WO2003074557A1

WO2003074557A1 - Novel b-cell malignancy-associated protein

Info

Publication number: WO2003074557A1
Application number: PCT/GB2003/000910
Authority: WO
Inventors: Paul J Adam; Julie Ann Loader; Jonathan Alexander Terrett
Original assignee: Oxford Glycosciences (Uk) Ltd
Priority date: 2002-03-06
Filing date: 2003-03-06
Publication date: 2003-09-12
Also published as: GB0305139D0; AU2003208472A1; GB2388113A

Abstract

The present invention provides a novel protein (BCNP-1) compositions comprising the protein, vaccines and antibodies that are immunospecific for the protein. The use of the protein in the diagnosis, screening, treatment and prophylaxis of B-cell malignancies, in particular Chronic Lymphocytic Leukaemia (CLL) is also provided.

Description

NOVEL B-CELL MALIGNANCY-ASSOCIATED PROTEIN

B-cell malignancies are a group of disorders that include CLL, multiple myeloma, and non-Hodgkin's lymphoma (NHL). They are neoplastic diseases of the blood and blood forming organs. They cause bone marrow and immune system dysfunction, which renders the host highly susceptible to infection and bleeding.

CLL is characterised by the progressive accumulation of apparently mature but functionally incompetent, monoclonal lymphocytes in the blood, bone marrow and lymphatic tissues. It represents the most common leukaemia with 7,000 new cases in the USA each year. CLL is restricted to adults, median onset 65 years with 40-50% of patients younger than 60 years and 10-20% younger than 50 years old. CLL is therefore not exclusively a disease of old age, indeed it can affect all adult age groups. Overall 5-year survival is around 60% depending upon the stage of the disease (range of survival 2-20 years).

The lack of a curative therapy for CLL indicates a need for new chemotherapeutic targets. Additionally, promising results have been obtained using the human anti-CD52 antibody Campath-IH, which suggests that the identification of cell surface molecules to serve as targets for immunotherapy approaches will provide useful therapeutic methods.

Furthermore, cell surface molecules identified in CLL are likely to be useful in the treatment of other B-cell malignancies, e.g. NHL, multiple myeloma or Burkitt's lymphoma. An ideal protein target for cancer immunotherapy should have a restricted expression profile in normal tissues and be over-expressed in tumours, such that the immune response will be targeted to tumour cells and not against other organs. In addition, the protein target should be exposed on the cell surface, where it will be accessible to therapeutic agents. Tumour antigens have been identified for a number of cancer types, by using techniques such as differential screening of cDNA (Hubert, R.S., et al. Proc. Natl. Acad, Sci. USA 96, 14523- 14528 (1999); Lucas, S., et al. Int. J. Cancer 87, 55-60 (2000)), and the purification of cell- surface antigens that are recognised by tumour-specific antibodies (Catimel, B., et al. J. Biol. Chem. 271, 25664-25670 (1996)).

The present invention is based on the finding of a novel B-cell malignancy associated antigen, designated BCNP-1, and splice variants thereof. The following ESTs correspond to short fragments of the sequence of BCNP-1,

GenBank accession numbers: 21847499 (SEQ HO NO: 22), 14822277 (SEQ ID NO: 23), 13665993 (SEQ ID NO: 24), 14821235 (SEQ ID NO: 25), 7633102 (SEQ ID NO: 26), 9720868 (SEQ ID NO: 27), 1395933 (SEQ ID NO: 28), and 17651856 (SEQ ID NO: 29). None of these sequences correspond to the full length sequences of BCNP-1 or its splice variants, none identify correctly the exon structure of the mature protein or would lead the skilled man to deduce these features of BCNP-1. Additionally, a conceptual translation of a segment of a long cDNA clone (18676485, SEQ ID NO: 30) was found to match a fragment of the BCNP-1 protein, however, neither the cDNA nor its conceptual translation accurately predict the full length sequence of the mature BCNP-1 protein or its exon structure Thus, in a first aspect, the present invention provides an isolated or recombinant BCNP-1 polypeptide which: a) comprises or consists of the amino acid sequence shown in Figure 2A, SEQ

HO NO: 1; b) comprises or consists of the amino acid sequence shown in Figure 2B, SEQ

ID NO: 3; c) comprises or consists of the amino acid sequence shown in Figure 2C, SEQ DO NO: 5; d) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to a), b) or c) which retains the activity of

BCNP-1; or e) is a fragment of a polypeptide having the amino acid sequence shown in Figure 2A, SEQ ID NO: 1, Figure 2B, SEQ HO NO: 3 or Figure 2C, SEQ HO NO: 5, which is at least ten amino acids long and has at least 70% identity over the length of the fragment.

The polypeptides described in a) to e) above are hereinafter referred to as "BCNP-1 polypeptides". The term "polypeptides" includes peptides, polypeptides and proteins, these terms are used interchangeably unless otherwise specified.

BCNP-1 polypeptides can be prepared in any suitable manner. BCNP-1 polypeptides may be provided in isolated form and include BCNP-1 polypeptides that have been purified to at least some extent. BCNP-1 polypeptides may also be produced using recombinant methods, synthetically produced or produced by a combination of these methods. Means for preparing such polypeptides are well-known in the art.

BCNP-1 polypeptides are preferentially provided in substantially pure form, that is to say, they are free, to a substantial extent, from other proteins. Thus, a BCNP-1 polypeptide may be provided in a composition in which it is the predominant component present (i.e. it is present at a level of at least 50%; preferably at least 75%, at least 80%, al least 85%, at least

90%, at least 95% or at least 98%; when determined on a weight/weight basis excluding solvents or carriers). In order to more fully appreciate the present invention, polypeptides within the scope of a)-e) above will now be discussed in greater detail.

Polypeptides within the scope of a)-c)

A polypeptide within the scope of a), b) or c), may consist of the particular amino acid sequence given in Figure 2A, SEQ ID NO: 1, Figure 2B, SEQ ID NO: 3 or Figure 2C, SEQ ID NO: 5, or may have an additional N-terminal and/or an additional C-terminal amino acid sequence relative to these sequences.

Additional N-terminal or C-terminal sequences may be provided for various reasons e.g. secretory or leader sequences or a pre-, pro- or prepro- sequence. An additional sequence which may provide stability during recombinant production may also be used. Techniques for providing such additional sequences are well known in the art.

Additional sequences may be provided in order to alter the characteristics of a particular polypeptide. This can be useful in improving expression or regulation of expression in particular expression systems. For example, an additional sequence may provide some protection against proteolytic cleavage.

Additional sequences can also be useful in altering the properties of a polypeptide to aid in identification or purification. For example, a fusion protein may be provided in which a polypeptide is linked to a moiety capable of being isolated by affinity chromatography e.g. multiple histidine residues, a FLAG tag, HA tag, or myc tag. The moiety may be an antigen or an epitope and the affinity column may comprise immobilised antibodies or immobilised antibody fragments which bind to said antigen or epitope (desirably with a high degree of specificity). The fusion protein can usually be eluted from the column by addition of an appropriate buffer.

Therefore in one embodiment, BCNP-1 polypeptides may be fused to other moieties for example but without limitation, with localisation-reporter proteins such as the Green Fluorescent Protein (U.S. Patent Nos. 5,625,048, 5,777,079, 6,054,321 and 5,804,387) or the DsRed fluorescent protein. Alternatively, a fusion protein may be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al, 1991, Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. The tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni²⁺ nitriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole- containing buffers. Additional N-terminal or C-terminal sequences may, however, be present simply as a result of a particular technique used to obtain a polypeptide of the present invention and need not provide any particular advantageous characteristic to the polypeptide of the present invention. Such polypeptides are within the scope of the present invention.

Such sequences may be optionally removed as required by incorporating a cleavable sequence as an additional sequence or part thereof. Thus a BCNP-1 polypeptide may be fused to other moieties, including other polypeptides.

Whatever additional N-terminal or C-terminal sequence is present, it is preferred that the resultant polypeptide should exhibit the biological and immunological activity of a BCNP-1 polypeptide having the amino acid sequence as shown in Figure 2A, SEQ HO NO: 1, Figure 2B, SEQ ID NO: 3 or Figure 2C, SEQ ID NO: 5.

Polypeptides within the scope of d)

Turning now to the polypeptides defined in d) above, it will be appreciated by the person skilled in the art that these polypeptides are derivatives of the polypeptides as described in a)-c) above, provided that such derivatives exhibit the activity of the polypeptide having the amino acid sequence shown in Figure 2A, SEQ ID NO: 1, Figure 2B, SEQ HO NO: 3 or Figure 2C, SEQ ID NO: 5. Modifications include naturally occurring modifications such as, and without limitation, post-translational modifications and also non-naturally occurring modifications such as may be introduced by mutagenesis.

Alterations in the amino acid sequence of a protein can occur which do not affect the function of a protein. These include amino acid deletions, insertions and substitutions and can result from alternative splicing and/or the presence of multiple translation start sites and stop sites. Polymorphisms may arise as a result of the infidelity of the translation process. Thus changes in amino acid sequence may be tolerated which do not affect the protein's activity. The skilled person will appreciate that various changes can often be made to the amino acid sequence of a polypeptide which has a particular activity to produce derivatives (sometimes known as "muteins" or variants) having at least a proportion of said activity, and preferably having a substantial proportion of said activity. Such derivatives of the polypeptides described in a)-c) above are within the scope of the present invention and are discussed in greater detail below. They include allelic and non-allelic variants. An example of a derivative of the present invention is a polypeptide as defined in a)-c) above, apart from the substitution of one or more amino acids with one or more other amino acids. The skilled person is aware that various amino acids have similar properties. One or more such amino acids of a polypeptide can often be substituted by one or more other such amino acids without eliminating a desired activity of that polypeptide. Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains). Of these possible substitutions, it is preferred that glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic). Other amino acids which can often be substituted for one another include:

- phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains);

- lysine, argmine and histidine (amino acids having basic side chains);

- aspartate and glutamate (amino acids having acidic side chains);

- asparagine and glutamine (amino acids having amide side chains); - cysteine and methionine (amino acids having sulphur-containing side chains) and;

- aspartic acid and glutamic aci can substitute for phospho-serine and phospho- threonine, respectively (amino acids with acidic side chains).

Substitutions of this nature are often referred to as "conservative" or "semi-conservative" amino acid substitutions. fn a further aspect, the substituted amino acid(s) do significantly affect the activity of the

BCNP-1 polypeptide and may be selected specifically to render dominant negative activity on the polypeptide. In another embodiment, the substituted amino acid(s) may be selected specifically to render the polypeptide constitutively active.

Amino acid deletions or insertions may also be made relative to the amino acid sequence given in a)-c) above. Thus, for example, amino acids which do not have a substantial effect on the activity of the polypeptide, or at least which do not eliminate such activity, may be deleted.

Such deletions can be advantageous since the overall length and the molecular weight of a polypeptide can be reduced whilst still retaining activity. This can enable the amount of polypeptide required for a particular purpose to be reduced - for example, dosage levels can be ^■ reduced.

Amino acid insertions relative to the sequence given in a)-c) above can also be made. This may be done to alter the properties of a BCNP-1 polypeptide (e.g. to assist in identification, purification or expression, as explained above in relation to fusion proteins).

Amino acid changes relative to the sequence given in a)-c) above may be naturally occurring or can be made using any suitable technique e.g. by using site-directed mutagenesis (Hutchinson et al, 1978, J. Biol. Chem. 253:6551).

It should be appreciated that amino acid substitutions or insertions within the scope of the present invention can be made using naturally occurring or non-narurally occurring amino acids. Whether or not natural or synthetic amino acids are used, it is preferred that only L-amino acids are present.

Whatever amino acid changes are made (whether by means of substitution, insertion or deletion), preferred polypeptides of the present invention have at least 50% sequence identity with a polypeptide as defined in a)-c) above, more preferably the degree of sequence identity is at least 75%, at least 76%, at least 80% or at least 85%. Sequence identities of at least 90%, at least 95% or at least 98% are most preferred.

Percentage identity is a well-known concept in the art used to describe the similarity between two polypeptide or nucleic acid sequences and can be calculated using, for example but without limitation, the BLAST™ software available from NCBI (Altschul, S.F. et al. , 1990, J. Mol. Biol. 215:403-410; Gish, W. & States, D J. 1993, Nature Genet. 3: 266-272; Madden, T.L. et al, 1996, MethEnzymol. 266:131-141; Altschul S.F. etal, 1997, Nucleic Acids Res 25: 3389-3402; Zhang, J. & Madden T.L. 1997, Genome Res 7: 649-656).

Where high degrees of sequence identity are present there will be relatively few differences in amino acid sequence. Thus for example they may be less than 20, less than 10, or even less than 5 differences.

Polypeptides within the scope of e

As discussed supra, it is often advantageous to reduce the length of a polypeptide, provided that the resultant reduced length polypeptide still has a desired activity or can give rise to useful antibodies. Feature e) of the present invention therefore covers fragments of polypeptides a)-c) above.

The skilled person can determine whether or not a particular fragment has activity using the techniques disclosed above. Fragments are at least 10 amino acids long. Preferred fragments may be at least 20, at least 50 or at least 100 amino acids long. A fragment has at least 70% identity over its length to the amino acid sequence shown in Figure 2A, SEQ HO NO: 1, Figure 2B, SEQ DO NO: 3 or Figure 2C, SEQ ID NO: 5, more preferably it has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% identity.

As will be discussed below, the BCNP-1 polypeptides will find use in a therapeutic approach to B-cell malignancies (e.g. CLL). The skilled person will appreciate that for the preparation of one or more BCNP-1 polypeptides, the preferred approach will be based on recombinant DNA techniques.

In a further aspect, the present invention provides an isolated or recombinant BCNP-1 nucleic acid molecule which: P T/GB03/00910

f) comprises or consists of the DNA sequence shown in Figure 2A, SEQ ID NO: 2 or its RNA equivalent; g) comprises or consists of the DNA sequence shown in Figure 2B, SEQ HO NO: 4 or its RNA equivalent; h) comprises or consists of the DNA sequence shown in Figure 2C, SEQ HO

NO: 6 or its RNA equivalent; i) has a sequence which is complementary to the sequences of f), g) or h); j) has a sequence which codes for a polypeptide as defined in a) to e) above; k) has a sequence which shows substantial identity with any of those of f), g), h), i) orj); or

1) is a fragment of f), g), h), i), j) or k), which is at least 8 nucleotides in length; provided that the nucleic acid does not consist of the nucleic acid sequences as shown in SEQ HO NO: 22, SEQ HO NO: 23, SEQ HO NO: 24, SEQ ID NO: 25, SEQ HO NO: 26, SEQ ID NO: 27, SEQ no NO: 28 or SEQ ID NO: 29. Unless the context indicates otherwise, the term "BCNP-1 nucleic acids" includes the nucleic acid molecules described in f) to 1) above, which may have one or more of the following characteristics.

1) they may be DNA or RNA;

2) they may be single or double stranded; 3) they may be provided in substantially pure form. Thus they may be provided in a form which is substantially free from contaminating proteins andor from other nucleic acids; and 4) they may be provided with introns or without introns (e.g. as cDNA).

BCNP-1 nucleic acids can be obtained from natural sources such as genomic DNA Ubraries or can be synthesized using well known and commercially available techniques. The BCNP-1 nucleic acids comprising coding sequence for BCNP-1 polypeptides described above can be used for the recombinant production of said polypeptides. The BCNP-1 nucleic acids may include the coding sequence for the mature polypeptide, by itself; or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre- pro- or prepro-protein sequence, a cleavable sequence or other fusion peptide portions, such as an affinity tag or an additional sequence conferring stability during production of the polypeptide. Preferred affinity tags include multiple histidine residues (for example see Gentz et al, 1989, Proc. Natl. Acad. Sci USA 86:821- 824), a FLAG tag, HA tag or myc tag. The BCNP-1 nucleic acids may also contain non- coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.

A BCNP-1 nucleic acid encoding a BCNP-1 polypeptide, including homologues and orthologues from species other than human, may be obtained by a process which comprises the steps of screening an appropriate library under stringent hybridisation conditions with a labelled probe having the sequence of a BCNP-1 nucleic acid as described in f)-l) above, and isolating full-length cDNA and genomic clones containing said nucleic acid sequence. Such hybridisation techniques are well-known in the art. One example of stringent hybridisation conditions is where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution of about 0.9M. However, the skilled person will be able to vary such conditions as appropriate in order to take into account variables such as probe length, base composition, type of ions present, etc. For a high degree of selectivity, relatively stringent conditions such as low salt or high temperature conditions, are used to form the duplexes. Highly stringent conditions include hybridisation to filter-bound DNA in 0.5M NaHP0₄, 7% sodium dodecyl sulphate (SDS), ImM EDTA at 65°C, and washing in 0. lxSSC/0.1 % SDS at 68°C (Ausubel F.M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). For some applications, less stringent conditions for duplex formation are required. Moderately stringent conditions include washing in 0.2xSSC/0.1% SDS at 42°C (Ausubel et al, 1989, supra). Hybridisation conditions can also be rendered more stringent by the addition of increasing amounts of formamide, to destabilise the hybrid duplex. Thus, particular hybridisation conditions can be readily manipulated, and will generally be chosen as appropriate. In general, convenient hybridisation temperatures in the presence of 50% formamide are: 42°C for a probe which is 95-100% identical to the fragment of a gene encoding a polypeptide as defined herein, 37°C for 90-95 % identity and 32°C for 70-90% identity.

One skilled in the art will understand that, in many cases, an isolated cDNA sequence will be incomplete, in that region coding for the polypeptide is cut short at the 5' end of the cDNA. This is a consequence of reverse transcriptase, an enzyme with inherently low processivity (a measure of the ability of the enzyme to remain attached to the template during the polymerization reaction), failing to complete a DNA copy of the mRNA template during 1^st strand cDNA synthesis.

Methods to obtain full length cDNAs or to extend short cDNAs are well known in the art, for example RACE (Rapid amplification of cDNA ends; e.g. Frohman et al, 1988, Proc. Natl. Acad. Sci USA 85:8998-9002). Recent modifications of the technique, exemplified by the Marathon™ technology (Clontech Laboratories Inc.) have significantly simplified the search for longer cDNAs. This technology uses cDNAs prepared from mRNA extracted from a chosen tissue followed by the ligation of an adaptor sequence onto each end. PCR is then carried out to amplify the missing 5 'end of the cDNA using a combination of gene specific and adaptor specific oligonucleotide primers. The PCR reaction is then repeated using nested primers which have been designed to anneal with the amplified product, typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence. The products of this reaction can then be analysed by DNA sequencing and a full length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full length PCR using the new sequence information for the design of the 5' primer.

The BCNP-1 polypeptides of the present invention can be coded for by a large variety of nucleic acid molecules, taking into account the well-known degeneracy of the genetic code. All of these molecules are within the scope of the present invention. They can be inserted into vectors and cloned to provide large amounts of DNA or RNA for further study. Suitable vectors may be introduced into host cells to enable the expression of BCNP-1 polypeptides using techniques known to the person skilled in the art.

BCNP-1 polypeptide derivatives within the scope of d) as discussed above, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of a BCNP-1 nucleic acid such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Standard techniques known to those of skill in the art can be used to introduce mutations, including, for example, site-directed mutagenesis and PCR mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. Techniques for cloning, expressing and purifying polypeptides are well known to the skilled person. DNA constructs can readily be generated using methods well known in the art. These techniques are disclosed, for example in J. Sambrook et al, Molecular Cloning 2" Edition, Cold Spring Harbour Laboratory Press (1989); in Old & Primrose Principles of Gene Manipulation 5th Edition, Blackwell Scientific Publications (1994); and in Stryer (Biochemistry 4th Edition, W H Freeman and Company (1995)). Modifications of DNA constructs and the proteins expressed such as the addition of promoters, enhancers, signal sequences, leader sequences, translation start and stop signals and DNA stability controlling regions, or the addition of fusion partners may then be facilitated.

Normally the DNA construct will be inserted into a vector, which may be of phage or plasmid origin. Expression of the protein is achieved by the transformation or transfection of the vector into a host cell which may be of eukaryotic or prokaryotic origin.

Therefore, a further aspect of the invention provides vectors comprising a BCNP-1 nucleic acid. The invention also provides suitable host cells transformed/transfected with a vector containing a BCNP-1 nucleic acid and a method of production of BCNP-1 polypeptides using such recombinant expression systems. Cell-free translation systems can also be employed to produce recombinant polypeptides. For example, but without limitation, rabbit reticulocyte, wheat germ lystate, SP5/T7 in vitro T&T and RTS 100 E. Coli HY transcription and translation kits from Roche Diagnostics Ltd., Lewes, UK and the TNT Quick coupled Transcription/Translation system from Promega UK, Southampton, UK. For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for BCNP-1 nucleic acids. Such incorporation can be performed using methods well known in the art, such as, calcium phosphate transfection, DEAD-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection (see e.g. Davis et al. , Basic Methods in Molecular Biology, 1986 and Sambrook et al. ,

Molecular Cloning: A Laboratory Manual, 2^nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY, 1989).

Knowledge of the nucleic acid structure can be used to raise antibodies and for gene therapy. Techniques for this are well-known by those skilled in the art. By using appropriate expression systems, BCNP-1 polypeptides may be expressed in glycosylated or non-glycosylated form. Non-glycosylated forms can be produced by expression in prokaryotic hosts, such as E. coli.

Polypeptides comprising N-terminal methionine may be produced using certain expression systems, whilst in others the mature polypeptide will lack this residue. Representative examples of host cells include bacterial cells e.g. E. Coli, Streptococci,

Staphylococci, Streptomyces and Bacillus subtilis cells, fungal cells such as yeast cells and Aspergϊllus cells; insect cells such as Drosophϊla S2 and Spodotera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, HEK 293. BHK and Bowes melanoma cells; and plant cells. A wide variety of expression systems can be used such as, and without limitation, chromosomal, episomal and virus-derived systems, e.g. vectors derived from bacterial plasmids, from bacteriophage, from transposons, from years episomes, from instertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses such as SN40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector which is able to maintain, propagate or express a nucleic acid to produce a polypeptide in a host may be used. The appropriate nucleic acid sequence may be inserted into an expression system by any variety of well-known and routine techniques, such as those set for in Sambrook et al, supra. Appropriate secretion signals may be incorporated into the BCΝP-1 polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the BCΝP-1 polypeptide or they may be heterologous signals.

Polypeptides may be prepared natively or under denaturing conditions and then subsequently refolded. Baculoviral expression vectors include secretory plasmids (such as pACGP67 from Pharmingen), which may have an epitope tag sequence cloned in frame (e.g. myc, N5 or His) to aid detection and allow for subsequent purification of the protein. Mammalian expression vectors may include pCDΝA3 and pSecTag (both Invitrogen), and pREP9 and pCEP4 (Invitrogen). E. coli systems include the pBad series (His tagged - Invitrogen) or pGex series (Pharmacia).

If a BCNP-1 polypeptide is to be expressed for use in cell-based screening assays, it is preferred that the polypeptide be produced at the cell surface. In this event, the cells may be harvested prior to use in the screening assay. If the BCNP-1 polypeptide is secreted into the medium, the medium can be recovered in order to isolate said polypeptide. If produced intracellularly, the cells must first be lysed before the BCNP-1 polypeptide is recovered.

BCNP-1 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including, ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, molecular sieving chromatography, centrifugation methods, electrophoresis methods and lectin chromatography. In one embodiment a combination of these methods is used. In a further embodiment, an antibody which specifically binds to a BCNP-1 polypeptide can be used to deplete a sample comprising a BCNP-1 polypeptide of said polypeptide or to purify said polypeptide.

In addition to nucleic acid molecules coding for BCNP-1 polypeptides, referred to herein as "coding" nucleic acid molecules, the present invention also includes nucleic acid molecules complementary thereto. Thus, for example, both strands of a double stranded nucleic acid molecule are included within the scope of the present invention (whether or not they are associated with one another). Also included are mRNA molecules and complementary DNA Molecules (e.g. cDNA molecules).

Fragments of BCNP-1 nucleic acids are within the scope of the present invention, in one embodiment such fragments are at least 1000 nucleotides in length and/or the fragments are less than 100, less than 80, less than 70 or less than 60 nucleotides in length. Nucleic acid molecules which can hybridise to any of the BCNP-1 nucleic acids discussed in f) to 1) above are also covered by the present invention. Such nucleic acid molecules are referred to herein as "hybridising" nucleic acid molecules. Hybridising nucleic acid molecules can be useful as probes or primers, for example. Desirably such hybridising molecules are at least 8 nucleotides in length and preferably are at least 25 or at least 50 nucleotides in length. The hybridising nucleic acid molecules preferably hybridise to nucleic acids within the scope of f) to 1) above specifically. A hybridising nucleic acid molecule may have a high degree of sequence identity along its length with a nucleic acid molecule within the scope of f) to 1) above (e.g. at least 50%, at least 75%, at least 80%, at least 85%, at least 90% at least 95% or at least 98% sequence identity). As will be appreciated by the skilled person, the higher the sequence identity a given single stranded nucleic acid molecule has with another nucleic acid molecule, the greater the likelihood that it will hybridise to a nucleic acid molecule which is complementary to that other nucleic acid molecule under appropriate conditions. Desirably the hybridising molecules will hybridise to such molecules under stringent hybridisation conditions, see supra.

Manipulation of the DNA encoding the protein is a particularly powerful technique for both modifying proteins and for generating large quantities of protein for purification purposes. This may involve the use of PCR techniques to amplify a desired nucleic acid sequence. Thus the sequence data provided herein can be used to design primers for use in PCR so that a desired sequence can be targeted and then amplified to a high degree.

Typically, primers will be at least eight nucleotides long and will generally be at least ten nucleotides long (e.g. fifteen to twenty-five nucleotides long). In some cases, primers of at least thirty or at least thirty-five nucleotides in length may be used. As a further alternative chemical synthesis may be used. This may be automated.

Relatively short sequences may be chemically synthesised and ligated together to provide a longer sequence.

In addition to being used as primers and/or probes, hybridising nucleic acid molecules of the present invention can be used as anti-sense molecules to alter the expression of BCNP-1 polypeptides by binding to complementary nucleic acid molecules. This technique can be used in anti-sense therapy.

The term identity can also be used to describe the similarity between two individual DNA sequences. The 'bestfit' program (Smith and Waterman, Advances in applied Mathematics, 482-489 (1981)) is one example of a type of computer software used to find the best segment of similarity between two nucleic acid sequences, whilst the GAP program enables sequences to be aligned along their whole length and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is preferred if sequences which show substantial identity with any of those off) to 1) have e.g. at least 50%, at least 75%, at least 80% at least 85%, at least 90%, at least 95% or at least 98% sequence identity. The term 'RNA equivalent' when used above indicates that a given RNA molecule has a sequence which is complementary to that of a given DNA molecule, allowing for the fact that in RNA 'U' replaces 'T' in the genetic code. The nucleic acid molecule may be in isolated, recombinant or chemically synthetic form. In a further aspect, the present invention provides BCNP-1 antibodies, which bind specifically to a BCNP-1 polypeptide. Preferred antibodies bind specifically to BCNP-1 polypeptides. Specifically recognising or binding specifically means that the antibodies have a greater affinity for BCNP-1 polypeptides than for other polypeptides. Thus, the BCNP-1 polypeptides may be used as immunogens to generate antibodies which immunospecifically bind a BCNP-1 polypeptide. BCNP-1 antibodies may be obtained by administering the BCNP-1 polypeptides to an animal, preferably a non-human animal, using well-known and routine protocols.

BCNP-1 antibodies include, but are not limited to polyclonal, monoclonal, bispecific, humanized or chimeric antibodies, single chain antibodies, Fab fragments and F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. The term "antibody" as used herein includes immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e. molecules that contain an antigen binding site that specifically binds an antigen. The immunoglobulin molecules of the invention can be of any class (e.g. IgG, IgE, IgM, IgD and IgA) or subclass of immunoglobulin molecule.

In the production of BCNP-1 antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g. ELISA (enzyme-linked immunosorbent assay). For example, to select antibodies which recognize a specific domain of a BCNP-1 polypeptide, one may assay generated hybridomas for a product which binds to a polypeptide fragment containing such domain. For selection of an antibody that specifically binds a first polypeptide homologue but which does not specifically bind to (or binds less avidly to) a second polypeptide homologue, one can select on the basis of positive binding to the first polypeptide homologue and a lack of binding to (or reduced binding to) the second polypeptide homologue.

For preparation of monoclonal antibodies (mAbs) directed toward a BCNP-1 polypeptide, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBN-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77- 96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAbs of the invention may be cultivated in vitro or in vivo. In an additional embodiment of the invention, mAbs can be produced in germ-free animals utilizing known technology.

The mAbs include but are not limited to human mAbs and chimeric mAbs (e.g. human-mouse chimeras). A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a human immunoglobulin constant region and a variable region derived from a murine mAb. (See, e.g. U.S. 4,816,567; and U.S. 4,816,397, which are incorporated herein by reference in their entirety.) Humanized antibodies are antibody molecules from non-human species having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule, (see, e.g. U.S. 5,585,089) 0910

Chimeric and humanised mAbs can be produced by recombinant DNA techniques known in the art, for example using methods described in WO 87/02671; EP 184187; EP 171496; EP 173494; WO 86/01533; U.S. 4,816,567; EP 125023; Better et al, 1988, Science 240:1041-1043; Liu et al, 1987, Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al, 1987, J. Immunol. 139:3521-3526; Sun et al, 1987, Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al, 1987, Cane. Res. 47:999-1005; Wood et al, 1985, Nature 314:446-449; Shaw et al, 1988, J. Natl. Cancer Inst. 80:1553-1559; Morrison, 1985, Science 229:1202-1207; Oi et al, 1986, Bio/Techniques 4:214; U.S. 5,225,539; Jones et al, 1986, Nature 321:552-525; Nerhoeyan et al. (1988) Science 239:1534; and Beidler et al, 1988, J. Immunol. 141:4053-4060.

Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Such antibodies can be produced using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chain genes, but which can express human heavy and light chain genes. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g. all or a portion of a BCΝP-1 polypeptide. MAbs directed against the antigen can be obtained using conventional hybridoma technology. The human immunoglobulin transgenes harboured by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g. U.S. 5,625,126; U.S. 5,633,425; U.S. 5,569,825; U.S. 5,661,016; and U.S. 5,545,806. Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection." hi this approach a selected non-human monoclonal antibody, e.g. a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope, (Jespers et al. (1994) Bio/technology 12:899- 903). The BCΝP-1 antibodies can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g. human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g. using labelled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene HI or gene Nffl protein. Phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J. Immunol. Methods 184:177-186 (1995); Kettleborough et al, Eur. J. Immunol. 24:952-958 (1994); Persic et al, Gene 187 9-18 (1997); Burton et al, Advances in Immunology 57:191-280 (1994); WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g. as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in WO 92/22324; Mullinax et al, BioTechniques 12(6):864-869 (1992); Sawai et al, AJRI 34:26-34 (1995); and Better et al, Science 240:1041-1043 (1988).

Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. 4,946,778 and U.S. 5,258,498; Huston et al, Methods in Enzymology 203:46-88 (1991); Shu et al, PNAS 90:7995-7999 (1993); and Skerra et al, Science 240: 1038-1040 (1988).

The invention further provides bispecific antibodies, which can be made by methods known in the art. Traditional production of full length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Milstein et al, 1983, Nature 305:537-539). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93/08829, and in Traunecker et al, 1991, EMBO J. 10:3655- 3659.

According to a different and more preferred approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light chain binding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance. h a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94/04690. For further details for generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 1986, 121:210. The invention provides functionally active fragments, derivatives or analogues of the

BCNP-1 antibodies. Functionally active means that the fragment, derivative or analogue is able to elicit anti-anti-idiotype antibodies (i.e. tertiary antibodies) that recognize the same antigen that is recognized by the antibody from which the fragment, derivative or analogue is derived. Specifically, in a preferred embodiment the antigenicity of the idiotype of the antibody may be enhanced by deletion of framework and CDR sequences that are C-terminal to the CDR sequence that specifically recognizes the antigen. To determine which CDR sequences bind the antigen, synthetic peptides containing the CDR sequences can be used in binding assays with the antigen by any binding assay method known in the art.

The present invention provides antibody fragments such as, but not limited to, F(ab')2 fragments and Fab fragments. Antibody fragments which recognize specific epitopes may be generated by known techniques. F(ab')2 fragments consist of the variable region, the light chain constant region and the CHI domain of the heavy chain and are generated by pepsin digestion of the antibody molecule. Fab fragments are generated by reducing the disulfide bridges of the F(ab')2 fragments. The invention also provides heavy chain and light chain dimmers of the BCNP-1 antibodies, or any minimal fragment thereof such as Fvs or single chain antibodies (SCAs) (e.g. as described in U.S. 4,946,778; Bird, 1988, Science 242:423- 42; Huston et al, 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al, 1989, Nature 334:544-54), or any other molecule with the same specificity as the BCNP-1 antibody. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may be used (Skerra et al., 1988, Science 242:1038-1041).

In other embodiments, the invention provides fusion proteins of the BCNP-1 antibodies, for example in which the BCNP-1 antibody is fused via a covalent bond (e.g. a peptide bond), at either the N-terminus or the C-terminus to an amino acid sequence of another protein (or portion thereof, preferably at least a 10, 20 or 50 amino acid portion of the protein) that is not the BCNP-1 antibody. Preferably the BCNP-1 antibody, is covalently linked to the other protein at the N-terminus of the constant domain. As stated above, such fusion proteins may facilitate purification, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system.

The BCNP-1 antibodies include analogues and derivatives that are either modified, i.e. by the covalent attachment of any type of molecule as long as such covalent attachment does not impair immunospecific binding. For example, but not by way of limitation, the derivatives and analogues of the BCNP-1 antibodies include those that have been further modified, e.g. by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatisation by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, etc. Additionally, the analogue or derivative may contain one or more non- classical amino acids.

The BCNP-1 antibodies can be used in methods known in the art relating to the localization and activity of the BCNP-1 polypeptides, e.g. for imaging or radio-imaging these proteins, measuring levels thereof in appropriate biological samples, in diagnostic methods, etc. and for radiotherapy.

The BCNP-1 antibodies can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression technique. Recombinant expression of BCNP-1 antibodies, requires construction of a nucleic acid that encodes the antibody. If the nucleotide sequence of the antibody is known, a nucleic acid encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g. as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding antibody, annealing and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

Alternatively, the nucleic acid encoding the BCNP-1 antibody may be obtained by cloning the antibody. If a clone containing the nucleic acid encoding the particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the antibody may be obtained from a suitable source (e.g. an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the antibody) by PCR amplification using synthetic primers hybridisable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence.

If an antibody molecule that specifically recognizes a particular antigen is not available (or a source for a cDNA library for cloning a nucleic acid encoding such an antibody), antibodies specific for a particular antigen may be generated by any method known in the art, for example, by immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, by generating monoclonal antibodies. Alternatively, a clone encoding at least the Fab portion of the antibody may be obtained by screening Fab expression libraries (e.g. as described in Huse et al., 1989, Science 246: 1275-1281) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (See, e.g. Clackson et al., 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).

Once a nucleic acid encoding at least the variable domain of the antibody molecule is obtained, it may be introduced into a vector containing the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g. WO 86/05807; WO 89/01036; and U.S. 5,122,464). Vectors containing the complete light or heavy chain for co-expression with the nucleic acid to allow the expression of a complete antibody molecule are also available. Then, the nucleic acid encoding the antibody can be used to introduce the nucleotide substitution(s) or deletion(s) necessary to substitute (or delete) the one or more variable region cysteine residues participating in an intrachain disulfide bond with an amino acid residue that does not contain a sulfhydyl group. Such modifications can be carried out by any method known in the art for the introduction of specific mutations or deletions in a nucleotide sequence, for example, but not limited to, chemical mutagenesis, in vitro site directed mutagenesis (Hutchinson et al, 1978, J. Biol. Chem. 253:6551), PCR based methods, etc.

In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al, 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al, 1984, Nature 312:604-608; Takeda et al, 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity, can be used. As described supra, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human antibody constant region, e.g. humanized antibodies.

Once a nucleic acid encoding a BCNP-1 antibody has been obtained, the vector for the production of the antibody may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing the antibody by expressing nucleic acid containing the BCNP-1 antibody sequences are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing an antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al. (1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and Ausubel et al. (eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY).

The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce a BCNP-1 antibody. The host cells used to express a recombinant BCNP-1 antibody may be either bacterial cells such as E. coli, or, preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule. In particular, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking, M.F. & Hofstetter, H., 1985, Gene 45:101-5; Cockett et al, 1990, Bio/Technology 8:2).

A variety of host-expression vector systems may be utilized to express a BCNP-1 antibody. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express the BCNP-1 antibody in situ. These include but are not limited to microorganisms such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g. Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g. baculovirus) containing the antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g. cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g. COS, CHO, BHK, HEK 293, 3T3 cells) harbouring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g. the adeno virus late promoter; the vaccinia virus 7.5K promoter).

In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such an antibody is to be produced, for the generation of pharmaceutical compositions, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al, 1983, EMBO J. 2:1791), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to a matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodopterafrugiperda cells. The antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). In mammalian host cells, a number of viral-based expression systems (e.g. an adenovirus expression system) may be utilized. As discussed above, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g. glycosylation) and processing (e.g. cleavage) of protein products may be important for the function of the protein.

For long-term, high-yield production of recombinant antibodies, stable expression is preferred. For example, cells lines that stably express a BCNP-1 antibody can be produced by transfecting the cells with an expression vector comprising the nucleotide sequence of the antibody and the nucleotide sequence of a selectable marker (e.g. neomycin or hygromycin), and selecting for expression of the selectable marker. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody.

The expression levels of the antibody can be increased by vector amplification (for a review, see Bebbington and Hentschel, "The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning", Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing the antibody is amplifiable, an increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al, 1983, Mol. Cell. Biol. 3:257). The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2197). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA. Once the BCNP-1 antibody has been recombinantly expressed, it may be purified by any method known in the art for purification of an antibody, for example, by chromatography (e.g. ion exchange chromatography, affinity chromatography such as with protein A or specific antigen, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. In a further aspect of the invention, BCNP-1 antibodies may be used in the treatment of B-cell malignancies (e.g. CLL).

In another aspect, the present invention provides a method for the treatment of B-cell malignancies (e.g. CLL), in a subject comprising administering to said subject, a therapeutically effective amount of an antibody that binds to a BCNP-1 polypeptide. Most preferred are antibodies that bind specifically to BCNP-1 polypeptides. In one embodiment, antibodies which specifically bind to BCNP-1 polypeptides may be used to inhibit the activity of said polypeptides. In a particular embodiment the BCNP-1 antibody is conjugated to a therapeutic or diagnostic moiety.

An antibody, optionally conjugated to a therapeutic moiety, can be used as a therapeutic composition that is administered alone or in combination with a cytotoxic factor(s) and/or cytokine(s). BCNP-1 antibodies can be conjugated to a therapeutic agent to modify a given biological response. The therapeutic agent is not to be construed as limited to classical chemical therapeutic agents. For example, the therapeutic agent may be a protein possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumour necrosis factor, α-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g. angiostatin or endostatin; or, a biological response modifier such as a lymphokine, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), nerve growth factor (NGF) or other growth factor.

Techniques for conjugating such therapeutic agents to antibodies are well known, see, e.g. Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62:119-58 (1982).

Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described in U.S. 4,676,980.

As described herein, BCNP-1 is associated with B-cell malignancies (e.g. CLL) and as such provides a means of detection/diagnosis. Thus, in a further aspect, the present invention provides a method of screening for and/or diagnosis of B-cell malignancies (e.g. CLL) in a subject and/or monitoring/assessing the effectiveness of B-cell malignancy (e.g. CLL) therapy in a subject, said method comprising detecting and/or quantifying in a biological sample obtained from said subject, a BCNP-1 polypeptide. In the context of the present invention, the biological sample can be obtained from any source, such as and without limitation, a serum sample or a tissue sample e.g. a clinical CLL sample. In a further embodiment, the level of the BCNP-1 polypeptide is further compared to a reference range or control. In one embodiment the BCNP-1 polypeptide is detected and/or quantified using a BCNP-1 capture reagent, e.g. an antibody.

The BCNP-1 antibodies can be used for diagnosis or to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive nuclides, positron emitting metals (for use in positron emission tomography), and nonradioactive paramagnetic metal ions. See generally U.S. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; suitable prosthetic groups include streptavidin, avidin and biotin; suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride and phycoerythrin; suitable luminescent materials include luminol; suitable bioluminescent materials include luciferase,

125 131 111 99 luciferin, and aequorin; and suitable radioactive nuclides include I, I, In and Tc. The invention also provides diagnostic kits, comprising a capture reagent (e.g. an antibody) against a BCNP-1 polypeptide. In addition, such a kit may optionally comprise one or more of the following: (1) instructions for using the capture reagent for diagnosis, prognosis, therapeutic monitoring or any combination of these applications;

(2) a labelled binding partner to the capture reagent;

(3) a solid phase (such as a reagent strip) upon which the capture reagent is immobilised; and (4) a label or insert indicating regulatory approval for diagnostic, prognostic or therapeutic use or any combination thereof. If no labelled binding partner to the capture reagent is provided, the anti-polypeptide capture reagent itself can be labelled with a detectable marker, e.g. a cherniluminescent, enzymatic, fluorescent, or radioactive moiety (see above).

The methods of screening and/or diagnosis according to the present invention may be performed using a number of methods know to those skilled in the art, including, without limitation, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2 dimensional gel electrophoresis, competitive and non-competitive assay systems using techniques such as Western blots, immunocytochemistry, immunohistochemistry, immunoassays, e.g. radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays. In another embodiment, the invention provides a method of screening for and/or diagnosis of B-cell malignancies (e.g. CLL) in a subject and/or monitoring/assessing the effectiveness of B-cell malignancy (e.g. CLL) therapy in a subject, said method comprising detecting and/or quantifying in a biological sample obtained from said subject, a BCNP-1 nucleic acid molecule. If desired, a BCNP-1 nucleic acid molecule, can be used in hybridisation assays. A

BCNP-1 nucleic acid molecule comprising at least 8 nucleotides (as described supra), can be used as a hybridisation probe. Hybridisation assays can be used for detection, prognosis, diagnosis, or monitoring of therapy of B-cell malignancies (e.g. CLL) in a subject. Accordingly, such a hybridisation assay comprises: i) contacting a biological sample, obtained from a subject, containing nucleic acid with a nucleic acid probe capable of hybridising to a BCNP-1 nucleic acid molecule, under conditions such that hybridisation can occur; and ii) detecting or measuring any resulting hybridisation.

The invention also provides a diagnostic kit comprising a nucleic acid probe capable of hybridising to RNA encoding a BCNP-1 polypeptide, suitable reagents and instructions for use.

In a further embodiment, a diagnostic kit is provided comprising in one or more containers a pair of primers that under appropriate reaction conditions can prime amplification of at least a portion of a BCNP-1 nucleic acid molecule, such as by polymerase chain reaction (see e.g. Innis et al, 1990, PCR Protocols, Academic Press, Inc., San Diego, CA), ligase chain reaction (see EP 320,308) use of Qβ replicase, cyclic probe reaction, or other methods known in the art. Typically, primers are at least eight nucleotides long and will preferably be at least ten to twenty-five nucleotides long and more preferably fifteen to twenty-five nucleotides long. In some cases, primers of at least thirty or at least thirty-five nucleotides in length may be used.

A further aspect of the invention provides methods of screening for agents that modulate a characteristic of, e.g. the interaction, expression or activity, of a BCNP-1 polypeptide or a BCNP-1 nucleic acid. Agents identified through the screening methods of the invention are potential therapeutics for use in the treatment of B-cell malignancies (e.g. CLL).

In a further embodiment, the present invention provides methods for screening for active agents that modulate the expression or activity of a BCNP-1 polypeptide or the expression of a BCNP-1 nucleic acid molecule said method comprising: a) comparing the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, in the presence of a candidate agent with the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, in the absence of the candidate agent or in the presence of a control agent; and b) determining whether the candidate agent causes the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, to change. In a specific embodiment the expression or activity level of the BCNP-1 polypeptide, or the expression level of the BCNP-1 nucleic acid molecule is compared with a predetermined reference range. The invention also provides agents identified by the screening methods described herein and their use in the treatment of B-cell malignancies.

In a further aspect, the present invention provides methods for screening for active agents that interact with a BCNP-1 polypeptide said method comprising: (a) contacting said polypeptide with a candidate agent; and (b) determining whether or not the candidate agent interacts with said polypeptide. Active agents can be selected from a wide variety of candidate agents. Examples of candidate agents include but are not limited to, nucleic acids (e.g. DNA and RNA including BCNP-1 nucleic acids), antibodies (e.g. BCNP-1 antibodies), carbohydrates, lipids, proteins, polypeptides (e.g. BCNP-1 polypeptides), peptides, peptidomimetics, small molecules and other drugs.

Agents for screening in the methods of the invention can be produced using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is suited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12:145; U.S. 5,738,996; and U.S. 5,807,683). Examples of suitable methods based on the present description for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al, 1993, Proc. Natl. Acad. Sci. USA 90:6909; Erb et al, 1994, Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al, 1994, J. Med. Chem. 37:2678; Cho et al, 1993, Science 261: 1303; Carrell et al, 1994, Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al, 1994, Angew. Chem. Int. Ed. Engl. 33:2061 ; and Gallop et al, 1994, J. Med. Chem. 37: 1233.

Libraries of agents may be presented, for example, in solution (e.g. Houghten, 1992, Bio/Techniques 13:412-421), or on beads (Lam, 1991, Nature 354:82-84), chips (Fodor, 1993, Nature 364:555-556), bacteria (US 5,223,409), spores (US 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al, 1992, Proc. Natl. Acad. Sci. USA 89:1865-1869) or phage (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al,. 1990, Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici, 1991, J. Mol. Biol. 222:301- 310).

In one embodiment, agents that interact with (i.e. bind to) a BCNP-1 polypeptide are identified in a cell based assay where a population of cells expressing a BCNP-1 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined. Preferably, the ability of a candidate agent to interact with a BCNP-1 polypeptide is compared to a reference range or control. In another embodiment, a first and second population of cells expressing a BCNP-1 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent. If desired, this type of assay may be used to screen a plurality (e.g. a library) of candidate agents using a plurality of cell populations expressing a BCNP-1 polypeptide. The cell, for example, can be of prokaryotic origin (e.g. E. coli) or eukaryotic origin (e.g. yeast or mammalian). Further, the cells can express the BCNP-1 polypeptide naturally or be genetically engineered to express the polypeptide. In some embodiments, a BCNP-1 polypeptide or the candidate agent is labelled, for example with a radioactive label (such as ³²P, ³⁵S or ¹²⁵I), a fluorescent label (such as fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde or fluorescamine) to enable detection of an interaction between a polypeptide and a candidate agent.

In another embodiment, agents that interact with (i.e. bind to) a BCNP-1 polypeptide are identified in a cell-free assay system where a sample expressing a BCNP-1 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined. Preferably, the ability of a candidate agent to interact with a BCNP-1 polypeptide is compared to a reference range or control. In a preferred embodiment, a first and second sample comprising native or recombinant BCNP-1 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent. If desired, this assay may be used to screen a plurality (e.g. a library) of candidate agents using a plurality of BCNP-1 polypeptide samples. Preferably, the polypeptide is first immobilized, by, for example, contacting the polypeptide with an immobilized antibody which specifically recognizes and binds it, or by contacting a purified preparation of polypeptide with a surface designed to bind proteins. The polypeptide may be partially or completely purified (e.g. partially or completely free of other polypeptides) or part of a cell lysate. Further, the polypeptide may be a fusion protein comprising the BCNP-1 polypeptide or a biologically active portion thereof and a domain such as glutathionine-S-transferase. Alternatively, the polypeptide can be biotinylated using techniques well known to those of skill in the art (e.g. biotinylation kit, Pierce Chemicals; Rockford, IL). The ability of the candidate agent to interact with the polypeptide can be can be duplicated by methods known to those of skill in the art.

In one embodiment, a BCNP-1 polypeptide is used as a "bait protein" in a two-hybrid assay or three hybrid assay to identify other proteins that bind to or interact with the BCNP-1 polypeptide (see e.g. US 5,283,317; Zervos et al, 1993, Cell 72:223-232; Madura et al. 1993, J. Biol. Chem. 268:12046-12054; Bartel et al, 1993, Bio/Techniques 14:920-924; Iwabuchi et al, 1993, Oncogene 8:1693-1696; and WO 94/10300). As those skilled in the art will appreciate, such binding proteins are also likely to be involved in the propagation of signals by a BCNP-1 polypeptide. For example, they may be upstream or downstream elements of a signalling pathway involving a BCNP-1 polypeptide. Alternatively, proteins that interact with a BCNP-1 polypeptide can be identified by isolating a protein complex comprising a BCNP-1 polypeptide and identifying the associated proteins using methods known in the art such as mass spectrometry (for examples see Blackstock, W. & Weir, M. 1999, Trends in Biotechnology, 17: 121-127; Rigaut, G. 1999, Nature Biotechnology, 17: 1030-1032; Husi, H. 2000, Nature Neurosci. 3:661-669; Ho, Y. et al., 2002, Nature, 415:180-183; Gavin, A. et al, 2002, Nature, 415: 141-147).

In all cases, the ability of the candidate agent to interact directly or indirectly with the BCNP-1 polypeptide can be determined by methods known to those of skill in the art. For example but without limitation, the interaction between a candidate agent and a BCNP-1 polypeptide can be determined by flow cytometry, a scintillation assay, an activity assay, mass spectrometry, microscopy, immunoprecipitation or Western blot analysis.

In yet another embodiment, agents that competitively interact with (i.e. competitively bind to) a BCNP-1 polypeptide are identified in a competitive binding assay and the ability of the candidate agent to interact with the BCNP-1 polypeptide is determined. Preferably, the ability of a candidate agent to interact with a BCNP-1 polypeptide is compared to a reference range or control. In an alternative embodiment, a first and second population of cells expressing both a BCNP-1 polypeptide and a protein which is known to interact with the BCNP-1 polypeptide are contacted with a candidate agent or a control agent. The ability of the candidate agent to competitively interact with the BCNP-1 polypeptide is then determined by comparing the interaction in the first and second population of cells. In another embodiment, an alternative second population or a further population of cells may be contacted with an agent which is known to competitively interact with a BCNP-1 polypeptide. Alternatively, agents that competitively interact with a BCNP-1 polypeptide are identified in a cell-free assay system by contacting a first and second sample comprising a BCNP-1 polypeptide and a protein known to interact with the BCNP-1 polypeptide with a candidate agent or a control agent. The ability of the candidate agent to competitively interact with the BCNP-1 polypeptide is then determined by comparing the interaction in the first and second sample, hi another embodiment, an alternative second sample or a further sample comprising a BCNP-1 polypeptide may be contacted with an agent which is known to competitively interact with a BCNP-1 polypeptide. In any case, the BCNP-1 polypeptide and known interacting protein may be expressed naturally or may be recombinantly expressed; the candidate agent may be added exogenously, or be expressed naturally or recombinantly. In another embodiment, agents that modulate an interaction between a BCNP-1 polypeptide and another agent, for example but without limitation a protein, may be identified in a cell-based assay by contacting cells expressing a BCNP-1 polypeptide in the presence of a known interacting agent and a candidate modulating agent and selecting the candidate agent which modulates the interaction. Alternatively, agents that modulate an interaction between a BCNP-1 polypeptide and another agent, for example but without limitation a protein, may be identified in a cell-free assay system by contacting the polypeptide with an agent known to interact with the polypeptide in the presence of a candidate agent. A modulating agent can act as an antibody, a cofactor, an inhibitor, an activator or have an antagonistic or agonistic effect on the interaction between a BCNP-1 polypeptide and a known agent. As stated above the ability of the known agent to interact with a BCNP-1 polypeptide can be determined by methods known in the art. These assays, whether cell-based or cell-free, can be used to screen a plurality (e.g. a library) of candidate agents.

In one embodiment, agents that modulate the expression of a BCNP-1 polypeptide or BCNP-1 nucleic acid are identified in a cell-based assay system. Accordingly, a population of cells expressing a BCNP-1 polypeptide or a BCNP-1 nucleic acid are contacted with a candidate agent and the ability of the candidate agent to alter expression of the BCNP-1 polypeptide or BCNP-1 nucleic acid is determined by comparison to a reference range or control. In another embodiment, a first and second population of cells expressing a BCNP-1 polypeptide or BCNP-1 nucleic acid are contacted with a candidate agent or a control agent and the ability of the candidate agent to alter the expression of the BCNP-1 polypeptide or BCNP-1 nucleic acid is determined by comparing the difference in the level of expression of the BCNP-1 polypeptide or the BCNP-1 nucleic acid between the first and second populations of cells. In a further embodiment, the expression of the BCNP-1 polypeptide or BCNP-1 nucleic acid in the first population may be further compared to a reference range or control. If desired, this assay may be used to screen a plurality (e.g. a library) of candidate agents. The cell, for example, can be of prokaryotic origin (e.g. E. coli) or eukaryotic origin (e.g. yeast or mammalian). Further, the cells can express a BCNP-1 polypeptide or BCNP-1 nucleic acid endogenously or be genetically engineered to express a BCNP-1 polypeptide or BCNP-1 nucleic acid. The ability of the candidate agents to alter the expression of a BCNP-1 polypeptide or BCNP-1 nucleic acid can be determined by methods known to those of skill in the art, for example and without limitation, by flow cytometry, radiolabelling, a scintillation assay, immunoprecipitation, western blot analysis or northern blot analysis. hi another embodiment, agents that modulate the expression of a BCNP-1 polypeptide or BCNP-1 nucleic acid are identified in an animal model. Examples of suitable animals include, but are not limited to, mice, rats, rabbits, monkeys, guinea pigs, dogs and cats. Preferably, the animal used represents a model of B-cell malignancies, for example but without limitation: xenografts of CLL cell lines in Severe Combined Immunodeficient (SCHO) mice, (Mohammad RM, et al, 1996, 10(1): ppl30-7, "Establishment of a human B-CLL xenograft model: utility as a preclinical therapeutic model"; Hummel JL, et al, Leukemia 1996, 10(8):ppl370-6 "Engraftment of human chronic lymphocytic leukaemia cells in SCID mice: in vivo and in vitro studies"), furthermore, a mouse model which mimics CLL is also available for pre-clinical, development studies (Phillips JA, et al, Cancer Res 1992 15;52(2):437-43 "The NZB mouse as a model for chronic lymphocytic leukaemia"). Accordingly, a group of mammals are administered (e.g. orally, rectally or parenterally such as intraperitoneally or intravenously) with a candidate agent and the ability of the candidate agent to modulate the expression of the BCNP-1 polypeptide or BCNP-1 nucleic acid is determined by comparison with a reference range or control. In another embodiment a first and second group of mammals are administered with a candidate agent or a control agent and the ability of the candidate agent to modulate the expression of the BCNP-1 polypeptide or the BCNP-1 nucleic acid is determined by comparing the difference in expression between the first and second group of mammals. Where desired the expression of the BCNP-1 polypeptide or the BCNP-1 nucleic acid in the first and second group of mammals can be compared to the level of a BCNP-1 polypeptide or a BCNP-1 nucleic acid in a control group of mammals or to a reference range. Changes in the expression of a polypeptide or a nucleic acid can be assessed by the methods outlined above. Alternatively, agents may be identified by monitoring the effect of their administration on symptoms associated with the disease or condition to be treated (e.g. to ameliorate symptoms or to delay onset or slow the progression of the disease). Therefore in a further embodiment, agents that reduce the severity of one or more symptoms associated with the disease or that slow the progression of the disease in a group of mammals treated with the candidate agent, compared to a untreated group of mammals are identified as potential active agents for the treatment of the disease. Techniques known to physicians familiar with B-cell malignancies, (e.g. CLL) can be used to determine whether a candidate agent has altered one or more symptoms associated with the disease. For example, a candidate agent that slows or prevents the accumulation of functionally incompetent, monoclonal lymphocytes in the blood, bone marrow and/or lymphatic tissues in an animal model of CLL may be beneficial for treating subjects having CLL.

In another embodiment, a cell-based assay system is used to identify agents capable of modulating the activity of a BCNP-1 polypeptide. Accordingly, the activity of a BCNP-1 polypeptide is measured in a population of cells that naturally or recombinantly express a BCNP-1 polypeptide, in the presence of candidate agent. Preferably the activity of a BCNP-1 polypeptide is compared to a reference range or control. In a preferred embodiment, the activity of a BCNP-1 polypeptide is measured in a first and second population of cells that naturally or recombinantly express a BCNP-1 polypeptide, in the presence of a candidate agent or in the absence of a candidate agent (e.g. in the presence of a control agent) and the activity of the BCNP-1 polypeptide is compared. The candidate agent can then be identified as a modulator of the activity of a BCNP-1 polypeptide based on this comparison.

Alternatively, the activity of a BCNP-1 polypeptide can be measured in a cell-free assay system where the BCNP-1 polypeptide is either natural or recombinant. Preferably, the activity of a BCNP-1 polypeptide is compared to a reference range or control. In a preferred embodiment, the activity of a BCNP-1 polypeptide is measured in a first and second sample in the presence or absence of a candidate agent and the activity of the BCNP-1 polypeptide is compared. The candidate agent can then be identified as a modulator of the activity of a BCNP-1 polypeptide based on this comparison.

The activity of a BCNP-1 polypeptide can be assessed by detecting its effects on a downstream effector, for example but without limitation, the level or activity of a second messenger (e.g. cAMP, intracellular Ca²⁺, diacylglycerol, IP3, etc.), detecting catalytic or enzymatic activity, detecting the induction of a reporter gene (e.g. luciferase), or detecting a cellular response, for example proliferation, differentiation or transformation where appropriate as known by those skilled in the art (for activity measurement techniques see e.g. US 5,401,639). In another embodiment, agents such as an enzyme, or a biologically active portion thereof, which is responsible for the production or degradation of a BCNP-1 polypeptide, or is responsible for the post-translational modification of a BCNP-1 polypeptide can be identified. In a primary screen, substantially pure, native or recombinantly expressed BCNP-1 polypeptides or cellular extract or other sample comprising native or recombinantly expressed BCNP-1 polypeptides are contacted with a plurality of candidate agents, for example but without limitation, a plurality of agents presented as a library, that may be responsible for the processing of a BCNP-1 polypeptide, in order to identify such agents. The ability of the candidate agent to modulate the production, degradation or post-translational modification of a BCNP-1 polypeptide can be determined by methods known to those of skill in the art, including without limitation, flow cytometry, radiolabelling, a kinase assay, a phosphatase assay, immunoprecipitation and western blot analysis.

In yet another embodiment, cells expressing a BCNP-1 polypeptide are contacted with a plurality of candidate agents. The ability of a candidate agent to modulate the production, degradation or post-translational modification of a BCNP-1 polypeptide can be determined by methods known to those of skill in the art, including without limitation, flow cytometry, radiolabelling, kinase assay, phosphatase assay, immunoprecipitation and Western blot analysis.

One skilled in the art will also appreciate that a BCNP-1 polypeptide may also be used in a method for the structure-based design of an agent, in particular a small molecule which acts to modulate (e.g. stimulate or inhibit) the activity of said polypeptide, said method comprising:

1) determining the three-dimensional structure of said polypeptide;

2) deducing the three-dimensional structure of the likely reactive or binding site(s) of the agent;

3) synthesising candidate agents that are predicted to react or bind to the deduced reactive or binding site; and

4) testing whether the candidate agent is able to modulate the activity of said polypeptide. It will be appreciated that the method described above is likely to be an iterative process.

This invention further provides BCNP-1 polypeptides, BCNP-1 nucleic acids, BCNP- 1 antibodies, agents that modulate the expression or activity of a BCNP-1 polypeptide, that interact with a BCNP-1 polypeptide or that modulate the expression of a BCNP-1 nucleic acid, including those identified by the above-described screening methods and uses thereof for treatments as described herein. Hereinafter, the agents, BCNP-1 polypeptides, BCNP-1 nucleic acids and BCNP-1 antibodies are referred to as "active agents". The term "treatment" includes either therapeutic or prophylactic therapy. When a reference is made herein to a method of treating or preventing a disease or condition using a particular active agent or combination of agents, it is to be understood that such a reference is intended to include the use of that active agent or combination of agents in the preparation of a medicament for the treatment of said disease or condition.

In one embodiment the invention provides an active agent for use in therapy. In order to use the active agents of the invention in therapy, they will normally be formulated into a pharmaceutical composition in accordance with standard pharmaceutical practice, e.g. by admixing the active agent and a pharmaceutically acceptable carrier.

As discussed herein, active agents of the invention find use in the treatment or prophylaxis of B-cell malignancies (e.g. CLL). Thus, in a further aspect, the present invention provides a pharmaceutical composition comprising at least one active agent, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents.

In one aspect, and so any additional components will be acceptable for vaccine use. In addition, the skilled person will appreciate that one or more suitable adjuvants may be added to such vaccine preparations.

In a further aspect of the invention the pharmaceutical composition is for use as a vaccine. A BCNP-1 polypeptide or nucleic acid as described above can be used in the production of vaccines for treatment of B-cell malignancies (e.g. CLL). Such material can be antigenic and/or immunogenic. Antigenic material includes a protein or nucleic acid that is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject. Immunogenic material includes a protein or nucleic acid that is capable of eliciting an immune response in a subject. Thus, in the latter case, the protein or nucleic acid may be capable of not only generating an antibody response but, in addition, a non-antibody based immune response i.e. a cellular or humoral response. It is well known in the art that is possible to identify those regions of an antigenic or immunogenic polypeptide that are responsible for the antigenicity or immunogenicity of said polypeptide i.e. an epitope or epitopes. Amino acid and peptide characteristics well known to the skilled person can be used to predict the antigenic index (a measure of the probability that a region is antigenic) of a BCNP-1 polypeptide. For example, but without limitation, the 'Peptidestructure' program (Jameson and Wolf, 1988, CABIOS, 4(1): 181) and a technique referred to as 'Threading' (Altuvia Y. et al, 1995, J. Mol. Biol. 249:244) can be used. Thus, the BCNP-1 polypeptides may include one or more such epitopes or be sufficiently similar to such regions so as to retain their antigenic/immunogenic properties.

A further aspect of the invention relates to a vaccine composition of use in the treatment of B-cell malignancies (e.g. CLL). Since a polypeptide or nucleic acid may be broken down in the stomach, the vaccine composition is preferably administered parenterally (e.g. subcutaneous, intramuscular, intravenous or intradermal injection).

Accordingly, in further embodiments, the present invention provides: a) the use of such a vaccine in inducing an immune response in a subject; and b) a method for the treatment of B-cell malignancies (e.g. CLL) in a subject, or of vaccinating a subject against B-cell malignancies (e.g. CLL) which comprises the step of administering to the subject an effective amount of a BCNP-1 polypeptide or nucleic acid, preferably as a vaccine.

Preferably, the nucleic acid is administered via gene therapy (see for example Hoshida, T. et al, 2002, Pancreas, 25: 111-121 ; Ikuno, Y. 2002, Invest. Ophthalmol. Vis. Sci. 200243:2406-2411; Bollard, C, 2002, Blood 99:3179-3187; Lee E., 2001, Mol. Med. 7:773- 782). In one embodiment, a BCNP-1 polypeptide fused to another polypeptide, such as the protein transduction domain of the FH /Tat protein, which facilitates the entry of fusion protein into a cell (Asoh, S. et al, 2002, Proc. Natl. Acad. Sci. USA, 99:17107-17112) is provided for use in the manufacture of a composition for the treatment of B-cell malignancies (e.g. CLL).

In a specific embodiment, hybridising BCNP-1 nucleic acid molecules are used as anti- sense molecules, to alter the expression of BCNP-1 polypeptides by binding to complementary BCNP-1 nucleic acids and can be used in the treatment or prevention of B-cell malignancies (e.g. CLL). An anti-sense nucleic acid includes a BCNP-1 nucleic acid capable of hybridising by virtue of some sequence complementarity to a portion of an RNA (preferably mRNA) encoding a BCNP-1 polypeptide. The anti-sense nucleic acid can be complementary to a coding and/or non-coding region of an mRNA encoding such a polypeptide. Most preferably, expression of a BCNP-1 polypeptide is inhibited by use of anti-sense nucleic acids. Thus, the present invention provides the therapeutic or prophylactic use of nucleic acids comprising at least eight nucleotides that are anti-sense to a gene or cDNA encoding a BCNP-1 polypeptide. A further aspect of the invention provides the use of an active agent in the preparation of a medicament for the prophylaxis and/or treatment of B-cell malignancies. An additional aspect of the invention provides a method for the prophylaxis and/or treatment of B-cell malignancies in a subject which comprises administering to said subject a therapeutically effective amount of an active agent of the invention, in particular the active agent is a BCNP-1 antibody, in a preferred embodiment the antibody specifically binds BCNP-1. The medicament will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier. This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient).

The pharmaceutical composition may be adapted for administration by any appropriate route, for example by the oral (including buccal or sublingual), rectal, nasal, topical (including buccal, sublingual or transdermal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route. The most suitable route for administration in any given case will be determined by the particular active agent, the B-cell malignancy involved, the subject and the nature and severity of the disease and the physical condition of the subject. Such compositions may be prepared by any method known in the art of pharmacy, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.

The active agents may be administered in combination, e.g. simultaneously, sequentially or separately, with one or more other therapeutically active, e.g. anti-B-cell malignancy, agents. Pharmaceutically acceptable carriers for use in the invention may take a wide variety of forms depending, e.g. on the route of administration.

Compositions for oral administration may be liquid or solid. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Oral liquid preparations may contain suspending agents, for example sorbitol, methyl cellulose, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agents, for example lecithin, sorbitan monooleate, or acacia; water; non-aqueous vehicles (which may include edible oils), for example polyols, almond oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid; flavoring agents, preservatives, coloring agents and the like may be used.

In the case of oral solid preparations such as powders, capsules and tablets, carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like may be included. Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are generally employed. In addition to the common dosage forms set out above, active agents of the invention may also be administered by controlled release means and/or delivery devices. Tablets and capsules may comprise conventional carriers or excipients such as binding agents for example, syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, stearic acid or salts thereof, sorbitol or glycine; tableting lubricants, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example potato starch; or acceptable wetting agents such as sodium lauryl sulphate. The tablets may be coated by standard aqueous or non-aqueous techniques according to methods well known in normal pharmaceutical practice. Suitable excipients for use with soft gelatine capsules include for example vegetable oils, waxes, fats, semi-solid, or liquid polyols etc.

Pharmaceutical compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient, as a powder or granules, or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in- oil liquid emulsion. Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active ingredient with the carrier, which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation. For example, a tablet may be prepared by compression or moulding, optionally with one or more accessory ingredients.

Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Moulded tablets may be made by moulding, in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent. Desirably, each tablet contains from about 1 mg to about 500 mg of the active ingredient and each cachet or capsule contains from about 1 to about 500 mg of the active ingredient. Compositions comprising an active agent of the invention may also be prepared in powder or liquid concentrate form. Conventional water soluble excipients, such as lactose or sucrose, may be incorporated in the powders to improve their physical properties. Thus, particularly suitable powders of this invention comprise 50 to 100% w/w, and preferably 60 to 80% w/w of the combination and 0 to 50% w/w and preferably 20 to 40% w/w of conventional excipients. When used in a veterinary setting such powders may be added to animal feedstuffs, for example by way of an intermediate premix, or diluted in animal drinking water.

Liquid concentrates of this invention for oral administration suitably contain a water- soluble compound combination and may optionally include a veterinarily acceptable water miscible solvent, for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol. The liquid concentrates may be administered to the drinking water of animals, particularly poultry.

Pharmaceutical compositions suitable for parenteral administration may be prepared as solutions or suspensions of the active agents of the invention in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include aqueous or non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Extemporaneous injection solutions, dispersions and suspensions may be prepared from sterile powders, granules and tablets.

The compositions may be presented in unit-dose or multi-dose containers, for example in sealed ampoules and vials and to enhance stability, may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. The sterile liquid carrier may be supplied in a separate vial or ampoule and can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g. glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Advantageously, agents such as a local anaesthetic, preservative and buffering agents can be included the sterile liquid carrier.

In certain embodiments, the active agents of the invention can be formulated to ensure proper distribution in vivo, for example, in liposomes. For methods of manufacturing liposomes, see, e.g. US 4,522,811; 5,374,548; and 5,399,331. The liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g. Ranade, V. 1989, J. Clin. Pharmacol. 29: 685). Exemplary targeting moieties include folate or biotin (see, e.g. US 5,416,016); mannosides (Umezawa et al., 1988, Biochem. Biophys. Res. Comm. 153:1038); antibodies (Bloeman, P. et al., 1995, FEBS Lett. 357:140; Owais, M. et al. (1995) Antimicrob. Agents Chemother. 39: 180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol. 1233: 134), different species of which may comprise the compositions of the inventions, as well as components of the invented molecules; psi 20 (Schreier et al. (1994) J. Biol. Chem. 269: 9090); see also Keinanen, K. & Laukkanen, M., 1994, FEBS Lett. 346: 123; KiUion, J. & Fidler, I., 1994, Immunomethods 4 : 273. In one embodiment of the invention, the active agents of the invention are formulated in liposomes; in a more preferred embodiment, the liposomes include a targeting moiety. In a most preferred embodiment, the therapeutic compounds in the liposomes are delivered by bolus injection to a site close to the region affected by the B-cell malignancy.

Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, impregnated dressings, sprays, aerosols or oils, transdermal devices, dusting powders, and the like. These compositions may be prepared via conventional methods containing the active ingredient. Thus, they may also comprise compatible conventional carriers and additives, such as preservatives, solvents to assist drug penetration, emollients in creams or ointments and ethanol or oleyl alcohol for lotions. Such carriers may be present as from about 1% up to about 98% of the composition. More usually they will form up to about 80% of the composition. As an illustration only, a cream or ointment is prepared by mixing sufficient quantities of hydrophilic material and water, containing from about 5-10% by weight of the compound, in sufficient quantities to produce a cream or ointment having the desired consistency.

Pharmaceutical compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. For example, the active ingredient may be delivered from the patch by iontophoresis as generaUy described in Pharmaceutical Research, 3(6):318 (1986).

For applications to external tissues, for example the mouth and skin, the compositions are preferably applied as a topical ointment or cream. When formulated in an ointment, the active ingredient may be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.

Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles and mouth washes.

Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent. They also include topical ointments or creams as above.

Pharmaceutical compositions adapted for nasal administration wherein the carrier is a sohd include a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable compositions wherein the carrier is a Uquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the active ingredient.

Pharmaceutical compositions adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurised aerosols, nebulisers or insufflators.

Pharmaceutical compositions suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories. Suitable carriers include cocoa butter or other glyceride or materials commonly used in the art, and the suppositories may be conveniently formed by admixture of the combination with the softened or melted carrier(s) followed by chilling and shaping moulds. They may also be administered as enemas.

Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray compositions. These may comprise emollients or bases as commonly used in the art.

Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solution which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation substantially isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Excipients which may be used for injectable solutions include water, alcohols, polyols, glycerine and vegetable oils, for example. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophiUsed) condition requiring only the addition of the sterile liquid carried, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets. The pharmaceutical compositions may contain preserving agents, solubilising agents, stabilising agents, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts (substances of the present invention may themselves be provided in the form of a pharmaceutically acceptable salt), buffers, coating agents or antioxidants. They may also contain therapeutically active agents in addition to the substance of the present invention.

Dosages of the active agents of the present invention to be administered can vary between wide limits, depending upon the active agent used, the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be reduced, in accordance with normal clinical practice. For the treatment of B-cell malignancies the dosage may range from O.Olmg/kg to 750mg/kg. For prophylactic use in humans and animals, the dosage may range from O.Olmg/kg to lOOmg/kg.

The compositions may contain from 0.1% by weight, preferably from 10-60% by weight of the active agent of the invention depending on the method of administration.

Pharmaceutical compositions, may be conveniently presented in unit dosage form containing a predetermined amount of an active agent of the invention per dose. Such a unit may contain, for example but without limitation, O.lmg.kg to lOOmg.kg depending on the disease or condition being treated, the route of administration, and the age, weight and condition of the subject. Preferred unit dosage compositions are those containing a daily dose or sub-dose, as recited above, or an appropriate fraction thereof of the active ingredient. These unit dosage forms will generaUy be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage forms. It will be recognised by one of skill in the art that the optimal quantity and spacing of individual doses of an active agent of the invention will be determined by the nature and extent of the condition being treated, the form route and site of administration and the particular subject being treated, and that such optimums can be determined by conventional techniques. It will also be appreciated by one of skill in the art that the optimal course of treatment, i.e. the number of doses of an active agent of the invention given per day for a defined number of days can be ascertained by those skilled in the art using conventional course of treatment determination tests. Dosage regimens are adjusted to provide the optimum desired response. For example a sing bolus may be administered, several divided doses may be administered over time of the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Pharmaceutical compositions can comprise BCNP-1 polypeptides, BCNP-1 nucleic acids or agents which interact with, alter the expression or activity of, or competitively interact with a BCNP-1 polypeptide. Said compositions can also comprise an agent which modulates the interaction of a BCNP-1 polypeptide with another agent, e.g. a known interactor. hi summary, the invention further provides:

(i) the use of a BCNP-1 polypeptide or BCNP-1 nucleic acid in the manufacture of a medicament for the treatment of B-cell malignancies (e.g. CLL); 03 00910

(ii) a method of treatment of B-cell malignancies (e.g. CLL) in a subject, which comprises administering to said subject a therapeutically effective amount of a BCNP-1 polypeptide or a BCNP-1 nucleic acid;

(iii) a BCNP-1 polypeptide or BCNP-1 nucleic acid for use in the treatment of B-cell malignancies (e.g. CLL);

(iv) the use of an antibody that binds to a BCNP-1 polypeptide in the manufacture of a medicament for use in the prophylaxis and/or treatment of B-cell malignancies (e.g. CLL);

(v) a method of treatment of B-cell malignancies (e.g. CLL) in a subject, which comprises administering to said subject a therapeutically effective amount of an antibody for a BCNP-1 polypeptide;

(vi) an antibody for a BCNP-1 polypeptide for use in the treatment of B-cell malignancies (e.g. CLL);

(vii) the use of an agent which modulates the interaction, expression or activity of a BCNP-1 polypeptide or a BCNP-1 nucleic acid in the preparation of a medicament for the treatment of B-cell malignancies (e.g. CLL);

(viii) a method for the prophylaxis and/or treatment of B-cell malignancies (e.g. CLL) in a subject, which comprises administering to said subject a therapeutically effective amount of an active agent of the invention; and

(ix) an agent which modulates the interaction, expression or activity of a BCNP-1 polypeptide or a BCNP-1 nucleic acid for use in the treatment of B-cell malignancies (e.g. CLL).

Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis. The prior art documents mentioned herein are incorporated to the fullest extent permitted by law.

The invention will now be described with reference to the following examples, which should not in any way be construed as limiting the scope of the present invention. The examples refer to the figures in which:

Figure 1: shows a putative exon structure of BCNP-1 based on a GenScan coding region prediction of the chromosomal region where the gene was shown to be located by EST BLAST alignment. Based on this prediction and the identification of a tryptic digest peptide, primers were designed to clone BCNP-1, the locations of the primers and over-lapping fragments of BCNP-1 amplified using different combinations of each are indicated.

Figure 2A: shows the nucleotide (SEQ HO NO: 2) and amino acid (SEQ ED NO: 1) sequences of BCNP-1 alternate form 1. The tandem mass spectrum is underlined. Spectra matched by mass are shown in bold (the accuracy was within 20ppm). The internal alternatively spliced region of cDNA (as described in Example 1) is italicised. This sequence has alternative final exon I beginning at 1981 (this residue is indicated by an arrow). Figure 2B: shows the nucleotide (SEQ HO NO: 4) and amino acid (SEQ ID NO: 3) sequences of BCNP-1 alternate form 2. The tandem mass spectrum is underlined. Spectra matched by mass are shown in bold (the accuracy was within 20ppm). The internal alternatively spliced region of cDNA (as described in Example 1) is italicised. This sequence has alternative final exon II beginning at 1981 (this residue is indicated by an arrow).

Figure 2C: shows the nucleotide (SEQ HO NO: 6) and amino acid (SEQ HO NO: 5) sequences of BCNP-1 alternate form 3. The tandem mass spectrum is underlined. Spectra matched by mass are shown in bold (the accuracy was within 20ppm). The internal alternatively spliced region of cDNA (as described in Example 1) is italicised. This sequence has alternative final exon in beginning at 1981 (this residue is indicated by an arrow).

Figure 3: shows tissue distribution of BCNP-1 mRNA. Levels of mRNA in normal tissues and three lymphoma derived cell lines (Daudi, Raji and HL-60) were quantified by real time RT-PCR. mRNA levels are expressed as the number of copies ng^"1 cDNA.

Figure 4: shows the expression of BCNP-1 mRNA in normal and tumour tissues.

Levels of BCNP-1 mRNA in matched normal and tumour tissues from breast, cervix, colon, kidney, lung, thymus and uterus cancer patients were measured by real time RT-PCR. mRNA levels are expressed as the number of copies ng^"1 cDNA.

Figure 5: shows the expression of BCNP-1 mRNA in a number of cancer-derived cell lines. Levels of BCNP-1 mRNA were measured by real time RT-PCR; mRNA levels are expressed as the number of copies ng^"1 cDNA.

Figure 6: shows the distribution of the three BCNP-1 alternate final exon splice form mRNAs in cell lines derived from B-cell malignancies. Levels of mRNA were quantified by real time RT-PCR. mRNA levels are expressed as the number of copies ng^"1 cDNA. Grey bars represent expression of transcripts containing alternate form 1 (see Figure 1), black bars represent alternate form 2, hatched bars represent alternate form 3.

Figure 7: shows the distribution of three BCNP-1 alternate final exon splice form mRNAs in clinical CLL tissues. Levels of mRNA were quantified by real time RT- PCR. mRNA levels are expressed as the number of copies ng^"1 cDNA. Grey bars represent expression of transcripts containing alternate form 1, black bars represent alternate form 2, hatched bars represent alternate form 3. In addition to the 8 CLL samples 6 normal tissues/blood cell sub-sets are shown for comparison.

Figure 8: shows the distribution of three BCNP-1 alternate final exon splice form mRNAs in clinical lymphoma tissues. Levels of mRNA were quantified by real time RT-PCR. mRNA levels are expressed as the number of copies ng^"1 cDNA. Grey bars represent expression of transcripts containing alternate form 1, black bars represent alternate form 2, hatched bars represent alternate form 3. In addition to the 8 CLL samples 6 normal tissues/blood cell sub-sets are shown for comparison. DL-BCL, diffuse large B-cell lymphoma; FCL, follicular lymphoma; NS-HL, nodular sclerosing non-Hodgkin' s lymphoma.

Example 1: Identification and cloning of BCNP-1

Protein BCNP-1 was isolated from CLL specimens. la - Plasma membrane generation

10 x 15cm² dishes of cells were washed three times with PBS-CM (each dish contained approx. 2xl0⁸ cells). 5ml of ice cold PBS-CM was added to the first dish and the cells were scraped using a plastic cell lifter. AU the dishes were scraped in this volume of PBS-CM. The cells were then centrifuged at 1000 x g for 5 min at +4°C. The supernatant was removed and the cells were resuspended in 10ml of homogenisation buffer (250mM Sucrose in lOmM HEPES, ImM EDTA ImM Vanadate, 0.02% Azide). The cells were centrifuged at 1000 x g for 5 min at +4°C and the supernatant removed. The cell pellet was then resuspended in 5 x packed cell volume with homogenisation buffer plus protease inhibitors (Sigma). The ball bearing homogeniser (BBH) (8.002mm ball) was chilled and rinsed with homogenisation buffer. The cell suspension was taken up in a 2ml syringe and this was attached to one side of the BBH. Another syringe was attached to the other side of the BBH. The cell mixture was fed through the chamber up to five times. The cells were monitored using a microscope and when the cells were sufficiently lysed the resulting mixture was centrifuged at 1000 x g for 5 min at +4°C. The resulting supernatant (PNS) was retained. 1ml of homogenisation buffer was added to the nuclear pellet and re-centrifuged at 1000 x g for 5 min. The above two fractions were pooled and centrifuged at 3000 x g for 10 min at +4°C. The 3000 x g supernatant was layered onto 2ml 60% sucrose cushion in SW40 or SW60 tube and centrifuged at 100 000 x g for 45 min with slow acceleration and deceleration. The crude plasma membrane was evident as a discrete layer on top of the sucrose cushion. The upper layer was removed (cytosol) and the plasma membrane was collected using a pasteur pipette. The % sucrose of crude plasma membrane fraction was determined using a refractometer. The membrane preparation was diluted with HEPES buffer to reduce the sucrose content to below 15%. The crude plasma membrane preparation was layered on preformed 15 to 60% sucrose gradient in SW40 tube and spun at 100 000 x g for 17 h with slow acceleration and deceleration. The sucrose gradient was fractionated using the gradient unloader (speed 0.5, distance 2.5, fractions 35). The protein content of the fractions was measured and 10 micrograms of protein was run on a 4-20% acrylamide ID gel (Novex) and subject to western blotting with antibodies to Transferrin Receptor, Oxidoreductase II and Calnexin.

lb - Preparation of plasma membrane fractions for ID gel analysis

Plasma membrane fractions that had transferrin immunoreactivity but no oxidoreductase H or calnexin immunoreactivity were identified. These sucrose fractions were pooled and diluted at least four times with lOmM HEPES, ImM EDTA ImM Vanadate, 0.02% Azide. The diluted sucrose fraction was added to a SW40 or SW60 tube and centrifuged at 100 000 x g for 45 min with slow acceleration and deceleration. The supernatant was removed from the membrane pellet and the pellet washed three times with PBS-CM. The membrane pellet was solubulized in 2% SDS in 63mM TrisHCl, pH 7.4. A protein assay was done and mercaptoethanol (2% final), glycerol (10%) and bromopheneol blue (0.0025% final) was added. A final protein concentration of 1 microgram/microlitre was used for ID-gel loading.

lc - ID gel technology Protein membrane pellets were solubilised in ID-sample buffer (approximately lmg/ml) and the mixture heated to 95°C for 5 min. Samples were separated using ID-gel electrophoresis on pre-cast 8-16% gradient gels (Bio-Rad Laboratories, Hemel Hempstead, UK). A sample containing 30-50 micrograms of the protein mixtures obtained from a detergent extract were applied to the stacking gel wells using a micro-pipette. A well containing molecular weight (10, 15, 25, 37, 50, 75, 100, 150 and 250 kDa) was included for calibration by interpolation of the separating gel after imaging. Separation of the proteins was performed by applying a current of 30mA to the gel for approximately 5 h or until the bromophenol blue marker dye had reached the bottom of the gel.

After electrophoresis the gel plates were prised open, the gel placed in a tray of fixer (10% acetic acid, 40% ethanol, 50% water) and shaken overnight. The gel was then primed for 30 min by shaking in a primer solution (7.5% acetic acid, 0.05% SDS in Milli-Q water) followed by incubation with a fluorescent dye (0.06% OGS dye (US 6,335,446) in 7.5% acetic acid) with shaking for 3 h.

A digital image of the stained gel was obtained by scanning on a Storm Scanner (Molecular Dynamics Inc, USA) in the blue fluorescence mode. The captured image was used to determine the area of the gel to excise for in-gel proteolysis.

Id - Recovery and analysis of selected proteins

The vertical lane of the gel at 8 lkDa was excised using a stainless steel scalpel blade that cuts sequentially down the length of the gel lane with no attempt at collecting specific protein bands.

Proteins were processed using in-gel digestion with trypsin (Modified trypsin, Promega, Wisconsin, USA) to generate tryptic digest peptides. The recovered peptide pool was divided into two; one pool was analyzed by mass spectrometry using a PerSeptive Biosystems Voyager- DETM STR Matrix-Assisted Laser Desorption Ionization

Time-of-Flight (MALDI-TOF) mass spectrometer, and the second pool of selected tryptic peptides were analyzed by nano-LC tandem mass spectrometry (LC/MS/MS) using a Micromass Quadrupole Time-of-Flight (Q-TOF) mass spectrometer (Micromass, Altrincham, U.K.). For partial amino acid sequencing and identification of proteins uninterpreted tandem mass spectra of tryptic peptides were searched using the SEQUEST search program (Eng et al, 1994, J. Am. Soc. Mass Spectrom. 5:976-989), version v.C.l. Criteria for database identification included: the cleavage specificity of trypsin; the detection of a suite of a, b and y ions in peptides returned from the database. The database searched was constructed from protein entries in the non-redundant database held by the National Centre for Biotechnology Information (NCBI) that is accessible at http://www.ncbi.nlm.nih.gov/ and the Ensembl Genome Server at http://www.ensembl.org/. Following identification of proteins through spectral-spectral correlation using the SEQUEST program, masses detected in MALDI-TOF mass spectra were assigned to tryptic digest peptides within the proteins identified. In cases where no amino acid sequences could be identified through searching with uninterpreted MS/MS spectra of tryptic digest peptides using the SEQUEST program; tandem mass spectra of the peptides were interpreted manually, using methods known in the art. (In the case of interpretation of low-energy fragmentation mass spectra of peptide ions see Gaskell et al, 1992, Rapid Commun. Mass Spectrom. 6:658-662). The method described in WO 02/21139, which is incorporated herein by reference in its entirety, was also used to interpret mass spectra.

As a result of sequence database searching a tandem amino acid sequence was found to match a GenScan coding region prediction (Clorf24) at chromosomal position 19pl3.11. However, the prediction did not give any indication of the gene structure or the number of genes contained within this prediction.

Additionally, sequences were identified using peptide mass data derived from mass spectrometer analysis and the MOWSE database search procedure. Peptide mass information can provide a 'fingerprint' signature sufficiently discriminating to allow for the unique and rapid identification of unknown sample proteins, independent of other analytical methods such as protein sequence analysis. Practical experience has shown that sample proteins can be uniquely identified using as few as 3-4 experimentally determined peptide masses when screened against a fragment database derived from over 50,000 proteins (D.J.C. Pappin, P. Hojrup and A.J. Bleasby 'Rapid Identification of Proteins by Peptide-Mass Fingerprinting'. Current Biology (1993), vol 3, 327-332. and http://www.hgmp.mrc.ac.uk/Bioinformatics/Webapp/mowse/). The version of the code used for a MOWSE database search had the following modifications: the size of the parent protein is not included in the calculation such that large proteins such as titin no longer bias the score; instead the theoretical frequency of a peptide of mass (x) is estimated using the mass (x) of the peptide and the mean mass of an amino acid whilst allowing for a probability of 0.2 for a missed internal cleavage (by trypsin) and 0.1 for the probability of the occurrence of a proteolytic cleavage site.

The score assigned to a match on a peptide mass (x) is the logarithm of the probability of finding such a match at random and is inversely proportional to the frequency of fragments of that mass. The score is thus calculated using the linear regression formula found by plotting the score for a match on peptide mass (x) against the mass (x). Four mass matches to predicted trypsin fragments were identified in this manner for BCNP-1.

BCNP-1 was cloned from the Daudi Burkitt's Lymphoma Derived Cell Line: Preparation of total RNA and cDNA synthesis

Total RNA was prepared from cultured cells using Trizol reagent (Life Technologies), according to the manufacturer's instructions, and resuspended in RNAse-free water at a concentration of lμg/μl. 1 to 5μg total RNA were used as a template for cDNA synthesis using an oligo dT primer and the Superscript H reverse transcription kit (Life Technologies). cDNAs were column purified (Qiagen) and eluted at a concentration of lOng/μl.

Cloning of BCNP-1 cDNA: The GenScan coding region prediction was aligned with genomic DNA

(www.ensembl.org) and localised to chromosomal position 19pl3.1. This allowed the design of multiple PCR primers that were used to generate multiple overlapping coding region fragments from RT-PCR of spleen and Daudi cell-line mRNA. The fragments amplified are illustrated in Figure 1. The largest amplified fragment was almost full-length (2.3 kb) and indicated that the GenScan prediction represented only one gene, which we termed B-Cell novel protein 1 (BCNP-1). Combinations of the following sets of primers were used to amplify multiple overlapping fragments of BCNP-1 (Figure 1). FI: 5'gctgagcaggagatgggaattg 3' (SEQ HO NO: 7) F2: 5'ggagacgacagcagcatgggtg 3' (SEQ HO NO: 8) R3: 5' caaggattcagggcagagagca 3' (SEQ HO NO: 9) F4: 5' gaacgtctagaagatgcgacct 3' (SEQ HO NO: 10) R5: 5' gaagttgctcccgcatcagcac 3' (SEQ ID NO: 11) F6: 5' gatatcaggggaccgctcgagt 3' (SEQ ID NO: 12) R7: 5' actcgagcggtcccctgatatc 3' (SEQ HO NO: 13) R8: 5' tacatcattggcaccaagggtc 3' (SEQ ID NO: 14) R9: 5' agagatgggacacaaattcacc 3' (SEQ HO NO: 15)

RT-PCR Reactions contained lOng cDNA and reagents for PCR (www.Clontech.com), and used the following thermocycling parameters: 1 cycle of 94°C for 5 min, followed by 40 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 110 sec. PCR products were column purified (Qiagen), cloned into the pCR4 TOPO vector

(www.Invitrogen.com) and the nucleotide sequence subsequently verified (University of Oxford, Sequencing Facility, UK).

Rapid amplification of cDNA ends (RACE) PCR was also used to determine the 5 and 3 prime ends of the BCNP-1 mRNA transcript. RACE-ready cDNA libraries from human spleen and the Burkitts Lymphoma-derived Daudi cell line were obtained commercially from Clontech Laboratories Inc (www.Clontech.com). For 3' BCNP-1 RACE PCR the following BCNP-1 internal primer was used, 5' gatatcaggggaccgctcgagtcgtg 3' (SEQ HO NO: 16), along with the manufacturers API linker primer. First round 'touch-down' PCR amplification was carried out using the following thermocycling conditions; 94°C (5 min), followed by 94°C (5 sec), 72°C (2.5 min) for 5 cycles, followed by 94°C (5 sec), 70°C (2.5 min) for 5 cycles, followed by 94°C (5 sec), 68°C (2.5 min) for 25 cycles. Nested PCR was carried out on products from the first round of amplification using the internal BCNP-1 primer, 5' accttttgtgctgagccaactcgagc 3' (SEQ ID NO: 17), the manufacturers AP2 linker primer, and identical thermocycling conditions to the initial amplification. RACE PCR products were cloned into the pCR4 TOPO vector (www.Invitrogen.com) and the cDNA sequence verified.

These analyses revealed that BCNP-1 represented an alternately spliced transcript of approximately 2.3 kb and encoded a protein of approximately 651 amino acids with a predicted MW of 72 kDa, consistent with the 81 kDa size range band from which the protein was identified by ID electrophoresis. cDNA sequence analysis identified an internal alternately spliced exon and three alternate final exons in spleen and the Daudi cell line (Figures 2A-C). BCNP-1, which showed no significant homologies to known protein classes (www.Ensembl.org), was predicted to contain 3 transmembrane domains but no other known protein motifs (http://ca.expasy.org/tools/). Therefore, the present invention has identified the existence of a novel protein and splice variants thereof, the sequence and exon structure of which was not derivable from the GenScan prediction. The original GenScan prediction covered a large area of the chromosome and gave no indication as to the number of genes contained within this region. Additionally, portions of the prediction were discovered to be incorrect when the complete sequence of BCNP-1 and its splice variants was identified. Indeed, the GenScan prediction gave no indication of the presence of the splice variations described herein.

Example 2: Expression of BCNP-1 mRNA in human tissues We used real time quantitative RT-PCR (Heid, C.A., Stevens, J., Livak, K.J. &

Williams, P.M. Real time quantitative PCR. Genome Res. 6, 986-994 (1996); Morrison, T.B., Weis, J.J. & Wittwer, C.T. "Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification". Biotechniques 24, 954-958 (1998)) to analyse the distribution of BCNP-1 mRNA expression in normal human tissues (Clontech), B-cell lines, clinical chronic lymphoid leukemia (CLL) tissues, and clinical lymphoma tissues. CLL tissues were derived from patients attending the Royal Marsden and Royal Bournemouth hospitals after local ethical committee review and after obtaining informed, written consent. Lymphoma samples were derived from pathologically validated clinical lymphoma tissues and obtained with full Institutional Review Board approval from Ardais Corporation (Lexington, MA, www.Ardais.com). The primers used for PCR were as follows:

Sense, 5' ggtggtcgtggggaagggaaga 3' (SEQ HO NO: 16) Antisense, 5' ccacggtagcaaggcaggaagt 3' (SEQ ID NO: 17)

Alternate final exon isoform PCR:

Sense, 5' tcccatgggaacaggagggagc 3' (SEQ ID NO: 18) Antisense, 5' actgagcttgttcacgagcttg 3' (SEQ HO NO: 19) (alternate form 1) Antisense, 5' attcagctccggaatgttcctg 3' (SEQ ID NO: 20) (alternate form 2) Antisense, 5' cagagaagctgccaatatccag 3' (SEQ ID NO: 21) (alternate form 3)

Reactions containing 5ng cDNA, prepared as described above, SYBR green sequence detection reagents (PE Biosystems) and sense and antisense primers were assayed on an ABI7700 sequence detection system (PE Biosystems). The PCR conditions were 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min, and 40 cycles of 95°C for 15sec, 65°C for lmin. The accumulation of PCR product was measured in real time as the increase in SYBR green fluorescence, and the data were analysed using the Sequence Detector program vl.6.3 (Perkin Elmer Biosystems). Standard curves relating initial template copy number to fluorescence and amplification cycle were generated using the amplified PCR product as a template, and were used to calculate BCNP-1 copy number in each sample.

The distribution of BCNP-1 mRNA was very low in most normal tissues but showed high levels of expression in B-cell rich tissues such as lymph node, tonsil and spleen (Figure 3).

The distribution of BCNP-1 mRNA in clinical carcinomas was measured in matched normal and tumour tissue samples from breast, cervix, colon, kidney, lung, thymus and uterus cancer patients (Figure 4). BCNP-1 expression was not significantly altered between any of the tumour samples, relative to their matched normal tissues, indicating that the elevation of BCNP-1 is specific for CLL. In addition, it can be seen from comparison to normal tonsil tissue that the levels of BCNP-1 expression in the tumour samples was much lower than that seen in normal B-cell rich tissue confirming that the increased expression of BCNP-1 is restricted to B-cell tissue.

To further examine the specificity of BCNP-1 expression to B-cell and lymphoma derived samples the expression level of BCNP-1 mRNA was examined in a number of cell lines related to a wide variety of cancer types (Figure 5). It can be seen that expression of BCNP-1 is very low in all other cancer-related cell lines, confirming the specificity of BCNP- 1 for B-cell malignancies.

In addition, the distribution of expression of all three alternate final exon splice variants of BCNP-1 were examined in a number of B-cell derived cell lines (Figure 6). Overall, each alternate BCNP-1 transcript showed a similar trend of expression, however, alternate form 2 (see Figure 2B) was the most abundant form. High levels of expression were seen in many of the B-cell disease derived cell lines with highest levels seen in the REC 1MV (mantle lymphoma derived) and K-231 (follicular non-Hodgkins lymphoma derived) cell lines.

Having demonstrated the restricted mRNA distribution of BCNP-1 in B-cell rich tissues and it's particularly high expression in multiple B-cell disease derived cell lines we examined BCNP-1 expression in clinical chronic lymphoid leukemia (CLL) and lymphoma samples. Figure 7 shows the distribution of each alternate final exon BCNP-1 transcript in CLL samples. Compared to expression in normal B-cell rich tissues BCNP-1 mRNA was present at considerably higher levels in 5 of the 8 (62%) CLL samples examined with alternate form 2 again showing highest expression levels (Figure 7). Figure 6 shows the distribution of BCNP-1 in clinical lymphoma samples. Compared to expression in normal B- cell rich tissues BCNP-1 mRNA was present at higher levels in many of the lymphoma samples (7/17 (41%) diffuse large B-cell lymphomas; 2/6 (33%) follicular lymphomas; 2/6 (33%) non-Hodgkins lymphomas). Alternatively spliced form 2 showed the highest levels of mRNA expression particularly in two of the diffuse large B-cell lymphomas (Figure 8).

Thus, BCNP-1 mRNA expression is restricted to B-cell rich normal human tissues and is significantly elevated in clinical CLL and lymphoma samples, suggesting that this protein has potential as a specific therapeutic target for B-cell malignancies such as CLL and lymphoma.

Cellular Localisation of BCNP-1 Protein; C-terminal tagging with SuperGlo™ auto fluorescent protein (AFP) was used to determine the cellular localisation of BCNP-1 in the COS-7 cell line. The most abundant alternate final exon form of BCNP-1, alternate form 2 (see Figure 2B), was PCR cloned into the pQBI25/50-fNl vector (Qbiogene) resulting in an in-frame addition of the SuρerGlo™(sg)AFP protein to the C-terminus of the expressed protein. Transient transfection of sgAFP-tagged BCNP-1 cDNA into the COS-7 cell line was achieved using Superfect™ transfection reagent (Qiagen) according to the manufacturers instructions. Transfected cells were washed in phosphate buffered saline (PBS), fixed in 4% paraformaldehyde for 30 min, then washed again in PBS before being mounted in an aqueous-based fluorescent mounting medium (Dako Ltd.). Fluorescence images were captured using a DC300F digital camera attached to a DMIRE2 fluorescence microscope (Leica Microsystems (UK) Ltd.)

Analysis of the cellular location of AFP-tagged BCNP-1 demonstrated high cytoplasmic expression as well as significant expression associated with the plasma membrane. Plasma membrane localisation is consistent with the proteomic discovery of BCNP-1 in purified CLL plasma-membranes and the prediction that it contains multiple transmembrane domains. The localisation of of BCNP-1 to the plasma membrane demonstrates its suitability as a immunotherapeutic target for the treatment of B-cell malignancies (e.g. CLL). Thus, BCNP-1 shows a restricted pattern of expression in normal human tissues, is selectively elevated in lymphoma derived cell lines and CLL samples, and has a very low expression in several other types of cancer, suggesting that this protein has potential as a specific marker and/or therapeutic target for CLL and other B-cell malignancies.

Claims

1. An isolated or recombinant BCNP-1 polypeptide which: a) comprises or consists of the amino acid sequence shown in Figure 2A, SEQ nθ NO: l; b) comprises or consists of the amino acid sequence shown in Figure 2B, SEQ ID NO: 3; c) comprises or consists of the amino acid sequence shown in Figure 2C, SEQ HO NO: 5; d) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to a), b) or c) which retains the activity of BCNP-1; or e) is a fragment of a polypeptide having the amino acid sequence shown in Figure 2A, SEQ ID NO: 1, Figure 2B, SEQ ID NO: 3 or Figure 2C, SEQ ID NO: 5, which is at least ten amino acids long and has at least 70% homology over the length of the fragment.

2. An isolated or recombinant BCNP-1 nucleic acid molecule which: f) comprises or consists of the DNA sequence shown in Figure 2A, SEQ HO NO: 2 or its RNA equivalent; g) comprises or consists of the DNA sequence shown in Figure 2B, SEQ ID NO: 4 or its RNA equivalent; h) comprises or consists of the DNA sequence shown in Figure 2C, SEQ HO

NO: 6 or its RNA equivalent; i) has a sequence which is complementary to the sequences of f)-h); j) has a sequence which codes for a polypeptide as defined in a) to e) above; k) has a sequence which shows substantial identity with any of those of f), g), h), i) orj); or 1) is a fragment of f), g), h), i), j) or k), which is at least 8 nucleotides in length. provided that the nucleic acid does not consist of the nucleic acid sequences as shown in SEQ ID NO: 22, SEQ HO NO: 23, SEQ HO NO: 24, SEQ ID NO: 25, SEQ HO NO: 26, SEQ HO NO: 27, SEQ no NO: 28 or SEQ ID NO: 29.

3. A vector comprising one or more nucleic acid molecules as defined in claim 2.

4. A host cell transformed/transfected with a vector as defined in claim 3.

5. An antibody, or fragment thereof which retains the binding domain of the antibody, which binds specifically to a polypeptide as defined in claim 1.

6. An antibody as claimed in claim 5; wherein the antibody is monoclonal.

7. An antibody as claimed in claim 5 or 6; wherein the antibody is chimeric, humanized or bispecific.

8. An antibody as claimed in any one of claims 5 to 7; wherein the antibody is conjugated to a diagnostic or therapeutic moiety.

9. An antibody as claimed in claim 8, wherein the therapeutic moiety is a second antibody or a fragment or derivative thereof, a detctable substance, a cytotoxic agent or a cytokine.

10. A pharmaceutical composition comprising a polypeptide as defined in claim 1, a nucleic acid molecule as defined in claim 2, and/or an antibody as defined in any one of claims 5 to 9, optionally together with one or more pharmaceutically acceptable excipients, carriers or diluents.

11. A method of screening for and/or diagnosis of B-cell malignancies in a subject and/or monitoring/assessing the effectiveness of B-cell malignancy therapy in a subject, said method comprising detecting and/or quantifying in a biological sample obtained from said subject a polypeptide as defined in claim 1 or a nucleic acid molecule as defined in claim 2.

12. A method as claimed in claim 11, wherein the polypeptide is detected and/or quantified using an antibody.

13. A method of screening for agents that modulate the expression or activity of a polypeptide as defined in claim 1 or a nucleic acid molecule as defined in claim 2 said method comprising: a) comparing the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, in the presence of a candidate agent with the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, in the absence of the candidate agent or in the presence of a control agent; and b) determining whether the candidate agent causes the expression or activity of said polypeptide, or the expression of said nucleic acid molecule, to change.

14. The method of claim 13; wherein the expression or activity level of said polypeptide, or the expression level of said nucleic acid molecule is compared with a predetermined reference range.

15. A method of screening for agents that interact with a polypeptide as defined in claim 1, said method comprising:

(a) contacting said polypeptide with a candidate agent; and

(b) determining whether or not the candidate agent interacts with said polypeptide.

16. The method according to claim 15, wherein the determination of interaction between the candidate agent and the BCNP-1 polypeptide comprises quantitatively detecting binding of the candidate agent and said polypeptide.

17. An agent identified by the method of any one of claims 13 to 16 which causes the expression or activity of the BCNP-1 polypeptide, or the expression of the BCNP-1 nucleic acid molecule, to change, or which interacts with the BCNP-1 polypeptide.

18. The use of a polypeptide as defined in claim 1 or a nucleic acid as defined in claim 2 in the preparation of a medicament for the prophylaxis and/or treatment of B-cell malignancies.

19. The use of a agent that modulates the expression or activity of a BCNP-1 polypeptide, that interacts with a BCNP-1 polypeptide or that modulates the expression of a BCNP-1 nucleic acid in the preparation of a medicament for the prophylaxis and/or treatment of B-cell malignancies.

20. The use of an antibody as defined in anyone of claims 5 to 9 in the preparation of a medicament for the prophylaxis and/or treatment of B-cell malignancies.

21. The method as claimed in claim 11 or claim 12 or the use as defined in any one of claims 18 to 20; wherein the B-cell malignancy is chronic lymphocytic leukaemia.