WO2003062465A1 - Compounds that are used to diagnose a predisposition to osteoporosis - Google Patents

Compounds that are used to diagnose a predisposition to osteoporosis Download PDF

Info

Publication number
WO2003062465A1
WO2003062465A1 PCT/ES2003/000034 ES0300034W WO03062465A1 WO 2003062465 A1 WO2003062465 A1 WO 2003062465A1 ES 0300034 W ES0300034 W ES 0300034W WO 03062465 A1 WO03062465 A1 WO 03062465A1
Authority
WO
WIPO (PCT)
Prior art keywords
polymorphism
regulatory region
osteoporosis
predisposition
seq
Prior art date
Application number
PCT/ES2003/000034
Other languages
Spanish (es)
French (fr)
Inventor
Natalia GARCÍ GIRALT
Francesc Xavier NOGUÉS SOLAN
Leonardo Gabriel Mellibovsky Saidler
Susana Balcells Comas
Adolfo DÍEZ PÉREZ
Daniel Raúl GRINBERG VAISMAN
Original Assignee
Universidad De Barcelona
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad De Barcelona filed Critical Universidad De Barcelona
Publication of WO2003062465A1 publication Critical patent/WO2003062465A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates to diagnostic methods and kits based on polymorphisms in a collagen gene. Specifically, it refers to methods and kits for the diagnosis of predisposition to certain pathological conditions, analyzing the presence of these polymorphisms. More specifically it refers to the diagnosis of predisposition to osteoporosis.
  • the invention also relates to the collagen gene that contains the polymorphisms.
  • Osteoporosis is a common condition characterized by a reduced bone mass, a deterioration of the microarchitecture of bone tissue and an increased risk of fracture.
  • the risk of osteoporotic fracture is related to bone mineral density (BMD).
  • BMD bone mineral density
  • Several inherited and environmental factors are involved in the pathogenesis of osteoporosis. Studies using families and pairs of twins indicate that osteoporosis has a substantial genetic component. The contribution of genetic factors to the variance of bone mineral density is between 65% and 92% in twin studies.
  • Type I collagen is the most abundant protein in the bone matrix. Mutations in the coding regions of the genes encoding the two chains of type I collagen (COL1A1 and COL1A2) result in a severe autosomal dominant pediatric condition called osteogenesis imperfecta. Unlike the severe effects produced by mutations located in the coding regions of type I collagen genes, changes in their regulatory regions may be responsible for subtle differences in gene expression in response to extracellular signals. This, in turn, can result in differences in BMD and fracture risk.
  • GT polymorphism has been described in intron 1 of the COL1A1 gene, which is within a recognition site for Sp1 transcription factor, and has been shown to be associated with BMD, both in the spine lumbar as in the neck of the femur, or with fractures (cf. US 5,922,542; SF Grant et al., Nat. Genet. 1996, vol. 14, pp. 203-5).
  • some studies have not been able to reproduce these results (cf. A. Heegaard et al., Calcif. Tissue Int. 2000, vol. 66, pp. 409-13; M. Liden, Calcif. Tissue Int. 1998, vol. 63, pp. 293-5; P. Garnero et al., J. Bone Miner Res. 1998, vol. 13, pp. 813-7).
  • the treatments currently available for osteoporosis include mainly hormone replacement therapy, bisphosphonates such as alendronate, selective estrogen receptor modulators, calcium, vitamin D metabolites or parathyroid hormone. These treatments generally manage to stop the progressive decrease in BMD characteristic of women suffering from this disease, but, in general, they are not able to reverse osteoporosis; that is, they are not able to induce an increase in BMD in patients. Thus, it is especially interesting to be able to identify those individuals with a predisposition or greater susceptibility to osteoporosis. In such a case, appropriate therapy could be applied before the effects of osteoporosis appear.
  • the present invention is the result of the search for new polymorphisms in the promoter of the COL1 A1 gene, in a region between nucleotide positions -2300 to -1500, which is relevant for its expression in osteoblasts in vivo.
  • Two new nucleotide exchange polymorphisms (“single nucleotide polymorphisms", SNPs), one of which shows association with BMD of the lumbar spine, have been found in a cohort of 256 Spanish postmenopausal women and the other is in a strong linkage disequilibrium (“linkage disequilibrium”) with the previously described GT polymorphism that shows to be associated with BMD, both in the lumbar spine and in the femoral neck (cf. US 5,922,542).
  • This invention provides diagnostic methods, compounds and kits for detecting individuals who have a predisposition or susceptibility to certain disease states, in particular, osteoporosis or low BMD.
  • the invention allows to identify human individuals who have such predisposition or susceptibility, identifying those individuals with an altered collagen 1A1 gene.
  • the invention also provides a therapy for those individuals who have a predisposition or susceptibility to conditions. Pathological mentioned above.
  • a first aspect of the invention provides a method of diagnosing the predisposition of a human individual to osteoporosis or a high probability of having low bone mineral density (BMD), which comprises detecting - in a sample of fluid or tissue obtained from said individual- the presence of a polymorphism selected from the group formed by an indel T polymorphism in the -1663 position and a polymorphism of change from G to T in the -1997 position in the regulatory region of the COL1A1 gene.
  • BMD bone mineral density
  • the diagnostic method involves examining an individual at risk of suffering a condition or disease by correlating it with the presence of one or both polymorphisms (that is, the presence of the less frequent allele of each SNP).
  • a diagnosis can use the polymerase chain reaction (PCR) or the single strand conformational polymorphism test, or both, and can determine whether an individual possesses a wild collagen gene or a polymorphism.
  • PCR polymerase chain reaction
  • each individual can be homozygous for the wild allele, heterozygous for the wild allele and polymorphism, or homozygous for the polymorphism.
  • Different genotypes correlate with a different predisposition to osteoporosis or a high probability of having low BMD.
  • the diagnostic method also includes the use of indicator means that react in the presence of one of the polymorphisms.
  • the indicating means typically induces that a detectable signal is produced in the presence of the polymorphism, and can induce a color change or a coagulation or a restriction site, detectable by additional analytical steps.
  • the indicator means also, can comprise an antibody that has binding affinity that distinguishes between the wild sequence and a polymorphism.
  • the diagnostic method comprises detecting the presence of a G to T polymorphism in the -1997 position in a regulatory region of the COL1A1 gene. In a preferred embodiment, this detection is carried out using PCR primers that amplify a segment of DNA that contains the nucleotide at the -1997 position in the regulatory region of the COL1A1 gene. In a more preferred embodiment a pair of PCR primers with the sequences SEQ ID NO: 5 and SEQ ID NO: 6 is used.
  • the diagnostic method comprises detecting the presence of an indel T polymorphism at position -1663 in the regulatory region of the COL1A1 gene.
  • this detection is carried out using PCR primers that amplify a segment of DNA containing the nucleotide at the -1663 position in the regulatory region of the COL1A1 gene.
  • a pair of PCR primers with the sequences SEQ ID NO: 2 and SEQ ID NO: 3 is used.
  • a second aspect of the invention provides diagnostic methods adapted to determine the presence of a polymorphism in a collagen gene.
  • the diagnostic method comprises a pair of PCR primers that amplify a segment of DNA from the regulatory region of the COL1 A1 gene, where the amplified DNA segment is up to 800 base pairs in length - preferably up to 500, more preferably up to 250- and the nucleotide position -1997 of the regulatory region of the COL1A1 gene is substantially towards the middle of the DNA segment.
  • the PCR primers are selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6.
  • the diagnostic method comprises a pair of PCR primers that amplify a segment of DNA from the regulatory region of the COL1A1 gene, where the amplified DNA segment is up to 800 base pairs in length - preferably up to 500, more preferably up to 500 250- and the nucleotide position -1663 of the regulatory region of the COL1A1 gene is substantially towards the middle of the DNA segment.
  • the PCR primers are selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 3.
  • the invention also provides a diagnostic kit for the predisposition of a human individual to osteoporosis or a high probability of having low bone mineral density (BMD), comprising diagnostic means according to the second aspect of the invention, optionally within of a container
  • the diagnostic kit comprises a transport means such as a compartmentalized box that accommodates the diagnostic means according to the invention, optionally within a container such as a vial, a tube, a vial or something similar.
  • a third aspect of the invention provides a collagen gene, or a fragment thereof, in which, or a guanosine nucleotide at the -1997 position is replaced by a thymidine nucleotide, or a series of eight thymidines in the range of -1663 to -1670 is replaced by a series of seven thymidines in the range of -1663 to -1669, or both.
  • the gene or the gene fragment is an isolated DNA molecule, free of other naturally occurring DNA molecules naturally associated with it.
  • the isolated DNA molecule comprises a regulatory region of the collagen gene in which a guanosine in the -1997 position is replaced by a thymidine; in a preferred case this isolated DNA molecule comprises the oligonucleotide of SEQ ID NO: 4.
  • the isolated DNA molecule comprises a collagen gene regulatory region in which a series of eight thymidines in the range of -1663 a -1670 is replaced by a series of seven thymidines in the range of -1663 to -1669; In a preferred case this isolated DNA molecule comprises the oligonucleotide of SEQ ID NO: 1.
  • a fourth aspect of the invention provides a method of osteoporosis therapy comprising: the examination of a human individual for the genetic predisposition to osteoporosis; and, if said predisposition is identified, the treatment of said individual to prevent or reduce osteoporosis or delay the onset of osteoporosis, where the predisposition to osteoporosis correlates with a polymorphism of a COL1A1 gene of said individual, selected from the group formed by a polymorphism of G to T in the -1997 position of the regulatory region of the COL1A1 gene, and an indel T polymorphism in the -1663 position of the regulatory region of the COL1A1 gene.
  • the predisposition to osteoporosis correlates with a G to T polymorphism at the -1997 position of the regulatory region of the COL1A1 gene. In other embodiment, such predisposition correlates with an indel T polymorphism at position -1663 of the regulatory region of the COL1A1 gene.
  • the treatment of the individual is performed by hormone replacement therapy; In another preferred case for each of these two embodiments, the treatment of the individual is performed by an antiosteoporotic agent selected from the group consisting of: bisphosphonates, selective estrogen receptor modulators, calcium, vitamin D metabolites and parathyroid hormone.
  • an individual who is heterozygous for both polymorphisms is classified as having the lowest risk (as illustrated in group D of FIG. 2).
  • An individual who is either G / G + I / I, or G / G + D / D, or G / T + l / l is Classify as having a moderate risk.
  • an individual who is either G / G + l / D is classified in the highest risk category.
  • the risk is assessed in reference to both the presence of one of the two polymorphisms of the collagen gene, as well as other known indications (genetic, physiological, nutritional, etc.).
  • the invention provides additional information on which the risk of an individual can be based.
  • FIG. 1 shows the strategy followed for the search and genotyping of the new polymorphisms in the promoter of the COL1A1 gene.
  • A Position of the three amplimers used in the search. The +1 position corresponds to the transcription start site. The relevant region for osteoblastic expression in vivo is indicated.
  • B Genotyping of polymorphism -1663indelT by an improved SSCP method. The three genotypes are distinguished at the single chain level (ss). In addition, heterozygous (ID) individuals are easily distinguished from homozygous by the formation of heteroduplex molecules at the level of double chains (ds).
  • C Genotyping of PCOL2 polymorphism by restriction analysis.
  • the genotypes ee (homozygous for the Eco31 l site), EE (homozygous without the site) and Ee (heterozygous) correspond to GG, TT and GT, respectively.
  • the first lane corresponds to the molecular weight marker. The size, in base pairs, is shown on the right.
  • FIG. 2 represents the analysis of compound genotypes and haplotypes.
  • A Mean BMD values for the five groups (called A through E) of composite genotypes that have frequencies greater than 5%.
  • FIG. 3 illustrates the electrophoretic mobility shift test ("Electrophoretic Mobility Shift Assays", EMSA) using the PCOL1-I probe and a nuclear extract of primary osteoblasts.
  • A Scheme of the three different probes used: double chain, direct single chain (“forward"), and single reverse chain (“reverse”).
  • B A double chain PCOL1-I probe was incubated in the presence (+) or absence (-) of the extract. The competitors are indicated above.
  • the triangle encompasses the three lanes in which increasing amounts of PCOL1-l-ds cold probe (molar excesses of 10 3 , 10 4 and 10 5 of cold probe with respect to labeled probe) were added.
  • the triangle encompasses the two lanes in which increasing amounts of PCOL1-l-ss cold probe (10 3 and 10 4 molar excesses of cold probe with respect to the marked one) were added.
  • Each of the non-specific competitors (PCOL1-l-ss direct -8A- and GRE-ss inverse) is at a molar excess of 10 4 .
  • the arrow indicates a band that probably corresponds to the double chain generated by the hybridization of the two complementary PCOL1-l-ss oligonucleotides.
  • FIG. 4 shows an EMSA using PCOL2-G probes and an osteoblastic nuclear extract.
  • A Scheme of the three different probes used: double chain, direct single chain ("forward"), and single reverse chain (“reverse”).
  • B A double-chain PCOL2-G probe was incubated in the absence (-) or presence (+) of the extract. The competitors are indicated above.
  • the triangle encompasses the four lanes in which increasing amounts of double-stranded PCOL2 cold oligonucleotide were added. From left to right, the alleles and molar excess are the following: G-10 3 , G-10 4 , T-10 4 and G-2x10 4 .
  • each of the non-specific competitors is in a molar excess of 10 4 .
  • C Comparison of the binding capabilities of the double-chain and single-chain PCOL2-G probes. The labeled double-stranded PCOL2-G oligonucleotides (probe 1), single straight chain (probe 2) and reverse single strand (probe 3) in the absence (-) or presence (+) of the extract were incubated.
  • D A PCOL2-G reverse single chain probe was incubated in the absence (-) or presence (+) of the extract. The competitors are indicated above.
  • the triangle encompasses the two lanes in which increasing amounts of PCOL2-G-ss cold oligonucleotide are added (molar excesses of 10 3 and 10 4 ).
  • Each of the non-specific competitors (Sp1-ds and reverse GRE-ss) is in a molar excess of 10 4 .
  • FIG. 5 shows a comparison of the binding capacities of the two alleles (G and T) of the -1997 position.
  • a reverse PCOL2-G-SS (C * ) probe was incubated in the absence (-) or presence (+) of the osteoblastic nuclear extract.
  • Lanes 3 through 8 contain increasing amounts (molar excesses of 10 2 , 10 3 and 10 4 ) of the inverse PCOL2-G-ss probe (C) (lanes 3 to 5) or of the inverse PCOL2-T-ss probe (A) (lanes 6 to 8).
  • Bone mineral density (BMD) of the lumbar spine (L2-L4) and non-dominant femur neck was measured using dual x-ray absorptiometry (Hologic QDR 4500 SL ® , Hologig, Waltham, MA, USA). BMD was expressed in g / cm 2 .
  • Genomic DNA was obtained from blood leukocytes using the Kit Wizard (Promega, Madison, Wl, U.S.A.) for genomic DNA purification.
  • the promoter region of COL1A1 comprising positions -2292 to -1499 in three fragments of about 300 bp overlapping each other was amplified by PCR (FIG. 1), using the primers described in TABLE 1.
  • the amplification reactions contained 100 ng of genomic DNA, 20 pmol of each primer, 10 nmol of each dNTP, 1.25 U of Taq polymerase (Promega, Madison, Wl, USA) and MgCI 2 at 1.5 mM (fragment 1) or at 2 mM (fragments 2 and 3) in one volume final 50 ⁇ l.
  • the single chain conformation polymorphisms (SSCP) assay was performed as follows: 4-5 ⁇ l of each PCR reaction was mixed with 7 ⁇ l of STOP buffer (95% formamide, 10 mM EDTA, 0 xylene cyanol , 05%, bromophenol blue 0.05%), heat denaturation at 80 ° C for 3 min and cool on ice before electrophoresis at 150-200 V in 8% polyacrylamide gels (acrylamide: bisacrylamide 29: one).
  • the optimal SSCP conditions for polymorphisms -1663indelT (in fragment 1) and -1997 G / T (in fragment 2) were at room temperature and 4 ° C, respectively. For the visualization of the bands, the gels were dyed with silver.
  • Polymorphism -1663NdelT is type with an improved PCR-SSCP protocol, as follows: a 180 bp fragment (which becomes 179 bp in the polymorphism) was amplified using the PCOL1 F primer of SEQ ID NO: 2 (5 'TAGCCCCTGCAGTCTCCCTC 3') and primer PCOL1 R of SEQ ID NO: 3 (5 'AAGATTCCATTGCCTCCCCC 3') under the following conditions: 10 pmol of each primer, 5 nmol of each dNTP, 0.7 U of Taq polymerase (Promega, Madison, Wl, USA), MgCI 2 to 1, 5 mM and 100 ng of genomic DNA in a final volume of 25 ⁇ l.
  • the program consisted of an initial denaturation step of 1 min at 94 ° C, 35 cycles of 40 s at 94 ° C and 30 s at 62 ° C, followed by a final step of 5 min at 72 ° C.
  • the PCR products were prepared for loading on SSCP gels as described above and were subjected to electrophoresis in 12% polyacrylamide gels containing 5% glycerol at room temperature and 140 V. The bands were revealed by silver staining .
  • the -1997 G / T polymorphism is type using a PCR-RFLP (restriction fragment length polymorphism) strategy, as follows: DNA samples were subjected to PCR amplification of fragment 2 with primers F2 and R2 which are shown in TABLE 1, and were subsequently digested with the restriction enzyme Eco31 l. The digestion products were resolved in 8% polyacrylamide gels. The most frequent allele appears as two bands of 212 and 81 bp, while the less frequent remains undigested (293 bp).
  • PCR-RFLP restriction fragment length polymorphism
  • Human bone cells were obtained from surgical samples of healthy subjects undergoing surgery for acute trauma and free of bone remodeling disease.
  • a protocol based on a described method was used (PJ Marie et al., In Vitro Cell. Dev. Biol. 1989, vol. 25, pp. 373-80) with some modifications (M. Nacher et al., Bone Miner. 1994, vol. 26, pp. 231-43; C. Garcia-Moreno et al., Bone 1998, vol. 22, pp. 233-9).
  • a culture of primary osteoblasts was established from a pool of cells from four donors.
  • DMEM Dulbecco-modified Eagle medium
  • FCS fetal bovine serum
  • Nuclear extracts were prepared from confluent cells according to a published protocol (E. Schreiber et al., Nucleic Acids Res. 1989, vol. 17, p. 6419), using a modified C buffer (10% glycerol , MgCl 2 to 1.5 mM). Protein concentrations were determined by the method Bradford, and the nuclear extracts were stored at -80 ° C until use. Testing of electrophoretic mobility change (EMSA)
  • underlined bases correspond to the polymorphic sites.
  • the corresponding complementary probes were also synthesized.
  • the double chain probe was obtained by hybridization of the complementary oligonucleotides. All probes were labeled at the end with [ ⁇ - 32 P] ATP using the T4 polynucleotide kinase (Promega, Madison, Wl, USA).
  • Binding reactions normally contain 10 ⁇ g of nuclear extract, 2 ⁇ g of double stranded poly (dl-dC) (Amersham Pharmacia Biotech, Freiburg, Germany), 6 ⁇ g of acetylated BSA and 50,000 cpm of radioactively labeled probe.
  • the mixture is incubated for 15-20 min at 37 ° C in a buffer containing 20 mM HEPES and pH 7.9, 60 mM KCI, 1 mM EDTA, 1 mM DTT and 10% glycerol in one volume total of 20 ⁇ l.
  • the DNA-protein complexes were resolved from the free probes in non-denaturing gels of 5% polyacrylamide (29: 1) containing 2.5% glycerol.
  • Electrophoresis was performed at 4 ° C in TBExl buffer at 15-18 mA for approximately 2 h. The gels were dried under vacuum and exposed to X-ray films with intensifying screens at -70 ° C for 24-48 hours. In competition assays, binding reactions were made in the presence of an excess of unlabeled competing oligonucleotide, as indicated in each case.
  • the oligonucleotides containing the binding sites of known transcription factors (Sp1 and the glucocorticoid receptor) were: Sp1 5 'ATTCGATCGGGGCGGGGCGAGC 3' (SEQ ID NO: 13)
  • a new polymorphism was detected in fragment 1.
  • Four of the seven control individuals showed a different SSCP pattern, detected mostly in the heteroduplex region of the gel. Sequencing revealed a deletion of a T nucleotide in a series of eight T residues, located at positions -1663 to -1670. The allele that carried 8 Ts was called I (by the insertion of a residue T) and the one carrying 7 Ts was called D (by the deletion of a T), and the polymorphism was called -1663indelT.
  • I by the insertion of a residue T
  • D by the deletion of a T
  • the polymorphism was called -1663indelT.
  • To establish genotypic frequencies an improved SSCP strategy was followed (see above), using a smaller PCR fragment (FIG. 1B). Allelic and genotypic frequencies for this polymorphism have been established in 256 women (TABLE 2).
  • Sp1 polymorphism in intron 1 of COL1A1 is type.
  • TABLE 2 shows the genotypic and allelic frequencies.
  • genotypes and BMD of the lumbar spine in 256 postmenopausal women were analyzed.
  • the mean BMD value, the standard deviation (SD) and the range in our sample were 0.894 g / cm 2 , 0.135 and 0.567-1, 297.
  • the mean for each of the genotypes of -1663indelT, -1997 G / T and Sp1 is shown in TABLE 3.
  • Genotypes II 155 GG 194 SS 161 (0.60) (0.76) (0.63)
  • BMD means ⁇ SD of the individuals carrying the different genotypes -1663indelT, -1997 G / T and Sp1.
  • the BMD means of the lumbar spine of compound genotypes that include all three polymorphic sites were also analyzed. Only genotypes that had frequencies greater than 5% (5 of the 27 possible combinations) were included.
  • FIG. 2 shows the means of BMD for these five compound genotypes, called A to E.
  • the highest average BMD (0.982 ⁇ 0.186) corresponded to group D (triple heterozygous), while the lowest value (0.853 ⁇ 0.137) corresponded to group C
  • a competition test was performed (FIG. 4D). The addition of a 10 4 molar excess of both the single chain GRE oligonucleotide and the double chain Sp1 oligonucleotide showed no competition with respect to the delayed band.
  • FIG. 5 shows an EMSA in which the labeled probe was the single chain oligonucleotide carrying the C (PCOL2-G, reverse chain), and the competitors were the single cold chain carrying the C (molar excesses of 10 3 , 10 4 and 10 5 ), or the same amounts of the simple cold chain carrying the A (reverse chain of the T allele).
  • a competition difference was detected, which is best observed when comparing lanes 4 and 7 (molar excesses of 10 4 ).
  • 1663indelT and Sp1 suggests that -1663indelT contributes to the effect of Sp1 that has been detected in some populations.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to compounds that are used to diagnose a predisposition to osteoporosis. Novel single nucleotide polymorphisms (SNPs) have been discovered in the COL1A1 gene regulatory region. Tests carried out on postmenopausal women showed that a G-to-T polymorphism at position -1997 was associated with lumbar spine bone mineral density (BMD) and femoral neck BMD. Polymorphism -1663indelT, which corresponds to the deletion of a T from a tract of eight (-1670 to -1663), is in strong linkage disequilibrium with the aforementioned Sp1 polymorphism of intron 1 which has been shown to be associated with BMD. Significant interactions between -1997 G/T and -1663indelT and between -1997 G/T and Sp1 were also observed. The invention can be used to diagnose and treat osteoporosis, in particular, as a diagnostic kit comprising novel PCR primers.

Description

Compuestos para el diagnóstico de la predisposición a la osteoporosisCompounds for the diagnosis of osteoporosis predisposition
Esta invención se refiere a métodos y kits de diagnóstico basados en polimorfismos en un gen del colágeno. Específicamente, se refiere a métodos y kits para el diagnóstico de la predisposición a ciertos estados patológicos, analizando la presencia de estos polimorfismos. Más específicamente se refiere al diagnóstico de la predisposición a la osteoporosis. La invención además se refiere al gen del colágeno que contiene los polimorfismos.This invention relates to diagnostic methods and kits based on polymorphisms in a collagen gene. Specifically, it refers to methods and kits for the diagnosis of predisposition to certain pathological conditions, analyzing the presence of these polymorphisms. More specifically it refers to the diagnosis of predisposition to osteoporosis. The invention also relates to the collagen gene that contains the polymorphisms.
ESTADO DE LA TÉCNICA ANTERIORSTATE OF THE PREVIOUS TECHNIQUE
La osteoporosis es una afección común caracterizada por una masa ósea reducida, un deterioro de la microarquitectura del tejido óseo y un aumento del riesgo de fractura. El riesgo de fractura osteoporótica está relacionado con la densidad mineral ósea (DMO). Varios factores hereditarios y ambientales están implicados en la patogénesis de la osteoporosis. Estudios usando familias y pares de gemelos indican que la osteoporosis tiene una componente genética sustancial. La contribución de factores genéticos a la varianza de la densidad mineral ósea está entre 65% y 92% en estudios de gemelos.Osteoporosis is a common condition characterized by a reduced bone mass, a deterioration of the microarchitecture of bone tissue and an increased risk of fracture. The risk of osteoporotic fracture is related to bone mineral density (BMD). Several inherited and environmental factors are involved in the pathogenesis of osteoporosis. Studies using families and pairs of twins indicate that osteoporosis has a substantial genetic component. The contribution of genetic factors to the variance of bone mineral density is between 65% and 92% in twin studies.
El colágeno de tipo I es la proteína más abundante de la matriz ósea. Mutaciones en las regiones codificantes de los genes que codifican las dos cadenas del colágeno de tipo I (COL1A1 y COL1A2) resultan en una condición pediátrica autosómica dominante severa llamada osteogénesis imperfecta. A diferencia de los graves efectos producidos por mutaciones situadas en las regiones codificantes de los genes del colágeno de tipo I, los cambios en sus regiones reguladoras pueden ser responsables de diferencias sutiles en la expresión del gen en respuesta a señales extracelulares. Esto, a su vez, puede resultar en diferencias en la DMO y en el riesgo de fractura. En esta línea, ha sido descrito el polimorfismo G-T en el intrón 1 del gen del COL1A1 , que se encuentra dentro de un sitio de reconocimiento para el factor de transcripción Sp1, y se ha demostrado que estaba asociado con la DMO, tanto en la columna lumbar como en el cuello del fémur, o con fracturas (cf. US 5.922.542; S.F. Grant et al., Nat. Genet. 1996, vol. 14, pp. 203-5). Sin embargo algunos estudios no han podido reproducir esos resultados (cf. A. Heegaard et al., Calcif. Tissue Int. 2000, vol. 66, pp. 409-13; M. Liden, Calcif. Tissue Int. 1998, vol. 63, pp. 293-5; P. Garnero et al., J. Bone Miner Res. 1998, vol. 13, pp. 813-7).Type I collagen is the most abundant protein in the bone matrix. Mutations in the coding regions of the genes encoding the two chains of type I collagen (COL1A1 and COL1A2) result in a severe autosomal dominant pediatric condition called osteogenesis imperfecta. Unlike the severe effects produced by mutations located in the coding regions of type I collagen genes, changes in their regulatory regions may be responsible for subtle differences in gene expression in response to extracellular signals. This, in turn, can result in differences in BMD and fracture risk. In this line, GT polymorphism has been described in intron 1 of the COL1A1 gene, which is within a recognition site for Sp1 transcription factor, and has been shown to be associated with BMD, both in the spine lumbar as in the neck of the femur, or with fractures (cf. US 5,922,542; SF Grant et al., Nat. Genet. 1996, vol. 14, pp. 203-5). However, some studies have not been able to reproduce these results (cf. A. Heegaard et al., Calcif. Tissue Int. 2000, vol. 66, pp. 409-13; M. Liden, Calcif. Tissue Int. 1998, vol. 63, pp. 293-5; P. Garnero et al., J. Bone Miner Res. 1998, vol. 13, pp. 813-7).
Los tratamientos de que se dispone actualmente para la osteoporosis incluyen principalmente la terapia de sustitución hormonal, los bisfosfonatos tales como el alendronato, los moduladores selectivos del receptor de estrógenos, el calcio, los metabolitos de la vitamina D o la hormona paratiroidea. Estos tratamientos generalmente logran detener el descenso progresivo de la DMO característico de las mujeres que sufren esta enfermedad, pero, en general, no son capaces de revertir la osteoporosis; es decir, no son capaces de inducir un aumento de la DMO en las pacientes. Así, resulta especialmente interesante el poder identificar aquellos individuos con una predisposición o una mayor susceptibilidad a la osteoporosis. En tal caso, se podría aplicar una terapia apropiada antes de que aparezcan los efectos de la osteoporosis.The treatments currently available for osteoporosis include mainly hormone replacement therapy, bisphosphonates such as alendronate, selective estrogen receptor modulators, calcium, vitamin D metabolites or parathyroid hormone. These treatments generally manage to stop the progressive decrease in BMD characteristic of women suffering from this disease, but, in general, they are not able to reverse osteoporosis; that is, they are not able to induce an increase in BMD in patients. Thus, it is especially interesting to be able to identify those individuals with a predisposition or greater susceptibility to osteoporosis. In such a case, appropriate therapy could be applied before the effects of osteoporosis appear.
EXPLICACIÓN DE LA INVENCIÓNEXPLANATION OF THE INVENTION
La presente invención es el resultado de la búsqueda de nuevos polimorfismos en el promotor del gen COL1 A1 , en una región entre las posiciones nucleotídicas -2300 a -1500, que es relevante para su expresión en osteoblastos in vivo. Se han encontrado dos nuevos polimorfismos de cambio de un nucleótido ("single nucleotide polymorphisms", SNP's), uno de los cuales muestra asociación con la DMO de la columna lumbar, en una cohorte de 256 mujeres españolas postmenopáusicas y el otro está en un fuerte desequilibrio de ligamiento ("linkage disequilibrium") con el polimorfismo G-T previamente descrito que muestra estar asociado con la DMO, tanto en la columna lumbar como en el cuello femoral (cf. US 5.922.542).The present invention is the result of the search for new polymorphisms in the promoter of the COL1 A1 gene, in a region between nucleotide positions -2300 to -1500, which is relevant for its expression in osteoblasts in vivo. Two new nucleotide exchange polymorphisms ("single nucleotide polymorphisms", SNPs), one of which shows association with BMD of the lumbar spine, have been found in a cohort of 256 Spanish postmenopausal women and the other is in a strong linkage disequilibrium ("linkage disequilibrium") with the previously described GT polymorphism that shows to be associated with BMD, both in the lumbar spine and in the femoral neck (cf. US 5,922,542).
Esta invención proporciona métodos, compuestos y kits de diagnóstico para detectar individuos que tengan una predisposición o susceptibilidad a ciertos estados patológicos, en particular, la osteoporosis o la baja DMO. La invención permite identificar individuos humanos que tienen tal predisposición o susceptibilidad, identificando aquellos individuos con un gen del colágeno 1A1 alterado. La invención también proporciona una terapia para aquellos individuos que tienen una predisposición o susceptibilidad a los estados patológicos anteriormente mencionados.This invention provides diagnostic methods, compounds and kits for detecting individuals who have a predisposition or susceptibility to certain disease states, in particular, osteoporosis or low BMD. The invention allows to identify human individuals who have such predisposition or susceptibility, identifying those individuals with an altered collagen 1A1 gene. The invention also provides a therapy for those individuals who have a predisposition or susceptibility to conditions. Pathological mentioned above.
Un primer aspecto de la invención proporciona un método de diagnóstico de la predisposición de un individuo humano a la osteoporosis o de una probabilidad elevada de tener baja densidad mineral ósea (DMO), que comprende detectar -en una muestra de fluido o de tejido obtenida de dicho individuo- la presencia de un polimorfismo seleccionado del grupo formado por un polimorfismo indel T en la posición -1663 y un polimorfismo de cambio de G a T en la posición -1997 en la región reguladora del gen COL1A1.A first aspect of the invention provides a method of diagnosing the predisposition of a human individual to osteoporosis or a high probability of having low bone mineral density (BMD), which comprises detecting - in a sample of fluid or tissue obtained from said individual- the presence of a polymorphism selected from the group formed by an indel T polymorphism in the -1663 position and a polymorphism of change from G to T in the -1997 position in the regulatory region of the COL1A1 gene.
En particular, el método de diagnóstico implica el examen de un individuo con riesgo de padecer una afección o enfermedad correlacionándolo con la presencia de uno o ambos polimorfismos (es decir, la presencia del alelo menos frecuente de cada SNP). Dicho diagnóstico puede utilizar la reacción en cadena de la polimerasa (PCR, "polymerase chain reaction") o el ensayo de polimorfismo conformacional de cadena sencilla (SSCP, "single strand conformational polymorphism"), o ambos, y puede determinar si un individuo posee un gen silvestre del colágeno o un polimorfismo. Dado un SNP en el gen del colágeno, cada individuo puede ser homocigoto para el alelo silvestre, heterocigoto para el alelo silvestre y el polimorfismo, u homocigoto para el polimorfismo. Los diferentes genotipos se correlacionan con una diferente predisposición a la osteoporosis o a una probabilidad elevada de tener baja DMO.In particular, the diagnostic method involves examining an individual at risk of suffering a condition or disease by correlating it with the presence of one or both polymorphisms (that is, the presence of the less frequent allele of each SNP). Such a diagnosis can use the polymerase chain reaction (PCR) or the single strand conformational polymorphism test, or both, and can determine whether an individual possesses a wild collagen gene or a polymorphism. Given an SNP in the collagen gene, each individual can be homozygous for the wild allele, heterozygous for the wild allele and polymorphism, or homozygous for the polymorphism. Different genotypes correlate with a different predisposition to osteoporosis or a high probability of having low BMD.
El método de diagnóstico comprende, además, el uso de medios indicadores que reaccionan en presencia de uno de los polimorfismos. Los medios indicadores inducen, típicamente, que se produzca una señal detectable en presencia del polimorfismo, y pueden inducir un cambio de color o una coagulación o un sitio de restricción, detectables por pasos analíticos adicionales. Los medios indicadores, también, pueden comprender un anticuerpo que tenga afinidad de unión que distinga entre la secuencia silvestre y un polimorfismo.The diagnostic method also includes the use of indicator means that react in the presence of one of the polymorphisms. The indicating means typically induces that a detectable signal is produced in the presence of the polymorphism, and can induce a color change or a coagulation or a restriction site, detectable by additional analytical steps. The indicator means, also, can comprise an antibody that has binding affinity that distinguishes between the wild sequence and a polymorphism.
En una realización el método de diagnóstico comprende el detectar la presencia de un polimorfismo de G a T en la posición -1997 en una región reguladora del gen COL1A1. En una realización preferida, esta detección se lleva a cabo usando cebadores ("primers") de PCR que amplifican un segmento de ADN que contiene el nucleótido en la posición -1997 en la región reguladora del gen COL1A1. En una realización más preferida se utiliza un par de cebadores de PCR con las secuencias SEQ ID NO: 5 y SEQ ID NO: 6.In one embodiment, the diagnostic method comprises detecting the presence of a G to T polymorphism in the -1997 position in a regulatory region of the COL1A1 gene. In a preferred embodiment, this detection is carried out using PCR primers that amplify a segment of DNA that contains the nucleotide at the -1997 position in the regulatory region of the COL1A1 gene. In a more preferred embodiment a pair of PCR primers with the sequences SEQ ID NO: 5 and SEQ ID NO: 6 is used.
En otra realización, el método de diagnóstico comprende el detectar la presencia de un polimorfismo indel T en la posición -1663 en la región reguladora del gen COL1A1. En una realización preferida, esta detección se lleva a cabo usando cebadores de PCR que amplifican un segmento de ADN que contiene el nucleótido en la posición -1663 en la región reguladora del gen COL1A1. En una realización más preferida se utiliza un par de cebadores de PCR con las secuencias SEQ ID NO: 2 y SEQ ID NO: 3.In another embodiment, the diagnostic method comprises detecting the presence of an indel T polymorphism at position -1663 in the regulatory region of the COL1A1 gene. In a preferred embodiment, this detection is carried out using PCR primers that amplify a segment of DNA containing the nucleotide at the -1663 position in the regulatory region of the COL1A1 gene. In a more preferred embodiment a pair of PCR primers with the sequences SEQ ID NO: 2 and SEQ ID NO: 3 is used.
Un segundo aspecto de la invención proporciona métodos de diagnóstico adaptados a determinar la presencia de un polimorfismo en un gen del colágeno. En una realización, el método de diagnóstico comprende un par de cebadores de PCR que amplifican un segmento de ADN de la región reguladora del gen COL1 A1 , donde el segmento de ADN amplificado tiene hasta 800 pares de bases de longitud -preferentemente hasta 500, más preferentemente hasta 250- y la posición nucleotídica -1997 de la región reguladora del gen COL1A1 está sustancialmente hacia la mitad del segmento de ADN. En un caso preferido de esta realización, los cebadores de PCR se seleccionan del grupo formado por SEQ ID NO: 5 y SEQ ID NO: 6.A second aspect of the invention provides diagnostic methods adapted to determine the presence of a polymorphism in a collagen gene. In one embodiment, the diagnostic method comprises a pair of PCR primers that amplify a segment of DNA from the regulatory region of the COL1 A1 gene, where the amplified DNA segment is up to 800 base pairs in length - preferably up to 500, more preferably up to 250- and the nucleotide position -1997 of the regulatory region of the COL1A1 gene is substantially towards the middle of the DNA segment. In a preferred case of this embodiment, the PCR primers are selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6.
En otra realización el método de diagnóstico comprende un par de cebadores de PCR que amplifican un segmento de ADN de la región reguladora del gen COL1A1 , donde el segmento de ADN amplificado es hasta 800 pares de bases de longitud- preferentemente hasta 500, mas preferentemente hasta 250- y la posición nucleotídica -1663 de la región reguladora del gen COL1A1 está sustancialmente hacia la mitad del segmento de ADN. En un caso preferida de esta realización, los cebadores de PCR son seleccionados del grupo que consisten en SEQ ID NO: 2 y SEQ ID NO: 3.In another embodiment the diagnostic method comprises a pair of PCR primers that amplify a segment of DNA from the regulatory region of the COL1A1 gene, where the amplified DNA segment is up to 800 base pairs in length - preferably up to 500, more preferably up to 500 250- and the nucleotide position -1663 of the regulatory region of the COL1A1 gene is substantially towards the middle of the DNA segment. In a preferred case of this embodiment, the PCR primers are selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 3.
La invención también proporciona un kit de diagnóstico para la predisposición de un individuo humano a la osteoporosis o a una elevada probabilidad de tener baja densidad mineral ósea (DMO), que comprende medios de diagnóstico según el segundo aspecto de la invención, opcionalmente dentro de un envase. En una realización particular, el kit de diagnóstico comprende un medio de transporte tal como una caja compartimentada que acomoda los medios de diagnóstico según la invención, opcionalmente dentro de un envase tal como un vial, un tubo, una ampolla o algo similar.The invention also provides a diagnostic kit for the predisposition of a human individual to osteoporosis or a high probability of having low bone mineral density (BMD), comprising diagnostic means according to the second aspect of the invention, optionally within of a container In a particular embodiment, the diagnostic kit comprises a transport means such as a compartmentalized box that accommodates the diagnostic means according to the invention, optionally within a container such as a vial, a tube, a vial or something similar.
Un tercer aspecto de la invención proporciona un gen del colágeno, o un fragmento de éste, en el cual, o un nucleótido de guanosina en la posición -1997 es reemplazado por un nucleótido de timidina, o una serie de ocho timidinas en el intervalo de -1663 a -1670 es reemplazado por una serie de siete timidinas en el intervalo de -1663 a -1669, o ambos. Preferentemente, el gen o el fragmento de gen es una molécula de ADN aislada, libre de otras moléculas de ADN que en la naturaleza se hallan naturalmente asociadas a ella. En una realización la molécula de ADN aislada comprende una región reguladora del gen del colágeno en la cual una guanosina en la posición -1997 está sustituida por una timidina; en un caso preferido esta molécula de ADN aislada comprende el oligonucleótido de la SEQ ID NO: 4. En otra realización la molécula de ADN aislada comprende una región reguladora del gen del colágeno en la cual una serie de ocho timidinas en el intervalo de -1663 a -1670 está reemplazada por una serie de siete timidinas en el intervalo de -1663 a -1669; en un caso preferido esta molécula de ADN aislada comprende el oligonucleótido de la SEQ ID NO: 1.A third aspect of the invention provides a collagen gene, or a fragment thereof, in which, or a guanosine nucleotide at the -1997 position is replaced by a thymidine nucleotide, or a series of eight thymidines in the range of -1663 to -1670 is replaced by a series of seven thymidines in the range of -1663 to -1669, or both. Preferably, the gene or the gene fragment is an isolated DNA molecule, free of other naturally occurring DNA molecules naturally associated with it. In one embodiment the isolated DNA molecule comprises a regulatory region of the collagen gene in which a guanosine in the -1997 position is replaced by a thymidine; in a preferred case this isolated DNA molecule comprises the oligonucleotide of SEQ ID NO: 4. In another embodiment the isolated DNA molecule comprises a collagen gene regulatory region in which a series of eight thymidines in the range of -1663 a -1670 is replaced by a series of seven thymidines in the range of -1663 to -1669; In a preferred case this isolated DNA molecule comprises the oligonucleotide of SEQ ID NO: 1.
Mediante el examen de la presencia de uno de los polimorfismos mencionados anteriormente, es posible identificar individuos que tienen probabilidad de sufrir osteoporosis. Por consiguiente, un cuarto aspecto de la invención proporciona un método de terapia para la osteoporosis que comprende: el examen de un individuo humano para la predisposición genética a la osteoporosis; y, si dicha predisposición se identifica, el tratamiento de dicho individuo para prevenir o reducir la osteoporosis o retasar la aparición de la osteoporosis, donde la predisposición a la osteoporosis se correlaciona con un polimorfismo de un gen COL1A1 de dicho individuo, seleccionado del grupo formado por un polimorfismo de G a T en la posición -1997 de la región reguladora del gen COL1A1 , y un polimorfismo indel T en la posición -1663 de la región reguladora del gen COL1A1. En una realización de este cuarto aspecto de la invención, la predisposición a la osteoporosis se correlaciona con un polimorfismo de G a T en la posición -1997 de la región reguladora del gen COL1A1. En otra realización, tal predisposición se correlaciona con un polimorfismo indel T en la posición -1663 de la región reguladora del gen COL1A1. En un caso preferido para cada una de estas dos realizaciones, el tratamiento del individuo se realiza mediante terapia de sustitución hormonal; en otro caso preferido para cada una de estas dos realizaciones, el tratamiento del individuo se realiza mediante un agente antiosteoporótico seleccionado del grupo formado por: bisfosfonatos, moduladores selectivos del receptor de estrógenos, calcio, metabolitos de la vitamina D y hormona paratiroidea. El uso de todos estos tratamientos para la osteoporosis es bien conocido en la práctica médica y, según la invención, pueden ser iniciados en individuos con probabilidad de tener una predisposición a la osteoporosis pero en los cuales la osteoporosis aún no se ha manifestado significativamente.By examining the presence of one of the polymorphisms mentioned above, it is possible to identify individuals who are likely to suffer osteoporosis. Accordingly, a fourth aspect of the invention provides a method of osteoporosis therapy comprising: the examination of a human individual for the genetic predisposition to osteoporosis; and, if said predisposition is identified, the treatment of said individual to prevent or reduce osteoporosis or delay the onset of osteoporosis, where the predisposition to osteoporosis correlates with a polymorphism of a COL1A1 gene of said individual, selected from the group formed by a polymorphism of G to T in the -1997 position of the regulatory region of the COL1A1 gene, and an indel T polymorphism in the -1663 position of the regulatory region of the COL1A1 gene. In an embodiment of this fourth aspect of the invention, the predisposition to osteoporosis correlates with a G to T polymorphism at the -1997 position of the regulatory region of the COL1A1 gene. In other embodiment, such predisposition correlates with an indel T polymorphism at position -1663 of the regulatory region of the COL1A1 gene. In a preferred case for each of these two embodiments, the treatment of the individual is performed by hormone replacement therapy; In another preferred case for each of these two embodiments, the treatment of the individual is performed by an antiosteoporotic agent selected from the group consisting of: bisphosphonates, selective estrogen receptor modulators, calcium, vitamin D metabolites and parathyroid hormone. The use of all these treatments for osteoporosis is well known in medical practice and, according to the invention, can be initiated in individuals likely to have a predisposition to osteoporosis but in which osteoporosis has not yet manifested significantly.
Según la invención, un individuo que es heterocigoto para ambos polimorfismos (es decir, G/T + l/D) se clasifica como el que tiene menor riesgo (tal y como se ilustra en el grupo D de la FIG. 2). Un individuo que es, o bien G/G + I/I, o bien G/G + D/D, o bien G/T + l/l (cfr. grupos A, E y B en la FIG. 2) se clasifica como que tiene un riesgo moderado. Finalmente, un individuo que es, o bien G/G + l/D (cfr. grupo C en la FIG. 2), o bien homocigoto T/T (cfr. Tabla 3) se clasifica en la categoría de más alto riesgo.According to the invention, an individual who is heterozygous for both polymorphisms (ie, G / T + 1 / D) is classified as having the lowest risk (as illustrated in group D of FIG. 2). An individual who is either G / G + I / I, or G / G + D / D, or G / T + l / l (cf. groups A, E and B in FIG. 2) is Classify as having a moderate risk. Finally, an individual who is either G / G + l / D (cf. group C in FIG. 2), or homozygous T / T (cf. Table 3) is classified in the highest risk category.
Opcionalmente, el riesgo se evalúa en referencia tanto a la presencia de uno de los dos polimorfismos del gen del colágeno, como también, a otras indicaciones conocidas (genéticas, fisiológicas, nutricionales, etc.). La invención proporciona información adicional sobre la cual se puede basar el riesgo de un individuo.Optionally, the risk is assessed in reference to both the presence of one of the two polymorphisms of the collagen gene, as well as other known indications (genetic, physiological, nutritional, etc.). The invention provides additional information on which the risk of an individual can be based.
A lo largo de toda la descripción y reivindicaciones de la especificación, la palabra "comprende" y las variaciones de la misma, tal como "comprendiendo", no pretende excluir otros aditivos, componentes, integrantes o pasos. El resumen que acompaña esta solicitud se incorpora aquí como referencia. La descripción detallada y las figuras que siguen se proporcionan a modo de ilustración y no pretenden ser limitantes de la presente invención.Throughout the entire description and claims of the specification, the word "comprises" and variations thereof, such as "comprising", is not intended to exclude other additives, components, constituents or steps. The summary that accompanies this application is incorporated here by reference. The detailed description and the figures that follow are provided by way of illustration and are not intended to be limiting of the present invention.
A lo largo de la descripción y las reivindicaciones, el sistema de numeración utilizado para describir las posiciones nucleotídicas dentro de la región reguladora de COL1A1 es el descrito en Jiménez et al., J. Biol. Chem. 1994, vol. 269, pp. 12684-91.Throughout the description and claims, the numbering system used to describe the nucleotide positions within the region Regulator of COL1A1 is that described in Jiménez et al., J. Biol. Chem. 1994, vol. 269, pp. 12684-91.
DESCRIPCIÓN DE LAS FIGURASDESCRIPTION OF THE FIGURES
La FIG. 1 muestra la estrategia seguida para la búsqueda y genotipado de los nuevos polimorfismos en el promotor del gen COL1A1. (A) Posición de los tres amplímeros usados en la búsqueda. La posición +1 corresponde al sitio de inicio de la transcripción. Se indica la región relevante para la expresión osteoblástica in vivo. (B) Genotipado del polimorfismo -1663indelT por un método de SSCP mejorado. Los tres genotipos se distinguen a nivel de cadena sencilla (ss). Además, los individuos heterocigotos (ID) se distinguen fácilmente de los homocigotos por la formación de moléculas heterodúplex a nivel de cadenas dobles (ds). (C) Genotipado del polimorfismo PCOL2 mediante análisis de restricción. Los genotipos ee (homocigoto para el sitio Eco31 l), EE (homocigoto sin el sitio) y Ee (heterocigoto) corresponden a GG, TT y GT, respectivamente. El primer carril corresponde al marcador de peso molecular. El tamaño, en pares de bases, se muestra a la derecha.FIG. 1 shows the strategy followed for the search and genotyping of the new polymorphisms in the promoter of the COL1A1 gene. (A) Position of the three amplimers used in the search. The +1 position corresponds to the transcription start site. The relevant region for osteoblastic expression in vivo is indicated. (B) Genotyping of polymorphism -1663indelT by an improved SSCP method. The three genotypes are distinguished at the single chain level (ss). In addition, heterozygous (ID) individuals are easily distinguished from homozygous by the formation of heteroduplex molecules at the level of double chains (ds). (C) Genotyping of PCOL2 polymorphism by restriction analysis. The genotypes ee (homozygous for the Eco31 l site), EE (homozygous without the site) and Ee (heterozygous) correspond to GG, TT and GT, respectively. The first lane corresponds to the molecular weight marker. The size, in base pairs, is shown on the right.
La FIG. 2 representa el análisis de los genotipos compuestos y haplotipos. (A) Valores medios de DMO para los cinco grupos (denominados de A hasta E) de genotipos compuestos que presentan frecuencias mayores del 5 %.FIG. 2 represents the analysis of compound genotypes and haplotypes. (A) Mean BMD values for the five groups (called A through E) of composite genotypes that have frequencies greater than 5%.
La FIG. 3 ilustra el ensayo de cambio de movilidad electroforética ("Electrophoretic Mobility Shift Assays", EMSA) usando la sonda PCOL1-I y un extracto nuclear de osteoblastos primarios. (A) Esquema de las tres distintas sondas utilizadas: cadena doble, cadena sencilla directa ("forward"), y cadena sencilla inversa ("reverse"). (B) Se incubó una sonda PCOL1-I de cadena doble en presencia (+) o ausencia (-) del extracto. Arriba se indican los competidores. El triángulo abarca los tres carriles en los que se añadió cantidades crecientes de sonda fría PCOL1-l-ds (excesos molares de 103, 104 y 105de sonda fría respecto a sonda marcada). Cada uno de los competidores no específicos (Sp1-ds, GRE-ds y PCOL2-G-ds) está en un exceso molar de 104. (C) Comparación de las capacidades de unión de las sondas PCOL1-I de cadena doble y cadena sencilla (Pr). Se incubaron los oligonucleótidos marcados PCOL1-I de cadena doble (sonda 1), de cadena sencilla directa (sonda 2) y de cadena sencilla inversa (sonda 3) en presencia (+) o ausencia (-) del extracto. (D) Se incubó una sonda PCOL1-I de cadena sencilla directa en presencia (+) o ausencia (-) del extracto. Los competidores de indican arriba. El triangulo abarca los dos carriles en los que se añadió cantidades crecientes de sonda fría PCOL1-l-ss (excesos molares de 103 y 104 de sonda fría respecto a la marcada). Cada uno de los competidores no específicos (PCOL1-l-ss directa -8A- y GRE-ss inversa) está en un exceso molar de 104. La flecha indica una banda que probablemente corresponde a la cadena doble generada por la hibridación de los dos oligonucleótidos PCOL1-l-ss complementarios.FIG. 3 illustrates the electrophoretic mobility shift test ("Electrophoretic Mobility Shift Assays", EMSA) using the PCOL1-I probe and a nuclear extract of primary osteoblasts. (A) Scheme of the three different probes used: double chain, direct single chain ("forward"), and single reverse chain ("reverse"). (B) A double chain PCOL1-I probe was incubated in the presence (+) or absence (-) of the extract. The competitors are indicated above. The triangle encompasses the three lanes in which increasing amounts of PCOL1-l-ds cold probe (molar excesses of 10 3 , 10 4 and 10 5 of cold probe with respect to labeled probe) were added. Each of the non-specific competitors (Sp1-ds, GRE-ds and PCOL2-G-ds) is in a molar excess of 10 4 . (C) Comparison of the bonding capabilities of the double-chain and single-chain PCOL1-I probes (Pr). The double-stranded PCOL1-I labeled oligonucleotides (probe 1), direct single strand (probe 2) and reverse single strand (probe 3) were incubated in presence (+) or absence (-) of the extract. (D) A direct single chain PCOL1-I probe was incubated in the presence (+) or absence (-) of the extract. The competitors indicated above. The triangle encompasses the two lanes in which increasing amounts of PCOL1-l-ss cold probe (10 3 and 10 4 molar excesses of cold probe with respect to the marked one) were added. Each of the non-specific competitors (PCOL1-l-ss direct -8A- and GRE-ss inverse) is at a molar excess of 10 4 . The arrow indicates a band that probably corresponds to the double chain generated by the hybridization of the two complementary PCOL1-l-ss oligonucleotides.
La FIG. 4 muestra un EMSA utilizando sondas de PCOL2-G y un extracto nuclear osteoblástico. (A) Esquema de las tres distintas sondas utilizadas: cadena doble, cadena sencilla directa ("forward"), y cadena sencilla inversa ("reverse"). (B) Se incubó una sonda PCOL2-G de cadena doble en ausencia (-) o presencia (+) del extracto. Los competidores se indican arriba. El triángulo abarca los cuatro carriles en los que se añadió cantidades crecientes de oligonucleótido frío PCOL2 de cadena doble. De izquierda a derecha los alelos y el exceso molar son los siguientes: G-103, G-104 , T-104y G-2x104. Cada uno de los competidores no específicos (Sp1-ds y GRE-ds) está en un exceso molar de 104. (C) Comparación de las capacidades de unión de las sondas PCOL2-G de cadena doble y de cadena sencilla. Se incubaron los oligonucleótidos marcados PCOL2-G de cadena doble (sonda 1), de cadena sencilla directa (sonda 2) y cadena sencilla inversa (sonda 3) en ausencia (-) o presencia (+) del extracto. (D) Se incubó una sonda de cadena sencilla inversa de PCOL2-G en ausencia (-) o presencia (+) del extracto. Los competidores se indican arriba. El triángulo abarca los dos carriles en los que se añadió cantidades crecientes de oligonucleótido frío PCOL2-G-ss inversa (excesos molares de 103 y 104). Cada uno de los competidores no específicos (Sp1-ds y GRE-ss inversa) está en un exceso molar de 104.FIG. 4 shows an EMSA using PCOL2-G probes and an osteoblastic nuclear extract. (A) Scheme of the three different probes used: double chain, direct single chain ("forward"), and single reverse chain ("reverse"). (B) A double-chain PCOL2-G probe was incubated in the absence (-) or presence (+) of the extract. The competitors are indicated above. The triangle encompasses the four lanes in which increasing amounts of double-stranded PCOL2 cold oligonucleotide were added. From left to right, the alleles and molar excess are the following: G-10 3 , G-10 4 , T-10 4 and G-2x10 4 . Each of the non-specific competitors (Sp1-ds and GRE-ds) is in a molar excess of 10 4 . (C) Comparison of the binding capabilities of the double-chain and single-chain PCOL2-G probes. The labeled double-stranded PCOL2-G oligonucleotides (probe 1), single straight chain (probe 2) and reverse single strand (probe 3) in the absence (-) or presence (+) of the extract were incubated. (D) A PCOL2-G reverse single chain probe was incubated in the absence (-) or presence (+) of the extract. The competitors are indicated above. The triangle encompasses the two lanes in which increasing amounts of PCOL2-G-ss cold oligonucleotide are added (molar excesses of 10 3 and 10 4 ). Each of the non-specific competitors (Sp1-ds and reverse GRE-ss) is in a molar excess of 10 4 .
La FIG. 5 muestra una comparación de las capacidades de unión de los dos alelos (G y T) de la posición -1997. Se incubó una sonda PCOL2-G-SS inversa (C*) en ausencia (-) o presencia (+) del extracto nuclear osteoblástico. Los carriles del 3 al 8 contienen cantidades crecientes (excesos molares de 102, 103 y 104) de la sonda PCOL2-G-ss inversa (C) (carriles 3 a 5) o de la sonda PCOL2-T-ss inversa (A) (carriles 6 a 8). DESCRIPCIÓN DETALLADA DE LAS REALIZACIONES PREFERIDASFIG. 5 shows a comparison of the binding capacities of the two alleles (G and T) of the -1997 position. A reverse PCOL2-G-SS (C * ) probe was incubated in the absence (-) or presence (+) of the osteoblastic nuclear extract. Lanes 3 through 8 contain increasing amounts (molar excesses of 10 2 , 10 3 and 10 4 ) of the inverse PCOL2-G-ss probe (C) (lanes 3 to 5) or of the inverse PCOL2-T-ss probe (A) (lanes 6 to 8). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
SujetosSubjects
La Unidad de Menopausia del Hospital del Mar, Barcelona, reclutó a doscientas cincuenta y seis mujeres españolas con una media de edad de 51 ,8 ± 6 (media ± DE), todas con ancestros españoles. Se realizó un examen físico y se registró un historial médico general. Se excluyeron los sujetos con historial de enfermedad ósea, de enfermedades metabólicas o endocrinas, de terapia hormonal sustitutiva o con un historial de fármacos que podrían afectar a la masa ósea. Se registró la edad a la menarquia, edad a la menopausia, y años desde la menopausia. Se obtuvieron las muestras de sangre y un informe escrito de consentimiento siguiendo las normas del "Comité Revisor de Investigación Humana para Procedimientos Genéticos" del Hospital del Mar.The Menopause Unit of the Hospital del Mar, Barcelona, recruited two hundred and fifty-six Spanish women with an average age of 51, 8 ± 6 (mean ± SD), all with Spanish ancestors. A physical exam was performed and a general medical history was recorded. Subjects with a history of bone disease, metabolic or endocrine diseases, hormone replacement therapy or a history of drugs that could affect bone mass were excluded. Age at menarche, age at menopause, and years since menopause were recorded. Blood samples and a written consent report were obtained following the standards of the "Human Research Review Committee for Genetic Procedures" of Hospital del Mar.
Análisis de la densidad mineral óseaBone mineral density analysis
Se midió la densidad mineral ósea (DMO) de la columna lumbar (L2-L4) y del cuello del fémur no dominante utilizando la absorciometría dual de rayos X (Hologic QDR 4500 SL®, Hologig, Waltham, MA, USA). La DMO se expresó en g/cm2.Bone mineral density (BMD) of the lumbar spine (L2-L4) and non-dominant femur neck was measured using dual x-ray absorptiometry (Hologic QDR 4500 SL ® , Hologig, Waltham, MA, USA). BMD was expressed in g / cm 2 .
Análisis del ADNDNA analysis
El ADN genómico se obtuvo a partir de leucocitos sanguíneos usando el Kit Wizard (Promega, Madison, Wl, U.S.A.) de purificación de ADN genómico.Genomic DNA was obtained from blood leukocytes using the Kit Wizard (Promega, Madison, Wl, U.S.A.) for genomic DNA purification.
Búsqueda de nuevos polimorfismos en la región promotora de COL1A1Search for new polymorphisms in the promoter region of COL1A1
Se escogieron diez muestras de ADN al azar. Se amplificó mediante PCR la región promotora de COL1A1 que comprende las posiciones -2292 a -1499 en tres fragmentos de unos 300 pb solapados entre sí (FIG. 1), utilizando los cebadores descritos en la TABLA 1. Las reacciones de amplificación contenían 100 ng de ADN genómico, 20 pmol de cada cebador, 10 nmol de cada dNTP, 1 ,25 U de Taq polimerasa (Promega, Madison, Wl, U.S.A.) y MgCI2 a 1 ,5 mM (fragmento 1) o a 2 mM (fragmentos 2 y 3) en un volumen final de 50 μl. Se utilizó el siguiente protocolo: Un paso inicial de desnaturalización de 1 min a 94°C; 35 ciclos de 40 s a 94°C y 30 s a 55°C (fragmento 3) o 56°C (fragmento 1 y 2); un paso final de extensión de 5-10 min a 72°C. El ensayo de polimorfismos de conformación de cadenas sencillas (SSCP) se hizo como sigue: Se mezcló 4-5 μl de cada reacción de la PCR con 7 μl de tampón STOP (formamida al 95%, EDTA a 10 mM, xilen cianol al 0,05%, azul de bromofenol al 0,05%), desnaturalización por calor a 80°C durante 3 min y enfriar en hielo antes de la electroforesis a 150-200 V en geles de poliacrilamida al 8% (acrilamida:bisacrilamida 29: 1). Las condiciones óptimas de SSCP para los polimorfismos -1663indelT (en el fragmento 1) y -1997 G/T (en el fragmento 2 ) eran a temperatura ambiente y a 4°C, respectivamente. Para la visualización de la bandas, los geles fueron teñidos con plata.Ten random DNA samples were chosen. The promoter region of COL1A1 comprising positions -2292 to -1499 in three fragments of about 300 bp overlapping each other was amplified by PCR (FIG. 1), using the primers described in TABLE 1. The amplification reactions contained 100 ng of genomic DNA, 20 pmol of each primer, 10 nmol of each dNTP, 1.25 U of Taq polymerase (Promega, Madison, Wl, USA) and MgCI 2 at 1.5 mM (fragment 1) or at 2 mM (fragments 2 and 3) in one volume final 50 μl. The following protocol was used: An initial denaturation step of 1 min at 94 ° C; 35 cycles of 40 s at 94 ° C and 30 s at 55 ° C (fragment 3) or 56 ° C (fragment 1 and 2); a final extension step of 5-10 min at 72 ° C. The single chain conformation polymorphisms (SSCP) assay was performed as follows: 4-5 μl of each PCR reaction was mixed with 7 μl of STOP buffer (95% formamide, 10 mM EDTA, 0 xylene cyanol , 05%, bromophenol blue 0.05%), heat denaturation at 80 ° C for 3 min and cool on ice before electrophoresis at 150-200 V in 8% polyacrylamide gels (acrylamide: bisacrylamide 29: one). The optimal SSCP conditions for polymorphisms -1663indelT (in fragment 1) and -1997 G / T (in fragment 2) were at room temperature and 4 ° C, respectively. For the visualization of the bands, the gels were dyed with silver.
TABLA 1. Cebadores para la amplificación de tres fragmentos (FR) solapados de la región promotora de COL1A1.TABLE 1. Primers for the amplification of three overlapping fragments (FR) of the promoter region of COL1A1.
FR Posición SEQ Cebadores T dentro del ID (°C) promotor NO:FR Position SEQ Primers T within the ID (° C) promoter NO:
1 -1499 a 7 F1 : 5' AAGGTCCATCCCTCCATTGC 3' 561 -1499 to 7 F1: 5 'AAGGTCCATCCCTCCATTGC 3' 56
-1837 8 R1 : 5' TCATTTCTCTCCCTCCTGTG 3'-1837 8 R1: 5 'TCATTTCTCTCCCTCCTGTG 3'
2 -1780 a 5 F2: 5' CACCCTGCCCTAGACCAC 3' 562 -1780 to 5 F2: 5 'CACCCTGCCCTAGACCAC 3' 56
-2071 6 R2: 5' GAAAATATAGAGTTTCCAGAG 3'-2071 6 R2: 5 'GAAAATATAGAGTTTCCAGAG 3'
3 -2026 a 9 F3: 5' GATCCCCAAATATCCTTCAG 3' 553 -2026 to 9 F3: 5 'GATCCCCAAATATCCTTCAG 3' 55
-2292 10 R3: 5' GTTTTTGGAGGGAACAGAC 3'-2292 10 R3: 5 'GTTTTTGGAGGGAACAGAC 3'
Tipado de los polimorfismos -1663¡ndelT v -1997 G/T.Typing of polymorphisms -1663¡ndelT v -1997 G / T.
El polimorfismo -1663¡ndelT se tipo con un protocolo de PCR-SSCP mejorado, tal como sigue: se amplificó un fragmento de 180 pb (que pasa a ser de 179 pb en el polimorfismo) utilizando el cebador PCOL1 F de SEQ ID NO: 2 (5' TAGCCCCTGCAGTCTCCCTC 3') y el cebador PCOL1 R de SEQ ID NO: 3 (5' AAGATTCCATTGCCTCCCCC 3') en las siguientes condiciones: 10 pmol de cada cebador, 5 nmol de cada dNTP, 0,7 U de Taq polimerasa (Promega, Madison, Wl, U.S.A.), MgCI2 a 1 ,5 mM y 100 ng de ADN genómico en un volumen final de 25 μl. El programa consistió en un paso inicial de desnaturalización de 1 min a 94°C, 35 ciclos de 40 s a 94°C y 30 s a 62°C, seguidos por un paso final de 5 min a 72°C. Los productos de PCR se prepararon para su carga en geles SSCP tal como se describe anteriormente y fueron sometidos a electroforesis en geles de poliacrilamida al 12% conteniendo un 5% de glicerol a temperatura ambiente y a 140 V. Las bandas fueron reveladas por tinción con plata.Polymorphism -1663NdelT is type with an improved PCR-SSCP protocol, as follows: a 180 bp fragment (which becomes 179 bp in the polymorphism) was amplified using the PCOL1 F primer of SEQ ID NO: 2 (5 'TAGCCCCTGCAGTCTCCCTC 3') and primer PCOL1 R of SEQ ID NO: 3 (5 'AAGATTCCATTGCCTCCCCC 3') under the following conditions: 10 pmol of each primer, 5 nmol of each dNTP, 0.7 U of Taq polymerase (Promega, Madison, Wl, USA), MgCI 2 to 1, 5 mM and 100 ng of genomic DNA in a final volume of 25 μl. The program consisted of an initial denaturation step of 1 min at 94 ° C, 35 cycles of 40 s at 94 ° C and 30 s at 62 ° C, followed by a final step of 5 min at 72 ° C. The PCR products were prepared for loading on SSCP gels as described above and were subjected to electrophoresis in 12% polyacrylamide gels containing 5% glycerol at room temperature and 140 V. The bands were revealed by silver staining .
El polimorfismo -1997 G/T se tipo mediante una estrategia de PCR-RFLP (polimorfismo de longitud de fragmentos de restricción), tal como sigue: las muestras de ADN fueron sometidas a amplificación por PCR del fragmento 2 con los cebadores F2 y R2 que se muestran en la TABLA 1 , y posteriormente fueron digeridas con el enzima de restricción Eco31 l. Los productos de la digestión se resolvieron en geles de poliacrilamida al 8%. El alelo más frecuente aparece como dos bandas de 212 y 81 pb, mientras que el menos frecuente permanece no digerido (293 pb).The -1997 G / T polymorphism is type using a PCR-RFLP (restriction fragment length polymorphism) strategy, as follows: DNA samples were subjected to PCR amplification of fragment 2 with primers F2 and R2 which are shown in TABLE 1, and were subsequently digested with the restriction enzyme Eco31 l. The digestion products were resolved in 8% polyacrylamide gels. The most frequent allele appears as two bands of 212 and 81 bp, while the less frequent remains undigested (293 bp).
Extractos nucleares de osteoblastos primarios humanosNuclear extracts of human primary osteoblasts
Las células óseas humanas se obtuvieron a partir de muestras quirúrgicas de sujetos sanos sometidos a cirugía por traumatismo agudo y exentos de enfermedad de remodelaje óseo. Se utilizó un protocolo basado en un método descrito (P.J. Marie et al., In Vitro Cell. Dev. Biol. 1989, vol. 25, pp. 373-80) con algunas modificaciones (M. Nacher et al., Bone Miner. 1994, vol. 26, pp. 231-43; C. Garcia-Moreno et al., Bone 1998, vol. 22, pp. 233-9). Se estableció un cultivo de osteoblastos primarios a partir de un acervo de células procedentes de cuatro donantes. Las células fueron cultivadas en medio Eagle modificado por Dulbecco (DMEM) (Gibco BRL Life technologies S.A., Grand Island, NY, U.S.A.) suplementado con un 20% de suero fetal bovino (FCS) (Biological industries, Kibbutz Beth Haemek, Israel). Los extractos nucleares fueron preparados a partir de células en confluencia de acuerdo a un protocolo publicado (E. Schreiber et al., Nucleic Acids Res. 1989, vol. 17, p. 6419), utilizando un tampón C modificado (glicerol al 10%, MgCI2 a 1 ,5 mM). Se determinó las concentraciones de proteína por el método de Bradford, y los extractos nucleares se guardaron a -80°C hasta su uso. Ensayos de cambio de movilidad electroforética (EMSA)Human bone cells were obtained from surgical samples of healthy subjects undergoing surgery for acute trauma and free of bone remodeling disease. A protocol based on a described method was used (PJ Marie et al., In Vitro Cell. Dev. Biol. 1989, vol. 25, pp. 373-80) with some modifications (M. Nacher et al., Bone Miner. 1994, vol. 26, pp. 231-43; C. Garcia-Moreno et al., Bone 1998, vol. 22, pp. 233-9). A culture of primary osteoblasts was established from a pool of cells from four donors. The cells were cultured in Dulbecco-modified Eagle medium (DMEM) (Gibco BRL Life technologies SA, Grand Island, NY, USA) supplemented with 20% fetal bovine serum (FCS) (Biological industries, Kibbutz Beth Haemek, Israel). Nuclear extracts were prepared from confluent cells according to a published protocol (E. Schreiber et al., Nucleic Acids Res. 1989, vol. 17, p. 6419), using a modified C buffer (10% glycerol , MgCl 2 to 1.5 mM). Protein concentrations were determined by the method Bradford, and the nuclear extracts were stored at -80 ° C until use. Testing of electrophoretic mobility change (EMSA)
Para el EMSA, se prepararon las siguientes sondas de oligonucleótidos de cadena sencilla mediante síntesis automática de ADN (Gibco BRL, Paisley, Scotland, U.K.):For the EMSA, the following single chain oligonucleotide probes were prepared by automatic DNA synthesis (Gibco BRL, Paisley, Scotland, U.K.):
PCOL1-I 5' TTCTGTTCC I I I I I I I I CCCCTTTG 3' (SEQ ID NO: 11) PCOL1-D 5' TTCTGTTCC I I I I I I I CCCCTTTG 3' (SEQ ID NO: 1) PCOL2-G 5' CGCCTATTAGGGAGGGGGTCTCTTGGAACT 3' (SEQ ID NO: 12) PCOL2-T 5' CGCCTATTAGGGAGGGGJTCTCTTGGAACT 3'(SEQ ID NO:4)PCOL1-I 5 'TTCTGTTCC IIIIIIII CCCCTTTG 3' (SEQ ID NO: 11) PCOL1-D 5 'TTCTGTTCC IIIIIII CCCCTTTG 3' (SEQ ID NO: 1) PCOL2-G 5 'CGCCTATTAGGGAGGGGGTCTCTTGGAACT 3') (SEQ ID3: 12) -T 5 'CGCCTATTAGGGAGGGGJTCTCTTGGAACT 3' (SEQ ID NO: 4)
Donde las bases subrayadas corresponden a los sitios polimórficos. Se sintetizaron, también, las correspondientes sondas complementarias. La sonda de cadena doble se obtuvo por hibridación de los oligonucleótidos complementarios. Todas las sondas se marcaron en el extremo con [γ-32P] ATP utilizando la polinucleótido quinasa de T4 (Promega, Madison, Wl, U.S.A.).Where the underlined bases correspond to the polymorphic sites. The corresponding complementary probes were also synthesized. The double chain probe was obtained by hybridization of the complementary oligonucleotides. All probes were labeled at the end with [γ- 32 P] ATP using the T4 polynucleotide kinase (Promega, Madison, Wl, USA).
Las reacciones de unión contienen, normalmente, 10 μg de extracto nuclear, 2 μg de poli(dl-dC) de cadena doble (Amersham Pharmacia Biotech, Freiburg, Germany), 6 μg de BSA acetilada y 50.000 cpm de sonda marcada radiactivamente. La mezcla se incuba durante 15-20 min a 37°C en un tampón que contiene HEPES a 20 mM y pH 7,9, KCI a 60 mM, EDTA a 1 mM, DTT a 1 mM y glicerol al 10% en un volumen total de 20 μl. Los complejos de ADN-proteína se resolvieron de las sondas libres en geles no desnaturalizantes de poliacrilamida al 5% (29:1) que contenían glicerol al 2,5%. La electroforesis se realizó a 4°C en tampón de TBExl a 15-18 mA durante 2 h aproximadamente. Los geles se secaron al vacío y se expusieron a películas de rayos-X con pantallas intensificadoras a -70°C durante 24-48 horas. En los ensayos de competición, las reacciones de unión se hicieron en presencia de un exceso de oligonucleótido competidor no marcado, como se indica en cada caso. Los oligonucleótidos que contenían los sitios de unión de factores de transcripción conocidos (Sp1 y el receptor de glucocorticoides) eran: Sp1 5' ATTCGATCGGGGCGGGGCGAGC 3' (SEQ ID NO: 13)Binding reactions normally contain 10 μg of nuclear extract, 2 μg of double stranded poly (dl-dC) (Amersham Pharmacia Biotech, Freiburg, Germany), 6 μg of acetylated BSA and 50,000 cpm of radioactively labeled probe. The mixture is incubated for 15-20 min at 37 ° C in a buffer containing 20 mM HEPES and pH 7.9, 60 mM KCI, 1 mM EDTA, 1 mM DTT and 10% glycerol in one volume total of 20 μl. The DNA-protein complexes were resolved from the free probes in non-denaturing gels of 5% polyacrylamide (29: 1) containing 2.5% glycerol. Electrophoresis was performed at 4 ° C in TBExl buffer at 15-18 mA for approximately 2 h. The gels were dried under vacuum and exposed to X-ray films with intensifying screens at -70 ° C for 24-48 hours. In competition assays, binding reactions were made in the presence of an excess of unlabeled competing oligonucleotide, as indicated in each case. The oligonucleotides containing the binding sites of known transcription factors (Sp1 and the glucocorticoid receptor) were: Sp1 5 'ATTCGATCGGGGCGGGGCGAGC 3' (SEQ ID NO: 13)
GRE 5' TAATGAGAGAAGATTCTGTTCTAATGACCA 3' (SEQ ID NO: 14)GRE 5 'TAATGAGAGAAGATTCTGTTCTAATGACCA 3' (SEQ ID NO: 14)
Análisis estadístico de los efectos de cada uno de los polimorfismos sobre la densidad mineral ósea (DMO)Statistical analysis of the effects of each of the polymorphisms on bone mineral density (BMD)
Se utilizó el análisis de la varianza o de la covarianza (cuando se incluyeron las covariables) para determinar el efecto de cada polimorfismo sobre la DMO. En todos los casos se analizaron los efectos independientes de todas las variables predictivas, así como como sus interacciones. Cuando se observaron diferencias significativas, se compararon las medias usando el contraste múltiple de Scheffé. El nivel de significación se estableció a p<0,05. Se analizó la dependencia de las variables mediante el coeficiente de correlación de Pearson, para las variables continuas, o mediante el coeficiente rho de Spearman, para las variables ordinales. Los análisis se realizaron utilizando el paquete estadístico SPSS (6.1.3, SPSS Inc., 1989- 1995).The analysis of variance or covariance (when covariates were included) was used to determine the effect of each polymorphism on BMD. In all cases, the independent effects of all predictive variables were analyzed, as well as their interactions. When significant differences were observed, the means were compared using Scheffé's multiple contrast. The level of significance was set at p <0.05. The dependence of the variables was analyzed by Pearson's correlation coefficient, for the continuous variables, or by the Spearman rho coefficient, for the ordinal variables. The analyzes were performed using the statistical package SPSS (6.1.3, SPSS Inc., 1989-1995).
Deseguilibrio de ligamientoLinkage imbalance
Se utilizaron tres medidas de desequilibrio de ligamiento ampliamente utilizadas: D', δ y el coeficiente de Yule Φ. Se determinaron los niveles de significación de las correspondientes tablas 2x2 (1 grado de libertad) mediante el estadístico χ2.Three widely used linkage imbalance measures were used: D ', δ and the Yule coefficient Φ. The levels of significance of the corresponding 2x2 tables (1 degree of freedom) were determined using the χ 2 statistic.
Detección de dos polimorfismos nuevos en el promotor de COL1A1Detection of two new polymorphisms in the COL1A1 promoter
Para buscar polimorfismos relativamente frecuentes (>10%) en la región promotora de COL1A1 (posiciones -1499 a -2292), se procedió al rastreo de la misma mediante SSCP (FIG. 1A), utilizando muestras de ADN de un número pequeño de individuos seleccionados al azar.To search for relatively frequent polymorphisms (> 10%) in the promoter region of COL1A1 (positions -1499 to -2292), it was screened using SSCP (FIG. 1A), using DNA samples from a small number of individuals randomly selected
Se detectó un nuevo polimorfismo en el fragmento 1. Cuatro de los siete individuos control mostraron un patrón de SSCP diferente, detectado sobre todo en la región del heterodúplex del gel. La secuenciación reveló una deleción de un nucleótido T en una serie de ocho residuos T , localizada en las posiciones -1663 a -1670. Al alelo que portaba 8 Ts se le llamó I (por la inserción de un residuo T) y al que portaba 7 Ts se le llamó D (por la deleción de una T), y el polimorfismo fué denominado -1663indelT. Para establecer las frecuencias genotípicas, se siguió una estrategia mejorada de SSCP (ver arriba), usando un fragmento de PCR más pequeño (FIG. 1 B). Se han establecido la frecuencias alélicas y genotípicas para este polimorfismo en 256 mujeres (TABLA 2).A new polymorphism was detected in fragment 1. Four of the seven control individuals showed a different SSCP pattern, detected mostly in the heteroduplex region of the gel. Sequencing revealed a deletion of a T nucleotide in a series of eight T residues, located at positions -1663 to -1670. The allele that carried 8 Ts was called I (by the insertion of a residue T) and the one carrying 7 Ts was called D (by the deletion of a T), and the polymorphism was called -1663indelT. To establish genotypic frequencies, an improved SSCP strategy was followed (see above), using a smaller PCR fragment (FIG. 1B). Allelic and genotypic frequencies for this polymorphism have been established in 256 women (TABLE 2).
El análisis de SSCP del fragmento 2 en ocho individuos mostró dos patrones diferentes, uno presente en 5 casos y el otro en 3. Tras secuenciar, se detectó una transversión G-T en la posición -1997. Este cambio afecta a un sitio de restricción para el enzima Eco31 l (GGTCTC) de manera que éste está presente en el alelo G y ausente en el alelo T (FIG. 1C). Las frecuencias de este polimorfismo, denominado -1997 G/T, se muestran en la TABLA 2. En ambos casos, la frecuencia del alelo minoritario, en nuestra muestra, estaba por encima del 10% (23% para -1663 D y 13% para -1997 T). En el fragmento 3 no se detectó ningún polimorfismo.The SSCP analysis of fragment 2 in eight individuals showed two different patterns, one present in 5 cases and the other in 3. After sequencing, a G-T transversion was detected at position -1997. This change affects a restriction site for the Eco31 l enzyme (GGTCTC) so that it is present in the G allele and absent in the T allele (FIG. 1C). The frequencies of this polymorphism, called -1997 G / T, are shown in TABLE 2. In both cases, the frequency of the minor allele, in our sample, was above 10% (23% for -1663 D and 13% for -1997 T). In fragment 3 no polymorphism was detected.
Además de estos dos nuevos polimorfismos, se tipo el polimorfismo Sp1 en el intrón 1 de COL1A1. En la TABLA 2 se muestran las frecuencias genotípicas y alélicas.In addition to these two new polymorphisms, Sp1 polymorphism in intron 1 of COL1A1 is type. TABLE 2 shows the genotypic and allelic frequencies.
Asociación entre los polimorfismos de CQL1A1 y la DMQ de la columna lumbarAssociation between CQL1A1 polymorphisms and lumbar spine DMQ
Se analizó la asociación entre los genotipos y la DMO de la columna lumbar en 256 mujeres postmenopáusicas. El valor medio de la DMO, la desviación estándar (DE) y el rango en nuestra muestra fueron 0,894 g/cm2, 0,135 y 0,567-1 ,297. La media para cada uno de los genotipos de -1663indelT, -1997 G/T y Sp1 se muestra en la TABLA 3. TABLA 2. Frecuencias genotípicas y alélicas para los polimorfismos - 1663indelT, -1997 G/T y Sp1 del gen COL1A1 en 256 mujeres postmenopáusicas españolas. Frec. = frecuencia absoluta (relativa).The association between genotypes and BMD of the lumbar spine in 256 postmenopausal women was analyzed. The mean BMD value, the standard deviation (SD) and the range in our sample were 0.894 g / cm 2 , 0.135 and 0.567-1, 297. The mean for each of the genotypes of -1663indelT, -1997 G / T and Sp1 is shown in TABLE 3. TABLE 2. Genotypic and allelic frequencies for polymorphisms - 1663indelT, -1997 G / T and Sp1 of the COL1A1 gene in 256 Spanish postmenopausal women. Freq. = absolute (relative) frequency.
-1663 Frec. -1997 Frec. Sp1 Frec. indeIT G/T-1663 Freq. -1997 Freq. Sp1 Freq. indeIT G / T
Genotipos II 155 GG 194 SS 161 (0,60) (0,76) (0,63)Genotypes II 155 GG 194 SS 161 (0.60) (0.76) (0.63)
ID 84 GT 56 Ss 78 (0,33) (0,22) (0,30)ID 84 GT 56 Ss 78 (0.33) (0.22) (0.30)
DD 17 TT 6 ss 17 (0,07) (0,02) (0,07)DD 17 TT 6 ss 17 (0.07) (0.02) (0.07)
Alelos I 394 G 444 S 400 (0,77) (0,87) (0,78)Alleles I 394 G 444 S 400 (0.77) (0.87) (0.78)
D 118 T 68 s 112 (0,23) (0,13) (0,22)D 118 T 68 s 112 (0.23) (0.13) (0.22)
TABLA 3. Medias de DMO ± DE de los individuos portadores de los diferentes genotipos -1663indelT, -1997 G/T y Sp1.TABLE 3. BMD means ± SD of the individuals carrying the different genotypes -1663indelT, -1997 G / T and Sp1.
-1663 -1997 indeIT G/T Sp1-1663 -1997 indeIT G / T Sp1
Columna lumbar (n=256)Lumbar spine (n = 256)
II 0,897 GG 0,890 SS 0,899II 0.897 GG 0.890 SS 0.899
± 0,131 ± 0,129 ± 0,129± 0.131 ± 0.129 ± 0.129
ID 0,882 GT 0,918 Ss 0,879ID 0.882 GT 0.918 Ss 0.879
± 0,145 ± 0,157 ± 0,149± 0.145 ± 0.157 ± 0.149
DD 0,932 TT 0,823 ss 0,929DD 0.932 TT 0.823 ss 0.929
± 0,110 ± 0,100 ± 0,113± 0,110 ± 0,100 ± 0,113
Cuello femoral (n=146)Femoral neck (n = 146)
II 0,714 GG 0,720 SS 0,720II 0.714 GG 0.720 SS 0.720
± 0,107 ± 0,097 ± 0,109± 0.107 ± 0.097 ± 0.109
ID 0,728 GT 0,736 Ss 0,721ID 0.728 GT 0.736 Ss 0.721
± 0,090 ± 0,105 ± 0,085± 0.090 ± 0.105 ± 0.085
DD 0,734 TT 0,633 ss 0,727DD 0.734 TT 0.633 ss 0.727
± 0,069 ± 0,104 ± 0,075 TABLA 4. Análisis de la covarianza de la asociación entre los polimorfismos -1663indelT y -1997 G/T y la DMO de la columna lumbar, (gdl = grados de libertad)± 0.069 ± 0.104 ± 0.075 TABLE 4. Analysis of the covariance of the association between polymorphisms -1663indelT and -1997 G / T and BMD of the lumbar spine, (gdl = degrees of freedom)
gdl F Sig,gdl F Sig,
Peso corporal 1 10,092 0,002Body weight 1 10,092 0.002
Edad 1 4,986 0,026Age 1 4,986 0,026
Años desde la menopausia 1 9,312 0,003Years since menopause 1 9,312 0.003
-1997 G/T 2 4,324 0,014-1997 G / T 2 4,324 0,014
-1663¡ndelT 2 1 ,441 0,239-1663 ¡ndelT 2 1, 441 0.239
-1997 G/T * -1663indelT 2 4,011 0,019-1997 G / T * -1663indelT 2 4,011 0,019
Se obtuvo una asociación significativa cuando se hizo un análisis de la covarianza considerando la DMO de la columna lumbar como variable dependiente, los años desde la menopausia, la edad y el peso corporal como covariables, y -1663indelT y -1997 G/T como variables independientes. El polimorfismo -1997 G/T estaba asociado significativamente con la DMO de la columna lumbar (p = 0,014) y también lo estaba su interacción con el polimorfismo -1663indelT (p = 0,019) (TABLA 4). Se obtuvo un resultado similar para la interacción entre -1997 G/T y Sp1 (p = 0,045, no mostrado). Los polimorfismos -1663indelT y Sp1 mostraron un alto grado de concordancia (índice Kappa de Cohén = 0,894, p < 0,001), lo que imposibilitó su análisis simultáneo con el polimorfismo -1997 G/T.A significant association was obtained when an analysis of covariance was made considering BMD of the lumbar spine as a dependent variable, years since menopause, age and body weight as covariates, and -1663indelT and -1997 G / T as variables independent. Polymorphism -1997 G / T was significantly associated with BMD of the lumbar spine (p = 0.014) and so was its interaction with polymorphism -1663indelT (p = 0.019) (TABLE 4). A similar result was obtained for the interaction between -1997 G / T and Sp1 (p = 0.045, not shown). The polymorphisms -1663indelT and Sp1 showed a high degree of concordance (Kappa de Cohen index = 0.894, p <0.001), which made it impossible to analyze them simultaneously with the polymorphism -1997 G / T.
También se analizaron las medias de DMO de la columna lumbar de los genotipos compuestos que incluyen los tres sitios polimórficos. Sólo se incluyeron los genotipos que tenían frecuencias superiores al 5% (5 de las 27 combinaciones posibles). La FIG. 2 muestra las medias de DMO para estos cinco genotipos compuestos, denominados de A a E. La media de DMO más alta (0,982 ± 0,186) correspondió al grupo D (los triples heterocigotos), mientras que el valor más bajo (0,853 ± 0,137) correspondió al grupo CThe BMD means of the lumbar spine of compound genotypes that include all three polymorphic sites were also analyzed. Only genotypes that had frequencies greater than 5% (5 of the 27 possible combinations) were included. FIG. 2 shows the means of BMD for these five compound genotypes, called A to E. The highest average BMD (0.982 ± 0.186) corresponded to group D (triple heterozygous), while the lowest value (0.853 ± 0.137) corresponded to group C
(homocigotos GG en -1997 y heterocigotos en los otros dos loci). Un ANOVA considerando el genotipo triple como variable independiente dio asociación significativa con la DMO (p = 0,018). Se hizo un contraste múltiple de Scheffé y sólo se encontró una diferencia significativa entre los grupos C y D (p = 0,04). TABLA 5. Desequilibrio de ligamiento entre los polimorfismos -1663indelT, -1997 G/T y Sp1 , tomados de a pares.(homozygous GG in -1997 and heterozygous in the other two loci). An ANOVA considering the triple genotype as an independent variable gave significant association with BMD (p = 0.018). A multiple contrast of Scheffé was made and only a significant difference was found between groups C and D (p = 0.04). TABLE 5. Linkage imbalance between polymorphisms -1663indelT, -1997 G / T and Sp1, taken in pairs.
-1663indelT/ Sp1 Alelo s Alelo S x2 δ D' Φ-1663indelT / Sp1 Allele s Allele S x 2 δ D 'Φ
Alelo D 28 10 p <10"6 0,90 0,89 0,99D allele 28 10 p <10 "6 0.90 0.89 0.99
Alelo I 3 307Allele I 3 307
-1997 G/T / Sp1 Alelo s Alelo S χ2 δ D' Φ-1997 G / T / Sp1 Allele s Allele S χ 2 δ D 'Φ
Alelo G 95 332 p=0,002 0,84 0,81 0,75Allele G 95 332 p = 0.002 0.84 0.81 0.75
Alelo T 2 49Allele T 2 49
-1997 G/T / Alelo D Alelo I χ2 δ D' Φ-1997 G / T / Allele D Allele I χ 2 δ D 'Φ
-1663indelT-1663indelT
Alelo G 100 326 P= 0,003 0,75 0,73 0,67Allele G 100 326 P = 0.003 0.75 0.73 0.67
Alelo T 3 49Allele T 3 49
Asociación entre los polimorfismos de COL1A1 y la DMO del cuello del fémurAssociation between the polymorphisms of COL1A1 and the BMD of the neck of the femur
También se analizó la asociación entre los polimorfismos de COL1A1 y la DMO del cuello del fémur en un subgrupo de 146 mujeres. La media de DMO, DE y rango en nuestra muestra fueron 0,723 g/cm2, 0,097 y 0,515-1 ,060. Las medias de DMO para cada genotipo se muestra en la TABLA 3. Un análisis de la covarianza con la edad como covariable mostró que -1997 G/T estaba asociado con la DMO del cuello del fémur (p = 0,044, no mostrado). No se obtuvieron resultados significativos para los polimorfismos -1663indelT o Sp1.The association between COL1A1 polymorphisms and BMD of the femur neck in a subgroup of 146 women was also analyzed. The mean BMD, SD and range in our sample were 0.723 g / cm 2 , 0.097 and 0.515-1, 060. The BMD means for each genotype is shown in TABLE 3. An analysis of covariance with age as a covariate showed that -1997 G / T was associated with BMD of the femoral neck (p = 0.044, not shown). No significant results were obtained for polymorphisms -1663indelT or Sp1.
Unión de factores nucleares a oligonucleótidos gue contienen las posiciones 1663 v -1997 del promotor de COL1A1Binding of nuclear factors to oligonucleotides that contain the positions 1663 v -1997 of the COL1A1 promoter
Una sonda de cadena doble de 25 nucleótidos que contiene el alelo -1663 I (8Ts), denominada PCOL1-I, produjo un retención que se competía con cantidades crecientes del oligonucleótido frío, pero no con otras moléculas de ADN no relacionadas (FIG. 3B). Resultados similares se obtuvieron cuando se utilizó el alelo -1663 D (7 Ts, datos no mostrados). Cuando se analizaron los dos oligonucleótidos complementarios de cadena sencilla, la cadena directa (8T) mostró una retención más fuerte que la sonda de cadena doble, mientras que la cadena inversa (8A) no produjo retención (FIG. 3C). Entonces se probó si la unión a la cadena sencilla directa era específica. Como se muestra en la FIG. 3D, la adición de un exceso molar de la sonda fría (competidor específico) de 103 o 104 redujo la retención, mientras que la adición de un exceso molar de 104 del oligonucleótido GRE de cadena sencilla no lo hizo. Nótese que la adición de un exceso molar de 104 del oligonucleótido de cadena sencilla inversa (8A), que es complementario a la sonda, elimina la banda retardada pero genera una banda más baja (ver cabeza de flecha), que muy probablemente corresponde a la cadena doble generada por hibridación de la sonda directa al exceso de oligonucleótido inverso (8A). A este nuevo elemento de ADN, capaz de unir factores nucleares de osteoblasto, se le denominó PCOL1.A 25-nucleotide double-stranded probe containing the -1663 I (8Ts) allele, called PCOL1-I, produced a retention that competed with increasing amounts of the cold oligonucleotide, but not with other unrelated DNA molecules (FIG. 3B ). Similar results were obtained when the -1663 D allele was used (7 Ts, data not shown). When the two complementary single chain oligonucleotides were analyzed, the direct chain (8T) showed stronger retention than the double chain probe, while the reverse chain (8A) produced no retention (FIG. 3C). Then it was tested if direct single chain binding was specific. As shown in FIG. 3D, the addition of a cold probe molar excess (specific competitor) of 10 3 or 10 4 reduced retention, while the addition of a 10 4 molar excess of the single chain GRE oligonucleotide did not. Note that the addition of a 10 4 molar excess of the reverse single chain oligonucleotide (8A), which is complementary to the probe, eliminates the delayed band but generates a lower band (see arrowhead), which most likely corresponds to the double chain generated by hybridization of the direct probe to the excess of reverse oligonucleotide (8A). This new element of DNA, capable of joining nuclear osteoblast factors, was called PCOL1.
Una sonda de cadena doble de 30 nucleótidos que contiene el alelo -1997 G, denominada PCOL2-G, mostró unión específica a proteínas nucleares de osteoblastos (FIG. 4B). El examen de las cadenas sencillas dio un resultado asimétrico (FIG. 4C). Mientras que la cadena directa (portadora de la G) mostraba una retención difusa y de elevado peso molecular, la cadena inversa (portadora de la C) produjo una intensa señal de retención en la misma posición que la sonda de cadena doble. Para probar si la unión de la cadena sencilla inversa era específica, se efectuó un ensayo de competición (FIG. 4D). La adición de un exceso molar de 104 tanto del oligonucleótido GRE de cadena sencilla, como del oligonucleótido Sp1 de cadena doble, no mostró competición respecto a la banda retardada. Este segundo elemento de ADN, al que también se unen factores nucleares de osteoblastos, se denominó PCOL2.A 30-nucleotide double-stranded probe containing the -1997 G allele, called PCOL2-G, showed specific binding to osteoblast nuclear proteins (FIG. 4B). The examination of the single chains gave an asymmetric result (FIG. 4C). While the direct chain (carrier of the G) showed diffuse retention and high molecular weight, the reverse chain (carrier of the C) produced an intense retention signal in the same position as the double chain probe. To test whether the binding of the reverse single chain was specific, a competition test was performed (FIG. 4D). The addition of a 10 4 molar excess of both the single chain GRE oligonucleotide and the double chain Sp1 oligonucleotide showed no competition with respect to the delayed band. This second element of DNA, to which osteoblast nuclear factors also bind, was called PCOL2.
Finalmente, se comparó la capacidad de unión de los dos alelos del polimorfismo -1997 G/T. En la FIG. 5 se muestra un EMSA en el cual la sonda marcada era el oligonucleótido de cadena sencilla portador de la C (PCOL2- G, cadena inversa), y los competidores fueron la cadena sencilla fría portadora de la C (excesos molares de 103, 104 y 105), o las mismas cantidades de la cadena sencilla fría portadora de la A (cadena inversa del alelo T). Se detectó una diferencia de competición, que se observa mejor al comparar los carriles 4 y 7 (excesos molares de 104). El oligonucleótido portador de la C (alelo G) era un mejor competidor que el oligonucleótido portador de la A (alelo T), sugiriendo una capacidad de unión más elevada para el alelo G. Todos los experimentos de EMSA son representativos de al menos tres réplicas independientes.Finally, the binding capacity of the two alleles of the Polymorphism -1997 G / T. In FIG. 5 shows an EMSA in which the labeled probe was the single chain oligonucleotide carrying the C (PCOL2-G, reverse chain), and the competitors were the single cold chain carrying the C (molar excesses of 10 3 , 10 4 and 10 5 ), or the same amounts of the simple cold chain carrying the A (reverse chain of the T allele). A competition difference was detected, which is best observed when comparing lanes 4 and 7 (molar excesses of 10 4 ). The C-carrying oligonucleotide (G allele) was a better competitor than the A-carrying oligonucleotide (T allele), suggesting a higher binding capacity for the G allele. All EMSA experiments are representative of at least three replicates independent.
Sobre la asociación entre el polimorfismo -1997 G/T y la DMOOn the association between polymorphism -1997 G / T and BMD
El polimorfismo -1997 G/T resultó estar asociado significativamente a la DMO de la columna lumbar (p = 0,019), y a la DMO del cuello del fémur (p = 0,044), en 256 y 146 casos respectivamente, de la cohorte de mujeres españolas postmenopáusicas. Se demostró que el oligonucleótido que contenía el sitio polimórfico es capaz de unirse a factores nucleares de osteoblastos, y a este nuevo sitio de unión se le denominó PCOL2. Resulta interesante el hecho de que la unión era mucho más fuerte cuando se usaba la sonda de cadena sencilla inversa, cosa que sugiere la participación de una proteína de unión a ADN de cadena sencilla. Los dos alelos de este polimorfismo tienen diferentes capacidades de unión. Será importante probar mediante ensayos funcionales si estas diferencias resultan en diferentes niveles de transcripción. En caso afirmativo, podrían constituir la causa de la asociación encontrada en esta invención entre el polimorfismo -1997 G/T y la DMO. Ésta es la primera vez en la que se presenta una asociación entre un polimorfismo en el gen COL1A1 y la DMO junto con datos experimentales que muestran diferencias específicas de alelo.The polymorphism -1997 G / T was found to be significantly associated with BMD of the lumbar spine (p = 0.019), and BMD of the femoral neck (p = 0.044), in 256 and 146 cases respectively, of the cohort of Spanish women postmenopausal. It was shown that the oligonucleotide containing the polymorphic site is capable of binding to osteoblast nuclear factors, and this new binding site was called PCOL2. Interestingly, the binding was much stronger when the reverse single stranded probe was used, which suggests the involvement of a single stranded DNA binding protein. The two alleles of this polymorphism have different binding capacities. It will be important to test by functional tests if these differences result in different levels of transcription. If so, they could be the cause of the association found in this invention between -1997 G / T polymorphism and BMD. This is the first time that there is an association between a polymorphism in the COL1A1 gene and BMD along with experimental data showing specific allele differences.
Sobre el deseguilibrio de ligamiento entre los alelos de los sitios -1663 indeIT y Sp1On the linkage imbalance between alleles of sites -1663 indeIT and Sp1
El polimorfismo -1663indelT corresponde a la deleción de una T en una serie de 8 residuos T situada entre las posiciones -1670 y -1663. Se demostró que este cambio también cae dentro de un sitio de unión de proteínas nucleares de osteoblasto (denominado PCOL1), que esta unión es específica y que el/los factor/es nuclear/es involucrados se unen sólo a la cadena sencilla portadora de las Ts. En los experimentos presentados en esta invención el polimorfismo -1663indelT no mostró una asociación significativa a la DMO aunque su interacción con el -1997 G/T sí lo hizo (p = 0,019). De manera interesante los alelos en -1663indelT están en un fuerte desequilibrio de ligamiento (p < 10"50) con aquellos del sitio polimórfico Sp1 anteriormente descrito en el intrón 1 (US 5.922.542 y S.F. Grant y col., Nat. Genet. 1996, vol. 14, pp. 203-5). Tampoco se encontró asociación entre Sp1 y la DMO. Este fuerte desequilibrio de ligamiento detectado entre los alelos de -The polymorphism -1663indelT corresponds to the deletion of a T in a series of 8 residues T located between the positions -1670 and -1663. It was shown that this change also falls within a nuclear protein binding site of osteoblast (called PCOL1), that this union is specific and that the nuclear factor / is involved bind only to the single carrier chain of Ts. In the experiments presented in this invention the -1663indelT polymorphism did not show a significant association with BMD although its interaction with the -1997 G / T did (p = 0.019). Interestingly, the alleles in -1663indelT are in a strong linkage imbalance (p <10 "50 ) with those of the Sp1 polymorphic site previously described in intron 1 (US 5,922,542 and SF Grant et al., Nat. Genet. 1996, vol. 14, pp. 203-5) Nor was an association found between Sp1 and BMD, this strong linkage imbalance detected between the alleles of -
1663indelT y de Sp1 sugiere que -1663indelT contribuye al efecto de Sp1 que se ha detectado en algunas poblaciones.1663indelT and Sp1 suggests that -1663indelT contributes to the effect of Sp1 that has been detected in some populations.
Sobre la interacción entre los sitios polimórficosOn the interaction between polymorphic sites
Se observó que hay una interacción significativa entre -1997 G/T y - 1663indelT (o Sp1). Esto se observa fácilmente en la FIG. 2: Los individuos heterocigotos para -1663indelT (ID) pueden dividirse en dos grupos (C y D) de valores de media de DMO extremos de acuerdo con el genotipo en -1997. Por otro lado, los individuos homocigotos para el alelo -1663-1 (grupos A y B) tienen la misma media de la DMO independientemente del genotipo en -1997. It was observed that there is a significant interaction between -1997 G / T and - 1663indelT (or Sp1). This is easily seen in FIG. 2: Heterozygous individuals for -1663indelT (ID) can be divided into two groups (C and D) of extreme mean BMD values according to the genotype in -1997. On the other hand, homozygous individuals for the -1663-1 allele (groups A and B) have the same mean of BMD regardless of genotype in -1997.

Claims

REIVINDICACIONES
1. Método de diagnóstico de la predisposición de un individuo humano a la osteoporosis o a una probabilidad elevada de tener baja densidad mineral ósea (DMO), que comprende la detección, en un tejido o muestra de fluido separada de dicho individuo, de la presencia de un polimorfismo seleccionado del grupo formado por un polimorfismo indeIT entre las posiciones -1663 y -1670, y un polimorfismo de G a T en la posición -1997, en una región reguladora del gen COL1A1.1. Method of diagnosis of the predisposition of a human individual to osteoporosis or a high probability of having low bone mineral density (BMD), which comprises the detection, in a tissue or fluid sample separated from said individual, of the presence of a polymorphism selected from the group formed by an indeIT polymorphism between positions -1663 and -1670, and a polymorphism from G to T at position -1997, in a regulatory region of the COL1A1 gene.
2. Método según la reivindicación 1 , donde el polimorfismo es un cambio de G a T en la posición -1997 en una región reguladora del gen COL1A1.2. The method according to claim 1, wherein the polymorphism is a change from G to T at the -1997 position in a regulatory region of the COL1A1 gene.
3. Método según la reivindicación 2, donde el polimorfismo se detecta usando cebadores de PCR que amplifican un fragmento de ADN, fragmento que comprende al nucleótido de la posición -1997 en una región reguladora del gen COL1A1.3. A method according to claim 2, wherein the polymorphism is detected using PCR primers that amplify a DNA fragment, a fragment comprising the nucleotide of the -1997 position in a regulatory region of the COL1A1 gene.
4. Método según la reivindicación 3, donde los cebadores de PCR tienen las secuencias SEQ ID NO: 5 y SEQ ID NO: 6.4. Method according to claim 3, wherein the PCR primers have the sequences SEQ ID NO: 5 and SEQ ID NO: 6.
5. Método según la reivindicación 1 , donde el polimorfismo es un polimorfismo indel T entre las posiciones -1663 y -1670 en una región reguladora del gen COL1A1.5. Method according to claim 1, wherein the polymorphism is an indel T polymorphism between positions -1663 and -1670 in a regulatory region of the COL1A1 gene.
6. Método según la reivindicación 5, donde el polimorfismo se detecta utilizando cebadores de PCR que amplifican un fragmento de ADN, fragmento que comprende a los nucleótidos en las posiciones -1663 a -1670 de una región reguladora del gen COL1A1.6. A method according to claim 5, wherein the polymorphism is detected using PCR primers that amplify a DNA fragment, a fragment comprising nucleotides at positions -1663 to -1670 of a regulatory region of the COL1A1 gene.
7. Método según la reivindicación 6, donde los cebadores de PCR tienen las secuencias SEQ ID NO: 2 y SEQ ID NO: 3.7. Method according to claim 6, wherein the PCR primers have the sequences SEQ ID NO: 2 and SEQ ID NO: 3.
8. ADN aislado que comprende una región reguladora del gen COL1A1 en la que: una guanosina en la posición -1997 se ha sustituido por una timidina, y/o una serie de 8 timidinas en el intervalo de -1663 a -1670 se ha sustituido por una serie de 7 timidinas en el intervalo de -1663 a -1669. 8. Isolated DNA comprising a regulatory region of the COL1A1 gene in which: a guanosine in the -1997 position has been replaced by a thymidine, and / or a series of 8 thymidines in the range of -1663 to -1670 has been replaced for a series of 7 thymidines in the range of -1663 to -1669.
9. ADN según la reivindicación 8, en el que una guanosina en la posición -1997 se ha sustituido por timidina.9. DNA according to claim 8, wherein a guanosine in the -1997 position has been replaced by thymidine.
10. ADN según la reivindicación 9, que comprende la secuencia denominada SEQ ID NO: 4.10. DNA according to claim 9, comprising the sequence called SEQ ID NO: 4.
11. ADN según la reivindicación 8, en la que una serie de 8 timidinas en el intervalo de -1663 a -1670 se han sustituido por una serie de 7 timidinas en el intervalo de -1663 a -1669.11. DNA according to claim 8, wherein a series of 8 thymidines in the range of -1663 to -1670 have been replaced by a series of 7 thymidines in the range of -1663 to -1669.
12. ADN según la reivindicación 11 , que comprende la secuencia denominada SEQ ID NO: 1.12. DNA according to claim 11, comprising the sequence called SEQ ID NO: 1.
13. Método de terapia para la osteoporosis que comprende: ensayar la predisposición genética de un individuo humano a la osteoporosis; y, si dicha predisposición se identifica, tratar a ese individuo para prevenir o reducir la osteoporosis, o para retrasar la aparición de la osteoporosis, donde la predisposición a la osteoporosis se correlaciona con un polimorfismo del gen COL1A1 de dicho individuo, seleccionado del grupo formado por un polimorfismo de G a T en la posición -1997 de una región reguladora del gen COL1A1 , y un polimorfismo indel T entre las posiciones -1663 y -1670 de una región reguladora del gen COL1A1.13. Osteoporosis therapy method comprising: testing the genetic predisposition of a human individual to osteoporosis; and, if said predisposition is identified, treating that individual to prevent or reduce osteoporosis, or to delay the onset of osteoporosis, where the predisposition to osteoporosis correlates with a polymorphism of the COL1A1 gene of said individual, selected from the group formed by a polymorphism of G to T at position -1997 of a regulatory region of the COL1A1 gene, and an indel T polymorphism between positions -1663 and -1670 of a regulatory region of the COL1A1 gene.
14. Método según la reivindicación 13, donde la predisposición a la osteoporosis se correlaciona con un polimorfismo de G a T en la posición -1997 de una región reguladora del gen COL1A1.14. A method according to claim 13, wherein the predisposition to osteoporosis correlates with a G to T polymorphism in the -1997 position of a regulatory region of the COL1A1 gene.
15. Método según la reivindicación 14, donde el tratamiento del individuo se hace por terapia de sustitución hormonal.15. Method according to claim 14, wherein the treatment of the individual is done by hormone replacement therapy.
16. Método según la reivindicación 14, donde el tratamiento del individuo se hace con un agente anti-osteoporótico seleccionado del grupo formado por: bisfosfonatos, moduladores selectivos de receptores de estrógenos, calcio, metabolitos de la vitamina D y hormona paratiroidea.16. Method according to claim 14, wherein the treatment of the individual is done with an anti-osteoporotic agent selected from the group consisting of: bisphosphonates, selective estrogen receptor modulators, calcium, vitamin D metabolites and parathyroid hormone.
17. Método según la reivindicación 13, donde la predisposición a la osteoporosis se correlaciona con un polimorfismo indel T entre las posiciones -1663 y -1670 de una región reguladora del gen COL1A1.17. Method according to claim 13, wherein the predisposition to the Osteoporosis correlates with an indel T polymorphism between positions -1663 and -1670 of a regulatory region of the COL1A1 gene.
18. Método según la reivindicación 17, donde el tratamiento del individuo se hace por terapia de sustitución hormonal.18. Method according to claim 17, wherein the treatment of the individual is done by hormone replacement therapy.
19. Método según la reivindicación 17, donde el tratamiento del individuo se hace con un agente anti-osteoporótico seleccionado del grupo formado por: bisfosfonatos, moduladores selectivos de receptores de estrógenos, calcio, metabolitos de la vitamina D y hormona paratiroidea.19. Method according to claim 17, wherein the treatment of the individual is done with an anti-osteoporotic agent selected from the group consisting of: bisphosphonates, selective estrogen receptor modulators, calcium, vitamin D metabolites and parathyroid hormone.
20. Par de cebadores de PCR que amplifican un fragmento de ADN de la región reguladora del gen COL1A1 , donde el fragmento de ADN amplificado es de una longitud de hasta 800 pares de bases y la posición nucleotídica -1997 de la región reguladora del gen COL1A1 está sustancialmente hacia el medio del fragmento de ADN.20. Pair of PCR primers that amplify a DNA fragment from the regulatory region of the COL1A1 gene, where the amplified DNA fragment is up to 800 base pairs in length and the nucleotide position -1997 of the regulatory region of the COL1A1 gene It is substantially towards the middle of the DNA fragment.
21. Cebador de PCR seleccionado del grupo formado por SEQ ID NO: 5 y SEQ ID NO: 6.21. PCR primer selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6.
22. Kit de diagnóstico de la predisposición de un individuo humano a la osteoporosis, o de una probabilidad elevada de tener baja densidad mineral ósea (DMO), que comprende un par de cebadores según la reivindicación 20.22. Diagnostic kit for the predisposition of a human individual to osteoporosis, or a high probability of having low bone mineral density (BMD), comprising a pair of primers according to claim 20.
23. Par de cebadores de PCR que amplifican un fragmento de ADN de la región reguladora del gen COL1 A1 , donde el fragmento de ADN amplificado es de una longitud de hasta 800 pares de bases y la posición nucleotídica -1663 de la región reguladora del gen COL1A1 está sustancialmente hacia el medio del fragmento de ADN.23. Pair of PCR primers that amplify a DNA fragment from the regulatory region of the COL1 A1 gene, where the amplified DNA fragment is up to 800 base pairs in length and the nucleotide position -1663 of the regulatory region of the gene COL1A1 is substantially towards the middle of the DNA fragment.
24. Cebador de PCR seleccionado del grupo formado por SEQ ID NO: 2 y SEQ ID NO: 3.24. PCR primer selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 3.
25. Kit de diagnóstico de la predisposición de un individuo humano a la osteoporosis, o de una probabilidad elevada de tener baja densidad mineral ósea (DMO), que comprende un par de cebadores según la reivindicación 23. 25. Diagnostic kit for the predisposition of a human individual to osteoporosis, or a high probability of having low bone mineral density (BMD), comprising a pair of primers according to claim 23.
PCT/ES2003/000034 2002-01-25 2003-01-23 Compounds that are used to diagnose a predisposition to osteoporosis WO2003062465A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP200200261 2002-01-25
ES200200261 2002-01-25

Publications (1)

Publication Number Publication Date
WO2003062465A1 true WO2003062465A1 (en) 2003-07-31

Family

ID=27589320

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2003/000034 WO2003062465A1 (en) 2002-01-25 2003-01-23 Compounds that are used to diagnose a predisposition to osteoporosis

Country Status (1)

Country Link
WO (1) WO2003062465A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2521793A2 (en) * 2010-01-06 2012-11-14 University of Florida Research Foundation, Inc. Methods and kits for detecting risk factors for development of jaw osteonecrosis and methods of treatment thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011149A1 (en) * 1991-12-03 1993-06-10 Thomas Jefferson University Methods of detecting a genetic predisposition for osteoporosis
WO1997032041A1 (en) * 1996-02-29 1997-09-04 Gemini Research Ltd. Determination of collagen genotype

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011149A1 (en) * 1991-12-03 1993-06-10 Thomas Jefferson University Methods of detecting a genetic predisposition for osteoporosis
WO1997032041A1 (en) * 1996-02-29 1997-09-04 Gemini Research Ltd. Determination of collagen genotype

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DALGLEISH R.: "The huan type I collagen mutation database", NUCLEIC ACIDS RESEARCH, vol. 25, no. 1, 1997, pages 181 - 187 *
DIETZSCH E. ET AL.: "CA repeat polymorphism in the promoter region of the COL 1A2 gene", JOURNAL OF HUMAN GENETICS, vol. 44, no. 6, 1999, pages 419 - 420 *
GARCIA GIRALT N. ET AL.: "A new SNP in the upstream regulatory region of COL 1A1 is associated with BMD in perimenopausal women from Spain", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 15, no. SUPPL. 1, 2000, pages S490 *
GARCIA GIRALT N. ET AL.: "Two new single-nucleotide polymorphisms in the COL 1A1 upstream regulatory region and their relationship to bone mineral density", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 17, no. 3, 2002, pages 384 - 393 *
JIMENEZ S.A. ET AL.: "Functional analysis of human alpha1 (I) procollagen gene promoter", THE JORNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 17, 1994, pages 12684 - 12691 *
MANN V. ET AL.: "A COL 1A1 SP1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality", JOURNAL OF CLINICAL INVESTIGATION, vol. 107, no. 7, 2001, pages 899 - 907, XP002286258, DOI: doi:10.1172/JCI10347 *
NOGUES X. ET AL.: "Linkage disequilibrium between COL 1A1 Sp 1 and a new 1bp deletion polymorphism in the upstream regulatory region of the gene in Spanish perimenopausal women", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 15, no. SUPPL. 1, 2000, pages S490 *
SPOTILA L.D. ET AL.: "Mutation analysis of cloning sequences for type I procollagen in individuals with low bone density", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 9, no. 6, 1994, pages 923 - 931, XP002035051 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2521793A2 (en) * 2010-01-06 2012-11-14 University of Florida Research Foundation, Inc. Methods and kits for detecting risk factors for development of jaw osteonecrosis and methods of treatment thereof
EP2521793A4 (en) * 2010-01-06 2013-07-03 Univ Florida Methods and kits for detecting risk factors for development of jaw osteonecrosis and methods of treatment thereof

Similar Documents

Publication Publication Date Title
Stopkova et al. Identification of PIK3C3 promoter variant associated with bipolar disorder and schizophrenia
ES2660818T3 (en) Genetic markers to predict the responsiveness to a compound of FGF-18
JP6679486B2 (en) Genetic markers associated with suicide risk and methods of use thereof
Robles-Osorio et al. Genetic heterogeneity of autosomal dominant hypercholesterolemia in Mexico
Li et al. Mutation identification of the DSPP in a Chinese family with DGI-II and an up-to-date bioinformatic analysis
Tao et al. HepG2/erythrocyte glucose transporter (GLUT1) gene in NIDDM: a population association study and molecular scanning in Japanese subjects
US20100028924A1 (en) Method Of Diagnosing Pon1-Hdl Associated Lipid Disorders
Adamzik et al. A novel-1364A/C aquaporin 5 gene promoter polymorphism influences the responses to salt loading of the renin-angiotensin-aldosterone system and of blood pressure in young healthy men
US9567637B2 (en) Association of HTRA1 mutations and familial ischemic cerebral small-vessel disease
US20060141472A1 (en) Medical use of ras antagonists for the treatment of capillary malformation
ES2340459B1 (en) METHOD FOR DIAGNOSING OR DETERMINING THE GENETIC PREDISPOSITION TO DEVELOP HYPERTROPHIC MIOCARDIOPATIA.
CN101809168A (en) Use of CLEC1B for the determination of cardiovascular and thrombotic risk
Lindahl et al. Heterozygosity for a coding SNP in COL1A2 confers a lower BMD and an increased stroke risk
Lachman et al. Analysis of synapsin III–196 promoter mutation in schizophrenia and bipolar disorder
WO2003062465A1 (en) Compounds that are used to diagnose a predisposition to osteoporosis
WO2016100745A2 (en) Methods and compositions related to transplant-associated thrombotic microangiopathy
ES2449152T3 (en) In vitro diagnostic procedure for skin cancer
CA2793210A1 (en) Determining susceptibility to a sudden cardiac event
US20070190528A1 (en) Method of judging imflammatory disease by using single nucleotide polymorphism in galectin -2 gene
CA2664366C (en) Slc1a1 antipsychotic drug response markers
Oh et al. Association between common genetic variants of α2A-, α2B-, and α2C-adrenergic receptors and ischemic stroke
US7101666B2 (en) Involvement of the BDNF gene in mood disorders
JP2008534019A (en) Human Neimanpic C1-like 1 gene (NPC1L1) polymorphism and method of use thereof
Naganuma et al. Haplotype-based case–control study between human apurinic/apyrimidinic endonuclease 1/redox effector factor-1 gene and cerebral infarction
Kuznetsov et al. Genetic markers of idiopathic and congenital scoliosis, and diagnosis of susceptibility to the disease: review of the literature

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP