WO2003054230A2

WO2003054230A2 - Detection of disease due to abnormal oestrogen levels

Info

Publication number: WO2003054230A2
Application number: PCT/GB2002/005593
Authority: WO
Inventors: Geeta Narainamah Hampson
Original assignee: King's College London
Priority date: 2001-12-11
Filing date: 2002-12-10
Publication date: 2003-07-03
Also published as: AU2002347388A1; GB0129642D0; WO2003054230A3; AU2002347388A8

Abstract

An association has been made between polymorphisms in the human aromatase cytochrome P-450 gene (CYP 19) and diseases associated with or caused by oestrogen deficiency, and in particular, osteoporosis. A test is described for detecting the presence of these polymorphisms in a human subject and thereby predicting likelihood of development of osteoporosis and other diseases caused by abnormal levels of oestrogen.

Description

DETECTION OF DISEASE DUE TO ABNORMAL OESTROGEN LEVELS

This invention relates to the detection of predisposition to disease associated with abnormal levels of oestrogen, in particular diseases associated with or caused by oestrogen deficiency, including osteoporosis. The invention will be more particularly described in relation to osteoporosis but it will be appreciated that it has wider diagnostic implications, as indicated hereinafter.

Osteoporosis is a condition of skeletal fragility characterised by low bone mineral density (BMD), disruption of bone micro-architecture resulting in increased susceptibility to fractures. Low BMD values are strongly related to the risk of osteoporotic fracture. Osteoporosis-related fractures are an important cause of morbidity and mortality in the elderly and a major burden on health service resources, estimated at £900 million in the U.K.

At present, the technique widely used for the diagnosis of osteoporosis and the assessment of fracture risk is the measurement of BMD by dual energy X-ray absorptiometry (DEXA). However this method is time consuming, costly and may not be widely available for mass screening. Other methods used include quantitative computed tomography, quantitative ultrasound and single energy X-ray absorptiometry. Quantitative computed tomography is costly and the radiation dose required may prohibit its routine use. The use of quantitative ultrasound and single energy X-ray absorptiometry in clinical practice requires further validation. A better way of identifying those at greatest risk of osteoporosis, thus enabling targeting of preventative therapy before fractures have occurred, is much needed.

We have now established a correlation between a predisposition to osteoporosis and polymorphisms in the human aromatase cytochrome P-450 gene (CYP 19). We have tested for a polymorphism in biological samples taken from post-menopausal women and shown a significant correlation of these results with low bone mineral density and susceptibility to fractures. h accordance with the present invention, a method of detecting a predisposition to a disease associated with or caused by oestrogen deficiency comprises testing for a polymorphism in the human aromatase cytochrome P-450 gene (CYP 19).

One method we have used for the purposes of the present invention, described in detail hereinafter, is based on amplifying certain segments of the aromatase gene and making use of, or creating, a restriction site in the amplified product whereby restriction enzyme digestion of the product will result in one or more fragments indicative of which polymorphic form is present. However, it will be readily understood that the use of the present invention for prognosis of these diseases is not limited to this particular method, since suitable alternative methods are available as will be readily appreciated by those skilled in the art. Thus, for example, any method may be used in which an oligonucleotide probe is hybridised to a nucleic acid sample taken from the patient and the result is analysed to determine which nucleotide is present at the locus of the particular polymorphism being tested for. hi results obtained so far, the significant polymorphisms are single base polymorphisms.

As indicated above, the polymorphism may be such that depending on which polymorphic form is present the resulting amplicon contains or does not contain a restriction site and the presence or absence of said restriction site enables determination of which polymorphic form is present. In this embodiment, the test for the polymorphism comprises digesting the amplicon and noting the size of the fragments formed in the digest. Such a method is simpler and more straightforward than current methods, and can be applied to large sample numbers.

We have found that two such polymorphisms in the aromatase gene may be tested for in accordance with the present invention. In the preferred embodiment, a patient's sample of nucleic acid is tested for a polymorphism at position 95 of exon 3, at which the nucleotide base is either adenine or guanine. In this case, the method further comprises digesting the resulting amplicon with the enzyme Rsal. In an alternative embodiment a patient's sample of nucleic acid is tested for a polymorphism in intron 6 of the gene at 36 bp from the start of the intron. At this site the base is either thymine or adenine. hi this case the restriction enzyme used is Mfel.

When other methods are used, these may comprise providing a polynucleotide capable of hybridising to a segment of a patient's nucleic acid having a polymorphism in the human aromatase cytochrome P-450 gene (CYP 19); hybridising said polynucleotide to a segment of the patient's nucleic acid; and determining which polymorphic form is present in said segment by analysing said hybridisation.

In this embodiment, the polynucleotide may conveniently be immobilised on a support. For example, the polynucleotide is provided in an ordered array wherein the ordered array is addressable. This method allows for high-throughput testing for this polymorphism.

The nucleic acid sample may be obtained from the patient using any suitable method. It may be obtained, for example, from a patient's blood, or from a cheek swab.

Thus, our work has shown that polymorphisms in the aromatase gene (CYP 19) have an important role to play in the pathogenesis of osteoporosis, in particular in post- enopausal women. Polymorphisms that are relevant to this disease can be found at various locations in this particular gene and two such locations will be employed as exemplary for the purposes of the present invention.

The CYP 19 gene, located on chromosome 15, encodes the enzyme P450 aromatase which catalyses the biosynthesis of oestrogens from androgens. One particular CYP 19 sequence variant at exon 3 where there is a "silent" change from the deoxyribonucleotide 'Guanine' to 'Adenine' (G to A) at position 95 of exon 3 of the gene (corresponding to Val 80) has previously been identified and has been shown to be over-represented in patients with breast cancer. We make use of the polymorphism at this location as one method of determining a predisposition to osteoporosis. The original technique used for the identification of this polymorphism was sequence analysis. However this technique cannot be adapted easily to the screening of a large number of subjects. We have devised a simple, more straightforward way of identifying this polymorphism which can be applied to the genotyping of large sample numbers. The technique uses the polymerase chain reaction (PCR) followed by restriction enzyme digestion which allows the detection of different phenotypes.

We investigated the association between the 'G' to 'A' polymorphism in exon 3 of CYP 19 with serum oestradiol (the principle oestrogen secreted by the ovary in pre- menopausal women and at extra-gonadal sites in post-menopausal women) concentrations, bone mineral density and fracture incidence in 253 post-menopausal Caucasian women. Allele frequencies were as follows: AA n=63, GA n=134, GG n=56 and the distribution was in Hardy- Weinberg equilibrium. The CYP 19 genotype was found to be significantly associated with serum oestradiol concentrations (p=0.002) after adjustment for other confounders such as body mass index (BMI) and degree of exercise. The following Table shows a multiple linear regression analysis of LN oestradiol (R² value: 0.3) where the dependent variable is LN oestradiol:

The subjects with the three different genotypes were matched for age (mean [SD] years ) (AA: 64.7 [8.9], GA: 65 [9.5], GG: 63.2 [8.6]), years since menopause (YSM) (AA: 16.3[10], GA:16.9 [9.6], GG: 16.1[T0.3]), menopausal age (AA: 48.5 [5], GA: 48.2 [4.9], GG: 47 [5.3]) and BMI (AA: 25 [4.1], GA: 24 [4.5], GG: 25 [4.4]). Those women with the 'AA' genotype had significantly higher serum oestradiol concentrations then the 'GA' (p=0.08) or the 'GG' group (p=0.02) (Figure 1). Median (range) oestradiol levels (pmol/L) were AA': 17 (2.1-52.8), 'GA': 13.8 (0.8-57) and 'GG*: 13.8(0.2-164). We observed no statistically significant association between the CYP 19 genotype and BMD and BMD expressed as 'Z' scores in the whole study population. However when we looked at a sub-group of older women with more than 10 YSM (n=182), a stronger association could be found between BMD at the total hip and femoral neck and the CYP 19 genotype, compared to the population as a whole. The following Table shows a multiple linear regression analysis of BMD in women greater than 10 years since the menopause (n=182):

In this sub-group of women, BMD at the femoral neck and the total hip was found to be significantly lower in subjects with the 'GA' and 'GG' genotypes compared to the 'AA genotypes (p=0.022, and p=0.041 respectively). On average BMD at these sites was 7% lower in the 'GA' and 'GG groups compared to the 'AA' group. BMD results at the total hip expressed as 'Z' scores are shown for each genotype in Figure 2. A similar trend was seen at the spine when BMD at this site was expressed as 'Z' scores. In the sub-group of women >10 YSM, there was a significant difference in allele distribution between the subjects with osteoporosis and those without. There was a lower prevalence of osteoporosis in subjects with the 'AA' genotypes compared to the 'GA' and 'GG' genotypes (ρ=0.04) (Figure 3).

We also looked at the effect of the CYP 19 genotype and fracture incidence. In the sub-group of women with low trauma fractures (n=l 11), we found that the 'G' allele was over-represented. There was a lower incidence of fractures in the group with the 'AA' genotype suggesting a protective effect of 'AA' on fracture incidence (p=0.07). This effect was more marked in the women who were 10 YSM (n=89) (p=0.003) (Figure 4).

In summary, our study showed a significant association between serum oestradiol concentrations and the CYP 19 polymorphism. Subjects with the 'AA' genotypes had higher levels of oestradiol. The effect of this variation in the aromatase gene on endogenous oestrogen synthesis appears to influence susceptibility to osteoporosis in older women as subj ects with the 'AA' genotypes had significantly higher BMD, a lower prevalence of osteoporosis and osteoporosis-related fractures than those with the 'GA' and 'GG' genotypes.

This polymorphic variant is therefore useful in the prediction of susceptibility to diseases associated with oestrogen exposure e.g. osteoporosis (as shown in our clinical trial) and Alzheimers disease. It is also useful as a pharmacogenetic marker in the optimisation of therapy for instance in replacement therapy with oestrogen (HRT).

Envisaged clinical scenarios:

Case 1: 50 year old woman with the 'AA' genotype who wants to know if she should go on HRT not only for menopausal symptoms but more long-term for prevention of osteoporosis and possibly Alzheimer's disease. One could advise that according to her genotype (AA), she is producing some endogenous oestrogen and could suggest halving the dose of HRT as giving her more oestrogen might put her at high risk of breast cancer. One could even suggest that she may not require HRT long-term (>5- 10 years).

Case 2 : 50 year old woman with 'GA' or 'GG' genotype who is worried about taking HRT because of the increased risk of breast cancer. One could re-assure her that given her genotype, after the menopause her endogenous tissue oestrogen production is likely to be low and that she may benefit from HRT to protect her bones and may not be at high risk of breast cancer.

These are only theoretical case scenarios to illustrate the possible usefulness of the CYP 19 polymorphism. However, in the true clinical situation individual advice should be given in the light of more detailed clinical information.

The sequences of the CYP 19 gene exon 3, shown in upper case, and its surrounding introns 2 and 3, shown in lower case, are given below (SEQ ID NO:l). The underlined portions of sequence indicate the primer binding sites of the segment to be amplified as described later. The alternative nucleotides at position 240 are shown as 'R' (i.e G or A):-

LOCUS HUMCYAR03 590bp DNA PRI 27-APR-1993 DEFINITION Human aromatase cytochrome P-450 gene, exon 3. ACCESSION M30797 J05105

1 ttcaaatcac tttattcgtg attcacagat atacatcaca tgtacagaac acttagctat

61 aaaagaacaa aaacaggagt aacacagaac agttgcaabb tttggtgtaa ctaagatgtt

121 gcttatgctc tgacacctgt cctagGTCCT GGCTACTGCA TGGGAATTGG ACCCCTCATC

181 TCCCACGGCA GATTCCTGTG GATGGGGATC GGCAGTGCCT GCAACTACTA CAACCGGGTR

241 TATGGAGAAT TCATGCGAGT CTGGATCTCT GGAGAGGAAA CACTCATTAT CAGCAAgtga

301 gtctgttcat aatcgaagac atacttttta aatcgaggct ggagtttttt ggagttaaga

361 caactttatt ttgaatcttg atgtctttgt ttctaacgct atatttttac cactgaaatg

421 aagtgagcaa tccccagaaa tctaacattg caaacagaat aattgggttt tgcttgaatt

481 gaagccagca gtacataaat aactaactct ggaaagttgg gaaattattt acaatctctg

541 tgagcagtga atgtggaaac ttagaagcca gataatttga ttttgacaaa

Position 240 as shown in above corresponding to position 95 of exon 3 is the polymorphic site, which is either G or A, the 'GG' and the 'GA' genotypes being associated with osteoporosis.

The PCR primers used for amplifications are:- Sense primer: 5' AGTAACACAGAACAGTTGCA (SEQ ID NO: 2)

Anti-sense primer: the normal sequence would be

5' TCCAGACTCGCATGAATTCTCCATA (SEQ ID NO: 3)

In accordance with this particular method a mismatch (G for A underlined above) is introduced into the anti-sense primer in order to create a potential restriction site in the product of the PCR amplification. As a consequence, restriction digestion of the resulting amplicon with a suitable enzyme will either cleave or not cleave the amplicon depending on the base at position 240 in the sequence shown above. The modified antisense primer has the following sequence

5' TCCAGACTCGCATGAATTCT CCGTA (SEQ ID NO:4)

The sequence of the resulting amplicon is therefore as follows (SEQ ID NO: 5):-

AGTAACACAG AACAGTTGCA ATTTTTGGTG TAACTAAGAT GTTGCTTATG CTCTGACACC TGTCCTAGGT CCTGGCTACT GCATGGGAAT TGGACCCCTC ATCTCCCACG GCAGATTCCT GTGGATGGGG ATCGGCAGTG CCTGCAACTA CTACAACCGG GTRTACGGAG AATTCATGCG AGTCTGGA 188bp

The restriction enzyme Rsal recognises and cleaves the site GT/AC. Therefore where position 240 is A the 188bp amplicon remains intact whereas if position 240 is G there will be two products of the restriction digest, namely, one of 164 bp and one of 24 bp resulting from cleavage as indicated in the relevant portion of sequence shown below (the C resulting from the primer mismatch is underlined):-

.GTGT/ACGGAG (SEQ ID NO: 6)

The procedure using this method is described in detail in the following Example 1 and illustrated in the accompanying Figures. EXAMPLE 1

Genomic DNA is isolated from peripheral leukocytes from patients' samples using a genomic DNA extraction kit (Nucleonic Biosciences, Tepmel Life Sciences PLC, Manchester, UK). DNA is suspended in buffer containing 20mM Tris and 5 mM

EDTA and stored at 20°C until PCR of genomic sequence is performed. Two hundred ng of genomic DNA is then amplified in 20μl containing 0.5μM of both sense and anti-sense primers, 250μM of the 4 deoxyribonucleotides and I Unit (U) of Taq polymerase and buffer in 2.0 mM magnesium chloride. PCR amplification is carried out using the thermocycler 5700 from Applied Biosystems and includes the following steps: Initial denaturation at 95°C for 5 minutes followed by 35 cycles of amplification with denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds and extension at 72°C for 30 seconds. A final extension at 72°C for 7 minutes is also performed.

The sense primer and the modified anti-sense primer having the sequences specified above were used for PCR amplification of the extracted DNA. The PCR product before digestion is shown in Figure 5. The PCR product is then digested by Rsal (5U) overnight at 37°C in 20 μl volume. The digested PCR products are then visualised on a 3% agarose gel after ethidium bromide staining. Absence of the restriction site results in a 188 bp fragment whereas presence of the restriction site yields 164 bp and 24 bp fragments. Only the 188 bp and 164 bp fragments are seen on the gel. The absence of the restriction site (and hence presence of the intact 188 bp fragment) confirms the presence of the Adenine variant, whereas the presence of the smaller 164 bp fragment confirms the presence of the Guanine variant. If both the 188 bp and the 164 bp fragments are present, then the subject is heterozygote (Figure 6). Our preliminary data suggest that the prevalence of the homozygote 'A' variant in the general population is 12.5%, homozygote 'G' variant 25% and heterozygote 62.5%. EXAMPLE 2

An alternative method to that described above and in Example 1 makes use of another polymorphic site in the CYP 19 gene located in intron 6 of the gene. This polymorphic site is also associated with breast cancer, the AA' genotype being overrepresented in patients with breast cancer. The relevant portion of the CDA sequence is shown below (SEQ ID NO: 7), the polymorphism being indicated as W (i.e. A or T) at 36 bp from the start of intron 6. The primer binding sites are defined by the underlined portions of sequence and the primer sequences are given below. In this case it is not necessary to employ a mismatched primer: -

DEFINITION Human aromatase cytochrome P-450 gene, intron 6 and flanking sequence.

cttagaaccc ccagactgtt aggagaatct gcagggaatg ttttctgctc agagcaacct tcttaggctc acattttgct caactgctct ttcttgtgta tgtgtgtttt tttttcctac agAAAGTGCT ATCGTGGTTA AAATCCAAGG TTATTTTGAT GCATGGCAAG CTCTCCTCAT

CAAACCAGAC ATCTTCTTTA AGATTTCTTG GCTATACAAA AAGTATGAGA AGTCTGTgta agtaatacaa ctttggaaga tttatgagta cawttggatt ggtttttttc ccttgtgtct ttgctgtttt tcttggcctc tcaggtaact tttctgctct ctagagccca caagggagct gttgattaag ttgctgatga aacacttttt acagcaattt ggctgcattt ggccagacca gagagtaaat gaagcctttg gctgggcagc ttctcggcaa gggggctgag tgtgtggtct gggagcttca gcttggtaac taggacacta gtgtattttg agttgaagag aagggtcgac

Sense primer: 5 ' GGC AAG CTC TCC TCA TCA AA (SEQ ID NO: 8) Antisense primer 5' AAGCTCCCAGACCACACACT (SEQ ID NO: 9)

The resulting amplicon has the sequence (SEQ ID NO: 10):-

GGCAAG CTCTCCTCAT CAAACCAGAC ATCTTCTTTA AGATTTCTTG GCTATACAAA AAGTATGAGA AGTCTGTGTA AGTAATACAA CTTTGGAAGA TTTATGAGTA CAWTTGGATT GGTTTTTTTC CCTTGTGTCT TTGCTGTTTT TCTTGGCCTC TCAGGTAACT TTTCTGCTCT CTAGACCCCA CAAGGGAGCT GTTGATTAAG TTGCTGATGA AACACTTTTT ACAGCAATTT GGCTGCATTT GGCCAGACCA GAGAGTAAAT GAAGCCTTTG GCTGGGCAGC TTCTCGGCAA GGGGGCTGAG TGTGTGGTCT GGGAGCTT

PCR amplicon size: 324 bp

Restriction enzyme Mfel which cuts at c/aattg leading to the following alternatives :-

T allele: 324bp

A allele: 217 + 107 bp

The 'TT' genotype of intron 6 is associated with osteoporosis.

The procedure is substantially similar to that described in Example 1.

The test developed according to this invention offers a relatively straightforward way of identifying those individuals at 'high risk' of developing osteoporosis. As stated above, it can be applied for the screening of a large number of subjects. The current methods as detailed above cannot be used easily for mass screening.

An inventive realisation of the present applicant is that there is an association between a polymorphism at position 95 of exon 3 of CYP 19, and a predisposition to diseases associated with or caused by oestrogen deficiency. Although this polymorphism has previously been associated with high serum oestradiol and breast cancer, it is surprising that such a "silent" polymorphism, i.e. one which causes no change in the amino acid sequence of the enzyme encoded by the gene, should be associated with diseases caused by oestrogen deficiency.

A further aspect of the invention relates to a test for this polymorphism. It will be apparent, however, to those skilled in the art that there will be methods of testing for this polymorphism other than those described above. For example, a segment of the gene containing the polymorphism could be immobilised on a solid support, which may comprise the wells of a microtitre plate, beads or membranes (e.g. nitrocellulose). In particular, DNA microarray technology may be used. A subject's DNA may then be labelled, for example, fluorescently, radioactively, or with biotin, and used as a probe to screen the microarray. Depending on the stringency of hybridisation, it will be possible to determine the polymorphism in the subject's DNA. Any suitable method falls within the scope of the present invention.

It is becoming increasingly likely that in the future genetic markers will be used widely for 'risk' assessment in polygenic disorders such as cardiovascular disease and osteoporosis. It will of course be appreciated that the tests described herein can be used to detect a predisposition to any disease associated with or caused by abnormal levels, (such as deficiency) of oestrogens, and in particular of oestradiol. Such diseases include breast cancer, and Alzheimer's disease in elderly women as abnormal oestrogen levels have been implicated in these disorders. These tests will be applicable to both males and females, but will be especially relevant for determining a predisposition to post-menopausal osteoporosis in females.

Figure Legends:

Figure 1: Serum oestradiol concentrations (pmol/L) between the CYP 19 genotypes in the whole population. Results are shown as median. *p=0.03 GG vs AA, f P=0.07 GG+GA vs AA

Range : AA 2.1-52.8, AG : 0.8-57.0, GG : 0.2-164.0, AG+GG : 0.2-164.0 pmol/L

Figure 2: BMD values expressed as 'Z' score between CYP 19 genotype in the subgroup of women greater than 10 years since the menopause, *p=0.05 AA vs GG, fp=0.04 AA vs GA.

Figure 3: Prevalence of osteoporosis between the 'AA' and 'GA' + 'GG' CYP 19 genotypes in the same group of women.

Figure 4: Fracture prevalence between the 'AA' and 'GA' + 'GG' CYP 19 genotypes in women greater than 10 years since the menopause,

Figure 5: Photograph of the agarose gel following PCR PCR product size - 188 bp (undigested) Lanes 1-8 patient samples Lane 9 blank

Lane 10 molecular weight markers

Figure 6: CYP 19 genotypes following Rsal digestion showing the 188 and 164 bp fragments.

Lane 1 : molecular weight marker

Lanes 3, 4, 6, 7, 8, 9, 10,13, 15: Heterozygote 'GA'

Lanes 5, 11, 12: Homozygote 'AA'

Lane 14: Homozygote 'GG'

Claims

1. A method of detecting a predisposition to a disease associated with or caused by oestrogen deficiency which comprises testing for a polymorphism in the human aromatase cytochrome P-450 gene (CYP 19).

2. A method as claimed in claim 1, wherein the disease is osteoporosis.

3. A method as claimed in claim 1 or 2, in which a segment of the CYP 19 gene is amplified and tested for the indicative polymorphism.

4. A method as claimed in claim 3, wherein the polymorphism is such that depending on which polymorphic form is present the resulting amplicon either contains or does not contain a restriction site, whereby the presence or absence of said restriction site enables determination of which polymorphic form is present.

5. A method as claimed in claim 4, wherein the test comprises digesting the amplicon and noting the size of the fragments formed in the digest.

6. A method as claimed in claims 4 or 5, wherein amplification is carried out in such a way that a restriction site is introduced into the amplicon when one polymorphic form is present, but not when an alternative polymorphic form is present.

7. A method as claimed in any of claims 1 to 6, in which a patient's sample of nucleic acid is tested for a polymorphism at position 95 of exon 3 of the gene.

8. A method according to claim 7, in which the test is carried out by amplification of a segment of exon 3 having the sequence: AGTAACACAG AACAGTTGCA ATTTTTGGTG TAACTAAGAT GTTGCTTATG CTCTGACACC TGTCCTAGGT CCTGGCTACT GCATGGGAAT TGGACCCCTC ATCTCCCACG GCAGATTCCT GTGGATGGGG ATCGGCAGTG CCTGCAACTA CTACAACCGG GTRTACGGAG AATTCATGCG AGTCTGGA (SEQ ID NO: 5)

9. A method as claimed in any of claims 3 to 8, in which the primers used are

5' AGTAACACAGAACAGTTGCA (SEQ ID NO: 2) and 5' TCCAGACTCGCATGAATTCTCCGTA (SEQ ID NO: 4)

10. A method as claimed in any of claims 4 to 9, which comprises digesting the resulting amplicon with the enzyme Rsal.

11. A primer having one of the sequences specified in claim 9.

12. A primer pair having the sequences specified in claim 9.

13. A reagent kit for use with the method of any of claims 1 to 9, comprising a primer pair according to claim 12 and the restriction enzyme Rsal.

14. A method as claimed in any of claims 1 to 5, in which the patient's sample of nucleic acid is tested for a polymorphism in intron 6 of the gene at 36 bp from the start of the intron.

15. A method as claimed in claim 14 in which the test is carried out by amplification of a segment of intron 6 having the sequence:

GGCAAG CTCTCCTCAT CAAACCAGAC ATCTTCTTTA AGATTTCTTG GCTATACAAA AAGTATGAGA AGTCTGTGTA

AGTAATACAA CTTTGGAAGA TTTATGAGTA CAWTTGGATT

GGTTTTTTTC CCTTGTGTCT TTGCTGTTTT TCTTGGCCTC TCAGGTAACT TTTCTGCTCT CTAGACCCCA CAAGGGAGCT GTTGATTAAG TTGCTGATGA AACACTTTTT ACAGCAATTT GGCTGCATTT GGCCAGACCA GAGAGTAAAT GAAGCCTTTG GCTGGGCAGC TTCTCGGCAA GGGGGCTGAG TGTGTGGTCT GGGAGCTT (SEQ ID NO: 10)

16. A method as claimed in any of claims 3 to 5, in which the primers used are:

Sense primer: 5' GGC AAG CTC TCC TCA TCA AA (SEQ ID NO: 8)

Antisense primer: 5' AAG CTC CCA GAC CAC ACA CT (SEQ ID NO: 9)

17. A method as claimed in any of claims 4 or 5 or 14 to 16, which comprises testing the resulting amplicon by digestion with the enzyme Mfel and noting the number or the size of fragments formed in the digest.

18. A primer having one of the sequences specified in claim 16.

19. A primer pair having the sequences specified in claim 16.

20. A reagent kit for use with the method of any of claims 14 to 17, comprising a primer pair according to claim 19 and the restriction enzyme Mfel.

21. A method of detecting a polymorphism in the human aromatase cytochrome P-450 gene (CYP 19) comprising amplifying a segment of the CYP 19 gene and testing for the polymorphism, wherein the polymorphism is such that the resulting amplicon may or may not have a restriction site, and whereby the presence or absence of said restriction site enables determination of which polymorphic form is present.

22. A method as claimed in claim 21, wherein the test comprises digesting the amplicon and noting the size of the fragments formed in the digest.

23. A method as claimed in claims 21 or 22, wherein amplification is carried out in such a way that a restriction site is introduced into the amplicon when one polymorphic form is present, but not when an alternative polymorphic form is present.

24. A method as claimed in any of claims 21 to 23, wherein the polymorphism detected is at position 95 of exon 3 of the gene.

25. A method as claimed in any of claims 21 to 24, comprising digesting the resulting amplicon with the enzyme Rsal.

26. A method as claimed in claim 1 or 2 which comprises: providing a polynucleotide capable of hybridising to a segment of a patient's nucleic acid having a polymorphism in the human aromatase cytochrome P-450 gene (CYP 19); hybridising said polynucleotide to a segment of the patient's nucleic acid; and determining which polymorphic form is present in said segment by analysing said hybridisation.

27. A method as claimed in claim 26, wherein a patient's sample of nucleic acid is tested for a polymorphism at position 95 of exon 3 of the gene

28. A method as claimed in claim 26 or 27, wherein the polynucleotide is immobilised on a support.

29. A method as claimed in any of claims 26 to 28, wherein the polynucleotide is provided in an ordered array and wherein the ordered array is addressable.