WO2003061520A2 - Methodes de modulation de l'angiogenese - Google Patents

Methodes de modulation de l'angiogenese Download PDF

Info

Publication number
WO2003061520A2
WO2003061520A2 PCT/US2003/001749 US0301749W WO03061520A2 WO 2003061520 A2 WO2003061520 A2 WO 2003061520A2 US 0301749 W US0301749 W US 0301749W WO 03061520 A2 WO03061520 A2 WO 03061520A2
Authority
WO
WIPO (PCT)
Prior art keywords
shp
ptp
activity
retinopathy
expression
Prior art date
Application number
PCT/US2003/001749
Other languages
English (en)
Other versions
WO2003061520A3 (fr
Inventor
Lloyd P. Aiello
Original Assignee
Joslin Diabetes Center, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Joslin Diabetes Center, Inc. filed Critical Joslin Diabetes Center, Inc.
Priority to AU2003217229A priority Critical patent/AU2003217229A1/en
Publication of WO2003061520A2 publication Critical patent/WO2003061520A2/fr
Publication of WO2003061520A3 publication Critical patent/WO2003061520A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G01N2800/164—Retinal disorders, e.g. retinopathy

Definitions

  • Pathologic angiogenesis is a major cause of morbidity associated with numerous diseases. In the normal adult eye, the vasculature is quiescent. This stable condition presumably results from a delicate balance of endogeneous angiogenic agonists and inhibitors. 1 Suppression of angiogenesis and maintenance of vascular integrity are critical in the eye so as to maintain optical clarity and function of ocular structures such as the cornea, lens, vitreous and retina. However, unregulated angiogenesis or vascular leakage can occur in numerous ocular disorders including retinopathies.
  • Intraocular angiogenesis appears to be predominantly mediated by the endothelial cell-selective mitogen referred to as either vascular endothelial growth factor (NEGF) or vascular permeability factor (NPF).
  • NEGF vascular endothelial growth factor
  • NPF vascular permeability factor
  • Increased intraocular concentrations of NEGF are associated with intraocular neovascularization or retinal vascular leakage due to diabetic retinopathy, diabetic macular edema, age related macular degeneration, retinal vein occlusion, and retinopathy of prematurity.
  • NEGF vascular endothelial growth factor
  • NPF vascular permeability factor
  • PEDF was originally purified from human retinal pigment epithelial cells as an inducer of neuronal differentiation in Y79 retinoblastoma cells 21 ' 22 and shares protein sequence homology with serine protease inhibitors (SERPT ⁇ family) although it does not actually inhibit serine proteases.
  • SERPT ⁇ serine protease inhibitors
  • ' PEDF is down-regulated by hypoxia, 20 inhibits microglial growth and is neurotrophic for cerebellar granule cells.
  • EPC-1 early population doubling level cDNA
  • PEDF inhibits basic fibroblast growth factor (bFGF) mediated corneal vascularization and suppresses proliferation of cultured capillary endothelial cells in response to bFGF, platelet-derived growth factor, NEGF, interleukin-8, acidic fibroblast growth factor and lysophosphatidic acid.
  • bFGF basic fibroblast growth factor
  • NEGF platelet-derived growth factor
  • NEGF interleukin-8
  • acidic fibroblast growth factor and lysophosphatidic acid.
  • the invention is based, in part, on the discovery that protein tyrosine phosphatases (PTPs), e.g., SH2 domain-containing PTPs, e.g., SHP-1 and SHP-2, are targets for the diagnosis and treatment of angiogenesis related disorders, e.g., angiogenesis related ocular disorders, e.g., angiogenesis related ocular disorders described herein.
  • PTPs protein tyrosine phosphatases
  • SH2 domain-containing PTPs e.g., SHP-1 and SHP-2
  • PTPs protein tyrosine phosphatases
  • SHP-1 and SHP-2 protein tyrosine phosphatases
  • PEDF has been found to inhibit NEGF-induced phosphorylation, e.g., tyrosine phosphorylation, of NEGF receptor (e.g., KDR/NEGF-R2) thereby blocking association of the receptor with downstream components of the NEGF signaling pathway.
  • NEGF receptor e.g., KDR/NEGF-R2
  • PEDF modulates the association of a NEGF receptor, e.g., VEGFR-2 (KDR), with protein tyrosine phosphatases (PTPs), e.g., SH2 domain-containing PTPs, e.g., SHP-1 or SHP-2.
  • KDR VEGFR-2
  • PTPs protein tyrosine phosphatases
  • PEDF has been found to increase the association of NEGF receptor with an inhibitory phosphatase, e.g., SHP-1, and to decrease association of NEGF receptor with an enhancing phosphatase, e.g., SHP-2, thereby resulting in decreased phosphorylation of the NEGF receptor upon NEGF binding. While not wanting to be bound by theory, the suppression of NEGF receptor phosphorylation is believed to inhibit various downstream NEGF signaling events, thereby inhibiting VEGF-mediated angiogenesis, e.g., in the eye.
  • an inhibitory phosphatase e.g., SHP-1
  • an enhancing phosphatase e.g., SHP-2
  • SHP-1 acts, under normal, e.g., non-disease, conditions, as an inhibitory phosphatase, e.g., a NEGF-signaling inhibitory phosphatase; and SHP-2 acts as a stimulatory phosphatase, e.g., a NEGF-signaling stimulatory phosphatase.
  • inhibitory phosphatase e.g., a NEGF-signaling inhibitory phosphatase
  • SHP-2 acts as a stimulatory phosphatase, e.g., a NEGF-signaling stimulatory phosphatase.
  • other PTPs may be involved as well.
  • the invention features a method of modulating angiogenesis, e.g., in a tissue, e.g., a tissue explant (e.g., an eye explant) or a subject, e.g., in an eye of a subject.
  • the method includes modulating a phosphatase, e.g., a protein tyrosine phosphatase (PTPs), e.g., an SH2 domain-containing PTP, e.g., SHP- 1 or SHP-2, to thereby modulate angiogenesis.
  • a phosphatase e.g., a protein tyrosine phosphatase (PTPs), e.g., an SH2 domain-containing PTP, e.g., SHP- 1 or SHP-2
  • the method includes: optionally, identifying a tissue or subject in need of having angiogenesis modulated, and administering to the tissue or subject an agent that modulates the activity of a phosphatase, e.g., a protein tyrosine phosphatase (PTPs), e.g., an SH2 domain-containing PTP, e.g., SHP-1 or SHP-2.
  • a phosphatase e.g., a protein tyrosine phosphatase (PTPs), e.g., an SH2 domain-containing PTP, e.g., SHP-1 or SHP-2.
  • the subject is preferably a mammal, e.g., a primate, e.g., an ape or a human; a rodent, e.g., a rat, mouse, or an animal model for an angiogenesis related disorder, e.g., an animal model for retinopathy.
  • the tissue is an eye
  • the method includes administering a compound other than PEDF. In some embodiments, the method does not include administering or modulating PEDF.
  • the animal model is an animal model of retinopathy of prematurity, e.g., as described in Perm et al. (2001) Invest Ophthalmol Vis Sci 42:283-90.
  • the agent promotes, increases or mimics expression, levels, or activity of an inhibitory PTP, e.g., SHP-1, to thereby decrease unwanted or aberrant angiogenesis, e.g., in the eye.
  • An agent that promotes, increases or mimics expression, levels, or activity of an inhibitory PTP, e.g., SHP-1 can be one or more of: a PTP polypeptide, e.g., SHP-1 polypeptide, or a functional fragment or variant thereof (e.g., an SHP-1 variant having increased or constitutive SHP-1 activity, e.g., phosphatase activity, e.g., an SHP-1 mutant having one or more activating mutations in the N terminal SH2 domain); a peptide or protein agonist of a PTP, e.g., SHP-1, that increases the activity, e.g., the phosphatase activity or phosphotyrosme binding activity, of SHP-1; a small molecule that increases expression of
  • the nucleotide sequence can be a genomic sequence or a cD ⁇ A sequence.
  • the nucleotide sequence can include: an SHP-1 coding region; a promoter sequence, e.g., a promoter sequence from an SHP-1 gene or from another gene; an enhancer sequence; untranslated regulatory sequences, e.g., a 5' untranslated region (UTR), e.g., a 5'UTR from an SHP-1 gene or from another gene, a 3' UTR, e.g., a 3'UTR from an SHP-1 gene or from another gene; a polyadenylation site; an insulator sequence.
  • UTR 5' untranslated region
  • the level of SHP-1 protein is increased by increasing the level of expression of an endogenous SHP-1 gene, e.g., by increasing transcription of the SHP-1 gene or increasing SHP-1 mR ⁇ A stability.
  • transcription of the SHP-1 gene is increased by: altering the regulatory sequence of the endogenous SHP-1 gene, e.g., by the addition of a positive regulatory element (such as an enhancer or a D ⁇ A-binding site for a transcriptional activator); the deletion of a negative regulatory element (such as a D ⁇ A-binding site for a transcriptional repressor) and/or replacement of the endogenous regulatory sequence, or elements therein, with that of another gene, thereby allowing the coding region of the SHP-1 gene to be transcribed more efficiently.
  • a positive regulatory element such as an enhancer or a D ⁇ A-binding site for a transcriptional activator
  • a negative regulatory element such as a D ⁇ A-binding site for a transcriptional repressor
  • the agent inhibits the expression, levels, or activity of a stimulatory PTP, e.g., SHP-2, to thereby decrease angiogenesis, e.g., in the eye.
  • An agent that decreases the expression, levels, or activity of a stimulatory PTP, e.g., SHP- 2 can be one or more of: a PTP, e.g., SHP-2, binding protein, e.g., a soluble SHP-2 binding protein (e.g., a phosphotyrosme containing or mimicking peptide) that binds and inhibits a SHP-2 activity, e.g., phosphotyrosme binding activity or phosphatase activity; an antibody or antigen binding fragment thereof that specifically binds to the SHP-2 protein, e.g., an antibody that disrupts SHP-2's ability to bind a binding partner, e.g., disrupts the ability of SHP-2 to bind a phosphorylated NEGF-R;
  • SHP-2 is inhibited by decreasing the level of expression of an endogenous SHP-2 gene, e.g., by decreasing transcription of the SHP-2 gene.
  • transcription of the SHP-2 gene can be decreased by: altering the regulatory sequences of the endogenous SHP-2 gene, e.g., by the addition of a negative regulatory sequence (such as a D ⁇ A-biding site for a transcriptional repressor), or by the removal of a positive regulatory sequence (such as an enhancer or a D ⁇ A-binding site for a transcriptional activator).
  • the administration of the agent can be initiated, e.g., (a) when the subject begins to show signs of unwanted vascularization, e.g., in the eye, e.g., as evidenced by an increase of more than 5, 10, 20, or 30% in vascularization compared to a reference value, e.g., control, e.g., a non-disease state control; (b) when an angiogenesis related disease, e.g., retinopathy, e.g., diabetic retinopathy, is diagnosed; (c) before, during or after a treatment for an angiogenesis related disorder, e.g., retinopathy, is begun or begins to exert its effects; or (d) generally, as is needed to maintain health, e.g., ocular health, e.g., throughout the natural aging process.
  • a reference value e.g., control, e.g., a non-disease state control
  • an angiogenesis related disease e.g.,
  • the period over which the agent is administered can be long term, e.g., for six months or more or a year or more, or short term, e.g., for less than a year, six months, one month, two weeks or less.
  • the subject e.g., the mammal
  • exhibits unwanted vascularization in the eye e.g., the mammal has a retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation- induced disorder.
  • SHP-1 activity, levels or expression is modulated, e.g., increased, in the eye.
  • SHP-2 activity, levels or expression is modulated, e.g., decreases, in the eye.
  • a pharmaceutical composition including one or more of the agents described herein is administered in a pharmaceutically effective dose.
  • a pharmaceutical composition including one or more of the agents described herein is administered in a therapeutically effective dose.
  • the subject is a human.
  • the invention features a method of treating a subject, e.g., treating an angiogenesis related disorder, e.g., an angiogenesis related ocular disorder, e.g., retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity; neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder, in a subject.
  • an angiogenesis related disorder e.g., an angiogenesis related ocular disorder, e.g., retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity
  • neovascular glaucoma corneal neovascularization
  • the method includes (a) optionally, identifying a subject having or at risk for an ocular disorder, e.g., an angiogenesis-related ocular disorder, e.g., an angiogenesis-related ocular disorder described herein, and (b) modulating a phosphatase, e.g., a protein tyrosine phosphatase (PTP), e.g., an SH2 domain-containing PTP, e.g., SHP-1 or SHP-2, to thereby treat the subject.
  • a phosphatase e.g., a protein tyrosine phosphatase (PTP), e.g., an SH2 domain-containing PTP, e.g., SHP-1 or SHP-2
  • the method includes administering to the subject an agent that modulates a phosphatase, e.g., a protein tyrosine phosphatase (PTPs), e.g., an SH2 domain-containing PTP, e.g., SHP-1 or SHP-2.
  • PTP protein tyrosine phosphatase
  • the PTP is preferably modulated in the eye.
  • the agent promotes, increases or mimics expression, levels, or activity of an inhibitory PTP, e.g., SHP-1, to thereby decrease unwanted or aberrant angiogenesis, e.g., in the eye.
  • An agent that promotes, increases or mimics expression, levels, or activity of an inhibitory PTP can be one or more of: an PTP, e.g., SHP-1 polypeptide or a functional fragment or variant thereof (e.g., an SHP-1 variant having increased or constitutive SHP-1 activity, e.g., phosphatase activity, e.g., an SHP-1 mutant having one or more activating mutations in the N terminal SH2 domain); a peptide or protein agonist of a PTP, e.g., SHP-1, that increases the activity, e.g., the phosphatase activity or phosphotyrosme binding activity, of SHP-1; a small molecule that increases expression of PTP, e.g., SHP-1, e.g., by binding to the promoter region of the SHP-1 gene; an antibody, e.g., an antibody or antigen binding fragment thereof that binds to and stabilizes or assists the binding of
  • the nucleotide sequence can be a genomic sequence or a cD ⁇ A sequence.
  • the nucleotide sequence can include: a PTP, e.g., SHP-1, coding region; a promoter sequence, e.g., a promoter sequence from an SHP-1 gene or from another gene; an enhancer sequence; untranslated regulatory sequences, e.g., a 5' untranslated region (UTR), e.g., a 5'UTR from an SHP-1 gene or from another gene, a 3' UTR, e.g., a 3'UTR from an SHP-1 gene or from another gene; a polyadenylation site; an insulator sequence.
  • a PTP e.g., SHP-1, coding region
  • a promoter sequence e.g., a promoter sequence from an SHP-1 gene or from another gene
  • an enhancer sequence e.g., untranslated regulatory sequences, e.g., a
  • the level of SHP-1 protein is increased by increasing the level of expression of an endogenous SHP-1 gene, e.g., by increasing transcription of the SHP-1 gene or increasing SHP-1 mR ⁇ A stability.
  • transcription of the SHP-1 gene is increased by: altering the regulatory sequence of the endogenous SHP-1 gene, e.g., by the addition of a positive regulatory element (such as an enhancer or a D ⁇ A-binding site for a transcriptional activator); the deletion of a negative regulatory element (such as a D ⁇ A-binding site for a transcriptional repressor) and/or replacement of the endogenous regulatory sequence, or elements therein, with that of another gene, thereby allowing the coding region of the SHP-1 gene to be transcribed more efficiently.
  • a positive regulatory element such as an enhancer or a D ⁇ A-binding site for a transcriptional activator
  • a negative regulatory element such as a D ⁇ A-binding site for a transcriptional repressor
  • the agent inhibits the expression, levels, or activity of a stimulatory PTP, e.g., SHP-2, to thereby decrease angiogenesis, e.g., in the eye.
  • An agent that decreases the expression, levels, or activity of a stimulatory PTP, e.g., SHP- 2 can be one or more of: a PTP, e.g., SHP-2, binding protein, e.g., a soluble SHP-2 binding protein (e.g., a phosphotyrosme containing or mimicking peptide) that binds and inhibits a SHP-2 activity, e.g., phosphotyrosme binding activity or phosphatase activity; an antibody or antigen binding fragment thereof that specifically binds to the SHP-2 protein, e.g., an antibody that disrupts SHP-2's ability to bind a binding partner, e.g., disrupts the ability of SHP-2 to bind a phosphorylated NEGF-R;
  • PTP e.g., SHP-2
  • gene expression e.g., a small molecule which binds the promoter of SHP-2 and decreases SHP-2 gene expression.
  • SHP-2 is inhibited by decreasing the level of expression of an endogenous SHP-2 gene, e.g., by decreasing transcription of the SHP-2 gene.
  • transcription of the SHP-2 gene can be decreased by: altering the regulatory sequences of the endogenous SHP-2 gene, e.g., by the addition of a negative regulatory sequence (such as a D ⁇ A-biding site for a transcriptional repressor), or by the removal of a positive regulatory sequence (such as an enhancer or a D ⁇ A-binding site for a transcriptional activator).
  • a negative regulatory sequence such as a D ⁇ A-biding site for a transcriptional repressor
  • a positive regulatory sequence such as an enhancer or a D ⁇ A-binding site for a transcriptional activator
  • the administration of the agent can be initiated, e.g., (a) when the subject begins to show signs of unwanted vascularization, e.g., in the eye, e.g., as evidenced by an increase of more than 5, 10, 20, or 30% in vascularization compared to a reference value, e.g., control, e.g., a non-disease state control; (b) when an angiogenesis related disease, e.g., retinopathy, e.g., diabetic retinopathy, is diagnosed; (c) before, during or after a treatment for an angiogenesis related disorder, e.g., retinopathy, is begun or begins to exert its effects; or (d) generally, as is needed to maintain health, e.g., ocular health, e.g., throughout the natural aging process.
  • a reference value e.g., control, e.g., a non-disease state control
  • an angiogenesis related disease e.g.,
  • the period over which the agent is administered can be long term, e.g., for six months or more or a year or more, or short term, e.g., for less than a year, six months, one month, two weeks or less.
  • the subject exhibits unwanted vascularization in the eye
  • the mammal has a retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • a retinopathy e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • SHP-1 activity, levels or expression is modulated, e.g., increased, in the eye.
  • SHP-2 activity, levels or expression is modulated, e.g., decreases, in the eye.
  • a pharmaceutical composition including one or more of the agents described herein is administered in a pharmaceutically effective dose.
  • a pharmaceutical composition including one or more of the agents described herein is administered in a therapeutically effective dose.
  • the subject is a non-human animal, e.g., an animal model of an angiogenesis related disorder, e.g., an angiogenesis related ocular disorder, e.g., an animal model of retinopathy of prematurity, e.g., as described in Penn et al. (2001) Invest Ophthalmol Vis Sci 42:283-90.
  • the subject is a mammal, e.g., a human.
  • the subject is at risk for or has diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation- induced disorder.
  • the methos also includes evaluating the subject for one or more of the following parameters: (1) vision; (2) glucose levels; (3) insulin levels.
  • the invention features a method of evaluating a subject, e.g., determining if a subject is at risk for, or has, an ocular disorder, e.g., retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • an ocular disorder e.g., retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • the method includes evaluating a protein phosphatase, e.g., protein tyrosine phosphatase (PTP), e.g., SHP-1 or SHP-2, activity, levels or expression in a cell or tissue, preferably in the eye, of the subject, and correlating abnormal or aberrant PTP activity, levels or expression in the subject as compared to a control, with the risk or presence of an ocular disorder (e.g., an ocular disorder described herein) in the subject.
  • PTP protein tyrosine phosphatase
  • the method can include providing a record, e.g., a print or computer readable material, e.g., an informational, diagnostic, or instructional material, e.g., to the subject, health care provider, or insurance company, identifying the abnormal or aberrant PTP activity as a risk or diagnostic factor for an ocular disorder.
  • a record e.g., a print or computer readable material, e.g., an informational, diagnostic, or instructional material, e.g., to the subject, health care provider, or insurance company, identifying the abnormal or aberrant PTP activity as a risk or diagnostic factor for an ocular disorder.
  • the method includes detecting a genetic lesion or mutation in a PTP gene, e.g., in the SHP-1 or SHP-2 gene.
  • the human SHP-1 sequence is known and published as GenBank accession number X62055, shown herein as SEQ ID NO:l (amino acid sequence) and SEQ ID NO:2 (cDNA sequence).
  • the human SHP-2 sequence is known and published as GenBank accession number L07527, incorporated herein as SEQ ID NO:3 (amino acid sequence) and SEQ ID NO:4 (cDNA sequence).
  • the method includes evaluating the level of expression of a PTP gene, e.g., evaluating the amount or half life of a PTP mRNA, e.g., SHP-1 or SHP-2 mRNA.
  • a PTP gene e.g., evaluating the amount or half life of a PTP mRNA, e.g., SHP-1 or SHP-2 mRNA.
  • Over- or under-expression of a PTP gene, compared to a control can be evaluated by, e.g., Northern blot, TaqMan assay, or other methods known in the art.
  • the method includes evaluating a PTP activity, e.g., phosphatase activity or substrate binding activity (e.g., pY binding activity).
  • a PTP activity e.g., phosphatase activity or substrate binding activity (e.g., pY binding activity).
  • the method includes evaluating protein levels of a PTP protein, e.g., of SHP- 1 or SHP-2 protein.
  • the method includes treating the subject for the ocular disorder.
  • the subject is further evaluated for one or more of the following parameters: (1) vision; (2) glucose levels; (3) insulin level.
  • the evaluation is used to choose a course of treatment.
  • Methods of the invention can be used prenatally or to determine if a subject's offspring will be at risk for a disorder.
  • the invention features a method of evaluating an agent, e.g., screening for an agent that modulates angiogenesis, e.g., in the eye.
  • the method includes (a) providing a test agent, (b) determining if the agent interacts with a PTP, e.g., binds to and/or modulates the levels, expression, or activity of a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2, e.g., determining if it modulates the ability of SHP-1 or SHP-2 to interact with a NEGF-R or other SHP-1 or SHP-2 ligand, and (c) correlating the ability of a test agent to modulate an SHP domain containing PTP with the ability to modulate angiogenesis.
  • a PTP e.g., binds to and/or modulates the levels, expression, or activity of a PTP, e.g., a PTP described herein,
  • Correlating means identifying a test agent that modulates an SHP domain containing PTP as an agent capable of modulating angiogenesis, e.g., providing a record, e.g., a print or computer readable record, such as a laboratory record or dataset, identifying a test agent that modulates an SHP domain containing PTP as an agent capable of modulating angiogenesis.
  • the record can include other information, such as a specific test agent identifier, a date, an operator of the method, or information about the source, structure, method of purification or biological activity of the test agent.
  • the record or information derived from the record can be used, e.g., to identify the test agent as a compound or lead compound for pharmaceutical or therapeutic use.
  • Agents, e.g., compounds, identified by this method can be used, e.g., in the treatment of an ocular disorder, e.g., a retinopathy, e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • a retinopathy e.g., diabetic retinopathy, proliferative diabetic retinopathy, age related macular degeneration, retinopathy of prematurity, neovascular glaucoma, corneal neovascularization, retinopathy associated with retinal vein occlusion, sickle cell retinopathy, or radiation-induced disorder.
  • the method includes: providing a PTP protein or nucleic acid, e.g., SHP-1 or SHP-2 protein or nucleic acid or a functional fragment thereof; contacting the PTP protein or nucleic acid with a test agent, and determining if the test compound interacts with, e.g., binds, the PTP protein or nucleic acid.
  • a PTP protein or nucleic acid e.g., SHP-1 or SHP-2 protein or nucleic acid or a functional fragment thereof.
  • the test agent binds to the PTP protein and modulates a PTP activity.
  • the compound binds to the PTP protein and facilitates or inhibits any of: phosphatase activity or substrate binding activity, e.g., pY binding activity.
  • Methods for assaying phosphatase activity or substrate binding activity, e.g., pY binding activity, e.g., methods described herein, are art-recognized.
  • the test compound is one or more of: a protein or peptide; an antibody; a small molecule; a nucleotide sequence.
  • the agent can be an agent identified through a library screen described herein.
  • the contacting step is performed in vitro.
  • the contacting step is performed in vivo.
  • the method further includes administering the test compound to an experimental animal, e.g., an animal model for an angiogenesis related disorder, e.g., an angiogenesis related ocular disorder, e.g., an angiogenesis related ocular disorder described herein, e.g., retinopathy, e.g., a retinopathy described herein.
  • an animal model is an animal model of retinopathy of prematurity, e.g., as described in Penn et al. (2001) Invest Ophthalmol Vis Sci 42:283-90.
  • the method includes: providing a test cell, tissue, or subject; administering a test agent to the cell, tissue, or subject; and determining whether the test agent modulates a PTP expression, level or activity in the cell, tissue, or subject.
  • An agent that is found to modulate a PTP, e.g., SHP-1 or SHP-2, in the cell, tissue, or subject is identified as an agent that can modulate angiogenesis or vascularization, e.g., neovascularization, in the subject, e.g., in the eye.
  • the cell is a retinal cell.
  • the method includes (a) providing a cell-free expression system, cell, tissue, or animal having a transgene which includes a nucleic acid that encodes a reporter molecule functionally linked to the control region, e.g., a promoter, of a gene encoding a PTP, e.g., SHP-1 or SHP-2; (b) contacting the cell- free expression system, cell, tissue, or animal with a test agent; and (c) evaluating a signal produced by the reporter molecule.
  • a test agent that causes the modulation of reporter molecule expression, compared to a reference, e.g., a negative control, is identified as an agent that can modulate angiogenesis, e.g., in the eye.
  • Preferred agents increase expression of a PTP, e.g., an inhibitory PTP described herein, or decrease expression where the reporter molecule is under the control of a control region from a gene encoding an activating PTP, e.g., an activating PTP described herein.
  • the reporter molecule is any of: green fluorescent protein (GFP); enhanced GFP (EGFP); luciferase; chloramphenicol acetyl transferase (CAT); ⁇ -galactosidase; ⁇ -lactamase; or secreted placental alkaline phosphatase.
  • GFP green fluorescent protein
  • EGFP enhanced GFP
  • CAT chloramphenicol acetyl transferase
  • ⁇ -galactosidase ⁇ -lactamase
  • secreted placental alkaline phosphatase secreted placental alkaline phosphatase.
  • Other reporter molecules e.g., other enzymes whose function can be detected by appropriate chromogenic or fluorogenic substrates are known to those skilled in the art.
  • the agent is further tested in a cell-based and/or animal based model e.g., a cell based or animal model described herein.
  • the invention features a computer readable record encoded with (a) a subject identifier, e.g., a patient identifier, (b) one or more results from an evaluation of the subject, e.g., a diagnostic evaluation described herein, e.g., the level of expression, level or activity of a PTP, e.g., SHP-1 or SHP-2, in the subject, and optionally (c) a value for or related to a disease state, e.g., a value correlated with disease status or risk with regard to an ocular disorder, e.g., an ocular disorder described herein.
  • the invention features a computer medium having a plurality of digitally encoded data records.
  • Each data record includes a value representing the level of expression, level or activity of a PTP, e.g., SHP-1 or SHP-2, in a sample, and a descriptor of the sample.
  • the descriptor of the sample can be an identifier of the sample, a subject from which the sample was derived (e.g., a patient), a diagnosis, or a treatment (e.g., a preferred treatment).
  • the data record further includes values representing the level of expression, level or activity of genes other than a PTP, e.g., SHP-1 or SHP-2 (e.g., other genes associated with an ocular disorder, or other genes on an array).
  • the data record can be structured as a table, e.g., a table that is part of a database such as a relational database (e.g., a SQL database of the Oracle or Sybase database environments).
  • the invention also includes a method of communicating information about a subject, e.g., by transmitting information, e.g., transmitting a computer readable record described herein, e.g., over a computer network.
  • the invention features a method of providing information, e.g., for making a decision with regard to the treatment of a subject having, or at risk for, an ocular disorder described herein.
  • the method includes (a) evaluating the expression, level or activity of a PTP, e.g., SHP-1 or SHP-2; optionally (b) providing a value for the expression, level or activity of a PTP, e.g., SHP-1 or SHP-2; optionally (c) comparing the provided value with a reference value, e.g., a control or non-disease state reference or a disease state reference; and optionally (d) based, e.g., on the relationship of the provided value to the reference value, supplying information, e.g., information for making a decision on or related to the treatment of the subject.
  • a reference value e.g., a control or non-disease state reference or a disease state reference
  • supplying information e.g., information for making
  • the provided value relates to an activity described herein, e.g., to a phosphatase activity of a PTP, e.g., SHP-1 or SHP-2; or a binding activity, e.g., apY binding activity.
  • a PTP e.g., SHP-1 or SHP-2
  • a binding activity e.g., apY binding activity.
  • the decision is whether to administer a preselected treatment.
  • the decision is whether a party, e.g., an insurance company, HMO, or other entity, will pay for all or part of a preselected treatment.
  • a party e.g., an insurance company, HMO, or other entity
  • the method includes providing a sample, e.g., from the subject, and determining a gene expression profile of the sample, wherein the profile includes a value representing the level of expression of a PTP, e.g., SHP-1 or SHP-2.
  • the method can further include comparing the value or the profile (i.e., multiple values) to a reference value or reference profile.
  • the gene expression profile of the sample can be obtained by methods known in the art (e.g., by providing a nucleic acid from the sample and contacting the nucleic acid to an array).
  • the method can be used to diagnose an ocular disorder, e.g., an ocular disorder described herein, in a subject wherein misexpression of a PTP, e.g., SHP-1 or SHP-2, e.g., an increase in expression of an activating PTP, or a decrease in expression of an inhibitory PTP, is an indication that the subject has or is disposed to having an ocular disorder, e.g., an ocular disorder described herein.
  • the method can be used to monitor a treatment for an ocular disorder in a subject.
  • the gene expression profile can be determined for a sample from a subject undergoing treatment. The profile can be compared to a reference profile or to a profile obtained from the subject prior to treatment or prior to onset of the disorder (see, e.g., Golub et al. (1999) Science 286:531).
  • the invention features a method of evaluating a gene for its involvement in an ocular disorder, e.g., in an ocular disorder described herein.
  • the method includes (a) providing a cell, tissue, or animal in which VEGF mediated signaling, e.g., NEGF-mediated angiogenesis signaling, is perturbed, e.g., A PTP described herein is perturbed, (b) evaluating the expression of one or more genes in the cell, tissue, or animal, and (c) optionally comparing the expression of the one or more genes in the cell, tissue, or animal with a reference, e.g., with the expression of the one or more genes in a control cell, tissue or animal.
  • VEGF mediated signaling e.g., NEGF-mediated angiogenesis signaling
  • a gene or genes identified as increased or decreased in the cell, tissue, or animal as compared to the reference, e.g., the control, are identified as candidate genes involved in an ocular disorder, e.g., an ocular disorder described herein.
  • the cell or tissue is from a subject (e.g., a human or non-human animal, e.g., an experimental animal) having or being at risk for an ocular disorder, e.g., an ocular disorder described herein.
  • the animal is a transgenic animal, e.g., a transgenic animal having a knock-out or overexpressing mutation for a PTP, e.g., a PTP described herein, e.g., SHP-1 and SHP-2.
  • the invention features a method of evaluating a test compound. The method includes providing a cell and a test compound; contacting the test compound to the cell; obtaining a subject expression profile for the contacted cell; and comparing the subject expression profile to one or more reference profiles.
  • the profiles include a value representing the level of expression of a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • the subject expression profile is compared to a target profile, e.g., a profile for a normal cell or for desired condition of a cell.
  • the test compound is evaluated favorably if the subject expression profile is more similar to the target profile than an expression profile obtained from an uncontacted cell.
  • the invention features, a method of evaluating a subject.
  • the method includes: a) obtaining a sample from a subject, e.g., from a caregiver, e.g., a caregiver who obtains the sample from the subject; b) determining a subject expression profile for the sample.
  • the method further includes either or both of steps: c) comparing the subject expression profile to one or more reference expression profiles; and d) selecting the reference profile most similar to the subject reference profile.
  • the subject expression profile and the reference profiles include a value representing the level of expression of a PTP, e.g., a PTP described herein.
  • a variety of routine statistical measures can be used to compare two reference profiles.
  • the method can further include transmitting a result to a caregiver.
  • the result can be the subject expression profile, a result of a comparison of the subject expression profile with another profile, a most similar reference profile, or a descriptor of any of the aforementioned.
  • the result can be transmitted across a computer network, e.g., the result can be in the form of a computer transmission, e.g., a computer data signal embedded in a carrier wave.
  • a computer medium having executable code for effecting the following steps: receive a subject expression profile; access a database of reference expression profiles; and either i) select a matching reference profile most similar to the subject expression profile or ii) determine at least one comparison score for the similarity of the subject expression profile to at least one reference profile.
  • the subject expression profile, and the reference expression profiles each include a value representing the level of expression of a PTP, e.g., a PTP described herein, e.g., SHP- 1 or SHP-2.
  • treatment is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, e.g., a retinal cell or tissue, who has a disease, a symptom of disease or a predisposition toward a disease, e.g., an ocular disorder, e.g., an ocular disorder described herein.
  • Treatment can slow, cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, a symptom of the disease or the predisposition toward disease, e.g., by at least 10%.
  • a first molecule can interact with a second by (a) directly binding, e.g., specifically binding, the second molecule, e.g., transiently or stably binding the second molecule; (b) modifying the second molecule, e.g., by cleaving a bond, e.g., a covalent bond, in the second molecule, or adding or removing a chemical group to or from the second molecule, e.g., adding or removing a phosphate group or carbohydrate group; (c) modulating an enzyme that modifies the second molecule, e.g., inhibiting or activating a kinase or phosphatase that normally modifies the second molecule; (d) affecting expression of the second molecule, e.g.
  • FIG. 1 PEDF inhibits NEGF-induced phosphorylation of KDR.
  • Cells were exposed to PEDF (2 nM) for 60 min prior to addition of NEGF (0.25 nM). After 5 min, cellular protein was isolated and immunoprecipitated using anti-KDR antibody. Immunoprecipitates were evaluated by western blot analysis using antibodies specific for phosphotyrosme (pY) or KDR.
  • pY phosphotyrosme
  • KDR KDR.
  • Cells were exposed to PEDF (2 nM) for 60 min prior to addition of VEGF (0.25 nM). After 5 min, cellular protein was isolated and immunoprecipitated prior to immunoblotting.
  • Panel A Immunoprecipitation with KDR-specific antibody followed by immunoblotting with antibodies specific for phosphotyrosme (pY), PLC ⁇ , p85 or KDR.
  • Panel B Iminunoprecipitation with p85-specific antibody followed by immunoblotting with antibodies specific for KDR or p85.
  • Panel C Immunoprecipitation with KDR-specific antibody followed by immunoblotting with antibodies specific for ⁇ 3 integrin or KDR.
  • FIG. 3 PEDF inhibits NEGF-induced AKT phosphorylation.
  • Cells were incubated with 0.25nM NEGF for 15 min followed by addition of 2 nM PEDF for 5 min.
  • Cellular proteins were evaluated by western blot analysis utilizing phospho- specific and total anti-Akt antibodies. A representative western blot is shown (top), as is quantitation from multiple experiments normalized to total Akt (bottom).
  • FIG. 4 PEDF inhibits NEGF-induced phosphorylation of e ⁇ OS.
  • Cells were incubated with 0.25nM NEGF for 30 min followed by addition of 2 nM PEDF for 60 min.
  • Cellular proteins were evaluated by western blot analysis utilizing phospho- specific and total anti-e ⁇ OS antibodies. A representative western blot is shown (top), as is quantitation of multiple experiments normalized to total e ⁇ OS (bottom).
  • FIG. 5 PEDF inhibits NEGF-induced phosphorylation of ERK1/2 and PKC.
  • PEDF blockade of NEGF-induced KDR tyrosine phosphorylation involves the activity of protein-tyrosine phosphatase.
  • Cells were exposed to PEDF (2 nM) and/or ⁇ a 3 NO 4 (2uM) for 60 min prior to stimulation with NEGF (0.25nM) for 5 min.
  • Cellular proteins were immunoprecipitated with KDR-specific antibody and immunoblotted using antibodies specific for phosphotyrosme (pY) or KDR.
  • Figure 7 PEDF increases KDR-associated SHP-1. Cells were exposed to PEDF (2 nM) for 60 min prior to stimulation with NEGF (0.25nM) for 5 min.
  • Panel A Cellular proteins were immunoprecipitated with KDR-specific antibody followed by immunoblotting with antibodies specific for phosphotyrosme (pY), PLC ⁇ , KDR, SHP-1 or SHP-2.
  • Panel B Cellular proteins were immunoprecipitated with SHP-1- specific antibody followed by immunoblotting with antibodies specific for KDR or SHP-1. Results are representative of 2 independent experiments.
  • FIG. 8 Inhibition of SHP-1 partially prevents PEDF-mediated blockade of VEGF-induced KDR phosphorylation.
  • Cells were treated with PTP Inhibitor I (PTP- IH, 500 ⁇ M) and/or PEDF (2nM) as indicated.
  • PTP- IH PTP Inhibitor I
  • PEDF 2nM
  • Cells were stimulated with VEGF (0.25 nM) for 5 min and cellular proteins immunoprecipitated with antibody specific for KDR. Immunoprecipitates were immunoblotted with antibodies specific for phosphotyrosme (pY) or KDR. Results are representative of 2 independent experiments.
  • PEDF inhibits NEGF-induced retinal vascular leakage in vivo.
  • PEDF (2 ng/eye) or 0.1% BSA control were injected intravitreously into opposite eyes of the same animal. After 10 min, VEGF (2 ng/eye, estimated 0.48 nM final concentration) was injected into both eyes. After 10 min, sodium fluorescein (10 ul) was injected through a jugular vein catheter placed 24-hr prior to the experiment. Vitreous fluorescence was measured 25 min after fluorescein injection as described in methods.
  • Figure 10 (Table 1): PEDF ameliorates VEGF-induced alterations in retinal mean circulation time and retinal blood flow in vivo. As described in Methods, rats were subjected to intravitreal injection of the first compound 10 min prior to intravitreal injection of the second molecule indicated. Mean circulation time and retinal blood flow were measured 15 min after the second injection.
  • protein phosphatases e.g., protein tyrosine phosphatases (PTPs), e.g., SH2-domain containing PTPs, e.g., SHP-1 and SHP-2
  • PTPs protein tyrosine phosphatases
  • SH2-domain containing PTPs e.g., SHP-1 and SHP-2
  • angiogenesis related disorders e.g., angiogenesis related ocular disorders, e.g., angiogenesis related ocular disorders described herein.
  • PEDF acts at the level of the VEGF receptor by preventing VEGF-R2 tyrosine phosphorylation. This effect is mediated by SH2-domain containing protein-tyrosine phosphatases (PTP), e.g., SHP-1 and SHP-2.
  • PTP protein-tyrosine phosphatases
  • PEDF inhibits VEGF action comprehensively, since all major VEGF signaling pathways were inhibited by PEDF, including PLC- ⁇ , PI3 kinase, PKC, ERK 1/2, p38, Akt and eNOS. This broad spectrum of action indicates that PEDF may serve more than a pure antiangiogenic role in the vasculature.
  • PEDF would likely also modulate vascular permeability, vascular dilation/blood flow, and apoptosis as evidenced by effects on PKC, eNOS, and Akt, respectively. Indeed, the data suggest that PEDF blocks VEGF-induced retinal vascular permeability and retinal blood flow abnormalities in vivo, effects mediated in part by PKC 15 ' 52 and eNOS. 48 ' 53 ' 54
  • VEGF-induced phosphorylation of VEGF-R2, PLC- ⁇ , PKC, and eNOS could all account for the observed novel effect of PEDF on retinal permeability in vivo.
  • VEGF-induced PLC- ⁇ phosphorylation activates PKC leading to increased retinal permeability.
  • Permeability is also increased by VEGF-induced tyrosine phosphorylation of tight junction proteins 55 and focal adhesion-associated proteins such as paxillin, VE- cadherin and PECAM through binding to KDR.
  • NEGF-induced permeability in retinal microvascular cells is nitric oxide dependent. 54
  • PEDF acts at the VEGF receptor is supported by several findings. VEGF signaling is mediated through receptor tyrosine phosphorylation. 58,59 Although PEDF did not alter VEGF binding to its receptor, PEDF effectively suppressed VEGF-induced tyrosine phosphorylation of VEGF-R2. This effect prevented association of the VEGF receptor with PLC- ⁇ and p85. VEGF-stimulated tyrosine phosphorylation of PLC ⁇ and PBkinase were also suppressed.
  • the protein-tyrosine phosphatase (PTP) family consists of at least 75 enzymes, for which many of the biological functions and substrate specificities remain unknown. 60 ' 61 When activated, VEGF-R2 associates with both SHP-1 and SHP-2. 51 Recently the multifunctional cytokine tumor necrosis factor (TNF) was shown to increase association of SHP-1 with VEGF-R2. 62 While SHP-2 is thought to enhance proliferative signals emanating from receptor tyrosine-kinases such as the epidermal growth factor receptor, SHP-1 inhibits such signaling by dephosphorylating receptors or receptor substrates to which it binds. 63"68
  • PEDF suppresses NEGF-induced NEGF-R2 phosphorylation through activation of a protein-tyrosine phosphatase (PTP). This possibility is supported by the complete return of NEGF-induced NEGF- R2 tyrosine phosphorylation despite the presence of PEDF when exposed to the PTP inhibitor ⁇ a3NO4. Furthermore, the association of NEGF-R2 with the inhibitory PTP SHP-1 is increased by PEDF, especially in the presence of NEGF. In contrast, the NEGF-induced association of KDR with the signal enhancing PTP SHP-2 was suppressed by PEDF.
  • PTP protein-tyrosine phosphatase
  • PTPs e.g., SH2 domain containing PTPs, e.g., SHP-1 or SHP-2
  • VEGF vascular permeability or neovascularization
  • SHP-1 and/or SHP-2 are described, e.g., in U.S. Patent No. 6,262,044 and U.S. Patent No. 6,225,329.
  • activated mutants of SH2-domain-containing PTPs e.g., activated SHP-1 and SHP-2 mutants
  • Antisense modulation of SHP-1 expression is described, e.g., in U.S. Patent No. 6,121,047.
  • Antisense modulation of SHP-2 expression is described, e.g., in U.S. Patent No. 6,200,807.
  • SHP-1 or SHP-2 modulating agents include Keggin compounds phosphomolybdate (PM) and phosphotungstate (PT), which strongly inhibit SHP-1 (Heo et al., 2002, Exp Mol Med 34(3):211-23).
  • the diagnostic assays described herein involve evaluating a PTP (e.g., a PTP described herein) level, expression, or activity.
  • PTP e.g., SHP-1 or SHP-2
  • protein levels can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELIS A or fluorescence-activated cell sorting (FACS).
  • FACS fluorescence-activated cell sorting
  • various art-recognized methods are known and/or are commercially available for evaluating PTP activity in a sample.
  • a peptide substrate e.g., a phosphopeptide
  • a sample putatively containing a PTP is contacted with a sample putatively containing a PTP; the sample is allowed to incubate with the substrate for a time and under conditions sufficient for dephosphorylation to take place; and a determination is made of either (a) the free phosphate generated in the dephosphorylation reaction; or (b) phosphate remaining on the substrate.
  • the level of PTP activity in a subject sample is compared to the level and/or activity in a control, e.g., the level and/or activity in a tissue from a non-disease subject, h another method, an anti-phosphotyrosine antibody can be used to detect the activity of a PTP on a substrate.
  • Another method of evaluating a PTP in a subject is to determine the presence or absence of a lesion in, or the misexpression of, a gene that encodes the PTP.
  • the method includes one or more of the following: detecting, in a tissue of the subject, the presence or absence of a mutation which affects the expression of a gene encoding a PTP, or detecting the presence or absence of a mutation in a region which controls the expression of the gene, e.g., a mutation in the 5' control region; detecting, in a tissue of the subject, the presence or absence of a mutation which alters the structure of a gene encoding a PTP; detecting, in a tissue of the subject, the misexpression of a gene encoding a PTP, at the mRNA level, e.g., detecting a non-wild type level of a mRNA ; detecting, in a tissue of the subject, the misexpression of the gene, at the protein level, e.g., detecting
  • the method includes: ascertaining the existence of at least one of: a deletion of one or more nucleotides from a gene encoding a PTP; an insertion of one or more nucleotides into the gene, a point mutation, e.g., a substitution of one or more nucleotides of the gene, a gross chromosomal rearrangement of the gene, e.g., a translocation, inversion, or deletion.
  • detecting the genetic lesion can include: (i) providing a probe/primer including an oligonucleotide containing a region of nucleotide sequence which hybridizes to a sense or antisense sequence from a gene encoding a PTP, or naturally occurring mutants thereof or 5' or 3' flanking sequences naturally associated with the gene; (ii) exposing the probe/primer to nucleic acid of a tissue; and detecting, by hybridization, e.g., in situ hybridization, of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion.
  • detecting the misexpression includes ascertaining the existence of at least one of: an alteration in the level of a messenger RNA transcript of a gene encoding a PTP; the presence of a non-wild type splicing pattern of a messenger RNA transcript of the gene; or a non-wild type level of a gene encoding a PTP.
  • the method includes determining the structure of a gene encoding a PTP, an abnormal structure being indicative of risk for the disorder.
  • the method includes contacting a sample from the subject with an antibody to a PTP, or a nucleic acid which hybridizes specifically with the gene encoding the PTP.
  • the presence, level, or absence of a PTP (protein or nucleic acid) in a biological sample can be evaluated by obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting the protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes a PTP such that the presence of the protein or nucleic acid is detected in the biological sample.
  • a biological sample includes tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject, e.g., synovial fluid.
  • Preferred biological samples are serum or synovial fluid.
  • the level of expression of the PTP can be measured in a number of ways, including, but not limited to: measuring the mRNA encoded by the PTP's gene; measuring the amount of protein encoded by a gene of a PTP; or measuring the activity of the protein encoded by the gene.
  • the level of mRNA corresponding to a PTP gene in a cell can be determined both by in situ and by in vitro formats.
  • Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses and probe arrays.
  • One preferred diagnostic method for the detection of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA encoded by the gene being detected.
  • the nucleic acid probe can be, for example, a full-length nucleic acid, or a portion thereof, such as an oligonucleotide of at least 7, 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to mRNA or genomic DNA of a PTP.
  • the probe can be disposed on an address of an array, e.g., an array described below.
  • Other suitable probes for use in the diagnostic assays are described herein.
  • mRNA (or cDNA) is immobilized on a surface and contacted with the probes, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probes are immobilized on a surface and the mRNA (or cDNA) is contacted with the probes, for example, in a two-dimensional gene chip array described below.
  • a skilled artisan can adapt known mRNA detection methods for use in detecting the level of mRNA encoded by the gene of a PTP.
  • the level of mRNA in a sample that is encoded by a gene can be evaluated with nucleic acid amplification, e.g., by rtPCR (Mullis (1987) U.S. Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189- 193), self sustained sequence replication (Guatelli et al., (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al., (1989), Proc. Natl. Acad. Sci.
  • amplification primers are defined as being a pair of nucleic acid molecules that can anneal to 5' or 3' regions of a gene (plus and minus strands, respectively, or vice- versa) and contain a short region in between.
  • amplification primers are from about 10 to 30 nucleotides in length and flank a region from about 50 to 200 nucleotides in length. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule comprising the nucleotide sequence flanked by the primers.
  • a cell or tissue sample can be prepared/processed and immobilized on a support, typically a glass slide, and then contacted with a probe that can hybridize to mRNA that encodes the gene being analyzed.
  • the methods further contacting a control sample with a compound or agent capable of detecting mRNA, or genomic DNA of a PTP, and comparing the presence of the mRNA or genomic DNA in the control sample with the presence of mRNA or genomic DNA of a PTP in the test sample.
  • serial analysis of gene expression as described in U.S. Patent No. 5,695,937, is used to detect transcript levels of a PTP described herein.
  • a variety of methods can be used to determine the level of protein encoded by a gene of a PTP. In general, these methods include contacting an agent that selectively binds to the protein, such as an antibody with a sample, to evaluate the level of protein in the sample.
  • the antibody bears a detectable label.
  • Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used.
  • the term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with a detectable substance. Examples of detectable substances are provided herein.
  • the detection methods can be used to detect a PTP in a biological sample in vitro as well as in vivo.
  • In vitro techniques for detection of a PTP include enzyme linked immunosorbent assays (ELISAs), immunoprecipitations, immunofluorescence, enzyme immunoassay (EIA), radioimmunoassay (RIA), and Western blot analysis.
  • In vivo techniques for detection of a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2, include introducing into a subject a labeled anti- PTP antibody.
  • the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • the sample is labeled, e.g., biotinylated and then contacted to the antibody, e.g., an antibody positioned on an antibody array.
  • the sample can be detected, e.g., with avidin coupled to a fluorescent label.
  • the methods further include contacting the control sample with a compound or agent capable of detecting a PTP, and comparing the presence of the component protein in the control sample with the presence of the component protein in the test sample.
  • kits for detecting the presence of a PTP in a biological sample can include a compound or agent capable of detecting protein (e.g., an antibody) or mRNA (e.g., a nucleic acid probe) of a PTP in a biological sample; and a standard.
  • the compound or agent can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to evaluate a subject, e.g., for risk or predisposition to an ocular disorder, e.g., an ocular disorder described herein.
  • the diagnostic methods described herein can identify subjects having, or at risk of developing, an ocular disorder, e.g., an ocular disorder described herein.
  • the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agent that modulates a PTP, e.g., an agent described herein) to treat an ocular disorder, e.g., an ocular disorder described herein.
  • an agent e.g., an agent that modulates a PTP, e.g., an agent described herein
  • an ocular disorder e.g., an ocular disorder described herein.
  • Amino acid sequence variants of PTPs can be prepared by random mutagenesis of DNA which encodes a PTP (e.g., SHP-1 or SHP-2) or a region thereof.
  • Useful methods include PCR mutagenesis and saturation mutagenesis, as described below.
  • a library of random amino acid sequence variants can also be generated by the synthesis of a set of degenerate oligonucleotide sequences.
  • activated mutants of SH2-domain-containing PTPs e.g., activated SHP-1 and SHP-2 mutants
  • activated SHP-1 and SHP-2 mutants are described in U.S. Patent No. 6,156,551. Briefly, phosphotyrosme peptide binding to the SH2 domain of a PTP stimulates, or activates, phosphatase activity.
  • SH2-domain-containing PTPs that are biologically active without requiring phosphotyrosme peptide binding are known and include biologically SHP-1 and SHP-2 mutants comprising one, or more, mutations, in the N- SH2 domain.
  • These activated mutant PTPs are refe ⁇ ed to herein as being in the
  • the activated mutants can bind substrates or inhibitors in the absence of SH2 domain binding to phosphotyrosme residues.
  • PCR mutagenesis reduced Taq polymerase fidelity is used to introduce random mutations into a cloned fragment of DNA (Leung et al, 1989, Technique 1:11-15). This is a very powerful and relatively rapid method of introducing random mutations.
  • the DNA region to be mutagenized is amplified using the polymerase chain reaction (PCR) under conditions that reduce the fidelity of DNA synthesis by
  • Taq DNA polymerase e.g., by using a dGTP/dATP ratio of five and adding Mn ⁇ to the PCR reaction.
  • the pool of amplified DNA fragments are inserted into appropriate cloning vectors to provide random mutant libraries.
  • Saturation mutagenesis allows for the rapid introduction of a large number of single base substitutions into cloned DNA fragments (Mayers et al., 1985, Science 229:242).
  • This technique includes generation of mutations, e.g., by chemical treatment or irradiation of single-stranded DNA in vitro, and synthesis of a complimentary DNA strand.
  • the mutation frequency can be modulated by modulating the severity of the treatment, and essentially all possible base substitutions can be obtained. Because this procedure does not involve a genetic selection for mutant fragments both neutral substitutions, as well as those that alter function, are obtained. The distribution of point mutations is not biased toward conserved sequence elements.
  • a library of homologs can also be generated from a set of degenerate oligonucleotide sequences. Chemical synthesis of a degenerate sequences can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector. The synthesis of degenerate oligonucleotides is known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura et al. (1984) Annu. Rev.
  • Non-random or directed, mutagenesis techniques can be used to provide specific sequences or mutations in specific regions. These techniques can be used to create variants which include, e.g., deletions, insertions, or substitutions, of residues of the known amino acid sequence of a protein.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conserved amino acids and then with more radical choices depending upon results achieved, (2) deleting the target residue, or (3) inserting residues of the same or a different class adjacent to the located site, or combinations of options 1-3.
  • Alanine scanning mutagenesis is a useful method for identification of certain residues or regions of the desired protein that are preferred locations or domains for mutagenesis, Cunningham and Wells (Science 244:1081-1085, 1989).
  • a residue or group of target residues are identified (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine).
  • Replacement of an amino acid can affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell.
  • Those domains demonstrating functional sensitivity to the substitutions are then refined by introducing further or other variants at or for the sites of substitution.
  • the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predete ⁇ nined.
  • alanine scanning or random mutagenesis may be conducted at the target codon or region and the expressed desired protein subunit variants are screened for the optimal combination of desired activity.
  • Oligonucleotide-mediated mutagenesis is a useful method for preparing substitution, deletion, and insertion variants of DNA, see, e.g., Adelman et al., (DNA 2:183, 1983). Briefly, the desired DNA is altered by hybridizing an oligonucleotide encoding a mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequence of the desired protein. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the desired protein DNA.
  • oligonucleotides of at least 25 nucleotides in length are used.
  • An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotide(s) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single- stranded DNA template molecule.
  • the oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea et al. (Proc. Natl. Acad. Set. (1978) USA, 75: 5765).
  • the starting material is a plasmid (or other vector) which includes the protein subunit DNA to be mutated.
  • the codon(s) in the protein subunit DNA to be mutated are identified.
  • a double- stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation(s) is synthesized using standard procedures. The two strands are synthesized separately and then hybridized together using standard techniques.
  • This double-stranded oligonucleotide is referred to as the cassette.
  • This cassette is designed to have 3' and 5' ends that are comparable with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid.
  • This plasmid now contains the mutated desired protein subunit DNA sequence.
  • Combinatorial mutagenesis can also be used to generate mutants.
  • the amino acid sequences for a group of homologs or other related proteins are aligned, preferably to promote the highest homology possible. All of the amino acids which appear at a given position of the aligned sequences can be selected to create a degenerate set of combinatorial sequences.
  • the variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential sequences are expressible as individual peptides, or alternatively, as a set of larger fusion proteins containing the set of degenerate sequences.
  • Techniques for screening large gene libraries often include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the genes under conditions in which detection of a desired activity, e.g., binding to a natural ligand, e.g., a receptor or substrate, facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • a desired activity e.g., binding to a natural ligand, e.g., a receptor or substrate.
  • Two hybrid (interaction trap) assays can be used to identify a protein that interacts with a PTP (e.g., SHP-1 or SHP-2) or active fragments thereof. These may include, e.g., agonists, superagonists, and antagonists of PTP activity. (The subject protein and a protein it interacts with are used as the bait protein and fish proteins.). These assays rely on detecting the reconstitution of a functional transcriptional activator mediated by protein-protein interactions with a bait protein. In particular, these assays make use of chimeric genes which express hybrid proteins.
  • PTP e.g., SHP-1 or SHP-2
  • active fragments thereof may include, e.g., agonists, superagonists, and antagonists of PTP activity.
  • the subject protein and a protein it interacts with are used as the bait protein and fish proteins.
  • These assays rely on detecting the reconstitution of a functional transcriptional activator mediated by protein-protein interactions with a bait protein. In
  • the first hybrid comprises a DNA-binding domain fused to the bait protein, e.g., a PTP (e.g., SHP-1 or SHP-2) or active fragments thereof.
  • the second hybrid protein contains a transcriptional activation domain fused to a "fish" protein, e.g. an expression library. If the fish and bait proteins are able to interact, they bring into close proximity the DNA-binding and transcriptional activator domains. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a transcriptional regulatory site which is recognized by the DNA binding domain, and expression of the marker gene can be detected and used to score for the interaction of the bait protein with another protein.
  • the candidate peptides are displayed on the surface of a cell or viral particle, and the ability of particular cells or viral particles to bind an appropriate receptor protein via the displayed product is detected in a "panning assay".
  • the gene library can be cloned into the gene for a surface membrane protein of a bacterial cell, and the resulting fusion protein detected by panning (Ladner et al., WO 88/06630; Fuchs et al. (1991) Bio/Technology 9:1370- 1371 ; and Goward et al. (1992) TIBS 18: 136-140). This technique was used in Sahu et al. (1996) J.
  • a detectably labeled ligand can be used to score for potentially functional peptide homologs.
  • Fluorescently labeled ligands e.g., receptors, can be used to detect homolog which retain ligand-binding activity.
  • the use of fluorescently labeled ligands allows cells to be visually inspected and separated under a fluorescence microscope, or, where the morphology of the cell permits, to be separated by a fluorescence-activated cell sorter.
  • a gene library can be expressed as a fusion protein on the surface of a viral particle.
  • foreign peptide sequences can be expressed on the surface of infectious phage, thereby conferring two significant benefits.
  • coli filamentous phages Ml 3, fd., and fl are most often used in phage display libraries. Either of the phage gill or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle.
  • Foreign epitopes can be expressed at the NH2-terminal end of pill and phage bearing such epitopes recovered from a large excess of phage lacking this epitope (Ladner et al. PCT publication WO 90/02909; Ga ⁇ ard et al, PCT publication WO 92/09690; Marks et al. (1992) J. Biol. Chem. 267:16007-16010; Griffiths et al. (1993) EMBO J 12:725-734; Clackson et al. (1991) Nature 352:624-628; and Barbas et al. (1992) PNAS 89:4457- 4461).
  • E. coli the outer membrane protein, LamB
  • LamB the outer membrane protein
  • Oligonucleotides have been inserted into plasmids encoding the LamB gene to produce peptides fused into one of the extracellular loops of the protein. These peptides are available for binding to ligands, e.g., to antibodies, and can elicit an immune response when the cells are administered to animals.
  • Other cell surface proteins e.g., OmpA (Schorr et al. (1991) Vaccines 91, pp.
  • Peptides can be fused to pilin, a protein which polymerizes to form the pilus-a conduit for interbacterial exchange of genetic information (Thiry et al. (1989) Appl. Environ. Microbiol. 55, 984-993). Because of its role in interacting with other cells, the pilus provides a useful support for the presentation of peptides to the extracellular environment.
  • Another large surface structure used for peptide display is the bacterial motive organ, the flagellum.
  • Fusion of peptides to the subunit protein flagellin offers a dense array of may peptides copies on the host cells (Kuwajima et al. (1988) Bio/Tech. 6, 1080-1083).
  • Surface proteins of other bacterial species have also served as peptide fusion partners. Examples include the Staphylococcus protein A and the outer membrane protease IgA of Neisseria (Hansson et al. (1992) J. Bacteriol. 174, 4239-4245 and Klauser et al. (1990) EMBO J. 9, 1991-1999).
  • the physical link between the peptide and its encoding DNA occurs by the containment of the DNA within a particle (cell or phage) that carries the peptide on its surface. Capturing the peptide captures the particle and the DNA within.
  • An alternative scheme uses the DNA-binding protein Lad to form a link between peptide and DNA (Cull et al. (1992) PNAS USA 89:1865-1869). This system uses a plasmid containing the Lad gene with an oligonucleotide cloning site at its 3 '-end. Under the controlled induction by arabinose, a Lacl-peptide fusion protein is produced.
  • This fusion retains the natural ability of Lad to bind to a short DNA sequence known as LacO operator (LacO).
  • LacO operator By installing two copies of LacO on the expression plasmid, the Lacl- peptide fusion binds tightly to the plasmid that encoded it. Because the plasmids in each cell contain only a single oligonucleotide sequence and each cell expresses only a single peptide sequence, the peptides become specifically and stably associated with the DNA sequence that directed its synthesis. The cells of the library are gently lysed and the peptide-DNA complexes are exposed to a matrix of immobilized receptor to recover the complexes containing active peptides.
  • the associated plasmid DNA is then reintroduced into cells for amplification and DNA sequencing to determine the identity of the peptide ligands.
  • a large random library of dodecapeptides was made and selected on a monoclonal antibody raised against the opioid peptide dynorphin B.
  • a cohort of peptides was recovered, all related by a consensus sequence corresponding to a six- residue portion of dynorphin B. (Cull et al. (1992) Proc. Natl. Acad. Sci. U.S.A. 89-
  • peptides-on-plasmids differs in two important ways from the phage display methods.
  • the peptides are attached to the C-terminus of the fusion protein, resulting in the display of the library members as peptides having free carboxy termini.
  • Both of the filamentous phage coat proteins, pill and p VIII, are anchored to the phage through their C-termini, and the guest peptides are placed into the outward-extending N-terminal domains.
  • the phage-displayed peptides are presented right at the amino terminus of the fusion protein.
  • a second difference is the set of biological biases affecting the population of peptides actually present in the libraries.
  • the Lad fusion molecules are confined to the cytoplasm of the host cells.
  • the phage coat fusions are exposed briefly to the cytoplasm during - translation but are rapidly secreted through the inner membrane into the periplasmic compartment, remaining anchored in the membrane by their C-terminal hydrophobic domains, with the N-termini, containing the peptides, protruding into the periplasm while awaiting assembly into phage particles.
  • the peptides in the Lad and phage libraries may differ significantly as a result of their exposure to different proteolytic activities.
  • phage coat proteins require transport across the inner membrane and signal peptidase processing as a prelude to incorporation into phage. Certain peptides exert a deleterious effect on these processes and are underrepresented in the libraries (Gallop et al. (1994) J. Med. Chem. 37(9):1233-1251). These particular biases are not a factor in the Lad display system.
  • RNA from the bound complexes is recovered, converted to cDNA, and amplified by PCR to produce a template for the next round of synthesis and screening.
  • the polysome display method can be coupled to the phage display system. Following several rounds of screening, cDNA from the enriched pool of polysomes was cloned into a phagemid vector. This vector serves as both a peptide expression vector, displaying peptides fused to the coat proteins, and as a DNA sequencing vector for peptide identification.
  • polysome- derived peptides on phage By expressing the polysome- derived peptides on phage, one can either continue the affinity selection procedure in this format or assay the peptides on individual clones for binding activity in a phage ELISA, or for binding specificity in a completion phage ELISA (Barret, et al. (1992) Anal. Biochem 204,357-364). To identify the sequences of the active peptides one sequences the DNA produced by the phagemid host.
  • the high through-put assays described above can be followed (or substituted) by secondary screens in order to identify biological activities which will, e.g., allow one skilled in the art to differentiate agonists from antagonists.
  • the type of a screen used will depend on the desired activity that needs to be tested.
  • an assay can be developed in which the ability of a candidate agent to modulate tyrosine phosphatase activity can be used to identify antagonists or agonists from a group of peptide fragments isolated though one of the primary screens described above.
  • the ability of a test agent to modulate a PTP can be evaluated by evaluating the ability of the test agent to disrupt the ability of a chosen PTP (e.g., SHP-1 or SHP-2) to remove a phosphate residue from a substrate.
  • the test agent is contacted with a reaction mixture or cell containing the chosen PTP; a peptide substrate, e.g., a phosphopeptide, is contacted with the reaction mixture or cell; the reaction mixture or cell is allowed to incubate for a time and under conditions sufficient for dephosphorylation to take place; and a determination is made of either (a) the free phosphate generated in the dephosphorylation reaction; or (b) phosphate remaining on the substrate.
  • a chosen PTP e.g., SHP-1 or SHP-2
  • an anti- phosphotyrosine antibody can be used to detect the activity of a PTP on a substrate, in the presence or absence of a test agent.
  • the nucleotide and amino acid sequences of, e.g., SHP-1 and SHP-2, are known and are provided herein.
  • Amino acid sequence of SHP-1 (SEQ ID NO:l):
  • Nucleotide sequence ofSHP-1 cDNA (SEQ ID NO:2): caagaagacg gggattgagg aggcctcagg cgcctttgtc tacctgcggc agccgtacta tgccacgagg gtgaatgcgg ctgacattga gaaccgagtg ttggaactga acaagaagca ggagtccgag gaggaagtgg ctgattactg agcggttctttactg agcggttctttccctcacctgg cttgggccac tgtgcacagc tgtgccgctg gctg gctg gctg gctg gctg gctg gctg gctg gctg gctg gc
  • Nucleotide sequence ofSHP-2 cDNA (SEQ ID NO:4): cgccaggcct ggaggggggt ctgtgcgcgg ccggctggct ctgcg tccggtccg agcgggcctccgcg tccggtccgcca gcccgatgtg accgagccca gcggagcctg agcaaggagc gggtccgtcg cgga gggcggga aacatgacat cgcggagatg gtttcaccca aatatcactg gtgtggaggc agaaaaccta ctgttgacaa gaggagttga tggcag gaggagttga tggcagtggtttttggcaaggc ctagtaaaag
  • the invention also provides for production of the protein binding domains PTPs, e.g., SHP-1 or SHP-2, to generate mimetics, e.g. peptide or non-peptide agents, e.g., inhibitory agents.
  • PTPs protein binding domains
  • SHP-1 or SHP-2 protein binding domains
  • mimetics e.g. peptide or non-peptide agents, e.g., inhibitory agents.
  • Non-hydrolyzable peptide analogs of critical residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. (1986) J Med
  • an agent described herein e.g., a modulator of a PTP, e.g., SHP-1 or SHP-2
  • An antibody can be an antibody or a fragment thereof, e.g., an antigen binding portion thereof.
  • the term "antibody” refers to a protein comprising at least one, and preferably two, heavy (H) chain variable regions (abbreviated herein as VH), and at least one and preferably two light (L) chain variable regions (abbreviated herein as VL).
  • VH and VL regions can be further subdivided into regions of hypervariability, termed “complementarity determining regions” ("CDR"), interspersed with regions that are more conserved, termed “framework regions” (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • the extent of the framework region and CDR's has been precisely defined (see, Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NTH Publication No. 91- 3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917, which are incorporated herein by reference).
  • Each VH and VL is composed of three CDR's and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the antibody can further include a heavy and light chain constant region, to thereby form a heavy and light immunoglobulin chain, respectively.
  • the antibody is a tetramer of two heavy immunoglobulin chains and two light immunoglobulin chains, wherein the heavy and light immunoglobulin chains are inter-comiected by, e.g., disulfide bonds.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • the light chain constant region is comprised of one domain, CL.
  • the variable region of the heavy and light chains contains a binding domain that interacts with an antigen.
  • the constant regions of the antibodies typically mediate the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • antibody portion refers to one or more fragments of a full- length antibody that retain the ability to specifically bind to an antigen (e.g., a polypeptide encoded by a nucleic acid of Group I or II).
  • an antigen e.g., a polypeptide encoded by a nucleic acid of Group I or II.
  • binding fragments encompassed within the term "antigen-binding fragment" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab')2 fragment a bivalent fragment comprising two Fab fragments linked by a dis
  • the two domains of the Fv fragment, VL and VH are coded for by separate nucleic acids, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody.
  • monoclonal antibody or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope. A monoclonal antibody composition thus typically displays a single binding affinity for a particular protein with which it immunoreacts.
  • Anti-protein anti-peptide antisera or monoclonal antibodies can be made as described herein by using standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a PTP e.g., SHP-1 or SHP-2
  • SHP-1 or SHP-2 can be used as an immunogen to generate antibodies that bind the component using standard techniques for polyclonal and monoclonal antibody preparation.
  • the full-length component protein can be used or, alternatively, antigenic peptide fragments of the component can be used as immunogens.
  • a peptide is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
  • a suitable subject e.g., rabbit, goat, mouse or other mammal
  • An appropriate immunogenic preparation can contain, for example, a recombinant PTP, e.g., SHP-1 or SHP-2, peptide, or a chemically synthesized a PTP, e.g., SHP-1 or SHP-2, peptide or antagonist. See, e.g., U.S. Patent No. 5,460,959; and co-pending U.S.
  • the nucleotide and amino acid sequences of SHP-1 and SHP-2 described herein are known.
  • the preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent.
  • Immunization of a suitable subject with an immunogenic PTP, e.g., SHP-1 or SHP-2, or fragment preparation induces a polyclonal antibody response.
  • antibodies produced by genetic engineering methods such as chimeric and humanized monoclonal antibodies, comprising both human and non- human portions, which can be made using standard recombinant DNA techniques, can be used.
  • Such chimeric and humanized monoclonal antibodies can be produced by genetic engineering using standard DNA techniques known in the art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No. WO 86/01533; Cabilly et al. U.S. Patent No.
  • a human monoclonal antibody directed against a PTP e.g., SHP-1 or SHP-2
  • a human monoclonal antibody directed against a PTP can be made using standard techniques.
  • human monoclonal antibodies can be generated in transgenic mice or in immune deficient mice engrafted with antibody-producing human cells.
  • a human antibody-transgenic mouse or an immune deficient mouse engrafted with human antibody-producing cells or tissue can be immunized with a PTP, e.g., SHP-1 or SHP-2, or an antigenic peptide thereof, and splenocytes from these immunized mice can then be used to create hybridomas. Methods of hybridoma production are well known.
  • Human monoclonal antibodies against a PTP can also be prepared by constructing a combinatorial immunoglobulin library, such as a Fab phage display library or a scFv phage display library, using immunoglobulin light chain and heavy chain cDNAs prepared from mRNA derived from lymphocytes of a subject. See, e.g., McCafferty et al. PCT publication WO 92/01047; Marks et al.
  • a combinatorial library of antibody variable regions can be generated by mutating a known human antibody.
  • a variable region of a human antibody known to bind a PTP e.g., SHP-1 or SHP-2
  • a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • the immunoglobulin library can be expressed by a population of display packages, preferably derived from filamentous phage, to form an antibody display library.
  • Examples of methods and reagents particularly amenable for use in generating antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. PCT publication WO 92/18619; Dower et al. PCT publication WO 91/17271; Winter et al. PCT publication WO 92/20791; Markland et al. PCT publication WO 92/15679; Breitling et al. PCT publication WO 93/01288; McCafferty et al.
  • the antibody library is screened to identify and isolate packages that express an antibody that binds a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • the primary screening of the library involves panning with an immobilized PTP, e.g., SHP-1 or SHP-2, and display packages expressing antibodies that bind immobilized proteins described herein are selected.
  • Nucleic acid molecules which are antisense to a nucleotide encoding a PTP can also be used as an agent which inhibits expression of a chosen PTP.
  • An "antisense" nucleic acid includes a nucleotide sequence which is complementary to a "sense" nucleic acid encoding the component, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can form hydrogen bonds with a sense nucleic acid.
  • the antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof. For example, an antisense nucleic acid molecule which antisense to the "coding region" of the coding strand of a nucleotide sequence encoding the component can be used.
  • the coding strand sequences encoding a PTP e.g., SHP-1 or SHP-2
  • antisense nucleic acids can be designed according to the rules of Watson and Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of the mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxy
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest.
  • an agent that modulates a PTP can be administered to a subject by standard methods.
  • the agent can be administered by any of a number of different routes including intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), and transmucosal, or direct administration, e.g., onto the surface of the eye.
  • the modulating agent can be administered orally.
  • the agent is administered by injection, e.g., intramuscularly, or intravenously.
  • the agent is administered directly onto the surface of the eye.
  • the agent that modulates a PTP e.g., SHP-1 or SHP-2
  • an agent described herein e.g., nucleic acid molecules, polypeptides, fragments or analogs, modulators, organic compounds and antibodies (also referred to herein as "active compounds"
  • Such compositions typically include the nucleic acid molecule, polypeptide, modulator, or antibody and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances are known. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition can be formulated to be compatible with its intended route of administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as as
  • pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS), hi all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound (e.g., an agent described herein) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pha ⁇ naceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
  • the nucleic acid molecules described herein can be inserted into vectors and used as gene therapy vectors.
  • Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Patent 5,328,470) or by stereotactic injection (see e.g., Chen et al., PNAS 91:3054-3057, 1994).
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • the agent is administered in solution suitable for administration as an eye drop.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • the nucleic acids described herein can be incorporated into gene constructs to be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of a PTP described herein.
  • the invention features expression vectors for in vivo transfection and expression of a PTP described herein in particular cell types so as to reconstitute the function of, or alternatively, antagonize the function of the component in a cell in which that polypeptide is misexpressed.
  • Expression constructs of such components may be administered in any biologically effective carrier, e.g. any formulation or composition capable of effectively delivering the component gene to cells in vivo.
  • Approaches include insertion of the subject gene in viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus- 1, or recombinant bacterial or eukaryotic plasmids.
  • Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of, for example, cationic liposomes (lipofectin) or derivatized (e.g. antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO4 precipitation carried out in vivo.
  • a prefe ⁇ ed approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g. a cDNA, encoding a PTP, e.g., a
  • PTP described herein e.g., SHP-1 or SHP-2.
  • Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid.
  • Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host.
  • the development of specialized cell lines (termed "packaging cells") which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A.D. (1990) Blood 76:271).
  • a replication defective retrovirus can be packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include *Crip, *Cre, *2 and *Am.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-
  • Another viral gene delivery system useful in the present invention utilizes adenovirus-derived vectors.
  • the genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lyric viral life cycle. See, for example, Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
  • adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus are known to those skilled in the art.
  • Recombinant adenoviruses can be advantageous in certain circumstances in that they are not capable of infecting nondividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al. (1992) cited supra).
  • the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity.
  • introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA).
  • the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj- Ahmand and Graham (1986) J. Virol. 57:267).
  • Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
  • AAV adeno-associated virus
  • Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
  • It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration see for example Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J.
  • AAV vector such as that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce DNA into cells.
  • a variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA 81:6466- 6470; Tratschin et al. (1985) Mol. Cell. Biol.
  • non- viral methods can also be employed to cause expression of a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2, in the tissue of a subject.
  • a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2
  • Most nonviral methods of gene transfer rely on no ⁇ nal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules.
  • non- viral gene delivery systems of the present invention rely on endocytic pathways for the uptake of the subject gene by the targeted cell.
  • Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
  • Other embodiments include plasmid injection systems such as are described in Meuli et al. (2001) J Invest De ⁇ natol. 116(1):131-135; Cohen et al. (2000) Gene Ther 7(22): 1896-905; or Tarn et al. (2000) Gene Ther 7(21): 1867-74.
  • a gene encoding a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2
  • a PTP can be entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins) and (optionally) which are tagged with antibodies against cell surface antigens of the target tissue (Mizuno et al. (1992) No Shinkei Geka 20:547-551; PCT publication WO91/06309; Japanese patent application 1047381; and European patent publication EP-A-43075).
  • the gene delivery systems for the therapeutic gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art.
  • a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
  • initial delivery of the recombinant gene is more limited with introduction into the animal being quite localized.
  • the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g. Chen et al. (1994) PNAS 91: 3054-3057).
  • the pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
  • a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2
  • a PTP described herein e.g., SHP-1 or SHP-2
  • UTR 5' untranslated region
  • Primary and secondary cells to be genetically engineered can be obtained form a variety of tissues and include cell types which can be maintained propagated in culture.
  • primary and secondary cells include fibroblasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells), muscle cells (myoblasts) and precursors of these somatic cell types.
  • Primary cells are preferably obtained from the individual to whom the genetically engineered primary or secondary cells are administered. However, primary cells may be obtained for a donor (other than the recipient).
  • primary cell includes cells present in a suspension of cells isolated from a vertebrate tissue source (prior to their being plated i.e., attached to a tissue culture substrate such as a dish or flask), cells present in an explant derived from tissue, both of the previous types of cells plated for the first time, and cell suspensions derived from these plated cells.
  • tissue culture substrate such as a dish or flask
  • secondary cell or “cell strain” refers to cells at all subsequent steps in culturing. Secondary cells are cell strains which consist of secondary cells which have been passaged one or more times.
  • Primary or secondary cells of vertebrate, particularly mammalian, origin can be transfected with an exogenous nucleic acid sequence which includes a nucleic acid sequence encoding a signal peptide, and/or a heterologous nucleic acid sequence, e.g., encoding a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2, or an agonist or antagonist thereof, and produce the encoded product stably and reproducibly in vitro and in vivo, over extended periods of time.
  • a heterologous amino acid can also be a regulatory sequence, e.g., a promoter, which causes expression, e.g., inducible expression or upregulation, of an endogenous sequence.
  • An exogenous nucleic acid sequence can be introduced into a primary or secondary cell by homologous recombination as described, for example, in U.S. Patent No.: 5,641,670, the contents of which are incorporated herein by reference.
  • the transfected primary or secondary cells may also include DNA encoding a selectable marker which confers a selectable phenotype upon them, facilitating their identification and isolation.
  • Vertebrate tissue can be obtained by standard methods such a punch biopsy or other surgical methods of obtaining a tissue source of the primary cell type of interest. For example, punch biopsy is used to obtain skin as a source of fibroblasts or keratinocytes. A mixture of primary cells is obtained from the tissue, using known methods, such as enzymatic digestion or explanting. If enzymatic digestion is used, enzymes such as collagenase, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used.
  • enzymes such as collagenase, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used.
  • the resulting primary cell mixture can be transfected directly or it can be cultured first, removed from the culture plate and resuspended before transfection is carried out.
  • Primary cells or secondary cells are combined with exogenous nucleic acid sequence to, e.g., stably integrate into their genomes, and treated in order to accomplish transfection.
  • the term "transfection” includes a variety of techniques for introducing an exogenous nucleic acid into a cell including calcium phosphate or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection or electrophoration, all of which are routine in the art.
  • Transfected primary or secondary cells undergo sufficient number doubling to produce either a clonal cell strain or a heterogeneous cell strain of sufficient size to provide the therapeutic protein to an individual in effective amounts.
  • the number of required cells in a transfected clonal heterogeneous cell strain is variable and depends on a variety of factors, including but not limited to, the use of the transfected cells, the functional level of the exogenous DNA in the transfected cells, the site of implantation of the transfected cells (for example, the number of cells that can be used is limited by the anatomical site of implantation), and the age, surface area, and clinical condition of the patient.
  • the transfected cells e.g., cells produced as described herein, can be introduced into an individual to whom the product is to be delivered.
  • Various routes of administration and various sites e.g., renal sub capsular, subcutaneous, central nervous system (including intrathecal), intravascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomentai), intramuscularly implantation
  • the transfected cells produce the product encoded by the heterologous DNA or are affected by the heterologous DNA itself.
  • an individual who suffers from an antibody-mediated arthritic disorder is a candidate for implantation of cells producing an antagonist of a PTP, e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • a PTP e.g., a PTP described herein, e.g., SHP-1 or SHP-2.
  • An immunosuppressive agent e.g., drug, or antibody
  • Dosage ranges for immunosuppressive drugs are known in the art. See, e.g., Freed et al. (1992) N. Engl. J. Med. 327:1549; Spencer et al. (1992) N. Engl. J. Med. 327:1541' Widner et al. (1992) n. Engl. J. Med. 327:1556).
  • Dosage values may vary according to factors such as the disease state, age, sex, and weight of the individual.
  • VEGF mediates its vascular actions primarily through 2 high-affinity, transmembrane tyrosine kinase receptors, VEGF-R1 (Fit) and VEGF-R2 (KDR).
  • VEGF-R1 is required for endothelial cell morphogenesis while VEGF-R2 is primarily involved in mitogenesis 34 ' 35 and mediates most of VEGF's endothelial cell-selective growth and permeability activity. In cultured retinal endothelial cells, only VEGF-R2 is expressed. 36"38 Thus, it was initially determined whether PEDF could inhibit VEGF-induced tyrosine phosphorylation of VEGF-R2. Bovine retinal endothelial cells (BREC) were treated with or without VEGF and PEDF and cellular proteins were immunoprecipitated with antibodies specific for VEGF-R2 and subsequently immunoblotted with antibodies specific for phosphotyrosme.
  • BREC Bovine retinal endothelial cells
  • VEGF increased VEGF-R2 phosphorylation without affecting total VEGF- R2 levels.
  • 2nM PEDF suppressed VEGF-induced tyrosine phosphorylation of VEGF-R2.
  • serine and threonine phosphorylation can alter tyrosine phosphorylation, 39 this mechanism is unlikely for PEDF as similar experiments utilizing immunoprecipitation with anti-VEGF-R2 antibody and subsequent immunoblotting for phosphothreonine or phosphoserine did not show any effect of PEDF (data not shown).
  • a trivial mechanistic explanation for the PEDF effect could be that PEDF was preventing VEGF binding to its receptors.
  • NEGF increased the association of VEGF-R2 with both PLC- ⁇ and p85.
  • PEDF prevented these VEGF-induced associations.
  • PEDF had no observable effects on basal KDR phosphorylation or the basal PLC- ⁇ /p85/ VEGF-R2 association.
  • VEGF increased association of KDR with p85, a finding almost completely inhibited by PEDF.
  • PEDF again had no significant effect upon basal VEGF-R2 / p85 association.
  • Immunoprecipitation using anti-phosphotyrosine antibody and subsequent immunoblotting with antibodies specific for PLC- ⁇ or p85 suggested that NEGF-stimulated tyrosine phosphorylation of PLC- ⁇ , and p85 were inhibited by PEDF, although the magnitude of the p85 response was small (data not shown).
  • PEDF has been shown to block hypoxia-induced neovascularization and increased apoptosis has been postulated as a potential mechanism. Since VEGF is known to increase phosphorylation of Akt, a molecule with anti-apoptotic activity and a cell survival factor, 42"44 the effect of PEDF on VEGF-induced Akt phosphorylation was evaluated. As shown in Figure 3, VEGF induced Akt phosphorylation 2.2+0.4- fold (P ⁇ 0.001) within 15 min. Pre-incubation for 60 min with 2 nM PEDF inhibited VEGF-induced Akt phosphorylation 82.6+25.2% (P ⁇ 0.01) without significant effect on basal phosphorylation.
  • Akt increases phosphorylation and activity of e ⁇ OS
  • e ⁇ OS is important in mediating changes in retinal blood flow and VEGF-induced vascular permeability
  • 48 ' 49 the effect of PEDF on VEGF-induced e ⁇ OS phosphorylation (Figure 4) was evaluated.
  • VEGF (10 ng/ml) increased e ⁇ OS phosphorylation 78.8 ⁇ 16.9% (PO.01) after 30 min, an effect inhibited 81.2+11.2% (PO.01) by 60 min pre-incubation with 2 nM PEDF.
  • PEDF also reduced basal e ⁇ OS phosphorylation by 30.7% although this effect was not statistically significant. Total e ⁇ OS expression over this 30 minutes time period was not changed.
  • VEGF-induced signaling that would be expected if PEDF acted through reducing VEGF-R2 receptor phosphorylation
  • PEDF effects on VEGF-induced activation and phosphorylation of ERK1/2, protein kinase C, and p38 were evaluated.
  • BREC were treated with or without 2 nM PEDF for 1 hr prior to stimulation with 0.25nM VEGF for 5 min (figure 5a).
  • PEDF protein-tyrosine phosphatase
  • PEDF suppressed VEGF-induced tyrosine phosphorylation of VEGF-R2; however, the addition of Na 3 VO 4 completely blocked the ability of PEDF to inhibit VEGF-induced KDR tyrosine phosphorylation. Indeed, resultant tyrosine phosphorylation levels were equivalent to Na VO 4 treatment in cells stimulated by VEGF alone.
  • PTP Inhibitor I (Calbiochem), an inhibitor of SHP- 1.
  • 500 ⁇ M PTP inhibitor I partially restored VEGF-induced VEGF-R2 tyrosine phosphorylation in the presence of PEDF.
  • Example 4 PEDF Activity in vivo VEGF is a major mediator of intraocular neovascularization ' and retinal vascular permeability, 15 two complications primarily accounting for the visual loss observed in numerous retinal neovascular diseases such as diabetic retinopathy.
  • PEDF has been shown to prevent hypoxia-induced retinal neovascularization, 30 the effect of PEDF on VEGF-induced retinal permeability 15 and retinal blood flow 50 have not been previously evaluated.
  • Intravitreal injection of PEDF 10 min prior to stimulation with 25ng/ml VEGF resulted in a dose-dependant suppression of VEGF-induced retinal vascular permeability. This effect was initially evident at 2 ng/eye PEDF (estimated final concentration 0.48 nM) with maximal suppression of 114+78% (P ⁇ 0.001) observed at 20 ng/eye.
  • VEGF retinal mean circulation time (MCT) and increase retinal blood flow (RBF). 50 As shown in Table 1 , VEGF decreased MCT in rats by 23 ⁇ 12%
  • PEDF pretreatment completely blocked the VEGF-mediated decrease in MCT (PO.002), actually resulting in a slight increase in MCT that was not statistically significant. Conversely, PEDF pretreatment suppressed the VEGF-mediated increase in RBF by 102+68% (PO.033). PEDF had no significant effect on basal MCT, RBF or mean arterial or venous diameters.
  • VEGF 165 was purchased from R&D Systems Inc. (Minneapolis, MN) . [ 125 I]-VEGF was obtained from Amersham (Buckinghamshire, England). Plasma-derived horse serum, fibronectin, sodium pyrophosphate, sodium fluoride, sodium orthovanadate, aprotinin, leupeptin, and phenylmethylsulfonyl fluoride were obtained from Sigma (St. Louis, MO). Rabbit polyclonal anti-phospho-p44/p42 MAPK(ERKl/2) antibody, anti-phospho-Akt, anti-Akt, anti-phospho-eNOS and anti- phospho-panPKC antibodies were purchased from Cell Signaling (Beverly, MA).
  • Rabbit polyclonal anti-eNOS antibody was purchased from Pharmingen/ Transduction Laboratories (San Diego, CA). Rabbit polyclonal anti-phospho-threonine, anti-p85 antibodies, and mouse monoclonal anti-phosphotyrosine antibody (4G10) were obtained from Upstate Biotechnology, Inc (Lake Placid, NY). Rabbit polyclonal anti- ERKl, anti-KDR, anti-phospho-p38 antibodies, and anti-mouse PLC- ⁇ , anti-SHP-1 and anti-SHP-2 antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Rabbit anti-phospho-serine antibody and anti- ⁇ 3 integrin antibody were purchased from Chemicon International, Inc. (Temecula, CA).
  • Reagents for sodium dodecyl sulfate-polyacrylamide gel electrophoresis were obtained from Bio-Rad (Richmond, CA). Protein A-Sepharose was purchased from Amersham Pharmacia Biotech (Piscataway, NJ). Lysine-conjugated 70-kDa fluorescein dextran was obtained from Molecular Probes (Eugene, OR). PEDF protein was expressed and purified using a human embryonic kidney (HEK) 293 cell line which was stably transfected with an expression plasmid for human PEDF, as previously described.
  • HEK human embryonic kidney
  • BREC bovine micro vascular retinal endothelial cells
  • BREC were transfe ⁇ ed to new fibronectin-coated dishes using a cloning ring and Dulbecco's minimal essential medium (DMEM) containing 10% fetal bovine serum (FBS, Gibco BRL, Grand Island, NY) and 50 ⁇ g/ml ECGF.
  • DMEM Dulbecco's minimal essential medium
  • FBS fetal bovine serum
  • FBS fetal bovine serum
  • Immunoprecipitation After treatment, cells were washed with cold PBS and harvested on ice in lysis buffer (1% Triton X-100, 50 mmol/1 HEPES, 10 mmol/1 EDTA, 10 mmol/1 sodium pyrophosphate, 100 mmol/1 NaF, 1 mmol/1 Na 3 VO 4 , 1 ⁇ g/ml aprotinin, 1 ⁇ g/ml leupeptin, and 2 mmol/1 PMSF). The suspension was incubated on ice for 15min and centrifuged at 3600 rpm for 30 min.
  • lysis buffer 1% Triton X-100, 50 mmol/1 HEPES, 10 mmol/1 EDTA, 10 mmol/1 sodium pyrophosphate, 100 mmol/1 NaF, 1 mmol/1 Na 3 VO 4 , 1 ⁇ g/ml aprotinin, 1 ⁇ g/ml leupeptin, and 2 mmol/1 PMSF.
  • the supernatant as harvested and protein concentration was measured with Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, Calif.)
  • Bio-Rad protein assay Bio-Rad Laboratories, Hercules, Calif.
  • 1ml of the supernatant containing lmg total protein was incubated with lO ⁇ g of antibody against KDR for 2hr at 4 °C with rotation.
  • Protein A-Sepharose 4B suspension (20 ⁇ l of a 50% suspension) was added and rotated for lhr at 4 °C.
  • the immunocomplexes were separated by centrifugation, washed five times, and boiled for 3 min in Laemmli sample buffer.
  • Immunoblot analysis BREC were washed with cold PBS and lysed in lysis buffer. Protein concentrations were determined with Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, Calif.) Total cell lysates (50 ⁇ g) or immnoprecipitated proteins were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions and proteins were transfe ⁇ ed to nitrocellulose membrane (Bio-Rad, Hercules, CA). The blots were processed with appropriate antibodies followed by incubation with horseradish peroxidase-conjugated secondary antibody (Amersham, Piscataway, NJ). Visualization was performed using Amersham Enhanced Chemiluminescence detection system (ECL) per manufacturer's instructions.
  • ECL Amersham Enhanced Chemiluminescence detection system
  • VEGF Specific Binding Monolayers of subconfluent BREC grown in 12-well plates were incubated for 4 hours at 4°C in DMEM, 1% calf serum and 0.0 lnM 125 I- VEGF in the absence or presence of 100- fold excess of unlabelled VEGF. The monolayers were washed twice with cold PBS containing 0.1% bovine serum albumin (BSA), solubilized with 0.1 % SDS and counted in a gamma counter (Tracor Analytic, Elk Grove Village, IL model 1825).
  • BSA bovine serum albumin
  • Animal preparation Albino male Sprague-Dawley rats weighing 200 - 250g were used for all experiments. Each animal, 24h before the study, underwent surgical implantation of polyvinyl catheter (internal diameter 0.5mm, external diameter.0.8mm, length 20cm) into the right jugular vein after anesthetization by intraperitoneal injection of 0.1 mg/kg sodium amobarbital as previously described. 33 Immediately before the experiments, each rat was anesthetized as described above and both eyes were dilated using 1% tropicamide. Intravitreal injections were performed as previously described. 15 After the baseline fluorescence measurement, 30ul of 10% sodium fluorescein was injected into the rat via the externalized catheter port. Vitreous volume of the rat eye was estimated by the analysis of Hughes. Animals were cared for according to the ARVO Statement on the Use of Animals in Ophthalmic and Vision Research.
  • Vitreous Permeability Analysis Vitreous fluorophotometry was performed as previously described. 15 Briefly, the emitted light from the sample collected using Omnichrome argon laser (La Jo 11a, CA) and Haag-Streit slit-lamp (Germany) with slight modification, was dispersed through a monochromator and focused on an intensified 1024 photodiode element array detector of the TRACOR Northern detection system. The resulting spectra of emitted light were stored to disc for further analysis. The analysis was perfo ⁇ ned as described previously.
  • Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246,
  • Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age- related macular degeneration- related choroidal neovascular membranes. Invest. Ophthalmol. Vis. Sci. 37, 855-868 (1996).
  • Vascular endothelial growth factor is sufficient to produce iris neovascularization and neovascular glaucoma in a nonhuman primate. Arch. Ophthalmol. 114, 964-970 (1996).
  • Vascular endothelial growth factor-induced retinal permeability is mediated by protein kinase C in vivo and suppressed by an orally effective beta-isoform-selective inhibitor. Diabetes 46, 1473-1480 (1997).
  • Pigment epithelium-derived factor is a survival factor for cerebellar granule cells in culture. J. Neurochem. 64, 2509-2517 (1995).
  • PEDF Pigment epithelium-derived factor
  • Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells. J. Clin. Invest 100, 3131-3139 (1997). 50. Clermont,A.C, Aiello,L.P., Mori,F., Aiello,L.M. & Bursell,S.E.
  • Vascular endothelial growth factor and severity of nonproliferative diabetic retinopathy mediate retinal hemodynamics in vivo: a potential role for vascular endothelial growth factor in the progression of nonproliferative diabetic retinopathy.
  • Vascular endothelial growth factor induces rapid phosphorylation of tight junction proteins occludin and zonula occluden 1.
  • Vascular endothelial growth factor stimulates tyrosine phosphorylation and recruitment to new focal adhesions of focal adhesion kinase and paxillin in endothelial cells. J. Biol. Chem. 272, 15442-15451 (1997). 57. Esser,S., Lampugnani,M.G., Corada,M., Dejana,E. & Risau,W.
  • Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells. J. Cell Sci. Ill, 1853-1865 (1998).
  • Tumor necrosis factor employs a protein-tyrosine phosphatase to inhibit activation of KDR and vascular endothelial cell growth factor- induced endothelial cell proliferation. J. Biol. Chem. 275, 11216-11221 (2000).
  • Shp-2 tyrosine phosphatase is a signal enhancer of the epidermal growth factor receptor in mammals. Proc Natl. Acad. Sci. U. S. A 96, 8528-8533 (1999). 68. Tsuda,M. et al. Integrin-mediated tyrosine phosphorylation of SHPS-1 and its association with SHP-2. Roles of Fak and Src family kinases. J. Biol. Chem. 273, 13223-13229 (1998).
  • the B-cell transmembrane protein CD72 binds to and is an in vivo substrate of the protein tyrosine phosphatase SHP-1. Curr. Biol. 8, 1009- 1017 (1998).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

La présente invention concerne une méthode de modulation de l'angiogenèse, par exemple dans l'oeil. La méthode consiste à moduler une protéine tyrosine phosphatase (PTP) contenant un domaine SH2.
PCT/US2003/001749 2002-01-22 2003-01-22 Methodes de modulation de l'angiogenese WO2003061520A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003217229A AU2003217229A1 (en) 2002-01-22 2003-01-22 Methods of modulating angiogenesis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US35116902P 2002-01-22 2002-01-22
US60/351,169 2002-01-22

Publications (2)

Publication Number Publication Date
WO2003061520A2 true WO2003061520A2 (fr) 2003-07-31
WO2003061520A3 WO2003061520A3 (fr) 2003-12-18

Family

ID=27613468

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/001749 WO2003061520A2 (fr) 2002-01-22 2003-01-22 Methodes de modulation de l'angiogenese

Country Status (2)

Country Link
AU (1) AU2003217229A1 (fr)
WO (1) WO2003061520A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141258A2 (fr) * 2006-06-09 2007-12-13 Rheinische Friedrich-Wilhelms-Universität Bonn Méthode pour diagnostic précoce de rétinopathie diabétique proliférative
WO2008016996A2 (fr) * 2006-08-01 2008-02-07 Joslin Diabetes Center, Inc. Procédés de modulation de la mémoire métabolique

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6156551A (en) * 1998-06-05 2000-12-05 Beth Israel Deaconess Medical Center Activated mutants of SH2-domain-containing protein tyrosine phosphatases and methods of use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6156551A (en) * 1998-06-05 2000-12-05 Beth Israel Deaconess Medical Center Activated mutants of SH2-domain-containing protein tyrosine phosphatases and methods of use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HUANG L. ET AL.: 'HCPTA, a protein tyrosine phosphatase that regulates vascular endothelial growth factor receptor-mediated signal transduction and biological activity' J. BIOL. CHEM. vol. 274, no. 53, December 1999, pages 38183 - 38188, XP002970569 *
WANG J. ET AL.: 'Machanistic studies on full length and the catalytic domain of the tandem SH2 domain-containing protein tyrosine phosphatase: Analysis of phophoenzyme levels and Vmax stimulatory effects of glycerol and a phosphotyrosyl peptide ligand' BIOCHEMISTRY vol. 36, 1997, pages 2993 - 2999, XP002970568 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141258A2 (fr) * 2006-06-09 2007-12-13 Rheinische Friedrich-Wilhelms-Universität Bonn Méthode pour diagnostic précoce de rétinopathie diabétique proliférative
WO2007141258A3 (fr) * 2006-06-09 2008-01-31 Univ Bonn Méthode pour diagnostic précoce de rétinopathie diabétique proliférative
WO2008016996A2 (fr) * 2006-08-01 2008-02-07 Joslin Diabetes Center, Inc. Procédés de modulation de la mémoire métabolique
WO2008016996A3 (fr) * 2006-08-01 2008-08-21 Joslin Diabetes Center Inc Procédés de modulation de la mémoire métabolique

Also Published As

Publication number Publication date
AU2003217229A1 (en) 2003-09-02
WO2003061520A3 (fr) 2003-12-18

Similar Documents

Publication Publication Date Title
US20080038245A1 (en) Methods of modulating angiogenesis
US7175844B2 (en) Methods of modulating fibrosis
US9132169B2 (en) Methods and compositions for modulating adipocyte function
US7700555B2 (en) Methods of treating diabetes
US20020091082A1 (en) Methods of modulating symptoms of hypertension
US20050142596A1 (en) Methods of diagnosing renal and cardiovascular disease
US7256176B2 (en) Methods of modulating β cell function
US7410756B2 (en) Methods of modulating angiogenesis
US20040023386A1 (en) Modulation of nitric oxide synthase by PKC
WO2003061520A2 (fr) Methodes de modulation de l'angiogenese
WO2003083057A2 (fr) Adipocytes et leurs utilisations
WO2006019824A2 (fr) Procede de traitement du diabete
US6759201B2 (en) Method of identifying a neural progenitor cell by evaluating expression of daedalos
US20030073634A1 (en) Methods of treating obesity
US20080102032A1 (en) Methods of Treating Diabetes Using Inhibitors of ARNT2
US20050136039A1 (en) Adipocytes and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP