WO2003055995A2

WO2003055995A2 - Lipase genes and proteins

Info

Publication number: WO2003055995A2
Application number: PCT/CA2002/001998
Authority: WO
Inventors: Xiao-Yan Wen; A. Keith Stewart; Lap-Chee Tsui; Robert A. Hegele
Original assignee: Xiao-Yan Wen; Stewart A Keith; Lap-Chee Tsui; Hegele Robert A
Priority date: 2001-12-21
Filing date: 2002-12-23
Publication date: 2003-07-10
Also published as: AU2002351616A1; CA2471119A1; WO2003055995A3; EP1492873A2; AU2002351616A8

Abstract

Lipase proteins play important role in tissue or plasma lipid and lipoprotein metabolism and function to hydrolize lipid such as triglycerides. Disease associates with lipase function indludes lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism. The invention describes two novel lipase proteins (LPDL and LPDLR) and the nucleic acids encoding them as well as the regulatory sequences controlling their gene expression. The invention relates to use of LPDL and/or LPDLR nucleic acid or their proteins in modulating cellular process in disease state or in normal energy homeostasis. The invention also relate to their modulators, antibodies, antisense oligonucleotides and diagnostic assays, the screening for mutations, gene therapy, use of their promoters to control gene expression, and their industrial use in food industry and oil and waste management. The invention also relates methods of drug screening for LPDL and LPDLR, their therapeutic use in humans and their use as pharmaceutical compositions.

Description

TITLE: Lipase Genes and Proteins FIELD OF THE INVENTION

The invention relates to the field of lipase structure and function, triglyceride metabolism, lipoprotein metabolism and energy homeostasis, and is concerned with novel lipase proteins, LPDL and LPDLR, nucleic acids encoding the proteins, nucleic acids controlling their gene expression and methods and agents for their manipulation for the modulation of cellular processes, and their use in basic research, industry, disease prevention, diagnosis and therapy. BACKGROUND OF THE INVENTION (i) Triglyceride metabolism

Plasma triglyceride (TG) is associated with increased atherosclerosis risk and TG metabolism is crucial for whole body and local energy homeostasis. A number of thorough reviews of TG metabolism have been published (Zilversmit 1995; Adeli et al. 2001 ; Hegele 2001; Moghadasian et al. 2001; Jin et al. 2002). Briefly, in the intestine, pancreatic lipase (PNLIP) hydrolyses dietary TG to liberate free fatty acid (FFA), that is absorbed both passively and actively. Several different classes of membrane proteins have been proposed as FA acceptors or transporters (Glatz and Storch 2001). FA trafficking by soluble intracellular FA binding proteins may involve interaction with specific membrane or protein targets, such as FABP2. Within enterocytes, processing by partially characterized biosynthetic pathways prepare TG for assembly together with cholesterol esters [CE], apolipoprotein (apo) B-48 and apo E, which is mediated by microsomal TG transfer protein (MTP). The assembly process creates chylomicrons (CM) for secretion into lymph and plasma. In the liver, fat or carbohydrate that is not required for energy is converted to TG through several partially characterized biosynthetic pathways (Hegele 2001). Acyl-CoA: diacylglycerol acyltransferase (DGAT) is a microsomal enzyme that catalyzes the terminal and only committed step in TG synthesis. DGAT had been considered necessary for adipose tissue formation and essential for survival. Two groups (Oelkers et al. 1998; Cases et al. 1998) independently cloned the DGAT gene. While there are no human DGAT mutations, targeted disruption produces lean mice that resisted diet-induced obesity, but still synthesized TG (Smith et al. 2000), suggesting the existence of other DGAT-like enzymes. Indeed a new diacylglycerol acyltransferase gene DGAT2 was recently identified which conferred high levels of DGAT activity (Lardizabal et al. 2001 The systhesized TG as the major form of energy storage within the adipocytes increases body fat and weight. However, another important control of adipose triglycerides is hormone sensitive lipase which hydrolyzes adipocyte TG and provide the body with energy (Kahn 2000). Within hepatocytes, MTP directs the assembly of TG and CE together with apo B-100 and apo E to produce very low-density lipoproteins (VLDL) for secretion into plasma. In the capillaries of adipose tissue and muscle, CM and VLDL core TG are hydrolyzed to FFA by endothelial-bound lipoprotein lipase (LPL), using apo CII as a co-factor. FFA are re-esterified and stored as TG within adipocytes, or oxidized to provide energy in muscle. CM and VLDL are remodeled into smaller, denser, more CE-rich CM remnants (CMR) and intermediate density lipoprotein (IDL), respectively. CMR and some IDL are cleared by apo E-mediated endocytosis through hepatic remnant receptors, contributing to the hepatic lipid pool. IDL that is not cleared is then hydrolyzed by hepatic lipase (HL or LIPC) making smaller, CE-rich LDL particles.

While all plasma lipoprotein metabolic pathways are complex and interconnected, TG and HDL metabolism are especially closed linked. Clinically, elevated TG occurs almost always together with depressed HDL cholesterol. Liver and small intestine produce nascent HDL particles, which attract excess FC from both extra-hepatic cells and other circulating lipoproteins. Phospholipids (PL) and FC that accumulate in the intimal layer of the arteries are transferred to apo Al of nascent HDL, a process mediated by the ATP-binding cassette A-l transporter (ABCAl). Using apo Al as a cofactor, plasma lecithin: cholesterol acyltransferase (LCAT) converts FC to CE, providing a source of core lipid for HDL. Plasma cholesteryl ester transfer protein (CETP), and PL transfer protein (PLTP), modify HDL by shuttling CE and PL between HDL and TG-rich lipoproteins (VLDL and CM). HL hydrolyzes HDL TG, thus reducing HDL size. HDL delivers cholesterol to the liver, and scavenger receptor BI

(SRBI) mediates selective uptake of lipids. Macrophages depend on cholesterol efflux through transfer to HDL to prevent lipid accumulation (Nicholson et al. 2000; van Berkel et al. 2000).

It is clear that enzymes and transfer proteins within the plasma compartment, such as LPL and CETP, have pleiotropic effects on many classes of lipoproteins (Hegele 2001). Thus, newly identified gene products, such as LPDL, may be reasonably expected to have pleiotropic effects on plasma lipids and lipoproteins, and likely on tissue lipids.

(ii) Plasma TG and coronary heart disease (CHD) risk The complexity of mechanisms that underlie the association between hypertriglyceridemia and atherosclerosis obscures ascertainment of a direct causal relationship (Forrester 2001). Pro-atherogenic metabolic and biochemical abnormalities, such as obesity, diabetes, decreased HDL cholesterol, increased small-dense LDL, increased FFA, dysglycemia, hyperinsulinemia, increased plasma viscosity, increased inflammatory molecules, impaired fibrinolysis and pro-thrombosis, are often associated with elevated TG. Any of these associated factors will increase atherosclerosis risk. Recent epidemiologic consensus opinion is that moderately elevated plasma TG (between 2.3 and 9.3 mmol/L), usually due to excess VLDL and/or remnant particles, appears to be independently associated with increased CHD risk (Austin 1999; Yarnell et al. 2001), especially in familial hypertriglyceridemia (Austin et al. 2000). In contrast, grossly elevated plasma TG (>12 mmol/L), usually due to excess CM, is associated with increased risk of pancreatitis, but not necessarily CHD (Santamarina-Fojo 1998). Studies in which treatment was given to lower TG have shown improved CHD outcomes, although this is often hard to attribute to an affect on TG specifically (Hodis et al. 1994; Frick et al. 1997; Rubins et al. 1999). Mechanistically, CM, VLDL or their remnants may act directly in atherogenesis, contributing to arterial wall foam cell formation (Gianturco et al. 1982; Evans et al. 1993). Because post-prandial FFA released from lipolysis impair physiological endothelial response, a newer concept is that post-prandial lipemia may independently predict CHD. While factors such as diet, alcohol, obesity and diabetes contribute to moderate hypertriglyceridemia, the primary molecular mechanisms underlying inter-individual variation in response to such secondary factors remain incompletely characterized in most hypertriglyceridemic patients (Hegele 2001).

(iii) Lipase and lipase mutations

Lipases hydrolyze a wide range of esterified FA species within triglyceride (TG), and are often active against other substrates, such as phospholipids (PLs). At least 20 lipases or lipase-like molecules have been given names and accession numbers in OMEVI (http ://www.ncbi.nlm.nih. gov/entrez/queryl . These have been characterized based upon factors such as their anatomical distribution, localization intra- or extra-cellularly, substrate specificity, and or homology with other lipases (Hide et al. 1992). For instance, lipases that function within the plasma compartment, anchored to endothelium by heparan sulfate proteoglycans, include, in order from most-to-least-potent TG lipase activity, and least-to- most-potent PL lipase activity, LPL, HL, and EL (Jin et al. 2002). Other lipases are non- secreted and have predominantly intracellular hydrolytic activity, such as hormone sensitive lipase (HSL) and lysosomal acid lipase (LAL) (Holm et al. 1988). The activity of some other lipases is extra-corporeal, such as that of pancreatic lipase (PNLIP) within the intestine.

Lipases are evolutionarily conserved within superfamily members and between species. One highly conserved motif includes the lipase consensus sequences G-X-S-X-G that contains the active site serine which forms a catalytic triad with His and Asp that minics the catalytic triad of trysin (Emmerich et al. 1992; Lowe 1997). The crystal structure analysis of pancreatic lipase revealed Serl53, His264 and Aspl77 as its triad (Lowe 1997). Other structural features include conserved cystine residues in disulfide bridge formation for tertiary structure and the lid motif which determines the substrate specificity (van Tibeurgh et al. 1994, Dugi et al. 1995). For most triglyceride lipases, the lid loop is composed of 19~23 amino acids between two conserved systine residue (Dugi et al. 1995). Lipase genes usually contain 9~10 exons. Human LPL gene contains 10 exons that spans a genomic region of 30 kb on chromosome 8 with mutations mostly detected in exon 5 and 6 (Deeb et al, 1989; Ishimura- Oka, et al., 1992). Human hepatic lipase on chromosome 15 contains 9 exons and was reported to 35 kb in size (Ameis et al., 1990).

More than ten phospholipases (PLases) and related genes are cited in OMIM. These include PLases Al, A2, C, D and lysophospholipase. Almost all of these have no disease causing mutation and no disease association (Jin et al. 2002). A new member of the PLase family, phosphatidylserine phospholipase Al (PS-PLA1), has recently been described. Surprisingly PS-PLA1 does not show any homology to PLase members, but shows about 30% homology to mammalian TG lipases HL, LPL and PL (Sato et al. 1997), a finding that in consistent with the observed reactivity of other members of the lipase superfamily against various substrates.

Naturally occurring loss-of-function mutations in LPL cause chylomicronemia (Santamarina-Fojo 1998; Hegele 2001), some ZEZ, SNPs are fairly consistently associated with metabolic and cardiovascular phenotypes (Busch and Hegele 2000), and LPL knock-out and transgenic mice have instructive phenotypes involving the expected alterations in plasma TG and HDL (Goldberg and Merkel 2001). Similarly, naturally occurring loss-of-function mutations in HL cause a complex hyperlipidemia with early atherosclerosis (Hegele et al. 1993), some HL SNPs, especially -514C>T, are fairly consistently associated with metabolic and cardiovascular disease phenotypes (Cohen et al. 1999; Hegele 2001), and HL knock-out and transgenic mice have instructive phenotypes that reflect the human phenotypes (Kawano et al. 2002). In contrast, neither naturally occurring human mutations, nor induced murine mutations in EL have yet been reported, although several common SNPs have been associated with variation in plasma concentrations of HDL cholesterol (deLemos et al. 2002). Mild to moderate hypertriglyceridemia (Fredrickson Type IV) with low HDL cholesterol is among the most common hyperlipidemia seen in many lipid clinics, but most patients have no mutation in either LPL or HL. Thus, it remains important to identify new candidate genes for TG metabolism using a variety of experimental approaches as required.

(iv, Ipd insertional mutation Microinjection of cloned DNA directly into the pronucleus of a fertilized egg is the most widely used method for generating transgenic mice. The injection of foreign DNA into the zygote normally results in chromosomal integration. The transgene probably integrates randomly into the mouse genome. Occasionally this integration will disrupt an endogenous gene and results in a mutation, which is designated an "insertional mutation". The overall frequency of generating insertional mutations by microinjection is estimated to be 5-10% (Palmiter et al. 1986).

We previously identified a mouse transgenic insertional mutation, Ipd (for "lipid defect"), characterized by perinatal accumulation of TG in both plasma and liver (Wen et al. 1998). The Ipd mutation was recessive and induced by LacZ transgene. Apart from elevated plasma triglyceride level, the Ipd homozygotes are runts and develop fatty livers. Molecular cloning of the transgene-flanking sequences led to mapping of the Ipd locus to the distal part of murine chromosome 16 (Wen et al. 1998). Further mapping studies ruled out the identity of Ipd with a recently identified phospholipase gene psp lal in its vicinity (Wen et al. 2001). The locus in a mouse insertional mutation is genetically tagged by the transgene, which provides a unique marker to clone the genetic locus and to identify the affected gene. The fortuitous observation of plasma and tissue TG disturbances in the insertional mutation from the γF-crystallin promoter/ZαcZ Z-14 transgenic mouse experiments provided an important clue - actually a positional clue - that some gene within the disrupted Ipd locus on murine chromosome 16 was a key determinant of TG metabolism.

SUMMARY OF THE INVENTION

The present invention relates to two novel lipase proteins, LPDL and LPDLR and to the nucleic acid molecules encoding them as well as to expression vectors comprising the nucleic acid molecules of the invention and host cells transformed with the expression vectors.

The protein sequences of LPDL and LPDLR are described in Figure IB

(SEQ._D.NO:2), Figure 2B (SEQ.ID.NO:4), Figure 2D (SEQ.ID.NO:6), Figure 3B

(SEQ.ID.NO:8), Figure 4B (SEQ.ID.NO:10) or, Figure 4D (SEQ.ID.NO: 12).

The invention also relates to fragments, analogs, homologs, derivatives or mimetics of the LPDL or LPDLR proteins and to antibodies that can bind the LPDL or LPDLR proteins or fragments, analogs, homologs, derivatives or mimetics thereof.

The nucleic acid sequences of LPDL and LPDLR include the cDNA sequences of the genes including a nucleic acid sequence as shown in Figure 1A (SEQ.ID.NO:l), Figure 2A

(SEQ.ID.NO:3), Figure 2C (SEQ._D.NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ._D.NO:9), Figure 4C (SEQ.ID.NO:l l); including promoter and regulatory sequences for controlling gene expression as shown in Figure 21-A for mouse Ipdl (SEQ.BD.NO:77), 21- B for human LPDL gene (SEQ.ID.NO:78), Figure 22-A for mouse Ipdlr (SEQ.ID.NO:79), 22- B for human LPDLR gene (SEQ.ID.NO:80); and including exon/intron sequences of the genes as shown in Figure 15 of human LPDL gene: Exon/Intron 1 (SEQ.ID.NO.17), Exon/Intron 2 (SEQ._D.NO.18), Exon/Intron 3 (SEQ.ID.NO.19), Exon/Intron 4 (SEQ.ID.NO.20), Exon/Intron 5 (SEQ.ID.NO.21), Exon/Intron 6 (SEQ.ID.NO.22), Exon/Intron 7 (SEQ.ID.NO.23), Exon/Intron 8 (SEQ.ID.NO.24), Exon/Intron 9 (SEQ._D.NO.25), and Exon/Intron 10 (SEQ.ID.NO.26); and in Figure 16-A as exon sequences and adjacent intron sequences of human LPDLR gene: Exon/Intron 1 (SEQ.ID.NO.27), Exon/Intron 2 (SEQ.ID.NO.28), Exon/Intron 3 (SEQ.ID.NO.29), Exon/Intron 4 (SEQ.ID.NO.30), Exon/Intron 5 (SEQ.ID.NO.31), Exon Intron 6 (SEQ.ID.NO.32), Exon Intron 7 (SEQ.ID.NO.33), Exon Intron 8 (SEQ.ID.N0.34), Exon/Intron 9 (SEQ.ID.NO.35) and Exon/Intron 10 (SEQ.ID.NO.36).

The invention also relates to fragments, analogs, homologs, derivatives of the nucleic acids of LPDL and LPDLR including both cDNA, exon and intron seuqences and the promter and regulatory elements for gene expression.

The invention also relates to methods for identifying substances which can bind with LPDL or LPDLR protein, to methods for identifying compounds that affect LPDL or LPDLR protein activity or expression and to methods for identifying compounds that affect the binding of LPDL or LPDLR with an LPDL or LPDLR binding protein.

The invention also relates to the use of agents capable of modulating the expression of a nucleic acid molecule of the invention to modulate tissue or plasma lipid and lipoprotein metabolism. It further relates to the use of an agent that can stimulate the activity or expression of an LPDL or LPDLR protein to treat conditions selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjδgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism. Additionally, the invention relates to methods for detecting conditions associated with increased or decreased LPDL or LPDLR expression. Such conditions include disorders selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjδgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

The invention also relates to pharmaceutical compositions comprising a nucleic acid molecule of the invention, an antisense oligonucleotide complimentary to a nucleic acid molecule of the invention, a LPDL or LPDLR protein or gene, a compound identified by the methods of the invention, or a substance capable of modulating the expression or activity of an LPDL or LPDLR protein in admixture with a suitable diluent or carrier including an antisense oligonucleotide complimentary to a nucleic acid molecule of the invention.

The invention also relates to methods for screening a subject for a mutation in a LPDL or LPDLR protein which comprises obtaining a sample from the subject, comparing the sequence of the LPDL or LPDLR gene from the sample with the corresponding wild type gene sequence, wherein a difference indicates a mutation in the LPDL or LPDLR gene in the sample.

The invention also teaches a nucleic acid molecule comprising: (a) a nucleic acid sequence as shown in Figure 1A (SEQ.ID.NO: !), Figure 2A (SEQ.ID.NO:3), Figure 2C (SEQ.ID.NO:5), Figure 3A (SEQ._D.NO:7), Figure 4A (SEQ.ID.NO:9), Figure 4C (SEQ.ID.NO: 11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ.ID.NO.22), (SEQ.ID.NO.23), (SEQ.ID.NO.24), (SEQ.ID.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ._D.NO.28), (SEQ.ID.NO.29), (SEQ.ID.NO.30), (SEQ.ID.N0.31), (SEQ.ID.NO.32), (SEQ._D.NO.33), (SEQ.LD.NO.34), (SEQ.ID.NO.35), (SEQ.1D.N0.36); Figure 21 (SEQ.ID.NO:77), (SEQ.ID.NO:78); or Figure 22 (SEQ.ID.NO:79), (SEQ.ID.NO:80); (b) nucleic acid sequences that have substantial sequence homology to a nucleic acid sequences of (a) or (b); (c) sequences which are at least 90% homologous with a sequence of any of (a) to (b); (d) sequences which are at least 95% homologous with a sequence of any of (a) to (b); (e) sequences which are at least 98% homologous with a sequence of any of (a) to (d); and (f) a sequences which are at least 99% homologous with a sequence of any of (a) to (b).

The invention teaches a method for identifying a compound which inhibits or promotes the activity of a polynucleotide sequence of the invention, comprising the steps of: (a) selecting a control animal having the sequence and a test animal having the sequence; (b) treating the test animal using a compound; and, (c) determining the relative quantity of an expression product of the sequence, as between the control animal and the test animal.

The invention further teaches a method for identifying a compound which inhibits or promotes the activity of a polynucleotide sequence of the invention, comprising the steps of: (a) selecting a host cell of the invention; (b) cloning the host cell and separating the clones into a test group and a control group; (c) treating the test group using a compound; and (d) determining the relative quantity of an expression product of the sequence, as between the test group and the control group.

The invention also teaches a process for producing a polypeptide sequence of the invention comprising the step of culturing the host cell of the invention under conditions sufficient for the production of the polypeptide.

The invention teaches a method for identifying a compound which inhibits or promotes the activity of a polypeptide sequence of the invention, comprising the steps of: (a) selecting a control animal having the sequence and a test animal having the sequence; (b) treating the test animal using a compound; (c) determining the relative quantity or relative activity of an expression product of the sequence or of the the sequence, as between the control animal and the test animal.

The invention teaches a composition for treating a disorder of tissue or plasma lipid and lipoprotein metabolism comprising a compound which modulates a polynucleotide sequence of the invention and a pharmaceutically acceptable carrier. The disorder may be selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism. The compound may be selected from the group consisting of small organic molecules, peptides, polypeptides, antisense molecules, oligonucleotides, polynucleotides, triglycerides and derivatives thereof.

The invention teaches a method for diagnosing the presence of or a predisposition for a lipase disorder or lipid metabolism disorder in a subject by detecting a germline alteration in a sequence of the invention in the subject, comprising comparing the germline sequence of a sequence of the invention from a tissue sample from the subject with the germline sequence of a wild-type of the sequence, wherein an alteration in the germline sequence of the subject indicates the presence of or a predisposition to the triglyceride disorder. The disorder may be selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia, fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. Fa preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism. The comparing may be performed by a method selected from the group consisting of immunoblotting, immunocytochemistry, enzyme-linked immunosorbent assay, DNA fingerprinting, in situ hybridization, polymerase chain reaction, reverse transcription polymerase chain reaction, radioimmunoassay, immunoradiometric assay and immunoenzymatic assay. The alteration may occur at a SNP selected from the group consisting of but not limiting to C55Y, G364E, E431K and D444E of LPDL gene and SNPs within R gene.

The invention teaches a method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL, LPDLR, and the control regions thereof, comprising the steps of: (a) selecting a control animal having the polynucleotide and a test animal having the polynucleotide; (b) treating the test animal using a compound; and, (c) determining the relative quantity of an expression product of the polynucleotide, as between the control animal and the test animal.

The invention teaches a method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL, LPDLR, and the control regions thereof comprising the steps of: (a) selecting a host cell having the polynucleotide, wherein the host cell is heterologous to the polynucleotide; (b) cloning the host cell and separating the clones into a test group and a control group; (c) treating the test group using a compound; and (d) determining the relative quantity of an expression product of the polynucleotide, as between the test group and the control group.

The invention teaches a method for identifying a compound modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) selecting a control animal having the polypeptide and a test animal having the polypeptide; (b) treating the test animal using a compound; (c) determining the relative quantity or relative activity of an expression product of the polypeptide or of the the polypeptide, as between the control animal and the test animal. The invention teaches a method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) selecting a host cell comprising the polypeptide, wherein the host cell is heterologous to the polypeptide; (b) cloning the host cell and separating the clones into a test group and a control group; (c) treating the test group using a compound; and (d) determining the relative quantity or relative activity of an expression product of the polypeptide or of the the polypeptide, as between the test group and the control group.

The invention teaches a method for identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) selecting a control animal having the polynucleotide and a test animal having the polynucleotide; (b) treating the test animal using a compound; and, (c) determining the relative quantity of an expression product of an operably linked polynucleotide to the polynucleotide, as between the control animal and the test animal.

The invention teaches a method for identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) selecting a host cell comprising the polynucleotide, wherein the host cell is heterologous to the polynucleotide; (b) cloning the host cell and separating the clones into a test group and a control group; (c) treating the test group using a compound; and (d) determining the relative quantity of an expression product of an operably linked polynucleotide to the polynucleotide, as between the test group and the control group.

The invention teaches a composition for treating a lipase or lipid disorder comprising a compound which modulates a polynucleotide from the coding sequence selected from the group consisting of LPDL and LPDLR, and a pharmaceutically acceptable carrier. The disorder may be selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism. The invention further teaches a method for identifying a compound which modulates a biological activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) providing an assay which measures a biological activity of the selected polypeptide; (b) treating the assay with a compound; and (c) identifying a change in the biological activity of the selected polypeptide, wherein a difference between the treated assay and a control assay identifies the compound as modulator of the polypeptide.

The invention further teaches the use of a cell containing a transgene comprising a polypeptide of the invention for cell therapy by administration to a patient in need thereof.

The invention further teaches a process for expression of a protein product of a polypeptide selected from the group consisting of LPDL and LPDLR comprising the steps of: (a) providing a recombinant DNA cloning vector system which integrates into the genome of an host single cell organism, a vector system comprising: DNA-sequences encoding functions facilitating gene expression comprising a promoter, transcription initiation sites, and transcription terminator and a polypeptide selected from the group consisting of LPDL and LPDLR; (b) transforming the host with the recombinant DNA cloning vector system from step (a); and (c) culturing the transformed host in a culture medium.

Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described in relation to the drawings in which:

Figures 1A (SEQ.ID.NO: 1) and B (SEQ.ID.NO:2) show the nucleic acid and amino acid sequences, respectively for human LPDL.

Figures 2A (SEQ.ID.NO.3), B (SEQ.ID.N0.4), C (SEQ.ID.NO:5) and D (SEQ.DD.NO:6) show the nucleic acid or amino acid sequences for mouse lpdl. Figures 3A (SEQ.ID.N0.7) and B (SEQ.ID.N0.8) show the nucleic acid and amino acid sequences, respectively, for mouse lpdlr.

Figures 4A (SEQ.ID.N0.9), B (SEQ.ID.NO.10), C (SEQ.ID.NO: 11) and D (SEQ.ID.NO: 12) show the nucleic acid or amino acid sequences for human LPDLR. Figure 5 shows the shotgun sequencing of BAC clone for identification of LPDL gene exons and Ipd lipase sequences.

Figure 6 shows the nucleic acid sequence of contig #6 from the BAC clones (SEQ.ID.NO.13).

Figure 7 shows the nucleic acid sequence of contig #28 from the BAC clones (SEQ.ID.NO.14).

Figure 8 shows the nucleic acid sequence of contig #86 from the BAC clones (SEQ.ID.NO.15).

Figure 9 shows the nucleic acid sequence of contig #98 from the BAC clones (SEQ.ID.NO.16). Figures 10 A and B show gene expression of LPDL and LPDLR

Figure 11 shows the cDNA and amino acid sequences of human LPDL highlighting the ORF, lipase consensus sequence, conserved cystine residues and catalytic triads.

Figure 12 shows the cDNA and amino acid sequences of mouse lpdlr highlighting the ORF, lipase consensus sequence, conserved cystine residues and catalytic triads. Figure 13 shows a protein sequence comparison of LPDL and LPDLR with other lipases and PS-PLA1.

Figure 14 shows the phylogenetic relationship of the lipase family and PS-PLA1.

Figure 15 shows exon sequences and adjacent intron sequences of human LPDL gene:

Exon/Intron 1 (SEQ.ID.NO.17); Exon Intron 2 (SEQ.ID.NO.18); Exon Intron 3 (SEQ.ID.NO.19); Exon/Intron 4 (SEQ._D.NO.20); Exon/Intron 5 (SEQ.ID.NO.21);

Exon Intron 6 (SEQ.ID.NO.22); Exon/Intron 7 (SEQ.ID.NO.23); Exon Intron 8

(SEQ.ID.NO.24); Exon/Intron 9 (SEQ._D.NO.25); Exon/Intron 10 (SEQ.ID.NO.26);

Figure 16- A shows exon sequences and adjacent intron sequences of human LPDLR gene: Exon/Intron 1 (SEQ.ID.NO.27); Exon/Intron 2 (SEQ.ID.N0.28); Exon/Intron 3 (SEQ.ID.NO.29); Exon Intron 4 (SEQ.ID.NO.30); Exon/Intron 5 (SEQ.ED.N0.31);

Exon/Intron 6 (SEQ.ID.NO.32); Exon/Intron 7 (SEQ.ID.NO.33); Exon/Intron 8

(SEQ.ID.NO.34); Exon/Intron 9 (SEQ._D.NO.35); Exon/Intron 10 (SEQ._D.NO.36);

Figure 16-B shows the assembled LPDLR gene sequences from exons together with encoded protein sequences. Figure 17 shows schematic map of genetic disruption of exon 10 of Ipdl in the Ipd locus.

Figure 1 8-A s hows primer s equences for a mplifying a nd d etecting e xons o f h uman LPDL: Primer IF (SEQ.ID.N0.37); Primer 1R (SEQ.ID.N0.38); Primer 2F (SEQ.ID.NO.39); Primer 2R (SEQ.ED.NO.40); Primer 3F (SEQ.ED.NO.41); Primer 3R (SEQ.ID.NO.42); Primer 4F (SEQ.ID.N0.43); Primer 4R (SEQ.ID.NO.44); Primer 5F (SEQ.ID.NO.45); Primer 5R (SEQ.rD.NO.46); Primer 6F (SEQ.ID.NO.47); Primer 6R (SEQ.ID.NO.48); Primer 7F (SEQ.ID.NO.49); Primer 7R (SEQ.ID.NO.50); Primer 8F (SEQ.LD.NO.51); Primer 8R (SEQ.ID.N0.52); Primer 9F (SEQ.ID.NO.53); Primer 9R (SEQ.ID.NO.54); Primer 10F (SEQ.ID .NO.55); Primer 10R (SEQ.ID .N0.56);

Figure 1 8-B s hows p rimer s equences for amplifying and detecting exons of human LPDLR: Primer IF (SEQ.ID.NO.57); Primer 1R (SEQ.LD.NO.58); Primer 2F (SEQ.JD.NO.59); Primer 2R (SEQ.ID.NO.60); Primer 3F (SEQ._D.NO.61); Primer 3R (SEQ.LD.NO.62); Primer 4F (SEQ._D.NO.63); Primer 4R (SEQ.ID.NO.64); Primer 5F (SEQ.JD.NO.65); Primer 5R (SEQ.rD.NO.66); Primer 6F (SEQ.ID .N0.67); Primer 6R (SEQ.ID.NO.68); Primer 7F (SEQ._D.NO.69); Primer 7R (SEQ.ID.NO.70); Primer 8F (SEQ.ID.N0.71); Primer 8R (SEQ.1D.N0.72); Primer 9F (SEQ._D.NO.73); Primer 9R (SEQ.ID.N0.74); Primer 10F (SEQ._D.NO.75); Primer 10R (SEQ.ID.N0.76).

Figure 19 shows SNPs identified for human LPDL gene. Figure 20 shows significant (P<0.05) quantitative lipoprotein associations with LPDL

SNPs.

Figure 21 -A shows promoter and regulatory sequences of murine Ipdl (SEQ.ID.NO.77), the primer sequences used to clone the promoter fragments and the sizes of cloned fragments; Figure 21-B shows promoter and regulatory sequences of human LPDL (SEQ.ID.N0.78).

Figure 22 shows computing analysis of transcription factor binding sites in 200 bp of murine Ipdl promoter.

Figure 23 -A shows promoter and regulatory sequences of murine LPDL (SEQ.ID.NO.79). Figure 23-B shows promoter and regulatory sequences of human Ipdl

DETAILED DESCRIPTION OF THE INVENTION

The inventors previously identified a mouse perinatal, transgenic insertional mutation,

Ipd (lipid defect), which is characterized by accumulation of triglycerides in the liver and in the plasma. It was hypothesized that this triglyceride accumulation resulted from the transgenic disruption of a putative gene involved in triglyceride metabolism. Molecular cloning of the transgene-flanking sequences led to mapping of the Ipd locus to the distal part of murine chromosome 16 (Wen et. el. 1998). Since the identified human PS-PLA1 demonstrates significant homology to mammalian triglyceride lipases, the inventors first characterized the murine ps-plal to investigate whether it is encoded from Ipd locus. Using mouse whole-genome radiation hybrid (WG-RH) mapping, the ps-plal gene was mapped to the same chromosome as the Ipd locus but with a genetic distance of 17 cM which suggest that ps-plal and Ipd are different genes (Wen et. al. 2001). To further identify the putative lipase gene in the Ipd locus, the inventors used a positional cloning strategy.

Since the insertional locus of Ipd mutation involves gene rearrangement, identifying the disrupted gene directly from the mutant locus is not straight forward. The inventors cloned the entire wild-type region of Ipd locus with bacteria artificial chromosome (BAC). By sequencing one BAC clone (-500 kb sequenced) and in connection with and bioinformatic studies, the inventors have identified lipase-related sequences and discovered a new mouse gene Ipdl (Ipd lipase) that belongs to the triglyceride lipase gene family. Using mouse Ipdl gene fragments as probes, the inventors cloned the human LPDL cDNA and identified its nucleic acid and amino acid sequences. Based on the LPDL sequences and bioinformatic studies, the inventor further identified a second novel lipase related to but distinct from LPDL which is designated LPDL-related lipase (LPDLR).

LPDL and LPDLR demonstrates extensive homology to other members in the lipase gene family with about 30-40% identity at protein level. But interestingly, the lid sequence (12 amino acids) of both LPDL and LPDLR are much shorter than that of the other lipases (19-23). In contrast, it demonstrates similarity with the PS-PLA1 lid sequences that is also composed of 12 amino acids. Previous studies in HL and LPL demonstrate the 22-amino acid loops ("lids") are critical for the interaction with lipid substrate (Dugi et al., 1992). Using the GrowTree program of the web-base SeqWeb Wisconsin GCG package, the inventors have demonstrated that LPDL, LPDLR and PS-PLA1 are very closely related in evolution and they form a subfamily in the lipase family.

By Northern blot and or RNA in situ hybridization, LPDL is expressed strongly in the testis and weakly in the liver while LPDLR is expressed in colon prostate and testis. The genomic structure and exon/intron boundaries of both LPDL and LPDLR genes has been characterized. Ten exons were discovered for both genes. Human LPDL locates on chromosome 21 and spans a huge genetic region of over 100 kb while LPDLR locates on human chromosome 3. The comparison of mouse genomic sequences adjacent to transgene insertion with the gene structure of mouse Ipdl gene revealed that exon 10 was deleted in the mutant Ipd insertional locus, suggesting disruption of Ipdl lipase gene resulted in the observed phenotype in the Ipd mutant mice.

Following the characterization of human LPDL and LPDLR genomic structure, the inventors performed mutation screening of both genes in hypertriglyceridemic subjects and normal populations. For LPDL gene, seven transcribed and six non-transcribed SNPs were discovered. Their allele frequencies were determined from genotyping of normal populations. One coding SNP, C55Y, was only detected in hypertriglyceridemic subjects but not in the normal population, suggesting the discovery of a potential human disease mutation. By sequence comparison with other lipases whose tertiary structure were well characterized (van Tilbeurgh et al. 1994), C55 of LPDL belongs to the conserved cysteine residues required for disulfide bridge formation and is therefore structurally important. Interestingly, further studies of SNP association with lipid traits demonstrated association of a few LPDL SNPs to be associated with HDL cholesterol in a few independently sampled populations. Five SNPs for LPDLR gene have been identified including two transcribed SNPs. However, these two LPDLR coding SNPs appeared to be silent without amino acid substitution.

Since the LPDL gene is highly expressed in testis and weakly expressed in the liver but not in any other tissues examined, LPDL promoter activity is very tissue specific. By comparing the mouse Ipdl and human LPDL gene sequences, the promoter region demonstrates significant sequence homology indicating structural conservation of LPDL promoter across the species. From the BAC#16 DNA of mouse Ipdl gene, the inventors have cloned the promoter region up to -6 kb and generated differently-sized promoter/reporter gene constructs. With computing analysis of the promoter sequences, the inventors also identified potential binding sites for variety of transcription factors. Two recombinant adenoviruses carrying human LPDL and murine Ipdlr lipases have been generated and their function in regulating lipid metabolism is being investigated in animal models. The inventors also expressed the recombinant proteins of human LPDL and mouse lpdlr in Baculo virus system.

I. Nucleic Acid Molecules of the Invention

The present invention provides an isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR protein. In one embodiment, the LPDL nucleic acid molecule is preferentially but expressed in but not limited to testis and liver, and the LPDLR nucleic acid molecule is preferentially expressed in but not limited to testis, prostate, colon, mammary and salivary gland.

The term "isolated" refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized. The term "nucleic acid" is intended to include DNA and RNA and can be either double stranded or single stranded.

In one embodiment of the invention, the LPDL and LPDLR nucleic acid includes a nucleic acid sequence as shown in Figure 1A (SEQ.1D.N0:1), Figure 2A (SEQ.ID.NO:3), Figure 2C (SEQ.ID.NO:5), Figure 3A (SEQ._D.NO:7), Figure 4A (SEQ.ID.NO:9), Figure 4C (SEQ.ID.NO: 11).

In another embodiment of the invention, an isolated nucleic acid molecule is provided having a sequence which encodes a LPDL protein or LPDLR protein having the amino acid sequence as shown in Figure IB (SEQ.ID.NO:2), Figure 2B (SEQ.ID.NO:4), Figure 2D (SEQ.ID.NO:6), Figure 3B (SEQ.ID.NO: 8), Figure 4B (SEQ.ID.NO: 10) or, Figure 4D (SEQ._D.NO: 12).

In another embodiment of the invention, an isolated nucleic acid molecule is provided having a sequence as promoter and/or regulatory elements which control the gene expression of LPDL protein or LPDLR protein as shown in Figure 21 -A for mouse Ipdl (SEQ.FD.NO:77); 21-B for human LPDL gene (SEQ._D.NO:78); Figure 22-A for mouse Ipdlr (SEQ.ID.NO:79); 22-B for human LPDLR gene (SEQ.ID.NO: 80);

In one more embodiment of the invention, an isolated nucleic acid molecule is provided having a exon/intron sequence of LPDL or LPDLR gene having the nucleotide acid sequence as shown in Figure 15 of human LPDL gene: Exon/Intron 1 (SEQ.ID.NO.17), Exon/Intron 2 (SEQ.ID.NO.18), Exon Intron 3 (SEQ.ID.NO.19), Exon/Intron 4 (SEQ.ID.NO.20), Exon/Intron 5 (SEQ.ID.N0.21), Exon/Intron 6 (SEQ.ID.NO.22), Exon Intron 7 (SEQ.ID.NO.23), Exon Intron 8 (SEQ.ID.NO.24), Exon/Intron 9 (SEQ.ID.N0.25), and Exon/Intron 10 (SEQ.ID .NO.26); and in Figure 16-A as exon sequences and adjacent intron sequences of human LPDLR gene: Exon Intron 1 (SEQ.ID.NO.27), Exon/Intron 2 (SEQ.ID.NO.28), Exon Intron 3 (SEQ.lD.NO.29), Exon Intron 4 (SEQ.ID.NO.30), Exon/Intron 5 (SEQ.ID.NO.31), Exon/Intron 6 (SEQ.ID .N0.32), Exon/Intron 7 (SEQ.ID.NO.33), Exon/Intron 8 (SEQ.ID.NO.34), Exon/Intron 9 (SEQ.ID .N0.35) and Exon/Intron 10 (SEQ.ID .N0.36).

In a preferred embodiment, the invention provides an isolated nucleic acid sequence comprising:

(a) a nucleic acid sequence as shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ._D.NO:3), Figure 2C (SEQ.ED.NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ.lD.NO:9), Figure 4C (SEQ.ID.NO: 11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ._D.NO.21), (SEQ.ED.NO.22), (SEQ.ID.NO.23), (SEQ.ID.NO.24), (SEQ.ID.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ.ID.N0.28), (SEQ._D.NO.29), (SEQ.ID.NO.30), (SEQ.ID.NO.31), (SEQ.ID.NO.32), (SEQ.ID.N0.33), (SEQ._D.NO.34), (SEQ.ID.NO.35), (SEQ._D.NO.36); Figure 21 (SEQ.ID.NO:77), (SEQ.ID.NO:78); or Figure 22 (SEQ.ID.NO:79), (SEQ._D.NO:80), wherein T can also be U; (b) a nucleic acid sequence that is complimentary to a nucleic acid sequence of

(a);

(c) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence of (a) or (b);

(d) a nucleic acid sequence that is an analog of a nucleic acid sequence of (a), (b) or (c); or

(e) a nucleic acid sequence that hybridizes to a nucleic acid sequence of (a), (b), (c) or (d) under stringent hybridization conditions.

The term "sequence that has substantial sequence homology" means those nucleic acid sequences which have slight or inconsequential sequence variations from the sequences in (a) or (b), i.e., the sequences function in substantially the same manner and can be used to modulate triglyceride levels. The variations may be attributable to local mutations or structural modifications. Nucleic acid sequences having substantial homology include nucleic acid sequences having at least 65%, more preferably at least 85%, and most preferably 90-95% identity with the nucleic acid sequence as shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ._D.NO:3), Figure 2C (SEQ._D.NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ.ID.NO:9), Figure 4C (SEQ.ID.NO: 11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ.ID.NO.22), (SEQ.ID.NO.23), (SEQ._D.NO.24), (SEQ._D.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ._D.NO.28), (SEQ.ID.NO.29), (SEQ.ID.NO.30), (SEQ.ID.NO.31), (SEQ.ID.NO.32), (SEQ.ID.N0.33), (SEQ.ID.NO.34), (SEQ.ID.NO.35), (SEQ.ID.NO.36); Figure 21 (SEQ._D.NO:77), (SEQ._D.NO:78) or Figure 22 (SEQ.ID.NO:79), (SEQ.ID.NO: 80).

The term "sequence that hybridizes" means a nucleic acid sequence that can hybridize to a sequence of (a), (b), (c) or (d) under stringent hybridization conditions. Appropriate "stringent hybridization conditions" which promote DNA hybridization are known to those skilled in the art, or may be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the following may be employed: 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C; 0.2 x SSC at 50°C to 65°C; or 2.0 x SSC at 44°C to 50°C. The stringency may be selected based on the conditions used in the wash step. For example, the salt concentration in the wash step can be selected from a high stringency of about 0.2 x SSC at 50°C. In addition, the temperature in the wash step can be at high stringency conditions, at about 65°C.

The term "a nucleic acid sequence which is an analog" means a nucleic acid sequence which has been modified as compared to the sequence of (a), (b) or (c) wherein the modification does not alter the utility of the sequence as described herein. The modified sequence or analog may have improved properties over the sequence shown in (a), (b) or (c). One example of a modification to prepare an analog is to replace one of the naturally occurring bases (i.e. adenine, guanine, cytosine or thymidine) of the sequences shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ.ID .NO:3), Figure 2C (SEQ.ID .NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ.ID.NO:9), Figure 4C (SEQ.ID.NO: 11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ._D.NO.22), (SEQ.ID.NO.23), (SEQ.ID.NO.24), (SEQ._D.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ._D.NO.28), (SEQ.ID.NO.29), (SEQ.ID.NO.30), (SEQ._D.NO.31), (SEQ.ID.NO.32), (SEQ.ID.NO.33), (SEQ.ID.NO.34), (SEQ.ID .N0.35), (SEQ._D.NO.36); Figure 21 (SEQ.ID.NO:77), (SEQ.K).NO:78) or Figure 22 (SEQ._D.NO:79), (SEQ.ID.NO:80), with a modified base such as xanthine, hypoxanthine, 2- aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6- aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8- aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8- substituted adenines, 8-halo guanines, 8 amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine.

Another example of a modification is to include modified phosphorous or oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages in the nucleic acid molecules shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ.ID .NO:3), Figure 2C (SEQ.ID.NO:5), Figure 3 A (SEQ.ID .NO:7), Figure 4A (SEQ.ID .NO:9), Figure 4C (SEQ.ID.NO: 11) Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ.ID.N0.22), (SEQ.ID.NO.23), (SEQ._D.NO.24), (SEQ._D.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ._D.NO.28), (SEQ.ID.NO.29), (SEQ._D.NO.30), (SEQ.ID.N0.31), (SEQ.ID.NO.32), (SEQ.ID.NO.33), (SEQ.ID.NO.34), (SEQ.ID.NO.35), (SEQ.ID.N0.36); Figure 21 (SEQ._D.NO:77), (SEQ._D.NO:78) or Figure 22 (SEQ._D.NO:79), (SEQ.ID.NO:80). For example, the nucleic acid sequences may contain phosphorothioates, phosphotriesters, methyl phosphonates, and phosphorodithioates. A further example of an analog of a nucleic acid molecule of the invention is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in the DNA (or RNA), is replaced with a polyamide backbone which is similar to that found in peptides (P.E. Nielsen, et al Science 1991, 254, 1497). PNA analogs have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind stronger to a complimentary DNA sequence due to the lack of charge repulsion between the PNA strand and the DNA strand. Other nucleic acid analogs may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may have morpholino backbone structures (U.S. Pat. No. 5,034,506). The analogs may also contain groups such as reporter groups, a group for improving the pharmacokinetic or pharmacodynamic properties of nucleic acid sequence.

It will be appreciated that the invention includes nucleic acid molecules encoding truncations of proteins of the invention, and analogs and homologs of proteins of the invention and truncations thereof, as described below. It will further be appreciated that variant forms of nucleic acid molecules of the invention which arise by alternative splicing of an mRNA corresponding to a cDNA of the invention are encompassed by the invention.

Isolated and purified nucleic acid molecules having sequences which differ from the nucleic acid sequence of the invention due to degeneracy in the genetic code are also within the scope of the invention. Such nucleic acids encode functionally equivalent proteins but differ in sequence from the above mentioned sequences due to degeneracy in the genetic code.

An isolated nucleic acid molecule of the invention which comprises DNA can be isolated by preparing a labelled nucleic acid probe based on all or part of the nucleic acid sequences of the invention and using this labelled nucleic acid probe to screen an appropriate

DNA library (e.g. a cDNA or genomic DNA library). For example, a genomic library isolated can be used to isolate a DNA encoding a novel protein of the invention by screening the library with the labelled probe using standard techniques. Nucleic acids isolated by screening of a cDNA or genomic DNA library can be sequenced by standard techniques.

An isolated nucleic acid molecule of the invention which is DNA can also be isolated by selectively amplifying a nucleic acid encoding a novel protein of the invention using the polymerase chain reaction (PCR) methods and cDNA or genomic DNA. It is possible to design synthetic oligonucleotide primers from the nucleic acid sequence of the invention for use in PCR. A nucleic acid can be amplified from cDNA or genomic DNA using these oligonucleotide primers and standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. It will be appreciated that cDNA may be prepared from mRNA, by isolating total cellular mRNA by a variety of techniques, for example, by using the guanidinium-thiocyanate extraction procedure of Chirgwin et al., Biochemistry, 18, 5294-5299 (1979). cDNA is then synthesized from the mRNA using reverse transcriptase (for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Petersburg, FL).

An isolated nucleic acid molecule of the invention which is RNA can be isolated by cloning a cDNA encoding a novel protein of the invention into an appropriate vector which allows for transcription of the cDNA to produce an RNA molecule which encodes a protein of the invention. For example, a cDNA can be cloned downstream of a bacteriophage promoter, (e.g., a T7 promoter) in a vector, cDNA can be transcribed in vitro with T7 polymerase, and the resultant RNA can be isolated by standard techniques.

A nucleic acid molecule of the invention may also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S. Patent Nos. 4,401,796 and 4,373,071).

Determination of whether a particular nucleic acid molecule encodes a novel protein of the invention may be accomplished by expressing the cDNA in an appropriate host cell by standard techniques, and testing the activity of the protein using the methods as described herein. A cDNA having the activity of a novel protein of the invention so isolated can be sequenced by standard techniques, such as dideoxynucleotide chain termination or Maxam- Gilbert chemical sequencing, to determine the nucleic acid sequence and the predicted amino acid sequence of the encoded protein. The initiation codon and untranslated sequences of nucleic acid molecules of the invention may be determined using currently available computer software designed for the purpose, such as PC/Gene (IntelliGenetics Inc., Calif). Regulatory elements can be identified using conventional techniques. The function of the elements can be confirmed by using these elements to express a reporter gene which is operatively linked to the elements. These constructs may be introduced into cultured cells using standard procedures. In addition to identifying regulatory elements in DNA, such constructs may also be used to identify proteins interacting with the elements, using techniques known in the art.

The sequence of a nucleic acid molecule of the invention may be inverted relative to its normal presentation for transcription to produce an antisense nucleic acid molecule which are more fully described herein. Preferably, an antisense sequence is constructed by inverting a region preceding the initiation codon or an unconserved region. In particular, the nucleic acid sequences contained in the nucleic acid molecules of the invention or a fragment thereof, may be inverted relative to its normal presentation for transcription to produce antisense nucleic acid molecules. The invention also provides nucleic acids encoding fusion proteins comprising a novel protein of the invention and a selected protein, or a selectable marker protein (see below).

Also provided are portions of the nucleic acid sequence encoding fragments, functional domains or antigenic determinants of the LPDL or LPDLR protein. The present invention also provides for the use of portions of the sequence as probes and PCR primers for LPDL or LPDLR and related proteins and well as for determining functional aspects of the sequence.

One of ordinary skill in the art is now enabled to identify and isolate LPDL or LPDLR genes or cDNAs which are allelic variants or spliced isoforms of the disclosed LPDL and

LPDLR sequences, using standard hybridization screening or PCR techniques.

II. Novel Proteins of the Invention The invention further broadly contemplates an isolated LPDL or LPDLR protein. The terms "LPDL protein" or "LPDLR protein" as used herein include all homologs, analogs, fragments or derivatives of the LPDL or LPDLR which can modulate triglyceride and lipase related function.

In one embodiment, the isolated LPDL or LPDLR protein has an amino acid sequence as shown in Figure IB (SEQ.ID.NO:2), Figure 2B (SEQ.ID.NO:4), Figure 2D

(SEQ._D.NO:6), Figure 3B (SEQ.ID.NO: 8), Figure 4B (SEQ.ID.NO: 10) or, Figure 4D

(SEQ.ID.NO: 12).

Within the context of the present invention, a protein of the invention may include various structural forms of the primary proteins which retain biological activity. For example, a protein of the invention may be in the foπn of acidic or basic salts or in neutral form. In addition, individual amino acid residues may be modified by oxidation or reduction.

In addition to the full length amino acid sequences, the protein of the present invention may also include truncations of the protein, and analogs, and homologs of the protein and truncations thereof as described herein. The invention further provides polypeptides comprising at least one functional domain or at least one antigenic determinant of a LPDL or LPDLR protein.

Analogs of the protein of the invention and/or truncations thereof as described herein, may include, but are not limited to an amino acid sequence containing one or more amino acid substitutions, insertions, and/or deletions. Amino acid substitutions may be of a conserved or non-conserved nature. Conserved amino acid substitutions involve replacing one or more amino acids of the proteins of the invention with amino acids of similar charge, size, and/or hydrophobicity characteristics. When only conserved substitutions are made the resulting analog should be functionally equivalent. Non-conserved substitutions involve replacing one or more amino acids of the amino acid sequence with one or more amino acids which possess dissimilar charge, size, and/or hydrophobicity characteristics.

One or more amino acid insertions may be introduced into the amino acid sequences of the invention. Amino acid insertions may consist of single amino acid residues or sequential amino acids ranging from 2 to 15 amino acids in length. For example, amino acid insertions may be used to destroy target sequences so that the protein is no longer active. This procedure may be used in vivo to inhibit the activity of a protein of the invention.

Deletions may consist of the removal of one or more amino acids, or discrete portions from the amino acid sequence of the LPDL or LPDLR. The deleted amino acids may or may not be contiguous. The lower limit length of the resulting analog with a deletion mutation is about 10 amino acids, preferably 100 amino acids. Analogs of a protein of the invention may be prepared by introducing mutations in the nucleotide sequence encoding the protein. Mutations in nucleotide sequences constructed for expression of analogs of a protein of the invention must preserve the reading frame of the coding sequences. Furthermore, the mutations will preferably not create complementary regions that could hybridize to produce secondary mRNA structures, such as loops or hairpins, which could adversely affect translation of the receptor mRNA.

Mutations may be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site specific mutagenesis procedures may be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Deletion or truncation of a protein of the invention may also be constructed by utilizing convenient restriction endonuclease sites adjacent to the desired deletion. Subsequent to restriction, overhangs may be filled in, and the DNA religated. Exemplary methods of making the alterations set forth above are disclosed by Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989).

The proteins of the invention also include homologs of the amino acid sequence of the LPDL or LPDLR protein and/or truncations thereof as described herein. Such homologs are proteins whose amino acid sequences are comprised of amino acid sequences that hybridize under stringent hybridization conditions (see discussion of stringent hybridization conditions herein) with a probe used to obtain a protein of the invention. Homologs of a protein of the invention will have the same regions which are characteristic of the protein.

A homologous protein includes a protein with an amino acid sequence having at least 70%, preferably 80-95% identity with the amino acid sequence of the LPDL or LPDLR protein.

The invention also contemplates isoforms of the proteins of the invention. An isoform contains the same number and kinds of amino acids as a protein of the invention, but the isoform has a different molecular structure. The isoforms contemplated by the present invention are those having the same properties as a protein of the invention as described herein.

The present invention also includes a protein of the invention conjugated with a selected protein, or a selectable marker protein to produce fusion proteins. For example, the LPDL or LPDLR cDNA sequence is inserted into a vector that contains a nucleotide sequence encoding another peptide (e.g. GST-glutathione succinyl transferase). The fusion protein is expressed and recovered from prokaryotic (e.g. bacterial or baculovirus) or eukaryotic cells. The fusion protein can then be purified by affinity chromatography based upon the fusion vector sequence and the LPDL or LPDLR protein obtained by enzymatic cleavage of the fusion protein. The proteins of the invention (including truncations, analogs, etc.) may be prepared using recombinant DNA methods. Accordingly, nucleic acid molecules of the present invention having a sequence which encodes a protein of the invention may be incorporated according to procedures known in the art into an appropriate expression vector which ensures good expression of the protein. Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), so long as the vector is compatible with the host cell used. The expression "vectors suitable for transformation of a host cell", means that the expression vectors contain a nucleic acid molecule of the invention and regulatory sequences, selected on the basis of the host cells to be used for expression, which are operatively linked to the nucleic acid molecule. "Operatively linked" is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.

The invention therefore contemplates a recombinant expression vector of the invention containing a nucleic acid molecule of the invention, or a fragment thereof, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence. Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, or viral genes (For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Selection of appropriate regulatory sequences is dependent on the host cell chosen, and may be readily accomplished by one of ordinary skill in the art. Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other sequences, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector. It will also be appreciated that the necessary regulatory sequences may be supplied by the native protein and/or its flanking regions.

The invention further provides a recombinant expression vector comprising a DNA nucleic acid molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression, by transcription of the DNA molecule, of an RNA molecule which is antisense to a nucleotide sequence of the invention. Regulatory sequences operatively linked to the antisense nucleic acid can be chosen which direct the continuous expression of the antisense RNA molecule.

The recombinant expression vectors of the invention may also contain a selectable marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule of the invention. Examples of selectable marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, β- galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. Transcription of the selectable marker gene is monitored by changes in the concentration of the selectable marker protein such as β-galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. If the selectable marker gene encodes a protein conferring antibiotic resistance such as neomycin resistance transformant cells can be selected with G418. Cells that have incorporated the selectable marker gene will survive, while the other cells die. This makes it possible to visualize and assay for expression of recombinant expression vectors of the invention and in particular to determine the effect of a mutation on expression and phenotype. It will be appreciated that selectable markers can be introduced on a separate vector from the nucleic acid of interest.

The recombinant expression vectors may also contain genes which encode a fusion moiety which provides increased expression of the recombinant protein; increased solubility of the recombinant protein; and aid in the purification of a target recombinant protein by acting as a ligand in affinity purification. For example, a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.

Recombinant expression vectors can be introduced into host cells to produce a transformed host cell. Accordingly, the invention includes a host cell comprising a recombinant expression vector of the invention. The term "transformed host cell" is intended to include prokaryotic and eukaryotic cells which have been transformed or transfected with a recombinant expression vector of the invention. The terms "transformed with", "transfected with", "transformation" and "transfection" are intended to encompass introduction of nucleic acid (e.g. a vector) into a cell by one of many possible techniques known in the art. Prokaryotic cells can be transformed with nucleic acid by, for example, electroporation or calcium-chloride mediated transformation. Nucleic acid can be introduced into mammalian cells via conventional techniques such as calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofectin, electroporation or microinjection. Suitable methods for transforming and transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other such laboratory textbooks.

Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the proteins of the invention may be expressed in bacterial cells such as E. coli, Pseudomonas, Bacillus subtillus, insect cells (using baculovirus), yeast cells or mammalian cells. Other suitable host cells can be found in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1991).

As an example, to produce LPDL or LPDLR proteins recombinantly, for example, E. coli can be used using the T7 RNA polymerase/promoter system using two plasmids or by labeling of plas id-encoded proteins, or by expression by infection with M13 Phage mGPI-2. E. coli vectors can also be used with Phage lamba regulatory sequences, by fusion protein vectors (e.g. lacZ and trpE), by maltose-binding protein fusions, and by glutathione-S- transferase fusion proteins.

Alternatively, the LPDL or LPDLR proteins can be expressed in insect cells using baculoviral vectors, or in mammalian cells using vaccinia virus. For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV40) promoter in the pSV2 vector and introduced into cells, such as testis cells to achieve transient or long-term expression. The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin and mycophoenolic acid. The LPDL or LPDLR DNA sequences can be altered using procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site- directed sequence alteration with the use of specific oligonucleotides together with PCR. The cDNA sequence or portions thereof, or a mini gene consisting of a cDNA with an intron and its own promoter, is introduced into eukaryotic expression vectors by conventional techniques. These vectors permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation. The endogenous SAP gene promoter can also be used. Different promoters within vectors have different activities which alters the level of expression of the cDNA. In addition, certain promoters can also modulate function such as the glucocorticoid-responsive promoter from the mouse mammary tumor virus.

Some of the vectors listed contain selectable markers or neo bacterial genes that permit isolation of cells by chemical selection. Stable long-term vectors can be maintained in cells as episomal, freely replicating entities by using regulatory elements of viruses. Cell lines can also be produced which have integrated the vector into the genomic DNA. In this manner, the gene product is produced on a continuous basis.

Vectors are introduced into recipient cells by various methods including calcium phosphate, strontium phosphate, electroporation, lipofection, DEAE dextran, microinjection, or by protoplast fusion. Alternatively, the cDNA can be introduced by infection using viral vectors.

LPDL or LPDLR proteins may also be isolated from cells or tissues, including mammalian cells or tissues, in which the protein is normally expressed.

The protein may be purified by conventional purification methods known to those in the art, such as chromatography methods, high performance liquid chromatography methods or precipitation.

For example, an anti-LPDL or anti-LPDLR antibody (as described below) may be used to isolate a LPDL or LPDLR protein, which is then purified by standard methods.

The proteins of the invention may also be prepared by chemical synthesis using techniques well known in the chemistry of proteins such as solid phase synthesis (Merrifield, 1964, J. Am. Chem. Assoc. 85:2149-2154) or synthesis in homogenous solution (Houbenweyl, 1987, Methods of Organic Chemistry, ed. E. Wansch, Vol. 15 I and II, Thieme, Stuttgart). III. Uses The present invention includes all uses of the nucleic acid molecules and LPDL or LPDLR proteins of the invention including, but not limited to, the preparation of antibodies and antisense oligonucleotides, the preparation of experimental systems to study LPDL or LPDLR, the isolation of substances that modulate LPDL or LPDLR expression and/or activity as well as the use of the LPDL or LPDLR nucleic acid sequences and proteins and modulators thereof in diagnostic and therapeutic applications. Some of the uses are further described below. (i) Experimental Systems

Eukaryotic expression systems can be used for many studies of the LPDL or LPDLR genes and gene product(s) including determination of proper expression and post-translational modifications for full biological activity, identifying regulatory elements located in the 5' region of the LPDL or LPDLR gene and their role in tissue regulation of protein expression, production of large amounts of the normal and mutant protein for isolation and purification, to use cells expressing the LPDL or LPDLR protein as a functional assay system for antibodies generated against the protein or to test effectiveness of pharmacological agents, or as a component of a signal transduction system, to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring and artificially produced mutant proteins.

Using the techniques mentioned, the expression vectors containing the LPDL or LPDLR cDNA sequences or portions thereof can be introduced into a variety of mammalian cells from other species or into non-mammalian cells.

The recombinant cloning vector, according to this invention, comprises the selected DNA of the DNA sequences of this invention for expression in a suitable host. The DNA is operatively linked in the vector to an expression control sequence in the recombinant DNA molecule so that LPDL or LPDLR protein can be expressed. The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of the fd coat protein, early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus, simian virus, 3-phosphoglycerate kinase promoter, yeast acid phosphatase promoters, yeast alpha-mating factors and combinations thereof.

Expression of the LPDL or LPDLR gene in heterologous cell systems may also be used to demonstrate structure-function relationships as well as to provide cell lines for the purposes of drug screening. LPDL or LPDLR DNA sequence into a plasmid expression vector to transfect cells is a useful method to test the proteins influence on various cellular biochemical parameters including the identification of substrates as well as activators and inhibitors of the phosphatase. Plasmid expression vectors containing either the entire coding sequence for LPDL or LPDLR, or for portions thereof, can be used in in vitro mutagenesis experiments that will identify portions of the protein crucial for regulatory function.The DNA sequence can be manipulated in studies to understand the expression of the gene and its product. The changes in the sequence may or may not alter the expression pattern in terms of relative quantities, tissue- specificity and functional properties.

The invention also provides methods for examining the function of the LPDL or LPDLR protein encoded by the nucleic acid molecules of the invention. Cells, tissues, and non-human animals lacking in expression or partially lacking in expression of the proteins may be developed using recombinant molecules of the invention having specific deletion or insertion mutations in the nucleic acid molecule of the invention. A recombinant molecule may be used to inactivate or alter the endogenous gene by homologous recombination, and thereby create a deficient cell, tissue or animal. Such a mutant cell, tissue or animal may be used to define specific cell populations, developmental patterns and in vivo processes, normally dependent on the protein encoded by the nucleic acid molecule of the invention. To confirm the importance of the LPDL or LPDLR proteins in lipid metabolism, a LPDL or LPDLR knockout mouse can be prepared. By way of example, a targeted recombination strategy may be used to inactivate the endogenous LPDL gene. A gene which introduces stop codons in all reading frames and abolishes the biological activity of the protein may be inserted into a genomic copy of the protein. The mutated fragment may be introduced into embryonic stem cells and colonies may be selected for homologous recombination with positive (neomycin)/negative (gancyclovir, thymidine kinase) resistance genes. To establish germ line transmission, two clones carrying the disrupted gene on one allele may be injected into blastocyts of C57/B16 mice and transferred into B6/SJL foster mothers. Chimeras may be mated to C7B1/6 mice and progeny analysed to detect animals homozygous for the mutation (LPDL -/-). The effects of the mutation on the triglyceride metabolism in comparison to non- mutated controls may be determined, and the survival and histologic pattern of disease may be analyzed.

(ii) Antibodies

The isolation of the LPDL and LPDLR proteins enables the preparation of antibodies specific for the proteins. Accordingly, the present invention provides an antibody that binds to a LPDL or a LPDLR protein. Antibodies may be used advantageously to monitor the expression of either protein. Antibodies can be prepared which bind a distinct epitope in an unconserved region of the protein. An unconserved region of the protein is one that does not have substantial sequence homology to other proteins.

Conventional methods can be used to prepare the antibodies. For example, by using a peptide of LPDL or LPDLR, polyclonal antisera or monoclonal antibodies can be made using standard methods. A mammal, (e.g., a mouse, hamster, or rabbit) can be immunized with an immunogenic form of the peptide which elicits an antibody response in the mammal. Techniques for conferring immunogenicity on a peptide include conjugation to carriers or other techniques well known in the art. For example, the protein or peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassay procedures can be used with the immunogen as antigen to assess the levels of antibodies. Following immunization, antisera can be obtained and, if desired, polyclonal antibodies isolated from the sera.

To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Such techniques are well known in the art, (e.g., the hybridoma technique originally developed by Kohler and Milstein (Nature 256, 495-497 (1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4, 72 (1983)), the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and screening of combinatorial antibody libraries (Huse et al., Science 246, 1275 (1989)). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the peptide and the monoclonal antibodies can be isolated. Therefore, the invention also contemplates hybridoma cells secreting monoclonal antibodies with specificity for LPDL or LPDLR as described herein.

The term "antibody" as used herein is intended to include fragments thereof which also specifically react with LPDL or LPDLR, or peptides thereof, having the activity of the LPDL or LPDLR. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above. For example, F(ab')2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments.

Chimeric antibody derivatives, i.e., antibody molecules that combine a non-human animal variable region and a human constant region are also contemplated within the scope of the invention. Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, or other species, with human constant regions. Conventional methods may be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes the gene product of LPDL or LPDLR antigens of the invention (See, for example, Morrison et al., Proc. Natl Acad. Sci. U.S.A. 81,6851 (1985); Takeda et al., Nature 314, 452 (1985), Cabilly et al., U.S. Patent No. 4,816,567; Boss et al., U.S. Patent No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom patent GB 2177096B). It is expected that chimeric antibodies would be less immunogenic in a human subject than the corresponding non-chimeric antibody. Monoclonal or chimeric antibodies specifically reactive with a protein of the invention as described herein can be further humanized by producing human constant region chimeras, in which parts of the variable regions, particularly the conserved framework regions of the antigen-binding domain, are of human origin and only the hypervariable regions are of non- human origin. Such immunoglobulin molecules may be made by techniques known in the art, (e.g., Teng et al., Proc. Natl. Acad. Sci. U.S.A., 80, 7308-7312 (1983); Kozbor et al., Immunology Today, 4, 7279 (1983); Olsson et al, Meth. Enzymol., 92, 3-16 (1982)), and PCT Publication WO92/06193 or EP 0239400). Humanized antibodies can also be commercially produced (Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great Britain.)

Specific antibodies, or antibody fragments, reactive against LPDL or LPDLR proteins may also be generated by screening expression libraries encoding immunoglobulin genes, or portions thereof, expressed in bacteria with peptides produced from the nucleic acid molecules of LPDL or LPDLR. For example, complete Fab fragments, VH regions and FV regions can be expressed in bacteria using phage expression libraries (See for example Ward et al., Nature 341, 544-546: (1989); Huse et al., Science 246, 1275-1281 (1989); and McCafferty et al. Nature 348, 552-554 (1990)). Alternatively, a SCID-hu mouse, for example the model developed by Genpharm, can be used to produce antibodies or fragments thereof. (iii) Antisense Oligonucleotides

Isolation of a nucleic acid molecule encoding LPDL or LPDLR enables the production of antisense oligonucleotides that can modulate the expression and/or activity of LPDL and/or LPDLR. Accordingly, the present invention provides an antisense oligonucleotide that is complimentary to a nucleic acid sequence encoding LPDL and LPDLR.

The term "antisense oligonucleotide" as used herein means a nucleotide sequence that is complimentary to its target.

The term "oligonucleotide" refers to an oligomer or polymer of nucleotide or nucleoside monomers consisting of naturally occurring bases, sugars, and intersugar (backbone) linkages. The term also includes modified or substituted oligomers comprising non-naturally occurring monomers or portions thereof, which function similarly. Such modified or substituted oligonucleotides may be preferred over naturally occurring forms because of properties such as enhanced cellular uptake, or increased stability in the presence of nucleases. The term also includes chimeric oligonucleotides which contain two or more chemically distinct regions. For example, chimeric oligonucleotides may contain at least one region of modified nucleotides that confer beneficial properties (e.g. increased nuclease resistance, increased uptake into cells), or two or more oligonucleotides of the invention may be joined to form a chimeric oligonucleotide. The antisense oligonucleotides of the present invention may be ribonucleic or deoxyribonucleic acids and may contain naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The oligonucleotides may also contain modified bases such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4- thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8- thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. Other antisense oligonucleotides of the invention may contain modified phosphorous, oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. For example, the antisense oligonucleotides may contain phosphorothioates, phosphotriesters, methyl phosphonates, and phosphorodithioates. In an embodiment of the invention there are phosphorothioate bonds links between the four to six 3'-terminus bases. In another embodiment phosphorothioate bonds link all the nucleotides.

The antisense oligonucleotides of the invention may also comprise nucleotide analogs that may be better suited as therapeutic or experimental reagents. An example of an oligonucleotide analogue is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in the DNA (or FtNA), is replaced with a polyamide backbone which is similar to that found in peptides (P.E. Nielsen, et al Science 1991, 254, 1497). PNA analogues have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind stronger to a complimentary DNA sequence due to the lack of charge repulsion between the PNA strand and the DNA strand. Other oligonucleotides may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may have morpholino backbone structures (U.S. Pat. Nol 5,034, 506). Oligonucleotides may also contain groups such as reporter groups, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an antisense oligonucleotide. Antisense oligonucleotides may also have sugar mimetics.

The antisense nucleic acid molecules may be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. The antisense nucleic acid molecules of the invention or a fragment thereof, may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g. phosphorothioate derivatives and acridine substituted nucleotides. The antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced.

The antisense oligonucleotides may be introduced into tissues or cells using techniques in the art including vectors (retroviral vectors, adenoviral vectors and DNA virus vectors) or physical techniques such as microinjection. The antisense oligonucleotides may be directly administered in vivo or may be used to transfect cells in vitro which are then administered in vivo. In one embodiment, the antisense oligonucleotide of LPDL or LPDLR may be delivered to testis, hepatocytes and or endothelial cells in a liposome formulation. (iv. Diagnostic Assays

The finding by the present inventors that LPDL and LPDLR are involved in the regulation of lipid and lipoprotein metabolism allows the detection of conditions involving an increase or decrease in LPDL or LPDLR activity or expression. Such conditions include disorders selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

Accordingly, the present invention provides a method of detecting a condition associated with increased or decreased LPDL or LPDLR expression or activity (including an absence) comprising assaying a sample for (a) a nucleic acid molecule encoding a LPDL or LPDLR protein or a fragment thereof or (b) a LPDL or LPDLR or a fragment thereof. In one embodiment, the condition associated with decreased LPDL or LPDLR expression or activity is hypertriglyceridemia.

(a) Nucleic acid molecules The nucleic acid molecules encoding LPDL and LPDLR as described herein or fragments thereof, allow those skilled in the art to construct nucleotide probes for use in the detection of nucleotide sequences encoding LPDL or LPDLR or fragments thereof in samples, preferably biological samples such as cells, tissues and bodily fluids. The probes can be useful in detecting the presence of a condition associated with LPDL or LPDLR or monitoring the progress of such a condition. Accordingly, the present invention provides a method for detecting a nucleic acid molecules encoding LPDL or LPDLR comprising contacting the sample with a nucleotide probe capable of hybridizing with the nucleic acid molecule to form a hybridization product, under conditions which permit the formation of the hybridization product, and assaying for the hybridization product. Example of probes that may be used in the above method include the nucleic acid sequences shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ.ID.NO:3), Figure 2C (SEQ.ID.NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ._D.NO:9), Figure 4C (SEQ.1D.N0:11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ._D.NO.22), (SEQ.ID.NO.23), (SEQ.ID.NO.24), (SEQ.ID.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ.ID.NO.27), (SEQ.ID.NO.28), (SEQ.ID.NO.29), (SEQ.ID.NO.30), (SEQ._D.NO.31), (SEQ.ID.NO.32), (SEQ.ID.NO.33), (SEQ.ID.N0.34), (SEQ.ID.NO.35), (SEQ.ID.NO.36); Figure 21 (SEQ.ID.NO:77), (SEQ.ID.NO:78) or Figure 22 (SEQ.ID.NO:79), (SEQ.ID.NO: 80) or fragments thereof. A nucleotide probe may be labelled with a detectable substance such as a radioactive label which provides for an adequate signal and has sufficient half-life such as 32P, 3H, 14C or the like. Other detectable substances which may be used include antigens that are recognized by a specific labelled antibody, fluorescent compounds, enzymes, antibodies specific for a labelled antigen, and chemiluminescence. An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleic acid to be detected and the amount of nucleic acid available for hybridization. Labelled probes may be hybridized to nucleic acids on solid supports such as nitrocellulose filters or nylon membranes as generally described in Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual (2nd ed.). The nucleotide probes may be used to detect genes, preferably in human cells, that hybridize to the nucleic acid molecule of the present invention preferably, nucleic acid molecules which hybridize to the nucleic acid molecule of the invention under stringent hybridization conditions as described herein.

Nucleic acid molecules encoding a LPDL or LPDLR protein can be selectively amplified in a sample using the polymerase chain reaction (PCR) methods and cDNA or genomic DNA. It is possible to design synthetic oligonucleotide primers from the nucleotide sequences shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ.1D.N0:3), Figure 2C (SEQ.ID.NO:5), Figure 3A (SEQ.ID.NO:7), Figure 4A (SEQ.ID.N0:9), Figure 4C (SEQ.ID.NO: 11), Figure 15 (SEQ.ID.NO.17), (SEQ.ID.NO.18), (SEQ.ID.NO.19), (SEQ.ID.NO.20), (SEQ.ID.NO.21), (SEQ.ID.NO.22), (SEQ._D.NO.23), (SEQ.ID.NO.24), (SEQ._D.NO.25), (SEQ.ID.NO.26); Figure 16-A (SEQ._D.NO.27), (SEQ.ID.NO.28), (SEQ.ID.NO.29), (SEQ.ID.NO.30), (SEQ.ID.NO.31), (SEQ.ID .NO.32), (SEQ.ID.NO.33), (SEQ.ID.N0.34), (SEQ.ID.NO.35), (SEQ._D.NO.36); Figure 21 (SEQ.ID.NO:77), (SEQ.ID.NO:78) or Figure 22 (SEQ.ID.NO:79), (SEQ.ID.NO: 80) for use in PCR. A nucleic acid can be amplified from cDNA or genomic DNA using oligonucleotide primers and standard PCR amplification techniques. The amplified nucleic acid can be cloned into an appropriate vector and characterized by DNA sequence analysis. cDNA may be prepared from mRNA, by isolating total cellular mRNA by a variety of techniques, for example, by using the guanidinium-thiocyanate extraction procedure of Chirgwin et al., Biochemistry, 18, 5294-5299 (1979). cDNA is then synthesized from the mRNA using reverse transcriptase (for example, Moloney MLV reverse transcriptase available from Gibco/BRL, Bethesda, MD, or AMV reverse transcriptase available from Seikagaku America, Inc., St. Petersburg, FL).

Genomic DNA may be used directly for detection of a specific sequence or may be amplified enzymatically in vitro by using PCR prior to analysis (Saiki et al., 1985, Science, 230: 1350-1353 and Saiki et al., 1986, Nature, 324: 163-166). Reviews of this subject have been presented by Caskey C.T., 1989, Science, 236: 1223-1229 and by Landegren et al., 1989, Science, 242: 229-237. The detection of specific DNA sequence may be achieved by methods such as hybridization using specific oligonucleotides (Wallace et al., 1986, Cold Spring Harbour Symp. Quant. Biol, 51 : 257-261), direct DNA sequencing (Church et al., 1988, Proc. Natl. Acad. Sci., 81 : 1991-1995, the use of restriction enzymes (Flavell et al., 1978, Cell, 15: 25-41; Geever et al., 1981, Proc. Natl. Acad. Sci., 78: 5081-5085), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers et al., 1986, Cold Spring Harbour Sym. Quant. Biol., 51 : 275-284), RNase protection (Myers et al., 1985, Science, 230: 1242-1246), chemical cleavage (Cotton et al., 1985, Proc. Natl. Acad. Sci., 85: 4397-4401), and the ligase-mediated detection procedure (Landegren et al., 1988, Science, 241 : 1077-1080). Using PCR, characterization of the level of or condition of the subject polynucleotides present in the individual may be made by comparative analysis.

With the characterization of the LPDL or LPDLR gene product and its function, functional assays can also be used for LPDL or LPDLR gene diagnosis and screening and to monitor treatment. For example, enzymatic testing to determine levels of gene function, rather than direct screening of the LPDL or LPDLR gene or product, can be employed. Testing of this nature has been utilized in other diseases and conditions, such as in Tay-Sachs.

The invention thus provides a process for detecting disease by using methods known in the art and methods described herein to detect changes in expression of or mutations to the subject polynucleotides. For example, decreased expression of a subject polynucleotide can be measured using any one of the methods well known in the art for the quantification of polynucleotides, such as, for example, PCR, RT-PCR, DNase protection, Northern blotting and other hybridization methods. (b) Proteins

The LPDL or LPDLR protein may be detected in a sample using antibodies that bind to the protein as described in detail above. Accordingly, the present invention provides a method for detecting a LPDL or LPDLR protein comprising contacting the sample with an antibody that binds to LPDL or LPDLR which is capable of being detected after it becomes bound to the protein in the sample.

Antibodies specifically reactive with LPDL or LPDLR, or derivatives thereof, such as enzyme conjugates or labeled derivatives, may be used to detect LPDL or LPDLR in various biological materials, for example they may be used in any known immunoassays which rely on the binding interaction between an antigenic determinant of LPDL or LPDLR, and the antibodies. Examples of such assays are radioimmunoassays, enzyme immunoassays (e.g. ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination and histochemical tests. Thus, the antibodies may be used to detect and quantify LPDL or LPDLR in a sample in order to determine its role in particular cellular events or pathological states, and to diagnose and treat such pathological states.

In particular, the antibodies of the invention may be used in immuno-histochemical analyses, for example, at the cellular and sub-subcellular level, to detect LPDL or LPDLR, to localise it to particular cells and tissues and to specific subcellular locations, and to quantitate the level of expression.

Cytochemical techniques known in the art for localizing antigens using light and electron microscopy may be used to detect LPDL or LPDLR. Generally, an antibody of the invention may be labelled with a detectable substance and LPDL or LPDLR may be localised in tissue based upon the presence of the detectable substance. Examples of detectable substances include various enzymes, fluorescent materials, luminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, biotin, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include radioactive iodine 1-125, 1-131 or 3-H. Antibodies may also be coupled to electron dense substances, such as ferritin or colloidal gold, which are readily visualised by electron microscopy. Indirect methods may also be employed in which the primary antigen-antibody reaction is amplified by the introduction of a second antibody, having specificity for the antibody reactive against LPDL or LPDLR. By way of example, if the antibody having specificity against LPDL is a rabbit IgG antibody, the second antibody may be goat anti-rabbit gamma- globulin labelled with a detectable substance as described herein. Where a radioactive label is used as a detectable substance, LPDL may be localized by autoradiography. The results of autoradiography may be quantitated by determining the density of particles in the autoradiographs by various optical methods, or by counting the grains. (v) Screening for LPDL or LPDLR Mutations Nucleic acid sequences of LPDL or LPDLR might be determined in order to assay for changes, preferably disease-causing mutations that may be used as indicators of disease prognosis or as aids to inform treatment of these diseases. Such diseases include disorders selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

The knowledge of the human LPDL and LPDLR sequences provides a method for screening for diseases involving abnormally activated or inactivated LPDL or LPDLR in which the activity defect is due to a mutant LPDL or LPDLR gene. For example, unregulated Jak 3 kinase leads to tumorigenesis (Schwaller, J. et al., (1998), EMBO J., v. 17, p. 5321-33; Lacronique et al., (1997), Science, v. 278, p. 1309-12; Peeters et al, (1997), Blood, v. 90, p. 2535-40). As discussed above, the LPDL and LPDLR proteins may play roles in the regulation of triglyceride activity and metabolism, lipoprotein metabolism, energy homeostatsis and other lipase related funtions. Patients may be screened routinely using probes to detect the presence of a mutant SAP gene by a variety of techniques. Genomic DNA used for the diagnosis may be obtained from body cells, such as those present in the blood, tissue biopsy, surgical specimen, or autopsy material. The DNA may be isolated and used directly for detection of a specific sequence or may be PCR amplified prior to analysis. RNA or cDNA may also be used. To detect a specific DNA sequence hybridization using specific oligonucleotides, direct DNA sequencing, restriction enzyme digest, RNase protection, chemical cleavage, and ligase-mediated detection are all methods which can be utilized. Oligonucleotides specific to mutant sequences can be chemically synthesized and labelled radioactively with isotopes, or non-radioactively using biotin tags, and hybridized to individual DNA samples immobilized on membranes or other solid-supports by dot-blot or transfer from gels after electrophoresis. The presence or absence of these mutant sequences is then visualized using methods such as autoradiography, fluorometry, or colorimetric reaction. Suitable PCR primers can be generated which are useful for example in amplifying portions of the subject sequence containing identified mutations. Direct DNA sequencing reveals sequence differences between normal and mutant DNA. Cloned DNA segments may be used as probes to detect specific DNA segments. PCR can be used to enhance the sensitivity of this method. PCR is an enzymatic amplification directed by sequence-specific primers, and involves repeated cycles of heat denaturation of the DNA, annealing of the complementary primers and extension of the annealed primer with a DNA polymerase. This results in an exponential increase of the target DNA. Other nucleotide sequence amplification techniques may be used, such as ligation-mediated PCR, anchored PCR and enzymatic amplification as would be understood by those skilled in the art.

As examples in amplifying LPDL and LPDLR genes, primers have been designed within the adjacent intron regions of exons as listed in Figure 18-A for human LPDL gene: Primer IF (SEQ._D.NO.37), Primer 1R (SEQ._D.NO.38), Primer 2F (SEQ.ID.NO.39), Primer 2R (SEQ.ID.NO.40), Primer 3F (SEQ.ID.NO.41), Primer 3R (SEQ.ID.NO.42), Primer 4F (SEQ.ID.N0.43), Primer 4R (SEQ.ID.NO.44), Primer 5F (SEQ.ID.NO.45), Primer 5R (SEQ.ID.NO.46), Primer 6F (SEQ._D.NO.47), Primer 6R (SEQ.ID.NO.48), Primer 7F (SEQ.ID.NO.49), Primer 7R (SEQ.ID.NO.50), Primer 8F (SEQ.ID.NO.51), Primer 8R (SEQ.ID.NO.52), Primer 9F (SEQ.ID.NO.53), Primer 9R (SEQ.ID.NO.54), Primer 10F (SEQ.ID.NO.55), Primer 10R (SEQ.ID.NO.56), and in Figure 18-B for human LPDLR gene: Primer IF (SEQ.ID.NO.57), Primer 1R (SEQ.ID.NO.58), Primer 2F (SEQ.ID.NO.59), Primer 2R (SEQ.ID.NO.60), Primer 3F (SEQ.ID.NO.61), Primer 3R (SEQ._D.NO.62), Primer 4F (SEQ.ID.NO.63), Primer 4R (SEQ.ID.NO.64), Primer 5F (SEQ.ID.NO.65), Primer 5R (SEQ.ID.NO.66), Primer 6F (SEQ._D.NO.67), Primer 6R (SEQ._D.NO.68), Primer 7F (SEQ._D.NO.69), Primer 7R (SEQ._D.NO.70), Primer 8F (SEQ.ID.NO.71), Primer 8R (SEQ.ID.NO.72), Primer 9F (SEQ.1D.N0.73), Primer 9R (SEQ.ID.NO.74), Primer 10F (SEQ.ID .N0.75), Primer 10R (SEQ.ID .NO.76). However, the primers could also be designed elsewhere within the introns, be disigned within the exons or within the promoter and regulatory region.

Sequence alterations may also generate fortuitous restriction enzyme recognition sites that are revealed by the use of appropriate enzyme digestion followed by gel-blot hybridization. DNA fragments carrying the site (normal or mutant) are detected by their increase or reduction in size, or by the increase or decrease of corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme and the fragments of different sizes are visualized under UV light in the presence of ethidium bromide after gel electrophoresis.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels. Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. Small deletions may also be detected as changes in the migration pattern of DNA heteroduplexes in non-denaturing gel electrophoresis. Alternatively, a single base substitution mutation may be detected based on differential primer length in PCR. The PCR products of the normal and mutant gene could be differentially detected in acrylamide gels.

Nuclease protection assays (SI or ligase-mediated) also reveal sequence changes at specific locations. Alternatively, to confirm or detect a polymorphism restriction mapping changes ligated PCR, ASO, REF-SSCP and SSCP may be used. Both REF-SSCP and SSCP are mobility shift assays that are based upon the change in conformation due to mutations. DNA fragments may also be visualized by methods in which the individual DNA samples are not immobilized on membranes. The probe and target sequences may be in solution or the probe sequence may be immobilized. Autoradiography, radioactive decay, spectrophotometry, and fluorometry may also be used to identify specific individual genotypes.

According to an embodiment of the invention, the portion of the DNA segment that is informative for a mutation can be amplified using PCR. The DNA segment immediately surrounding a specific mutation acquired from peripheral blood or other tissue samples from an individual can be screened using constructed oligonucleotide primers. This region would then be amplified by PCR, the products separated by electrophoresis, and transferred to membrane. Labeled probes are then hybridized to the DNA fragments and autoradiography performed. (vi) LPDL and LPDLR promoters and regulatory elements

The promoter and the regulatory elements of both LPDL and LPDLR genes might be used to modify cellular process in controlling gene of choice for expression. The controlled gene expression can be tissue-specific. The inventors have described promoter and regulatory sequences of both LPDL or LPDLR gene as in Figure 21-A for mouse Ipdl (SEQ.ID.NO:77); 21-B for human LPDL gene (SEQ.ID .NO:78); Figure 22-A for mouse Ipdlr (SEQ.ID.NO:79); 22-B for human LPDLR gene (SEQ.ID.NO: 80); However, the regulatory sequences may be located upstream of the provided sequences, within the intron or exon sequences or within the 3'UTR regrion. For example, the human HMGB1 promoter is modulated by a silencer and an enhancer-containing intron. With intron 1 included in the construct, the HMGB1 promter activity can be increase at 2-3 folds (Lum et al. Biochim Biophys Acta, 1520, 79-84, 2001).

To use tissue specific promoter directing gene expression in desired tissue have been demonstrated be a successful strategy to modify cellular processes or achieve targeted therapeutic effect (Maxwell et al. Leuk Lymphoma. 7,457-62, 1992, Yu et al. Cancer Gene Ther., 8, 628-35, 2001). One example is to use prostate-specific antigen (PSA) promoter to direct cytotoxic gene diphtheria toxin (DT) to prostate tissue for prostate cancer therapy. Such treatment preferentially kill PSA-positive prostate cancer cells in vitro, and regressed tumor growth and prolonged animal survival in vivo (Li et al. Cancer Res., 62, 2576-82., 2002).

Since Ipdl gene is strongly and specificly expressed in the primary spermatocytes in testis tissue, Ipdl promoter can be employed to direct gene to testis tissue to modify cellular processes. One application is to target DT toxin gene to testis in eliminating spermatocytes and achieving male sterility. The LPDLR gene is expressed more widely in prostate, testis, colon, mammary and salivary gland. The LPDLR promoter can be further dissected to identify the tissue specific elements which can be used along or in combination with other promoters in targeting different tissues. The delivery systems of promoter/fusion gene construct can be viral or non-viral delivery systems. The construct can be delivered to cells in vitro or in vivo with either somatic or stem cell treatment. (vii) LPDL and LPDLR Modulators

In addition to antibodies and antisense oligonucleotides described above, other substances that modulate LPDL or LPDLR expression or activity may also be identified.

Accordingly, the present invention includes the use of the nucleic acids encoding LPDL and the

LPDLR and the respective proteins to develop or identify substances that modulate LPDL or

LPDLR expression or activity.

(a) Substances that Bind LPDL or LPDLR Substances that affect LPDL or LPDLR activity can be identified based on their ability to bind to either protein.

Substances which can bind with the LPDL or LPDLR of the invention may be identified by reacting the LPDL or LPDLR with a substance which potentially binds to LPDL or LPDLR, and assaying for complexes, for free substance, or for non-complexed LPDL or LPDLR, or for activation of LPDL or LPDLR. In particular, a yeast two hybrid assay system may be used to identify proteins which interact with LPDL or LPDLR (Fields, S. and Song, O., 1989, Nature, 340:245-247). Systems of analysis which also may be used include ELISA.

Accordingly, the invention provides a method of identifying substances which can bind with LPDL or LPDLR comprising the steps of: - reacting LPDL or LPDLR and a test substance, under conditions which allow for formation of a complex between the LPDL or LPDLR and the test substance, and assaying for complexes of LPDL or LPDLR and the test substance, for free substance or for non complexed LPDL or LPDLR, wherein the presence of complexes indicates that the test substance is capable of binding LPDL. or LPDLR. The LPDL or LPDLR protein used in the assay may have the amino acid sequence shown in Figure IB or 2B may be a fragment, analog, derivative, homolog or mimetic thereof as described herein.

Conditions which permit the formation of substance and LPDL or LPDLR complexes may be selected having regard to factors such as the nature and amounts of the substance and the protein.

The substance-protein complex, free substance or non-complexed proteins may be isolated by conventional isolation techniques, for example, salting out, chromatography, electrophoresis, gel filtration, fractionation, absorption, polyacrylamide gel electrophoresis, agglutination, or combinations thereof. To facilitate the assay of the components, antibody against LPDL or LPDLR or the substance, or labelled LPDL or LPDLR, or a labelled substance may be utilized. The antibodies, proteins, or substances may be labelled with a detectable substance as described above.

LPDL or LPDLR, or the substance used in the method of the invention may be insolubilized. For example, LPDL or LPDLR or substance may be bound to a suitable carrier. Examples of suitable carriers are agarose, cellulose, dextran, Sephadex, Sepharose, carboxymethyl cellulose polystyrene, filter paper, ion-exchange resin, plastic film, plastic tube, glass beads, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc. The carrier may be in the shape of, for example, a tube, test plate, beads, disc, sphere etc.

The insolubilized protein or substance may be prepared by reacting the material with a suitable insoluble carrier using known chemical or physical methods, for example, cyanogen bromide coupling.

The proteins or substance may also be expressed on the surface of a cell using the methods described herein.

The invention also contemplates assaying for an antagonist or agonist of the action of LPDL or LPDLR.

It will be understood that the agonists and antagonists that can be assayed using the methods of the invention may act on one or more of the binding sites on the protein or substance including agonist binding sites, competitive antagonist binding sites, non-competitive antagonist binding sites or allosteric sites.

The invention also makes it possible to screen for antagonists that inhibit the effects of an agonist of LPDL or LPDLR. Thus, the invention may be used to assay for a substance that competes for the same binding site of LPDL. The invention further provides a method for assaying for a substance that affects a

LPDL or LPDLR regulatory pathway comprising administering to a human or animal or to a cell, or a tissue of an animal, a substance suspected of affecting a LPDL or LPDLR regulatory pathway, and quantitating the LPDL or LPDLR protein or nucleic acids encoding LPDL or LPDLR, or examining the pattern and/or level of expression of LPDL or LPDLR, in the human or animal or tissue, or cell. LPDL or LPDLR may be quantitated and its expression may be examined using the methods described herein.

(b) Peptide Mimetics

The present invention also includes peptide mimetics of the LPDL or LPDLR of the invention. For example, a peptide derived from a binding domain of LPDL or LPDLR will interact directly or indirectly with an associated molecule in such a way as to mimic the native binding domain. Such peptides may include competitive inhibitors, enhancers, peptide mimetics, and the like. All of these peptides as well as molecules substantially homologous, complementary or otherwise functionally or structurally equivalent to these peptides may be used for purposes of the present invention.

"Peptide mimetics" are structures which serve as substitutes for peptides in interactions between molecules (See Morgan et al (1989), Ann. Reports Med. Chem. 24:243-252 for a review). Peptide mimetics include synthetic structures which may or may not contain amino acids and/or peptide bonds but retain the structural and functional features of a peptide, or enhancer or inhibitor of the invention. Peptide mimetics also include peptoids, oligopeptoids (Simon et al (1972) Proc. Natl. Acad, Sci USA 89:9367), and peptide libraries containing peptides of a designed length representing all possible sequences of amino acids corresponding to a peptide of the invention.

Peptide mimetics may be designed based on information obtained by systematic replacement of L-amino acids by D-amino acids, replacement of side chains with groups having different electronic properties, and by systematic replacement of peptide bonds with amide bond replacements. Local conformational constraints can also be introduced to determine conformational requirements for activity of a candidate peptide mimetic. The mimetics may include isosteric amide bonds, or D-amino acids to stabilize or promote reverse turn conformations and to help stabilize the molecule. Cyclic amino acid analogues may be used to constrain amino acid residues to particular conformational states. The mimetics can also include mimics of inhibitor peptide secondary structures. These structures can model the 3-dimensional orientation of amino acid residues into the known secondary conformations of proteins. Peptoids may also be used which are oligomers of N-substituted amino acids and can be used as motifs for the generation of chemically diverse libraries of novel molecules. Peptides of the invention may also be used to identify lead compounds for drug development. The structure of the peptides described herein can be readily determined by a number of methods such as NMR and X-ray crystallography. A comparison of the structures of peptides similar in sequence, but differing in the biological activities they elicit in target molecules can provide information about the structure-activity relationship of the target. Information obtained from the examination of structure-activity relationships can be used to design either modified peptides, or other small molecules or lead compounds that can be tested for predicted properties as related to the target molecule. The activity of the lead compounds can be evaluated using assays similar to those described herein. Information about structure-activity relationships may also be obtained from co- crystallization studies. In these studies, a peptide with a desired activity is crystallized in association with a target molecule, and the X-ray structure of the complex is determined. The structure can then be compared to the structure of the target molecule in its native state, and information from such a comparison may be used to design compounds expected to possess. (c) Modulation of the LPDL or LPDLR Promoter

As would be readily apparent to those skilled in the art, it is also possible to modulate LPDL or LPDLR through manipulation of their promoters. One or more alterations to a promoter sequence of LPDL or LPDLR may increase or decrease promoter activity, or increase or decrease the magnitude of the effect of a substance able to modulate the promoter activity. "Promoter activity" is used to refer to the ability to initiate transcription. The level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter controlling genes such as reporter gene β-galactosidase. The amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridize with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction. In vivo promoter activity assay can be investigated by transgenic mouse system. In such embodiment, the LPDL promoter controlled β-galactosidase constructs will be introduced into mouse embryoes and the activity of the reporter gene expression in different tissues including testis may be studied.

Substances which affect the LPDL or LPDLR promoter activity may also be identified using the methods of the invention by comparing the pattern and level of expression of a reporter gene, in cells in the presence, and in the absence of the substance. Accordingly, a method for assaying for the presence of an agonist or antagonist of LPDL or LPDLR promoter activity is provided comprising providing a cell containing a reporter gene under the control of the promoter with a substance which is a suspected agonist or antagonist under conditions which permit interaction and assaying for the increase or decrease of reporter gene product.

(d) Drug Screening Methods

In accordance with one embodiment, the invention enables a method for screening candidate compounds for their ability to increase or decrease the activity of a LPDL or LPDLR protein. The method comprises providing an assay system for assaying LPDL or LPDLR activity, assaying the activity in the presence or absence of the candidate or test compound and determining whether the compound has increased or decreased LPDL or LPDLR activity.

Accordingly, the present invention provides a method for identifying a compound that affects LPDL or LPDLR protein activity or expression comprising:

(a) incubating a test compound with a LPDL or LPDLR protein or a nucleic acid encoding a LPDL or LPDLR protein, and

(b) determining an amount of LPDL or LPDLR protein activity or expression and comparing with a control (i.e. in the absence of the test substance), wherein a change in the LPDL or LPDLR protein activity or expression as compared to the control indicates that the test compound has an effect on LPDL or LPDLR protein activity or expression.

In accordance with a further embodiment, the invention enables a method for screening candidate compounds for their ability to increase or decrease expression of a LPDL or LPDLR protein. The method comprises putting a cell with a candidate compound, wherein the cell includes a regulatory region of a LPDL or LPDLR gene operably joined to a reporter gene coding region, and detecting a change in expression of the reporter gene.

In one embodiment, the present invention enables culture systems in which cell lines which express the LPDL or LPDLR gene, and thus LPDL or LPDLR protein products, are incubated with candidate compounds to test their effects on expression. Such culture systems can be used to identify compounds which upregulate or downregulate LPDL or LPDLR expression or function, through the interaction with other proteins.

Such compounds can be selected from protein compounds, chemicals and various drugs that are added to the culture medium. After a period of incubation in the presence of a selected test compound(s), the expression of LPDL or LPDLR can be examined by quantifying the levels of LPDL or LPDLR mRNA using standard Northern blotting procedure, as described in the examples included herein, to determine any changes in expression as a result of the test compound. Cell lines transfected with constructs expressing LPDL or LPDLR can also be used to test the function of compounds developed to modify the protein expression. In addition, transformed cell lines expressing a normal LPDL or LPDLR protein could be mutagenized by the use of mutagenizing agents to produce an altered phenotype in which the role of mutated LPDL or LPDLR can be studied in order to study structure/function relationships of the protein products and their physiological effects.

Alternatively, rather than evaluating the levels of LPDL or LPDLR expression in the presence of a test compound, other proteins which interact with the LPDL or LPDLR protein products may be assessed through signal transduction assays, such as are well known in the art.

Such assays would identify the impact of certain compounds on LPDL or LPDLR function and subsequent intracellular protein interaction and physiological effect.

The present invention also includes screening compounds for their ability to affect the interaction between LPDL or LPDLR and their binding partners.

Accordingly, the present invention provides a method for identifying a compound that affects the binding of an LPDL or LPDLR protein and an LPDL or LPDLR binding protein comprising:

(a) incubating (i) a test compound, (ii) an LPDL or LPDLR protein and (iii) an LPDL or LPDLR binding protein under conditions which permit the binding of

LPDL or LPDLR protein to the LPDL or LPDLR binding protein, and

(b) assaying for complexes of LPDL or LPDLR protein and the LPDL or LPDLR binding protein and comparing to a control (i.e. in the absence of the test substance), wherein a reduction of complexes indicates that the compound has an effect on the binding of the LPDL or LPDLR protein to an LPDL or

LPDLR binding protein.

All testing for novel drug development is well suited to defined cell culture systems which can be manipulated to express LPDL or LPDLR and study the result of LPDL or

LPDLR protein signaling and gene transcription. Animal models are also important for testing novel drugs and thus may also be used to identify any potentially useful compound affecting LPDL or LPDLR expression and activity and thus physiological function. (viii) Industrial Uses

Dietary fats have important effects on human health and disease. The efficient digestion of dietary fats (triglycerides) can be achieved by a group of lipase proteins which are secreted into digestive tracts. They include lingual, gastric and pancreatic lipases (Hamosh Nutrition. 6, 421-8. ,1990, Lowe, J Nutr. 127, 549-57. 1997). Although lipase fuction is important for normal lipid metabolism, inhibition of its fuction can also be used in treating disease state. For example, an inhibitor of gastric lipases, Ro 18-tetrahydrolipstatin, was identifed and tested in treating obese patients (Hauptman et al. Am J Clin Nutr. 55, 309S-13S 1992). The regulation of dietary lipid in digestive system is complicated. For example, Knochout of carboxyl ester lipase decreased intestinal absorption of dietary cholesteryl ester but retinyl ester absorption is normal (Weng et al. Biochemistry. 38, 4143-9. 1992).

Because LPDLR lipase is expressed in the colon, mammary and salivary glands, it functions in promoting dietary lipid digestion and energy intake. Accordingly, increase of LPDLR lipase activity in the digestive tracts should help energy intake and gaining weight while disruption of LPDLR function should have negative effect on body energy metabolism and inducing weight loss. In food industry, LPDLR lipase might be served as a nutriment or food additive in improving health conditions. Alternatively, modulation or cancellation of LPDLR lipase function may help controlling body weight for obese patients. LPDLR lipase treatment or modulation could be applyed alone or combined with other lipases such as gastric lipase or LPDL. In a similar manner, modulation of lipase function can be used in meat industry in controlling leanness of animals such as pig, cow and chiken.

In oil and waste management industry, lipase can be used for cleaning of lipid contamination. For example, enzymatic kinetics of continuous hydrolysis of palm oil triglyceride in organic solvent using a source of immobilized lipase was studied in packed bed reactor (Min et al., Artif Cells Blood Substit Immobil Biotechnol. 27, 417-21, 1999). Another group used continuous cultivation technique screening for lipase-producing microorganisms suitable for the degradation of domestic wastes and interesterification of butter fat by lipase isolates (Pabai et al. Can J Microbiol. 42, 446-52, 1996). The LPDL and LPDLR lipases might be used in oil industry or in waste management. They may be used alone or in combination with each other or with other mammalian or bacteria lipases. (ix) Therapeutic Uses

As previously discussed, the LPDL or LPDLR proteins of the invention are likely involved in the regulation of triglyceride metabolism, lipoprotein metabolism and energy homeostasis. Accordingly, the present invention provides a method of modulating triglyceride, lipoprotein metabolism and energy homeostasis comprising of administering to a cell or animal in need thereof, an effective amount of agent that modulates LPDL or LPDLR expression and/or activity. Apart from applying LPDL and/or LPDLR genes or proteins, the invention also includes a use of an agent that modulates LPDL or LPDLR expression or activity to modulate triglyceride metabolism, lipoprotein metabolism and energy homeostasis, or to prepare a medicament to modulate triglyceride, lipoprotein metabolism and energy homeostasis.

The term "agent that modulates LPDL or LPDLR expression and/or activity" means any substance that can alter the expression and/or activity of LPDL or LPDLR and includes agents that can inhibit LPDL or LPDLR expression or activity and agents that can enhance LPDL or LPDLR expression or activity. Examples of agents which may be used to modulate LPDL or LPDLR include nucleic acid molecules encoding LPDL or LPDLR, the LPDL or LPDLR protein as well as fragments, analogs, derivatives or homologs thereof, antibodies, antisense nucleic acids, peptide mimetics, substances isolated using the screening methods described herein or substances that modulate the interaction of LPDL or LPDLR with LPDL OR LPDLR associating or binding proteins.

The term "effective amount" as used herein means an amount effective, at dosages and for periods of time necessary to achieve the desired results.

The term "animal" as used herein includes all members of the animal kingdom, including humans. As stated previously, LPDL or LPDLR may be involved in modulating triglyceride activity and metabolism and stimulators and inhibitors of LPDL or LPDLR may be useful in modulating disorders involving triglyceride activity such as hypertriglyceridemia. For example, substances that stimulate LPDL (for example, identified using the methods of the invention) may be used to prevent hypertriglyceridemia and the diseases caused by hyertriglyceridemia, such as atherosclerosis. Inhibitors could be used where increased triglyceride levels would advantageous.

In one embodiment, the invention provide a methods of treating lipase deficiencies, fatty livers, hypertriglyceridemia, lipoprotein metabolism defects, preventing and treating atheroscrelosis and cardiovascular diseases, by administering to a cell or animal an effective amount of an agent that modulates, preferably stimulate, the expression or the biological activity of LPDL or LPDL, such that there is a reduction in triglyceride activity. The diseases treated not only include those genetic defects in lipid metabolism but also the secondary diseases result from other primary defects such as the dyslipidemia from diabetes or lipoprotein defects. In another embodiment, the invention provides methods of modifying the body energy homeostasis. For example, hormone sensitive lipase (HSL) hydrolyzes the triglycerides in white fat mass and increases the body energy consumption (Kahn Nature Genet. 25, 6-9, 2000). One study demonstrated the lean and obese women responded very differently in a carbonhydrate load and the plasma triglycerides were significantly higher in obese women than in the lean controls (Dallongeville et al., J Nutr. 132, 2161-6., 2002). In one example, LPDL and LPDLR lipases can be used to increase the body energy metabolism, accelerate triglycerides comsumption and decrease the body weight or prevent the obese people from gaining more weight. In another mechanism, HSL, LPDL and/or LPDLR lipase function can be abolished or decreased to help lean body slowing down energy comsuption and gain weight. The therapy includes but not limits to the following diseases: lipase deficiency, lipoprotein defects, hypertriglyceridemia (primary genetic defect or secondary from other diseases), fatty liver diseases, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), body weight disorders (including but not limited to obesity, cachexia and anorexia), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), eczema, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of lipase deficiency, lipoprotein defects, hypertriglyceridemia, high cholesterol, atherosclerosis, fatty liver disease, cardiovascular diseases, hyper triglyceride metabolism and hypo triglyceride metabolism.

In accordance with another embodiment, the present invention enables gene therapy as a potential therapeutic approach, in which normal copies of the LPDL or LPDLR gene are introduced into patients to successfully code for normal LPDL or LPDLR protein in several different affected cell types. Mutated copies of the LPDL or LPDLR gene, in which the protein product is changed, can also be introduced into patients.

Retroviral vectors can be used for somatic cell gene therapy especially because of their high efficiency of infection and stable integration and expression. The targeted cells however must be able to divide and the expression of the levels of normal protein should be high. The full length LPDL or LPDLR gene can be cloned into a retroviral vector and driven from its endogenous promoter or from the retroviral long terminal repeat or from a promoter specific for the target cell type of interest. Other viral vectors which can be used include lentivirus, adenovirus, adeno-associated virus, vaccinia virus, bovine papilloma virus, or a herpesvirus such as Epstein-Barr virus. Gene transfer could also be achieved using non-viral means requiring infection in vitro. This would include calcium phosphate, DEAE dextran, electroporation, cationic or anionic lipid formulations (liposomes) and protoplast fusion. Although these methods are available, many of these are lower efficiency.

Transplantation of normal genes or mutated genes that code for an active LPDL or LPDLR into a targeted affected area of the patient can also be useful therapy for any disorder in which LPDL or LPDLR activity is deficient. In this procedure, a LPDL or LPDLR gene is transferred into a cultivatable cell type such as hepatocytes and testis cells. The transformed cells are then injected into the patient.

The invention also provides a method for reversing a transformed phenotype that results from excessive expression from the LPDL or LPDLR human gene sequence, and/or hyper-activation of a LPDL or LPDLR protein product. Anti-sense based strategies can be employed to explore gene function, inhibit gene function and as a basis for therapeutic drug design. The principle is based on the hypothesis that sequence specific suppression of gene expression can be achieved by intracellular hybridization between mRNA and a complementary anti-sense species. It is possible to synthesize anti-sense strand nucleotides that bind the sense strand of RNA or DNA with a high degree of specificity. The formation of a hybrid RNA duplex may interfere with the processing/transport/translation and/or stability of a target mRNA.

Hybridization is required for an antisense effect to occur. Antisense effects have been described using a variety of approaches including the use of antisense oligonucleotides, injection of antisense RNA, DNA and transfection of antisense RNA expression vectors.

Therapeutic antisense nucleotides can be made as oligonucleotides or expressed nucleotides. Oligonucleotides are short single strands of DNA which are usually 15 to 20 nucleic acid bases long. Expressed nucleotides are made by an expression vector such as an adeno viral, retroviral or plasmid vector. The vector is administered to the cells in culture, or to a patient, whose cells then make the antisense nucleotide. Expression vectors can be designed to produce antisense RNA, which can vary in length from a few dozen bases to several thousand.

Antisense effects can be induced by control (sense) sequences. The extent of phenotypic changes are highly variable. Phenotypic effects induced by antisense are based on changes in criteria such as biological endpoints, protein levels, protein activation measurement and target mRNA levels.

In the present invention, mammalian cells in which the LPDL or LPDLR gene is overexpressed and which demonstrate an abnormal phenotype, can be transfected with anti- sense LPDL or LPDLR nucleotide DNA sequences that hybridizes to the LPDL or LPDLR gene in order to inhibit the transcription of the gene and reverse or reduce the abnormal phenotype. Expression vectors can be used as a model for anti-sense gene therapy to target the LPDL or LPDLR which is expressed in abnormal cells. In this manner abnormal cells and tissues can be targeted while allowing healthy cells to survive. This may prove to be an effective treatment for cell abnormalities induced by LPDL or LPDLR. Immunotherapy is also possible for the treatment of diseases associated with excess LPDL or LPDLR activity. Antibodies can be raised to a hyperactive LPDL or LPDLR protein (or portion thereof) and then be administered to bind or block the abnormal protein and its deleterious effects. An immunogenic composition may be prepared as injectables, as liquid solutions or emulsions. The LPDL or LPDLR protein may be mixed with pharmaceutically acceptable excipients compatible with the protein. Such excipients may include water, saline, dextrose, glycerol, ethanol and combinations thereof. The immunogenic composition and vaccine may further contain auxiliary substances such as emulsifying agents or adjuvants to enhance effectiveness. Immunogenic compositions and vaccines may be administered by subcutaneous or intramuscular injection. The immunogenic preparations and vaccines are administered in such amount as will be therapeutically effective, protective and immunogenic. Dosage depends on the route of administration and will vary according to the size of the host.

The invention also makes it possible to screen for antagonists that inhibit the effects of LPDL or LPDLR. Thus, the invention may be used to assay for a substance that anatagonizes or blocks the action of the proteins.

Substances identified by the methods described herein, may be used for modulating LPDL or LPDLR activity or action and accordingly may be used in the treatment of conditions involving perturbation of the protein. In particular, the substances may be particularly useful in the treatment of disorders of hematopoietic cell proliferation. (viii) Pharmaceutical Compositions

The above described substances including LPDL and LPDLR proteins, nucleic acids encoding LPDL or LPDLR proteins, antibodies, and antisense oligonucleotides as well as other agents that modulate LPDL or LPDLR may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for administration in vivo for the treatment of various conditions. Such conditions include disorders selected from the group consisting of eczema, cardiovascular disorders (including but not limited to hypertriglyceridemia, dyslipidemia, atherosclerosis, coronary artery disease, cerebrovascular disease hypertension, and peripheral vascular disease), inflammation (including but not limited to sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis and acne), Sjδgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, body weight disorders (including but not limited to obesity, cachexia and anorexia), psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, hypercholesterolemia, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and diabetic complications. In preferred embodiments, the conditions are selected from the group consisting of high cholesterol, hypertriglyceridemia, atherogenesis, fatty liver disease, hyper triglyceride metabolism and hypo triglyceride metabolism.

By "biologically compatible form suitable for administration in vivo" is meant a form of the substance to be administered in which any toxic effects are outweighed by the therapeutic effects. The substances may be administered to living organisms including humans, and animals.

Administration of a therapeutically active amount of pharmaceutical compositions of the present invention is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, a therapeutically active amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance to elicit a desired response in the individual. Dosage regimes may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. An active substance may be administered in a convenient manner such as by injection

(subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration. Depending on the route of administration, the active substance may be coated in a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound. If the active substance is a nucleic acid encoding, for example, a modified LPDL or LPDLR it may be delivered using techniques known in the art.

The compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985) or Handbook of Pharmaceutical Additives (compiled by Michael and Irene Ash, Gower Publishing Limited, Aldershot, England (1995)). On this basis, the compositions include, albeit not exclusively, solutions of the substances in association with one or more pharmaceutically acceptable vehicles or diluents, and may be contained in buffered solutions with a suitable pH and/or be iso-osmotic with physiological fluids. In this regard, reference can be made to U.S. Patent No. 5,843,456. As will also be appreciated by those skilled, administration of substances described herein may be by an inactive viral carrier.

The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation. In one embodiment, transgenic cells containing genes of the invention can be prepared and used for introduction into a patient. In preparing cells for transfection and subsequent introduction into a patient's system, it is preferred to start with somatic mammalian cells obtained from the eventual recipient of the cell-based gene transfer treatment of then present invention. A wide variety of different cell types may be used, including fibroblasts, endothelial cells, smooth muscle cells, progenitor cells (e.g. from bone marrow, adipose, or peripheral blood), dermal fibroblasts, EPC (endothelial progenitor cells) or other mesenchymal cells, marrow stromal cells (MSC), and epithelial cells, and others. Dermal fibroblasts are simply and readily obtained from the patient's exterior skin layers, readied for in vitro culturing by standard techniques. Endothelial cells are harvested from the eventual recipient, e.g. by removal of a saphenous vein and culture of the endothelial cells. Progenitor cells can be obtained from bone marrow biopsies or isolated from the circulating blood, and cultured in vitro. The culture methods are standard culture techniques with special precautions for culturing of human cells with the intent of re-implantation.

The somatic gene transfer in vitro to the recipient cells, i.e. the genetic engineering, is performed by standard and commercially available approaches to achieve gene transfer, as outlined above. Preferably, the methods include electroporation, the use of poly cationic proteins (e.g. SUPERFECT*) or lipofection (e.g. by use of GENEFECTOR), agents available commercially and which enhance gene transfer. In particular, electroporation provides a high degree of transfection and does not require the use of any foreign material. However, other methods besides electroporation, lipofection and polycationic protein use, such as viral methods of gene transfer including adeno and retro viruses, may be employed. These methods and techniques are well known to those skilled in the art, and are readily adapted for use in the process of the present invention. Electroporation is the most preferred technique, for use with dermal fibroblast host cells, while the use of polycationic proteins is useful for use with smooth muscle cells.

The following non-limiting examples are illustrative of the present invention: EXAMPLES Example 1 Sequencing of the Ipd locus and bioinformatic identification and cloning of a novel lipase (Ipdl) Because mutant Ipd homozygotes had hepatic steatosis and hypertriglyceridemia, we hypothesized that the murine Ipd locus would encode a TG lipase. Since analysis of the junction sequences of the Ipd transgene insertion locus did not yield any lipase-related sequences and the mouse genetic sequencing database was not available at that time, we chose to clone the entire wild-type Ipd locus with bacteria artificial chromosomes (BACs) that encompassed the effected region. By screening a wild-type mouse genomic BAC library with two probes that flanked each side of the transgene, three BAC clones containing the Ipd locus were identified. Using shotgun strategy, we sequenced one BAC clone (BAC#016) with -3- fold redundancy. 719 sequences for a total of 449,373 base pairs (bp) were randomly sequenced. These sequences formed 93 contigs for a total contig length of 163,372 bp (Figure 5A). We used the BLASTX engine (http://www.ncbi.nlm.nih.gov) to interrogate all non- redundant GenBank sequences with the 93 contigs and identified a fragment in contig #6 that had significant homology to a portion of both human and rat phosphatidylserine-specific phospholipase Al (PS-PLA1) with -50% identity at the protein sequence level. Following the identification of this lipase-related sequence, bioinformatic gene prediction tools were used to identify five putative exons from four contigs [#6 (Figure 6), #28 (Figure 7), #86 (Figure 8) and #98 (Figure 9)], which translated as a continuous putative protein sequence of 261 amino acid (designated as Ipd lipase or Ipdl) that includes the highly conserved Gly-Met-Ser-Leu-Gly lipase consensus sequences (Figure 5B&C). With the availability of murine LPDL exon sequences, the inventors tried to identify its mouse and human ESTs in the published genetic databases but no ESTs with significant homology were found. Based on the predicted exon sequences of murine LPDL, primers were then designed to clone the cDNA fragment of murine LPDL and a 0.6 kb fragment was generated by RT-PCR from mouse testis sample cDNA. The upstream and downstream sequences of the 0.6kb fragment were cloned by 5'RACE and 3'RACE (Rapid Amplification of cDNA End). All the cloned fragments are sequenced and assembled which represents mouse Ipdl cDNA sequence of 2,056 bp in length. Mouse LPDL gene encodes a LPDL protein of 423 amino acids (Figure 2B).

To clone the mouse full length Ipdl gene, the inventors performed PCR cloning in mouse Marathon-Ready Testis cDNA (Clontech, Cat. No. 74551-1) with primers designed from the above assembled mouse Ipdl cDNA sequences. The sequence of 5'-primer, lpd5'UTRl, is: CCGTCCTTCCCACTTGATTA, the sequence 3'-primer, lpd-Full-3R2, is: GGTTGAAGATCTACCCTTGTTCC. A cDNA of 1,383 bp (Figure 2C) was cloned which encodes a lipase protein (lpdl2) of 407 amino acids (Figure 2D). Since the human LPDL protein has 460 amino acids, the two mouse Ipdl proteins identified here are much shorter and could be different spliced isoforms of the Ipdl gene.

Example 2

Gene expression of LPDL and LPDLR gene To identify the gene expression pattern, the inventors completed a mouse multiple tissue Northern blot analysis. With probes generated from predicted exon sequences of the genomic BAC clone, the inventors successfully detected a 2 kb band in testis RNA but not in any other adult mouse tissues examined including heart, brain, spleen, lung, liver, skeleton muscle and kidney (Fig. lOAa). By non-radiation RNA in situ hybridization with DIG-labeled anti-sense probe (Schaeren-Wiemers et al. 1993), mouse Ipdl expression was strongly detected in testis (Figure 10 B-b) and weakly in the liver (Figure 10 B-d) in two week-old mice as compared to control tissue sections hybridized with sense probe (Figure 10 B-a&c) In adult mice, Ipdl expression was detected in the cytoplasm of primary spermatocytes but not in the matured sperm or Leydig cells between the seminiferous tubules (Figure 10 B-d). With human LPDL gene as probe, Northern blotting also showed that human LPDL was expressed in testis (Figure 10 A-b). However, for the human LPDLR gene, Northern blot hybridization suggested that it was highly expressed in colon, prostate and testis with four different sized isoforms ranging from 2 to 4 kb. The strongly expressed isoform in colon was -3 kb, whereas in testis the -4 kb transcript was highly expressed. The -3 and 4 kb transcripts were expressed at comparable levels in prostate (Figure 10 A-c).

Like LPDL, other lipases such as EL and HSL are also highly expressed in the testis, which may reflect higher TG energy metabolism (Hirata et al., 1999, Mairal et al. 2002, Haemmerle et al 2002). Hepatic expression of LPDL in two week-old mice supports the hepatic phenotype in the Ipd mutant mice. Apart from the expression in testis and prostate, human LPDLR is expressed in colon, and ESTs of mouse Ipdlr had also been identified from salivary gland and mammary gland suggesting a role in digesting exogenous dietary TG.

Example 3

Cloning of human LPDL cDNA Using mouse Ipdl gene fragments as probes screening a human testis large insert cDNA library (Cat. No. HL5503u, Clontech, Palo Alto, California), four positive clones have been identified. Sequencing of these clones revealed a cDNA of 1685 bp in length. The open reading frame (ORF) was found to be 1383 bp in size (Figure 1A) with a start codon (ATG) at nucleotide 78 and stop codon (TAG) at nucleotide 1640. The ORF encodes a human LPDL protein of 460 amino acids (Figure IB and Figure 11). A hydrophobic leader sequence with a putative cleavage site after amino acid residue 15 was predicted by SPScan program of SeqWeb Wisconsin GCG Package. The lipase consensus sequence GXSXG was found with an active serine at amino acid residue 159. Sequence analysis suggested the existence of two additional active residues, Asp-183 and His-258 that are predicted to form a catalytic triad with Ser-159 (Emmerich et al. 1992). A lipase lid sequence has also been identified between two cysteine residues at 238 and 251 and likely functions to determine substract specificity (Dugi et al. 1995). Seven conserved cysteine residues at amino acid 55, 238, 251, 275, 286, 289 and 297 that could participate in disulfide bridge formation (van Tilbeurgh et al. 1994) were also found. Other conserved cysteines include Cysl 1 and Cys455 (Figure 11).

Example 4

Identification of a New LPDL-Related Lipase LPDLR

Using Ipdl protein sequence to BLAST-search against the translated EST database, the inventors identified a mouse EST (BG868436, from salivary grand) which translated to another novel lipase with significant homology to Ipdl. However, the homology is only at the protein level but not at nucleotide level. The inventors named this novel lipase as /pα7-related lipase or Ipdlr. Sequencing of BG868436 revealed a cDNA of 2,155 bp in length with ORF starting from nucleotide 78 and stopping at nucleotide 1640. The ORF encodes a mouse Ipdlr protein of 451 amino acids (Figure 3 and Figure 12). The lipase consensus sequence GxSxG was found with an active serine at amino acid residue 154. Alignment analysis suggested that, for the putative catalytic triad, Asp 178 and Serl54 were conserved (Emmerich et al. 1992), but the normally conserved histidine residue within the triad was replaced by Tyr253 (Figure 12). A lipase lid sequence was also identified between two cysteine residues at 233 and 246 with 12 amino acid and demonstrates good structural similarity as LPDL proteins and PS-PLA1. Eight conserved cysteine residues at amino acid 12, 233, 246, 270, 281, 284, 292 and 446 that could participate in disulfide bridge formation (van Tilbeurgh et al. 1994). The human LPDLR cDNA were sequenced as 2481 bp in length which translate into a protein of 451 amino acids (Figure 4B). Example 5 LPDL and LPDLR are new members of conserved lipase gene family

Alignment of human LPDL and mouse Ipdlr protein sequences with other human lipases revealed significant structural conservation (Figure 13). By algorithm analysis to compare two sequence alignment (Henikoff, et al. 1992), human LPDL exhibits 71% identity to mouse Ipdl protein and 44% identity to mouse Ipdlr. Comparing to other human lipases, LPDL exhibited 36%, 34%, 32%, 31% and 31% amino acid identity to human endothelial derived lipase (EDL or LIPG), pancreatic lipase (PNLIP), hepatic lipase (HL), pancreatic lipase related protein 1 (LIP1) and lipoprotein lipase (LPL). Interestingly, human LPDL also demonstrates very high sequence homology to the phospholipase PS-PLA1 with an amino acid identity of 34%. The "catalytic triad" as well as the lipase consensus sequences GxSxG are conserved in all triglyceride lipases and PS-PLA1. Among the ten highly conserved cysteine residues required in triglyceride lipase for tertiary structure formation, seven appeared to be conserved in the LPDL protein (Figure 13).

The lid domain plays a crucial role in determining lipase substrate specificity (Dugi et al. 1995, Lowe 1997). The lid in both human LPDL and mouse Ipdlr is composed of 12 amino acids, which is much shorter than those found in human PNLIP, LIP1 , EDL, LPL and HL (23, 23, 19, 22 and 22 residues, respectively) (Figure 13). Interestingly, both hLPDL and mLPDLR lid sequences show higher homology to the lid of PS-PLA1 which is also 12 amino acids in length (Figure 13). However, the LPDL and Ipdlr proteins does not contain the phosphatidylserine-binding peptide motif that exists in PS-PLA1 and functions for phosphatidylserine selectivity (Igarashi et al. 1995). Phylogenetic analysis shows that LPDL, LPDLR and PS-PLA1 share higher structural conservation (Figure 14), suggesting they form a subfamily within the lipase gene family. Example 6 Genomic Structure of Human LPDL Gene and LPDLR Gene Using the mouse Ipdl exon sequences to BLAST search against the nucleotide genetic database in GenBank, the inventors identified a genomic sequence of 340 kb (AP001660) on chromosome 21 q with significant homology to the mouse Ipdl gene. Ten DNA fragments from this genomic sequence were further characterized as exons of the human LPDL gene. The exon/intron boundaries were determined using a combination of analysis with exon/intron consensus sequences, bioinformatic gene prediction tools and alignment with the cloned human cDNA sequences (Table 1). The exon sizes of human LPDL gene range from 90 to 386 bp and they span a genomic region >100 kb. The largest intron, intron 9, spans 35.5 kb and the smallest intron, intron 4, spans -1 kb (Table 1). Start and stop codons are located in exons 1 and 10, respectively, and lipase consensus sequence GXSXG is in exon 3. Exons 4, 5 and 6 span the most conserved regions, including the lid sequences and two of three active residues within the triad structure for catalytic activity. The exon sequences and partial intron sequences of human LPDL gene is shown in Figure 15. Similarly, the exon sequences of human LPDLR gene were identified and shown in Figure 16.

Table 1 . Intron-βxon boundaries of human LPDL Exon size bp 5 ' boundary 3 ' boundary Intron size kb

1 106 .. GAGTTACGGA GTGAGATCTGgtaagatatt 1 21

2 386 cttatttcagATAATAAAAG AAATCTTTTGgtaagtctgg 2 3

3 109 ttaattgcagAAGCATGGTG AGAATAACAGgtaaaattat 3 4

4 102 tgctttccagGTCTTGACCC GACTCCAATGgtaacaaatc 4 15

5 90 ttcttctcagGTTTAGGCAT ATTTTCTCAGgtatactgac 5 1

6 168 aacccttaagGAATTCAATT CCTCGGCTGGgtaagagaga 6 2

7 105 caaatctcagGTTATCAAGC CCATTCTGTAgtaagttatt 7 10 8 8 1 11122 tattttgtagCCTATTATTT GGCTTTATGAgtaagtaaaa 8 10

9 177 ttctctctagAAAGAACAAA ACCCAGAAAGgtaagaaaat 9 35

10 206 tctttctcagACCACCACTT CTATTTCTTGG...

Example 7

Genetic Disruption in mutant Ipd locus

Using 5' RACE, sequencing, searching mouse genetic databases and bioinformatic gene prediction, the inventors identified a continuous mouse genomic fragment of 110 kb, which contained all 10 exons of the mouse Ipdl gene. When aligning the mouse Ipdl sequences with the human genomic LPDL sequences, 9 of 10 exons were within the conserved peaks with >75% sequence identity (Figure 17). Within the -5 kb region before exon 1, there was another cluster of peaks with sequence identity of 50 to 75% which may represent the conserved promoter sequences for the gene and regulatory elements.

Since the identified lipase-like gene was a logical candidate for the Ipd phenotype, the inventors next confirmed that the transgene insertion in the Ipd locus disrupted the Ipdl lipase gene. The inventors mapped the transgene junction clones relative to the gene structure of the mouse Ipdl gene. One junction clone (D3) was mapped before mouse exon 10 while the other junction clone (3 A) mapped after exon 10 (Figure 17), indicating that exon 10 of the Ipdl gene was deleted in the mutant Ipd locus. It is perhaps of interest that -7 kb upstream of the Ipdl gene, there were five conserved peaks (with >75% identity) designated as Conserved Nucleotide Sequences (CNS), which may represent another gene (Figure 17).

The finding that the exon 10 of Ipdl is deleted in the Ipd mutant suggests that C- terminal sequences may participate in the substrate specificity during TG hydrolysis. Besides deletion of exon 10, other genetic rearrangements could not be ruled out because of the complexity of gene mutations, especially transgene-induced mutations. For example, the most recently characterized mutation/?^ (fatty liver dystrophy) is characterized by a deletion of 2 kb sequences eliminating exon 2 and 3, and inversion of 40 genomic sequences plus a duplication of 0.5 kb segments in 3'UTR(Peterfy et al., 2001). Example 8 Human LPDL and LPDLR SNPs and association with plasma lipoproteins

Since the mouse Ipd mutation had both disrupted Ipdl and high plasma TG, the inventors considered that LPDL gene variation in humans might contribute to dyslipidemia. The inventors addressed this hypothesis in two ways. First, from genomic DNA we directly sequenced LPDL exons of 60 non-diabetic Caucasians with moderate to severe hypertriglyceridemia (mean+SEM untreated TG 12.1+8.5 mmol/L, age 55+12 years) who had no obvious secondary cause of hyperlipidemia, and 10 matched normolipidemic Caucasian controls (untreated TG 1.1+0.3 mmol/L). The primer sequences used for amplifying LPDL exons are listed in Figure 18 A. The hypertriglyceridemic subjects had previously been shown to have no mutation in LPL, HL or EDL. For newly discovered SNPs, allele frequencies were determined in subjects from 80 Caucasian subjects. The inventors found six non-transcribed and seven transcribed SNPs (Figure 19), including the nonsynonymous SNPs C55Y, G364E, E431K and D444E (Table 2). Genotype frequencies for each SNP did not deviate significantly from Hardy-Weinberg expectations in all samples. Mild to moderate pairwise linkage disequilibrium was observed for about half of the pairwise comparisons of LPDL SNP genotypes in Caucasians (data not shown). Two SNPs were further characterized in several additional samples of 80 individuals each: in African, East Indians, Chinese, Inuit and Amerindian, the frequencies for K431 were 0.57, 0.24, 0.05, 0.31 and 0.20, respectively, and the frequencies for E444 were 0.53, 0.51, 0.58, 0.69 and 0.51, respectively. Allele frequencies of six coding SNPs in 186 hypertriglyceridemic Caucasian subjects (TG>10 mmol/L) and 232 matched Caucasian controls (TG<1 mmol/L) were compared, and none was found to be significantly different between samples. However, heterozygosity for C55Y was found only in the Caucasian hypertriglyceridemic patients (2/186 vs 0/232), suggesting that this might be a rare mutation associated with hypertriglyceridemia.

Table 2 . LPDL SNPs and allele frequencies

A. Non-transcribed LPDL SNPs location nucleotide allele frequencies Caucasian)

Intron 1 41 nt 5' to exon 2 OT T: 0.14

Intron 2 74 nt 5' to exon 3 C>T T: 0.25

Intron 4 49 nt 3 ' to exon 4 A>G G: 0.32

Intron 5 16 nt 5' to exon 6 T>C C: 0.02

Intron 9 46 nt 3' to exon 9 G>A A: 0.35

3' to ORF nt +146 G>T T: 0.18

B. Transcribed LPDL SNPs location amino acid nucleotide allele frequencies (Caucasian)

Exon 1 -540T T: 0.20

Exon 2 C55Y 164G>A only in hypertriglyceridemic subjects

Exon 3 S159 4770T T: 0.25

Exon 8 G364E 1091G>A A: 0.03

Exon 9 E431K 1291G>A A: 0.34

Exon 10 D444E 13320A A: 0.55

3' UTR +80G>A A: 0.43 Next, the inventors tested for associations of SNP genotypes with plasma lipoproteins in three unrelated samples using our established approach (Hegele et al., 1994, 2001a and 2001b). Two independently ascertained, unrelated samples of healthy, normolipidemic Caucasians (174 and 161 individuals) and a well-characterized sample of healthy Inuit (208 subjects) (Hegele et al., 2001b) were studied. The first sample of 174 Caucasians was 48.3% male and had mean (+SEM) age 50.1 ±4.3 years. The second sample of 161 Caucasians was 42.0% male and had mean (+SEM) age 53.7+5.8 years. In ANOVA, dependent variables were the four plasma lipoprotein traits (TG, total, HDL and LDL cholesterol), appropriately transformed to give distributions that were not significantly different from normal. Correction was made for age, sex and body mass index by including these as independent covariates, along with the genotype for the coding SNPs only, assuming dominant, co-dominant and recessive models for each minor allele, as described (Hegele et al., 2001b). Seven significant associations were found with plasma lipoproteins (Figure 20). At least one LPDL SNP genotype was associated with variation in HDL cholesterol in all three samples. Also, LPDL SNP genotypes were associated with variation in LDL cholesterol in both Caucasian samples (Figure 20).

While 7 transcribed SNPs were discovered, only one putative mutation was identified, namely C55Y, which was present only in hypertriglyceridemic subjects. C55 is an important residue in LPDL, which is predicted to participate disulfide bridge formation and in determining lipase tertiary structure (van Tilbeurgh et al. 1994, Lowe 1997). C55 is also conserved in both mouse Ipdlr and human PS-PLA1 (Fig. 13). Therefore, the C55Y substitution may affect function.

Replication in three independent normolipidemic samples strengthens the case for association between LPDL SNPs and HDL cholesterol, although linkage disequilibrium with unmeasured variants at another gene remains possible. Variation in HDL cholesterol has been previously been associated with SNPs in other lipases, specifically in LPL (reviewed in Busch and Hegele 2000), HL (Cohen et al. 1999) and EDL (deLemos et al. 2002). The mechanisms underlying these associations are unknown, but LPDL appears to be a fourth lipase that is associated with variation in plasma HDL cholesterol. The absence of concomitant association of LPDL SNPs with plasma TG is compatible with observations from other experiments and model systems in which TG and HDL metabolism are uncoupled (Hegele 2001).

Using a similar strategy, the inventors amplified the ten exons of human LPDLR gene in 30 non-diabetic Caucasians with moderate to severe hypertriglyceridemia (untreated TG>10 mmol/L) with primers listed in Figure 18B. The hypertriglyceridemic subjects had previously been shown to have no mutation in LPL, HL or EDL. For newly discovered SNPs, allele frequencies were determined in subjects from 80 Caucasian subjects. The inventors found three non-transcribed and two transcribed SNPs, (Table 3). The two coding SNPs appeared to be silent without amino acid substitution. The reference sequences for LPDLR SNP screening is the assembled exon sequences and corresponding protein sequences as listed in Figure 16B. A larger scale screening for LPDLR SNPs is expected.

Table 4 . LPDLR SNPs and allele frequencies

A A.. NNoonn--ttrraannssccrriibl ed LPDLR SNPs location nucleotide allele frequencies (Caucasian)

Intron 1 90 nt 3 ' to exon 1 G>A A: 0.01

Intron 8 29 nt 3' to exon 8 OT T: 0.46

5' UTR nt -56 OT T: 0.01

B. Transcribed LPDLR SNPs location amino acid nucleotide allele frequencies (Caucasian)

Exon 6 C284 934C>T T: 0.087

Exon 9 K372 1198A>G A: 0.46

Example 9

Gene promoter and regulatory sequences in LPDL and LPDLR gene

Since the LPDL gene is highly expressed in testis and weakly expressed in the liver but not in any other tissues examined, LPDL promoter activity is very tissue specific. When aligning -100 the mouse and human LPDL genomic sequences together, the inventors identified -4 kb region before exon-1 (Figure 17), which represents the promoter and regulatory region. The inventors then cloned the promoter region upto -6 kb (SEQ.ID.NO.77) from the BAC#16 DNA of mouse Ipdl gene. In defining the regulatory region and identify the tissue specific elements, primers were designed to clone differently-sized fragments in the promoter region (Figure 21). A serious of promoter/reporter gene constructs ranging from -6 kb (P1F-P7R) to -2 kb (P5F-P7R) were constructed. One fragment of 341 bp with minimum promoter sequences served as experimental control. Human LPDL promoter sequence is shown in Figure 21B (SEQ.ID.NO.78). With computing analysis of the promoter sequences using the online TESS software (http://www.cbil.upenn.edu/cgi-bin/tess/tess33), the inventors also identified potential binding sites for variety of transcription factors within the -6 kb promoter region. To demonstrate it in principle, Figure 22 shows transcription factors that potentially bind to the 200 bp region of murine Ipdl promoter. The promoter sequences of human and murine LPDLR gene (SEQ._D.NO.79 and SEQ._D.NO.80) are shown in Figure 23 A and B, respectively. Since LPDLR gene is expressed in different tissues such as prostate, testis, colon, mammary and salivary gland, different tissue specific regulatory elements are predicted. Similar studies are being conducted in characterizing LPDLR promoter. The characterized promoter and regulatory element could be employed to direct gene expression in desired tissues to modulate cellular processes and define the drug target.

Example 10

Expression recombinant LPDL and LPDLR protein In investigation of the function of the gene product, the recombinant LPDL protein is expressed in baculovirus expression system using Invitrogen Bac-to-Bac HT Baculovirus Expression System (Invitrogen Cat. No. 10608016, Carlsbad, CA). A 6xHis tag is engineered into the construct for purification of the recombinant protein (anti-His antibody is commercially available). Recombinant baculovirus were generated and the recombinant proteins will be expressed in High Five cells (Invitrogen). Recombinant His6-tagged LPDL protein is purified from dialyzed culture media by immobilized metal-ion-affinity chromatography on Ni-nitrilotriacetic acid (Ni-NTA)-Sepharose (Qiagen Inc.). The LPDL protein is used in generating a monoclonal antibody. As the SNP in exon 2 (164G>A, C55Y) is only found in hypertriglyceridemic subjects, a site-specific mutagenesis is conducted in human LPDL cDNA to create a mutant gene and express the mutant form of protein, and its function be analyzed. Similarily, LPDLR is being expressed in the same baculovirus system. Example 11 Generation of viral vectors for LPDL gene therapy in murine models

Since adenoviruses have a wide spectrum of tissue tropism, the inventors made a first generation adenovirus vector that carries the human LPDL gene and mouse Ipdlr gene, respectively, for proof of principle in gene therapy. We used the AdMAX™ adenovirus vector system for the study. Since this system employs a Cre/LoxP site-specific recombination mechanism, the efficiency in rescuing the recombinant adenovirus is 30 folds higher than the regular strategy by homologous recombination (Ng et al. 1999). Northern blot analysis and RT-PCR have confirmed the virus-derived gene expression. To determine the expression of LPDL at protein level, we had generated an antibody against LPDL based on its peptide sequences and Western Blot analysis was performed. Apart from Ipd null function mice, there are also other transgenic mouse models with hypertriglyceridemia could be used for the LPDL- adenovirus gene therapy study to test the hypothesis that overexpression of LPDL and Ipdlr within the plasma compartment might ameliorate hypertriglyceridemia and modulate lipid processing. APOC3 transgenic mice and LPL deficient mice each develop marked hypertriglyceridemia on a chow diet and could serve as models of hypertriglyceridemia. Also, the APOE knockout mouse has a component of hypertriglyceridemia due to accumulation of TG-rich lipoproteins and remnants, which might also serve as substrates for circulating LPDL, expressed from an adenoviral vector construct. In addition, the Ipd mouse had substantial TG accumulation in hepatocytes, suggesting deficiency of an intracellular lipase activity. Since the LAL deficient mouse develops liver TG accumulation, without hypertriglyceridemia, and given the tropism of adenovirus for the liver, the LAL deficient mouse might also serve as an instructive model for IPDZ-adenoviral mediated gene therapy. We propose first to test a first- generation adenovirus vector in proof-of-principle studies. As the first generation adenovirus is highly immunogenic and gene expression will be relatively transient, we will explore use of the helper-dependent third-generation adenovirus system. Since the immunogenic viral genes have been removed in the helper-dependent vector, the system will not generate severe immuno-toxicity and gene expression will be prolonged (Schiedner et. al. 1997). An AAV viral vector may also be generated for in vivo studies of long term Ipdl replacement in a knockout mouse model.

While the present invention has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the invention is not limited to the disclosed examples. To the contrary, the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

References

Adeli K, Taghibiglou C, Van Iderstine SC, Lewis GF (2001) Mechanisms of hepatic very low- density lipoprotein overproduction in insulin resistance. Trends Cardiovasc Med 11 :170-176.

Ameis D, Stahnke G, Kobayashi J, McLean J, Lee G, Buscher M, Schotz MC, Will H. (1990)

Isolation and characterization of the human hepatic lipase gene. J Biol Chem., 265: 6552-6555 Anderson RA, Byrum RS, Coates PM, Sando GN (1994) Mutations at the lysosomal acid cholesteryl ester hydrolase gene locus in Wolman disease. Proc Natl Acad Sci USA 91 :2718- 2722.

Auch D, Reth M (1990) Exon trap cloning: Using PCR to rapidly detect and clone exons from genomic DNA fragments, Nuc. Acid Res., 18:6743-6744 Austin MA, Hokanson JE. (1994) Epidemiology of triglycerides, small dense low-density lipoprotein(a) as risk factors for coronary heart disease, Med Clin. North Am (Lipid Disorders), 78: 99-115 Austin MA (1999) Epidemiology of hypertriglyceridemia and cardiovascular disease. Am J

Cardiol 83: 13F-16F Austin MA, McKnight B, Edwards KL, Bradley CM, McNeely MJ, Psaty BM, Brunzell JD,

Motulsky AG (2000) Cardiovascular disease mortality in familial forms of hypertriglyceridemia: A 20-year prospective study. Circulation 101 :2777-2282

Bainton D, Miller NE, Bolton CH, Yarnell JWG, Sweetnam PM, Baker IA, Lewis B, Elwood PC

(1992) Plasma triglyceride and high-density lipoprotein cholesterol as predictors of ischaemic heart disease in British men. Br. Heart J., 68: 60-66 Beisiegel U (1996) New aspects on the role of plasma lipases in lipoprotein catabolism and atherosclerosis, Atherosclerosis, 124(l):l-8

Bird AP (1986) CpG-rich islands and the function of DNA methylation, Nature, 321 :209-213 Bradley A (1997) Production and analysis of chimeric mice. In Robertson, E.J. ed.,

Teratocarcinomas and Embryonic Stem Cells: a Practical Approach, Oxford, UK: IRL Press, pp.

113-151. Busch CP, Hegele RA (2000) Variation of candidate genes in triglyceride metabolism. J

Cardiovasc Risk 7:309-315. Cases S, Novak S, Zheng YW, Myers HM, Lear SR, Sande E, Welch CB, Lusis AJ, Spencer TA,

Krause BR, Erickson SK, Farese RV Jr (1998) ACAT-2, a second mammalian acyl-CoA: cholesterol acyltransferase. J Biol Chem 273: 26755-26764. Castelli WP (1992) Epidemiology of triglycerides: a view from Framingham, Am J. Cardiol,

70(suppl.): 3H-9H Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry, 18:5294-5299 Chuat JC, Raisonnier A, Etienne J, Galibert F (1992) The lipoprotein lipase-encoding human gene: sequence from intron-6 to intron-9 and presence in intron-7 of a 40-million-year-old Alu sequence. Gene, 110:257-261 Connelly PW, Maguire GF, Little JA (1987) Apolipoprotein CHSt. Michael. Familial apolipoprotein CII deficiency associated with premature vascular disease. J Clin Invest 80: 1597-

1606. Connelly PW, Hegele RA (1998) Hepatic lipase deficiency. Crit Rev Clin Lab Sci 35 :547-72

Deeb SS. and Peng RL. Structure of the human lipoprotein lipase gene. Biochemistry,

28:4131-4135 Dugi KA, Dichek HL, Talley GD, Brewer HB Jr, Santamarina-Fojo S. (1992) Human lipoprotein lipase: the loop covering the catalytic site is essential for interaction with lipid substrates, J Biol Chem., 267:25086-25091 Dugi KA, Dichek HL, Santamarina-Fojo S (1995) Human hepatic and lipoprotein lipase: the loop covering the catalytic site mediates lipase substrate specificity. J Biol Chem, 270:25396-25401 Durrington PN (1998) Triglycerides are more important in atherosclerosis than epidemiology has suggested, Atherosclerosis, 141(suppl. l):S57-62. Emmerich J, Beg OU, Peterson J, Previato L, Brunzell JD et al. (1992) Human lipoprotein lipase: analysis of the catalytic triad by site- directed mutagenesis of Ser-132, Asp-156, and His-241. J

Biol Chem, 267:4161-4165 Evans AJ, Sawyez CG, Wolfe BM, Connelly PW, Maguire GF, Huff MW (1993) Evidence that cholesteryl ester and triglyceride accumulation in J774 macrophages induced by very low density lipoprotein subtractions occurs by different mechanisms. J Lipid Res 34:703-717.

Frick MH, Syvanne M, Nieminen MS, Kauma H, Majahalme S, Virtanen V, Kesaniemi YA, Pasternack A, Taskinen M-R (1997) Prevention of the angiographic progression of coronary and vein-graft atherosclerosis by gemfibrozil after coronary bypass surgery in men with low levels of HDL cholesterol. Circulation, 96:2137-2143

Forrester JS (2001) Triglycerides: risk factor or fellow traveler? Curr Opin Cardiol\6:26l-264.

Gehrisch S, Kostka H, Tiebel M, Patzak A, Paetzold A, Julius U, Schroeder HE, Hanefeld M, Jaross W., (1999) Mutations of the human hepatic lipase gene in patients with combined hypertriglyceridemia/hyperalphalipoproteinemia and in patients with familial combined hyperlipidemia, J Mol. Med., 77:728-34

Gehrisch S. (1999) Common mutations of the lipoprotein lipase gene and their clinical significance, Curr Atheroscler Rep, 1 :70-78

Gianturco SH., Bradley WA. and Gotto AM. Jr (1982) Hypertriglyceridemic very low density lipoprotein induce triglyceride synthesis and accumulation mouse peritoneal macrophges. J Clin Invest, 70:168-176

Glatz JF, Storch J (2001) Unravelling the significance of cellular fatty acid-binding proteins. Curr Opin Lipidol 12: 267-274

Gordon JW, Vehlinger J, Dayani N, Talansky BE, Gordon M, and Neumann PE (1990) Analysis of the hotfoot (ho) locus by creation of an insertional mutation in a transgenic mouse, Devel. Biol. , 137: 349-358

Haemmerle G, Zimmermann R, Strauss JG, Kratky D, Riederer M, Knipping G, Zechner R. (2002a) Hormone-sensitive lipase deficiency in mice changes the plasma lipid profile by affecting the tissue-specific expression pattern of lipoprotein lipase in adipose tissue and muscle, J Biol Chem., 277: 12946 Haemmerle G, Zimmermann R, Hayn M, Theussl C, Waeg G, Wagner E, Sattler W, Magin TM, Wagner EF, Zechner R. (2002b) Hormone-sensitive lipase deficiency in mice causes diglyceride accumulation in adipose tissue, muscle, and testis, J Biol Chem. 277: 4806

Hegele RA, Plaetke R, Lalouel JM (1990) Linkage disequilibrium between DNA markers at the low-density lipoprotein receptor gene. Genet Epidemiol 7:69-81.

Hegele, R.A., Evans, A., Tu, L., Ip, G., Brunt, J.H. and Connelly, P.W. A gene-gender interaction affecting plasma lipoproteins in a genetic isolate. Arterioscler. Thromb. 14, 671-678 (1994)

Hegele RA, Breckenridge WC, Cox DW, Maguire GF, Little JA and Connelly PW (1998) Elevated LDL triglyceride concentrations in subjects heterozygous for the hepatic lipase S267F variant, Arterioscler Thromb Vase Biol, 18: 1212-6,

Hegele RA (2001) Monogenic dyslipidemias: window on determinants of plasma lipoprotein metabolism. Am J Hum Genet 69:1161-77.

Hegele RA, Ramdath DD, Ban MR, Carruthers MN, Carrington CV, Cao H (2001) Polymorphisms in PNLIP, encoding pancreatic lipase, and associations with metabolic traits. J Hum Genet 46:320-324.

Hegele RA (2002) SNP judgments and freedom of association. Arterioscler Thromb Vase Biol 22: 1058-1061.

Henikoff S, Henikoff JG. (1992) Amino acid substitution matrices from protein blocks, Proc Natl Acad Sci USA, 89: 10915-9. Hide W, Chan L, and Li W-H (1992) Structure and evolution of the lipase superfamily, J Lipid Res 33:167-178

Higgs HN, Han MH, Johnson GE, and Glomset JA. (1998) Cloning of a phosphatidic acid- preferring phospholipase Al from bovine testis. J Biol Chem. 273: 5468-5477

Hirata K, Dichek HL, Cioffi JA, Choi SY, Leeper NJ et al. (1999) Cloning of a unique lipase from endothelial cells extends the lipase gene family, J Biol Chem, 274, 14170-14175

Hodis HN, Mack WJ, Azen SP, Alaupovic P, Pogoda JM, LaBree L, Hemphill LC, Kramsch DM, Blankenhorn DH (1994) Triglyceride- and cholesterol-rich lipoproteins have a different effect on mild/moderate and severe lesion progression as assessed by quantitative coronary angiography in a controlled trial of lovastatin. Circulation, 90:42-49 Hokanson JE and Austin MA (1996) Plasma triglyceride level is a risk factor for cardiovascular disease independent of high-density lipoprotein cholesterol level: a meta-analysis of population- based prospective studies. J Cardiovasc Res 3: 213-219

Holm C, Kirchgessner TG, Svenson KL, Fredrikson G, Nilsson S, Miller CG, Shively JE, Heinzmann C, Sparkes RS, Mohandas T, et al. (1988) Hormone-sensitive lipase: sequence, expression, and chromosomal localization to 19 cent-ql3.3, Science, 241: 1503 Igarashi K, Kaneda M, Yamaji A, Saido TC, Kikkawa U et al. (1995) A novel phosphatidylserine-binding peptide motif defined by an anti-idiotypic monoclonal antibody.

JBiol Chem, 270, 29075-29078 Ishimura-Oka K, Semenkovich CF, Faustinella F, Goldberg IJ, Shachter N, Smith LC, Coleman T, Hide WA, Brown WV, Oka K, et al. (1992) A missense (Asp250— -Asn) mutation in the lipoprotein lipase gene in two unrelated families with familial lipoprotein lipase deficiency, J.

Lipid Research, 33, 745-754 Jaye M, Lynch KJ, Krawiec J, Marchadier D, Maugeais C, Doan K, South V, Amin D, Oerrone M,

Rader DJ. (1999) Nature Genetics, 21 :424-428 Jin W, Marchadier D, Rader DJ (2002) Lipases and HDL metabolism. Trends Endocrinol Metab

13:174-178. Kawano K, Qin S, Vieu C, Collet X, Jiang XC. (2002) Role of hepatic lipase and scavenger receptor BI in clearing phospholipid/free cholesterol-rich lipoproteins in PLTP-deficient mice.

Biochim Biophys Ada, 1583: 133 Kelly D, Chancellor K, Milatovich A, Francke U, Suzuki K, Popko B (1994) Autosomal recessive neuromuscular disorder in a transgenic line of mice, J Neurosci 14: 198-207 Kirchgessner TG, Chuat JC, Heinzmann C, Etienne J, Guilhot S et al. (1989) Organization of the human lipoprotein lipase gene and evolution of the lipase gene family. Proc Natl Acad Sci USA,

86:9647-965 IKothary R, Clapoff S, Brown A, Campbell R, Peterson A, Rossant J (1988) A transgene containing lacZ inserted into the dystonia locus is expressed in neural tube. Nature,

335: 435-437. Kontula K, Ehnholm C (1996) Regulatory mutations in human lipoprotein disorders and atherosclerosis, Curr Opin Lipidol , 7:64-68 Leroy A, Toohill KL, Fruchart JC, Jonas A (1993) Structural properties of high density lipoprotein subclasses homogeneous in protein composition and size. J Biol Chem 268:4798-4805.

Li WW, Dammerman MM, Smith JD, Metzger S, Breslow JL, Leff T (1995) Common genetic variation in the promoter of the human apo CHI gene abolishes regulation by insulin and may contribute to hypertriglyceridemia. J Clin Invest 96:2601-2605. Mairal, A. et al. Characterization of a novel testicular form of human hormone-sensitive lipase. Biochem. Biophys. Res. Commun. 291, 286-290 (2002)

Mark WH., Signorelli K., Blum M., Kwee L., and Lacy E. (1992) Genomic structure of the locus associated with an insertional mutation in line 4 transgenic mice, Genomics, 13: 159-166 McCoy MG, Sun GS, Marchadier D, Maugeais C, Glick JM and Rader DJ. (2002) Characterization of the lipolytic activity of endothelial lipase. J Lipid Res., 43: 921 McNeish JD, Scott WJ, Potter SS. (1988) Legless, a novel mutation found m pTHl-1 transgenic mice, Science, 241 : 837-839 Merlino GT, Stahle C, Jhappan C, Linton R, Mahon KA, Willingham MC (1991) Inactivation of a sperm motility gene by insertion of an epidermal growth factor receptor transgene whose product is overexpressed and compartmentalized during spermatogenesis, Genes and Development, 5:

1395-1406 Moghadasian MH, Frohlich JJ, McManus BM (2001) Advances in experimental dyslipidemia and atherosclerosis. Lab Invest 81 : 1173-1183. Nagai Y, Aoki J, Sato T, Amano K, Matsuda Y et al. (1999) An alternative splicing form of phosphatidylserine-specific phospholipase Al that exhibits lysophosphatidylserine-specific lysophospholipase activity in humans. J Biol Chem, 274, 11053-11059 Ng P, Parks RJ, Cummings DT, Evelegh CM, Sankar U and Graham FL. (1999) A high-efficiency

Cre/loxP-based system for construction of adeno viral vectors, Hum Gene Therapy, 10:2667-

2672. Nicholson AC, Febbraio M, Han J, Silverstein RL, Hajjar DP (2000) CD36 in atherosclerosis. The role of a class B macrophage scavenger receptor. Ann NY Acad Sci 902: 128-131 Oelkers P, Behari A, Cromley D, Billheimer JT, Sturley SL (1998) Characterization of two human genes encoding acyl coenzyme A: cholesterol acyltransfεrase-related enzymes. J Biol Chem 273:

26765-26771. Osuga J, Ishibashi S, Oka T, Yagyu H, Tozawa R, Fujimoto A, Shionoiri F, Yahagi N, Kraemer FB,

Tsutsumi O, Yamada N. (2000) Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity, Proc Natl Acad Sci USA. 97: 787 Palmiter RD, Brinster RL (1986) Germ-line transformation of mice, Ann. Rev Genet 20: 465-99 Peterfy, M., Phan, J., Xu, P. & Reue, K. Lipodystrophy in the fid mouse results from mutation of a new gene encoding a nuclear protein, lipin. Nat. Genet. 27, 121-124 (2001)

Rastan S, Beeley LJ (1997) Functional genomics: going forwards from the databases. Cur. Opin.

Genet. Devel, 1:111 '-783 Rommems JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G, Tsui LC. (1989) Identification of the cystic fibrosis gene: chromosome walking and jumping, Science, 245, 1059-1065 Rubins HB, Robins SJ, Collins D, Fye CL, Anderson JW, Elam MB, Faas FH, Linares E, Schaefer

EJ, Schectman G, Wilt TJ, Wittes J (1999) Gemfibrozil for the secondary prevention of coronary heart disease in men with low levels of high-density lipoprotein cholesterol. Veterans

Affairs High-Density Lipoprotein Cholesterol Intervention Trial Study Group. N Engl J Med

341 :410-418. Santamarina-Fojo S (1998) The familial chylomicronemia syndrome. Endocrinol Metab Clin North

Am 27:551-567 Sato T, Aoki J, Nagai Y, Dohame N, Takio K, Doi T, Arai H, Inoue K (1997) Serine phospholipid- specific phospholipase A that is secreted from activated platelets. J Biol Chem 272: 2192-2198 Schaeren-Wiemers, N. & Gerfin-Moser, A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin- labelled cRNA probes. Histochemistry 100, 431-440 (1993) Schiedner G, Morral N, Parks RJ, Wu Y, Koopmans SC, Langston C, Graham FL, Beaudet AL,

Kochanek S (1997) Genetic DNA transfer with a high-capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nature Genet 18:180-183

Shani M (1986) Tissue specific and developmentally regulated expression of a chimeric actin- globin gene in transgenic mice, Mol. Cell. Biol., 6: 2624-2631 Shawlot W, Deng JM, Fohn LE, Behringer RR et. Al. (1998) Restricted beta-galactosidase expression of a hygromycin-lacZ gene targeted to the beta-actin locus and embryonic lethality of beta-actin mutant mice, Transgenic Res. 7, 95-103.

Simons LA. (1992) Triglyceride levels and the risk of coronary artery disease: a view from

Australia, Am. J. Cardiol, 70: 14H-18H Smith SJ, Cases S, Jensen DR, Chen HC, Sande E, Tow B, Sanan DA, Raber J, Eckel RH, Farese

RV Jr (2000) Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking Dgat. Nature Genet 25: 87-90

Sohaila Rastan and Lee Beeley (1997) Functional genomics: going forwards from the databases,

Cur. Opin. Genet. & Dev., 1:111-183 Sprecher DL (1998) Triglycerides as a risk factor for coronary artery disease, Am. J. Cardiol,

17(12A):49U-56U Sprecher DL, Harris BV, Stein EA, Bellet PS, Keilson LM, Simbartl LA (1996) Higher triglycerides, lower high-density lipoprotein cholesterol, and higher systolic blood pressure in lipoprotein lipase-deficient heterozygotes: a preliminary report, Circulation, 94:3239-3245 van Berkel TJ, Van Eck M, Herijgers N, Fluiter K, Nion S (2000) Scavenger receptor classes A and

B. Their roles in atherogenesis and the metabolism of modified LDL and HDL. Ann N Y Acad Sci 902:113-126

Van Etten WJ, Steen RG, Nguyen H, Castle AB, Slonim DK et al. (1999) Radiation hybrid map of the mouse genome, Nat Genet 22, 384-387 Van Tilbeurgh H, Roussel A, Lalouel JM, Cambillau C (1994) Lipoprotein lipase: molecular model based on the pancreatic lipase x-ray structure: consequences for heparin binding and catalysis. J Biol Chem, 269, 4626-4633 Wagner EF, Covarriubias L, Stewart TA, Mintz B (1983) Prenatal lethalities in mice homozygous for human growth hormone gene sequences integrated in the germ line. Cell 35: 647-653 Wang J, Wen X-Y, Stewart AK and Hegele R. (2002), Polymoφhisms in the gene encoding phosphatidylserine-specific phospholipase Al (PS-PLA1), J Human Genet, 47:611-3. Wen X-Y, Bryce DM, Breitman ML (1998) Characterization of Ipd (lipid defect): a novel mutation on mouse chromosome 16 associated with a defect in triglyceride metabolism. Hum. Mol Genet,

7, 743-750 Wen X-Y, Stewart AK, Skaug J, Wei E, Tsui LC. (2001) Murine phosphatidylserine-specific phospholipase Al (Ps-plal) maps to chromosome 16 but is distinct from the Ipd (lipid defect) locus. Mammalian Genome, 12: 129-132

Wikie TM and Palmiter RD (1987) Analysis of the integrant in Myk-103 transgenic mice in which males fail to transmit the integrant, Mol. Cell. Biol, 1: 1646-1655 Woychik RP, Stewart TA, Davis LG, D'Estachio P, Leder P. (1985) An inherited limb deformity created by insertional mutagenesis in a transgenic mouse, Nature, 318: 36-40 Woychik RP, Maas RL, Zeller R., Vogt TF. and Leder P. (1990) "Formins": proteins deduced from the alternative transcripts of the limb deformity gene, Nature, 346: 850-858 Yarnell JW, Patterson CC, Sweetnam PM, Thomas HF, Bainton D, Elwood PC, Bolton CH, Miller

NE (2001) Do total and high density lipoprotein cholesterol and triglycerides act independently in the prediction of ischemic heart disease?: ten-year follow-up of Caeφhilly and Speedwell cohorts. Arterioscler Thromb Vase Biol 21 :1340-1345

Zilversmit DB (1995) Atherogenic nature of triglycerides, postprandial lipidemia, and triglyceride-rich remnant lipoproteins, Clin. Chem. 41: 153-158

Claims

WE CLAIM:

1. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR protein.

2. An isolated nucleic acid molecule according to claim 1 encoding a LPDL or LPDLR protein having the amino acid sequence as shown in Figure IB (SEQ.ID.NO:2), Figure 2B (SEQ.JD.NO:4), Figure 2D (SEQ._D.NO:6), Figure 3B (SEQ.ID.NO: 8) or, Figure 4B (SEQ.ID.NO: 10).

3. A nucleic acid molecule according to claim 1 or 2 selected from the group comprising:

(a) a nucleic acid sequence as shown in Figure 1A (SEQ.ID.NO: 1), Figure 2A (SEQ.ID.NO:3), Figure 2C (SEQ._D.NO:5), Figure 3A (SEQ.ID.NO:7) or, Figure 4A (SEQ.ID.NO:9), Figure 4C (SEQ.ID.NO: 11), wherein T can also be U,

(b) a nucleic acid sequence that is complimentary to a nucleic acid sequence of

(a),

(c) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence of (a) or (b),

(d) a nucleic acid sequence that is an analog of a nucleic acid sequence of (a), (b) or (c),

(e) a sequence which is at least 90% homologous with a sequence of any of (a) to

(d),

(f) a sequence which is at least 95% homologous with a sequence of any of (a) to

(d),

(g) a sequence which is at least 98% homologous with a sequence of any of (a) to

(d),

(h) a sequence which is at least 99% homologous with a sequence of any of (a) to

(d), and

(i) a nucleic acid sequence that hybridizes to a nucleic acid sequence of any one of (a) to (h) under stringent hybridization conditions.

4. An antisense oligonucleotide that is complimentary to a nucleic acid sequence according to any one of claims 1 to 3.

5. An expression vector comprising a nucleic acid molecule of any one of claims 1 to 4.

6. A host cell transformed with an expression vector of claim 5.

7. An isolated LPDL or LPDLR polypeptide.

8. A polypeptide according to claim 7 which has the amino acid sequence selected from the group comprising:

(a) as shown in Figure IB (SEQ.ID .NO:2),

(b) as shown in Figure 2B (SEQ._D.NO:4), Figure 2D (SEQ.ID .NO:6)

(c) as shown in Figure 3B (SEQ.ID.NO:8),

(d) as shown in Figure 4B (SEQ.ID.NO: 10), Figure 4D (SEQ.ID.NO: 12).

(e) a sequence which is at least 90% homologous with a sequence of any of (a) to (d),

(f) a sequence which is at least 95% homologous with a sequence of any of (a) to (d),

(g) a sequence which is at least 98% homologous with a sequence of any of (a) to (d), (h) a sequence which is at least 99% homologous with a sequence of any of (a) to (d), and

(i) a fragment, analog, homolog, derivative or mimetic of any one of (a) to (h).

9. An antibody that can bind a polypeptide according to claim 7 or 8.

10. A method of identifying substances which can bind with an LPDL or LPDLR polypeptide, comprising the steps of:

(a) incubating a LPDL or LPDLR polypeptide and a test substance, under conditions which allow for formation of a complex between the LPDL or LPDLR polypeptide and the test substance, and

(b) assaying for complexes of the LPDL or LPDLR polypeptide and the test substance, for free substance or for non complexed LPDL or LPDLR polypeptide, wherein the presence of complexes indicates that the test substance is capable of binding to the LPDL or LPDLR polypeptide.

11. A method for identifying a compound that affects LPDL or LPDLR polypeptide activity or expression comprising:

(a) incubating a test compound with an LPDL or LPDLR polypeptide or a nucleic acid encoding a LPDL or LPDLR polypeptide, and

(b) determining an amount of LPDL or LPDLR polypeptide activity or expression and comparing with a control, wherein a change in the LPDL or LPDLR polypeptide activity or expression as compared to the control indicates that the test compound has an effect on LPDL or LPDLR polypeptide activity or expression.

12. A method for identifying a compound that affects the binding of an LPDL or LPDLR polypeptide and an LPDL or LPDLR binding polypeptide comprising:

(a) incubating (i) a test compound, (ii) an LPDL or LPDLR polypeptide and (iii) an LPDL or LPDLR binding polypeptide under conditions which permit the binding of LPDL or LPDLR polypeptide to the LPDL or LPDLR binding polypeptide, and

(b) assaying for complexes of LPDL or LPDLR polypeptide and the LPDL or LPDLR binding polypeptide and comparing to a control, wherein a reduction of complexes indicates that the compound has an effect on the binding of LPDL or LPDLR polypeptide to an LPDL or LPDLR binding polypeptide.

13. A use of an effective amount of an agent capable of modulating the expression of a nucleic acid molecule according to any one of claims 1 to 3 or the activity of a polypeptide according to claims 7 or 8 to modulate triglyceride activity.

14. A use according to claim 13 wherein the agent is identified according to a method of claims 10 to 12.

15. A use according to claim 13 wherein the agent inhibits the expression or activity of an LPDL or LPDLR polypeptide.

16. A use according to claim 13 wherein the agent is an antisense oligonucleotide according to claim 4 or an antibody according to claim 9.

17. A use according to claims 13 wherein the agent induces the expression or the activity of an LPDL or LPDLR polypeptide.

18. A use of an effective amount of an agent that can stimulate the activity or expression of an LPDL or LPDLR polypeptide to treat lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyshpidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

19. A method of detecting or monitoring a condition associated with increased LPDL or LPDLR e xpression o r a ctivity c ompπsing: ( a) o btaimng a s ample from t he a nimal a nd ( b) assaying the sample for a nucleic acid molecule according to any one of claims 1 to 3 or a polypeptide according to claim 7 or 8

20 A method of detecting or monitoring a condition associated with decreased LPDL or LPDLR expression or activity in an animal comprising, (a) obtaining a sample from the animal and (b) assaying the sample for a nucleic acid molecule according to any one of claims 1 to 3 or a polypeptide according to claim 7 or 8

21 A method according to claim 19 or 20 wherein the condition is preferablely consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

22. A pharmaceutical composition comprising (a) a nucleic acid molecule according to any one of claims 1 to 3, (b) an antisense oligonucleotide according to claim 4, (c) an LPDL or LPDLR polypeptide according to claim 7 or 8, (d) a substance identified according to claims 10 to 12, or (e) a substance capable of modulating the expression or activity of an LPDL or LPDLR polypeptide, in admixture with a suitable diluent or carrier.

23 A method for screening a subject for a mutation in a LPDL or LPDLR polypeptide which comprises obtaining a sample from the subject and comparing the sequence of the LPDL or LPDLR gene in the sample with the sequence of wild type LPDL or LPDLR gene which codes for a LPDL or LPDLR polypeptide, wherein a difference in the sequence of the LPDL or LPDLR gene of the subject from wild-type indicates a mutation in the LPDL or LPDLR gene in the sample.

24. A method according to claim 23 wherein the sequence of the wild type LPDL or LPDLR gene codes for a LPDL or LPDLR polypeptide having the amino acid sequence set forth in SEQ. ID. NO: 2, SEQ. ID. NO. 4, SEQ. ID. NO. 6, SEQ. ID. NO. 8, SEQ. ID. NO. 10, or SEQ. ID. NO. 12.

25. A nucleic acid molecule selected from the group comprising:

(a) a nucleic acid sequence of LPDL or LPDLR promoters and the regulatory sequences as shown in Figure 21-A (SEQ._D.NO:77); 21-B (SEQ._D.NO:78); Figure 23-A (SEQ.ID.NO:79); 23-B (SEQ.ID.NO: 80);

(b) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence of (a) or (b),

(c) a sequence which is at least 90% homologous with a sequence of any of (a) to

(b),

(d) a sequence which is at least 95% homologous with a sequence of any of (a) to

( ),

(e) a sequence which is at least 98% homologous with a sequence of any of (a) to (d), and

(f) a sequence which is at least 99% homologous with a sequence of any of (a) to (b).

26. A method for identifying a compound which inhibits or promotes the activity of a polynucleotide sequence of claim 1 or claim 25, comprising the steps of:

(a) selecting a control animal having said sequence and a test animal having said sequence,

(b) treating said test animal using a compound, and,

(c) determining the relative quantity of an expression product of said sequence, as between said control animal and said test animal.

27. A method for identifying a compound which inhibits or promotes the activity of a polynucleotide sequence of claim 1 or claim 25, comprising the steps of:

(a) selecting a host cell of claim 6,

(b) cloning said host cell and separating said clones into a test group and a control group,

(c) treating said test group using a compound, and

(d) determining the relative quantity of an expression product of said sequence, as between said test group and said control group.

28. A process for producing a polypeptide sequence of claim 8 comprising the step of culturing the host cell of claim 6 under conditions sufficient for the production of said polypeptide.

29. A method for identifying a compound which inhibits or promotes the activity of a polypeptide sequence of claim 8, comprising the steps of:

(b) treating said test animal using a compound,

(c) determining the relative quantity or relative activity of an expression product of said sequence or of the said sequence, as between said control animal and said test animal.

30. A composition for treating a disorder of tissue or plasma lipid and lipoprotein metabolism comprising a compound which modulates a sequence according to claim 1 and a pharmaceutically acceptable carrier.

31. A composition as claimed in claim 36, wherein said disorder is selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, any other tissue or plasma disorders of lipid or lipoprotein metabolism, eczema, cardiovascular disorders, coronary artery disease, cerebrovascular disease hypertension, peripheral vascular disease, inflammation, sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis acne, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, body weight disorders, obesity, cachexia and anorexia, psychiatric -disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and/or diabetic complications.

32. A composition as claimed in claim 30, wherein said disorder is selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

33. A composition as claimed in claim 30, wherein said compound is selected from the group consisting of small organic molecules, peptides, polypeptides, antisense molecules, oligonucleotides, polynucleotides, triglycerides and derivatives thereof.

34. A method for diagnosing the presence of or a predisposition for a disorder in a subject by detecting a germline alteration in a sequence of claim 1 in said subject, comprising comparing the germline sequence of a sequence of claim 1 from a tissue sample from said subject with the germline sequence of a wild-type of said sequence, wherein an alteration in the germline sequence of said subject indicates the presence of or a predisposition to said triglyceride disorder.

35. A method for diagnosing the presence of or a predisposition for a disorder as claimed in claim 34, wherein said disorder is selected from the group consisting of a trigyceride disorder, lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, any other tissue or plasma disorders of lipid or lipoprotein metabolism, eczema, cardiovascular disorders, coronary artery disease, cerebrovascular disease hypertension, peripheral vascular disease, inflammation, sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis acne, Sjδgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, body weight disorders, obesity, cachexia and anorexia, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and/or diabetic complications.

36. A composition as claimed in claim 33, wherein said disorder is selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

37. The method of claims 34 to 36, wherein said comparing is performed by a method selected from the group consisting of immunoblotting, immunocytochemistry, enzyme-linked immunosorbent assay, DNA fingeφrinting, in situ hybridization, polymerase chain reaction, reverse transcription polymerase chain reaction, sequencing of DNA or RNA or protein, radioimmunoassay, immunoradiometric assay and immunoenzymatic assay.

38. A method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL, LPDLR, and the control regions thereof, comprising the steps of:

(a) selecting a control animal having said polynucleotide and a test animal having said polynucleotide,

(b) treating said test animal using a compound, and,

(c) determining the relative quantity of an expression product of said polynucleotide, as between said control animal and said test animal.

39. A method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL , LPDLR, and the control regions thereof comprising the steps of:

(a) selecting a host cell having said polynucleotide, wherein said host cell is heterologous to said polynucleotide,

(c) treating said test group using a compound, and

(d) determining the relative quantity of an expression product of said polynucleotide, as between said test group and said control group.

40. A method for identifying a compound modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of:

(a) selecting a control animal having said polypeptide and a test animal having said polypeptide,

(b) treating said test animal using a compound,

(c) determining the relative quantity or relative activity of an expression product of said polypeptide or of the said polypeptide, as between said control animal and said test animal.

41. A method for identifying a compound which modulates a triglyceride disorder, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of:

(a) selecting a host cell comprising said polypeptide, wherein said host cell is heterologous to said polypeptide, (b) cloning said host cell and separating said clones into a test group and a control group,

(c) treating said test group using a compound, and

(d) determining the relative quantity or relative activity of an expression product of said polypeptide or of the said polypeptide, as between said test group and said control group.

42. A method for identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of:

(b) treating said test animal using a compound, and,

(c) determining the relative quantity of an expression product of an operably linked polynucleotide to said polynucleotide, as between said control animal and said test animal.

43. A method for identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of:

(a) selecting a host cell comprising said polynucleotide, wherein said host cell is heterologous to said polynucleotide,

(c) treating said test group using a compound, and

(d) deteπnining the relative quantity of an expression product of an operably linked polynucleotide to said polynucleotide, as between said test group and said control group.

44. A composition for treating a triglyceride disorder comprising a compound which modulates a polynucleotide from the coding sequence selected from the group consisting of LPDL and LPDLR, and a pharmaceutically acceptable carrier.

45. A composition as claimed in claim 44, wherein said disorder is selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, any other tissue or plasma disorders of lipid or lipoprotein metabolism, eczema, cardiovascular disorders, coronary artery disease, cerebrovascular disease hypertension, peripheral vascular disease, inflammation, sinusitis, asthma, pancreatitis, osteoarthritis, rheumatoid arthritis acne, Sjόgren's syndrome, gastrointestinal disorders, viral diseases and postviral fatigue, body weight disorders, obesity, cachexia and anorexia, psychiatric disorders, cancer, cystic fibrosis, endometriosis, pre-menstrual syndrome, alcoholism, congenital liver disease, Alzheimer's syndrome, autoimmune disorders, atopic disorders, acute respiratory distress syndrome, articular cartilage degradation, diabetes and/or diabetic complications.

46. A composition as claimed in claim 44, wherein said disorder is selected from the group consisting of lipase deficiency, atherosclerosis, fatty liver disease and dyslipidemias, such as hypercholesterolemia, hypertriglyceridemia, mixed (combined) dyslipidemia, lipid or lipoprotein deficient states, and/or any other tissue or plasma disorders of lipid or lipoprotein metabolism.

47. A method for identifying a compound which modulates a biological activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of: (a) providing an assay which measures a biological activity of the selected polypeptide, (b) treating the assay with a compound, and (c) identifying a change in the biological activity of the selected polypeptide, wherein a difference between the treated assay and a control assay identifies the compound as modulator of the polypeptide.

48. A method as claimed in claim 35, wherein said alteration occurs at a SNP selected from the group consisting of C55Y, G364E, E431K and D444E of LPDL gene.

49. A method as claimed in claim 48, wherein said alteration occurs at C55Y.

50. The use of a cell containing a transgene comprising a polypeptide of claim 1 for cell therapy by administration to a patient in need thereof.

51. A process for expression of a protein product of a polypeptide selected from the group consisting of LPDL and LPDLR comprising the steps of:

(a) providing a recombinant DNA cloning vector system which integrates into the genome of an host single cell organism, a vector system comprising: DNA-sequences encoding functions facilitating gene expression comprising a promoter, transcription initiation sites, and transcription terminator and a polynucleotide selected from the group consisting of LPDL and LPDLR,

(b) transforming the host with the recombinant DNA cloning vector system from step a, and (c) culturing the transformed host in a culture medium.

52. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR protein, wherein said nucleic acid molecule is a mouse nucleic acid molecule or a functional anolog thereof

53. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR protein, wherein said nucleic acid molecule is a human nucleic acid molecule or a functional anolog thereof .

54 An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR protein, wherein said nucleic acid molecule is a mammalian nucleic acid molecule or a functional anolog thereof .

55. An isolated polypeptide comprising a LPDL or LPDLR protein, wherein said polypeptide is a mouse polypeptide or a functional anolog thereof .

56 An isolated polypeptide comprising a LPDL or LPDLR protein, wherein said polypeptide is a human polypeptide or a functional anolog thereof .

57. An isolated polypeptide comprising a LPDL or LPDLR protein, wherein said polypeptide is a mammalian polypeptide or a functional anolog thereof .

58. An isolated nucleic acid molecule having a exon/mtron sequence of LPDL or LPDLR gene selected from the group consisting of: (a) SEQ.ID.NO.17;

(b) SEQ.ID.NO.18;

(c ) SEQ.ID.NO.19;

(d) SEQ.ID.NO.20:

(e) SEQ.ID.NO.21;

( ) SEQ.ID.NO.22

(g) SEQ.ID NO 23:

(h) SEQ.ID.NO.24

⁽0 SEQ._D.NO.25

0) SEQ.ID.N0.26: (k) SEQ.ID.NO.27;

(1) SEQ.ID.N0.28;

(m) SEQ.ID.NO.29;

(n) SEQ.ID.NO.30;

(o) SEQ.ID.N0.31;

(p) SEQ.ID.NO.32;

(q) SEQ.ID.NO.33;

(r ) SEQ.ID.N0.34;

(s) SEQ.ID.NO.35;

(t) SEQ.ID.N0.36;

(u) a nucleic acid sequence that is complimentary to a nucleic acid sequence selected from the group consisting of (a) to (t);

(v) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence selected from the group consisting of (a) to (t);

(w) a nucleic acid sequence that is an analog of a nucleic acid sequence selected from the group consisting of (a) to (t);

(x) a sequence which is at least 90% homologous with a sequence selected from the group consisting of (a) to (t),

(y) a sequence which is at least 95% homologous with a sequence selected from the group consisting of (a) to (t),

(z) a sequence which is at least 98% homologous with a sequence selected from the group consisting of (a) to (t),

(aa) a sequence which is at least 99% homologous with a sequence selected from the group consisting of (a) to (t), and

(bb) a nucleic acid sequence that hybridizes to a nucleic acid sequence selected from the group consisting of (a) to (t), under stringent hybridization conditions.

59. An isolated nucleic acid molecule having a primer sequence of LPDL or LPDLR gene selected from the group consisting of:

(a) SEQ.ID.N0.37;

(b) SEQ.ID.N0.38;

(c ) SEQ.ID.N0.39;

(d) SEQ.ID.NO.40;

(e) SEQ.ID.N0.41;

(f) SEQ.ID.NO.42; (g) SEQ.ID.N0.43;

(h) SEQ.ID.N0.44;

(i) SEQ.ID.N0.45;

(j) SEQ.ID.N0.46;

(k) SEQ.ID.N0.47;

( ) SEQ.BD.NO.49;

(n) SEQ.ID.NO.50;

(o) SEQ.ID.N0.51;

(p) SEQ.ID.N0.52;

(r ) SEQ.ID.N0.54;

(s) SEQ.ID.N0.55;

(t) SEQ.ID.N0.56;

(v) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence selected from the group consisting of (a) to (l);

(x) a sequence which is at least 95% homologous with a sequence selected from the group consisting of (a) to (t),

(y) a sequence which is at least 98% homologous with a sequence selected from the group consisting of (a) to (t),

(x) a sequence which is at least 99% homologous with a sequence selected from the group consisting of (a) to (t), and

(aa) a nucleic acid sequence that hybridizes to a nucleic acid sequence selected from the group consisting of (a) to (t), under stringent hybridization conditions.

60. The use of a nucleic acid sequence of claim 59 for mutation screening.

61. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR promoter, wherein said nucleic acid molecule is a mouse nucleic acid molecule or a functional anolog thereof .

62. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR promoter, wherein said nucleic acid molecule is a human nucleic acid molecule or a functional anolog thereof .

63. An isolated nucleic acid molecule comprising a sequence encoding a LPDL or LPDLR promoter, wherein said nucleic acid molecule is a mammalian nucleic acid molecule or a functional anolog thereof .

64. An isolated nucleic acid molecule having a regulatory sequence of LPDL or LPDLR gene selected from the group consisting of:

(a) SEQ.ID.NO.77;

(b) SEQ.ID.NO.78;

(c ) SEQ.ID.NO.79;

(d) SEQ.ID.NO.80;

(e) a nucleic acid sequence that is complimentary to a nucleic acid sequence selected from the group consisting of (a) to (t);

(f) a nucleic acid sequence that has substantial sequence homology to a nucleic acid sequence selected from the group consisting of (a) to (t);

(g) a nucleic acid sequence that is an analog of a nucleic acid sequence selected from the group consisting of (a) to (t);

(h) a sequence which is at least 95% homologous with a sequence selected from the group consisting of (a) to (t),

(i) a sequence which is at least 98% homologous with a sequence selected from the group consisting of (a) to (t),

(j) a sequence which is at least 99% homologous with a sequence selected from the group consisting of (a) to (t), and

(k) a nucleic acid sequence that hybridizes to a nucleic acid sequence selected from the group consisting of (a) to (t), under stringent hybridization conditions.

65. A method as claimed in any one of claims 38, 39, 42 and 43, wherein said polynucleotide is a nucleic acid sequence of claim 64.

66. A method for identifying a compound which modulates a testis function, comprising identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL, LPDLR, and the control regions thereof, comprising the steps of.

(b) treating said test animal using a compound, and,

67. A method for identifying a compound which modulates testis function, compnsmg identifying a compound which modulates the activity of a polynucleotide, wherein the polynucleotide is a coding sequence selected from the group consisting of LPDL , LPDLR, and the control regions thereof comprising the steps of

(c) treating said test group using a compound, and

68 A method for identifying a compound modulates testis function, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of:

(b) treating said test animal using a compound,

(c) determining the relative quantity or relative activity of an expression product of said polypeptide or of the said polypeptide, as between said control animal and said test animal

69 A method for identifying a compound which modulates testis function, comprising identifying a compound which modulates the activity of a polypeptide selected from the group consisting of LPDL and LPDLR, comprising the steps of

(a) selecting a host cell comprising said polypeptide, wherein said host cell is heterologous to said polypeptide,

(c) treating said test group using a compound, and (d) determining the relative quantity or relative activity of an expression product of said polypeptide or of the said polypeptide, as between said test group and said control group.

70 A method for identifying a compound which modulates testis function by modulating the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of

(b) treating said test animal using a compound, and,

71. A method for identifying a compound which modulates testis function by modulating the activity of a polynucleotide, wherein the polynucleotide is a control region of a gene selected from the group consisting of LPDL and LPDLR, comprising the steps of.

(c) treating said test group using a compound, and

(d) determining the relative quantity of an expression product of an operably linked polynucleotide to said polynucleotide, as between said test group and said control group.

72. A process for preparing a product of a polypeptide selected from the group consisting of LPDL and LPDLR comprising the steps of:

(a) providing a recombinant DNA system which integrates into the DNA of an host organism, said system comprising DNA-sequences encoding functions facilitating gene expression comprising a promoter, transcription initiation sites, and transcription terminator and a polynucleotide selected from the group consisting of LPDL and LPDLR, and

(b) transforming the host with the recombinant DNA system from step (a).

73. A process as claimed in claim 72, wherein said host is a mammalian cell.

74 A process as claimed in claim 72, wherein said host is a virus

75 A process as claimed in claim 72, wherein said host is an adenovirus.

76. A process as claimed in claim 72, wherein said host is a vector.

77. The use of a transformed host of any one of claims 72 to 76 comprising administering said transformed host to a patient in need thereof.

78. The use of a transformed host of any one of claims 72 to 76 comprising culturing said transformed host in a culture medium to produce a polypeptide selected from the group consisting of LPDL and LPDLR.

79. The use of a transformed host of claims 78 further comprising administering said polypeptide to a patient in need thereof.

80. The use as claimed in claim 79 wherein said patient is in need of weight managment.

81. The use as claimed in claim 79 wherein said patient is in need of control of said patient's energy level.

82. The use as claimed in claim 78 further comprising using said polypeptide as a food additive.

83. The use as claimed in claim 78 further comprising using said polypeptide for waste management for digesting enrironmental lipid contamination.