially dried seeds are capable of precocious germination during the second week after anthesis and then dormancy gradually sets in during the third week. A desiccation period is needed to proceed from seed development to germination. The mechanisms that relieve dormancy after P T/NL03/00175

ripening are unknown, but may involve non-enzymatic oxidative reactions or may result from turnover of products inhibiting germination.

The balance between seed maturation, dormancy and seed germination is controlled by the interplay of several key plant hormones. ABA plays an important role during seed maturation by stimulating the expression of seed maturation related genes such as late embryogenesis abundant genes, seed storage component genes and dormancy related genes.

The phytohormone abscisic acid (ABA) plays a central role in seed maturation, both to suppress precocious germination and to induce the expression of maturation-associated genes for storage product accumulation and acquisition of desiccation tolerance. Mutants of Arabidopsis and tomato that are deficient in ABA synthesis have impaired seed maturation and dormancy (Koornneef and van der Veen, 1980; Koornneef et al., 1982). Similarly, ABA-deficient and ABA-insensitive mutants of tomato and Arabidopsis show no dormancy. In maize, ABA-deficient mutant kernels are viviparous, precociously germinating in spite of a large contribution of ABA from the maternal plant (Fong et al., 1983). These data have led to the supposition that a threshold level of ABA is required to block viviparous development. The timing of the ABA signal is also critical. Fong et al. (1983) showed that the ABA synthesis inhibitor fluridone produces precocious germination in maize only if given early in kernel development. These investigators speculated that embryo-derived ABA was essential in early development, and that maternal ABA or other physiological or mechanical aspects of the seed environment blocked germination at later stages (Fong et al., 1983).

The focus on the action of ABA in suppressing precocious germination has superseded assessment of other factors that may play roles in modulating the vivipary versus maturation decision. Frequently, germination has been considered to be a default developmental program that is suppressed by an appropriately timed ABA signal. While such a model is attractive in its simplicity, some data suggest that a positive factor is needed for germination of immature maize embryos. For example, fluridone-inhibition of ABA synthesis induces precocious germination only when treatments are applied during a narrow window of maize kernel development (Fong et al., 1983). Also, it has been reported that the ability of excised maize embryos to germinate varies in a stage-specific manner that cannot be directly correlated with endogenous ABA content (Rivin and Grudt, 1991). Similar results have been reported in wheat (Radley, 1979).

GAs are an important class of plant hormones involved in the regulation of processes from seed germination through the development and reproduction of plants. During the entire life cycle, GA promotes cell elongation; this role is particularly important given that plant form is entirely dictated by cell elongation and cell division in the absence of cell mobility. GA also acts as a regulator of key transition points in the plant life cycle by its ability to promote the germination of seeds and induction of flowering. Mutants defective in GA biosynthesis, such as gal can be male-sterile dwarfs (when some GA is still produced), whereas plants carrying severe alleles remain as rosettes unless treated with GA. When grown in a long-day photoperiod, they produce flower buds, although in the absence of GA the buds do not develop into viable flowers. In short days they do not produce flowers. When treated with GA the biosynthesis mutants are able to set seeds, but the seeds are unable _ to germinate in the absence of exogenous GA.

In contrast to ABA, a possible role for GAs in vivipary has received little attention, although biologically active GAs are known to be present during seed development in other species, including cereals (Jacobsen and Chandler, 1987). Gibberellin (GA) acts antagonistically with ABA to down-regulate the maturation/dormancy program and to initiate germination. Additionally, GAs are clearly important in the germination of many types of mature seeds. In wheat and barley, GA induces the expression of various hydrolytic enzyme genes, stimulating the mobilization of endosperm reserves (for review, see Jacobsen et al., 1995). GA is also involved in the release from dormancy of various species; GA-deficient mutants of Arabidopsis and tomato are impaired in this process, in addition to the other phenotypical abmormalities associated with GA deficiency, such as dwarfism, male sterility, inability to produce flowers, dark green color, etc, that occur in these GA deficient mutants, depending on the severity of the allele. Even though some aspects may be of interest, GA deficient mutants are economically not interesting since these dark green dwarfs usually have multiple developmental defects and are unable to produce seeds (Koornneef and van der Veen, 1980; Liu et al., 1994), although GA-deficient mutants of other species germinate efficiently (for review, see Reid, 1986). In many cases, ABA antagonizes these effects of GA, both at the level of gene expression (for review, see Jacobsen et al., 1995) and in modulating germination per se (Liu et al., 1994; Steber et al., 1998). In maize, a clear requirement for GA in the germination of mature seeds has not been demonstrated by the behaviour of mutants, and measurements of GA in developing maize kernels have been limited to very early development (Murofushi et al., 1991).

Gibberellins (GAs) are tetracyclic diterpenoid compounds that play an important role in many aspects of plant growth and development, such as promotion of cell division and extension, seed germination, stem growth, flowering, and fruit set (Crozier 1983). The pathway of GA biosynthesis has been elucidated in extensive biochemical studies, and the enzymes involved have been characterized (Fig. 1).

The GA biosynthetic pathway can be divided into three stages according to the type of reactions and enzymes involved (Hedden and Kamiya 1997; Phillips et al, 1995). Stage 1 involves the cyclization of geranylgeranyl diphosphate to e7i£-copalyl diphosphate, which in turn is converted to ent- kaurene. The enzymes that catalyze these reactions are called eπ,ϊ-copalyl diphosphate synthase and eπ,£-kaurene synthase, which in Arabidopsis are encoded by the GA1 (Sun and Kamiya 1994) and GA2 (Yamaguchi et al. 1998b) genes, respectively. In the second stage, the P450 monooxygenase eτι£-kaurene oxidase, encoded by GA3 of Arabidopsis (Helliwell et al. 1998), sequentially oxidizes C-19 of eπ-i-kaurene via eπ.i-kaurenol and erci-kaurenal to ent- kaurenoic acid, which is further oxidized to ent-7 hydroxy kaurenoic acid. This is followed by contraction of the B ring with extrusion of C-7 to give GA12- aldehyde, which is in turn converted to GA12. Soluble dioxygenases catalyze the final steps of the pathway to produce bio-active GAs (including GA 20- oxidases and GA 3beta-hydroxylases). During seed development GA is synthesized as non-bioactive precursors, which are converted to biologically active GA forms very early during imbibition. Active GA can be inactivated by the addition of an OH group at the C-2 by GA 2beta-hydroxylases. It has also been shown that seed germination of WT and phytochrome-deficient mutants was inhibited by uniconazole (an inhibitor of an early step in biosynthesis of GA, the oxidation of ent-kaurene) and prohexadione (an inhibitor of late steps, namely, 2 beta- and 3 beta-hydroxylation, Yang et al, 1995).

Since dormancy is unpredictable and hard to control it is an undesirable trait in crop plants. The majority of commercial crops have non- dormant seeds. The disadvantage of this lack of dormancy is that seeds may germinate while still on the plant during wet conditions just prior to harvesting. Pre-harvest sprouting causes devastating damage in a number of crop plants since the pre-sprouted seeds once harvested and dried can no longer germinate. Furthermore, during the pre-harvest sprouting a number of physiological processes related to germination such as amylase production in wheat, cause damage to the quality of the grain. Pre-harvest sprouting is extremely deleterious to the quality of wheat flour, particularly in baking quality, due to the degradation of seed starch during germination. Physiological studies have established that pre-harvest sprouting in wheat is caused by the lack of embryo dormancy, allowing germination to proceed at an inappropriate moment. Therefore, in order to prevent pre-harvest sprouting, it is necessary to be able to regulate the time at which germination starts, either by controlling natural seed dormancy or by engineering a similar physiological mechanism. The ability to trigger germination chemically in seeds that are unable to germinate without this chemical would alleviate all of these problems.

Summary of the invention

The invention now concerns a method for the inhibition of germination in plants characterised in that a plant is provided with a nucleotide sequence which when expressed is able to inhibit an enzyme in the gibberellic acid (GA) biosynthesis pathway and wherein the expression of said nucleotide sequence is under control of a seed specific promoter.

A specific embodiment of the invention is a method as above wherein said nucleotide sequence comprises a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:l, SEQ ID NO:3 or other GA biosynthesis genes such as the GA1 sequence, or homologues or variants thereof.

Also provided in the invention is a method for inhibition of germination wherein a plant is transformed with one or more plant expressible nucleotide constructs which upon transcription yield a double stranded RNA which is homologous to at least a stretch of 40 nucleotides to the nucleotide sequence coding for an enzyme in the gibberellic acid biosynthesis pathway. Preferably such a nucleotide sequence coding for an enzyme in the gibberellic acid biosynthesis pathway is selected from the group of SEQ ID NO:l, SEQ ID NO: 3 and the nucleotide sequence encoding GAl. The homology is 70%, more preferably 80%, even more preferably 90% and most preferably 100%. Further part of the invention is a rice germination related P450 protein having the amino acid sequence as depicted in SEQ ID NO:2 or a variant thereof and the nucleotide sequence coding for this protein, which preferably comprises the nucleotide sequence as depicted from nucleotides 113-1558 of SEQ ID NO:l. The invention further provides for a plant expressible construct comprising a seed-specific promoter operably linked to the above mentioned nucleotide sequence or at least a part thereof having 40 or more nucleotides. In this construct the nucleotide sequence can also be provided in the anti-sense direction or in the form of an inverted repeat for yielding double stranded RNA.

Further part of the invention are plant expressible constructs comprising a seed specific promoter operably linked to a nucleotide sequence having a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:3 or the GAl sequence, or homologues thereof.

The invention also provides the possibility to knockout such a gene by T-DNA insertion, point mutation (which can be detected in mutagenized population using methods like TILLING or DELETAGENE) or deletion, if the particular gene is at least expressed in the seed and not essential for the plant to survive.

The invention also comprises vectors comprising the above mentioned constructs and Agrobacterium comprising such a vector. Further part of the invention is a plant transformed with one of the above mentioned plant expressible constructs, vectors or Agrobacteria, and seed from such a plant.

Also a method for inducing germination in such a seed wherein said seed prior to sowing or during immbibition is treated with gibberellin (giberellic acid or a precursor of gibberellic acid), is part of the invention. Description of the figures

Figure 1. The biosynthesis pathway of GA. The key players in this pathway have either been identified through biochemical analysis, or genetic dissection. The names of the mutants defective in different steps of the pathway are showed in frames. Two cytochrome P450 genes, GA3 (CYP701A3) and Dwarf3 (CYP88A), have been found to encode GA biosynthesis enzymes.

Figure 2. The cDNA (1,738 bp) and amino acid sequence of the GRP isolated from rice, which corresponds to the CYP87A subfamily of the cytochrome P450. The start and stop codons are marked with frame. The EST sequence is underlined.

Figure 3. The alignment of rice GRP protein sequence with a member of related P450 proteins from different species. The accession number of the proteins are: 9502380 (AtCYP87A2), AAC05093 (AtDWF4), Q42569 (AtCYP90Al), Q43246 (maize DWF3), Q43147 (tomato DWF), U32579 (maize DWF3) and AAK11565 (AtDWF3).

Figure 4. The evolutionary relationship of GRP protein with other related P450 proteins identified in different plant species. A. A phylogenetic tree made by MegAlign software using ClustalV method (DNASTAR package). B. The peptide sequences identity in comparison with other proteins showed in A.

Figure 5 Northern blot (A) and RT-PCR (B) analysis of GRP gene expression in rice.

Figure 6 Northern analysis of the expression of GRP gene after treatment of 7-day old rice seedlings with ABA, BR and IAA. A) Treatment of 0.1 μM ABA for 2, 4, 8 and 12 hours; B) Treatment of 1 μ M BR for 4, 6, 12 and 24 hours; C) Treatment of 0.1 μM IAA for 2, 4, 8 and 12 hours. Fig. 7 Diagrammatic drawing showing the binary constructs made for rice transformation.

Fig. 8 Rice transformation via Agrobacterium inoculation in immature embryos. A: freshly isolated immature embryos from rice; B: callus formation after Agrobacterium co-cultivation; C: Km resistant calli obtained; D: plantlets regenerated from transgenic calli; E) Putative transgenic rice growing in greenhouse. F) TI seeds on Km selection media.

Fig. 9 PCR analysis to identify the p35S-anti-GRP transgenic lines. Among the five lines tested, four of them(#l, 2, 4, 5) showed positive, and one (#4) is negative. Plasmid DNA was used as positive control (+). M: molecular weight marker.

Fig. 10 Phenotype analysis of rice plants carrying anti-sense GRP. Expression of anti-sense GRP under the control of CaMV 35S promoter leads to the shorter panicle (B as compared to WT in A) and shorter plants (D as compared to WT in C). The TI seedlings showed shortness (F as compared WT in E), which can be partially recovered by BL treatment (G).

Fig. 11 PCR analysis to identify the pGluB-anti-GRP transgenic lines. Among the five lines tested, two of them (#3, 4) showed positive, and two (#1, 2) showed negative. Plasmid DNA was used as positive control (+). M: molecular weight marker.

Fig. 12. Germination experiment of the TI seeds from the pGluB-anti-GRP transgenic lines. A) WT seeds showed 100% germination. B) transgenic seeds carrying the pGluB-anti-GRPconstruct showed very low germination rate (2 in 13). C) pGluB- anti- GRP transgenic seeds germinated well on the plate supplied with lOmg/L GA. Figure 13. Diagrams of the RNAi constructs used to engineer controlled germination in Arabidopsis

Detailed description of the invention

We now have surprisingly found that seed-specific inhibition of an enzyme which is active in the GA biosynthesis pathway yields inhibition of germination without side effects on plant growth and development, which is normally associated with GA-deficient mutants. This finding is based on the hypothesis that GA is an essential positive stimulus for germination. Inhibition of GA biosynthesis may lower the content of GA or precursors of GA in the seeds, which leads to germination deficiency. Such defects could be recovered through supplementation of gibberellins (GA or GA precursors) to the seeds when germination is needed. . The results presented here show that seed-specific inhibition of a gene causes inhibition of germination of that seed, which can be restored by application of gibberellins. .

In principle all genes that control a step i the GA biosynthetic pathway can be shut down specifically during seed development or imbibition and would yield this surprising effect. A prerequisite for this, of course, is that these genes should be critical to the GA biosynthetic pathway, and that no other genes take over its function in the absence of the gene product. Such genes include ent-kaurene oxidase (GA3), ent-kaurene synthase B (GA2), ent- kaurenoic oxidase 1, and many others. Preferably for GA3 the enzyme from Arabidopsis is used (EMBL accession numbers AF047719-21), which is a member of the P450 gene family (Helliwell et al, 1998). Also for GA2 preferably the Arabidopsis gene can be used (Yamaguchi et al, 1998) , while for ent-kaurenoic oxidase 1 the gene from barley (Helliwell et al, 2001) can be used. It is also possible to x inhibit two genes with the same enzymatic activity at the same time in a seed-specific manner, such as can be done for ent- kaurenoic acid oxidase 1 and 2 (CYP88A3 and CYP88A4), which both catalyse the same three steps in the GA biosynthetic pathway (Helliwell et al, 2001). The schematic drawing of the GA biosynthetic pathway in Fig. 1 shows further enzymes which can be inhibited according to the present invention.

Most preferably used is the GAl gene (encoding ent-kaurene synthase A, under the new nomenclature named ent-copalyl diphosphate synthase (CPS)) from Arabidopsis. This gene has been cloned and characterized by Sun et al (1992) and the sequence has been published (mRNA in GenBank accession number U11034, the genomic sequence is contained in BAG T58J from chromosome IV (accession number AC004044) at mRNA position 34857-41903.

We have now also found a novel gene from rice which is part of the cytochrome P450 family and which when down-regulated inhibits seed germination. This gene is believed to be involved in the GA biosynthetic pathway (although maybe not directly in the synthesis route for gibberellic acid). The encoded protein is further nominated in this application as the rice GERMINATION RELATED P450 (GRP ) protein. The experiments show that inhibition of this gene is equally applicable as a method for controlled germination in plants. The role of cytochrome P450 enzymes in plants is poorly understood and only a few of them have been characterized to some extent. Cytochrome P450 represents a family of haem-containing proteins, most of which catalyse NADPH- and O₂-dependent hydroxylation reactions. Plant P450s participate in myriad biochemical pathways including those devoted to the synthesis of plant secondary products, such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides and glucosinolates, and plant growth regulators such as gibberellins, jasmonic acid and brassinosteroids. P450 is one of the largest gene families in Arabidopsis. There are 286 members in the P450 gene family in Arabidopsis according to the annotation to the genomic sequence (The Arabidopsis genome initiative, 2000). The function of most of these genes is unknown. The discrepancy between the number of known P450-catalysed reactions and the number of putative genes in Arabidopsis suggest that a large number of metabolic reactions yet needs to be identified.

The amino acid sequence of this rice GRP is provided in SEQ ID NO:2.

The word protein means a sequence of amino acids connected through peptide bonds. Polypeptides or peptides are also considered to be proteins. A protein leader comprises the protein sequences encoded in the open reading frame which are not present in the mature protein. It may comprise a signal peptide needed for translocation to the ER and a propeptide, which is cleaved off during the posttranslational processing.

Variants of the protein of the invention are proteins that are obtained from the proteins depicted in the sequence listing by replacing, adding and/or deleting one or more amino acids, while still retaining its biological activity. Such variants can readily be made by protein engineering in vivo, e.g. by changing the open reading frame capable of encoding the protein so that the amino acid sequence is thereby affected. As long as the changes in the amino acid sequences do not altogether abolish the activity of the protein such variants are embraced in the present invention. Further, it should be understood that variants should be derivable from the proteins depicted in the sequence listing while retaining biological activity, i.e. all, or a great part of the intermediates between the variant and the protein depicted in the sequence listing should have biological activity. A great part would mean 30% or more of the intermediates, preferably 40% of more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 99% or more.

Also comprised in the invention are homologous proteins which are derived from other plants (also called orthologues). As an example of such homologous proteins the orthologue from Arabidopsis is provided in this application (SEQ ID NO:4), which is denominated as AtCYP87A2 of which the gene can be found in the Arabidopsis genome (on BAG AC025417, chromosome I). Several ESTs for this gene have been disclosed (Gen Bank accession numbers: AI995175, H77048 and N37614), but no putative function has been described and no mutants are known. It will be clear for a person skilled in the art that on basis of the nucleotide sequences coding for both the rice and the Arabidopsis protein orthologues from other plant species can be easily found.

GRP orthologues could be identified through database searching in NCBI GenBank. Based on sequence similarity and alignment analysis using minimal gap size in the alignment, we found that the GRP has the highest amino acid (AA) sequence similarity with another member of CYP87A protein encoded in rice genome (47.9%), followed by Arabidopsis Cyp87A2 as depicted in SEQ ID NO:4 (46.4%), and sunflower CYP87A (45.1%), then a third CYP87A protein from rice (CYP87A1, 44.8%), and then the fourth copy of CYP87A from rice (41.8%). In the Arabidopsis genome, only one copy of the CYP87A encoding gene has been found. The Arabidopsis CYP87 family contains only one member, which means that all other p450s in the Arabidopsis genome share less than 41% AA sequence identity with this gene, since P450 families are defined to contain those genes with more than 41% AA sequence identity. The fact that the GRP has such high similarities with CYP87A from highly divergent species such as rice and sunflower, indicates that a cut-off of 41% suffices to identify additional orthologues. Therefore, a minimum 41% peptide identity could be used as cut-off line for identifying this particular subfamily.

The present invention also provides the nucleotide sequences coding for the rice GRP of which the amino acid sequence is depicted in SEQ ID NO:2. Preferably, the nucleotide sequence comprises the nucleotide sequence of SEQ ID NO:l, more preferably a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO:l from nucleotide 113 to nucleotide 1558. Also part of the invention are nucleotide sequences which are conservatively modified variants of the above mentioned sequences or polymorphic variants thereof. Those of skill in the art will recognise that the degeneracy of the genetic code allows for a plurality of polynucleotides to encode for the identical amino acid. Such "silent variations" can be used, for example, to selectively hybridise and detect allelic variants of the nucleotide sequences of the present invention. Additionally, the present invention provides isolated nucleotide sequences comprising one or more polymorphic (allelic) variants of the above nucleotide sequences. Further part of the invention are polynucleotides still coding for a protein which has a biological function identical to the function of the rice GRP, which are the product of amplification from a nucleotide library using primer pairs which selectively hybridise under stringent conditions to loci within the above mentioned nucleotide sequences. The primer length in nucleotides is selected from the group of integers consisting of from at least 15 to 50. Those of skill in the art will recognise that a lengthened primer sequence can be employed to increase specificity of binding (i.e. annealing) to a target sequence. Stringent conditions in this respect means a reaction at a temperature of between 60°C and 65°C in 0.3 strength citrate buffered saline containing 0.1% SDS followed by rinsing at the same temperature with 0.3 strength citrate buffered saline containing 0.1% SDS.

Thus, also part of the invention are polynucleotides which selectively hybridise, under selective hybridisation conditions, to one or more of the above discussed nucleotide sequences, and which code for an amino acid sequence which has a biological function similar to the function of the rice GRP of the invention. Another way to indicate hybridisation potential is on sequence identity. In this sense, the present invention provides also for nucleotide sequences which have a percentage of identity related to the above mentioned sequences of 40% to 95% . Thus, for example, the percentage of identity can be at least, 40%, 45%, 50%, 55%, 60%,- 65%, 70%, 75%, 80%, 85%, 90%, or 95% . Sequence identity on nucleotide sequences can be calculated by using the BLASTN computer program (which is publicly available, for instance through the National Center for Biotechnological Information, accessible via the internet on http://www.ncbi.nlm.nih.gov/) using the default settings of 11 for wordlength (W), 10 for expectation (E), 5 as reward score for a pair of matching residues (M), -4 as penalty score for mismatches (N) and a cutoff of 100.

An example of a nucleotide sequence which fulfills the above conditions is the nucleotide sequence encoding the Arabidopsis AtCYP87A2 proetein, as depicted in SEQ ID NO:3.

The inhibition of the gene involved in the biosynthesis of GA should be seed-specific. This enables control at the site where the GA exerts its effect on the germination and prevents unwanted effects of the inhibition on GA- mediated processes in the rest of the plants. It thus prevents the occurrence of aberrant phenotypes (such as dwarfed plants) which are found in the known mutant plants that are hampered in their GA biosynthesis. Seed-specific inhibition can be obtained by seed-specific expression of an inhibiting gene construct (the essence of which will be detailed below). Thus, in order to obtain seed-specific expression such a construct should be placed under control of (operably linked with) a seed-specific promoter. These promoters are well- known in the art and readily obtainable by the skilled person. Examples of promoters which are known to give seed-specific expression are: the nap in promoter (Stalberg et al., 1993), the endosperm-specific promoter GluB-1 (Takaiwa et al, 1996), the FAE1 promoter, for example the FAE1 promoter from Arabidopsis (Rossak et al, 2001), the oleosin promoter, for example the oleosin promoter from Arabidopsis (Plant et al, 1994), the β-phaseolin promoter, for example the β-phaseolin obtainable from french bean (Bustos et al, 1991), the glutenin promoter, such as the one obtainable from rice (WasMda et al, 1999), the promoter of the Arabidopsis thaliana 2S albumin gene (Vandekerckhove et al, 1989) and the cruA promoter of Brassica napus (Ryan et al, 1989). Further, in order to achieve specific expression in potato tubers, the patatin (B33) promoter (US Patent 5,436,393), the MOT (malate oxogluterate translocator) promoter (WO 99/06578) or any other promoter able to drive expression in tissues prone to sprouting such as the tuber phloem restricted version of the RolC promoter, may be used. At the other end of the construct a terminator is provided which causes transcription to stop. This can be any terminator which functions in plants. Particularly preferred are the NOS, OCS and 35S terminator or the potato protease inhibitor II (potpill) terminator.

Inhibition of the above mentioned genes is preferably accomplished by providing a plant with a construct which is able to express an inhibiting compound in the seed. Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and/or mRNA product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of outward properties of the cell or the organism (in the specific case of the invention, the inability to germinate or sprout) or by biochemical techniques such as RNA solution hybridisation, nuclease protection, Northern hybridisation, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS). Basically, three methods for inhibition are known at this moment and included in this application: antisense expression, sense co-suppression and RNA- inhibition. However, the invention is not limited to these methods and any other method which causes silencing of the endogenous gene is included.

For antisense expression, a nucleotide sequence coding for a gene involved in the GA biosynthetic pathway, its homologue or variant, or at least a part thereof of 40 nucleotides or more, is put behind a seed-specific promoter in anti-sense direction. After transcription of this nucleotide sequence an mRNA is produced which is complementary to the mRNA formed through transcription of the endogenous GA biosynthetic pathway gene of the plant. It is well proven by now that production of such an anti-sense mRNA is capable of inhibition of the endogenous expression of the gene for which it is complementory. Furthermore, it has been proven that to achieve this effect even sequences with a less than 100% homology are useful. Also antisense mRNA's which are shorter than the endogenous mRNA which they should inhibit can be used. Generally, it is accepted that mRNA sequences of 40 nucleotides or more which have a homology of 70% or more will be capable of generating an inhibitory effect. The principal patent reference is EP 240,208 of Calgene Inc. There is no reason to doubt the operability of antisense technology. It is well-established, used routinely in laboratories around the world and products in which it is used are on the market.

The second approach is commonly called sense co- suppression. This phenomenon occurs when the gene involved in the GA biosynthetic pathway or part of said gene is expressed in its sense direction. Although this kind of expression when full length genes are used most often results in overexpression of the gene, it has been found that in some cases and especially in cases when a sequence shorter than the full length sequence is used, expression of this gene or fragment causes inhibition of the endogenous gene. The principal patent reference on sense co-suppression is EP 465,572 in the name of DNA Plant Technology Inc.

Sense and antisense gene regulation is reviewed by Bird and Ray (Gen. Eng. Reviews 9: 207-221, 1991). Gene silencing can thus be obtained by inserting into the genome of a target organism an extra copy of the target gene coding sequence which may comprise either the whole or part or be a truncated sequence and may be in sense or in antisense orientation. Additionally, intron sequences which are obtainable from the genomic gene sequence may be used in the construction of suppression vectors. There have also been reports of gene silencing being achieved within organisms of both the transgene and the endogenous gene where the only sequence identity is within the promoter regions.

The third possible way to silence genes is by using the so-called RNAi technology, which covers all applications in which double-stranded RNAs are used to achieve silencing of an endogenous gene. As has been demonstrated by Fire et al. (Nature, 391: 806-811, 1998) application of a dsRNA of which one strand is at least partly complementary to the endogenously produced mRNA whether produced intracellularly or added extracellularly is extremely capable of inhibiting translation of the mRNA into a protein. It is believed that this phenomenon works through the intermediate production of short stretches of dsRNA (with a length of 32 nucleotides). To achieve production of dsRNA a construct is made harbouring both a sense and an antisense nucleotide sequence (together also called an inverted repeat) of at least 40 nucleotides of which one is complementary to the endogenous gene which needs to be silenced. The sense and antisense nucleotide sequences can be connected through a spacer nucleotide sequence of any length which allows for a fold back of the formed RNA so that a double stranded RNA is formed by the sense and antisense sequence. The spacer then serves to form the hairpin loop connecting both sense and antisense sequence. The order of the sense and antisense sequence is not important. It is also possible to combine more than one sense-antisense combination in one and the same construct. If the simple form is depicted as: prom - S - spac — AS - term, also the following constructs can be applied: prom - SI - spac — AS1 - spac - S2 — spac — AS2 — term, or prom - S2 — spac - SI — spac - AS1 - spac — AS2 — term. Variations in the built up of the construct are possible, as long as the end product of the transcription of said constructs yields one or more dsRNAs. Alternatively, the double stranded structure may be formed by two separate constructs coding for complementary RNA strands, where RNA duplex formation occurs in the cell. In short notation these constructs then look like: proml-Sl-terml and prom2- ASl-term2. Proml and prom2 can be the same or different but should both be seed-specific promoters, terml and term2 can be the same or different. Both constructs can be introduced into the cell on the same vector, but can also be introduced using two different vectors.

RNA containing nucleotide sequences identical to a portion of the target gene are preferred for inhibition. RNA sequences with insertions, deletions and single point mutations relative to the target sequence have also been found effective for inhibition. Thus, sequences with a sequence identity of less than 100% may be used. Sequence identity may be calculated by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Aanlysis Primer, Stockton Press, 1991, and references cited therein), for instance by using the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g. University of Wisconsin Computing Group). Thus, the duplex region of the RNA may be defined functionally as a (double stranded) nucleotide sequence that is capable of hybridising with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 M EDTA, 50°C to 65°C hybridisation for 12-16 hours; followed by washing). The length of the identical nucleotide sequences should be at least 40 nucleotides, but preferably larger: 50, 100, 200, 300 or 400 bases.

As disclosed herein, 100% sequence identity between the inhibiting construct and the target endogenous gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence.

Thus also included in the invention are constructs having a nucleotide sequence under control of a seed-specific promoter wherein said nucleotide sequence comprises a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:l, SEQ ID NO:3 or the GAl sequence, or homologues or variants thereof.

The recombinant DNA constructs for use in the methods according to the present invention may be constructed using recombinant DNA technology well known to persons skilled in the art. The recombinant gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene product in the transformed cells. Preferably used are binary vectors which are useful for plant transformation using Agrobacterium.

Selectable markers, which may be included as a part of the introduced recombinant DNA, are used to select transformed cells (those containing recombinant DNA) over untransformed cells. Examples of suitable markers include genes that provide antibiotic or herbicide resistance. Cells containing the recombinant DNA are capable of surviving in the presence of antibiotic or herbicide concentrations that kill untransformed cells. Examples of selectable marker genes include the bar gene which provides resistance to the herbicide Basta; the nptll gene which confers kanamycin resistance; the hpt gene which confers hygromycin resistance; and the cah gene which gives resistance to cyanamid. An entire plant can be generated from a single transformed plant cell through cell culturing techniques known to those skilled in the art.

Although the invention is illustrated in transgenic rice and Arabidopsis, the actual applicability of the invention is not hmited to these plant species. Any plant species can be provided with a recombinant DNA sequence according to the invention, but preferred are plant species which normally produce seeds.

This invention could also provide a way to prevent unwanted seed germination through gene knockout of the abovementioned genes using T-DNA insertion, point mutation and deletion which can be detected in a large population using technologies such as PCR, TILLING and DELETAGENE, if the particular gene is at least expressed in the seeds and is not essential for normal plant growth and development.

Although some of the embodiments of the invention may not be practicable at present, for example because some plant species are as yet recalcitrant to genetic transformation, the practising of the invention in such plant species is merely a matter of time and not a matter of principle, because the amenability to genetic transformation as such is of no relevance to the underlying concept of the invention.

Transformation of plant species is now routine for an impressive number of plant species, including both the Dicotyledoneae as well as the Monocotyledoneae. In principle any transformation method may be used to introduce chimeric DNA according to the invention into a suitable ancestor cell. Methods may suitably be selected from the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al, 1982, Nature 296. 72-74; Negrutiu I. et al, June 1987, Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (Shillito R.D. et al, 1985 Bio/Technol. 3, 1099-1102), microinjection into plant material (Crossway A. et al, 1986, Mol. Gen. Genet. 202, 179-185), (DNA or RNA-coated) particle bombardment of various plant material (Klein T.M. et al, 1987, Nature 327, 70), infection with (non-integrative) viruses, in planta Agrobacterium tumefaciens mediated gene transfer by infiltration of adult plants or transformation of mature pollen or microspores (EP 0 301 316) and the like. A preferred method according to the invention comprises Agrobacterium-m.edia.ted DNA transfer. Especially preferred is the use of the so-called binary vector technology as disclosed in EP A 120 516 and U.S. Patent 4,940,838).

Although considered somewhat more recalcitrant towards genetic transformation, monocotyledonous plants are amenable to transformation and fertile transgenic plants can be regenerated from transformed cells or embryos, or other plant material. Presently, preferred methods for transformation of monocots are microprojectile bombardment of embryos, explants or suspension cells, and direct DNA uptake or (tissue) electroporation (Shimamoto, et αl, 1989, Nature 338, 274-276). Transgenic maize plants have been obtained by introducing the Streptomyces hygroscopicus bαr-gene, which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin), into embryogenic cells of a maize suspension culture by microprojectile bombardment (Gordon-Kamm, 1990, Plant Cell, 2, 603-618). The introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13, 21- 30). Wheat plants have been regenerated from embryogenic suspension culture by selecting embryogenic callus for the estabhshment of the embryogenic suspension cultures (Vasil, 1990 Bio/Technol. 8, 429-434). The combination with transformation systems for these crops enables the application of the present invention to monocots.

Monocotyledonous plants, including commercially important crops such as rice, wheat and corn are also amenable to DNA transfer by Agrobacterium strains (vide WO 94/00977; EP 0 159 418 BI; EP 0 856 060; Gould J, Michael D, Hasegawa O, Ulian EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426- 434).

Generally after transformation, plant cells or cell groupings are selected for the transfer with the nucleic acid sequence encoding the protein according to the invention, following which the transformed material is regenerated into a whole plant.

Following DNA transfer and regeneration,- putatively transformed plants may be evaluated, for instance using Southern analysis, for the presence of the recombinant DNA according to the invention, copy number and/or genomic organization. In addition, or alternatively, expression levels of the newly introduced DNA may be undertaken, using Northern and/or Western analysis, techniques well known to persons having ordinary skill in the art.

The invention thus provides a method to inhibit germination of seeds in seed-producing plants. However, in order to breed further with plants being genetically altered it is necessary to restore the germination. This can be done by externally applying GA to the seeds. This external hormone stimulus will replace the effect which would have been otherwise obtained by the endogenous production of GA. GA here refers to any isoform of the gibberillins. When precursors of gibberelic acid (see fig. 1) are used, they are of course only applicable if the enzymes of the GA biosynthetic pathway starting with this precursor are not inhibited in the seeds thus treated.

This technology can be used to prevent preharvest sprouting. Pre- harvest sprouting is a general problem in crops such as wheat, barley, rapeseeds, etc. This is mainly caused by heavy rains during the harvesting season. In China, particularly in the middle part of China (Jian-Su, He-Nan, Shan-Dong, Si-Chuan and He-Bei provinces), this problem has caused 5-75% reduction on farmer's profit for wheat growers. Pre-harvest sprouting leads to partial degradation in starch and other storage products such as lipid and proteins, which greatly reduce the quality of the storage products in term of bread making and other applications. The seeds also lose their germination capacity if pre-harvest sprouting occurs. In some years wheat growers in Jiang-Su province can have no seeds for the following year. The same problem has also been observed in other countries such as Japan and Korea which have similar weather conditions.

Using the above mentioned gene construct, the transgenic seeds from plants such as wheat and barley will not be able to germinate in the absence of exogenously added hormone. This will prevent the germination of the seeds while they are still on the plant, which protects the quality of the seed storage components and the viability of the seeds. Before sowing the seeds in the following season, they will be treated with GA to recover their germination capacity.

Another application in which this technology can be used is the prevention of 'volunteers' from previous crops. Crops such as rapeseed and potato can be weed for the next growing season when seeds were shattered or tubers were left in the field during harvesting. This can be prevented if the seeds are unable to germinate without additional GA treatment, using the above introduced technology.

Transgenic plants produced according this technology can also be a potential weed-killer in the field. When their pollen pollinate the wild species P T/NL03/00175

in the field and its short-distance surrounding area, the offspring will not be able to germinate. Since the plants rely on pollination to spread such traits, and since no further spread occurs in the following generation (seeds will not be able to germinate), the ecological impact on biodiversity is minimal. With this mechanism a third application area is to prevent spread of GMO crops. If GMO crops also are provided with constructs according to this invention, undesired spread of the transgenic crops can be prevented.

A following application of the technology is to achieve uniform seed germination. This is very important to achieve an optimal production facility and to be able to minimise the number of harvests necessary to obtain all the produce from the field. Synchronisation of the germination can be obtained by starting with the transgenic seeds and simultaneously induction of the germination by treatment with GA.

Examples

Example 1: Cloning of GRP gene in rice

To analyse the function of different cytochromoe P450 genes in rice seed development, we searched the public database based on current sequence information about P450. One member of the cytochrome P450 EST (Accession No. G72122) was found in Oryza satiυa L. EST database. The sequence of this EST has the highest homology with the Arabidopsis CYP87A gene in the P450 family. Since this gene was later confirmed to be involved in seed germination, it was named GERMINATION-RELATED P450 (GRP), Gene-specific primers of GRP-1 (5'-GTGGAGGGAGGAGAAGAGAAGC-3') and GRP-2 (5'- TTGGATGTAATAGCGTTGAGGG-3') were designed according to the EST sequence to screen a pPC86 plasmid-based rice cDNA library that was arrayed in 96-well plates using PGR-based method. Positive clones were sequenced to obtain full-length cDNA clones. DNA sequencing was performed by TaKaRa Biotechnology company (Dalian, China). A full-length cDNA clone of GRP (Figure 2) was isolated, which has 1,738 nucleotides with one single open reading frame located between nucleotides 113(ATG) and 1,560(TGA). The predicted GRP protein has 482 amino acids with total molecular mass of 53 kDa (Figure 2). Figure 3 shows protein alignment of various genes in the P450 family. Based on phylogenetic analysis, the GRP gene seems most closely related to the GYP87A sub-family of the cytochrome P450 genes (Fig. 4A). GRP protein shares 46.4% sequence identity at the peptide level with the AtCYP87A2 protein from Arabidopsis, and 45.1% with the CYP87A protein from sunflower. The homology of GRP with other families of the P450 proteins is relatively low: 30.3% with the Arabidopsis DWF4, 29% with the tomato DWF, 29.7% with ROUNDIFOLIA proteins (Fig. 4B). Relatively high homologies were found with other uncharacterized rice ESTs (Fig 4). The Arabidopsis DWF4 gene has been shown to be involved in brassinolide synthesis pathway (Azpiroz et al., 1998; Choe et al., 1998).

To analyze the expression of the GRP, total RNAs were isolated by acid guanidinium thiocyanate-phenol-chloroform extraction procedures from various rice tissues. Seven-day old rice seedlings treated with ABA at the concentration of 100 μM for 2, 4, 8 and 16 hours, BR (1 μM 24-eBL) for 4, 6, 12, and 24 hours and IAA for 2,4,8 and 16hrs are also included to test if the expression of GRP is regulated by these hormones. One gram materials were powdered in liquid nitrogen, extracted with guanidinium thiocayanate-phenol- chloroform, precipitated by ethanol, purified with LiCl and chloroform. Total RNA (20-30 ug per lane) was re-suspended in nuclease-free water and separated in 1.5%(w/v) denaturing agarose gels with 15% (v/v) formaldehyde, and blotted onto Hybond-N⁺ membrane (Amersham). RNA was fixed onto the membrane by heating for 2 hrs at 80D. A 1,045 bps fragment generated by Sal I and EcoRI digestions was served as α-³ P-dCTP-labelled hybridization probe. Membrane were hybridized at 65D in 250 mM sodium phosphate buffer pH7.2 containing 7% SDS, 1% BSA, and ImM EDTA. High stringency washes were performed at 60°C in 2 x SSC, 0.5% SDS for 15 min and in 0.2 x SSC, 0.5% SDS for 20 min (Fieuw et al. 1995). Blots were exposed to Fuji X- films between intensifying screens for 4-5 days at -70°C. The results showed relatively high level of GRP mRNA in leaves, not detectable in roots, panicle and leaves (Figure 5A).

RT-PCR was also used to carry out the expression analysis. Total RNAs were reverse transcribed to first strand cDNAs using oligo(dT) primer (Superscript Pre-amplification System, Promega). cDNA produced from 30 μg of total RNA were used as templates in 20 μl of PCR mixture. PCR primers used to detect mRNAs of the GRP were 5' GTGGAGGGAGGAGAAGAGAAGC 3' and 5' TTGGATGTGATAGCCTTGAGGG 3'. The Oryza satiυa RAcl actin gene was used as a positive internal control, by using the primers of 5'- GAACTGGTATGGTCAAGGCT G-3' and 5'- ACACGGAGCTCGTTGTAGAAG- 3'. The amplified PCR products (10 μl) were fractionated by electrophoresis on a 2.5% (w/v) agarose gel, stained with ethidium bromide, and scanned using the gel doc 2000 (Bio-Rad company). The results from this experiment are similar to the results of Northern blotting, which is high expression level in shoots and not detectable in roots. Due to its sensitivity, the GRP gene was also showed expression in leaves and panicles.

Rice seedlings treated with IAA, BL and ABA were used to see if the expression of GRP gene is induced by hormones. The results indicate that the expression of GRP was highly induced by the 8-hour ABA treatment (Fig. 6A), slightly decreased after the 6-hour 24-eBL treatment (Figure 6B). IAA, to a lesser extent, also induced the expression of the GRP gene (Figure 6C).

Example 2. Functional analysis of GRP in rice

To characterize the function of GRP gene in seed development, constructs were made to suppress the expression of GRP gene using an antisense approach under the control of the CaMV 35S constitutive expression promoter. A 500 bp CaMV-35S promoter was used in a binary vector BinAR and digested with Smal and then dephosphorylated. DNA fragment of GRP (full-length cDNA) was digested with NotI and Sail, then blunted with T4 polymerase. Resulted DNA fragment was then ligated to the linarized BinAR vector mentioned above, resulted in a construct of p35S-anti-GRP that was checked with PCR and restriction enzymes to reveal the antisense orientation (Fig. 7).

Rice (Oryza satiυa Zhong-Hua 11, Japonica type) transformation was performed via Agrobacterium-mediΑied transformation using immature embryo as materials (Hiei et al., 1994). G418 resistant rice seedlings obtained after the Agrobacterium infection were transplanted into pots and the integration of T-DNA into rice genome was confirmed via PCR. Seeds collected from transformed plants were plated on agar-solidified sugar-free 1/2MS media using 30mg/L kanamycin as a selection regent. 50 transgenic seeds of each independent line were tested (Fig. 8). Among five lines tested by PCR analysis, four of them showed positive in carrying the transgenes (Fig. 9).

To compare the phenotypic effects resulting from expression of GRP in an antisense orientation, we measured plant height, panicle length, number of grains per panicle and grain weight per 1000 grains of two independent p35S- anti-GRP lines, as compared to wide types. The results indicate that the average plant height, panicle length, number of grains per panicle and grain weight per 1000 grains were reduced in the transgenic lines (see Table 1, Figure 10). The phenotype can be restored by 24-epi-brassinolide (24-eBL, Sigma, data not shown). Transgenic tobacco plants harbouring the same construct (p35S-anti-GRP) exhibited similar phenotypes (data not shown). Further analyses of transgenic plant in TI generation indicated that the transgenic plants harbouring p35S-anti-GRP also have delayed maturation (around two weeks).

Example 3. Using GRP to prevent germination of rice seeds.

To evaluate the possibility to use the GRP gene in controlling seed germination, a construct was made to express the GRP gene in antisense orientation under the control of an endosperm-specific promoter GluB-1 (Takaiwa et al, 1996). The binary construct of BinAR-35S was digested with EcoRI and Kpnl to remove the CaMV35S promoter region. GluB-1 promoter fragment was ligated to the same site and confirmed via PCR and restriction enzymes. Resulted plasmid harbouring GluB-1 was digested with Smal and then dephosphorylated. DNA fragment of GRP (full-length cDNA) was digested with NotI and Sail, then blunted with T4 polymerase. Resulted DNA fragment was then ligated to the linear vector with GluB-1 promoter, resulted in a construct of pGluB-anti-GRP that was checked with PCR and restriction enzymes to reveal the antisense orientation.

Transgenic plants harbouring pGluB- anti- GRP gene were obtained after transformation using immature embryos, as showed by PCR analysis (Fig. 11). The resulting four independent transgenic plants had no obvious phenotypic differences from the untransformed rice plants except slightly delayed maturation which is most likely to be caused by the tissue culture effect. However, the Tl seeds produced by these TO plants were unable to germinate under conditions that allowed germination of seeds from untransformed rice plants. Root protrusions can be observed in about 10% seeds.

The germination can be rescued when seeds were plated on medium with lOmg/1 GA3, but not with brassinosteroid. The results were summaried as follows: As shown in Fig 12, among 12 seeds tested, 1 seed germinated after 5 days culture, while in the control experiment 10 seeds from wildtype plants were germinated. After 20 days the germination frequency in the transgenic line is <10%, as compared to 83% in the control. However, supplementation with GA could recover the germination frequency of transgenic plants. When lOmg/L GA was added to the medium, the germination frequency reached 90%. (add the results from the repeated experiments).

Example 4. Finding homologs of rice GRP

Using the rice GRP cDNA to search the public database, several p450 genes with significant sequence similarity to the GRP gene were found. Three additional predicted rice ORFs of unknown function were identified, and searching the Arabidopsis genome revealed one gene (single member in a P450 family), the AtCYP87A2 clone, to have the highest sequence similarity to the rice P450 gene (SEQ ID NO:3, and figure 4). This Arabidopsis gene encodes the orthologue of the rice GRP cDNA. Other genes with sequence similarity are also shown in figure 4.

Example 5 Cloning of the Arabidopsis thaliana CYP87A2 silencing construct

The full gene and predicted introns of AtCYP87A2 are annotated in the Arabidopsis genome (on BAC AC025417, chromosome I) , and several ESTs have been found for this gene (GenBank accession numbers: AI995175, H77048 and N37614). However, no putative function of this gene has been described in the public domain, and no mutants are known. In order to create an RNAi construct for AtCYP87A2 fragments encoding the second exon of AtCYP87A2 were placed as inverted repeats in the pHannibal vector (Wesley et al., 2001) as follows.

Using the second exon of AtCYP87A2 (located on position 93083-93404 on BAC AC025417) an RNAi construct was made to shut down the AtCYP87A2 in seeds as follows. The primers TTAACTCGAG TATGGCCCAA TTTTCAAGAC CAATCTGGTG and TTAAGGTAC GCTTGCGGTT GCATCTTTGA GTTCTACTGA were used in a PCR reaction in genomic DNA from Arabidopsis thaliana Colombia, to generate a 339 bp PCR fragment containing the second exon of AtCYP87A2 flanked by Xhol and Kpnl sites, and TTAATCTAGA GTATGGCCCA ATTTTCAAGA CCAATCTGGT G and TTAAATCGAT GCTTGCGGTT GCATCTTTGA GTTCTACTGA were used to generate a 340 bp PCR fragment containing the second exon of AtCYP87A2 flanked by Xbal and Clal sites. These fragments were cloned into the pHannibal vector (Wesley et al., 2001). The resulting pHannibal87A2 construct containing AtCYP87A2 inverted repeats was modified to create seed specific shutdown of the AtCYP87A2 gene. This was done by removing the CaMV 35S promoter, and replacing it with the napin promoter (Stalberg et al., 1993). For this the NapA promoter and 5'UTR (bases 1 to 1145 from accession J02798 in GenBank) was PCR amplified from Brassica napus, using TAAGCGGCCG CAAGCTTTCT TCATCGGTGA TTGATTCCTT and AATTGTCGAC TATGTTTTTA ATCTTGTTTG TATTGATGAG generating an 1167 bp promoter/5'UTR fragment fianked by NotI and Sail sites. This fragment was cloned in the position of the NotI- Xhol CaMV 35S promoter fragment of pHannibal87A2, creating p87A2SeedStop.The complete construct was subsequently excised with NotI and inserted to binary vector pBINPLUS (van Engelen et al., 1995), generating pBIN87A2SS (see fig 11).

Example 6 Transformation of A thaliana with pBIN87A2SS

The binary constructs were confirmed by sequencing and transferred to Agrobacterium tumefaciens C58PMP90 before transformation to A. thaliana ecotype C24 using a floral dip method (Clough and Bent, 1998). Plants were grown until seeds could be harvested, and seeds were germinated on MS plates containing 100 μg/ml kanamycin and 100 μM GA4-7 in order to select kanamycin resistant seedlings containing the transgene.

Example 7 Phenotype of pBIN87A2SS transformed seeds

Once germinated in the presence of GA, the RNAi plants showed no morphological defects, and grew and developed normally. Flowering and seed set was normal. For wild type c24 seeds, storage at 4 degrees for 1 month is enough to allow after-ripening of the seeds, and normal germination of the after-ripened seeds occurs. However, when placed on moist filter paper or soil, the after-ripened transgenic seeds failed to germinate in the absence of GA. In the absence of GA only the 25% of seeds that were kanamycin sensitive (lacking the RNAi construct) were able to germinate. All seeds germinated normally on filter paper moistened with 100 μM GA4-7 or MS medium containing 100 μM GA4-7. When adding kanamycin to the GA containing MS medium, 75% of the seedlings remained green (containing the selectable marker) and 25% of seedlings bleached over time, indicating they were not transgenic. One week old seedlings were transferred from GA containing germination medium to the greenhouse, where they grew normally. These experiments demonstrate that the pBIN87A2SS construct conferred GA dependent germination to the Arabidopsis seeds, without altering other phenotypic characteristics.

Example 8 Cloning of GAl silencing construct

The GAl gene (encoding ent-kaurene synthase A, under the new nomenclature named ent-copalyl dphosphate synthase (CPS)) from Arabidopsis has been cloned and characterized (Sun et al., 1992). GenBank accession U11034 contains the mRNA sequence of this gene, and BAC T5J8 from chromosome IV (accession AC004044) contains the genomic sequence (mRNA position 34857-41903). An RNAi construct for shutdown of GAl in seeds was made using the fourth exon (nt 298-607 of U11034) from the GAl gene. The primers TTAACTCGAG AGATTAGTGT TGGAAGTAAT AGTAATGCAT TC and TTAAGGTACC CCTTTGTTGC ATTGATGAGG AAAGAGATTC were used in a PCR reaction on genomic DNA from Arabidopsis thaliana Colombia, to generate a 329 bp PCR fragment containing the fourth exon of Arabidopsis GAl flanked by Xhol and Kpnl sites, and TTAATCTAGA AGATTAGTGT TGGAAGTAAT AGTAATGCAT TC and TTAAGTCGAC CCTTTGTTGC ATTGATGAGG AAAGAGATTC were used to generate a 329 bp PCR fragment containing the fourth exon of Arabidopsis GAl flanked by Xbal and AccI (compatible with Clal) sites. These fragments were cloned into the pHannibal vector (Wesley et al., 2001). The resulting pHannibalGAl construct containing GAl inverted repeats was modified to create seed specific shutdown of the GAl gene. This was done by removing the CaMV 35S promoter, and replacing it with the napin promoter (Stalberg et al., 1993). For this the NapA promoter and 5'UTR (bases 1 to 1145 from accession J02798 in GenBank) was PCR amplified from Brassica napus, using TAAGCGGCCG CAAGCTTTCT TCATCGGTGA TTGATTCCTT and AATTGTCGAC TATGTTTTTA ATCTTGTTTG TATTGATGAG generating an 1167 bp promoter/5'UTR fragment flanked by NotI and Sail sites. This fragment was cloned in the position of the NotI- Xhol CaMV 35S promoter fragment of pHannibalGAl, creating pGAlSeedStop.The complete construct was subsequently excised with NotI and inserted to binary vector pBINPLUS (van Engelen et al., 1995), generating pBINGAlSS (see fig 11).

Example 9 Transformation of A. thaliana with pBINGAISS

The binary constructs were confirmed by sequencing and transferred to Agrobacterium tumefaciens C58PMP90 before transformation to A. thaliana ecotype C24 using a floral dip method (Clough and Bent, 1998). Plants were grown until seeds could be harvested, and seeds were germinated on MS plates containing 100 μg/ml kanamycin and 100 μM GA4-7 in order to select kanamycin resistant seedlings containing the transgene.

Example 10 Phenotype of pBINSSGAl seeds

Once germinated in the presence of GA, the RNAi plants showed no morphological defects, and grew and developed normally. Flowering and seed set was normal. However, when placed on moist filter paper or soil, the transgenic seeds failed to germinate in the absence of GA. In the absence of GA only the 25% of seeds that were kanamycin sensitive (lacking the RNAi construct) were able to germinate, indicating the presence of a single dominant gene conferring a GA dependent germinating phenotype to the seeds. For some lines only 6% of the seeds germinated in the absence of GA, indicating the presence of two independent transgene insertion loci conferring a GA dependent germination phenotype to the seeds. All seeds were able to germinate normally on filter paper moistened with 100 μM GA4-7 or MS medium containing 100 μM GA4-7. When adding kanamycin to the GA containing MS medium, 75% (or 94% for the transgenics containing two independent loci) of the seedlings remained green (containing the selectable marker) and 25% (or 6%) of seedlings bleached over time, indicating they were not transgenic. One week old seedlings were transferred from GA containing germination medium to the greenhouse, where they grew normally. These experiments demonstrate that the pBINSSGAl construct conferred GA dependent germination to the Arabidopsis seeds, without altering other phenotypic characteristics.

Example 11 Chemical synchronization and control of germination initiation

Seeds in which the GRP gene, or another gene involved in GA metabolism has been switched off, resulting in impaired gemination, can be triggered to germinate by applying GA during imbibition. GA application is needed for proper gemination, and several methods for application of GA can be envisioned. For example, dry seeds can be placed on moist filter paper or agar medium containing 100 μM GA₄ or other bioactive GA, such as GAi. The GA will be taken up by the seed during imbibition and germination will occur. Once germination has been triggered, externally added GA is no longer needed for plant growth and development. Alternatively, seeds can be pretreated with GA, for example by soaking for 4 to 48 hours in a GA solution, allowing synchronous uptake of water and GA during early imbibition, and can be subsequently placed on wet filter paper, sand, soil or other medium to allow progression of germination in the absence of added GA. Another way to add external GA to the seeds to allow germination is the method of coating or pelletting seeds with GA containing powder or mixture (along with the regular coating ingredients such as fungicides etc). The pelleted seeds can be sown according to normal farming practice, and during imbibition the GA becomes . solubilized and is taken up by the seed to trigger germination. Since all these methods provide external GA during imbibition, seeds can germinate normally. Without the addition of GA, seeds are unable to germinate, and 0175

spreading of GMO constructs, precocious germination, or contamination of the crop from the following year from seeds leftover from last year can be prevented. Once germination has been initiated by the externally provided GA, GA is no longer required, so the plants can be grown normally, producing seeds of normal size and composition, that lack the internal GA precursors for germination in the absence of external GA.

References:

Bustos MM, Begum D, Kalkan FA, Battraw MJ, Hall TC.(1991) Positive and negative cis-acting DNA domains are required for spatial and temporal regulation of gene expression by a seed storage protein promoter. EMBO J. 10:1469-1479.

Clough, S. J. and Bent, A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.

Crozier A (1983) The Biochemistry and Physiology of Gibberellins. Praeger, New York.

Fong F., Smith J.D., Koehler D.E. (1983) Early events in maize seed development: l-methyl-3-phenyl-5-(3-(trifluormethyl)phenyl)-4-(lH)- pyridinone induction of vivipary. Plant Physiol 73: 899-901.

Gleave, A.P. (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203-1207.

Hedden P, Kamiya Y (1997) Gibberelin biosynthesis: enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 48: 431-460.

Helliwell CA, Chandler PM, Poole A, Dennis ES, Peacock WJ. (2001) The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway. Proc Natl Acad Sci U S A. 2001 98:2065- 2070.

Helliwell CA, Sheldon CC, Olive MR, Walker AR, Zeevaart JA, Peacock WJ, Dennis ES. (1998) Cloning of the Arabidopsis ent-kaurene oxidase gene GA3. Proc Natl Acad Sci U S A. 95:9019-9024.

Hiei, Y., Ohta, S., Komari, T. and Kumashiro T. (1994). Efficient transformation of rice (Oryza satiυa L.) mediated by agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6, 271-282.

Huang, S., Raman, A.S., Ream, J.E., Fujiwara, H., Cerny, R.E. and Brown, S.M. (1998) Overexpression of 20-oxidase confers a gibberellin-overproduction phenotype in Arabidopsis. Plant Physiol. 118, 773-781.

Jacobsen JV, Chandler PM (1987) Gibberellin and abscisic acid in germinating cereals. In PJ Davies, ed, Plant Hormones and Their Role in Plant Growth and Development. Martinus Nijhoff, Boston, pp 164-193 Jacobsen JV, Gubler F, Chandler PM (1995) Gibberellin action in germinated cereals. In PJ Davies, ed, Plant Hormones, Ed 2. Martinus Nijhoff, Boston, pp 246-271

Jacobsen, S.E. and Olszewski, N.E. (1993) Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction. Plant Cell, 5, 887-896.

Koornneef M, van der Veen JH (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor Appl Genet 58: 257-263.

Liu YQ, Bergervoet JHW, deVos CHR, Hilhorst HWM, Kraak HL, Karssen CM, Bino RJ (1994) Nuclear replication activities during imbibition of abscisic acid and gibberellin-deficient tomato (Lycopersicon esculentum Mill.) seeds. Planta 194: 368-373.

Murofushi N, Honda I, Hirasawa R, Yamaguchi I, Takahashi N, Phinney BO (1991) Gibberellins from the seed, tassel, cob and silk of maize. Agric Biol Chem 55: 435-439.

Peng, J., Richards, D.E., Hartley, N.M. et al. (1999) Green revolution' genes encode mutant gibberellin response modulators. Nature, 400, 256-261.

Phillips AL, Ward DA, Uknes S, Appleford NEJ, Lange T, Huttly A, Gaskin P, Graebe JE, Hedden P (1995) Isolation and expression of three gibberellin 20- oxidase cDNA clones from Arabidopsis. Plant Physiol 108: 1049-1057.

Plant, AL, van Rooijen, GJ, Anderson, CP, Moloney, MM (1994) Regulation of an Arabidopsis oleosin gene promoter in transgenic Brassica napus. Plant Mol. Biol. 25, 193-205

Radley M. (1979) The role of gibberellin, abscisic acid, and auxin in the regulation of developing wheat grains. J. Exp. Bot. 30: 381-389.

Rivin C.J., Grudt T. (1991) Abscisic acid and the developmental regulation of embryo storage proteins in maize. Plant Physiol. 95: 358-365.

Rossak, M, Smith, M, Kunst, L (2001) Expression of the FAE1 gene and FAEl promoter activity in developing seeds of Arabidopsis thaliana. Plant Mol. Biol. 46, 717-725

Ryan, A.J., Royal, C.L., Hutchinson, J. & Shaw, CH. (1989) Nucl. Acids. Res. 17, 3584. Stalberg, K, Ellerstrom, M, Josefsson, L-G, Rask, L (1993). Deletion analysis of a 2S seed storage protein promoter of Brassica napus in transgenic tobacco. Plant Mol. Biol. 23, 671-683.

Steber CM, Cooney SE, McCourt P (1998) Isolation of the GA-response mutant slyl as a suppressor of ABI1-1 in Arabidopsis thaliana. Genetics 149: 509-521. Sun T-P, Goodman, HM, Ausubel, FM (1992) Cloning the Arabidopsis GAl locus by genomic subtraction. Plant Cell 4, 119-128.

Sun TP, Kamiya Y. (1994) The Arabidopsis GAl locus encodes the cyclase ent- kaurene synthetase A of gibberellin biosynthesis. Plant Cell. 6:1509-1518.

Takaiwa F, Yamanouchi U, Yoshihara T, Washida H, Tanabe F, Kato A, Yamada K. (1996) Characterization of common cis-regulatory elements responsible for the endosperm-specific expression of members of the rice glutelin multigene family.

The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815

Van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.P., Pereira, A. and Stiekema, W.J. (1995) pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res. 4, 288-290.

Van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.P., Pereira, A. and Stiekema, W.J. (1995) pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res. 4, 288-290.

Vandekerckhove, J., VanDamme, J., VanLijsebettens, M., Botterman, J., DeBlock, M., DeClerq, A., Leemans, J., Van Montagu, M & Krebbers, E. (1989) Bio/Technol. 7, 929.

Washida H, Wu CY, Suzuki A, Yamanouchi U, Akihama T, Harada K, Takaiwa F. (1999) Identification of cis-regulatory elements required for endosperm expression of the rice storage protein glutelin gene GluB-1. Plant Mol Biol. 40:1-12.

Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM. (2001) Construct design for efficient, effective and high- throughput gene silencing in plants. Plant J. 27, 581-90.

Yamaguchi, S, Sun, T-P, Kawaide, H, Kamiya, Y, (1998) The GA2 locus of Arabidopsis thaliana encodes ent-kaurene synthase of gibberellin biosynthesis. Plant Physiol. 116, 1271-1278. Yang YY, Nagatani A, Zhao YJ, Kang BJ, Kendrick RE, Kamiya Y. (1995) Effects of gibberellins on seed germination of phytochrome-deficient mutants of Arabidopsis thaliana. Plant Cell Physiol 1995 36:1205-1211

SEQUENCE LISTING <110> Plant Research International <120> Inhibition of germination in plants <130> inhibition germination

<140>

<141>

<160> 22

<170> Patentln Ver. 2.1

<210> 1

<211> 1738

<212> DNA

<213> Oryza sativa

<220>

<221> CDS

<222> (113) .. (1561)

<400> 1 gtatataact atctattcga tgatgaagat accccaccaa acccaaaaaa agagggtggg 60 tcgacccacg cgtccggcct tgttccatac ttgctcacta gttagctagg ac atg gaa 118

Met Glu 1 aag tct gag etc ttg eta gga teg tat tea tat gca get eta tgt ggt 166 Lys Ser Glu Leu Leu Leu Gly Ser Tyr Ser Tyr Ala Ala Leu Cys Gly 5 10 15 gtc aca etc ate ata gga tgg tta get cac tgg gta tac aaa tgg atg 214 Val Thr Leu lie lie Gly Trp Leu Ala His Trp Val Tyr Lys Trp Met 20 25 30 aat cct cca tgc att ggg agg ctt cct cct ggc tec atg ggc ttc cct 262 Asn Pro Pro Cys lie Gly Arg Leu Pro Pro Gly Ser Met Gly Phe Pro 35 40 45 50 att att ggt gag ace ttc cag ttc ttc aga gca age cca tea ata gac 310 He He Gly Glu Thr Phe Gin Phe Phe Arg Ala Ser Pro Ser He Asp 55 60 65 atg cca age tac tac aag caa aga ctg gag agg tat ggg cct eta ttc 358 Met Pro Ser Tyr Tyr Lys Gin Arg Leu Glu Arg Tyr Gly Pro Leu Phe 70 75 80 aag act age tta gtt gga egg cca gtg ate att tec ctt gac cca gag 406 Lys Thr Ser Leu Val Gly Arg Pro Val He He Ser Leu Asp Pro Glu 85 90 95 gtg aac cga ttc ata ttt caa caa gag ggt aaa ttg ttc caa agt tgg 454

Val Asn Arg Phe He Phe Gin Gin Glu Gly Lys Leu Phe Gin Ser Trp

100 105 110 tat cca gaa act gca att aat ate ttt ggc aag aag age etc ace aca 502

Tyr Pro Glu Thr Ala He Asn He Phe Gly Lys Lys Ser Leu Thr Thr

115 120 125 130 tac aac gga ace att cac aag ttt ate egg ggt gtc gcg gec aag etc 550

Tyr Asn Gly Thr He His Lys Phe He Arg Gly Val Ala Ala Lys Leu

135 140 145 ttt ggc ctt gaa aac ctg aaa gaa tea etc ctt cct gag eta gaa aac 598

Phe Gly Leu Glu Asn Leu Lys Glu Ser Leu Leu Pro Glu Leu Glu Asn

150 155 160 tct atg agg gag age ttc gca tea tgg act ggg aaa ccc age gtc gag 646

Ser Met Arg Glu Ser Phe Ala Ser Trp Thr Gly Lys Pro Ser Val Glu

165 170 175 gta cag gac ggc gtg tea gac atg ate ttt gac eta gtt gec aag aag 694

Val Gin Asp Gly Val Ser Asp Met He Phe Asp Leu Val Ala Lys Lys

180 185 190 ttg ate gga etc gat gtc ace aac tea aga gaa ttg aga aag aac ttt 742

Leu He Gly Leu Asp Val Thr Asn Ser Arg Glu Leu Arg Lys Asn Phe

195 200 205 210 cag gac ttc ttt cag ggg atg gtt tec ttc cca ata tat ttt cca ggg 790

Gin Asp Phe Phe Gin Gly Met Val Ser Phe Pro He Tyr Phe Pro Gly

215 220 225 aca tea ttc tac cga tec atg cag ggt agg aga aat gtg egg aac aca 838

Thr Ser Phe Tyr Arg Ser Met Gin Gly Arg Arg Asn Val Arg Asn Thr

230 235 240 ctt act gat ata atg aaa gag agg eta agt gca cct gga aag aag tat 886

Leu Thr Asp He Met Lys Glu Arg Leu Ser Ala Pro Gly Lys Lys Tyr

245 250 255 ggt gac ctt gta gac etc att gtt gaa gag eta cag age gaa aag cca 934

Gly Asp Leu Val Asp Leu He Val Glu Glu Leu Gin Ser Glu Lys Pro

260 265 270 atg ate gat gaa aac ttt get ata gac gca ctt get gcg etc ttg ttt 982

Met He Asp Glu Asn Phe Ala He Asp Ala Leu Ala Ala Leu Leu Phe

275 280 285 290 acg age ttt gca aca ctg tea tea ace ttg act gta get ttt aag tac 1030

Thr Ser Phe Ala Thr Leu Ser Ser Thr Leu Thr Val Ala Phe Lys Tyr

295 300 305 eta ace gac aat cca aaa gtt gtt gaa gag etc aag gag gag cac ggg 1078

Leu Thr Asp Asn Pro Lys Val Val Glu Glu Leu Lys Glu Glu His Gly

310 315 320 aca att eta aag aag cga gaa ggt gtg aat tec ggg ttc aca tgg gag 1126

Thr He Leu Lys Lys Arg Glu Gly Val Asn Ser Gly Phe Thr Trp Glu 325 330 335 gag tac agg tec ttg aaa ttc agt act cag gtt atg aat gaa att act 1174

Glu Tyr Arg Ser Leu Lys Phe Ser Thr Gin Val Met Asn Glu He Thr 340 345 350 cga att agt aac gtc aca cct gga gtt ttc agg aaa aca tta aca gat

1222

Arg He Ser Asn Val Thr Pro Gly Val Phe Arg Lys Thr Leu Thr Asp

355 360 365 370 gtg caa gtg aaa gga tat aca att cca tec ggg tgg tta gtc atg ata 1270

Val Gin Val Lys Gly Tyr Thr He Pro Ser Gly Trp Leu Val Met He 375 380 385 age ccc atg gca gtt cac eta aac cca aaa ttg ttc gag gat cca ctt 1318

Ser Pro Met Ala Val His Leu Asn Pro Lys Leu Phe Glu Asp Pro Leu 390 395 400 aaa ttt gat cca tgg agg tgg agg gag gag aag aga age teg atg ctg 1366

Lys Phe Asp Pro Trp Arg Trp Arg Glu Glu Lys Arg Ser Ser Met Leu 405 410 415 aaa aat tac atg cca ttt gga gga ggc gtc agg ctg tgt etc ggg gca 1414

Lys Asn Tyr Met Pro Phe Gly Gly Gly Val Arg Leu Cys Leu Gly Ala 420 425 430 gag ttt age aag ctt ttc att gca etc ttc etc cac ate ttg gtg ace

1462

Glu Phe Ser Lys Leu Phe He Ala Leu Phe Leu His He Leu Val Thr

435 440 445 450 gag tat agt tgg acg gag att gaa gga ggg gaa gta ctg cgc ata tea 1510

Glu Tyr Ser Trp Thr Glu He Glu Gly Gly Glu Val Leu Arg He Ser 455 460 465 gag ate atg ttc cct caa ggc tat cac ate caa eta gtt cct cag act 1558

Glu He Met Phe Pro Gin Gly Tyr His He Gin Leu Val Pro Gin Thr 470 475 480 taa tatacctatt ggatattcca ctgttgtaat aataaagaaa ttgtgaaccc 1611

aataacttgt tgcgtatgat atetatattg taactatgaa ataaacagct cgtgtgtett 1671 eagtttcaga ctgtgtcaaa aagtattatt ggaaeaaaaa aaaaaaaaaa aaaaaaaaaa 1731 aaaaaaa

1738

<210> 2

<211> 463

<212> PRT

<213> Oryza sativa

<400> 2 Leu He He Gly Trp Leu Ala His Trp Val Tyr Lys Trp Met Asn Pro

1 5 10 15 Pro Cys He Gly Arg Leu Pro Pro Gly Ser Met Gly Phe Pro He He

20 25 30

Gly Glu Thr Phe Gin Phe Phe Arg Ala Ser Pro Ser He Asp Met Pro 35 40 45

Ser Tyr Tyr Lys Gin Arg Leu Glu Arg Tyr Gly Pro Leu Phe Lys Thr 50 55 60

Ser Leu Val Gly Arg Pro Val He He Ser Leu Asp Pro Glu Val Asn 65 70 75 80

Arg Phe He Phe Gin Gin Glu Gly Lys Leu Phe Gin Ser Trp Tyr Pro 85 90 95

Glu Thr Ala He Asn He Phe Gly Lys Lys Ser Leu Thr Thr Tyr Asn 100 105 110

Gly Thr He His Lys Phe He Arg Gly Val Ala Ala Lys Leu Phe Gly 115 120 125

Leu Glu Asn Leu Lys Glu Ser Leu Leu Pro Glu Leu Glu Asn Ser Met 130 135 140

Arg Glu Ser Phe Ala Ser Trp Thr Gly Lys Pro Ser Val Glu Val Gin 145 150 155 160

Asp Gly Val Ser Asp Met He Phe Asp Leu Val Ala Lys Lys Leu He 165 170 175 Gly Leu Asp Val Thr Asn Ser Arg Glu Leu Arg Lys Asn Phe Gin Asp 180 185 190

Phe Phe Gin Gly Met Val Ser Phe Pro He Tyr Phe Pro Gly Thr Ser 195 200 205

Phe Tyr Arg Ser Met Gin Gly Arg Arg Asn Val Arg Asn Thr Leu Thr 210 215 220

Asp He Met Lys Glu Arg Leu Ser Ala Pro Gly Lys Lys Tyr Gly Asp 225 230 235 240

Leu Val Asp Leu He Val Glu Glu Leu Gin Ser Glu Lys Pro Met He 245 250 255 Asp Glu Asn Phe Ala He Asp Ala Leu Ala Ala Leu Leu Phe Thr Ser

260 265 270

Phe Ala Thr Leu Ser Ser Thr Leu Thr Val Ala Phe Lys Tyr Leu Thr 275 280 285 Asp Asn Pro Lys Val Val Glu Glu Leu Lys Glu Glu His Gly Thr He 290 295 300

Leu Lys Lys Arg Glu Gly Val Asn Ser Gly Phe Thr Trp Glu Glu Tyr 305 310 315 320

Arg Ser Leu Lys Phe Ser Thr Gin Val Met Asn Glu He Thr Arg He 325 330 335

Ser Asn Val Thr Pro Gly Val Phe Arg Lys Thr Leu Thr Asp Val Gin 340 345 350

Val Lys Gly Tyr Thr He Pro Ser Gly Trp Leu Val Met He Ser Pro 355 360 365

Met Ala Val His Leu Asn Pro Lys Leu Phe Glu Asp Pro Leu Lys Phe 370 375 380

Asp Pro Trp Arg Trp Arg Glu Glu Lys Arg Ser Ser Met Leu Lys Asn 385 390 395 400

Tyr Met Pro Phe Gly Gly Gly Val Arg Leu Cys Leu Gly Ala Glu Phe 405 410 415

Ser Lys Leu Phe He Ala Leu Phe Leu His He Leu Val Thr Glu Tyr 420 425 430

Ser Trp Thr Glu He Glu Gly Gly Glu Val Leu Arg He Ser Glu He 435 440 445

Met Phe Pro Gin Gly Tyr His He Gin Leu Val Pro Gin Thr 450 455 460

<210> 3

<211> 1437

<212> DNA

<213> Arabidopsis thaliana

<220>

<221> CDS

<222> (1) .. (1437)

<400> 3 atg tgg gca ttg etc att tgg gtt tct ttg ctt etc ata agt ate aca 48 Met Trp Ala Leu Leu He Trp Val Ser Leu Leu Leu He Ser He Thr 1 5 10 15 cat tgg gtt tat agt tgg aga aat cct aaa tgc aga ggg aaa ctt cca 96 His Trp Val Tyr Ser Trp Arg Asn Pro Lys Cys Arg Gly Lys Leu Pro 20 25 30 cct ggt tec atg ggt ttc cct tta etc ggc gag agt ate caa ttc ttc 144 Pro Gly Ser Met Gly Phe Pro Leu Leu Gly Glu Ser He Gin Phe Phe 35 40 45 aag cca aac aaa act tea gac ate cct cct ttt ate aaa gag aga gtt 192 Lys Pro Asn Lys Thr Ser Asp He Pro Pro Phe He Lys Glu Arg Val 50 55 60 aag aag tat ggc cca att ttc aag ace aat ctg gtg ggg aga cca gtt 240

Lys Lys Tyr Gly Pro He Phe Lys Thr Asn Leu Val Gly Arg Pro Val

65 70 75 80 att gta tea aca gat get gat ttg agt tat ttt gtg ttt aac caa gag 288

He Val Ser Thr Asp Ala Asp Leu Ser Tyr Phe Val Phe Asn Gin Glu

85 90 95 gga cgt tgt ttc cag agt tgg tat cca gac act ttt aca cac ate ttt 336

Gly Arg Cys Phe Gin Ser Trp Tyr Pro Asp Thr Phe Thr His He Phe

100 105 110 ggg aag aag aat gtg ggt tea tta cat ggt ttc atg tac aag tac ctt 384

Gly Lys Lys Asn Val Gly Ser Leu His Gly Phe Met Tyr Lys Tyr Leu

115 120 125 aaa aac atg gtt ttg act etc ttt ggc cat gat ggt etc aag aag atg 432

Lys Asn Met Val Leu Thr Leu Phe Gly His Asp Gly Leu Lys Lys Met

130 135 140 ctt cct caa gta gaa atg act gec aat aag agg ttg gag ctt tgg tea 480

Leu Pro Gin Val Glu Met Thr Ala Asn Lys Arg Leu Glu Leu Trp Ser

145 150 155 160 aat caa gat tea gta gaa etc aaa gat gca ace gca age atg ata ttt 528

Asn Gin Asp Ser Val Glu Leu Lys Asp Ala Thr Ala Ser Met He Phe

165 170 175 gat etc ace gcg aag aag ttg ate age cat gat cca gac aag tea tea 576

Asp Leu Thr Ala Lys Lys Leu He Ser His Asp Pro Asp Lys Ser Ser

180 185 190 gag aat eta agg gca aac ttt gtt get ttc ata cag gga ttg ate tct 624

Glu Asn Leu Arg Ala Asn Phe Val Ala Phe He Gin Gly Leu He Ser

195 200 205 ttc cct ttt gat ate cca ggc aca get tat cac aaa tgt eta cag ggt 672

Phe Pro Phe Asp He Pro Gly Thr Ala Tyr His Lys Cys Leu Gin Gly

210 215 220 agg gca aag gca atg aaa atg ttg agg aat atg ctt caa gag agg cgt 720

Arg Ala Lys Ala Met Lys Met Leu Arg Asn Met Leu Gin Glu Arg Arg

225 230 235 240 gag aac cct egg aag aat cca agt gat ttc ttt gat tat gtt att gaa 768

Glu Asn Pro Arg Lys Asn Pro Ser Asp Phe Phe Asp Tyr Val He Glu

245 250 255 gag att cag aaa gaa ggg aca att ctg aca gaa gag att gca ctg gat 816

Glu He Gin Lys Glu Gly Thr He Leu Thr Glu Glu He Ala Leu Asp

260 265 270 ttg atg ttt gtc ttg eta ttt gec age ttt gaa aca act tct ttg get 864

Leu Met Phe Val Leu Leu Phe Ala Ser Phe Glu Thr Thr Ser Leu Ala

275 280 285 eta act tta get ate aag ttt etc tea gat gac cct gaa gtc eta aag 912 Leu Thr Leu Ala He Lys Phe Leu Ser Asp Asp Pro Glu Val Leu Lys 290 295 300 cgt tta acg gaa gaa cat gag aca att ctg aga aac egg gaa gat gca 960 Arg Leu Thr Glu Glu His Glu Thr He Leu Arg Asn Arg Glu Asp Ala 305 310 315 320 gac tct gga ctt aca tgg gaa gaa tac aag tea atg act tac aca ttt 1008

Asp Ser Gly Leu Thr Trp Glu Glu Tyr Lys Ser Met Thr Tyr Thr Phe 325 330 335 cag ttc ata aac gaa ace gcg aga eta gca aat ata gtt cct gca ate 1056

Gin Phe He Asn Glu Thr Ala Arg Leu Ala Asn He Val Pro Ala He 340 345 350 ttc aga aag gcg ttg aga gat ata aaa ttc aaa gag ttt gtc aat gat 1104

Phe Arg Lys Ala Leu Arg Asp He Lys Phe Lys Glu Phe Val Asn Asp 355 360 365 aca gat tat acg att cca gee ggc tgg gcg gtg atg gtc tgt cca cca 1152

Thr Asp Tyr Thr He Pro Ala Gly Trp Ala Val Met Val Cys Pro Pro 370 375 380 get gta cat ttg aat ccc gaa atg tat aaa gat cct tta gtc ttt aat

1200

Ala Val His Leu Asn Pro Glu Met Tyr Lys Asp Pro Leu Val Phe Asn

385 390 395 400 cca tea aga tgg gag gga tea aaa gtt aca aac gca tea aag cac ttc 1248

Pro Ser Arg Trp Glu Gly Ser Lys Val Thr Asn Ala Ser Lys His Phe 405 410 415 atg gcg ttt ggt gga ggt atg agg ttc tgc gtt gga ace gac ttc aca 1296

Met Ala Phe Gly Gly Gly Met Arg Phe Cys Val Gly Thr Asp Phe Thr 420 425 430 aaa ttg cag atg get gcg ttt ctt cac age ttg gta aca aaa tac agg 1344

Lys Leu Gin Met Ala Ala Phe Leu His Ser Leu Val Thr Lys Tyr Arg

435 440 445 tgg gag gag ata aaa gga ggg aat ata act cga acg cct gga tta cag 1392

Trp Glu Glu He Lys Gly Gly Asn He Thr Arg Thr Pro Gly Leu Gin

450 455 460 ttt cca aat ggt tac cat gtc aaa etc cat aag aag aga gac tag

1437

Phe Pro Asn Gly Tyr His Val Lys Leu His Lys Lys Arg Asp

465 470 475

<210> 4 <211> 479 <212> PRT

<213> Arabidopsis thaliana

<400> 4

Met Trp Ala Leu Leu He Trp Val Ser Leu Leu Leu He Ser He Thr 1 5 10 15

His Trp Val Tyr Ser Trp Arg Asn Pro Lys Cys Arg Gly Lys Leu Pro 20 25 30

Pro Gly Ser Met Gly Phe Pro Leu Leu Gly Glu Ser He Gin Phe Phe 35 40 45

Lys Pro Asn Lys Thr Ser Asp He Pro Pro Phe He Lys Glu Arg Val 50 55 60

Lys Lys Tyr Gly Pro He Phe Lys Thr Asn Leu Val Gly Arg Pro Val 65 70 75 80

He Val Ser Thr Asp Ala Asp Leu Ser Tyr Phe Val Phe Asn Gin Glu 85 90 95

Gly Arg Cys Phe Gin Ser Trp Tyr Pro Asp Thr Phe Thr His He Phe 100 105 110

Gly Lys Lys Asn Val Gly Ser Leu His Gly Phe Met Tyr Lys Tyr Leu 115 120 125

Lys Asn Met Val Leu Thr Leu Phe Gly His Asp Gly Leu Lys Lys Met 130 135 140

Leu Pro Gin Val Glu Met Thr Ala Asn Lys Arg Leu Glu Leu Trp Ser 145 150 155 160

Asn Gin Asp Ser Val Glu Leu Lys Asp Ala Thr Ala Ser Met He Phe 165 170 175

Asp Leu Thr Ala Lys Lys Leu He Ser His Asp Pro Asp Lys Ser Ser 180 185 190

Glu Asn Leu Arg Ala Asn Phe Val Ala Phe He Gin Gly Leu He Ser 195 200 205

Phe Pro Phe Asp He Pro Gly Thr Ala Tyr His Lys Cys Leu Gin Gly 210 215 220

Arg Ala Lys Ala Met Lys Met Leu Arg Asn Met Leu Gin Glu Arg Arg 225 230 235 240

Glu Asn Pro Arg Lys Asn Pro Ser Asp Phe Phe Asp Tyr Val He Glu 245 250 255

Glu He Gin Lys Glu Gly Thr He Leu Thr Glu Glu He Ala Leu Asp 260 265 270

Leu Met Phe Val Leu Leu Phe Ala Ser Phe Glu Thr Thr Ser Leu Ala 275 280 285

Leu Thr Leu Ala He Lys Phe Leu Ser Asp Asp Pro Glu Val Leu Lys 290 295 300

Arg Leu Thr Glu Glu His Glu Thr He Leu Arg Asn Arg Glu Asp Ala 305 310 315 320 Asp Ser Gly Leu Thr Trp Glu Glu Tyr Lys Ser Met Thr Tyr Thr Phe 325 330 335

Gin Phe He Asn Glu Thr Ala Arg Leu Ala Asn He Val Pro Ala He 340 345 350

Phe Arg Lys Ala Leu Arg Asp He Lys Phe Lys Glu Phe Val Asn Asp 355 360 365

Thr Asp Tyr Thr He Pro Ala Gly Trp Ala Val Met Val Cys Pro Pro 370 375 380

Ala Val His Leu Asn Pro Glu Met Tyr Lys Asp Pro Leu Val Phe Asn 385 390 395 400

Pro Ser Arg Trp Glu Gly Ser Lys Val Thr Asn Ala Ser Lys His Phe 405 410 415

Met Ala Phe Gly Gly Gly Met Arg Phe Cys Val Gly Thr Asp Phe Thr 420 425 430

Lys Leu Gin Met Ala Ala Phe Leu His Ser Leu Val Thr Lys Tyr Arg 435 440 445

Trp Glu Glu He Lys Gly Gly Asn He Thr Arg Thr Pro Gly Leu Gin 450 455 460

Phe Pro Asn Gly Tyr His Val Lys Leu His Lys Lys Arg Asp 465 470 475

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 5 gtggagggag gagaagagaa gc 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 6 ttggatgtaa tagccttgag gg 22 <210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 7 gtggagggag gagaagagaa gc 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 8 ttggatgtga tagccttgag gg 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 9 gaactggtat ggtcaaggct 20

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 10 acacggagct cgttgtagaa g 21

<210> 11

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer <400> 11 ttaactcgag tatggcccaa ttttcaagac caatctggtg 40

<210> 12

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 12 ttaaggtacg cttgcggttg catctttgag ttctactga 39

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 13 ttaatctaga gtatggccca attttcaaga ccaatctggt g 41

<210> 14

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 14 ttaaatcgat gcttgcggtt gcatctttga gttctactga 40

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 15 taagcggccg caagctttct tcatcggtga ttgattcctt 40

<210> 16

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 16 aattgtcgac tatgttttta atcttgtttg tattgatgag 40

<210> 17

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 17 ttaactcgag agattagtgt tggaagtaat agtaatgcat tc 42

<210> 18

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 18 ttaaggtacc cctttgttgc attgatgagg aaagagattc 40

<210> 19

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 19 ttaatctaga agattagtgt tggaagtaat agtaatgcat tc 42

<210> 20

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 20 ttaagtcgac cctttgttgc attgatgagg aaagagattc 40 <210> 21

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 21 taagcggccg caagctttct tcatcggtga ttgattcctt 40

<210> 22

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 22 aattgtcgac tatgttttta atcttgtttg tattgatgag 40

Claims

Claims

1. Method for the inhibition of germination in plants characterised in that a plant is provided with a nucleotide sequence which when expressed is able to inhibit an enzyme in the gibberellic acid (GA) biosynthesis pathway and wherein the expression of said nucleotide sequence is under control of a seed specific promoter.

2. Method according to claim 1 wherein said nucleotide sequence comprises a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:l, SEQ ID NO:3 or the GAl sequence, or homologues thereof.

3. Method according to claim 1 or claim 2 wherein a plant is transformed with one or more plant expressible nucleotide constructs which upon transcription yield a double stranded RNA which is homologous to at least a stretch of 40 nucleotides to the nucleotide sequence coding for an enzyme in the gibberellic acid biosynthesis pathway.

4. Method according to claim 3, wherein the nucleotide sequence coding for an enzyme in the gibberellic acid biosynthesis pathway is selected from the group of SEQ ID NO:l, SEQ ID NO:3 and the nucleotide sequence encoding GAl.

5. Method according to claim 3 or 4 wherein the homology is 70%, more preferably is 80%, even more preferably is 90% and most preferably is 100%.

6. A rice germination related P450 protein having the amino acid sequence as depicted in SEQ ID NO:2 or a variant thereof.

7. Nucleotide sequence coding for the protein of claim 6.

8. Nucleotide sequence according to claim 7 comprising the nucleotide sequence as depicted from nucleotides 113-1558 of SEQ ID NO:l.

9. A plant expressible construct comprising a seed-specific promoter operably linked to a nucleotide sequence according to claim 7 or 8, or at least a part thereof having 40 or more nucleotides.

10. A plant expressible construct comprising a seed-specific promoter operably linked to a nucleotide sequence antisense to the nucleotide sequence according to claim 7 or 8, or at least a part thereof having 40 or more nucleotides.

11. A plant expressible construct comprising a seed-specific promoter operably linked to a nucleotide sequence having 40 or more nucleotides wherein said construct is able to produce a double-stranded RNA which is homologous to at least a stretch of 40 or more nucleotides of the nucleotide sequence according to claim 7 or 8 upon transcription.

12. A plant expressible construct comprising a seed specific promoter operably linked to a nucleotide sequence having a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:3 or the GAl sequence, or homologues thereof.

13. Vector comprising a construct according to any of claims 9-12.

14. Agrobacterium comprising a vector according to claim 13.

15. A plant transformed with a plant expressible construct according to any of claims 9-12, a vector according to claim 13 or a Agrobacterium according to claim 14.

16. Seed from a plant according to claim 15.

17. Method for inducing germination in a seed according to claim 16 wherein said seed prior to sowing is treated with gibberellic acid or a precursor of gibberellic acid.